text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
the present invention relates to an economical and durable weld - compatible coating for electrodes which acts to give the electrode water resistant characteristics and protect the flux or other coatings from abrasion damage or other physical contaminants . as can be seen in reference to fig1 the invention comprises a metallic core 10 , an electrode covering 12 , and a weld - compatible water resistant coating 14 . the metallic core 10 may comprise any metal , alloy or metallic composition known in the art to be useful in welding . examples of such metals and compositions include , but are not limited to , mild steel , cast iron , stainless steel , bronze welding alloys , aluminum , and nickel . the metallic core is preferably sized according to common welding standards , for example welding rods are commonly 14 inches in length and available in diameters ranging from 1 / 16 - 1 / 4 inches . however , the metallic core may be sized in any manner consistent with any one of the numerous welding techniques . the metallic core 10 is substantially surrounded by a coating 12 as can be seen in reference to fig1 . as indicated above the specific characteristics of both the metallic core 10 and the electrode coating 12 will be identified by the aws numbers which are typically stamped on the electrode . selection of the appropriate electrode for a given weld is known to anyone skilled in the art of welding . the compositions of these coatings or fluxes , as well as the methods of applying the same to an electrode , are well known in the art . coated electrodes are commercially available from a significant number of sources including the following companies : uniweld alloys of ft . lauderdale , fla . ; lincoln of cleveland , ohio , and eutectic castolin of flushing , n . y . the weld - compatible water resistant coating 14 , surrounds those portions of the metallic core 10 and electrode coating 12 which are intended to be utilized in the welding process . preferably the water resistant coating 14 completely surrounds the electrode coating 12 as shown in fig1 . it is likewise preferred that a plurality of water resistant coatings are layered onto the electrode . multiple coatings will act to insure that the hygroscopic materials within the electrode coating 12 are fully protected from atmospheric moisture , other contaminants and physical abrasion . still referring to fig1 adjacent either the bare electrode or the electrode covering 12 is a weld - compatible water resistant coating 14 . this water resistant coating 14 substantially comprises a binder and metallic flakes . the water - resistant coating may comprise between 35 - 55 % metallic flake . the metallic flakes may be composed of any of the numerous metals and alloys utilized in welding . as certain electrodes are preferably selected for certain welds , the composition of metallic flakes within the water resistant coating 14 will vary with the intended use of the electrode . as indicated above , it is well known in the art which type of electrode is compatible for any given weld . it is likewise preferred to utilize a water resistant coating 14 having metallic flakes similarly compatible with the intended weld . for example , in order to create a weld upon an aluminum surface it is preferred that the metallic core and the metallic flakes both comprise aluminum . utilization of either a copper electrode or an aluminum electrode with copper flakes in an aluminum weld will weaken the integrity of the weld . however , in producing a weld upon a stainless steel surface it is possible to utilize either a copper or stainless steel electrode and , thus , it is likewise possible to utilize a water resistant coating 14 having copper or stainless steel metal flakes . similarly , nickel flakes may be utilized in the water - resistent coating or an electrode in connection with a cast iron weld . thus , the metallic flakes utilized within the water resistant coating should be compatible with the welding process for which the coated electrode is intended . as indicated above , which type of metal may be utilized for any given weld is well known in the art . with regard to the size of the metal flakes , they preferably fall within the range of 10 to 40 microns . an example of appropriate metal flakes are the polished 8620 gold bronze flake manufactured by united states bronze powders inc . although these metal flakes will vary in size it is preferred that they are a relatively homogenous in size and shape . however , it is possible to utilize metallic flakes of varying average size within the water resistant coating 14 as discussed herein below . the flakes have substantially flat and uniform shape . the binder may comprise a phenolic resin or any other weld - compatible binder . thermoset phenolics are a preferred binder , an example of such phenolic is metcoseal apt sold by metco perkin elmer of westbury , n . y . 11590 - 0201 . an important aspect of suitable binders is that , during the welding process , as applied they do not produce excessive fumes , reducing agents or other compounds which are known to interfere with the welding process . the binder should also be capable of forming a durable layer which acts to hold the metal flakes in position around the coated electrode . it is also preferred that the binder is a thermoset resin cured at temperatures above 212 ° f . since this will cause any preexisting water to be driven off during the formation of the water - resistant coating . a water resistant coating is selected which is compatible with the intended application and weld . the precursor is prepared by mixing the resin and the appropriate vehicle or solvent . the particular composition of the solvent will vary depending upon the particular binder selected , when using phenolic resins examples of suitable solvents often may include toluene , xylene , ethanol , isopropanol , n - butanol , n - butyl acetate , methyl n - amyl ketone and admixtures thereof . the metallic flakes are mixed within the resin solution in order to form a substantially homogeneous suspension . in order to apply the water resistant coating to an electrode it is first necessary to select the desired electrode , that is the one having the properties best suited for the intended weld . once the appropriate electrode is selected it is placed within a drying oven to eliminate substantially all traces of moisture . for example , baking the electrode in an oven at 375 ° f . for over 30 minutes is typically adequate to eliminate substantially all traces of moisture . however , aluminum rods generally require a longer pre - bake , from over 30 minutes to an hour , in order to adequately remove existing moisture . the electrodes remain in the oven and are allowed to cool to approximately 110 ° f . and are not removed from the oven until just prior to application of the water resistant coating . after the initial baking , the rods are removed from the oven and the first layer of precursor to the water resistant coating is applied to the electrode . the precursor to the water resistant coating may be applied to the electrode by means of an applicator as shown in fig2 . the electrode is held by a rotatable shaft 20 and is dipped into a bath 22 comprised of the precursor . while the electrode is rotated it is removed from the bath and pulled between two felt pads 24 with the tension adjusted , such as by tension adjust screws 26 , to remove excess precursor . preferably the rod receives three such passes and is allowed to air dry for 5 minutes in between each pass . the water resistant coating may also be applied by hand by simply pouring the coating material onto a cloth and applying the coating to the electrode by hand . whether the coating is applied via the apparatus in fig2 by hand or another method commonly used to apply suspensions to a product , the coating is applied evenly over the electrode or electrode covering so as not to leave untreated areas , uneven portions or excess precursor that may cause dripping or running of the precursor . the rods are then placed in an oven and baked at approximately 375 ° f . for 10 to 15 minutes . baking the rods at this temperature for over 15 minutes may weaken the binder . it will be well known in the art that the baking times and temperatures may be varied as necessary to adequately set the particular phenolic resin or binder selected . the electrodes are then allowed to cool to approximately 110 ° f . whereupon additional layers of the water resistant coating may be applied as desired . the number of coatings utilized will obviously determine the thickness of the water resistant coating 14 . preferably layers are applied until no electrode coating or flux remains exposed . generally , this will require two or more layers although three layers is preferred . however , if great care is taken to thoroughly apply the water resistant coating one layer may sufficiently coat the electrode . the more coatings , the greater the water resistance of the electrode . thus , the number of layers applied should reflect the desired durability and shelf life of the electrode . it has been found that using six or more coatings will not be detrimental to the weld . however , when over six layers are utilized on the electrode , the coating may start to produce a noticeable odor during the welding process . the multiple layers of / water resistant coatings may either comprise the same coating material or a different coating material . for example , the first layer may comprise a coating utilizing larger metallic flakes and the second layer a coating utilizing smaller sized metallic flakes . however , in the preferred embodiment each coating utilizes metallic flakes having an average size of approximately 15 microns . a stainless steel 312 coated electrode is pre - baked in an oven at 375 ° f . for 30 minutes . the electrode is allowed to cool to a temperature of 110 ° f . the water resistant coating precursor is made by mixing 2 . 0 grams of the metcoseal apt thermoset phenolic and 3 . 2 g of vehicle ( 40 % xylene / 40 % methyl isobutyl ketone / 10 % methyl amyl alcohol / 10 % 2 - ethoxy ethyl acetate ) to which 2 . 1 grams of copper metal flakes ( usb cu 8000 ) are added and then mixed thoroughly . portions of the precursor are then poured onto a cloth and applied evenly to the electrode . the electrode is then allowed to air dry for 5 minutes and placed in an oven at 375 ° f . for 15 minutes . the electrode was allowed to cool to its previous temperature of 110 ° f . a second layer of the water resistant coating may be applied by the methods stated hereinabove . however , in this example the second layer utilized a water resistant coating precursor comprising 1 . 9 grams of copper metal flakes having an average size of 15 microns ( usb 8620 ), 2 . 0 grams of the phenolic and 2 . 9 grams of additional solvent . a water welding rod having superior water - resistent characteristics was thereby produced . an aluminum coated electrode is placed in a drying oven for 1 hour at 375 ° f . and allowed to cool to 110 ° f . the electrode is removed from the oven and precursor ( substantially homogenous layer of 2 . 1 g of usb aluminum 807 flakes , 3 . 2 g metcoseal ap and 2 . 0 g metcoseal apt ) is applied evenly over the electrode by hand with the aid of a clean dry cloth . the electrode is allowed to dry for 5 minutes and baked at 375 ° for 15 minutes . the electrode is then allowed to cool in the drying oven to just over 110 ° f . the electrode is removed and a second coating of precursor applied to the electrode by hand and then allowed to dry for 5 minutes and baked at 375 ° f . for 15 minutes . after cooling to 110 ° f . the electrode is again removed and a third coat of precursor applied by hand . the electrode is allowed to dry for 5 minutes and baked at 375 ° f . for 10 minutes . the electrode is allowed to cool to 110 ° f . in the drying oven and removed . a water - resistant aluminum electrode b was thereby produced . one quart of a thermoset phenolic resin ( metcoseal apt ) is mixed with one and a half ( 1 1 / 2 ) quarts solvent ( metcoseal ap ) in a cylindrical container . one quart of nickel metallic flake ( asb nicu 8620 flake ) is then added to and thoroughly mixed with the resin solution . a cast iron ni - 55 electrode is placed in a drying oven for 30 minutes at 375 ° f . and then allowed to cool in the oven to 110 ° f . the electrode is then removed from the drying oven and the end free of flex is securely changed in to a rod holder . the rod holder is in turn attached to a rotable shaft . while the shaft is rotating the electrode it is substantially immersed into the precursor and removed . excess precursor is removed from the electrode by spring loaded felt tip pads through which the electrode passes . the tension of the pads against the electrode is adjusted , by the tension adjust screws in connection with the springs , so that an even coating of precursor remains on the electrode substantially free of drips or runs . the electrode is allowed to dry for 5 minutes and then baked at 375 ° f . for 15 minutes . upon cooling to 110 ° f . the electrode and its last layer of water - resistant coating is again treated with the precursor as indicated above , allowed to dry for 5 minutes and baked at 375 ° c . for 15 minutes . after cooling to 110 ° f . the electrode and its 2 layers of water - resistant coatings is again treated with the precursor , as above , allowed to dry for 5 minutes , and baked at 375 ° f . for 15 minutes . after cooling to 110 ° f . the water resistant electrode is removed from the drying oven where it may be stored in ambient atmosphere without requiring special drying stops prior to use . while the invention has been particularly shown and described with reference to preferred embodiments thereof , it would be well be understood by those skilled in the art that other changes in form and details may be made therein without departing from the spirit and scope of the invention . | 1 |
specific permold coatings according to the present invention , conditions employed in their use and the nature of the product formed from them are shown in the following examples . a ten pound batch of materials was made , having weight percentages as follows : ______________________________________50 . 2 % resins in a 3 : 1 ratio of aropol 7501 ( ashland chemical ) and e - 720 ( owens corning ), respectively . 17 . 0 % diallyl phthalate prepolymer1 . 28 % tertiary butyl perbenzoate catalyst . 02 % cure promoter2 . 0 % calcium carbonate filler2 . 0 % zinc oxide filler0 . 9 % styrene allyl alcohol resin extender . 3 % fluorocarbon release agent fc 430 ( minn . mining & amp ; mfg . ) 1 . 5 % release agent23 . 0 % graphite flakes asbury # 146 ( asbury graphite mills ) ( maximum size 80 microns ) ______________________________________ the materials were placed in a welex model 20m mixer taking care that promoter and initiator did not come into gross contact with each other . the components were mixed at 1000 rpm for two minutes . materials were swept down from the sides of the container and mixing was performed for an additional minute at 2000 rpm . alternatively the graphite flakes can be left out during the first mixing phase and only subjected to one period of agitation . this procedure tends to preserve the plate - like structure of graphite flakes needed for electrical conductivity in the outer layer or coating of the final , premold coated article . the mixed material was extruded using a baker - perkins mp - 216 co - rotating twin screw extruder . during operation of the barrel and screw of the extruder were maintained at 150 ° f . and the die at 50 ° c . higher temperatures should be avoided as resin may polymerize and set up within the extruder otherwise . the screws turned at 350 rpm . the orifice remained open and the extruder was starve fed . these conditions minimize sheer on the graphite flakes and insure good electrical conductivity in the plastic item finally fabricated . alternatively , two extrusion phases may be employed wherein graphite flakes , initiator ( s ) and release agent ( s ) are excluded from the first phase . also , extrusion may be achieved using a buss pr - 47 kneader extruder operated at 290 rpm with barrel and screw temperatures of 45 °- 50 ° c . and 35 ° c ., respectively . the material leaving the extruder was a molten liquid . the molten liquid was passed through a set of chill rolls . the chill rolls pressed the mix into a sheet which was then broken into large flakes . the broken flakes were fed into a liquid nitrogen cooled hammer mill and ground to provide a coarse powder capable of passing through a 100 mesh screen . the 100 mesh product was put into the feed hopper of a gema molel 708 ( st . gallen , switzerland ) electrostatic spray handgun . the powder was sprayed against one of two matched male or female molds employing a gun voltage of 30 - 100 kv . the temperature of the mold surface was 280 °- 320 ° f . spray was directed against the one square foot flat plaque mold for 12 seconds . powder was applied to achieve a final thickness of 3 - 5 mils . after 37 seconds dwell time a 525 gram charge pattern of sheet molding compound was carefully laid into the mold . the mold was closed , closure being achieved after 11 seconds . the mold remained closed to 11 / 2 minutes with the sprayed mold surface at 280 °- 320 ° f . and the unsprayed mold surface at 275 °- 285 ° f . then the mold was opened and the molded part was removed . the premold coating or outer surface was free from blemishes and tears , was black in appearance and conformed to the contours and texture of the mold . ten such parts were made and tested for electrical conductivity . electrical conductivity of the premold coated surface containing graphite flakes was measured using a model 8333 - 00 ransburg sprayability meter ( indianapolis , inc .). when meter probes were touched firmly to various portions of the coated surface , conductivity readings of 125 - 160 were recorded . experience shows that a meter reading of 125 indicates sufficient surface conductivity to allow successful spray painting by electrostatic application methods known in the art . example 1 was repeated using 20 . 0 % graphite flakes and 3 . 0 % thorel vmd graphite fibers approximately 300 microns in length , all other chemical components and procedural conditions remaining constant . electrical conductivity of various portions of the coated surface containing graphite flakes and fibers was measured to be 125 - 165 + using a ransberg sprayability meter . field trails of this premold coating incorporated onto intricately shaped production parts yielded items with surface conductivities of 165 +. various percentage amounts of graphite flake , fiber and inorganic fillers were used to produce additional premold coatings according to this invention . table 1 shows the percentage and type of graphite and filler employed . in each instance the balance of the coating mixture was composed of resins , prepolymer , catalyst , filler , cure agent , resin extender and release agent maintained in proportion to each other as in example 1 . table 1______________________________________ ransburg % graphite % graphite meterexample # flake fiber % filler reading______________________________________3 0 25 . 0 0 75 - 804 15 . 0 0 0 70 - 1505 15 . 0 3 . 0 10 . 0 % 125 + baso . sub . 46 10 . 0 5 . 0 10 . 0 % 125 - 145 baso . sub . 47 15 . 0 0 6 . 6 % 75 - 150 tio . sub . 2 16 . 8 % caco . sub . 3 18 . 1 % baso . sub . 4 0 . 1 % c8 12 . 5 0 same as 75 - 140 ex . 79 10 . 0 0 same as 70 - 130 ex . 710 7 . 5 0 same as 70 - 125 ex . 711 5 . 0 0 same as 71 ex . 7______________________________________ experience indicates that graphite contents as high as 30 % might be blendable , processable and may produce useful premold coatings . fig1 is an illustration of a vehicle 10 embodying a plastic part 12 made in accordance with this invention . fig2 is a sectional view of the plastic part 12 comprising a bonded surface coating 16 and underlying part matrix 14 , said surface coating 16 containing sufficient graphite to render the part surface electroconductive . | 1 |
the present invention and operational advantages thereof can be fully understood by referring to the accompanying drawings and explanations thereof . now , exemplary embodiments of the present invention will be described with reference to the accompanying drawings to explain the present invention in detail . in the drawings , the same reference numerals indicate the same elements . now , an optical transmission line monitoring system using a gain clamped optical amplifier according to the present invention will be described with reference to the drawings . fig2 is a graph showing optical spectra of outputs of a gain clamped optical amplifier in the on and off states of an input signal ; as shown in fig2 , a power of an amplified spontaneous emission ( ase ) does not change regardless of the on and off states of a signal within a predetermined signal wavelength band . fig3 a , 3b , and 4 are views showing examples of a gain clamped optical amplifier . fig3 a and 3b are view showing structures of gain clamped semiconductor optical amplifiers using bragg gratings . fig3 a shows a gain clamped semiconductor optical amplifier having bragg gratings at both ends of a semiconductor chip ( an active section ), which is called a “ distributed bragg reflector ( dbr ) type .” fig3 b shows a gain clamped optical amplifier having a bragg grating under a waveguide an active region , which is called a “ distributed feedback ( dfb ) type .” more specifically , the soa comprises the structure of a laser cavity in the optical waveguide , which a gain medium . the structure of the laser cavity is formed with bragg gratings reflecting light in a predetermined narrow wavelength band . the laser oscillating in the laser cavity is used to saturate gain of the soa . if the power of the input of the soa is low , the power of the laser increases so that the gain of the soa is saturated . if the power of the input of the soa is high , the power of the laser decreases . but , since the power of the input is high , the gain the soa is saturated . therefore , the gain of the gain clamped soa can be saturated regardless of the power of the input of the soa , so that a constant signal gain can be obtained . in addition , since the soa is always in a gain saturated state , the power of the ase can be kept constant . fig4 is a view showing a gain clamped optical amplifier in which a laser cavity provided outside a semiconductor optical amplifier ; there are provided two optical add - drop multiplexers ( oadms ). a second oadm connected to the output of the soa has three terminals a , b , and c . having a predetermined wavelength , a portion of light input to the terminal a is output from the terminal c . the power of the light having the predetermined wavelength output from the terminal c is adjusted by a variable optical attenuator ( voa ) and input to the soa through a first oadm . in one cycle , the light output from the terminal c of the second oadm is amplified the soa , and then , input to the terminal a of the second oadm . this cycle is repeated to generate resonance . the laser having this cavity structure is called a ring laser . fig5 is a gain characteristic curve of a gain clamped optical amplifier . as shown in fig5 , it can be seen that , since the soa is kept in a constant gain saturated state , the gain is constant regardless of the power of the input signal . fig6 is a view showing an optical transmission line monitoring system according to an example of the present invention . the optical transmission line monitoring system comprises an otdr ( optical time - domain reflectometer ) 600 , optical transmission lines 610 and 640 , an optical filter 620 , and a gain clamped optical amplifier 630 . a monitoring light input to the optical transmission line 610 is reflected or back - scattered . the otdr 600 measures the reflected or back - scattered light to determine loss of transmission of the optical transmission line 610 , connection points , disconnection points , and so on . the monitoring light of the otdr 600 is a periodical pulsed light . since there are limitations on the output power of the monitoring light and the dynamic range of a photo diode in the receiver of the otdr 600 , only a single otdr 600 can not monitor over 150 km of the optical transmission line . in order to extend the monitoring distance of the otdr 600 , the gain clamped optical amplifier 630 amplifies the monitoring light ( the pulsed light ) of the otdr 600 . since the gain clamped optical amplifier 630 has a constant gain regardless of the power of the input signal thereof , the power of the ase is constantly regardless of the power of the monitoring light . now , the gain clamped optical amplifier will be described in detail with reference to fig2 to 5 . the optical filter 620 used between the otdr 600 and the gain clamped semiconductor optical amplifier 630 has a function of removing components outside a wavelength band of the monitoring light from the backward ase generated by the gain clamped optical amplifier 630 . the power of the ase can be kept constant by the gain clamped optical amplifier 630 regardless of the on and off state of the monitoring light ( a pulsed light ). the components outside the wavelength band of the monitoring light can be removed from the backward ase by the optical filter 620 . as a result , it is possible to prevent deterioration of the performance of the otdr because of the ase . fig7 is a graph showing a monitoring result of the optical transmission line monitoring system of fig6 . as the monitoring light proceeds along the optical transmission line , the power of the monitoring light is gradually reduced . next , the monitoring light is amplified by the optical amplifier at about 100 km . therefore , it is possible to extend the monitoring distance of the otdr . as seen in fig7 , it can be understood that the monitoring distance of the otdr extends over 200 km . fig8 is a view showing an optical transmission line monitoring system according to another example of the present invention . the optical transmission line monitoring system comprises an otdr 800 , optical transmission lines 810 and 850 , a circulator 820 , an optical fiber grating 830 , and a gain clamped optical amplifier 840 . the constructions and functions of the otdr 800 , the gain clamped optical amplifier 840 , and the optical transmission lines 810 and 850 are the same as those of fig6 . therefore , the detailed description is omitted . light transmitted on the optical transmission line 810 is input to the gain clamped optical amplifier 840 though the circulator 820 . a light backwardly output from the gain clamped optical amplifier 840 is input to the optical fiber grating 830 though the circulator 820 . a light reflected on the optical fiber grating 830 is input to the optical transmission line 810 through the circulator 820 . the optical fiber grating 830 reflects only the components within the wavelength band of the backward monitoring light which is amplified by the gain clamped optical amplifier 840 . in other words , the circulator 820 and the optical fiber grating 830 of fig8 collectively correspond to the optical filter of fig6 . fig9 is a view showing an optical transmission line monitoring system using an optical amplifier for data signal on an optical transmission line according to an example of the present invention ; the optical transmission line monitoring system comprises an otdr 900 , optical transmission lines 910 and 960 , a first coupler 920 , a gain clamped optical amplifier 940 , a second coupler 950 , and an optical amplifier 930 . the gain clamped optical amplifier 940 amplifies the monitoring light . the optical amplifier 930 amplifies the data signal . the otdr 900 and the gain clamped optical amplifier 940 are the same as those of fig6 . therefore , detailed description is omitted . the first coupler 920 used in front of the optical amplifier 930 demultiflexs both data signal and monitoring light output from the otdr 900 . the first coupler 920 transmits the data signal and the monitoring light to the optical amplifier 930 and the gain clamped optical amplifier 940 , respectively . the optical amplifier 930 and the gain clamped optical amplifier 940 amplify the data signal and the monitoring light , respectively . the second coupler 950 multiflexs the data signal from the optical amplifier 930 and the monitoring light from the gain clamped optical amplifier 940 and outputs the combined light to the optical transmission line 960 . the backscattered monitoring light or the reflected monitoring light is backwardly input to the gain clamped optical amplifier 940 through the second coupler 950 . fig1 is a view showing an example of a gain clamped optical amplifier using a gain - saturated signal . the gain clamped optical amplifier comprises a light source 1020 generating the gain - saturated signal , an optical amplifier 1030 , and a coupler 1010 inputting the gain - saturated signal to the optical amplifier 1030 . the gain - saturated signal generated by the light source 1020 is input to the optical amplifier 1030 through the coupler 1010 . here , the gain - saturated signal has enough high power to uniformly saturate the gain of the optical amplifier 1030 regardless of the monitoring light . therefore , it is possible to obtain a constant signal gain at any time . fig1 is a view showing another example of a gain clamped optical amplifier using an optical grating . the gain clamped optical amplifier comprises an optical fiber grating 1110 and an optical amplifier 1120 . the optical fiber grating 1110 has a function of reflecting a portion of ase generated by the optical amplifier 1120 to the optical amplifier 1120 . the reflected portion of ase is contributed to saturate the gain of the optical amplifier 1120 , so that the signal gain can be constant . the reflection wavelength band of the optical fiber grating 1110 is empirically determined . wider reflection wavelength band is preferable because sufficient reflected light has to be input to the optical amplifier 1120 in order to saturate the gain of the optical amplifier 1120 . since the light source and the coupler of fig1 can be replaced with a single optical grating , it is possible to implement a low - price gain clamped optical amplifier . according to the present invention , in case of extending an optical transmission line monitoring distance of an optical time - domain reflectometer ( otdr ) by using an optical amplifier , it is possible to prevent deterioration of performance of the otdr because of backward amplified spontaneous emission ( ase ) generated from the optical amplifier . in addition , since a data signal and a monitoring light have different wavelengths , it is possible to monitor the optical transmission line in real time in addition , the present invention can be adapted to an optical transmission line on which a optical amplifier . in addition , a long optical transmission line can be monitored by a gain clamped optical amplifier . therefore , it is possible to reduce time and cost in monitoring the optical transmission line . while the present invention has been particularly shown and described with reference to exemplary embodiments thereof , it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the present invention as defined by the following claims . | 7 |
although this invention is applicable to numerous and various types of roadways and surfaces , it has been found particularly useful in the environment of runways for aircraft . therefore , without limiting the applicability of the invention to runways for aircraft , the invention will be described in such environment . those skilled in the art will appreciate that the rar of the present invention can be used on roadways for automobiles and trucks and for other wheeled vehicles . the rar of the present invention can also be adapted for use with trains where the panels described below are proximate the rails upon which the trains travel . a schematic of the side view of a preferred rar illustrating its basic principles of operation is shown in fig1 . in this illustration , the rar 100 segment is shown positioned at the end of a typical ( fixed ) runway 101 . at the end of the fixed runway 101 , one or more transition runway panels 102 are to be installed in a transition segment 103 of the rar 100 . the function of the transition segment 103 of the rar 100 is to provide for a smooth transition for a vehicle during its motion from the fixed segment of the runway 101 to the rar segment 100 . in general , more than one transition runway panel 102 is preferred in order to make the vehicle motion smooth as it enters the rar segment 100 of the runway , i . e ., in order to prevent the tires from suddenly striking the rar segment 101 which would otherwise form a step like configuration immediately following the fixed runway segment 100 . the transition runway panels 102 are constructed with a surface panel 102 which make an angle α ( 104 in fig1 ) with the surface of the fixed runway 101 , rising to the height h ( 105 in fig1 ). under the transition runway panel ( s ) 102 are elastic elements , motion constraining mechanisms , braking mechanisms , and all other components , collectively shown in fig1 as element 106 , which hereinafter is referred to as the runway panel “ support and control assembly .” the details of the support and control assembly 106 is provided in fig2 . the support and control assembly 106 is mounted on a runway foundation 107 . following the transition runway panels 102 , the regular runway panels 108 are positioned . the runway panels 108 are held in place above the foundation 107 by support and control elements 109 , which are very similar in function and construction to the support and control elements 106 . in fig1 and to simplify the illustration , the mechanisms used to attach the transition panels 102 to the fixed runway 101 and to the other transition 102 and regular runway panels 108 are not shown . these details are provided in the ensuing illustrations . in addition , it is understood that the outermost side of the runway panels 108 are preferably not exposed . in practice , the sides of the runway panels 108 are preferably protected from the elements without the addition of any motion restraining elements such as with simple bellows . in addition , it is understood that in fig1 only one runway panel 108 is shown along the width of each segment of the rar 100 . however , it is understood that more than one runway panel 108 may be positioned side by side along the width of each runway panel segment 108 . the structure of the simplest type of support and control elements 106 and 109 is shown in the schematics of fig2 and 3 . such a support and control element consists of one or more spring elements 110 and one or more braking elements 111 connecting the runway panels 102 and 108 to the runway foundation 107 . as the vehicle tire 112 leaves the fixed portion of the runway 101 , it first rolls over the panels 102 within the transition segment 103 of the rar 100 , and then rolls over the regular rar panels 108 as shown in fig3 . the relatively small angle α ( 104 ) ensures that the transition between the transition panel 102 and regular panel 108 segments of the rar 100 is relatively smooth . depending on the weight w ( 114 ) being born on the tire 112 and the total spring rate provided by the spring elements 110 , the panel 102 ( 108 ) is displaced downward a distance d ( 113 ) as shown in fig3 . the spring rate is preferably selected , i . e ., set by a spring rate adjustment mechanism ( not shown ) such that the amount of downward displacement d ( 113 ) is fairly close to the height h ( 105 ) of the regular panels 108 . the amount of potential energy pe stored in the spring elements 10 is readily shown to be where k is the effective spring rate of the spring elements 110 , assuming that the spring elements 110 are not pre - loaded . if the spring elements 110 are pre - loaded a distance d 0 , then the potential energy stored in the spring elements 110 is readily shown to be pe = ½ k ( d + d 0 ) 2 − ½ kd 0 2 ( 2 ) in general , the spring elements 110 are desired to be pre - loaded in order to reduce the amount of displacement d for a desired level of potential energy pe . the source of potential energy pe that is stored in the spring elements 110 is the kinetic energy of the vehicle . therefore , the kinetic energy of the vehicle is reduced by the amount of potential energy pe that is stored in the rar panel 102 ( 108 ). obviously , the panel 102 ( 108 ) and thereby the spring elements 110 have to be locked in their displaced position shown in fig3 . otherwise , as the tire 112 passes over the panel 102 ( 108 ), the panel 102 ( 108 ) could transfer most of the stored potential energy back to the tire , thereby causing the rar system to have a minimal effect in absorbing the kinetic energy of the vehicle , i . e ., from slowing the vehicle down . here , the locking action is intended to be provided by the brake 111 , which is actuated by the braking force 115 . the preferred length of each of the rar panels 102 ( 108 ) relative to the size of the tire 112 and the preferred methods of connecting the panels 102 ( 108 ) together and to the runway foundation 107 will be described later . the components shown in the support and control elements 106 and 109 are the minimum type of elements that allow for the proper operation of the rar 100 . additional elements , such as those previously mentioned may , however , be added to provide for features that may be desirable depending on the operational requirements of each runway , the level of automation that is desired to be incorporated into the overall design , for allowing for the adjustment of one or more of the parameters of the system , its effective height h ( 105 ), the configuration of the system , etc . in the remainder of this description , various preferred design configurations and the types and ranges of parameters are provided as a function of various desired operating conditions . the operation of such reusable and adaptive runways ( rar ) 100 is equivalent to the vehicle traveling along an inclined surface , thereby transforming its kinetic energy into potential energy proportional to the vertical height that its center of mass attains . in the present invention , the kinetic energy of the vehicle is transformed into potential energy stored in the deforming elastic elements , i . e ., the springs 110 . in certain situations , it may be desired to provide friction ( braking action ) and / or viscous damping elements that are positioned in parallel or in certain cases in series with the elastic elements , thereby dissipating a certain portion of the kinetic energy of the vehicle . yet in other certain situations , it may be desired to use kinetic energy storage elements such as flywheels in series or in parallel with the elastic elements or even in place of the elastic elements . in a similar design , opposing magnet or magnets and coils ( i . e ., linear or rotary motors ) may be used in parallel or in series with one or more of the aforementioned elements . yet in certain other situations , electrical energy generators may be positioned in series or parallel with the elastic elements or in place of the elastic elements , or in series or parallel with the kinetic energy storage elements or in place of the kinetic energy storage elements . the electric energy generators or electric actuation devices ( or in fact any other means of actuation ) may be used as means to absorb part or the entire kinetic energy that is transferred to the rar panels , or they may be used in part or entirely as means of controlling the rate of such energy transfers . the latter means of control is usually aimed at achieving a smooth motion for the vehicle . in general , the spring rates , viscous damping rates , and the characteristics of any one of the aforementioned elements may be constant or adjustable . such means of adjustment of the characteristics and parameters of the aforementioned elements may be used to adjust the characteristics of the rar 100 to their near optimal conditions for each approaching vehicle , its speed , and operating condition . the aforementioned elements may also have linear or nonlinear characteristics . the advantages and disadvantages of a number of aforementioned combinations and the general characteristics that they can provide the rar system is described later in this disclosure . in short , a number of combinations and configurations of one or more elastic elements , one or more kinetic energy storage elements , one or more viscous damping elements , one or more braking elements , one or more electrical or hydraulic or pneumatic motors or their combination , and one or more electrical energy generators may be positioned in series or in parallel to provide the desired effect of “ absorbing ” the kinetic energy of the vehicle . the rar panels 102 and 108 are preferably constructed with relatively rigid but lightweight materials as relatively rigid but lightweight structures . the surface of the panels are preferably coated with appropriately formulated material to enhance endurance , increase friction and decrease wear . the rar surface panels 102 ( 108 ) may be constructed with panel or panel like elements that are relatively free to move relative to each other , particularly in the vertical direction and in rotation about a transversely directed axis ( perpendicular to the vertical and longitudinal axes of the runway or roadway ). in such a configuration , the horizontal motion of the panels 108 relative to each other and relative to the runway foundation 107 is preferably controlled by relatively stiff elastic elements 125 ( fig4 ), preferably with a considerable amount of ( preferably viscous like ) damping ( such as with synthetic rubber type of materials ) in order to control the panels from slipping in the longitudinal direction under the rotating tire . mechanical stops may also be provided to assist in the control of the horizontal motion of the rar panels 108 . such a rar panel configuration is suitable when the size of the panels 108 , particularly their length ( measured along the length of the runway ) is relatively small compared to the size of the vehicle tire such that at any point in time , the tire is in contact with more than one panel 108 , preferably with at least three panels 108 . the latter condition is necessary in order to assure a smooth motion for the vehicle as the tire moves from one panel 108 to the other , causing the panels 108 to generally conform to the shape of the tire as shown in fig4 , rather than causing the tire to move up a step like path . in another embodiment of this invention , the surface panels 102 ( 108 ) are hinged together as shown in fig5 along the length of the runway to allow for their relative rotation about their transverse axes in order to accommodate to the shape of the traveling tire 112 . the panels 108 ( or 102 ) are connected with hinges 120 to allow their relative rotation . such a rotation is required for the smooth operation of the rar so that as the tire moves over the first panel 108 ( fig5 ) and depresses a certain amount , the next panel 108 is rotated counterclockwise the required amount to allow such vertical displacement of the first panel 108 without resulting in a step to be formed between the two panels 108 . the hinge 120 or at its connections to the panels 108 or the panels 108 themselves may be constructed with certain amount of flexibility to allow the change in the horizontal projection of the longitudinal length of the panels due to the relative rotation of the panels 108 to be compensated . in yet another embodiment of the present invention , the panels are attached to the underlying structure ( foundation 107 ) of the runway by means of mechanical elements , i . e ., linkage or other types of mechanisms , such that their motion relative to the foundation is constrained in certain manner to allow for the smooth travel of the tire over the panels . an example of one of numerous possible types of such motion constraint mechanisms is shown in fig6 . this mechanism is constructed with linkage type of mechanisms . in fig6 , the side view of only one runway panel 108 ( 102 ) is shown . in this design , one side of the panel 108 ( 102 ) is attached with two links 136 and 137 which are hinged together at the hinge 134 . the link 136 is attached to the runway panel 108 ( 102 ) by the hinge 130 . the link 137 is attached to the runway foundation 107 by the hinge 132 . the opposite end of the panel 108 ( 102 ) is attached to the foundation 107 by links 138 and 139 which are hinged together with hinge 135 . in turn , the link 138 is attached to the panel 108 ( 102 ) by hinge 131 and link 139 is attached to the foundation 107 by hinge 133 . the pair of links 136 and 137 and the pair of links 138 and 139 reduce the total degree of freedom of the panel for motion in the vertical plane from three degrees of freedom ( two displacements and one rotation ) to two degrees of freedom , i . e ., the motion of the panel in the vertical plane is constrained by the linkage mechanism shown in fig6 to two degrees of freedom . as a result , other elements of the mechanism 106 ( 109 ) ( not shown in fig6 for clarity ), mostly the spring elements 110 , provide fewer constraining forces to provide for the aforementioned desired motion of the panels as the tire travels over the panel . those skilled in the art will appreciate that the elastic elements are operatively connected with the panels ( or belt ) to convert the kinetic energy of the vehicle to potential energy . thus , the elastic elements can be directly connected to the panels ( or belt ) or connected to the links in way which deforms the elastic element ( s ) upon movement of the links . it should be noted that in general , the panels 108 ( 102 ) are desired to possess two degrees of freedom in motion in the vertical plane . this is the case since as the tire travels over the panels 108 ( except a panel 102 located immediately following the fixed segment of the runway ), the panels 108 are desired to undergo a motion which is essentially a counterclockwise rotation that brings their edge closest to the tire downward , followed by a clockwise rotation that brings the opposite edge of the panel downward until the panel is essentially horizontal . it is readily observed that if the panels 108 are short relative to the size of the tire 112 as shown in fig4 , then during the above counterclockwise and clockwise rotations , the panels 108 would also undergo a vertical displacement such that the panels are essentially tangent to the periphery of the tire 112 at all times . however , panels 108 that are long relative to the size of the tire 112 such that the tire 112 may be located at times entirely over the surface of only one panel 108 , would undergo a more or less pure counterclockwise rotation as the leading edge of the panel 108 closest to the tire 112 is pushed downward to essentially the maximum set depth 105 , and as the tire 112 moves over the panel 108 , the panel 108 would then begin to rotate clockwise about the same leading edge until the panel 108 is essentially horizontal . the configuration of the panels 102 ( 108 ) is shown by way of example only and not to limit the scope or spirit of the present invention . for example , as shown in fig1 , all or a significant portion of the panels can be arranged at an angle α such as the transition panel 102 , or alternatively , all of the panels could be arranged flat ( e . g ., α = 0 ), such as panels 108 . in the alternative configuration of fig1 , the panels 102 are not attached to each other but are instead all hinged to the roadway for pivotal movement therewith . another class of mechanism that may be used to constrain the motion of the aforementioned longer runway panels 108 ( 102 ) relative to the runway foundation 107 to the aforementioned sequential counterclockwise and clockwise rotation about the leading edge 140 closest to the incoming tire 112 , as shown in fig7 . in this class of constraining mechanisms , the motion of the leading edge 140 of the panel 108 is constrained to a vertical motion , while the panel 108 ( 102 ) is free to rotate about the leading edge 140 . in the mechanism shown in fig7 , the motion of the edge 140 is constrained to the vertical direction by the sliding joint 141 , which consists of the sliding element 143 and the guide 144 . the sliding element 143 is hinged to the edge 140 of the panel 108 ( 102 ) by a rotary joint 142 , thereby allowing the panel to rotate counterclockwise as the edge 140 is pushed down to the previous panel and once the tire 112 begins to move over the panel 108 ( 102 ) shown in fig7 , to allow the panel 108 to rotate in the clockwise direction until it is essentially horizontal and depressed a distance h 105 . a plurality of such motion constraint mechanisms may be constructed . in fact , the mechanism shown in fig7 is selected only for the purpose of demonstrating the mode of operation of such motion constraint mechanisms and does not constitute the preferred embodiment unless the sliding joint is constructed as a living joint . this is the case since sliding joints constructed sliding and guiding elements , even together with balls or rollers or other anti - friction constructions , are much more susceptible to sticking , generally generate more friction forces , are harder to keep free of dirt and contaminants , and are generally larger and heavier , thereby are generally desirable to be avoided . the preferred mechanisms are constructed with rotary joints , such as in the form of one of many well - known linkage mechanisms that generate nearly straight - line motions . motion constraining mechanisms may also be preferably used to constrain the motion of the panels 108 ( 102 ) to rotations about axes perpendicular to the longitudinal and vertical directions , i . e ., clockwise and counterclockwise rotations as illustrated in fig4 , 6 , and 7 . in the schematic of fig8 , the edge 150 of a runway panel 108 ( 102 ) along the width of the runway 107 , i . e ., as viewed in a direction parallel to the longitudinal direction of the runway , is illustrated . to limit the motion of the runway panel to the above rotations , the motion constraining mechanism constrains the edge 150 to motions in the vertical direction while keeping the edge 150 parallel to the horizontal plane ( here , for the sake of simplicity and without intending to place any limitation on the design of the runway foundation , the foundation surface is considered to be flat and parallel to the horizontal plane ). the simplest linkage mechanism that would provide the above constraining motion , is a double parallelogram mechanism 160 as shown in fig8 . the mechanism consists of links 153 of equal lengths that are attached to the runway panel 108 ( 102 ) by spherical joints 151 ; links 155 of equal lengths that are connected to the foundation 107 with spherical joints 156 ; and a common link 154 to which the ends of the links 153 and 155 are hinged with rotary joints 152 . one or more double parallelogram mechanisms 160 may be used to constrain the motion of each runway panel 108 ( 102 ). in yet another embodiment of the present invention as shown in fig1 , the panels are replaced with an appropriately sized and relatively flat surfaced chain like or belt like structures 170 that cover a commonly used underlying support structure which is in turn attached to the support and control elements 106 ( 109 ) with or without one or more of the aforementioned motion constraining mechanisms . the use of such chain or belt like surface structures allow for a smoother travel of the tire , similar to the case of shorter panels shown in fig4 . for example , a continuous belt segment would in effect act similar to panels with very small lengths . hereinafter , the above types of runway surface elements are referred to as runway panels without intending to limit them to any one of the above designs . to those skilled in the art , numerous other “ runway panel ” design configurations that allow relatively smooth vertical displacement of the underlying surface as the vehicle tire travels over such “ runway panel ” and thereby affect deformation of appropriately positioned elastic potential energy storage elements similar to the spring elements 110 are possible and are intended to be covered by the present disclosure . the runway panels are elastically supported by spring elements that are positioned between the panels and the runway foundation . the elastic ( spring ) elements may take any form , for example , they may be constructed in a helical or similar form by spring wires of various cross - sections , or they may be formed as torsion or bending springs , torsion bars , or any of their combinations . to optimally control the vertical movement of the runway panels , the spring rates , i . e ., the relationship between the applied vertical force and the resulting vertical displacement of the runway panel may be linear or nonlinear . the spring elements may be positioned directly between the runway panels and the runway foundation or act on the mechanical elements that provide motion constraint to the panels . in general , various spring types and configurations may be used to provide various elastic responses upon the application of load ( mostly vertical ) at certain points on the panel , i . e ., to provide the desired effective spring rates in response to the vertical displacement and rotation about an axis directed in the transverse direction . the potential energy storage elements can also be the structural elements disclosed in u . s . pat . no . 6 , 054 , 197 , the contents of which are incorporated herein by its reference . in general , as shown in fig1 , the weight 115 of the tire 112 deforms the structural element 200 which is disposed between each panel 102 ( 108 ) and the runway base 107 to store a potential energy therein . the structural element may also itself serve as the braking element where displaced fluid 202 from the interior of the structural element ( caused by the deformation ) is captured in a reservoir 204 and restricted from returning to the cavity 202 , such as by closing a valve 206 while the structural element is deformed . the structural element 200 is released or reset ( extended ) by removing the restriction , such as by opening the valve 206 to allow the fluid to flow back into the cavity 202 . preferably , the structural elements 200 are remotely controlled by a processor 208 operatively connected to a solenoid which operates the opening and closing of the valves 206 . the amount of deformation the structural elements undergo can also be controlled and varied by the processor by controlling the amount that the valves 206 open ( i . e ., the orifice size is varied ). a structural element 200 corresponding to a valve 206 that is partially opened will be more rigid and thus undergo less deformation than a structural element having a corresponding valve 206 that is fully open . each runway panel assembly , i . e ., the runway panel , its motion constraining mechanisms and the elastic elements , viscous and dry friction based damping elements , are also equipped with one - way locks , that as the elastic elements are deformed under load , they are held in their maximum deformed position and are substantially prevented from regaining their original configuration as the load is lifted . such one - way locking mechanisms may be placed at any appropriate position between the runway panels and the foundation or between the runway panels and the mechanical motion constraining elements . the one - way locking mechanisms may also be positioned in parallel with one or more of the elastic elements , or may be constructed as an integral part of one or more of the elastic or damping elements . regardless of their design and the method of integrating them into the runway panel assembly , the one - way locks serve one basic function . this basic function is to “ lock ” the depressed runway panels in place and prevent them from “ springing ” back to their original position . in other words , as the airplane or other vehicle tire displaces a runway panel , the work done by the force exerted on the displacing surface panels ( mostly vertically and some in rotation ) is to be stored in the spring elements 110 ( 200 ) as potential energy . the function of the aforementioned one - way lock mechanisms is to “ lock in ” this potential energy by preventing the spring elements 110 ( 200 ) from moving back to their original position . the potential energy stored in the spring elements 110 ( 200 ), neglecting all other commonly present energy losses due to friction , etc ., is equal to the kinetic energy that is transferred from the airplane or other vehicle to the spring elements 110 ( 200 ). in general , one or more elastic elements of various types may be used on each runway panel and one or more of the spring elements may be initially preloaded . the primary purpose of preloading of the elastic elements is to reduce the amount of vertical and / or rotational displacement of the runway panels for a given applied load . another function of selectively preloading one or more of the elastic elements is to create the load - displacement ( rotation ) characteristics that is optimal or close to optimal for the operation of the runway . in the preferred embodiment of this invention , the effective spring rates of each runway panel assembly and the spring preloading are adjustable remotely . the spring rates and preloads may obviously be adjustable manually , particularly for runways that are only used with a few similar types of airplanes . in general , the runway panel assemblies are designed such that they do not require motion damping elements such as viscous dampers for their proper operation such as to prevent the bouncing action upon initial tire contact . such dampers are used to control the response of the runway panel assemblies to the speed of application of the tire load . in any case , minimal damping is desired to be used to make the rar most responsive to high - speed vehicles . in addition , if the stored potential energy in the elastic elements are intended to be used or harvested , minimal damping is desired to be employed since such dampers would convert a portion of the kinetic energy of the plane into heat , i . e ., a type of energy that is difficult to harness as compared to potential energy stored in elastic elements . on the other hand , certain runway panel assemblies , particularly those that are located at or close to the portion of the runway over which the plane travels at high speeds , may be desired to be equipped with motion damping elements such as viscous dampers that are appropriately positioned to provide resistance to the displacement and / or rotation of the runway panels for smooth operation . the effective damping rates of these elements are also desired to be adjustable remotely , manually and if possible by a closed - loop control loop . when the runway is intended to slow down airplanes upon landing , the plane may first land on a regular ( fixed ) runway segment and then enter the rar segment to be slowed or be brought to complete stop . in such cases , it is important that the transition between the two runway segments be as smooth as possible . such smooth transitions are readily obtained , e . g ., by providing higher spring rates for the initial highway panels and / or hinging them to the edge of the regular runway segment and then gradually decreasing the panel spring rates to achieve maximum deflection , i . e ., maximum vertical displacement of the runway panels under tire load . as the result , the vehicle begins to slow down smoothly as it enters the rar segment . then , as the plane continues to travel along the rar segment , the runway panels begin to be displaced vertically to their maximum set amount , and the kinetic energy of the plane continues to be transferred to the spring elements , while a certain ( usually much smaller ) portion of the kinetic energy is dissipated in the viscous damping and / or brake like friction elements . the plane will loose no control since the slowing down process does not involve any skidding or reduction or loss of contact friction between the tires and the runway surface . this is in total contrast with sand - filled roads and collapsible concrete runways that would form certain “ pathways ” along which the tires are forced to travel . of course , the rar may also constitute the entire runway which may be much smaller in length then a conventional runway for the same size aircraft . once the plane has been slowed down to the desired speed or has been brought to rest , the braking mechanisms of the runway panels can be released to slowly bring the panels to their original position . to make the movement smooth and prevent vibration , viscous damping or friction elements may be engaged during this return movement . alternatively , energy transformation means such as electric generators may be used to transform the stored energy in the elastic elements into usable electric energy . on the other hand , the potential energy stored in the elastic element of the runway panels may be used to accelerate a plane during its takeoff . the process is the reverse of the slowing down process . here , as the tire moves over a depressed runway panel , the panel brakes are released in a controlled manner from the back of each panel to the front as the tire moves over the panel , thereby pushing the plane forward and transferring the potential energy stored in the elastic elements to the plane as kinetic energy . by properly releasing the braking mechanisms , it is possible to transfer most of the stored potential energy to the plane . this process has the effect of allowing the plane to travel along a runway with a downward incline , thereby transferring the potential energy of the plane due to the total drop in the plane elevation to the plane in the form of kinetic energy . both landing and taking off processes using rar can be seen to be highly energy efficient . during the landing , minimal or no braking is required . during takeoff , a large portion of the required kinetic energy can be absorbed from the rar . by appropriate selection of the rar parameters , planes are able to land and take off in relatively short runways . such runways can therefore be also very useful for the construction of emergency landing and takeoff strips and for aircraft carrier . in general , elastomeric or hydraulic type of shock absorbers and bumpers may be used to limit the motion of the runway panels 108 ( 102 ) in the vertical direction to the designated depth h ( 105 ), or prevent excessive lateral motion of the panels or the motion constraint mechanisms , etc . in all situations , such elements are provided in order to smoothly bring these components to a stop and without a sudden shock . for the case of the depth 105 limiting stops , the allowable depth h ( 105 ) is preferably adjustable by a control system that adjusts the system parameters for each particular vehicle and initial speed and operating condition . such a controller is described above with regard to fig1 , however , similar control methods may be employed in the other embodiments discussed herein for controlling any or all system parameters . in general , the spring elements 110 are preferably preloaded to reduce the required depth h ( 105 ). it is also generally preferable to have springs with nonlinear force displacement characteristics of the general form shown in fig9 so that as the deformation is increased , the effective spring rate is also increased . such a spring rate characteristic allows the springs to also act as effective stops as the maximum desired depth h ( 105 ) is approached . the general shape of the desired spring displacement versus spring force curve 163 is shown in fig9 . the amount of preloading force is indicated by 165 . the spring rate , i . e ., the slope of the curve 163 increases with spring displacement . for a given displacement 161 of the spring , the corresponding spring rate k ( 162 ) is given by the slope of the tangent 164 at that point on the curve 163 . as can be observed , by proper selection of the spring 110 , as the displacement is increased ( in this case as it reaches the desired amount h ( 105 ), the spring rate becomes very large ( somewhere to the right of the point 161 ), where the spring turns into an effective stop . in general , more than one wide runway panel 108 ( 102 ) is desired to cover the width of the runway . by utilizing narrower panels , the effective mass that is displaced as the tire moves over a panel is reduced , thereby allowing for the rar panels to respond quickly . as a result , faster moving vehicles can be accommodated . in which case , the panels are desired to be hinged together as described for the longitudinal sides of the panels , together with similar elastic elements to allow the length variations due to the relative rotation of the panels . in one embodiment of the present invention , the aforementioned relative rotation of the panels along their hinged side edges is allowed . such an option would provide a certain amount of barrier that the tires have to climb in order to move in the direction of the width of the runway . such a barrier is desired , particularly if the vehicle is damaged or if the pilot is having problems controlling the vehicle . in an emergency situation , by allowing the depth h ( 105 ) to become larger , a larger stabilizing barrier can be provided for keeping the vehicle on the runway . for such emergency situations , auxiliary barriers positioned on the sides of the runway may also be activated to increase the height of the side barriers . on the other hand , in normal situations , the aforementioned relative rotation of the panels is preferably limited or is totally prevented by the provided hinges and the motion constraining mechanisms . although the rar is described above having static parameters , such parameters can be variable , either adjusted manually or automatically in response to sensed characteristics . for example , the rar can be equipped with sensors for detection of the position , size , and / or velocity of the vehicle before entering the rar . the information detected by one or more sensors is then input to a processor , which adjusts the parameters of the rar before the vehicle enters the rar . the sensors can also continue to monitor the vehicle as it travels on the rar and adjust the parameters thereof accordingly . for example , one parameter that can be adjusted based on the sensed characteristics is the spring rates of the spring elements 110 . means for adjusting spring rates of spring elements are well known in the art , such as helical or other passive springs in combination with pressurized gas springs . another example of a parameter that can be adjusted , is the viscous damping rates of the damper can also be adjusted based on the sensed characteristics . means for adjusting damping rates are well known in the art , such as providing an electrically actuated orifice change or by using magneto - restrictive fluids in fixed orifice fluid dampers . yet another example of a parameter that could be adjusted in response to the sensed characteristics is to provide moving stops that vary the amount of movement of the panels 102 , 108 . the stops can be moved by any means known in the art , such as by using electrically or hydraulically driven lead screws . these characteristics can be varied as a whole ( applied to all of the panels 102 , 108 , or applied to selective panels 102 ( 108 ) and done manually or under the control of a central processor or control unit . in certain situations such as in emergency situations when large amount of cargo has to be transported to certain location with heavy cargo aircrafts , the existing runways may be too short to accommodate such aircraft with full load . it is therefore highly desirable to develop the means to decelerate the aircraft over significantly shorter distances . in other cases , there may not even be a runway and some cleared pathway or roadway may be required to be used as landing strip . in all these situations , it is highly desirable to make the landing strip as short as possible . a need therefore exists for the development of the modular reusable and adaptive runways ( rar ) sections that could be transported to the site and be readily attached to at least a section of the existing runways , roadways or cleared paths to provide the means to smoothly decelerate the aircraft or other vehicles over such sections as described above and in u . s . pat . no . 6 , 969 , 213 entitled “ roadway for decelerating a vehicle including an aircraft ,” the entire contents of which is incorporated herein by reference . such modular sections are intended to be attached to the existing surfaces , e . g ., existing runway segments , using various means available in the art such as expansion bolts in the case of concrete or asphalt surfaces or even epoxy type of adhesives . the disclosed modular sections are preferably hinged together ( when the underlying ground is not firm enough ) or attached together with connections allowing certain amount of relative motion , particularly in rotation , when the underlying ground is firm , such as for the case of existing runways . one embodiment of the present invention is shown in the schematic of fig1 . in fig1 , the modular rar block 300 is shown to consist of a chassis 301 , preferably with a fully or partially solid ( holed ) base plate 302 , particularly when the section is to be mounted on relatively soft grounds . mounted inside the modular rar block 300 are at least one and preferably a number of runway panels 102 , which are attached to the chassis 301 by hinges 304 . in fig1 , the panels 102 are shown in their deployed position . support and control units 109 as discussed above are positioned as shown between in fig1 between the runway panel 102 and the chassis 301 . the support and control units 109 can also have a separate or an integrated actuation device for varying the deployed position of the runway panel 102 . it is noted that any one of the rar designs disclosed above or in u . s . pat . no . 6 , 969 , 213 may instead be mounted inside the modular rar block 300 . the chassis 301 may be provided with holes ( not shown ) in the bottom plate 302 for attachment to the underlying surface 306 with expansion bolts or other similar means known in the art . to cover a runway or other pathway section , the modular reusable and adaptive runways ( rar ) section blocks 300 are positioned side by side as shown in the top view of fig1 ( although only three of the twenty four blocks are marked in fig1 with reference numeral 300 , each of the blocks correspondent to the rar section blocks shown in fig1 ), and are preferably attached to the underlying surface using one or more of the aforementioned methods . fig1 is intended to show how the modular section blocks are assembled to cover certain area of the pathway and is similarly extended to cover the entire coverage area . although the rar section blocks are shown positioned side by side in the direction of travel ( arrow 305 ) and the in a direction perpendicular to such direction of travel , the rar section blocks can only be positioned side by side in one such direction ( e . g ., in the direction of travel ). the modular reusable and adaptive runways ( rar ) section blocks 300 can also be attached together at several points on their adjacent sides , preferably by means 320 that allow certain amount of relative motion , particularly in rotation . for this purpose , various bolt and nut fasteners and other types of fasteners and washers are available that allow certain amount of flexibility and range of rotation . for the sake of significantly reducing the amount of work and time that is needed to attach the modular reusable and adaptive runways ( rar ) section blocks 300 together , it is highly preferable to have at least a portion of attachment to comprise of interlocking structures that are provided on the sides of the blocks 300 chassis . such interlocking structures that would also allow certain amount of rotational motion are well known in the art . as an example , one such interlocking structure is shown in fig1 . in fig1 , two reusable and adaptive runways ( rar ) section blocks 300 a and 300 b are shown to be interlocked by a hook 333 , which is fixed to the chassis of the block 300 a , which engages a cylindrical pin 334 , which is fixed to the chassis of the block 300 b . the two blocks 300 a , 300 b can readily be interlocked in the field by placing , lifting and rotating either one of the blocks , engaging the hook ( s ), and laying the lifted block back on the pathway . the above means of interlocking reusable and adaptive runways ( rar ) section blocks is seen to allow for small rotational motion of one modular block relative to the other . referring now to fig1 and 18 , a transition can be provided to the first rar section block 300 that is encountered by the vehicle or aircraft to transition from a substantially zero height to the height of the rar section block 300 . the transition section can be a ramp formed of dirt and asphalt or other pathway surface , such as concrete . in addition , as shown in fig1 , the transition can be another rar section block 350 having a tapered chassis 301 a which tapers from the underlying surface 306 to the height of the subsequent rar section block 300 . alternatively , as shown in fig1 , several transition section blocks 350 a , 350 b and 350 c can be used to transition from the underlying surface 306 to the height of the subsequent rar section block 300 with each of the transition section blocks 350 a , 350 b and 350 c tapering a portion of the height between the underlying surface 306 to the height of the subsequent rar section block 300 after the transition . the transition rar block can have a leading portion 352 thereof which is a smooth surface without the movable panels 102 or the entire transition block can be without transition panels , as shown in transition section block 350 a in fig1 . while there has been shown and described what is considered to be preferred embodiments of the invention , it will , of course , be understood that various modifications and changes in form or detail could readily be made without departing from the spirit of the invention . it is therefore intended that the invention be not limited to the exact forms described and illustrated , but should be constructed to cover all modifications that may fall within the scope of the appended claims . | 1 |
the cloud point of a cellulosic polymer will depend on the kind of substituents , their degree of substitution , and to the average molecular weight of the polymer . if the cloud point is below about 10 ° c ., dispersion of the solid polymer ( before feeding it to the paper machine ) will require the use of colder water than may be available in a paper mill . if the cloud point is above about 95 ° c ., and the polymer is added in solution , the slurry temperature will not be above the cloud point and it may not be convenient to raise the temperature of the water in the sheet enough during drying to precipitate the polymer as a colloid at the drying stage , nor to maintain an existing colloid produced by adding it in water already above the cloud point . more preferably , the cloud points lies between 20 ° and 80 ° c ., and most preferably , between 35 ° c . and 65 ° c ., because that range of temperatures is conveniently used in the operation of most paper machines . suitable polymers can be selected readily by consulting manufactures , trade literature for cloud points . examples of cellulosic polymers exhibiting cloud points an acceptable range include methyl cellulose (&# 34 ; mc &# 34 ;), hydroxypropyl cellulose (&# 34 ; hpc &# 34 ;), methyl hydroxyethyl cellulose (&# 34 ; mhec &# 34 ;), methyl hydroxypropyl cellulose (&# 34 ; mhpc &# 34 ;), methyl hydroxybutyl cellulose (&# 34 ; mhbc &# 34 ;), and carboxyethyl methyl cellulose (&# 34 ; cemc &# 34 ;). of these , hpc and mc are preferred because their cloud points fall within the most preferred range . especially preferred is hpc , commercially available from hercules incorporated as klucel ® gf hydroxypropyl cellulose , which is a medium molecular size product with a 2 % solution viscosity of 150 - 400 cps . klucel ® gf hydroxypropyl cellulose is completely soluble in water below 45 ° c . and is insoluble above 45 ° c . fine colloidal particles are formed that can be maintained in a dispersed state when an aqueous solution of klucel ® gf hydroxypropyl cellulose is subjected to a temperature just above 45 ° c . if the polymer solution and the pulp slurry are both below the cloud point , the polymer will remain in solution and can not be expected to be substantive to the pulp . the concentration in the water at a given instant will be that needed to deposit enough in the sheet to impart the desired combination of strength and flexibility , after drying above the cloud point temperature . this concentration will be calculated from the amount wanted in the sheet , and the ratio of dry pulp fibers to water in the wet web entering the dryer . at equilibrium , the rate of polymer addition to the machine will equal the rate of polymer removal by way of the paper produced . the amount of polymer in the slurry is chosen depending on the magnitude of the effect desired in the grade of paper being produced . preferably , the amount will correspond to between about 0 . 1 % and about 2 % of the polymer , based on weight of dry fiber in the sheet produced . more preferably , the amount of polymer in the paper is between 0 . 5 % and 1 %. to achieve those proportions , the concentration of polymer in the slurry should preferably be maintained between 0 . 0002 % and 0 . 004 %, more preferably between 0 . 001 % and 0 . 002 %, assuming paper is prepared from 0 . 2 % pulp slurry . if the slurry temperature is above the cloud point , the colloidally dispersed polymer will be already available to adhere to the pulp fiber surface . optionally , an ionic water - soluble polymer can be added as a retention aid . many suitable cationic polymers are known to the art as retention aids for mineral fillers such as kaolin , talc , titanium dioxide , calcium carbonate , etc . in printing papers . such polymers include polyamines , amine - epichlorohydrin resins , polyamine - epichlorohydrin resins , poly ( aminoamide )- epichlorohydrin resins , cationic or anionic modified polyacrylamides , etc . a choice among many such commercial polymers can be made after routine experimentation . it is preferred to use amine - epichlorohydrin resin , polyamine epichlorohydrin resins , or poly ( aminoamide )- epichlorohydrin resins , because they are readily available in concentrated solution form and are easily diluted before addition . when a retention aid is used , it may be added to the pulp either before or after the cellulosic polymer . the pulps used may be those customarily used in the production of sanitary tissue or toweling . these pulps include but are not limited to : hardwood and softwood species , pulped by kraft , recycled pulp , sulfate , alkali , sulfite , thermomechanical , or chemithermomechanical pulp ( ctmp ), and may be bleached or unbleached . klucel ® hydroxypropyl cellulose is a nonionic water - soluble cellulose ether . klucel ® gf represents a medium molecular size product with a 2 % solution viscosity of 150 - 400 cps . klucel ® has a unique solubility property in water . it is completely soluble in water at a temperature below 45 ° c . and is insoluble above 45 ° c . fine colloidal particles are formed that can be maintained in a dispersed state when an aqueous solution of klucel ® is subjected to a temperature just above 45 ° c . the pulp was refined in a valley beater to 500 canadian standard freeness . the 2 . 50 % consistency pulp slurry was diluted to 0 . 322 % solid with normal tap water in a proportioner , where proportions of polymer ranging from 0 . 5 % to 2 % by weight of pulp solids were added to the pulp while stirring at room temperature , as well , as well as any retention aid . the concentration of polymer in the proportioner was therefore from 0 . 0016 to 0 . 0064 % on the same basis . aliquots of this pulp slurry were further diluted in a deckle box to the proper consistency for molding handsheets . both refining and papermaking were made at 7 . 5 to 8 . 0 ph . using klucel ® gf as the polymer , the slurry temperature in the deckle box was about 45 ° c . for preparation of the handsheets . tensile strength and modulus of papersheets were determined on an instron ® tensile tester at a drawing rate of 0 . 5 &# 34 ; and a span of 4 &# 34 ; for a 1 &# 34 ; wide sample . the tensile stiffness ( st ) was calculated from modulus ( e ) and thickness of paper ( t ) from the relation : st = e · t . bending stiffness was measured in a handle o &# 39 ; meter ( thwing albert instrument co . philadelphia , pa .). the instrument measures the property of a papersheet that is basically influenced by its flexibility , surface smoothness , and thickness . bending stiffness of a papersheet is known to correlate to its softness . brightness and opacity of paper were measured in a diano - s - 4 brightness tester . the results presented in tables 1 and 2 show that 0 . 2 to 1 . 0 percent addition of klucel ® gf has not adversely affected the tensile strength of paper , but rather shows a significant increase of about 8 %. however , the tensile stiffness and bending stiffness of paper were significantly reduced , corresponding to increased softness , and presumably attributable to discrete spot paper - to paper bondings induced by the colloidal klucel ® particles , instead of to continuous rigid bonding . table 1__________________________________________________________________________example 1handsheet propertiespulp : 70 / 30 nsk / ctmp tensile tensile bending strength modulus stiffness stiffnessadditive ( psi ) ( psi ) ( p / i ) ( g / in . ) __________________________________________________________________________ none 8 , 890 912 , 000 3 , 849 1651a . 0 . 5 % klucel ® gf 9 , 240 846 , 000 3 , 384 1061b . 1 . 0 % klucel ® gf 9 , 100 774 , 000 2 , 941 1051c . 0 . 5 % klucel ® gf + 9 , 580 875 , 000 3 , 500 114 0 . 5 % reten 200__________________________________________________________________________ nsk = northern softwood kraft ctmp = chemithermomechanical pulp p / i = pound per inch g / in . = gram per inch psi = pound per square inch table 2__________________________________________________________________________pulp : 70 / 30 nsk / ctmp tensile tensile bending strength modulus stiffness stiffnessadditive ( psi ) ( psi ) ( p / i ) ( g / in . ) __________________________________________________________________________ none 9 , 030 762 , 000 3 , 139 1632a . 0 . 2 % klucel ® gf 9 , 797 937 , 000 3 , 673 1382b . 1 . 0 % klucel ® gf + 9 , 330 854 , 000 3 , 425 130 0 . 5 % reten ® 200__________________________________________________________________________ nsk = northern softwood kraft ctmp = chemithermomechanical pulp p / i = pound per inch g / in . = gram per inch psi = pound per square inch the procedures of examples 1 and 2 were repeated with the klucel ® gf hydroxypropyl cellulose successively replaced with methyl cellulose , methyl hydroxyethyl cellulose , methyl hydroxypropyl cellulose , methyl hydroxybutyl cellulose , and carboxymethyl methyl cellulose . results similar to those reported in tables 1 and 2 were obtained . | 3 |
in the present invention , two identical main housing halves 10 ( fig1 ) are joined together back to back to comprise the main housing . a main housing half is a single integral piece preferably made of a high impact plastic . the main housing 10 has three sections , the vertical bubble capsule housing section 12 , the horizontal bubble capsule housing section 14 and the rotatable bubble capsule housing section 16 . housing section 12 has a vertical bubble capsule viewing opening 18 extending through main housing side wall 20 . surrounding opening 18 is a ring shaped boss 22 that extends out from side wall 20 . in opposite walls of ring boss 18 are half round nitches 24 in which the vertical bubble capsule 26 is inserted . four small cylindrical bosses extend from the side wall 20 of housing section 12 ; two screw receiver bosses 28 have blind holes 29 at their centers for receiving self - tapping screws 30 ( fig2 ); two screw guide bosses 32 have center holes 34 for guiding self - tapping screws into screw receiver bosses 28 . receiver bosses 28 are arranged relative to guide bosses 32 such that when two units of housing 10 are placed back to back , screw guide holes 34 are in alignment with screw receiver holes 29 . this same construction of guide and receiver bosses is repeated in housing section 16 . the sidewall 20 of housing section 12 curves upward at one end 20a where it meets end wall 36 . end wall 36 has a hole 38 through it . this hole is used for hanging the level on a wall hook , work belt or elsewhere . the construction of end wall 36 of section 12 at one end of main housing 10 is the same as the end wall 42 of section 16 at the opposite end of main housing 10 . on top of end wall 36 are an alignment nipple 44 and an alignment blind hole 46 . this structure is repeated on opposite end wall 42 except position of alignment nipple and hole are reversed so that when two units of housing 10 are placed back to back nipples fit into blind holes aligning the two housing halves . it is noted that side wall 20 extends out beyond the thin protions of top and bottom walls 47 and 48 forming ridges 50 . when two units of housing 10 are assembled back to back ridges 50 become sides of shallow elongated recesses 52 in the top and bottom sides of main housing 10 . optionally into one recess is fitted an elongated magnetic bar 54 and into the other recess is fitted elongated v - groove part 56 illustrated in fig4 . v - groove part 56 has a rectangular hole in its center so that the horizontal bubble capsule can be viewed from the top as well as from the side of the level structure . the rubberized magnetic bar enables the level to cling to ferrous metal surfaces leaving hands free . the v - groove part enables a user of the level to easily align the level parallel to the centerline of conduit or cylindrical surfaces . in the center section 14 of housing 10 is an opening 57 in side wall 20 for viewing the horizontal bubble capsule . half round nitches 58 in divider walls 49 are provided for holding ends of the horizontal bubble capsule 61 . in side wall 20 of section 16 is an opening 60 for viewing the rotatable bubble capsule 61 . surrounding opening 60 is a ring shaped boss 62 whose inside diameter is greater than hole 60 thereby forming a circular ridge 63 inside the ring boss 62 . ring boss 62 and ridge 63 form a recess into which cylindrical housing 64 rotatably fits . cylinder housing half 64 is a short cylinder with a closed end 65 . when two cylindrical housing halves are assembled back to back , they form a closed end cylinder which houses rotatable bubble capsule 61 . as shown in fig5 and 6 , cylindrical walls of housing 64 have half round nitches 66 which hold the rotatable bubble capsule . on top of cylinder housing walls 67 are alignment nipple 68 and blind hole 69 . when two cylindrical housing halves are assembled back to back , nipples 68 fit in blind holes 69 to insure proper alignment of halves . protruding from the outside of the closed cylinder end 65 are levers 70 that are used to rotate the cylindrical housing with thumb and forefinger . levers 70 and closed end cylinder are elements of a single integral piece of translucent plastic . fig2 is a side elevation view showing the outside of the present level structure . areas around capsule viewing openings are raised . self tapping screws 30 fit in counter sunk holes and hold opposite halves of main housing 10 securely together . as can be appreciated from the above specification and figures of the drawing , the present design enables the level to be constructed using very few parts . it is believed apparent that the structure of the present invention is not necessarily confined to the specific structure illustrated and described above , it being considered that the structure comprehends any variations covered by the basic principles disclosed . | 6 |
in its broadest aspect , the present invention provides a more efficient process for the preparation of tertiary amines ( v ) from secondary amines ( i ) and carbonyl compounds ( ii ). the process involves reacting a secondary amine ( i ) with a carbonyl compound ( ii ) in an acid - containing reaction medium , thereby forming an iminium salt intermediate ( iv ) and water ; removing the water from the reaction mixture with a water scavenger ; and reducing said iminium salt ( iv ) with a reducing agent to produce said tertiary amine ( v ). as shown in scheme 1 , reductive amination is an equilibrium process leading to the formation of iminium salt ( iv ) via the dehydration of the aminal ( iii ) before the reduction step . the water scavenger in this reaction functions to shift the equilibrium to the right , and facilitates formation of the iminium salt . as a supplemental benefit , near quantitative preparation of the iminium species , in advance of the introduction of the reducing agent , substantially eliminates costly competitive side reactions with the carbonyl compound . in a more preferred aspect , the present invention is concerned with the preparation of 1 - substituted - 2 , 3 , 4 , 5 - tetrahydro - 1 , 4 - benzodiazepines ( x ) by the reaction of 1h - 2 , 3 , 4 , 5 - tetrahydro - 1 , 4 - benzodiazepine precursors ( vi ) with an aldehyde ( vii ) in the presence of an acid and a water scavenger , to produce an iminium species ( ix ) as an intermediate , which is then reduced to yield the desired product ( scheme 2 ). generally speaking , for reactive amines and carbonyl compounds , a water scavenger is not required in a reductive amination , as the equilibrium normally favors the product . however , because 1h - 2 , 3 , 4 , 5 - tetrahydro - 1 , 4 - benzodiazepines and similar electron deficient secondary amines are not very reactive , a water scavenger facilitates reductive amination . “ water scavenger ” as use herein means any substance which removes or inactivates free water molecules , whether it be by a physical process such as absorption or adsorption , or by a chemical reaction . water scavengers suitable for use in the current invention include without limitation anhydrides of organic acids , aluminosilicates such as molecular sieves , other zeolites , finely divided silica gel , finely divided alumina , inorganic oxides such as barium oxide and calcium oxide , anhydrides of inorganic acids , such as phosphoric anhydride ( p 2 o 5 ), inorganic sulfates such as calcium sulfate , sodium sulfate , and magnesium sulfate , and other inorganic salts such as calcium chloride . aggressive water scavengers such as trifluoroacetic acid anhydride and trichloroacetic acid anhydride are particularly preferred for use in the process of this invention . in compounds i , ii , iii , iv , v , vi , vii , viii , ix and x , above , the substituent groups r , r 1 , r 2 , r 3 , r 4 , and r 5 may be the same or different and represent hydrogen , c 1 - c 12 alkyl groups , c 1 - c 12 heteroalkyl groups , c 5 - c 12 alkyl or heteroalkyl cyclic groups , c 5 - c 30 aryl groups , c 5 - c 30 heteroaryl groups , or c 3 - c 30 groups with both saturated and unsaturated moieties , which groups may or may not be cyclic , and in which groups a heteroatom may optionally be substituted for one or more carbon atoms . alternatively , r and r 1 taken together with the nitrogen to which they are attached may form a c 5 - c 30 group which contains one or more cyclic moieties , which may contain one or more heteroatoms , and which may also contain both saturated and unsaturated moieties . the y substituent can be rc ( o )—, roc ( o )—, r 1 r 2 nc ( o )—, rs ( o ) 2 —, ros ( o ) 2 — or r 1 r 2 ns ( o ) 2 —, wherein r , r 1 , and r 2 are as previously defined . the z substituent represents hydrogen or at least one substituent selected from the group of halogen , rcoo —, rs ( o ) 2 —, ros ( o ) 2 —, r 1 r 2 ns ( o ) 2 —, — cn or — no 2 , wherein r , r 1 , and r 2 are as previously defined , and n is an integer from 1 - 4 . when n is greater than one , each z substituent may be the same as or different from the other ( s ). suitable reducing agents for use in the above - described reactions include metal hydrides such as calcium hydride , lithium aluminum hydride , diborane , or sodium borohydride , alkylated metal hydrides such as trialkyltin hydrides , dialkyl aluminum hydrides , dialkyl boron hydrides , lithium triethyl borohydride , nacnbh 3 , or nabh ( oac ) 3 , organoselenides such as selenophenol ( phseh ) and substituted selenophenols wherein the substituent or substituents are as described below for substituted alkyl groups , h 2 in conjunction with a catalytic metal such as palladium , platinum , or nickel , raney nickel , and silanes of the formula sih ( r a r b r c ) in which r a , r b and r c independently represent c 1 - c 12 alkyl or c 2 - c 30 acyl . preferred reducing agents are h 2 / pd , silanes of the formula sih ( r a r b r c ), nacnbh 3 , and nabh ( oac ) 3 . silanes of the formula sih ( r a r b r c ) are particularly preferred as the reducing agent for carrying out the process of the invention , as they are completely soluble in the reaction medium , as described below , and produce organic soluble by - products , thereby greatly facilitating work - up and isolation of the desired tertiary amines . the most preferred reducing agents are trialkylsilanes including triethylsilane and tri - iso - propylsilane . acids which may be used in the practice of this invention include protic acids and non - protic acids . protic acids for use in the invention have a pk a within the range of about − 2 to about 2 . 5 . representative examples of protic acids include acidic ion - exchange resins ; inorganic acids such as hf , h 2 so 3 , h 3 po 4 , hno 2 ; substituted sulfonic acids such as methanesulfonic acid , trifluoromethane sulfonic acid , o - aminobenzosulfonic acid , naphthalenesulfonic acid , and chlorosulfonic acid ; organic carboxylic acids such as xcooh wherein x is ch 2 no 2 , monohalo -, dihalo -, or trihalo - substituted methyl , o - nitrophenyl , cn ( ch 2 ) 3 , cn ( ch 2 ) 2 , cnch 2 , o -( n + ( ch 3 ) 3 ) phenyl , 2 , 4 , 6 - trihydroxyphenyl , and monohalo -, dihalo -, or trihalo - substituted acetyl ; other organic acids such as maleic acid , lutidinic acid , oxalic acid quinolinic acid , dihydroxymalic acid , dihydroxytartaric acid , and cyclopropane - 1 , 1 - dicarboxylic acid ; and acidic hydroxyls . representative examples of non - protic acids include metal halides such as titanium ( iv ) halides , zinc ( ii ) halides , tin ( iv ) halides , aluminum ( iii ) halides , and non - metal halides such as antimony ( vi ) halides , gallium ( iii ) halides , and boron ( iii ) halides . preferably , protic acids for use in the invention have a pk a in the range of about − 0 . 3 to about 0 . 8 . preferred protic acids include halogenated alkanoic acids , such as trifluoroacetic acid and trichloroacetic acid , organic acids , such as trifluoromethane sulfonic acid , and naphthalene sulfonic acid , and acidic hydroxyls . preferred non - protic acids include titanium ( iv ) chloride , zinc ( ii ) chloride , and boron trifluoride . particularly preferred acids for use in the current invention are trifluoroacetic acid , trichloroacetic acid , chlorosulfonic acid and the like . trifluoroacetic acid is most preferred . preferred carbonyl compounds are aldehydes , including optionally substituted straight and branched - chain aliphatic aldehydes such as formaldehyde , acetaldehyde , propionaldehyde , butyraldehyde , valeraldehyde , caproaldehyde , heptaldehyde , or stearaldehyde , optionally substituted aromatic aldehydes such as benzaldehyde or salicylaldehyde , and optionally substituted heterocyclic aldehydes such as furfural , thiophene aldehyde , or imidazole carboxaldehydes , which include heterocyclic aldehydes of the formula vii - a wherein r 6 is h or lower alkyl and m is 1 or 2 . more preferred are aldehydes of formula vii - a wherein r 6 is hydrogen or a methyl group . most preferred are aldehydes of formula vii - a wherein r 6 is h and m is 1 , i . e ., imidazole - 4 - carboxaldehyde . a preferred process for the preparation of 1 - substituted - 2 , 3 , 4 , 5 - tetrahydro - 1 , 4 - benzodiazepines of formula x involves reaction of 1h - 2 , 3 , 4 , 5 - tetrahydro - 1 , 4 - benzodiazepine precursors of formula vi with an aldehyde of formula vii in the presence of trifluoroacetic acid as the acid and trifluoroacetic acid anhydride as the water scavenger , in a suitable solvent or solvent mixture , followed by reduction of the resulting iminium species of formula ix . suitable solvent ( s ) for use in the processes of the invention include , but are not limited to , hydrocarbons , halogenated hydrocarbons , ethers , esters , amides and nitriles . a preferred solvent is toluene . the reaction mixture temperature is preferably below about 30 ° c ., more preferably below about 25 ° c . preferred compounds prepared by the process of the present invention are those of formula x - a r 7 is optionally substituted lower alkyl , optionally substituted aryl or optionally substituted heterocyclo ; more preferred compounds of formula x - a which may be produced by the process of the present invention are those wherein r 7 is optionally substituted lower alkyl , optionally substituted phenyl , optionally substituted 2 - thienyl , or optionally substituted 1 - piperidinyl ; the most preferred compounds of formula x - a produced by the process of this invention are those wherein r 7 is n - propyl , n - butyl , 3 - methoxypropyl , 2 - thienyl , 5 - bromo - 2 - thienyl , phenyl , 4 - methoxyphenyl , or 1 - piperidinyl ; representative compounds of formula x - a which may be prepared by the processes of this invention include listed below are definitions of various terms used to describe this invention . these definitions apply to the terms as they are used throughout this specification , unless otherwise limited in specific instances , either individually or as part of a larger group . the term “ alkyl ” refers to straight or branched chain unsubstituted hydrocarbon groups of 1 to 20 carbon atoms , preferably 1 to 7 carbon atoms . the expression “ lower alkyl ” refers to unsubstituted alkyl groups of 1 to 4 carbon atoms . the term “ substituted alkyl ” refers to an alkyl group substituted by , for example , 1 to 41 substituents , preferably 1 to 15 substituents , and most preferably one to four substituents . the substituents may include , without limitation , halo , trifluoromethyl , trifluoromethoxy , hydroxy , alkoxy , cycloalkoxy , heterocyclooxy , oxo , alkanoyl , aryloxy , alkanoyloxy , alkylamino , arylamino , aralkylamino , cycloalkylamino , heterocycloamino , optionally substituted amino , e . g . nr a r b , in which r a and r b is each independently selected from hydrogen , halogen , alkyl , alkoxy , aryl or aralkyl ; alkanoylamino , aroylamino , aralkanoylamino , substituted alkanoylamino , substituted aroylamino , substituted aralkanoylamino , thiol , alkylthio , arylthio , aralkylthio , cycloalkylthio , heterocyclothio , alkylthiono , arylthiono , aralkylthiono , alkylsulfonyl , arylsulfonyl , aralkylsulfonyl , sulfonamido , e . g . so 2 nh 2 , substituted sulfonamido , e . g . so 2 nr a r b , nitro , cyano , carboxy , optionally substituted carbamyl , e . g . conr a r b , where r a and r b are as defined above ; alkoxycarbonyl , aryl , substituted aryl , guanidino and heterocyclos , such as indolyl , imidazolyl , furyl , thienyl , thiazolyl , pyrrolidyl , pyridyl , pyrimidyl and the like . where it is noted above that the alkyl substituent is further substituted , it will be substituted with halogen , alkyl , alkoxy , aryl or aralkyl . the term “ aryl ” refers to monocyclic or bicyclic aromatic hydrocarbon groups having 6 to 12 carbon atoms in the ring portion , such as phenyl , naphthyl , biphenyl and diphenyl groups , each of which may be substituted . the term “ aralkyl ” refers to an aryl group bonded directly through an alkyl moiety , such as benzyl . an aralkyl group may be substituted with any group described herein as an aryl or alkyl substitutent . the term “ substituted aryl ” refers to an aryl group substituted by , for example , one to seven substituents , and , preferably , one to four substituents such as alkyl , substituted alkyl , halo , trifluoromethoxy , trifluoromethyl , hydroxy , alkoxy , cycloalkyloxy , heterocyclooxy , alkanoyl , alkanoyloxy , amino , alkylamino , aralkylamino , cycloalkylamino , heterocycloamino , dialkylamino , alkanoylamino , thiol , alkylthio , cycloalkylthio , heterocyclothio , ureido , nitro , cyano , carboxy , carboxyalkyl , carbamyl , alkoxycarbonyl , alkylthiono , arylthiono , alkysulfonyl , sulfonamido , aryloxy and the like . the aryl group substituent may be further substituted by halo , hydroxy , alkyl , alkoxy , aryl , substituted aryl , substituted alkyl or aralkyl . the term “ cycloalkyl ” refers to optionally substituted , saturated cyclic hydrocarbon ring systems , preferably containing 1 to 3 rings and 3 to 7 carbons per ring which may be further fused with an unsaturated c 3 - c 7 carbocylic ring . examples of cycloalkyl groups include cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl , cycloheptyl , cycloctyl , cyclodecyl , cyclododecyl , and adamantyl . examples of cycloalkyl group substituents include one or more alkyl groups as described above , or one or more groups described above as alkyl substituents . the terms “ heterocyclic ”, “ heterocycle ”, and “ heterocyclo ” are used interchangeably herein to refer to an optionally substituted , fully saturated or unsaturated , aromatic or non - aromatic cyclic group , for example , which is a 4 to 7 membered monocyclic , 7 to 11 membered bicyclic , or 10 to 15 membered tricyclic ring system , which has at least one heteroatom in at least one carbon atom - containing ring . each ring of the heterocyclic group containing a heteroatom may have 1 , 2 , 3 , or 4 heteroatoms selected from nitrogen atoms , oxygen atoms and sulfur atoms , where the nitrogen and sulfur heteroatoms may also optionally be oxidized and the nitrogen heteroatoms may also optionally be quaternized . the heterocyclic group may be attached at any heteroatom or carbon atom . examples of monocyclic heterocyclic groups include pyrrolidinyl , pyrrolyl , indolyl , pyrazolyl , oxetanyl , pyrazolinyl , imidazolyl , imidazolinyl , imidazolidinyl , oxazolyl , oxazolidinyl , isoxazolinyl , isoxazolyl , thiazolyl , thiadiazolyl , thiazolidinyl , isothiazolyl , isothiazolidinyl , furyl , tetrahydrofuryl , thienyl , oxadiazolyl , piperidinyl , piperazinyl , 2 - oxopiperazinyl , 2 - oxopiperidinyl , 2 - oxopyrrolidinyl , 2 - oxazepinyl , azepinyl , 4 - piperidonyl , pyridyl , n - oxo - pyridyl , pyrazinyl , pyrimidinyl , pyridazinyl , tetrahydrothiopyranyl , tetrahydropyranyl , morpholinyl , thiamorpholinyl , thiamorpholinyl sulfoxide , tetrahydrothiopyranylsulfone , thiamorpholinyl sulfone , 1 , 3 - dioxolane and tetrahydro - 1 , 1 - dioxothienyl , dioxanyl , isothiazolidinyl , thietanyl , thiiranyl , triazinyl , triazolyl , and the like , including the various isomeric forms thereof . examples of bicyclic hetrocyclic groups include benzothiazolyl , benzoxazolyl , benzothienyl , quinuclidinyl , quinolinyl , quinolinyl - n - oxide , tetrahydroisoquinolinyl , isoquinolinyl , benzimidazolyl , benzopyranyl , indolizinyl , benzofuryl , chromonyl , coumarinyl , cinnolinyl , quinoxalinyl , indazolyl , pyrrolopyridyl , furopyridinyl ( such as furo [ 2 , 3 - c ] pyridinyl , furo [ 3 , 1 - b ] pyridinyl ] or furo [ 2 , 3 - b ] pyridinyl ), dihydroisoindolyl , dihydroquinazolinyl ( such as 3 , 4 - dihydro - 4 - oxo - quinazolinyl ), benzisothiazolyl , benzisoxazolyl , benzodiazinyl , benzofurazanyl , benzothiopyranyl , benzotriazolyl , benzpyrazolyl , dihydrobenzofuryl , dihydrobenzothienyl , dihydrobenzothiopyranyl , dihydrobenzothiopyranyl sulfone , dihydrobenzopyranyl , indolinyl , isochromanyl , isoindolinyl , naphthyridinyl , phthalazinyl , piperonyl , purinyl , pyridopyridyl , quinazolinyl , tetrahydroquinolinyl , thienofuryl , thienopyridyl , thienothienyl , and the like , including the various isomeric forms thereof . examples of substituents for the foregoing heterocyclic groups include one or more alkyl groups as described above or one or more groups described above as alkyl substituents . also included are smaller heterocyclos , such as epoxides and aziridines . as used herein , the expression “ optionally substituted ,” as in “ optionally substituted lower alkyl ”, “ optionally substituted aryl ” or the like , refers to alkyl , aryl , and other groups which may be unsubstituted or substituted with the substituents mentioned above . further , when a moiety is described herein as optionally substituted with more than one substituent , it is intended that each of the multiple substituents may be chosen independently from among the substituents mentioned above . compounds of formula x may form salts , which are also within the scope of this invention . advantageously , pharmaceutically acceptable salts , that is , those which are non - toxic and physiologically compatible , such as methylsulfonates , hydrochlorides , hydrobromides and the like , may be formed by the addition of an acid to a solution comprising the formula x compound . other salts may also be useful , e . g ., in isolating or purifying the compounds made by the processes of the present invention . the invention will now be further described by the following working examples , which are preferred embodiments of the invention . all temperatures are in degrees centigrade (° c .) unless otherwise indicated . these examples are provided for illustrative purposes only , and are in no way intended to limit the invention . ( r )- 2 , 3 , 4 , 5 - tetrahydro - 3 -( phenylmethyl )- 4 -( 2 - thienylsulfonyl )- 1h - 1 , 4 - benzodiazepine - 7 - carbonitrile ( 10 g ) and imidazole - 4 - carboxaldehyde ( 2 . 6 g ) were mixed in toluene ( 20 ml ) at 20 to 25 ° c . to this stirred slurry , first trifluoroacetic acid ( 9 . 4 ml ) and then trifluoroacetic acid anhydride ( 5 . 2 ml ) were added sequentially while maintaining the temperature below 30 ° c . the biphasic mixture was vigorously stirred at 20 to 25 ° c . for 2 hours . triethylsilane was then added and the reaction mixture was stirred at 20 to 25 ° c . until the reaction was determined to be complete according to hplc assay . the reaction mixture was polish - filtered , e . g ., through filter paper or a celite bed . the solvent was removed by evaporation , and a viscous yellow oil containing approximately 100 % yield of the crude title product was collected . the product of example i was dissolved in anhydrous ethanol . the solution was heated to 60 ° c . methanesulfonic acid was added at this temperature and a white slurry formed . the slurry was cooled to 0 to 5 ° c . over 1 hour and stirred for an additional 1 hour . the resulting white crystalline solid was filtered and washed with cold anhydrous ethanol . the wet cake was dried in a vacuum oven at 70 ° c . until the loss on drying ( lod ) was & lt ; 0 . 5 % to afford the title product as a white , crystalline substance ( 13 . 2 g , 92 . 3 % yield , hplc ap & gt ; 99 ). typical yield is between about 92 % to about 97 %. in a 500 ml flask was charged ( r )- 2 , 3 , 4 , 5 - tetrahydro - 3 -( phenylmethyl )- 4 -( 2 - thienylsulfonyl )- 1h - 1 , 4 - benzodiazepine - 7 - carbonitrile ( 25 . 0 g , 1 eq . ), imidazole - 4 - carboxaldehyde ( 6 . 45 g , 1 . 1 eq . ), and ch 2 cl 2 ( 150 ml ) at room temperature . cool to 0 - 5 ° c . add trifluoroacetic acid ( 18 . 8 ml , 4 eq .) in a period of 10 min . a solution was obtained after addition . stir the mixture for 10 min at 2 ° c . add trichloroacetic acid anhydride ( 11 . 7 ml , 1 . 05 eq .) in a period of 20 min at 2 ° c . stir the mixture for 30 min at 0 - 5 ° c . add na ( oac ) 3 bh ( 15 . 51 g , 1 . 2 eq .) in two portions at 0 - 5 ° c . agitate the mixture at 0 ° c . for 1 . 5 h , then room temperature for 1 hour . add ch 2 cl 2 ( 100 ml ), then cool to 0 ° c . adjust the ph to 8 - 9 with 10 % naoh ( about 125 ml used ). stir for 30 min . separate the two phases . wash the organic phase with h 2 o ( 2 × 100 ml ), then separate the two phases . remove most of the solvents , and add etoh ( 200 ml ); and heat up to 74 ° c . stir for 10 min at 74 ° c . cool to room temperature in a period of 60 min . crystals appeared at 65 ° c . filter and wash the crystals with etoh ( 40 ml ). dry at 40 ° c . in vacuum oven over night to give the product ( 13 . 55 g , 90 . 7 % yield ) as a white solid . charge ( r )- 2 , 3 , 4 , 5 - tetrahydro - 3 -( phenylmethyl )- 4 -( 2 - thienylsulfonyl )- 1h - 1 , 4 - benzodiazepine - 7 - carbonitrile ( 30 g , 1 eq .) and imidazole - 4 - carboxaldehyde ( 7 . 8 g , 1 . 1 eq .) into 300 ml of ch 2 cl 2 . cool the mixture to 0 - 5 ° c ., add trifluoroacetic acid ( 30 ml , 5 eq . ), and follow with trifluoroacetic acid anhydride ( 15 ml , 1 . 5 eq .). stir the solution at 0 - 5 ° c . for 15 min , then add a slurry of na ( oac ) 3 bh ( 21 g , 1 . 3 eq .) in 50 ml of ch 2 cl 2 while keeping the temperature below 20 ° c . remove the ice - bath and stir the mixture at room temperature for 18 h . cool the mixture to 0 - 5 ° c ., adjust ph with 10 % naoh to 12 . 5 ( ca . 250 ml used ). stir at room temperature for 30 min . split the phases , and extract the aqueous phase with 50 ml of ch 2 cl 2 . wash the combined organic layer with 100 ml of water . swap the ch 2 cl 2 to 300 ml of etoh by distillation at normal pressure . cool the solution to 20 - 25 ° c . over 1 h and stir for 30 min . filter the slurry and wash the wet cake with 50 ml of etoh . transfer the wet cake to a 500 - ml 3 - neck flask , and add 300 ml of etoh . heat to reflux for 10 minutes . slowly add methanesulfonic acid ( 4 . 8 ml ). keep stirring the clear solution at reflux for 30 min . cool the mixture to room temperature over 1 h and stir at room temperature for 1 h . a slurry forms at 65 ° c . filter the slurry and wash the cake with 50 ml of etoh . dry the cake at 40 ° c . in a vacuum oven overnight . the product is obtained as white solid ( 36 . 5 g , 84 % yield ). in a 500 ml flask was charged ( r )- 2 , 3 , 4 , 5 - tetrahydro - 3 -( phenylmethyl )- 4 -( 2 - thienylsulfonyl )- 1h - 1 , 4 - benzodiazepine - 7 - carbonitrile ( 20 . 0 g , 1 eq . ), imidazole - 4 - carboxaldehyde ( 5 . 2 g , 1 . 1 eq . ), and ch 2 cl 2 ( 80 ml ) at room temperature . cool to 0 - 5 ° c . add trichloroacetic acid ( 32 g , 4 eq .) and trichloroacetic acid anhydride ( 12 . 2 ml , 1 . 36 eq .) while keeping the temperature below 20 ° c . stir the mixture for 30 min at 0 - 5 ° c . add triethylsilane ( 11 . 6 ml , 1 . 5 eq .). agitate the mixture at 20 - 25 ° c . for 26 h until the reaction is complete . add ch 2 cl 2 ( 80 ml ), then cool to 0 ° c . adjust the ph to 8 - 9 with 10 % naoh . separate the two phases . wash the organic phase with h 2 o ( 50 ml ). remove most of the solvents , and add etoh ( 150 ml ); and heat up to reflux and stir at reflux for 10 min . cool to room temperature in a period of 60 min . crystals appeared at 65 ° c . stir at room temperature for 2 h . filter and wash the crystals with etoh ( 150 ml ). dry at 40 ° c . in vacuum oven over night to give the product ( 20 . 4 g , 85 % yield ) as a white solid . | 2 |
with reference to the illustrated drawings , the present disclosure refers to “ improvements introduced in support for vertical signpost ”, more precisely it is about a support ( 1 ) for vertical sign ( vs ), type used for setting directions as well as information about the distances , paths , petrol stations , restaurants , hospitals , police stations , and places of interest as well as guide vehicle drivers and pedestrians about the routes , destinations , access , distances , ancillary services and tourist attractions , and can also have the function of user education . according to the invention , the support ( 1 ) is obtained from the composition of association ( f ) formed recycled high density polyethylene — hdpe —, tire ground rubber obtained by recycling and component ‘ xlpe ’/ polycure from the recycling of electrical cables . these elements that can be aggregated in different proportions so long as they are in at least one range that can be defined as follows : 55 to 98 % 70 % of hdpe — high - density polyethylene recycled ; 28 to 35 % of xlpe / polycure recycled ; 5 to 15 % of tire ground rubber ; 1 . 0 to 3 . 0 % of ultraviolet resistance ; and 1 . 0 to 3 . 0 % of anti - flame . the ultraviolet resistance and anti - flame materials may be incorporated within the xlpe . that is , the 28 - 35 % of xlpe may include these materials . as an example of possible polymer compositions , but not limited to below represented formulations , at least three formulations are exemplified for the practical solution for implementing this support , namely : in relation to formula ( c ), the ultraviolet resistance and anti - flame properties may originate from additive other than xlpe . for instance , carbon black may be utilized as the anti uv material , and magnesium hydroxide may be utilized as the flame retardant . the section ( 2 ) of the support ( 1 ) made from the composition of recycled polymers may show different cross sections of length variations ( x ), namely : i ) a square section ( 2 a ) with dimension ( x )/( y ) preferably of 8 × 8 cm and up to 5 . 5 m in length ; ii ) a circular section ( 2 b ) with a diameter ( z ), preferably of 6 cm and up to 4 m long ; iii ) a square section ( 2 c ) with dimensions ( x 1 )/( y 1 ) of 10 × 10 cm and up to 6 m in length ; iv ) rectangular ( 2 d ) with dimension ( x 2 )/( y 2 ) of 7 × 15 cm up to 6 m in length ; v ) a square section ( 2 e ) with a dimension ( x 3 )/( y 3 ), preferably of 5 . 5 cm × 5 . 5 cm and up to 3 m in length . all the supports ( 1 ) are provided at least one weak point ( p 1 ) ( fragility aperture ) and preferably two points ( p 1 ) prevailing in the lower part of the support which is a height ( h ) from 10 to 20 cm from the ground after installation . this ( these ) point ( s ) of weakness ( p 1 ) consist of hole ( s ) from 10 to 15 mm in diameter which pierces the underside of the support part , in one direction , preferably in cross direction . it will be appreciated that other sections of the supports are substantially identical in shape to the section including the points of weakens with the exception that the points of weakness are absent . the support ( 1 ) obtained from the innovative composition of recycled polymers incorporates various structural arrangements hardware or rebars ( 3 ), these arrangements that are specific for combination with the various sections ( 2 a ), ( 2 b ), ( 2 c ), ( 2 d ) and ( 2 e ) of the section ( 2 ) conferring resistance to variations of the support ( 1 ). this hardware ( 3 ) may be in the form of steel rebars and feature diametric variations . though illustrated as having circular cross - sections , it will be appreciated that the hardware ( 3 ) may have other cross - sectional shapes as well . in one embodiment , the hardware extends continuously within the support ( 1 ) between a bottom end of the support and a top end of the support . in a preferred constructive version , the sections ( 2 a ) with quadrangular dimensions ( x )/( y ) can receive the following arrangements of rebars ( 3 a ): a ) four rebars ( 3 a 1 ) with a diameter ( d 1 ), preferably of 8 mm and two weak points ( p 1 ) arranged in a crossway ( see fig2 ). that association and arrangement consists resistance as shown below : b ) four rebars ( 3 a 2 ) having a diameter ( d 2 ), preferably 6 mm and two weak points ( p 1 ) arranged in a cross shape ( see fig4 ). that association and arrangement make up the strength as shown below : c ) a pair of rebars ( 3 a 3 ) with a diameter ( d 3 ), preferably of 6 mm and a pair of rebars ( 3 a 4 ) with a diameter ( d 4 ), preferably of 8 mm and two weak points ( p 1 ) arranged in a crossway ( see fig3 ). that association and arrangement makes up the strength as shown below : in a second constructive variation , the circular sections ( 2 b ) with a diameter ( z ) can receive the following arrangements rebars ( 3 b ): d ) four rebars ( 3 b 1 ) with a diameter ( d 5 ), preferably of 6 mm and two weak points ( p 1 ) arranged in a crossway ( see fig5 ); e ) six rebars ( 3 b 2 ) with a diameter ( d 6 ), preferably of 4 mm and two weak points ( p 1 ) arranged in a crossway ( see fig6 ); that association and arrangement of rebars ( 3 b 1 ) and ( 3 b 2 ) with section ( 2 b ) comprises the mechanical strength as shown below : in a third constructive variation , the sections ( 2 c ) with dimensions ( x 1 )/( y 1 ) can receive the following arrangements rebars ( 3 c ): f ) four rebars ( 3 c 1 ) with a diameter ( d 7 ), preferably of 10 mm and two weak points ( p 1 ) arranged in a crossway ( see fig7 ); g ) four rebars ( 3 c 2 ) with a diameter ( d 8 ), preferably of 8 mm and two weak points ( p 1 ) arranged crossway ( see fig8 ); h ) a pair of rebars ( 3 c 3 ) with a diameter ( d 9 ) of 8 mm and preferably a pair of rebars ( 3 c 4 ) with a diameter ( d 10 ), preferably of 10 mm , apart from two weak points ( p 1 ) arranged crossway ( see fig9 ). that association and arrangement of rebars ( 3 c 1 ), ( 3 c 2 ), ( 3 c 3 ) and ( 3 c 4 ) with section ( 2 c ) comprises the mechanical strength as shown below in the fourth constructive variation , the sections ( 2 d ) with dimension ( x 2 )/( y 2 ) can receive the following rebar arrangement ( 3 d ): i ) four rebars ( 3 d 1 ) with a diameter ( d 11 ), preferably 10 mm and two weak points ( p 1 ) arranged in cross form ( see fig1 ); j ) four rebars ( 3 d 2 ) with a diameter ( d 12 ), preferably of 8 mm and two weak points ( p 1 ) arranged crossway ( see fig1 ); l ) a pair of rebars ( 3 d 3 ) with a diameter ( d 13 ), preferably of 8 mm and a pair of rebars ( 3 d 4 ) with a diameter ( d 14 ), preferably of 10 mm , apart from two weak points ( p 1 ) arranged crossway ( see fig1 ). the association and arrangement of rebars ( 3 d 1 ), ( 3 d 2 ), ( 3 d 3 ) and ( 3 d 4 ) with section ( 2 d ) comprises the mechanical strength as shown below : in the fifth constructive variant , the sections ( 2 e ) with dimensions ( x 3 )/( y 3 ) can receive the following arrangements rebars ( 3 c ): m ) four rebars ( 3 c 1 ) with a diameter ( d 7 ), preferably of 6 mm and two weak points ( p 1 ) arranged in a crossway ( see fig7 ); that association and arrangement of rebars ( 3 c 1 ), section ( 2 e ) comprises the mechanical strength as shown below : in the sixth constructive variation , the sections ( 2 a ), ( 2 b ), ( 2 c ), ( 2 d ) and ( 2 e ) can receive rebars ( 3 ) and tube sections ( 4 ) as conduits for the passage of electrical cables and wires ( f ) in order to facilitate the installation of lights , reflectors , luminous plate and the like on the polymeric support plates ( see fig1 to 16 ). in this fifth variation are applied to the two weak points ( p 1 ) arranged crossway . the description of the polymer composition associated with the distribution of the steel bars , tube sections and points of weakness in the bottom of the support , allows the support to acquire currently desired breakdown characteristics , since the support has the necessary wind resistance dictated by technical standards , while cooperating with the reduction of accidents , since the support and the signpost are folded away from the collision and not offering resistance to shock intensity sufficient to be characterized as a fixed barrier , which can provide abrupt deceleration of the vehicle and its occupants causing risk to physical integrity and health of the same , as usually happens . the support is , in one embodiment , produced in an extrusion process . that is , the formula utilized , along with any rebars and / or conduits are forced through a die . such manufacturing is known to those skilled in the art and not further discussed . modifications may be introduced with regard to certain construction details and form , without this implying depart from the fundamental principles that are clearly substantiated in the set of claims , thus understood that the terminology did not have the limitation of purpose . | 5 |
referring to fig1 a , a force diagram 20 aids in the description and analysis of the forces causing vibration in an orbital sander . in this diagram the forces are all coplanar . a motor shaft 21 spinning about that axis at a rotation speed of ω provides a frame of reference . the motor shaft 21 is the principal moving part of the orbital sander and drives the operational components including the sanding pad with attached sandpaper . for purposes of analysis the sanding pad assembly may be fairly represented by a point mass located at a center of the constituent mass . the motor shaft 21 , can be assumed symmetrical around the motor shaft axis and with homogeneous density , thereby not contributing to any imbalance in the system . the mass of the sanding pad assembly with sandpaper can be represented by mass 24 at distance a from a motor shaft axis 21 of rotation . at rotational speed ω , the mass 24 imparts a rotational force 27 on the motor shaft axis 21 , that is the product of radius a times the magnitude of the mass 24 , and the square of the rotational velocity , i . e . ω 2 ( f = mrω 2 ). vibration results as time - varying reactionary forces , and in the case of the orbital sander transmits through the bearings and contributes to the horizontal top bearing force 45 and the bottom bearing force 51 . along with forces imparted simply by the rotation of the shaft , vibration stems from time - varying reactionary forces fed to the orbital sander motor shaft 21 by action of the operator . the operator pushing the sander across the surface of the workpiece and pressing the sander to the workpiece with a vertical pushing force 42 that together with the gravitational force impart a vertical pushing force 48 through the workpiece acting on the shaft , thus forming a force couple . vibration results as time - varying reactionary forces , and in the case of the orbital sander transmits through the bearings and contributes to the horizontal top bearing force 45 and the bottom bearing force 51 . to counteract the reactionary forces , i . e . the horizontal top bearing force 45 and the bottom bearing force 51 , a top correction - mass 30 and a bottom correction - mass 36 spin with motor shaft 21 , at radii c and e respectively , and produce forces respectively . as set forth above , the resulting forces , forces 33 and 39 are proportional to the rotational velocity squared ω 2 , and respective radii c and e . the force diagram demonstrates that by suitably selecting the radii c and e respectively , the reactionary forces are effectively counterbalanced eliminating the reactionary forces , i . e . the horizontal top bearing force 45 and the bottom bearing force 51 . suitably varying the radii c and e is a dynamic process as the pushing force 42 varies referring to fig1 b ( the elements present remain as set forth as in fig1 a discussed above ), as the rotational velocity ω , a phase - shift phenomenon exists , resulting from the time difference between when the rotational system produces a maximum force and when the corresponding forces are measured . in other words , the force measured is not necessarily coplanar to the correcting forces 33 and 39 . the measured force must be adjusted by the phase - angle φ to obtain bearing forces that are coplanar to the correction - forces 33 and 39 . if the phase - angle φ equals zero , then the measured bearing forces 45 and 51 are coplanar to the correction - forces 33 and 39 . the phase - angle φ is measured using an optical sensor 75 in a presently preferred embodiment though as will readily be perceived by those skilled in the art , any suitable motor shaft 21 indexing device will serve to measure the phase - angle φ . the purpose of the indexing device such as the optical sensor 75 is to inform the controller of the phase - angle of the motor shaft 21 as it rotates , whereas the accelerometers 54 , 57 indicate the magnitudes of the top bearing force 45 , and the bottom bearing force 51 . referring to fig1 a , 1 b , and 2 , a controller 63 comprises two processing channels , a top channel 66 a and a bottom channel 66 b . the top channel 66 a is configured to minimize the top bearing force 45 and the bottom channel 66 b is configured to minimize the bottom bearing force 51 . the controller 63 controls the radial positions , at radii c and e respectively , of the top correction - mass 30 and the bottom correction - mass 36 , to produce forces 33 and 39 . as forces 33 and 39 are optimized , the top bearing force 45 and the bottom bearing force 51 are minimized . characteristic of a closed - loop program , the outputs are measured with accelerometer 54 and accelerometer 57 , then fedback and compared to the desired input . if they are not the same the controller 63 makes adjustments to drive them to be the same . the controller receives inputs from mixers 69 a and 69 b by the top channel 66 a and the bottom channel 66 b of the controller 63 respectively . the mixers receive a signal as a negative input from the accelerometers 54 and 57 for the top bearing acceleration , which is represented by the top bearing force 54 , and the bottom bearing acceleration , which is represented by the bottom bearing force 57 respectively . since accelerometers measure acceleration , the controller 60 , works in acceleration instead of working in force values . force and acceleration are proportional . the mixers 69 a and 69 b receive inputs representative of a zero acceleration input as a positive input for comparison with the output of the top and bottom bearing accelerometers 54 and 57 respectively . these inputs are corrected for phase angle information received by the optical sensor 75 to determine an appropriate signal for determining a position for varying the positions of the top correction - mass 30 and the bottom correction - mass 36 by varying radii c and e respectively . a second mixer 71 a modifies the output of the top channel 66 a as a second mixer 71 b modifies the output of the bottom mixer according to the input of a force disturbance that could be from several different sources , such as the operator pushing on the sander and / or a change in sandpaper mass from either installing a new piece of sandpaper , loading the current sandpaper with work - piece particles , or degrading the current sandpaper by loosing abrasive particle media . referring to fig3 , in a presently preferred embodiment an effective two - channel control algorithm 100 begins at a block 102 and operates continuously while the sander drives the sandpaper and only ends when the orbital sander is turned off . the purpose of the control algorithm 100 is to move correction - masses 30 and 36 until both phase - corrected bearing acceleration 45 and bearing acceleration 51 are near or equal to zero . another objective of algorithm 100 is to get both phase - corrected bearing acceleration 45 and phase - corrected bearing acceleration 51 to zero or near zero in a short amount of time . although there could be other more efficient algorithms , algorithm 100 has proven to function effectively . the algorithm 100 has the feature to change from coarse to fine resolution by assuming a large step size ( displacement ) of correction - mass position . in the current algorithm , the low resolution displacement value is ten times longer than the high resolution displacement value . in algorithm 100 , after both bearing accelerations have been corrected for the phase - angle φ offset they are combined for comparison purposes . this combined value has the advantage of having only one acceleration level to compare instead of two . determining the absolute value of each top bearing acceleration 45 and bottom bearing acceleration 51 calculate this comparison level . the higher of the two absolute acceleration levels is the comparison value . when the comparison value is near or equal to zero , then the bearing accelerations 45 and 51 are also near or equal to zero and the sander housing will transmit minimal vibration to the operator &# 39 ; s hand . at a block 105 , the controller receives signals from the optical sensor 75 and the accelerometers 54 and 57 to derive the phase corrected top and bottom bearing accelerations . at a block 105 , the highest absolute acceleration level ( the comparison value ) is calculated , as described above . this initial highest absolute acceleration is the baseline level . at a block 108 , the mass displacement , or movement step size is set to the low - resolution value . at a block 111 , the controller moves the bottom correcting mass 36 by decreasing the radius e . again , at a block 114 , the highest absolute acceleration level is calculated , as described above , as in the block 105 . at a decision block 117 , the algorithm compares the new highest absolute acceleration level to the baseline level in order to determine if the movement of the mass at block 111 has reduced the acceleration . if the new highest absolute level is lower than the baseline level , then the new highest absolute level is made equal to the baseline level , and the old baseline level is erased . at a decision block 120 , the algorithm determines whether to use the low resolution mass displacement value or the high - resolution displacement value . in either case , again at a block 111 , the controller moves the bottom correcting mass 36 by decreasing the radius e . again the steps in block 114 and decision block 117 are repeated . while the new highest absolute level is lower than the baseline , steps in block 120 , block 111 , block 114 and decision block 117 are repeated again and again until the new highest absolute level is higher than the baseline . when at decision block 117 , the new highest acceleration level is higher than the baseline level , the step in block 126 is initiated . at a block 126 , the controller moves the top correcting mass 30 by decreasing the radius c . at a block 129 , and as in a block 105 , the highest absolute acceleration level is calculated . at a decision block 132 , the algorithm compares the new highest absolute acceleration level to the baseline level in order to determine if the movement of the mass at block 126 has reduced the acceleration . if the new highest absolute level is lower than the baseline level , then the new highest absolute level is made equal to the baseline level , and the old baseline level is erased . again at a block 126 , the controller moves the top correcting mass 30 by decreasing the radius c . again the steps in block 129 and decision block 132 are repeated . while the new highest absolute level is lower than the baseline , steps in block 126 , block 129 and decision block 132 are repeated again and again until the new highest absolute level is higher than the baseline . when at decision block 132 , the new highest acceleration level is higher than the baseline level , the step at block 135 is initiated . at a block 135 , the controller moves the top correcting mass 30 by increasing the radius c . at a block 138 , and as in a block 105 , the highest absolute acceleration level is calculated . at a decision block 141 , the algorithm compares the new highest absolute acceleration level to the baseline level in order to determine if the movement of the mass at block 135 has reduced the acceleration . if the new highest absolute level is lower than the baseline level , then the new highest absolute level is made equal to the baseline level , and the old baseline level is erased . again at a block 135 , the controller moves the top correcting mass 30 by increasing the radius c . again the steps in block 138 and decision block 141 are repeated . while the new highest absolute level is lower than the baseline , steps in block 135 , block 138 and decision block 141 are repeated again and again until the new highest absolute level is higher than the baseline . when at a decision block 141 , the new highest acceleration level is higher than the baseline level , the next step is initiated . at a block 144 , the controller moves the bottom correcting mass 30 by increasing the radius c . at a block 147 , and as in a block 105 , the highest absolute acceleration level is calculated . at a decision block 150 , the algorithm compares the new highest absolute acceleration level to the baseline level in order to determine if the movement of the mass at block 144 has reduced the acceleration . if the new highest absolute level is lower than the baseline level , then the new highest absolute level is made equal to the baseline level , and the old baseline level is erased . again at a block 144 , the controller moves the bottom correcting mass 36 by increasing the radius e . again the steps in block 147 and decision block 150 are repeated . while the new highest absolute level is lower than the baseline , steps in block 144 , block 147 and decision block 150 are repeated again and again until the new highest absolute level is higher than the baseline . when at a decision block 150 , the new highest acceleration level is higher than the baseline level , the next step at the decision block 120 is initiated . at a decision block 120 , the algorithm determines whether to use the low resolution mass displacement value or the high - resolution displacement value . in the current algorithm , the low - resolution mass displacement value is used to implement a minimum of two mass displacement cycles , defined as performing the steps listed from block 111 to the decision block 150 . after two mass displacement cycles , in the decision block 120 , the baseline acceleration level from using the prior mass displacement value is compared to the new baseline acceleration level using the current mass displacement value . while the new baseline acceleration is lower than the prior baseline acceleration level , the low - resolution mass displacement value is used and the system continues implementing additional mass displacement cycles . when no change in two consecutive baseline accelerations occurs , the algorithm changes to using the high resolution mass displacement value . referring to fig4 , a cross - section view of a presently preferred embodiment of the inventive orbital sander 20 c reveals a compact and functional sanding machine . a sander housing 22 is configured to enclose the workings of the sander and also to serve as an advantageous shaped handgrip . the sander housing 22 encloses a drive train with elements found in non - inventive orbital sander systems : a motor 25 ( either electric or pneumatic ), a motor shaft 21 a , a top bearing 44 and top bearing mount 43 , a bottom bearing 51 and a bottom bearing mount 52 , an orbital bearing assembly 97 , and a sanding pad 99 . collectively these elements form a drive train similar to that found in a conventional sander . inventive elements of a dynamic balancing system include a controller 60 , slip ring brushes 79 along with a slip brush plate 77 to convey signals to a top stepper motor 83 a and a bottom stepper motor 83 b mounted respectively on an top motor plate 87 a and a bottom motor plate 87 b . in the top correcting assembly 78 a , a top stepper motor 83 a drives a top biased correction - mass assembly 85 a and in a bottom correcting assembly 78 b , the bottom stepper motor 83 b drives a bottom biased correction - mass assembly 86 b . a top thrust transfer pad 84 a supports a top thrust bearing 89 a as the top stepper motor 83 a drives the top biased correction - mass assembly 85 a . similarly , the bottom thrust transfer pad 84 b supports the bottom thrust bearing 89 b as the bottom stepper motor drives the bottom correction - mass assembly 85 b . these elements affect the placement of corrective masses in the respective correction - mass assemblies 85 a and 85 b at the direction of controller 60 . the controller 60 receives input from the advantageously placed top bearing accelerometer 54 , the bottom bearing accelerometer 57 and the optical sensor 75 . referring to fig5 , an exemplary correcting assembly 78 represents both the top correcting assembly 78 a ( fig4 ) and bottom correcting assembly 78 b ( fig4 ). each correcting assembly 78 is configured to nest with a second correcting assembly 78 that is rotated 180 degrees around a minor ( vertical ) axis and flipped across a horizontal plane . in this manner , opposed masses are oriented for parallel radial movement with respect to the shaft 21 a ( fig4 ) while each are axially offset from the motor 25 ( fig4 ) distinct distances . so configured , the masses of the rotating stepper motors 83 are at equal radial distances in a horizontal plane , thereby neutralizing their masses in the horizontal plane in the rotating system , but they are vertically offset to create the vertical distance between correction - mass 36 and correction - mass 30 . similarly , placement of the motor plate 87 , the thrust transfer pad 84 , and the thrust bearing 89 , are placed to compensate for each other in the horizontal plane in the rotating system . although the motor plate 87 , the thrust transfer pad 84 , and the thrust bearing 89 are vertically offset from each corresponding other , the active dynamic rotational balancing system correctly compensates for this offset . stepper motor mount 80 , is held in place by motor plate 87 and contains the stepper motor 83 , thrust transfer pad 84 , and the thrust bearing 89 . built on the motor plate 87 to give rigidity and exact placement of remaining elements , the correction - mass assembly 78 includes the stepper motor mount 80 , thrust transfer pad 80 , the thrust bearing 89 , the stepper motor 83 , a configured correction - mass 85 and a matched pair of biasing springs 82 . a stepper motor armature 88 rotates 1 / 20th of a revolution for each step with a pitch advantageously selected to allow fine resolution movement of the correction - mass 85 , a 0 . 25 mm screw pitch is selected in the presently preferred embodiment so the correction - mass 85 is moved 0 . 0125 mm for each step . in operation , during high - speed rotation of the correction - mass assembly 78 , a rotational acceleration acts on the armature 88 of the stepper motor 83 . the rotational acceleration applies a force to the armature 88 causing misalignment . the thrust transfer pad 84 supporting a thrust bearing 89 is advantageously included to support the armature 88 from misalignment , assuring optimal operation of the stepper motor 83 . the inventive configuration of the correction - mass assembly 78 amplifies the force used to move the correction - masses often against rotational acceleration . in the presently preferred embodiment , the stepper motor 83 can only provide 3 lbs of thrust ( radial force ) to accomplish the movement of correction - masses . to achieve more than 11 lbs of balancing force , two springs 82 supply a biasing force to counteract the rotational acceleration on the correction - masses 85 . in the presently preferred embodiment , when correction - masses 85 at an extreme range of the designed travel , a rotational force of 11 lbs is exerted on the correction - mass . advantageously in this position the springs 82 supply a total of 9 lbs biasing in opposition to the rotational force . thus , at even the extreme end of the range there are only 2 lbs . of thrust that the stepper motor 83 must supply to move the correction - masses 85 inward . referring to fig6 , an exploded view of the inventive sander 20 c sets forth the several components of the presently preferred embodiment . though illustrated with an electric motor 25 , the presently preferred embodiment may be driven by any suitable motive means including a pneumatic motor as will readily be appreciated by one skilled in the arts . the housing 22 is , advantageously , formed to enclose the driving means and to conform to an operator &# 39 ; s hand . two bearings , a top bearing 44 in the top bearing mount 43 and a bottom bearing 53 in its bottom bearing mount 52 hold the motor shaft 21 a in fixed relationship to the housing 22 . additionally , the top bearing mount 43 provides a suitable mount for the top bearing accelerometer 54 ( fig4 ) and the optical sensor 75 ( fig4 ), both advantageously placed to note movement of the motor shaft 21 a . similarly , the bottom bearing mount 52 provides a suitable mount for the bottom bearing accelerometer 57 . as discussed above the accelerometers 54 , and 57 along with the optical sensor 75 or other suitable indexing device such as a hall effect sensor , allow for measurement and determination of the phase - corrected accelerations on the motor shaft 21 a . with the determinations of the phase - corrected accelerations on the shaft , the controller 63 can suitably move the correction - masses 85 a , 85 b into optimal position to minimize the phase - corrected accelerations . the motor shaft 21 a drives the sanding pad 99 and the orbital bearing assembly 97 . the orbital bearing assembly 97 contains an offset axis and produces an orbital motion in any designated one of known modes such as random orbital , dual - action , or jitterbug . the motor shaft 21 a drives the sanding pad 99 in an eccentric orbit around the motor shaft axis 21 ( fig1 a , 1 b ). for a random orbital sander , the circular sanding pad 99 is mounted to a bearing on its axis ; during operation sanding pad 99 is allowed to slip on a sanding pad axis . in a dual - action , the operator can select one of two modes of operation , one being the random orbital operation , the other being a locked pad mode . in the locked pad mode , the pad does not slip on its axis . in most orbital sanders , the sanding pad 99 is suitably configured to accept round pads with either pressure sensitive adhesive or a hook and pile system . in a jitterbug orbital sander , the sanding pad is square or rectangular and contains two clips to attach the sanding medium . the advantage of a square pad is that the square pad will accept standard sheet sanding medium , and the sheet sanding medium can be cut to the correct size . the controller 63 ( fig2 ) controls the stepper motors 83 by means , in the presently preferred embodiment , of four voltage sources for each of two stepper motors thus by means of eight voltage signals . therefore , an eight channel slip - ring system 92 includes a eight channel slip - ring 81 with contact rings in each of the defined channels . eight contact brushes 79 each contact one of the individual contact rings . suitable wiring ( not shown ) allows the voltage signals sent by the controller 63 , at the contact rings to reach the two stepper motors 83 a , 83 b . to place the signal on the contact rings , brush springs 94 suitably bias the contact brushes 79 against the contact rings while conducting signals to the brushes by biased contact . a non - conductive slip brush plate 77 holds the slip brushes 79 in orthogonal relation to the contact rings while allowing axial movement of the slip brushes 79 . a keeper 96 and an insulated pin 93 fix the biasing slip brush springs 94 in relationship to the slip brushes 79 to suitably apply the biasing force . both the keeper 96 and the pins are of a nonconductive material to prevent cross - talk between distinct voltage channels . while the preferred embodiment of the invention has been illustrated and described , as noted above , many changes can be made without departing from the spirit and scope of the invention . for example , an additional adjusting mechanism that allows the operator to increase the orbital eccentricity might be inserted to allow for more aggressive sanding . accordingly , the scope of the invention is not limited by the disclosure of the preferred embodiment . instead , the invention should be determined entirely by reference to the claims that follow . | 1 |
refer now to the drawings wherein depicted elements are , for the sake of clarity , not necessarily shown to scale and wherein like or similar elements are designated by the same reference numeral through the several views . turning to fig3 , an example of a router 200 in accordance with an embodiment of the present invention can be seen . as shown , communication between line cards 202 - 1 to 202 - n is provided through wireless millimeter wave links ( i . e ., between 100 ghz and 10 thz ) instead of through “ long reach ” serdes links . each card 202 - 1 to 202 - n is secured within a rack 206 ( which is part of the router chassis 208 ). the rack 206 is able to power each of the line cards 202 - 1 to 202 - n and to provide controls from a processor ( i . e ., controller 102 of fig1 ). each card 102 - 1 to 102 - n is able to provide multiple transmit and receive links to its adjacent line cards . additionally , a waveguide ( or many waveguides ) can be included within chassis 208 to allow the first line card 202 - 1 to the last line card 202 - n . in order to be able to create these wireless millimeter wave links , the line cards 202 - 1 to 202 - n should be arranged in a manner in which the links do not interfere with one another , which can be seen in fig4 and 5 . as shown , two different types of line cards 202 - 1 and 202 - n can be employed : active cards 201 and relay cards 203 . active cards 201 are generally include ports 112 - 1 to 112 - r , whereas relay cards 203 . this allows for the assembly of a lower cost router 200 , where some active cards 201 are replaced with relay cards 203 , allowing the millimeter wave links are present so as to generally maintain the same functionality . active cards 201 are generally comprised of io circuits 304 - 1 to 304 - 6 ( more may be included ) that are secured to the printed circuit board ( pcb ) 306 and spaced apart from one another by a distance d 1 such that the transmit and receive links for adjacent io circuits ( i . e ., io circuit 304 - 1 and 304 - 2 ) do not interfere with one another . each of these io circuits 304 - 1 to 304 - 6 is coupled to a forwarding circuit 302 over “ short reach ” serdes links ( which can include multiple serdes lanes ). the forwarding circuit 302 is also coupled to ports 112 - 1 to 112 - r . the relay card 203 , on the other hand , has relay circuits 402 - 1 to 402 - 6 that are secured to pcb 406 and arranged in a similar manner to io circuits 304 - 1 to 304 - 6 . these relay circuits 402 - 1 to 402 - 6 are also coupled to a relay controller 404 over “ short reach ” serdes links . turning to fig6 , an example arrangements for io circuit 304 ( labeled 304 - a for fig6 ) can be seen . as shown , io circuit 304 - a id generally comprised of a transceiver 502 secured to the top surface of the pcb 306 - a and a relay circuit 402 - a secured to the bottom surface of pcb 306 - a . each of the transceiver 502 and relay circuit 402 - a is coupled to the forwarding circuit 302 over “ short reach ” serdes links and each has a transmit link and a receive link that extend from the top and bottom surfaces of the pcb 306 - a , respectively . the transmit and receive links are also usually at different frequencies to avoid interference . for example , the transmit link and receive link for transceiver 502 and be 160 ghz and 120 ghz , respectively , and the transmit and receive links for relay circuit 402 - a can be 120 ghz and 160 ghz , respectively . additionally , for relay card 203 , relay circuits ( i . e ., 404 - 1 ) are secured to the top surface and bottom surface of pcb 406 in a similar arrangement . another approach ( as shown in fig7 ) is to employ transceiver 504 in io circuit 304 - b . for this example , transceiver 504 provides transmit and receive links that extend from both the top and bottom surfaces of the pcb 306 - b . for the transmit and receive links extending from the top surface of the pcb 306 - b , transceiver 504 function in a similar manner to transceiver 502 , but , because pcbs ( i . e ., pcb 306 - b ) often include layers that are reflective or opaque to millimeter wave radiation , the pcb 306 - b is configured to be roughly transparent . this is accomplished by having a radio frequency ( rf ) window 506 positioned below or aligned with transceiver 504 . in this rf window 506 , openings are formed in layers that are opaque or reflective to millimeter wave radiation so as to allow the transceiver to form transmit and receive links that extend from the bottom surface of the pcb 306 - b . turning to fig8 , a diagram of an example of a relay circuit 402 can be seen . in this example , the relay circuit 402 is generally comprised of a serdes circuit ( which generally includes a serializer 602 and deserializer 608 ), an intermediate circuit ( which generally includes multiplexer 604 and demultiplexer 610 ), a transmitter 606 , a receiver 612 , and an antenna 614 . typically , the serdes circuit is coupled to serdes lanes so as to communicate ( i . e ., provide and receive data packets ) with a forwarding circuit 302 or relay controller 404 . the multiplexer 604 and demultiplexer 610 are also controlled by the forwarding circuit 302 or relay controller 404 so as to control the data flow from the receiver 612 and to transmitter 606 . in fig9 , a diagram of an example of the transceiver 502 or 504 can be seen . this transceiver 502 or 504 is generally comprised of a serdes circuit ( which generally includes a serializer 602 and deserializer 608 ), an intermediate circuit ( which generally includes lane aggregation circuit 702 and lane de - aggregation circuit 704 ), a transmitter 606 , a receiver 612 , and an antenna 614 . the lane aggregation circuit 702 and lane de - aggregation circuit 704 are typically coupled to the transmitter 606 and receiver 612 via a high speed serial interface and coupled to the serdes circuit through a low speed parallel interface . this allows data to be communicated to and from the forwarding circuit 302 over serdes lanes . one important characteristic ( which was mentioned above ) is the spacing of the io circuits 304 - 1 to 304 - 6 and / or relay circuits 402 - 1 to 402 - 6 . this spacing is typically premised on the shape of the beam formed by antenna ( i . e ., antenna 614 ). turning to fig1 and 11 , examples of the radiation patterns for single antennas can be seen . as shown , these beams are fairly wide . this means that the distance d 1 may be on the order of 2 . 5 - inches or more , but , to achieve narrower spacing , a phased array can be employed . as shown in the example of fig1 , phased array transceivers 702 and 704 can be employed in io circuit 304 - c . these transceiver 702 and 704 are each generally comprised of a integrated circuit 706 and antenna package 708 . for example , ic 706 can be a terahertz or millimeter wave phased array system that includes multiple transceiver circuits . an example of such an ic can be seen in co - pending u . s . patent application ser . no . 12 / 878 , 484 , which is entitled “ terahertz phased array system ,” filed on sep . 9 , 2010 , and is hereby incorporated by reference for all purposes . this ic 706 is then secured to the antenna package 708 to allow each transceiver ( for example ) to communicate with a transceiver antenna included on the antenna package 708 . the antenna package 708 is then secured to the pcb 306 - a with solder balls 710 to allow the ic 706 to communicate with the forwarding circuit 302 through the antenna package 708 . alternatively , ic 706 and antenna package 708 can form relay circuit 402 so that other , alternative configurations ( such as relay card 203 ) can be formed . turning to fig1 , an example of the antenna package 708 can be seen in greater detail . as shown , the antenna package 708 includes a phased array 804 that is substantially surrounded by a high impedance surface ( his ) 802 . an example of such an his can be seen in u . s . patent application ser . no . 13 / 116 , 885 , which is entitled “ high impedance surface ,” was filed on may 26 , 2011 , and is hereby incorporated by reference for all purposes . also , as shown , the phased array 804 includes transceiver antennas 806 - 1 to 806 - 4 , but any number of antennas is possible that are arranged into the four quadrants or regions . this phased array 204 can then be used to steer the beam of radiation . examples of the radiation patterns formed the phased array 804 can be seen in fig1 - 19 . specifically , the radiation patterns of fig1 - 19 are for phased array 804 being 2 × 2 , 3 × 3 , and 4 × 4 arrays with 4 and 16 quadrature amplitude modulation ( qam ). as can be seen the lobes are significantly narrower . for the example 2 × 2 phased array using 4 - qam of fig1 , the main lobe is about 104 °, and , with an antenna area of 4 mm 2 , this would mean that the distance d 1 is about 2 . 55 - inches . for the example 2 × 2 phased array using 16 - qam of fig1 , the main lobe is about 124 °, and , with an antenna area of 4 mm 2 , this would mean that the distance d 1 is about 3 . 75 - inches . for the example 3 × 3 phased array using 4 - qam of fig1 , the main lobe is about 66 °, and , with an antenna area of 9 mm 2 , this would mean that the distance d 1 is about 1 . 3 - inches . for the example 3 × 3 phased array using 16 - qam of fig1 , the main lobe is about 76 °, and , with an antenna area of 9 mm 2 , this would mean that the distance d 1 is about 1 . 55 - inches . for the example 4 × 4 phased array using 4 - qam of fig1 , the main lobe is about 46 °, and , with an antenna area of 16 mm 2 , this would mean that the distance d 1 is about 0 . 85 - inches . for the example 4 × 4 phased array using 16 - qam of fig1 , the main lobe is about 54 °, and , with an antenna area of 16 mm 2 , this would mean that the distance d 1 is about 1 . 0 - inches . by employing phased arrays , not only can the spacing be narrowed , but redundancy can be built in as well . because of the configuration of router 200 , some redundancy is already present . for example , if line card 202 - 3 were to fail and the millimeter wave transmit and receive links with line cards 202 - 2 and 202 - 4 to line card 202 - 3 are unavailable , routing can be performed through the waveguide 204 . assuming this failure of line card 202 - 3 and a packet is intended to be routed from line card 202 - 1 to 202 - 4 , the packet could travel through the waveguide 204 to line card 202 - n and relayed up to line card 202 - 4 . however , with phased arrays , beam steering can be used as well to redirect links . turning to fig2 , a example of redundancy can be seen . in this example , io circuit 304 - a of line card 202 - a has failed , so the transmit and receive links between io circuit 304 - c and 304 - a are not functioning . because io circuit 304 - c includes a phased array , it can perform beam steering and can use reflections to the nearest io circuit ( which would be io circuit 304 - b ) using the shortest reflected path . in this example , the line cards 202 - a and 202 - b are separated from one another by distance d 2 ( which can , for example , be about 2 - inches ) and io circuit pairs 304 - a / 304 - c and 304 - b / 304 - d are separated from one another by distance d 1 ( which can , for example , be about 3 . 75 inches ). the io circuit 304 - c can steer the beam for its transmit link by an angle θ ( about 32 °, for example ) from the norm , meaning that the beam would reflect off of line card 202 - a at distance d 3 ( which , for example , can be 1 . 25 - inches ) and reflect off of line card 202 - b at distance 2 * d 3 ( which can , for example , be 2 . 5 - inches ) so as to be received by io circuit 304 - b . an encoding scheme ( such as orthogonal frequency - division multiplexing or odfm ) can the be used so that io circuit 304 - b can communicate with both 304 - c and 304 - d . having thus described the present invention by reference to certain of its preferred embodiments , it is noted that the embodiments disclosed are illustrative rather than limiting in nature and that a wide range of variations , modifications , changes , and substitutions are contemplated in the foregoing disclosure and , in some instances , some features of the present invention may be employed without a corresponding use of the other features . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the scope of the invention . | 8 |
fig1 is a block diagram of a first embodiment memory card 14 of the present invention . memory card 14 comprises an oscillator 1 , a counter 3 , a selection means 4 , a comparator 5 that outputs a refresh signal 6 , a refresh controller 7 , and a plurality of drams 102 . the memory card 14 has self - generated refresh capability . oscillator 1 provides basic timing at a frequency &# 34 ; f o &# 34 ;. a crystal oscillator set to 300 khz has been found to be satisfactory . ( highly accurate 300 khz crystals are inexpensive and widely available , they are used , for example in watches .) the counter 3 , selection means 4 , and comparator 5 are able to produce selectable digital output periods of 8 , 16 , 32 , and 64 milliseconds , using the oscillator 1 output as a reference . other selectable periods could be used , but these periods match the most common refresh periods of the popular dram chips currently available . refresh controller 7 comprises the circuits necessary to initiate a burst refresh of all the row addresses in drams 102 using cas - before - ras refresh cycles each 8 , 16 , 32 , or 64 milliseconds . drams 102 , for purposes of this discussion only , can be assumed to be 256k bit types organized as 64k by four bits . twelve such devices will easily form into a memory array of 192k by 16 . counter 3 , containing individual flip - flops 2 , together with selection means 4 , comparator 5 , and refresh controller 7 can , for example , all be integrated into a single asic chip that has an external crystal to support oscillator 1 and a number of external jumpers connected to option programming pins to support selection means 4 . address 100a can be input to card 14 as a straight unmultiplexed 24 bit address , or it can be multiplexed in an i / o bus fashion on databus 100f . a card enable signal 10 comprises , in an exemplary embodiment , a card enable , an output enable , a pair of card address signals , and a ready ( rdy ). read control 100b and write control 100c can be separate controls , as shown in fig1 or can be reduced to a signal write enable ( we ) used in conjunction with card enable ( ce ) and output enable ( oe ). refresh controller 7 must output cas and ras signals that follow normal ras - before - cas timing for data read / write and cas - before - ras timing to initiate each row refresh . if drams , such as type hm514256 are used , write enable ( we ) and output enable ( oe ) must also be output by controller 7 to drams 102 . addresses 100a are multiplexed by controller 7 onto the nine or more multiplexed addresses that must be input to drams 102 that represent the column and row addresses . for such dram types , there will be 512 rows that need to be periodically refreshed . the refresh of drams 102 can be done in either a single burst of 512 consecutive refresh cycles ( one cycle per row ) every 8 , 16 , 32 , or 64 milliseconds , or distributed over time ( e , g ., eight milliseconds over 512 rows = 15 . 6 microseconds per row ), or some combination of these two extremes . (&# 34 ; dram refresh modes ,&# 34 ; motorola semiconductor application note an987 , motorola memory data , rev . 6 , 1990 , p . 13 - 2 .) fig2 shows how the successive flip - flops 2 of counter 3 divide down the clock from oscillator 1 . if the clock was 300 khz to begin with , counter 3 must divide by 2400 to yield an output squarewave having a period of eight milliseconds . for a period of sixteen milliseconds , the division is 4800 , and for 32 and 64 milliseconds , the divisions are 9600 and 19 , 200 , respectively . as shown , the output &# 34 ; n &# 34 ; has a duty cycle of 50 %. refresh will occur only during the high level output . there will be 2400 ticks of the clock from oscillator 1 during this time , and a simple divide by four will provide 600 ticks per refresh burst period , or one tick every 13 . 3 microseconds . since 512 rows are contained in a typical dram 102 , then 600 will be more than enough cycles in a burst to guarantee that all rows are refreshed in an eight millisecond period . while the output &# 34 ; n &# 34 ; of counter 3 is high , signal 6 will be high , and memory card 14 will not be available for data read / writes since it is busy with refresh . by changing counter 3 , selection means 4 , and comparator 5 , a refresh signal 6 can be produced that has a duty cycle less that 50 %, and thus will make memory card 14 more available for data transfers . fig3 provides greater detail on the asic memory controller chip suggested above , it is referred to here as a second embodiment of the present invention . dram 102 is equivalent to that described in the previous embodiment , and therefore uses the same element numbering . address 21 and databus 23 can be separate , as shown in fig3 but i / o pins can be saved if , for example , a 24 - bit address were multiplexed in three bytes over the databus 23 and held in addressable latches controlled by control input 22 . control input 22 comprises rd , wr , and ce ( read , write , and card enable ). additional chip or card address lines and a decoder can alternatively be added to support multiplexing the address 21 onto the databus 23 . multiplexed nine - bit addresses ( typical ) are supplied to drams 102 by data transfer control generator 24 working in conjunction with address mux 25 . the addresses are timed to coincide with ras and cas and such coordination is conventional . the refresh status of the memory controller can be determined by the cpu by addressing register 32 and by then inspecting a bit corresponding to signal 36 . when register 32 is properly addressed , data mux 33 connects databus 23 to register 32 . the refresh of dram 102 is paced by oscillator 26 . control mux 28 will periodically shift front inputting normal ras - before - cas timed signals from data transfer control generator 24 to cas - before - ras timing from refresh control generator 27 . how often refresh cycles are injected is controlled by counter 29 , comparator 30 , and refresh period adjustment means 31 . the overall function and purpose is described above in conjunction with counter 3 , selection means 4 , and comparator 5 . a refresh selection signal 36 will switch control mux 28 every 8 , 16 , 32 , or 64 milliseconds , for a duration of 4 , 8 , 16 , or 32 milliseconds , respectively . other durations and periods are possible , and may be preferable , and will depend in part on the particular types of devices being used for drams 102 . fig4 shows how a cpu can determine with a read of register 32 the refresh status to see if data is available ( signal 36 low ). when the status is unknown , several register read cycles 51 are made until the status returns an indication that a data read / write cycle is available . as soon as that happens , a window of opportunity opens up that will last for a predeterminable time duration , and the cpu can read data in a burst without further checking the refresh status . at the end of the opportunity , the cpu has to begin looping on the register status bit to wait for the next refresh cycle to finish . register read cycles 51 are repeated until the fact that data is again available is indicated by register 32 . the dram 102 cycles that correspond to the above are shown aligned in time with the card accesses by the external cpu . refresh operation cycles 61 are shown in burst mode . preferably , refresh cycles 61 will just be equal in number to the number of rows in dram 102 and bursts will be spaced apart at near the maximum time allowed by the particular dram devices being used . alternatively , distributed , hidden , and write - with - cas - before - ras refresh timing can be used in the present invention . a third embodiment of the present invention is shown in fig5 and is configured as a memory card similar to the first and second embodiments described above and in fig3 . fig6 is a corresponding timing chart , and is similar to fig4 . fig5 differs from fig3 in that a delay module 38 has been added between comparator 30 and control mux 28 . the effect of data transfer enable 36 on mux 28 is skewed by delay 38 . so even if the contents returned by register 32 are positive , control 34 will not be switched off until after a delay that effectively stretches the data transfer period . immediately afterwards , refresh operations are executed automatically and the contents of register 32 will show the memory card to be ready for data transfers . fig7 is a block diagram of a fourth embodiment memory card . fig8 is a detailed block diagram of interface 71 ( fig7 ). dram 102 is equivalent to the above embodiments . an osc 70 has a quartz crystal and outputs a fixed period clock . an interface 71 controls dram 102 with address and control signals referenced to osc 70 and a master external to the memory card . a refresh requestor 71a divides the signal from osc 70 and periodically outputs a refresh signal ( ref ) to initiate a refresh cycle in corresponding dram 102 on memory card 72 . a decoder 7lb outputs a ras and a cas based on the address , card enable ( ce ) and data transfer signals ( wr , rd ) from outside the memory card . a dummy - cycle status indication 71c detects whether or not a rd signal together with a particular address signal from the external cpu are , in fact , indicating dummy - cycles ( defined as reads of reserved , special addresses ). a refresh inhibitor 71d disables the ras and cas output from decoder 7lb from reaching dram 102 when a dummy - cycle is detected . a refresh signal from refresh requestor 71a is based on dummy - cycle status indication signal detected by dummy - cycle detector 71c . an address generator 71e generates a memory address based on ref signal , ras and cas output , without being inhibited by refresh inhibitor 71d and address signal from external cpu . the outputs of address generator 71e float ( standby condition ) during dummy - cycles because they are not needed by dram 102 . in fig7 the external cpu outputs a dummy - cycle signal to interface 71 before accessing ( data transfer ) memory card 72 . so detector 71c of interface 71 detects the dummy - cycle signal and signals refresh inhibitor 71d . refresh requests from requestor 71a and ras and cas from decoder are disabled . the dummy - cycle causes address generator 71e to float its outputs . when ce signal 42 and either rd 100b or wr 100c are received from external cpu , interface 71 can do a data transfer with dram 102 after a fixed standby period has elapsed . otherwise , a refresh request from refresh generator and ras / cas from decoder 7lb are output . dram 102 is thereby refreshed . when ce signal 42 , address signal and rd 100b , or ce signal 42 , address signal and wr 100c from external cpu are input to interface 71 during refresh operation , then interface 71 gives precedence to refresh operation ; i . e ., any signal other than a dummy - cycle signal does not effect refresh operation . an external cpu outputs a dummy signal to the interface circuit 40 of the memory card 41 before accessing ( in a read or write data transfer operation ) the memory card 41 . the dummy detection circuit 71c of the interface circuit 40 detects the dummy signal and the detected signal is input to the refresh inhibit circuit 71d , which immediately begins inhibiting the refresh signal generated from the refresh generation circuit 71a together with the ras signal and cas signal from the ras , cas generation circuit . when the detection signal from the dummy detection circuit 71c is input to the address generation circuit 71e , the address signal from the address generation circuit 71e goes to a floating condition . the detection signal from the dummy detection circuit 71c is temporarily output to the refresh inhibit circuit 71d and address generation circuit 71e . when the ce signal 42 and rd signal 100b or wr signal 100c from the external cpu are input to the interface circuit 71 after a fixed period in the standby condition has elapsed , then the interface circuit 71 executes read - write operation of the dram 102 . when the ce signal 42 , address signal and rd signal 100b , or ce signal 42 , address signal and wr signal 100c from the external cpu are not input , then the refresh signal from the refresh generation circuit and the ras signal and cas signal from the ras , cas generation circuit 7lb are output to the dram 102 and the dram 102 is refreshed . when the ce signal 42 , address signal and rd signal 100b , or ce signal 42 , address signal and wr signal 100c from the external cpu are input to the interface circuit 71 during refresh operation , then the interface circuit 71 gives precedence to the refresh operation ; i . e ., any signal other than a dummy signal does not effect refresh operation . as described above , by means of the invention , an oscillation source is included in the memory card and refresh operation is preformed automatically , and therefore no refresh signals need to be received from outside the memory card . also , since the timing of the refresh signal need not be considered in the interface with main unit , when the memory card is used with the interface of a different unit , read - write operation is performed according to the read - write signal from the main unit while giving precedence to the refresh operation in the memory card , whereby a memory card with broad applicability is achieved . in addition , the read - write period and refresh period are separated in the memory card and posted externally , and therefore the memory card need only be accessed during the read - write period , thus eliminating access during the refresh period and shortening the access time of the memory card . also , since the memory card performs refresh operation by itself , a memory card with broad applicability to various models is achieved . further , by delaying the read - write period in the memory card so it extends into the refresh period , read - write operation can be performed during that delay time , thus increasing the utility of the memory card . the memory card is temporarily set to a standby mode by the input of a dummy signal from outside the memory card , and read - write operation from outside the memory card or refresh operation by the memory card itself is performed after the standby condition has elapsed , whereby refresh operation by the memory card itself and read - write operation from outside the memory card are prevented from conflicting and the memory card can be accessed with greater efficiency . while present invention has been described in conjunction with several specific embodiments , it is evident to those skilled in art that many further alternatives , modifications and variations will be apparent in light of forgoing description . thus , present invention described herein is intended to embrace all such alternatives , modifications , applications and variations that may fall within spirit and scope of appended claims . | 6 |
for the sake of clarity , the figures are not drawn to scale and the same elements are noted with the same references in the various drawings . as represented in fig3 and 4 , a device according to the invention comprises an airtight chamber 20 constituting a tunnel and ended by an input lock chamber 21 and an output lock chamber 22 , respectively . each lock chamber is closed by doors , 23 and 24 , 25 and 26 . a plate 1 , introduced through the lock chamber 21 , is conveyed toward the vacuum chamber 20 by a conveyor 27 . the conveyor 27 is preferably in alignment with a conveyor 28 in the upper portion of chamber 20 . at the output , a conveyor 29 of the lock chamber 22 is in alignment with the conveyor 28 of chamber 20 . the path of conveyor 28 in the vacuum chamber is linear and horizontal at least in a sputtering area . preferably , the path of conveyor 28 is linear and horizontal throughout chamber 20 from the input lock chamber 21 to the output lock chamber 22 . conveyors 27 , 28 , and 29 are , for example formed by two separated parallel strips , driven by rollers 30 . plates 1 are conveyed , with their surface to be coated facing downside , so as to rest by two edges on the conveyor strips . aerial conveyors can also be used . aerial conveyors are constituted by rails from which sledges are suspended , whose skates constitute supports for two edges of plates 1 . plates 1 could also be suspended to aerial conveyors by clips for gripping the plate edges . sputtering sources 31 are disposed in the lower part of chamber 20 . these sputtering sources are constituted by crucibles 11 containing the material to be sputtered and electron bombardment devices ( not shown ). sources 31 are preferably distributed in the processing area so that the whole surface of plate 1 is coated during its passage through chamber 20 . in other words , chamber 20 includes several sputtering sources 31 disposed perpendicularly with respect to the axis of the conveyor of plates 1 , each sputtering source 31 covering a determined portion of the width of chamber 20 . each sputtering source 31 is associated with a collimator limiting the beam of sputtered material emitted by the source . the collimator is disposed between the crucible 11 of the sputtering source and the surface to be coated of plate 1 . the collimators are , for example , constituted by a mask 32 disposed between the crucibles 11 and the surface to be coated of plate 1 . mask 32 is , for example , formed by a plate circularly apertured in front of each crucible 11 . the diameter of each aperture 33 of mask 32 depends upon the range of the desired incidence angles for the sputtering of material 10 , and upon the distance separating the crucibles from mask 32 . as represented in fig3 and 4 , the sputtering sources 31 are distributed along the vacuum chamber 20 . the sources could also be aligned along a direction perpendicular to the conveyor axis . however , care should be taken so that the areas , covered by the base of the sputtering cones on plate 1 and defined by apertures 33 , cover the whole width of plate 1 . also , care should be taken so that the base of the sputtering cones of the two sources 31 , having adjacent coating areas , suitably overlap each other in order to not impair the evenness of the deposition . thus , the invention achieves the sputtering of the material practically orthogonally to the surface to be coated while decreasing the distance separating plates 1 from the sputtering sources . this decrease in the distance is obtained by the increase in the number of sputtering sources associated with a same plate . this increased number of sources decreases the base surface of each sputtering cone and accordingly makes it possible to decrease the distance between the plates and the crucibles 11 . moreover , the distance between plates 1 and a determined number of crucibles 11 is determined as a function of the small size and no longer as a function of the large size of a rectangular plate . in addition , using a mask 32 apertured only in front of the crucibles 11 and whose apertures 33 are formed as a function of the size of the plates , prevents the material from scattering in the chamber 20 by limiting the sputtering directions to the useful directions . referring back to the example disclosed with relation to fig2 plate 1 can be placed at only approximately 13 centimeters from the five crucibles 11 whose sputtering cones have a base diameter of 4 centimeters . such sputtering cones can , for example , be obtained with a mask 32 having circular apertures 33 with a diameter of approximately 2 centimeters disposed at approximately 6 centimeters from crucibles 11 . since a determined plate 1 receives sputtered material provided by five crucibles 11 , each of which is assigned to a portion of the plate surface , the deposition speed increases by a ratio 5 with respect to the example of fig2 . fig5 illustrates another embodiment of a device according to the invention . in this embodiment , plates 1 are still linearly conveyed into chamber 20 by a conveyor 34 , but they are tilted according to a determined angle with respect to the horizontal plane . each sputtering source 31 is associated with a collimator 35 which defines a sputtering cone in a direction having an angle β with respect to the normal to the surface of the material 10 contained in crucible 11 . the cone defined by each collimator 35 is directed towards plate 1 . each collimator 35 is , for example , as previously formed by a plate comprising a circular aperture 33 defining the sputtering cone . preferably , each plate constituting a collimator 35 covers a crucible 11 with which it is associated to prevent the material from unduly scattering in chamber 20 . the sputtering sources 31 are still distributed perpendicularly to the conveyor direction , but also at different heights so that the distance between plate 1 and each crucible 11 is constant . for the sake of clarity , only one sputtering source 31 is represented in fig5 . in practice , several sources should be provided so that each sputtering cone corresponds to a strip of plate 1 , making it possible , as previously , to dispose the plates at a short distance from crucibles 11 . preferably , when the plates 1 are tilted , an aerial conveyor is used . the conveyor 34 is , for example , constituted by beams 37 suspended to two parallel rails 38 through conveyor rollers 39 . plates 1 are suspended to the beams by supporting grips 40 . such an embodiment avoids material eruptions , which may occur mainly along the normal to the surface of the material contained in the crucible , to reach the plates , which would render them inoperative . as is apparent to those skilled in the art , various modifications can be made to the above disclosed preferred embodiments . more particularly , each of the described devices can be replaced with one or more elements fulfilling the same functions . for example , the conveyors could be formed by any appropriate means provided that they linearly convey the plates in a horizontal direction and that the downside surface of the plates is accessible . in addition , the selection of the respective sizes of the apertures of the collimators and of the distance between the collimators and the sputtering sources depends upon the desired incidence angle for the sputtered material , the size of the plates to process , and the distance between the plates and the sputtering sources . | 7 |
referring now to the drawings , fig1 is a schematic diagram of a microphone comprising a housing 10 in which an audio transducer ( e . g . a microphone insert ) 20 and a one - bit digital signal processor 30 are disposed . a transmission line such as a coaxial cable 40 carries signals from ( and , in some embodiments , to ) the signal processor 30 . fig2 to 4 are more detailed schematic diagrams of respective embodiments of the microphone connected to an input stage 50 of a digital signal processing apparatus 60 . in fig2 to 4 , the following reference numerals are used to denote similar , though not identical , parts : [ 0022 ] 30 , 30 ′, 30 ″ digital signal processor within the microphone housing the digital signal processing apparatus 60 could be , for example , an audio mixing console or effects unit operable to process one - bit digital audio signals . starting therefore with fig2 the signal processing apparatus 60 includes a clock generator 110 which generates a clocking signal to which the one - bit digital audio signal from the microphone is to be synchronised . the clock generator supplies the clock signal to the input stage 50 and also , via the coaxial cable 40 ( but in a “ reverse ” direction ), to a clock recovery and power supply unit 120 within the signal processor 30 of the microphone . the clock recovery and power supply unit 120 generates two output signals : one is a straightforward clocking signal supplied to a one - bit analogue - to - digital converter ( adc ) 130 , and the other is a power output which supplies operating power to the one - bit adc 130 , a line driver 140 and ( if necessary ) the audio transducer 20 . the power supply is derived from the clocking signal carried by the coaxial cable 40 by rectifying and smoothing the clocking signal . this avoids the need for a conventional “ phantom power ” arrangement , although conventional phantom power could be used instead if desired . in operation , therefore , the audio transducer 20 generates an analogue - audio output signal dependant on sound levels in the vicinity of the audio transducer 20 . the one - bit adc 130 converts the analogue signal into a one - bit digital signal in accordance with the clock supplied from the clock recovery and power supply unit 120 . the line driver 140 then amplifies the output of the one - bit adc 130 to a suitable level for transmission via the coaxial cable 40 . at the digital signal processing apparatus 60 , the input stage ( synchronised by the clock generator 110 ) terminates the coaxial cable 40 and “ cleans up ” the waveform of the digital signal transmitted via the coaxial cable 140 by using a thresholder ( e . g . a schmidt trigger ) to detect whether the signal on the coaxial cable 40 is above or below a threshold signal level , thereby generating a “ clean ” digital output for subsequent processing . a second embodiment is illustrated in fig3 where the digital signal processing 30 ′ includes a clock generator 210 which supplies a clocking signal to the one - bit adc 130 as before . also , as in fig2 the line driver 140 amplifies the output of the one - bit adc 130 to a suitable level for transmission along the coaxial cable 40 . in fig3 the clock generator 210 , the one - bit adc 130 , the line driver 140 and ( if necessary ) the audio transducer 20 are powered either by batteries or by conventional phantom powering . at the recipient digital signal processing apparatus 60 , the signal on the coaxial cable 40 is passed to a clock recovery unit 220 which recovers the clocking rate of the one - bit digital signal by synchronising a phase - locked - loop to the bit rate of the one - bit signal . the input stage 50 ′ is synchronised by the output of the clock recovery unit 220 . a further synchronising stage may be required if the one - bit signal from the microphone is to be processed along with one - bit signals synchronised to other clocking sources ( e . g . from other microphones ). [ 0035 ] fig4 illustrates a third embodiment which addresses three potential problems with the embodiment of fig3 . these problems are ( i ) it not always easy to recover a clocking signal from a one - bit digital audio signal ; ( ii ) since a low - pass filtered version of a one - bit digital audio signal can be considered as a representation of the analogue audio signal , there is the danger that the relatively high signal levels output from the line driver 140 will be fed back ( e . g . by induction ) to the relatively low signal level input of the one - bit adc 130 , leading to possible feedback problems potentially causing non - linear distortion ; and ( iii ) if the microphone is unplugged or powered down , the thresholder in the input stage 50 could output a continuous sequence of the same bit value ( e . g . zero )— which represents a very large signal level indeed in the one - bit digital domain . these potential problems are addressed in the embodiment of fig4 by incorporating a status scrambler 310 in the microphone and a corresponding de - scrambler 320 at the recipient digital signal processing apparatus . the scrambler 310 and de - scrambler 320 will be described in detail below with reference to fig5 but , briefly , their purpose is to ensure that the data transmitted along the coaxial cable 40 is relatively de - correlated from the audio signal supplied to the one - bit adc 130 . this can reduce the problems of feedback between the output of the line driver 130 and the input to the one - bit adc 130 . also , the digital content of the data signal can be changed so that it is easier for the clock recovery circuit 220 to recover a clocking signal from the scrambled signal . [ 0039 ] fig5 a schematically illustrates one embodiment of the scrambler 310 , and fig5 b schematically illustrates one embodiment of the complementary descrambler 320 . in fig5 a , the signal to be scrambled is supplied as one input to a two - input exclusive - or gate 500 . the output of the exclusive - or gate 500 is fed through a series of n one - bit delays 510 — where n could be , for example , between 8 and 16 . the output of the final delay of the chain forms the scrambled data output and is also fed back to provide the second input to the exclusive - or gate 500 . similarly , in fig5 b , the input data to be descrambled is supplied in parallel to the first of a chain of m one - bit delays ( where m is the same as the value of n in fig5 a ) and to one input of a two - input exclusive - or gate 530 . the other input of the exclusive - or gate 530 receives the output of the chain of delays 520 . the output of the exclusive - or gate 530 forms the descrambled data . although illustrative embodiments of the invention have been described in detail herein with reference to the accompanying drawings , it is to be understood that the invention is not limited to those precise embodiments , and that various changes and modifications can be effected therein by one skilled in the art without departing from the scope and spirit of the invention as defined by the appended claims . | 7 |
fig1 is a perspective view of an example of a music production system 10 with a user 12 holding a music module 14 connected to a computer 16 , and user 12 wearing a headset 18 including a microphone 20 and earphones 22 . user 12 is shown singing into microphone 20 and computer 16 is displaying a scene 23 with virtual band characters selected by the user . in this example , the virtual characters are playing instruments and accompanying user 12 as the user sings . audiovisual content such as scene 23 may be developed and displayed subsequent to the user recording the singing instead of simultaneously . fig2 is a block diagram of one example of components and configurations that may be used in music production system 10 . system 10 is shown with music module 14 , computer 16 and headset 18 , which headset includes microphone 20 and earphones 22 . computer 16 may include a processor 24 , input / output ( io ) 26 , memory 28 , a display 30 and digital signal processor ( dsp ) 32 . module 14 is operably connected to headset 18 . music module 14 is operably connected to computer 16 through io 26 . dsp 32 and memory 28 may instead or additionally be included in music module 14 . system 10 may create multiple versions of an input tune as tracks that play simultaneously or independently . in this example , music module 14 is a computer interface device with control inputs related to recording music , composing music , editing recorded music , and adding music effects and accompaniment . the music module may be connected to computer 16 or may be used in a standalone mode to record and play music . computer 16 may include software associated with music module 14 that provides user interfaces for recording and editing the music of user 12 . headset 18 with microphone 20 and earphone 22 connects to module 14 by cable or by a wireless connection . module 14 may be connected to io 26 of the computer by a usb cable or other wired or wireless connection . in some examples , module 14 may be used for substantially all the input and navigation functions for music and audiovisual production . correspondingly , io 26 may be a wireless interface or a wired interface . for example , io 26 may incorporate a wireless 802 . x connection , an infrared connection or another kind of wireless connection . computer 16 may be a laptop , a notebook , a personal data assistant , personal computer or other kind of processor based device . fig3 is a top view of music module 14 showing one configuration of inputs . music module 14 is shaped to resemble a guitar body . module 14 could be shaped to resemble other musical instruments such as a violin or a piano or have any other desired shape . fig3 shows a joystick 34 , a pad a 36 with 4 buttons , a pad b 38 with 5 buttons , a pad c 40 with 4 keys and a string input 42 . inputs may correlate to user interface objects displayed on computer 16 . joystick 34 and pad a 36 may control the movement of a cursor on the computer display and user interface . inputs of pad b 38 may be used to exit a user interface , control volume , select items and turn recording on and off . pad c 40 may access special effects or be used to select an instrument such as drums . the keys of pad c 40 may activate files for a kick drum , a first snare drum , a second snare drum , and a cymbal or other audio device . each input of music module 14 may have multiple uses and functions . one input may select specific functions of other inputs . inputs may include a select key , edit and undo keys , a pitch bend / distortion joystick , a volume control , controls for record , pause , play , next , previous and stop , drum kit keys , and sequencer keys . this configuration is an example and should not be construed as a limitation . other configurations of inputs and music modules may be used and fall within the scope of this specification . music production system 10 with music module 14 in a first recording and / or production mode records an acoustical signal musical input from a user . system 10 may process the recorded input signal to correct qualities such as pitch and tempo and may add special effects and accompaniment . system 10 may correct the pitch in real time and reproduce the signal so that even if a singer may be singing off key , the signal output is an on - key music signal from music system 10 . optionally , in a second mode , production system 10 may generate visual effects to accompany the composed music . system 10 may provide images of characters playing the accompanying music , a character representing the user , a band manager and / or a producer . using module 14 , user 12 may select and design a production and performance venue associated with the recorded music . system 10 may present the characters in a scene such as musicians playing the user &# 39 ; s music on stage in front of an audience . in the first composing mode , user 12 may input an acoustic music signal at microphone 20 . typically , user 12 hums or sings , but user 12 may play an instrument into microphone 20 . user 12 may input music to music module 14 through a connection to another music device . for clarity , only singing into a microphone will be described for musical input in the following examples . this is an example and should not be construed as a limitation . in this example , microphone 20 converts the acoustic signal to an analog electronic signal . the analog signal goes to a digital signal processor ( dsp ) 32 in module 14 or computer 16 . this signal is then sampled and digitized into a time series of values that represents the original acoustic signal . dsp 32 may be an ic configured to modify a digital signal or dsp 32 functionality may be implemented as a software application . dsp 32 , at least in part , and as described further below , functions to shift the tone or pitch of the digitized signal to correlate to the nearest reference frequency in a library of frequencies in memory 28 . dsp 32 further determines the start and end of a frequency and determines a note value to record music notation for the input tune . computer 16 or music module 14 records the corrected singing in memory 28 as an original corrected track . dsp 32 may convert the signal back to an analog signal and output the corrected singing track to earphones 22 or another acoustic signal generating device such as an amplifier and speakers . computer 16 and / or music module 14 may also record the original uncorrected input signal as a separate track . corrected signal , corrected music , corrected music track , or any variations of these terms , for the purposes of this disclosure mean recorded digital music that has been constructively altered in tone , tempo , pitch and / or other quality by system 10 . uncorrected signal , uncorrected music or uncorrected track , or any variation of these terms , for the purpose of this disclosure means recorded analog or digital music which has not been constructively altered in tone , pitch , tempo and / or other quality before being recorded by system 10 . computer 16 may include a software application that provides functionality and user interfaces to further compose , produce and develop the recorded and corrected music . user 12 may use music module 14 to navigate in the user interface of the music production software . user 12 may use inputs on module 14 to select editing or functions in production mode at a user interface displayed on computer 16 . the options , tools and functions available at the user interface may include pitch , distortion , cut and paste , volume settings , play , pause , fast forward , rewind , restart from beginning , etc . user 12 with module 14 may also include special effects for their recorded and corrected music such as reverb , echo , vibrato , tremolo , delay or 3d audio . the user may create additional tracks to play simultaneously with the original corrected music track . the user may create a harmony or accompanying voice track to accompany their corrected music track . system 10 may use the original corrected music track as the harmony by recording it as a second track with the frequency or pitch of the first track shifted . the harmony track is played simultaneously with the original corrected music track and may sound like a second person singing . user 12 may create one or more instrument tracks from a list of available instruments stored in memory 28 to accompany the first corrected music track . the list of instrument assets to choose from may include percussion , reed , strings , brass , synthesized and voice . the key of the instrument music tracks may be adjusted for accompanying instruments so that the output most closely matches the physical capabilities of the selected instrument . thus , a set of notes in a key appropriate for a flute would be selected , or those appropriate for a trumpet while playing the corrected music . the goal is to make the output sound with accompanying instruments realistic , without requiring manual input from the user . fig4 shows a flow chart for music production system 10 process 100 with process steps in the music recording mode . at step 110 , audio input is captured from the microphone . microphone 20 converts an acoustic signal to an analog electrical signal . the input signal must be digitized with a sample rate high enough to reproduce the music with adequate quality . for example , the audio signal may be captured at 25600 hz . every 4th sample may be used to build the analysis buffer which is equivalent to 128 samples every 20 milliseconds . this down - sampled buffer is then filtered using a 4 th order “ butterworth ” bandpass filter to remove frequencies below 50 hz and above 1000 hz . this output is saved in an analysis buffer and direct - monitor buffer . sampling the input analog signal may include measuring and recording amplitude values of the signal at a predetermined rate to produce a time series of values of the analog signal . a frame or buffer consists of a group of values of the digitized input signal over a defined time span . a defined time span might be 20 milliseconds . the digitized values shift through the frame as they are digitized . typically , each set of values defined by the frame are analyzed as described below . a single note may be composed of a hundred frames . a pitch detector at 112 takes the analysis buffer from the input and determines the fundamental frequency of the signal values in the buffer . the system may use an on the fly pitch estimation algorithm derived from the signal represented as a 2 dimensional time delay . the algorithm may use an autocorrelation or difference function . the algorithm compares time sequenced values in the buffer to a time delayed set of the same values to find repeated waveforms and signal frequencies . the time delays correspond to frequencies . the output from this stage is a fundamental frequency value for the frame . a note conditioner at 114 uses both the detected fundamental frequency from the pitch detector , and the analysis buffer from audio input step 110 to determine when notes begin and end . there are two parallel methods employed for this task . the first method is an input amplitude analysis . since no note can exist if the input is silent , the amplitude of the input establishes an absolute baseline for note on and off determination . if the amplitude of the analysis buffer is over a certain threshold and no note is currently playing , a new note is started . if the amplitude of the analysis buffer drops below a certain threshold , any currently playing note is ended . it is also important to detect steep rises and falls in the amplitude , independent of the overall volume . to do this , the note conditioner compares the amplitude of the current analysis buffer to the average amplitude of the previous six analysis buffers . this comparison generates a type of signal derivative . if this derivative is below a certain threshold , any currently playing note is ended . this first method may not be effective in all cases . where the amplitude rises more gradually , this method may miss the change to a new note . to account for this , the note conditioner additionally uses a second method of lookback frequency analysis . the note conditioner in part translates a complex input such as singing into a format that can be reproduced on a much more limited instrument . lookback frequency analysis specifically attempts to detect smooth changes in pitch where no obvious amplitude changes occur and translate this into individual , fixed - pitch note events . to do this , the note conditioner compares the current analysis buffer &# 39 ; s detected frequency with the detected frequency of the analysis buffer four frames previous . if these two detected pitches are separated by more than two and less than seven semitones , the currently playing note is ended and a new note is started . the output from this stage is a set of data for each frame , which contains whether a note is currently playing , whether a new note was just started or ended , the detected frequency of the current note and whether the detected frequency is valid . a composer at 116 determines specific notes being sung from a group of frames representing the note . a note defines not only the frequency , but the duration of the played frequency . a single note may be characterized by a hundred frames with a different fundamental frequency for each frame . the composer also determines which single frequency among a group of frequency values that occur during a note best represents the entire note . from the set of frame fundamental values representing a note , the composer determines one current note pitch value by using a “ consensus ” technique described below . the composer sends the note value directly to an instrument synthesizer . an instrument synthesizer of step 118 takes the note events generated by the composer and synthesizes the audio output from various instruments . it is designed around the “ soundfont ” instrument specification , which defines wav buffers mapped to keyboard zones . notes lying within a zone apply simple pitch - shifting to play the associated wav file back at the correct frequency . the instrument synthesizer functions as a well - defined implementation of a soundfont player . the output from this stage is an audio buffer containing the synthesized waveform . the instrument synthesizer waveform output may include the singer &# 39 ; s voice w / corrected tone and / or pitch . an input monitor of step 120 addresses the issues of latency and lack of reliable pitch during the beginning of a new note . 20 milliseconds buffers of audio input are collected and analyzed to detect fundamental frequencies at the pitch detector of step 112 . this means that any detected frequency is available for re - synthesis through the instrument synthesizer 20 milliseconds after the user inputs their voice . the human voice exhibits unusual harmonic content and extra noise when it begins to vocalize . this may further aggravate the delay of the pitch detection stage in determining an accurate frequency at the very beginning of a new note . this can be considered the “ latency ” of the system and will be at least 20 milliseconds due to thread blocking issues and the difficulty of detecting initial pitches . this greater than 20 milliseconds latency is annoying and noticeable to anyone singing into the microphone and causes a confusing delay to the output . to mitigate this , the input monitor stage mixes the input waveform from the direct - monitor buffer ( which is available every 10 milliseconds from the audio input stage ) with the instrument synthesizer &# 39 ; s output buffer . when the input monitor detects that the note conditioner has begun producing valid pitches , it lowers the volume on the direct - monitor input and raises the proportion of the output signal coming from the instrument synthesizer . the direct monitor input is a leadin and the following instrument synthesizer signal is corrected musical content . in this way , the user will very briefly hear their own voice at the start of a note . when the pitch detection system begins producing reliable values for the output , their voice is quickly muted . this technique reduces the apparent latency in the output . the output from this stage is the audio buffer containing the synthesized waveform mixed with the direct - monitor buffer . an audio effects of step 122 applies audio buffer level effects such as echo , distortion , and chorus to the output audio buffer received from the instrument synthesizer . the output from this stage is an audio buffer containing the effected output . at step 124 , an audio output takes the final buffer from the audio effects stage and presents it to the computer &# 39 ; s sound card to be played through speakers or to earphones 22 . these are examples of steps that may be used in implementing a production music system . the steps used here are for the purpose of describing one example of a system and should not be considered a limitation . a production music system may have more or fewer steps or different steps and fall within the scope of this disclosure . returning to step 112 of fig4 , pitch detection may use a difference equation derived from a two dimensional analysis of an autocorrelation function . autocorrelation is often used for finding a repeated pattern in a signal . autocorrelation determines over what time period a signal repeats itself and therefore the frequency of the signal . the related difference function provides the aperiodicity of a digitized signal across a range of time delays . by taking the minimums of the aperiodicity of a signal , the frequencies in the signals are identified . a difference function used to identify fundamental frequencies is : d ′ ( τ ) = ∑ 1 w - τ ( x j - x j + τ ) 2 2 ∑ 1 w - τ ( x j 2 - x j + τ 2 ) as described by saurabh sood & amp ; ashok krishnamurthy in “ a robust on - the - fly pitch ( otfp ) estimation algorithm ” previously incorporated by reference . this equation provides a plurality of frequencies from the values in a buffer or frame of data of the digitized signal . fig5 is a graph 160 showing the results of applying the difference function to a frame of data . the vertical axis is aperiodicity and the horizontal axis is time or time delay which correlates to a frequency or wavelength . a fundamental frequency of the signal occurs when aperiodicity is minimized . this occurs at time values where the difference function is a minimum at points as noted at 162 a , 162 b , 162 c and 162 d . system 10 may define the number of minima from each buffer to be analyzed . the fundamental frequency is determined from the set of minima using amplitude and threshold values . there are two cases where frequency selection may fail , where successive minima values differ only by an insignificant amount and where successive minima differ by a significant amount . this is accounted for by two step thresholding . in the first step of the process , the amplitude threshold is small and the temporal threshold is large . example values for the temporal threshold may be 0 . 2 and for the amplitude may be 0 . 07 . this accounts for small differences in amplitude . in the second step of the process , the amplitude threshold is large and the temporal threshold is small . example values for the temporal threshold may be 0 . 05 and for the amplitude threshold may be 0 . 2 . this accounts for large differences in amplitude . fig6 is a flow diagram for the pitch detector of fig4 at step 112 , with an on the fly pitch estimation algorithm 200 using a difference function . at step 202 frame data is acquired for analysis . at step 204 the difference equation is applied to the frame data resulting in an aperiodicity / time plot similar to fig5 . at 206 a set of minima are identified from the data . at 208 the amplitude of the minima are adjusted by parabolic interpolation to compensate for quantization and sampling effects . the minimum threshold value is identified as t g . at 210 small amplitude and large temporal thresholds ( at & lt ;& lt ; tt ) are set . at 212 the temporal threshold test identifies minima values which satisfy the equation : n - t g t i & lt ; temporal threshold 1 at 214 the candidates satisfying this equation are compared to the amplitude threshold . each minima is compared to the amplitude threshold and if smaller , the value replaces t g . the process is repeated with large amplitude and small temporal thresholds set at 216 . ( at & gt ;& gt ; tt ). among all the candidates using the first temporal threshold value , minima values are identified at 218 that satisfy : n - t g t i & lt ; temporal threshold 2 candidates satisfying this equation are then compared to the new amplitude threshold at 220 . if smaller , the t g is replaced with the new value . this time delay value defines the fundamental frequency for the frame . these are examples of steps that may be used in implementing a production music system . the steps used here are for the purpose of describing the system and should not be considered a limitation . a production music system may have more or fewer steps or different steps and fall within the scope of this disclosure . fig7 is a diagram 300 describing the consensus technique of composer step 116 of fig4 used to determine a fundamental frequency from the frame frequencies defined at pitch detector step 112 . a set of frequencies for a single note may occur due to vibrato , harmonics or wavering of the singing voice during a note . consensus uses a range which is a frequency span of a set size . the range including the most points represents the strongest “ consensus ” of values . consensus determines the fewest number of ranges of a set size to cover all frequency values for the note . diagram 300 shows fifteen frequencies on a frequency axis that are between 430 and 450 hertz . the legend shows a range 302 that spans a frequency of 3 hertz with a center value 304 . a frequency value 306 is shown that falls in the range 302 . using consensus , the center of the range encompassing the most values , or the highest consensus , is the most accurate note frequency . this technique determines which frequencies during a note are the most likely to have been the note the user was actually singing . in this example , range 308 with five frequencies and a center value of 439 . 7 determines the primary or fundamental frequency and defines the played note . a specific frequency is a characteristic of every note and a frequency may correspond to a note . a reference frequency closest to the determined frequency may be sent to instrument synthesizer 118 . the reference frequency may be a note frequency of the 12 - tone chromatic scale such as in this example , 440 hertz or the note a 4 . the frequency may be fixed to lie on the notes of the c major scale . the frequency may be selected to lie on the notes of the c minor scale . the frequency may be selected within certain octave ranges . the composer sends the selected notes to the instrument synthesizer to be played . the hertz frequency value may be referenced to a midi note index between 0 and 127 . this note index is then “ rounded ” up or down to the nearest legal note for the selected scale or instrument . from there , it is converted back into a hertz frequency value to be sent to the instrument synthesizer . the output from this stage is a determination of whether the note is on or off and updated frequency . in addition to creating the music , the user may want to create a visual representation to accompany the music tracks while playing . in the second animation mode , the user develops virtual animate characters and scenes with music module 14 and an animation user interface on computer 16 . the user interface may provide a menu of virtual characters that can be part of the band and production crew used in playing and producing the music . the user may create their own band with a manager , a producer , a tour bus and stage effects . the software may use beat matching functions to synchronize movements of the animated band members with the user generated composition as it plays . for example , the tracks of a user generated composition typically have a beat or tempo value set by music system 10 . the virtual band member characters may be programmed with a set of repetitive movements such as strumming a guitar or beating on drums . the character movement repetition rate may be set by music system 10 to equal the beat or tempo of the music the characters to play . this may extend to dance movements by the virtual characters . with the animation user interface , user 12 is able to swap out instruments , load saved productions , switch out characters or character dress , control simple functions ( volume , play , pause , fast forward , rewind , restart from beginning ) and re - skin the stage . user 12 may save completed animation productions in different selectable formats that can be played on most dvd players . the first and second operating modes of system 10 may operate simultaneously . in the animation mode , the selected characters may interact with the user and follow a script related to composition or production functions . a virtual producer character may be configured to guide the user in developing and adding tracks to the original corrected music track . the producer may interact with the user by asking questions and making suggestions on adding tracks or other production . the virtual manager character may be programmed to guide the user in developing a band , choosing band members , choosing venues or other options available in the second animation mode . characters may react appropriately to the user &# 39 ; s actions and inputs . for example , the producer may fall asleep in his chair if there is no user input for a fixed period of time . if the user plays music at full volume , the producer may jump up and his hair may stick out . it is believed that this disclosure encompasses multiple distinct inventions with independent utility . while each of these inventions has been described in its best mode , numerous variations are contemplated . all novel and non - obvious combinations and subcombinations of the described and / or illustrated elements , features , functions , and properties should be recognized as being included within the scope of this disclosure . applicant reserves the right to claim one or more of the inventions in any application related to this disclosure . where the disclosure or claims recite “ a ,” “ a first ,” or “ another ” element , or the equivalent thereof , they should be interpreted to include one or more such elements , neither requiring nor excluding two or more such elements . | 0 |
the term &# 34 ; hot melt &# 34 ; as used herein should be understood to mean any solid , thermoplastic or thermosetting adhesive which melts upon application of heat and then sets to a firm bond on cooling . besides providing a sufficiently strong bond between the printing blanket and the holding bar , the adhesive layer therebetween can be remelted , if desired , after the use of the printing blanket , for example , to allow removal of the holding bar in reusable form . with reference to fig1 of the drawing , a typical holding bar in accordance with the invention is shown . the holding bar is typically in the form of a channel - like member having a bight 3 and a pair of legs 1 and 2 diverging outwardly from opposite ends of the bight . the holding bar is adapted to be deformed so that the legs 1 and 2 are arranged substantially parallel as illustrated in fig1 . for the preparation of the holding bar and printing blanket by the method of this invention , a strip of hot melt adhesive is applied to part of at least the top surface of the printing blanket 6 . the adhesive 7 is preferably applied to the printing blanket 6 by unrolling a supply 8 and placing it along the edge of the bottom surface of the blanket 6 . thus , one embodiment of the invention includes a supply 8 and scissors apparatus 9 for cutting the strip for easy application to the printing blanket 6 as shown in fig2 . after the adhesive strip 7 has been applied on the printing blanket 6 , the printing blanket 6 is placed in between legs 1 and 2 of holding bar 4 . the legs of the holding bar 4 are moved apart in the area 5 where leg 1 adjoins bight 3 as shown in fig3 . this allows the edge of the printing blanket 6 to be positioned closely adjacent to bight 3 and preferably against the inside surface of such bight . the holding bar 4 can be slipped onto the printing blanket 6 immediately after , or concurrently with , the travel of the adhesive strip 7 rolled down the edge of the printing blanket 6 . the holding bar 4 and the printing blanket 6 are then fitted on the lower plane 10 of the heating station ( limit switch ) and the top plane 11 of the heating station is fitted over the top end of the holding bar as shown in fig3 . this station applies both heat and pressure to the assembly pressure is applied by lowering the upper plane 11 until the necessary force is applied to close the holding bar 4 at the required thickness as shown in fig4 . the holding bar 4 is then maintained in this position as long as the heat coming from the upper plane 11 is transmitted to the holding bar 4 . the heat is applied to melt the adhesive strip so that it can adhere to each component . generally , a temperature of about 180 ° c . is sufficient to do this . the preferred adhesive strips are those which are hot melt adhesives of a thermosetting or thermoplastic nature , such as nylons or polyurethanes . other hot melt adhesives are known to those skilled in the art and can also be used . at room temperature , these adhesives are solid and can be formed into desired shapes . for this invention , it is preferably to utilize flat strips of adhesive which have a uniform thickness and a width which corresponds to width of the legs of the holding bar . this enables a substantially uniform thickness of adhesive to be applied in the appropriate locations in a simple and straightforward manner , thus highly simplifying the manufacturing process compared to the use of liquid or semi - solid adhesives . moreover , the application of a substantially uniform thickness of the adhesive enables increased bond strengths to be obtained between the holding bar 4 and the blanket 6 . since the adhesive is a solid at room temperature , it is easy to handle and accurately place on the blanket . it also facilitates placement in the holding bar without initially sticking to the legs of the bar or otherwise being displaced inadvertently . the closing of the legs of the holding bar onto the adhesive strip and blanket also retain the position of the adhesive without squeezing or extruding it into undesired locations . thereafter , the heat which is applied causes the adhesive strip to melt and adhere to the bar and blanket at a substantially uniform thickness for maximum bond strength . also , the connection can be made easily and quickly , so that the blanket can be used minutes after being made , rather than in 24 hours when liquid adhesives are used . finally , referring to fig5 the upper plane 11 is lifted and the now barred blanket is taken off and forced to cool in a cooling station 20 and 21 which solidifies the adhesive 7 and provides a firm bond between the bar and the blanket . after cooling of holding bar 4 and printing blanket 6 , the bar and the blanket are able to bear the necessary mechanical stresses due to tensioning in the cylinder , and can be immediately used . the holding bar or similar bar may be made of any suitable material . preferably the holding bar is made of an easily deformable , heat conductive , non - ferrous metallic material such as aluminum . further , it will be appreciated that the holding bar may be of any suitable construction and reference is made to u . s . pat . no . 3 , 883 , 940 , for example , for a disclosure of holding bars of other materials and designs . as has been mentioned in connection with the method of this invention , the printing blanket and / or the holding bar can be heated and provided with a hot melt adhesive in various ways other than those adopted in the embodiments of fig3 - 5 . the applications and heating method of fig3 - 5 is preferred , however , because of the quickness of assembly , the ease with which the printing blanket is heated and coated , the constancy of the bar temperature , and the uniformity of the thickness of the resultant adhesive layer . furthermore , the fitting of the holding bar over the printing blanket immediately after the application of the adhesive strip onto the latter , as in this embodiment , contributes to the uniformity of the thickness of the adhesive to thus provide a firmer union therebetween . while present exemplary embodiments of this invention , and methods of practicing the same , have been illustrated and described , it will be recognized that this invention may be otherwise variously embodied and practiced within the spirit and scope of the following claims . | 1 |
fig1 shows a harvesting machine in the form of a self - propelled forage harvester 10 . the forage harvester 10 is supported on a frame 12 that is carried by front driven wheels 14 and rear steerable wheels 16 . the forage harvester 10 is controlled from an operator &# 39 ; s cab 18 from which a harvested crop take - up arrangement 20 can be viewed and controlled . crop taken up from the ground by means of the harvested crop take - up arrangement 20 , for example , grass or the like , is conducted , over supply rolls , not shown , arranged within an intake housing on the front side of the forage harvester 10 , to a chopper drum 22 that chops it into small pieces and delivers it to a conveyor arrangement 24 . the crop leaves the forage harvester 10 to an accompanying trailer over a discharge duct 26 that can be pivoted about an approximately vertical axis and repositioned in its inclination . a post - chopper reduction arrangement 28 extends between the chopper drum 22 and the conveyor arrangement 24 , through which the crop to be conveyed is conducted tangentially to the conveyor arrangement 24 . in this embodiment the harvested crop take - up arrangement 20 is configured as a so - called pick - up . the harvested crop take - up arrangement 20 is supported on the ground by a stand 32 and is carried by support wheels 38 on each side , fastened to the stand 32 over a carrier 46 . the task of the harvested crop take - up arrangement 20 consists of taking up harvested crop from the ground on a field , deposited in a swath 48 , and to conduct it to the forage harvester 10 for further processing . for this purpose , the harvested crop take - up arrangement 20 is moved across the field during the harvesting operation at a small spacing to the ground , while it is raised for transport on public roads or on paths . the harvested crop take - up arrangement 20 includes a conveyor arrangement 36 in the form of a screw conveyor that conveys the crop taken up from the sides of the harvested crop take - up arrangement 20 to an outlet opening , not shown , that is followed to the rear by the supply rolls . the harvested crop take - up arrangement 20 is provided with a take - up device 34 , driven in rotation , arranged underneath the conveyor arrangement 36 , which raises the crop from the ground by means of its conveying tines and delivers it to the conveyor arrangement 36 . moreover a hold down 40 is fastened to the carrier 46 and is in the form of a sheet metal component arranged above the take - up device 34 . the forage harvester 10 is equipped with a camera 42 on the upper side of the operator &# 39 ; s cab 18 extending in the direction of operation . the lens of the camera 42 is aimed to the front and inclined downward at the swath 48 . the camera 42 is located on the longitudinal center line of the forage harvester 10 . together with an electronic control arrangement , the camera 42 forms an automatic steering system , that shall be described in greater detail below , that guides the forage harvester 10 automatically along the swath 48 , in order to simplify the work of the operator in the operator &# 39 ; s cab 18 . at first , however , another possible application of the automatic steering system shall be described on the basis of fig2 . here the camera 42 is attached at the upper side of the operator &# 39 ; s cab 18 on the side of a tractor 50 in the forward operating direction . the camera 42 is located on the longitudinal center plane of the tractor 50 and its lens is also aimed forward and downward at the swath 48 . the tractor 50 is provided with front , steerable wheels and rear , driven wheels 54 . it tows a baler 56 which takes up harvested crop out of the swath 48 from the field by means of the take - up device 34 and forms it into bales 58 . in place of the rotobaler shown , the baler 56 can also be a rectangular baler . it could also be configured as a self - propelled machine . the invention can also be applied to a tractor 50 used for ground - breaking operations . at their front sides , the forage harvester 10 and the tractor 50 are equipped with lighting arrangements that make it possible to illuminate the swath 48 in case that the ambient light is not sufficient . fig3 schematically shows the steering system 60 of the forage harvester 10 of fig1 or the steering system of the tractor 50 of fig2 . the camera 42 is provided with a picture sensor 62 in particular in the form of a ccd or a cmos whose output signal is digitized by means of an analog / digital converter 64 and transmitted to a video interface 66 . the picture data of the camera 42 may consist only of luminance data ( grey scale values , brightness ) or they may also contain chrominance or color data . a processor 68 , as a rule , a microprocessor or microcontroller , communicates bidirectionally with the video interface 66 . the picture generated by the lens 82 of the camera 42 on the picture sensor 62 can be displayed to the operator in the operator &# 39 ; s cab 18 on a display arrangement 70 connected to the processor 68 . the display arrangement 70 can also reproduce other information , for example , operating data of the steering system 60 and / or of the forage harvester 10 or the tractor 50 . a keyboard 72 is also available to the operator as are other input devices , for example , mouse , joystick or voice input , with which the operator can provide input to the processor 68 . the processor 68 controls electromagnetic valves 74 that are supplied on their input sides with pressurized hydraulic fluid from a source 76 and connected on their output sides with a steering cylinder 78 . on the forage harvester 10 of fig1 , the steering cylinder 78 repositions the rear wheels 16 , while on the tractor 50 , of fig2 , it repositions the front wheels 52 . a wheel angle sensor 80 detects the actual steering angle of the wheels 16 or 52 and transmits this information to the processor 68 . the hardware configuration of such automatic steering systems 60 is sufficiently well known in the state of the art , so that here a detailed description can be omitted and reference can be made to the state of the art described initially above whose disclosure is incorporated into the present document by reference . the task of the automatic steering system 60 consists of guiding the forage harvester 10 or the tractor 50 with the baler 56 along the swath 48 across the field without any steering effort on the part of the operator . for this purpose , the processor 68 processes the pictures of the camera 42 by means of electronic picture processing and generates , on the basis of the results , appropriate control signals for the electromagnetic valves 74 . as a rule , the swath 48 consists of a dried crop of stalks that has been cut by means of a mowing machine , left to dry on the field and gathered by a swather , or that was deposited in the form of a swath during the harvest of a field of cereal crop by the combine . fig4 shows a typical picture taken by the camera 42 during the harvest of grass . it can be seen that the brightness values of the swath 48 and the area of the field 84 alongside the swath 48 are not distinguished significantly . therefore it would be problematic or nearly impossible to generate a steering signal by taking the individual picture points , called “ pixels ” in the following , of the picture signal of the camera 42 exclusively on the basis of their brightness and associating them with the swath 48 or the field 84 . a picture containing chrominance data may be more appropriate to distinguish between the swath 48 and the field 84 on the basis of the colors if the stalks of the cereal crop differ sufficiently in their colors from the field . but this is not the case particularly if the stalks that remain standing on the field are at least partially dried or if the swath is to be taken up immediately after the mowing , as in the case of the harvest of cereal crop . however , as can be seen in fig4 , on the field 84 only vertical stalks ( grass stubble ) remain standing , while in contrast thereto the swath 48 includes longer stalks lying in different directions , and to a certain proportion extending horizontally . for this reason the present invention proposes that the texture of the pixels be evaluated in order to utilize it for the decision whether a pixel is located on the field 84 or in the swath 48 . the texture is understood to be the local distribution and the variation of the grey scale values ( and / or the chrominance values ) in a partial region of the picture . on the field , the texture consists of short , mostly vertical structures ( stalks ), while it consists of longer stalks in the swath , that extend in various directions . accordingly , the processor 68 operates according to a procedure that is shown in fig5 . starting in step 100 with a picture taken by the camera 42 , a picture data file is made available in step 102 to the processor 68 over the video interface 66 . in step 104 , a texture information is derived for each of the pixels that are to be processed further from this picture data file . in order to reduce the calculating time , in step 104 all incoming pixels can be processed or only a part of them that include a region containing the swath 48 . the texture information in step 104 can be derived in various ways . there is the possibility of performing a grey scale value dependency analysis , in which a dependency matrix is calculated . for small areas of the picture , the dependency matrix contains information as to which combinations of adjoining grey scale values appear in the neighborhood of the pixel . if the grey scale values in the neighborhood of the pixel are homogeneous , the dependency matrix thereby points to the fact that only identical grey scale values are present . on the other hand , if the grey scale values in the neighborhood vary very sharply , the result is a different dependency matrix . in a preferred embodiment , the grey scale value analysis considers only the direct 8 immediate neighbors of the pixel , at the edge of the picture area evaluated this number is reduced to 3 ( in the corners ) or 5 . in this way , the result is information whether the texture in the neighborhood of the pixel is uniform or not . to deduce the texture information in step 104 , a grey scale value dependency analysis dependent upon direction can also be performed . as can be seen on the basis of fig4 , and was already mentioned above , the field 84 contains many vertical line structures . on the other hand , in the swath 48 the stalks are wildly disheveled . therefore , an obvious solution is to disregard the diagonal neighbors of the pixels and to utilize only the pixels below and above as well as to the left and the right of the pixel considered here for the establishment of a dependency matrix . thereby , the texture information deduced in this way in step 104 contains information whether the texture in the neighborhood of the pixel contains vertical or horizontal structures . the amount of information , but not necessarily the information contents , is reduced compared to the grey scale value dependency analysis not dependent of direction . furthermore , the texture information in step 104 can also be generated by a color analysis . in this investigation , the chrominance information of the swath 48 is analyzed . if a color camera 42 is used , then each pixel of the color picture that was generated contains three color information , in each case for red , green and blue . hence , if the swath 48 is colored differently from the field 84 , the color information can be used to distinguish between the two , even at the same brightness . finally there is also the possibility of combining the grey scale value dependency analysis or the grey scale value dependency analysis that is dependent upon direction with the color analysis . hence , for each pixel that is to be evaluated , a dependency matrix that is independent of direction or such a matrix that is dependent upon direction is generated for the grey scale values and for the color information , that are processed further together . in the aforementioned analyses , the so - called second order statistic can be applied . moreover , a series combination is possible in which initially a number of rgb analyses are performed and subsequently the results of the rgb analyses are subjected to a texture analysis . after information about the texture in the vicinity of the pixel has been gained in step 104 , step 106 follows according to fig5 . there , a classification is performed on the basis of the texture information made available in step 104 , that is , for each pixel that is to be processed , or group of pixels that are to be processed , a decision is reached whether it , or they , belong to the swath or to the field . here , any desired appropriate algorithms can be used . the use of a neuronal network has been shown to be particularly advantageous , since it can conform to changes in the picture taking conditions due to its learning capability . the application of fuzzy logic or neuro - fuzzy logic would also be conceivable . this decision is performed in two steps : at first , a likelihood value is evaluated for each pixel or group of pixels that reproduces the likelihood that it belongs or they belong to the swath . following this , the particular likelihood is tested to see whether or not it exceeds a threshold value ( as a rule 50 %). a possible configuration of such a neuronal network 112 is shown schematically in fig6 . the neuronal network 112 is composed of at least two neuronal layers 114 , 116 . the first neuronal layer 114 is provided with an inlet 118 to which the texture information gained in step 104 in the form of the likelihood matrix and , if necessary , the color information is supplied . in the neuronal layer 114 , a linkage of the input values with the information that can be learned is performed , the result of which is available at an outlet 120 of the first neuronal layer 114 and is conducted to the inlet 122 of the neuronal layer 116 . as shown in the illustration , the first neuronal layer 114 makes available several parallel output signals to the second neuronal layer 116 . the second neuronal layer 116 has a single outlet 124 . in the second neuronal layer 116 a linkage is also performed of the signal present at the inlet 122 with information that can be learned . finally , at the outlet of the second neuronal layer 116 , information is made available that can be converted to binary form whether the pixel that was examined or the pixel group belong to the swath 48 or to the field 84 . the network 112 could also include further neuronal layers between the two neuronal layers 114 , 116 shown . any desired other network architecture can be used in place of the so - called back propagation network shown . for every pixel that is to be examined , its own neuronal network 112 could be made available , or a single network 112 can be used that is supplied with all the input data for all the pixels one after the other . as a rule , the neuronal network 112 is put into practice by means of software in the processor 68 . in other embodiments it could also be realized by special hardware . as previously mentioned , the neuronal network 112 is capable of learning . therefore , it is initially taught which parts of the picture that was taken belong to the swath 48 and which parts belong to the field 84 . this process is shown schematically in fig7 . the neuronal network 112 is supplied with texture information generated in a learning phase ( in place of texture information derived from a picture taken by a camera ), that can , for example , be stored electronically , or alternately the forage harvester 10 or the tractor 50 is positioned on the field 84 in front of a swath 48 and a picture is taken of the swath 48 by the camera 42 . furthermore the neuronal network 112 is supplied with information about the position of regions of the swath 48 and of the field 84 in each of the pictures . these may be rectangles 86 or 88 , as is shown in fig4 . thereby , masks are defined whose interior contains pixel masses belonging to the swath 48 or the field 84 . on the basis of this information , the neuronal network 112 is in a position to learn how the swath 48 and the field 84 appear and to distinguish between them . this learning process could also be performed by the operator manually steering the forage harvester 10 or the tractor 50 along a swath 48 . thereby the neuronal network 112 also learns to distinguish between the swath 48 and the field 84 . the neuronal network 112 delivers a resulting picture that is used to confirm the success . the picture can be reproduced on the display arrangement 70 and inform the operator whether the operating conditions for the automatic steering system 60 are adequate or whether it would be better to revert to manual steering , for example , in the case of darkness or fog . the learning phase of the neuronal network 112 can be repeated again and again or extended upon a corresponding input from the operator , or performed only once previously during the manufacture of the steering system or , differing from the above description or for changed operating conditions selected values stored in memory or replacement memory cards may be provided . after the conclusion of the learning phase ( fig7 ) the neuronal network 112 operates according to fig8 . it is supplied with texture information derived from pictures from the camera 42 and it delivers a pixel picture in which a binary distinction is made between swath and field . by supplying the neuronal network 112 with the texture information , the distinction between the swath 48 and the field 84 is simplified and made possible even under difficult viewing conditions . reference will now again be made to fig5 in which a binary pixel data file is now available following step 106 . the individual pixels are associated with either the field 84 or the swath 48 . on the basis of this pixel data file , in the following step 108 , the longitudinal axis of the swath 48 is detected , that is , its direction and distance from the longitudinal center line of the forage harvester 10 or the tractor 50 is determined ( that is , the angle to the longitudinal center line of the forage harvester 10 or the tractor 50 ). on the basis of the direction and the distance in step 110 , a steering signal is then generated which is transmitted to the electromagnetic valves 74 . thereby the forage harvester 10 or the tractor 50 operates automatically along the swath 48 . the procedure shown in fig5 is repeated regularly , for example , 25 times in a second . higher or lower frequencies of repetition could also be used . at the end of the swath , the operator manually steers the harvesting machine to the next swath that is to be taken up . in another embodiment , the next swath is also recognized by the automatic steering system 60 and the harvesting machine is automatically steered there . for the sake of edification , fig9 through 15 show pictures that result from the picture shown in fig4 during the processing shown in fig5 . fig9 shows the result of a grey scale value dependency analysis independent of direction . fig1 shows a grey scale value dependency analysis that is dependent upon direction . in both figures , the likelihood values calculated by the neuronal network are shown for the case that the pixel belongs to the swath , before it was binarized . a comparison of fig9 and 10 , that both quasi represent the result of step 106 of fig5 before the classification , shows the positive effect of the grey scale value dependency analysis dependent upon direction . therefore , for the further processing , only the results of the grey scale value dependency analysis dependent upon direction are used . fig1 shows the result of the decision ( step 106 in fig5 ) whether the pixels belong to the swath 48 ( white ) or to the field 84 ( black ), that is , the binarization by the neuronal network 112 . previously , the neuronal network 112 was subjected to a learning phase ( fig7 ) in which the picture of fig4 was presented to it as learning picture and the rectangles 86 , 88 as representing surfaces belonging to the field 84 or the swath 48 . this network has also shown good results with other pictures . fig1 through 14 correspond to process steps of the step 108 of fig5 . in fig1 , all continuous surfaces were calculated and all surfaces were removed that were less than a threshold value ( here the threshold was 450 pixels ). in fig1 , the largest remaining surface of fig1 is shown , with which subsequently in fig1 the small black intervening areas were removed by the application of deletion and erosion . moreover , fig1 shows two axes of inertia of the remaining surfaces of the swath 48 . on the basis of the axes of inertia that extend in the longitudinal direction , the direction of the swath 48 and its distance from the longitudinal center plane of the forage harvester 10 or the tractor 50 can be determined . these magnitudes are utilized for the generation of a steering signal for the electromagnetic valves 74 , where the actual value given by the wheel angle sensor 80 is considered . having described the preferred embodiment , it will become apparent that various modifications can be made without departing from the scope of the invention as defined in the accompanying claims . | 0 |
fig1 illustrates a snowmobile 10 that has a frame 12 with a rear portion supported and propelled along the ground by an engine - driven track drive 14 and a front portion supported on the ground by a pair of skis 16 , 18 . the vehicle has a manually controlled steering mechanism 19 that includes a handlebar steering control 20 on pivotally mounted steering shaft 22 , which moves a steering rod 24 laterally , the ends of the steering rod being coupled to the skis 16 , 18 to turn them and steer the vehicle . each of the skis 16 , 18 is coupled by a separate suspension system 26 , 28 to the frame 12 and to the manually controllable steering mechanism , the two suspension systems being similar . as illustrated in fig2 - 5 , the suspension system 26 for the ski 16 includes a leaf spring 30 for supporting the frame 12 on the ski 16 , and a shock dampener 32 which also couples the frame to the ski , the shock dampener 32 serving to dampen oscillations induced by the leaf spring . the spring 30 , which includes a plurality of resilient leaves 34 , 36 , has front and rear ends 30f , 30r mounted at longitudinally spaced locations on the ski by a pair of brackets 38 , 40 . the brackets permit sufficient freedom of movement of the spring ends so that the middle portion 30m of the spring can move up and down . the dampener 32 includes a pneumatic cylinder 42 which lies above the leaf spring 30 and a pistion 44 with an upper end that is slidably received in the cylinder and a lower end 44l which is mounted on the ski . the leaf spring 30 is formed with a hole 46 in the middle part 30m thereof , and the piston 44 projects through the hole 46 in its extension between the cylinder and ski . by forming a hole in the leaf spring and projecting the shock dampener piston through the hole , the shock dampener can be mounted so it extends in a primarily vertical position and with the single shock dampener centered on the ski , or in other words , lying over the center line 48 of the ski . the cylinder 42 of the shock dampener is pivotally received in a hole 50 formed in a member of the snowmobile frame 12 to permit the shock dampener 32 to pivot about an axis 52 that extends primarily vertically , or , in other words , with a greater vertical than horizontal directional component ( i . e . it extends at less than 45 ° from the vertical ). the lower end of the shock dampener cylinder 42 has a mount 54 with a pair of trunnions 56 that are pivotally received on a mounting bracket 58 that is securely fastened to the middle portion 30m of the leaf spring . the bracket 58 has a hole 60 aligned with the hole 46 in the leaf spring , to permit the extension of the piston therethrough . the upper portion of the shock dampener cylinder 42 includes a tapered splined shaft 62 with a threaded end 64 . a steering link 66 which couples the steering rod 24 to the shock dampener cylinder 42 , has an inner end 68 with a splined aperture 70 that receives the splined shaft 62 on the cylinder . the link 66 also has an outer end 72 which is pivotally coupled to the steering rod 24 . when the steering rod 24 shifts laterally , the steering link 66 turns the cylinder 42 which , in turn , turns the bracket 58 and the leaf spring 30 to thereby turn the ski 16 and steer the vehicle . the steering link 66 is secured to the cylinder by a nut 74 threaded onto the upper threaded end 64 of the cylinder , and the link is securely held to the cylinder while permitting rotation of the link relative to the frame 12 by means of a low friction washer 76 . thus , the shock dampener 32 is pivotally mounted on the frame and serves to couple the steering link 66 to the leaf spring 30 to transmit steering torque . when the snowmobile passes over rough terrain , the skis often undergo pitching movements ; that is , the front of the ski moves up and down with respect to the rear of the ski . in order to accommodate such pitching , the lower end of the shock dampener cylinder 42 is pivotally mounted by the trunnions 56 on the leaf spring , and the lower end 44l of the piston is slidably mounted on the ski . the trunnions 56 permit the lower end of the cylinder 42 to pivot about a horizontal and laterally - extending axis 80 with respect to the leaf spring during pitching of the ski . during such pivoting at axis 80 , the leaf spring moves longitudinally with respect to the piston 44 , and accordingly , the holes 46 , 60 in the leaf spring and bracket 58 are elongated . as a further consequence of such pivoting at the lower end of the cylinder at axis 80 , the lower end 44l of the piston tends to slide longitudinally with respect to the ski . to allow for such sliding , a slide rod 82 is attached to the lower end of the piston , by screwing the threaded lower end of the piston into a corresponding hole 84 formed in the slide rod . a bolt 86 extends in a lateral direction through a hole in the slide rod , and the ends of the bolt 86 serve as slide bearings that slide along guideways 88 formed in a pair of slide brackets 90 , 92 , that are fixed to the middle portion of the ski 16 and that also serve as slide bearings . one end of the slide bolt 86 has a head 86h while the other end is held by a high friction nut 94 that can be adjusted in tightness to control the amount of friction of sliding of the piston lower end along the ski . it may be noted that during pitching of the ski , the leaf spring also pitches , and accordingly , the lower surface 54l of the cylinder is cut away at the front and rear to prevent interference with free pivoting of the leaf spring and the bracket 58 thereto . thus , the invention provides a ski suspension system which efficiently utilizes a ski dampener that provides a coupling of the frame to the ski in parallel with a spring to dampen oscillations . the ski dampener is allowed to be mounted in a primarily vertical orientation and substantially centered over the center line of the ski , by projecting a piston of the dampener through a hole formed in a center portion of the leaf spring . steering torque is transmitted through the cylinder of the shock dampener by pivotally mounting the cylinder of the dampener on the frame of the snowmobile , coupling the upper portion of the cylinder to the manually controllable steering linkage of the snowmobile , and coupling the lower portion of the cylinder to the leaf spring . although the piston of the shock dampener extends primarily vertically to a middle portion of the ski , the ski is not prevented from pitching , because the lower end of the piston is slidably mounted on the ski while the cylinder is pivotally mounted on the spring . although particular embodiments of the invention have been described and illustrated herein , it is recognized that modifications and variations may readily occur to those skilled in the art and consequently , it is intended that the claims be interpreted to cover such modifications and equivalents . | 1 |
although it can be difficult to produce and market computer software profitably , there are aspects of software marketing which are attractive . perhaps the most attractive feature is that the marginal cost of producing a software product is very small and can approach zero . thus with a software package which may have cost tens or hundreds of millions of dollars to develop , to produce one more copy may cost almost nothing . thus software provides a product in which the marginal sale , i . e . each additional sale , can be very profitable . it is also a well - known marketing strategy to provide products which are differentiated by capacity and price . in this way it is possible to increase the market for a particular item while at the same time achieving the larger profits normally associated with products which have maximum capabilities . for example luxury cars typically have more profit margin associated with them than economy cars . the total market for cars , as well as the total profit on car sales is generally considered to be maximized by selling cars with a range of costs and features . it has also been widely commented upon , that the new economy is based on the sale of knowledge not the sale of physical assets . the method of marketing papermaking machinery described herein builds on these marketing trends by defining a papermaking product which can be produced at low marginal cost , can be used to create product differentiation , and derives profitability through the sale of knowledge . the papermaking product is additional capacity of a papermaking machine which is included at no additional cost to the buyer of a papermaking machine , wherein the buyer of the papermaking machine is prevented from utilizing the additional capacity until the buyer makes or agrees to make a subsequent payment . the capacity of a given papermaking machine can often be improved by the addition of software modifications and more sophisticated controls , together with additional sensors . typically a customer for a papermaking machine purchases a machine of a capacity matched to the use to which the machine will be put . a purchaser of a papermaking machine evaluates the resources available in terms of fiber sources and the existing or hoped for marketing channels for the sale of paper . the purchaser of the papermaking machine then chooses to buy a papermaking machine matched to the anticipated grade and quantity of paper which will be produced and - sold . while it is possible that the purchaser of a papermaking machine will purchase a machine with additional capabilities at a higher cost in the expectation that these capabilities may find use in the future , buying unneeded capacity may be difficult to justify . the cost of the papermaking machine with added capacity to the purchaser without an immediate need for the added capacity will typically be the same as the cost to another maker of paper who will immediately use the added capacity . if one paper maker pays for capacity which is not used , and the other uses all the capacity paid for , the latter will have a lower capital cost . in a mature industry , where profit margins typically are very narrow , having higher capital costs is very undesirable . in evaluating the cost of the upgrade in capacity , the analysis is greatly simplified where the buyer has identified a specific need for increased capacity . in this situation , the paper machine buyer compares additional cost to the expected additional profit from the use of the additional capacity . at the point in time when the additional capacity is needed , the uncertainty concerning use of the additional capacity is removed as well as the uncertainty that the added capacity will become technically obsolete , or will not address the particular market , whether for a higher grade of paper or for greater quality of paper . on the other hand the paper machine manufacturer can purchase , or invest in additional capacity in the machines the paper machine manufacturer sells , at a low marginal cost , while the likelihood of the additional capacity being used is spread over multiple purchasers of papermaking machines allowing a statistical analysis of the investment risk . a paper machine manufacturer will typically invest in technology for improving the capacity of the papermaking machines it sells , because at least some customers will be willing to pay the additional cost of the technology improvements . the marginal cost of adding additional capabilities to a papermaking machine can be extremely low or zero if these technology improvements consist of better programs , for example updates and automation systems , better control algorithms for the adjustment of certain processes , e . g . fuzzy , neural network or predictive adjustment control algorithms , or other software tools , useful for improving the papermaking processes , or storing and processing data relating to the papermaking processes , or predicting maintenance , or any other software . of course the cost of a papermaking machine which can make use of improved software may be somewhat higher inasmuch as there is a need for more expensive controllers , controller boards , process and machine sensors ; and more precise valves or other controllable parameters . in addition , the installation of more sophisticated software may require additional testing , calibration , or setup labor . the capacity of a papermaking machine is defined herein as the speed and quality of the paper which can be made on the papermaking machine . increased capacity means an increased papermaking speed , or the making of paper which is of greater value . the greater value of the paper may be achieved , for example , by forming a sheet which is more one - sided , has a greater caliper for a given weight , has better fiber orientation , produces a better paper finish , and other attributes such as those known to those skilled in the art of papermaking . increasing capacity by increasing speed results in the manufacture of additional paper without substantial additional capital costs , thus increasing profitability . increasing capacity by increasing paper quality can lead to additional revenue with a little or no additional cost . therefore an increasing capacity which results from increased quality or value which amounts to only one or two percent may result in a substantial increase in profit derived from a particular papermaking machine and thus qualifies as a substantial increase in capacity . on the other hand increasing paper speed may require a speed increase of 10 , 20 , or 40 percent or more to achieve the same level of increased profitability and thus a substantial increase of capabilities with reference to speed will be in the foregoing ranges , for example a machine is sold with the capacity of 1800 m / min . but may have a capacity which can be increased to 2500 m / min . of course an increase in papermaking capacity may be a combination of increasing papermaking speed and an increase in paper quality . the means of increasing papermaking capacity may be arranged in modules of interrelated software or controller functionality so that increased papermaking capacity can be purchased in steps or even as a continuously variable function of the customer &# 39 ; s need and willingness to pay . where increased papermaking capacity is increased solely through unlocking or uploading data and programming code , the increased capacity can be purchased and billing can be carried out , through an estore ( i . e . through transactions carried out by ecommerce techniques over the internet ) or portal designed for the customer . in this type of exchange , the customer selects the desired modules or desired capacity and receives the download of software keys or software upgrades to effect operation . it is also possible that to achieve increased capacity it may be necessary to add proprietary items , such as sensors , controllers or minor items of hardware , which are proprietary to the papermaking machine manufacturer by way of patent , trade secret , copyright , or licensing reasons . these proprietary hardware items will have a relatively small intrinsic cost , i . e . cost to the papermaking machine manufacturer , a cost that is usually less than one percent of the purchase price of the papermaking machine . these systems may not be installed on the original machine as purchased because of their proprietary nature . the purchaser of a papermaking machine may be limited to the capacity agreed upon at the time of purchase by contract , by licensing agreements , by software keys , by the lack of certain software , or by the lack of certain proprietary parts , or a combination of the foregoing . when the purchaser of a papermaking machine desires greater papermaking capacity , the purchaser is given access to the greater papermaking capacity by contract modifications , the providing a software or software keys , or proprietary parts or a combination of the foregoing in return for payment . the size of the payment may be negotiated or preferably will be the result of a calculator or table of papermaking capacity and price supplied to the papermaking machine purchaser at the time of purchase . the selling of a papermaking machine , or increased capacity should be understood to include an outright sale for a given price or a lease agreement with terms and conditions which normally take account of financing costs , and the terms of lease result in substantially equivalent value received for the papermaking machine . if the papermaking machine is leased , the lease terms can be adjusted to increase the return to the supplier of the papermaking machine , in proportion to the increase in capacity which is made available , by the same means which are described with respect to an outright purchase . the lease terms may include leasing additional capacity for a limited period , after which the papermaking machine would be returned to its original capacity . it should be understood that the relationship described as proportional is not limited to a relationship which is necessarily linear in proportionality . it should be understood that the modifications performed on the papermaking machine to increase its capacity within the meaning of the claims can be distinguished from prior art rebuild techniques in that the value added is large compared to the cost of adding that value , i . e . downloading software or replacing limited proprietary components . for example , the manufacturer &# 39 ; s cost of implementing the upgrade is zero to about one percent of the market value of the upgrade . this definition points to the fact that substantially all of the value added after the sale has been preinstalled in the machine as originally sold . it should be understood that the prior art of course includes the practice of upgrading a papermaking machine by adding additional equipment . the invention is different from this past practice because the additional equipment ( capacity ) is added before the machine is sold , however the process of making the additional capacity available to the purchaser might require the addition of some hardware . this additional hardware differs in kind from the prior art type of rebuild or modification . the difference is a very insubstantial hardware addition whose main purpose is to unlock , or make available , capability already present , not to add capability which is not present . past practices included the opposite approach of adding very little value to the machine when it is sold ( for example attachment brackets ), which facilitates the addition of equipment of substantial cost later . it should be understood that the term “ substantially less ” as used to describe the sale price , means a price amounting to at least 5 percent , preferably 10 percent , and more preferably 25 percent less . moreover , the term “ substantially lower capacity ” when referring to production speed refers to a papermaking machine which has a speed which is reduced by 10 , 20 , 40 percent or more , yet when referring paper of a reduced quality , this term means a quality which reduces the value of the paper by one percent or more . it should be understood that the method of investing in additional capacity of a papermaking machine is applicable to any substantial part of a papermaking machine for example a reel - up , or a calendar . it should also be understood that the term papermaking machine includes a machine for making paperboard and the like . it is understood that the invention is not limited to the particular construction and arrangement of parts herein illustrated and described , but embraces all such modified forms thereof as come within the scope of the following claims . | 6 |
referring now to fig1 , there is disclosed mathematical matrix ( 1 ) presenting a single integrated apparatus depicting conceptual relationships between numbers 0 to 100 which allows children to count each of the numbers individually and to count to 100 by 1 &# 39 ; s , 2 &# 39 ; s , 5 &# 39 ; s or 10 &# 39 ; s as well as to count by odd or even numbers . the mathematical matrix ( 1 ) is organized about a vertical y - axis and a horizontal x - axis with stations ( 103 ). a pair of top terminal stations having the numbers 50 and 50 and a pair of bottom terminal stations having the numbers 0 and 100 . a balanced display of numbers from 0 to 100 is presented in fig1 . in some embodiments the 50 and 50 pair and the 0 and 100 pair may be on the left and right of the x - axis . considering the structure of the matrix more specifically , ascending numbers from 0 to 50 are arranged in a first string a on the left side of the y - axis and descending numbers from 100 to 50 are arranged in a second string , b on the right side of the y - axis . numbers which are on lines parallel to the x - axis always sum to the number 100 ( 105 ), for example 47 and 53 ; 21 and 79 , and 9 and 91 . thus , the matrix provides an apparatus to teach addition and subtraction . in order to make numbers countable by 10 &# 39 ; s more readily distinguishable , these numbers occur in straight lines parallel to the y - axis with numbers other than 50 , 50 and 0 , 100 being offset substantially from the y - axis . each of the 10 &# 39 ; s numbers occurs at an apex with portions strings approaching the 10 &# 39 ; s number converging . each number ending in 5 , so as to be wholly divisible by 5 is located at an apex in - board of the numbers evenly divisible by 10 . consequently , the matrix allows a student to readily count by 10 &# 39 ; s and by 5 &# 39 ; s while clearly showing that the 5 &# 39 ; s occur evenly between the 10 &# 39 ; s , and upon counting are always separated by 10 digits . referring now to fig2 , there is shown a puzzle arrangement wherein the numbers at stations ( 203 ) in the strings a and b are not present . students are then presented with the task of entering the numbers which are provided on chips ( 201 ) in a separate pile . the chips ( 201 ) may be in a container which can be shaken . the chips ( 201 ) may pour out on a table or desk surface next to the matrix . the student &# 39 ; s task is to properly place the chips in the matrix while initially viewing a complete or partially complete matrix displayed to the class . in order to distinguish even numbers from odd numbers , all even numbers occur at stations ( 203 ) represented by circles and all odd numbers occur at stations ( 203 ) represented by triangles . in some embodiments all the stations ( 203 ) are the same shape and in some embodiments the shape of the station ( 203 ) is determined by the number in the digit ( n ) or ( m ) in that the station ( 203 ) has the same number of sides as the number in the digit ( n ) or ( m ) for example see fig5 . optionally , the matrix may further distinguish even and odd numbers by color , for example , the even number stations ( 203 ) may be red , and the odd number stations ( 203 ) may be blue . in order to make it easier to count by 10 &# 39 ; s , the stations ( 203 ) with numbers 0 , 10 , 20 , 30 , 40 , 50 , 60 , 70 , 80 , 90 , and 100 may optionally be the same color . also , the stations ( 203 ) with numbers counting by 5 , but not ending in 0 , may be a particular color . in lieu of having a mechanical arrangement a computerized version of the game is shown in fig3 in which an electronic image ( 200 ) of the matrix of fig1 is displayed with numbers up to ( 100 ). another image ( 300 ) of the matrix is provided with empty or partially empty stations . a separate image ( 400 ) with a bank of numbers from 0 to 100 is also provided for filling in empty stations the image ( 300 ). there are options for placing numbers from the numbers bank ( 400 ) in stations on the matrix ( 300 ) which can be done either with the image ( 200 ) present at another location or located on separate sheets at the location of each computer terminal . children may be instructed to place all of the 10 numbers on the board and then perhaps all of the 5 numbers on the board . finally , students can be requested to place all the numbers between the 10 &# 39 ; s and 5 &# 39 ; s on the board . various exercises can be performed using the image of the matrix ( 300 ) with empty or partially empty stations so that the students may work with the numbers and learn what the matrix has to teach them about the relationship between the various numbers between 0 and 100 . in other embodiments other ranges may be substituted for 0 - 100 for example 100 - 1000 . if necessary , an element of competition may be introduced into the instruction by timing how long it takes each student or group of students to insert a random distribution of numbers in the matrix . when a student correctly places the numbers , an audible or non - audible finish signal is provided so that those who complete the task by a selected time are rewarded . this game has many options for encouraging kids to learn about the numbers 0 to 100 . while the matrix and associated learning activities are the primary use of the matrix , other uses of the matrix have been conceived , such as but not limited to , table gaming wherein wagerers place bets on numbers they select and are rewarded according to formulas derived from the relationship of selected numbers to complements thereof which equal 100 . fig4 is an illustrative example of the game in hypothetical play . the stations ( 403 ) are shown alternating between circles and triangles where circles correspond to even numbers and triangles correspond to odd numbers . special movement spaces and examples of their effects ( 405 , 407 , 409 , 411 , and 413 ) are used by a user / player ( 419 ) when they perform an action that grants them access to the spaces for example landing on the space , answering a question , or drawing a card . when landing on a space granting downward diagonal movement a slide ( 405 ) may be used to transfer the user ( 419 ). when landing on a space granting movement directly across to the other string a car on a road ( 409 ) may be used to transfer the user ( 419 ). when landing on a space granting upward diagonal movement an airplane ( 413 ) may be used to transfer the user ( 419 ). when landing on a space granting upward movement a latter ( 411 ) may be used to transfer the user ( 419 ). when landing on a space granting downward movement an elevator ( 407 ) may be used to transfer the user ( 419 ). the special movement spaces and examples of their effects ( 405 , 407 , 409 , 411 , and 413 ) are illustrative examples and are not meant to be limiting for example an escalator could be used to show upward or downward diagonal movement . math problem bubbles ( 415 ) may optionally be displayed in the computerized embodiments when user lands on a space or before a user may move from a space . the math problem bubbles ( 415 ) may be any type of math questions for example a word problem , identifying the next number in a sequence , an algebra problem , a calculus problem , naming a geometric shape , or a geometry problem . in some embodiments math problems are written on cards ( 417 ). the cards ( 417 ) may be real or displayed on a computer . fig5 shows a series of ten stations where each station is a represented by a geometric shape with the number of sides of the shape corresponding to the ones digit of the number associated with it . numbers ending in 0 are represented by a circle ( 501 ). numbers ending in 1 are represented by a horizontal line segment ( 503 ). numbers ending in 2 are represented by an absolute value sign ( 505 ). numbers ending in 3 are represented by a triangle ( 507 ). numbers ending in 4 are represented by a square ( 509 ). numbers ending in 5 are represented by a pentagon ( 511 ). numbers ending in 6 are represented by a hexagon ( 513 ). numbers ending in 7 are represented by a heptagon ( 515 ). numbers ending in 8 are represented by an octagon ( 517 ). numbers ending in 9 are represented by a nonagon ( 519 ). fig5 is an illustrative example using regular polygons . some embodiments may use irregular polygons or have their sides correspond to numbers other than those in the ones digit position . without further elaboration , it is believed that one skilled in the art can , using the preceding description , utilize the present invention to its fullest extent . the preceding preferred specific embodiments are , therefore , to be construed as merely illustrative , and not limitative of the remainder of the disclosure in any way whatsoever . the entire disclosures of all applications , patents and publications , cited herein and of corresponding u . s . provisional application ser . no . 61 / 318 , 514 , filed mar . 29 , 2010 , are incorporated by reference herein . from the foregoing description , one skilled in the art can easily ascertain the essential characteristics of this invention and , without departing from the spirit and scope thereof , can make various changes and modifications of the invention to adapt it to various usages and conditions . | 6 |
this invention affords foam inhibiting substances whose performance properties are at least equivalent to those already known in the art , and which have the additional property of improved biodegradability . the inventive foam inhibitors may be generally described as adducts of ethylene oxide with relatively long chain aliphatic alcohols or vicinal glycols , whose terminal groups are alkyl - blocked . more specifically , the present invention relates to foam inhibitor additives for cleaning preparations in the nature of at least one hydroxyalkyl polyethylene glycol ether of the formula : r 3 is a straight - chain or branched c 4 - 8 - alkyl ; and with the proviso that the total number of carbon atoms in r 1 and r 2 is between 6 and 16 . other than in the operating examples , or where otherwise indicated , all numbers expressing quantities of ingredients or reaction conditions used herein are to be understood as modified in all instances by the term &# 34 ; about &# 34 ;. suitable starting materials for producing the polyglycol ethers corresponding to formula i include linear or branched c 4 - 8 alcohols , such as n - butanol , i - butanol , n - amyl alcohol , i - amyl alcohol , n - hexanol , isomeric hexanols , n - heptanol and isomeric n - heptanols , n - octanol and isomeric octanols , such as 2 - ethylhexanol . these alcohols , which may be used either individually or in admixture , are reacted with ethylene oxide in known manner in a molar ratio of from 1 : 7 to 1 : 12 . the reaction products obtained are reacted with c 8 - 18 - epoxides , preferably in the presence of suitable alkaline catalysts . both 1 , 2 - epoxides and also compounds containing an internal epoxide group may be used for the reaction . c 12 - 16 - 1 , 2 - epoxides have proven to be particularly suitable . mixtures of epoxides of different chain lengths are also suitable . the molar ratio of alkyl polyglycol ether to epoxide preferably is 1 : 1 and the addition of alkaline catalyst is between 0 . 1 to 1 % by weight , based on the quantity of epoxide used . the reaction is carried out by heating for several hours to temperatures of 100 ° to 200 ° c ., preferably 120 ° to 180 ° c . the conversion level may readily be determined by determining the epoxide content of the mixture . heating for 4 to 8 hours to 150 °- 170 ° c . is generally sufficient . further information on the reaction of polyglycol ethers with long chain epoxides can be found in european published patent application no . 88 , 039 . in preferred embodiments of the invention , referring to formula i , r 1 is a linear c 12 - 16 - hydrocarbon , r 2 is hydrogen , r 3 is n - butyl , n - hexyl , or n - octyl , and n is a number from 8 to 10 . it is particularly preferred to use compounds of formula i in which r 3 is an n - butyl radical . the polyglycol ethers corresponding to formula i may be used either individually or in a mixture thereof , or in further combination with at least one secondary foam - inhibitive compound which is a polyethylene glycol ether of the type obtainable by the addition of from 4 to 20 parts of ethylene oxide onto 1 part by weight of polyglycerol having a hydroxyl number of from 900 to 1200 , followed by etherification of the free hydroxyl groups with at least one alkyl halide containing from 4 to 8 carbon atoms , as described in german patent application no . 33 15 952 ( and corresponding u . s . application no . 06 / 601 , 477 , now u . s . pat . no . 4 , 522 , 740 which is incorporated herein by reference ). mixtures of the polyglycol ethers of formula i and the terminal group blocked polyglycerol polyglycol ethers defined above in a ratio by weight of 1 - 9 : 1 , preferably 2 . 3 - 9 : 1 , have a particularly pronounced foam inhibiting effect . the terminal group blocked hydroxyalkyl polyglycol ethers of formula i used in accordance with the invention are distinguished by their high stability to alkalis and acids , by their very effective inhibition of foaming in mildly acidic to strongly alkaline cleaning solutions and by favorable degradation rates in the waste water . their biodegradability , as determined by the prescribed methods , is equivalent to a bias - removal of more than 80 %. the cleaning preparations in which the terminal group blocked polyglycol ethers are used in accordance with the invention may contain the constituents normally present in preparations of this type , such as wetting agents , builders and complexing agents , alkalis or acids , corrosion inhibitors and , if desired , even antimicrobial agents and / or organic solvents . suitable wetting agents are nonionics , such as polyglycol ethers of the type obtained by the addition of ethylene oxide onto alcohols , particularly fatty alcohols , alkyl phenols , fatty amines and carboxylic acid amides , and anionics , such as alkali metal , amine and alkylol amine salts of fatty acids , alkyl sulfuric acids , alkyl sulfonic acids and alkyl benzene sulfonic acids . the builders and complexing agents which the cleaning preparations may contain include alkali metal orthophosphates , polymer phosphates , silicates , borates , carbonates , polyacrylates and gluconates and also citric acid , nitriloacetic acid , ethylene diamine tetraacetic acid , 1 - hydroxyalkane - 1 , 1 - diphosphonic acids , amino tri -( methylene - phosphonic acid ) and ethylene diamine tetra -( methylene - phosphonic acid ), phosphonoalkane polycarboxylic acids such as , for example , phosphonobutane tricarboxylic acid , and alkali metal salts of these acids . highly alkaline cleaning preparations , particularly those for washing bottles , contain considerable quantities of caustic alkali in the form of sodium and potassium hydroxide . if it is desired to obtain special cleaning effects , the cleaning agents may contain organic solvents , for example alcohols , petroleum fractions and chlorinated hydrocarbons , and free alkylol amines . in the context of the invention , cleaning preparations are primarily understood to be the aqueous solutions intended for direct application to the substrates to be cleaned . in addition , the expression &# 34 ; cleaning preparations &# 34 ; also applies to the concentrates and solid mixtures intended for the preparation of the working solutions . the solutions ready for use may be mildly acidic to strongly alkaline . the hydroxyalkyl polyglycol ethers of formula i either alone or in admixture with the second compound when used in accordance with the invention are added to the ready - to - use cleaning preparations in a foam inhibitive amount , preferably in a concentration of 10 to 2500 ppm , most preferably 50 to 500 ppm . 484 g ( 1 mol ) of the adduct of 10 mols of ethylene oxide with 1 mol of n - butanol , 227 . 5 g ( 1 mol ) of linear 1 , 2 - epoxy tetradecane and 1 . 3 g of sodium methylate ( 30 % solution in methanol ) were heated in vacuo to 100 ° c . to remove the methanol introduced with the catalyst and then heated with stirring for 6 hours to 160 ° c . in an inert gas atmosphere . after cooling , the reaction product was neutralized with the equivalent quantity of acetic acid and filtered . the product had an analytically determined hydroxyl number of 80 . its cloud point , as determined in 1 % sodium hydroxide , was below 5 ° c . the terminal group blocked hydroxyalkyl polyglycol ethers shown in table i were similarly produced . their cloud points were determined in 1 % sodium hydroxide solution . e . o . stands for added ethylene oxide groups and the symbol & lt ; for &# 34 ; less than &# 34 ;. table i______________________________________ cloudexample starting materials oh pointno . epoxide glycol ether number (° c . ) ______________________________________1 1 , 2 - epoxytetra - n - butanol + 80 & lt ; 5 decane 10 e . o . 2 1 , 2 - epoxyoctane n - butanol + 99 . 5 37 9 e . o . 3 1 , 2 - epoxydecane n - butanol + 100 19 9 e . o . 4 1 , 2 - epoxydo - n - butanol + 101 17 decane 9 e . o . 5 1 , 2 - epoxyhexa - n - butanol + 75 . 6 & lt ; 5 decane 9 e . o . 6 1 , 2 - epoxyoctan - n - butanol + 70 & lt ; 5 decane 9 e . o . 7 1 , 2 - epoxytetra - n - hexanol + 69 . 5 & lt ; 5 decane 10 e . o . 8 1 , 2 - epoxydo - 2 - ethylhexanol + 69 & lt ; 5 decane 10 e . o . ______________________________________ production of the terminal group blocked polyglycerol polyglycol ethers in accordance with german patent application no . 33 15 952 in an autoclave , 137 g of polyglycerol ( hydroxyl number 961 ) were reacted with 1400 g of ethylene oxide ( ratio by weight 1 : 10 . 9 ) at 180 ° c ./ 10 bar in the presence of 3 g sodium methylate . 1313 g of polyglycerol ethylene glycol ether , hydroxyl number 113 , were obtained . 350 g of the product obtained , 171 g of n - hexyl chloride and 228 g of 75 % by weight sodium hydroxide solution were stirred for 4 hours at 120 ° c . the organic phase was separated off from the cooled reaction mixture . the organic phase was washed with water at 50 ° c . until the washing liquid showed a neutral reaction . unreacted hexychloride and water were removed from the reaction mixture by heating in vacuo to 150 ° c . 281 . 5 g of polyglycerol polyethylene glycol hexylether ( polyglycerol + 10 . 9 butyl - e . o .) were obtained . the product had a hydroxyl number of 3 . 5 . the reaction product is referred to hereinafter as product b . the foam inhibiting effect was determined using test solutions containing 1 % by weight of sodium hydroxide and 0 . 03 % by weight ( 300 ppm ) of foam inhibitor . in the course of the tests , triethanolamine tetrapropylene benzene sulfonate was added to these solutions as the test foaming agent in quantities increasing in stages by amounts of 100 ppm . quantities of 200 ml of the test solutions were tested at 65 ° c . in the foam beating apparatus according to german industrial standard ( din ) 53 , 902 . the foam volume in ml was read off at 5 seconds . an average value from 5 individual measurements was determined for each concentration of the test foam agent . from the results obtained , the foam volume observed at a concentration of the test foaming agent of 1200 ppm is shown in the second column of table ii below . as a second representative measured value , the concentration of test foaming agent at which a foam volume of more than 200 ml was measured for the first time is shown in the third column of table ii . table ii______________________________________ ppm of testfoam inhibitor ml of foam at 1200 ppm foaming agent forof example no . of test foaming agent & gt ; 200 ml of foam______________________________________2 300 6003 300 12004 200 16001 30 20005 35 22006 40 18007 30 20008 30 1800______________________________________ a storable , solid , bottle washing preparation was prepared by mechanically mixing the following components : 80 parts by weight of caustic soda , 12 parts by weight of sodium tripolyphosphate , 5 parts by weight of sodium silicate ( molar ratio of na 2 o to sio 2 1 : 3 . 35 ) and 3 parts by weight of the product of example 1 . using a 1 % by weight solution of this preparation , milk bottles were washed at 80 ° c . in a standard bottle washing machine having one solution zone and an hourly throughput of 18 , 000 bottles . the cleaning effect was good and no troublesome foaming was observed . a storable , solid mixture was obtained by mechanically mixing the following active components : 80 parts by weight of sodium tripolyphosphate and 20 parts by weight of the product of example 5 . beer bottles were washed at 85 ° c . in a bottle washing machine having three solution zones and an hourly throughput of 80 , 000 bottles . the beer bottles had been labeled with paper labels using casein glue which normally causes vigorous foaming in immersion baths . when 1 . 5 % by weight sodium hydroxide solution containing 0 . 15 % by weight of the active mixture described above was used for washing , the machine could be operated without any troublesome foaming . a storable mixture was prepared by mechanically mixing the following active components : 40 parts by weight of sodium ethylene diamine tetraacetate , 20 parts by weight of sodium tripolyphosphate , 30 parts by weight of sodium gluconate , 10 parts by weight of the product of example 1 . wine bottles were washed at 85 ° c . in a standard commercial bottle washing machine having two separate solution zones and an hourly throughput of 24 , 000 bottles . a 1 . 5 % by weight sodium hydroxide solution to which 0 . 5 % by weight of the concentrate described above had been added was used as the cleaning solution . washing was not accompanied by any troublesome foaming and the bottles were satisfactorily clean . a storable cleaning preparation for cleaning metal surfaces by spraying was prepared by mechanically mixing the following components : 80 parts by weight of sodium metasilioate pentahydrate , 16 parts by weight of sodium tripolyphosphate , 4 parts by weight of cocoamine + 12 e . o ., 1 part by weight of the product of example 1 . the foam formatlon and foam collapse of a 2 % by weight solution of this cleaning agent was tested at 60 ° c . in accordance with german industrial standard ( din ) 53 , 902 by comparison with an agent which did not contain the product of example 1 , but which had otherwise the same composition . the results are set out in table iv below . table iv______________________________________ ml . of foam after mins . cleaning agent 0 1 2 10______________________________________comparison example 530 140 0 0example 13 180 15 0 0______________________________________ an immersion type degreasing agent for metals was prepared by mechanically mixing the following components : 40 parts by weight of sodium metasilicate pentahydrate , 35 parts by weight of sodium carbonate , 20 parts by weight of sodium tripolyphosphate , 2 . 5 parts by weight of sodium alkyl benzene sulfonate , 2 . 5 parts by weight of nonyl phenol + 14 e . o ., 4 . 5 parts by weight of the product of example 1 , 0 . 5 part by weight of product b . greasy steel moldings were cleaned at 60 ° c . by immersion in a 4 % by weight solution of this cleaning preparation . the degreasing effect was very good and no troublesome foaming was observed . a storable concentrate for cleaning metal surfaces was prepared by dissolving the following components in water : 30 parts by weight of sodium caprylate , 10 parts by weight of borax , 14 parts by weight of sodium tripolyphosphate , 10 parts by weight of triethanolamine , 2 parts by weight of monoethanolamine , 6 parts by weight of the product of example 1 , 78 parts by weight of water . iron surfaces were sprayed at 50 ° to 55 ° c . with a 1 . 5 % by weight solution of this cleaning agent ( ph 8 . 5 ). the cleaning effect was good and no troublesome foaming was observed . a storable concentrate for cleaning metal surfaces was prepared by dissolving the following components in water : 25 parts by weight of the diethanolamine salt of isononanoic acid , 20 parts by weight of diethanolamine , 1 part by weight of benztriazole , 4 parts by weight of the product of example 6 and 50 parts by weight of water . gray iron castings were sprayed at 50 ° to 55 ° c . with a 1 % by weight solution of this cleaning preparation . the cleaning effect was good and no troublesome foaming was observed . | 2 |
a distributed telecommunications system provides functionality to support modern small or large office business settings , such as call forwarding , auto - attendant , voice mail , voice messaging , etc . the telecommunications system is made up of components that can be located in various locations that are remote from each other . each of the components is coupled to an internet protocol ( ip ) based wide - area network . the system provides message storage assurance to subscribers and enables a caller to generate a message and terminate the communication with a voice recorder without having to wait on - the - line for a confirmation that the voice message was successfully delivered and stored . the system also provides message durability in that once the voice message is recorded , the system ensures that despite device and network service outages , the voice message is saved in the common message store . a geographically distributed messaging system 100 comprising a media server 120 , document server 160 , and a common message store 170 , provides for message storage assurance and durability of voice messages . media server 120 couples the distributed messaging system 100 to one or more networks . document server 160 , located remotely from the media server 120 , manages storage of voice messages in common message store 170 . the complexities of interfacing to telecommunications networks such as the public switched telephone network ( pstn ) 115 are handled through a signaling gateway function ( sgf ) 117 coupled between media server 120 and pstn 115 with sigtran protocol used in the link between media server 120 and sgf 117 and signaling system 7 ( ss7 ) is used to perform out - of - band signaling in support of the call - establishment , billing , routing , and information - exchange functions between sgf 117 and pstn 115 . as illustrated in fig1 , media server 120 is also coupled to pstn 115 via t1 / e1 or other multiple channel links . a voice over ip ( voip ) gateway 133 integrates the media server 120 with a modular voice processor 130 or other devices that use session initiation protocol ( sip ). access control 107 manages the complexities of integrating multiple media servers 120 with internet protocol ( ip ) network 105 . when a single media server 120 is used , a communication link using sip , sigtran , or the h . 323 messaging protocols couples media server 120 to ip network 105 . one or more automatic - speech recognition ( asr ) modules 135 and one or more text - to - speech ( tts ) conversion modules are coupled to media server 120 to enable both audio and text input and output to / from distributed messaging system 100 . a voice over ip ( voip ) gateway 133 integrates the media server 120 with a modular voice processor 130 or other devices that use session initiation protocol ( sip ). a simplified protocol is used for communications between the remaining components of the distributed messaging system . voice extensible markup language ( voicexml or vxml ) is one mode of communication between media server 120 and remotely located document server 160 . vxml , which uses hypertext transfer protocol ( http ) to communicate information in packets , allows a user to interact with devices coupled to ip networks using voice - recognition technology . instead of a traditional graphical user interface based browser , vxml relies on a voice browser and / or any of a plethora of voice - based devices such as telephones , mobile phones and combination devices . instead of a traditional browser that relies on a keyboard and a mouse , vxml relies on a voice browser and a voice - based device . using vxml , the user interacts by listening to audio output that is either pre - recorded or synthesized and submits input through the user &# 39 ; s natural speaking voice or a touch - tone keypad . vxml is designed for creating audio dialogs that feature synthesized speech , digitized audio , and recognition of spoken and dual - tone multiple frequency encoded inputs , recording of voice messages , and mixed conversations . as will be explained in further detail below , vxml http requests are communicated from media server 120 to document server 160 , which manages the storage , confirmation , and retrieval of voice messages saved in common message store 170 . application server 150 , coupled to document server 160 and internet 155 , provides a mechanism for subscribers of the distributed messaging system and third - parties with proper access privileges to access previously stored voice messages from common message store 170 . messages are durable when once a subscriber records a message in a vxml session , the message is saved and accessible via a common message store remotely located from the subscriber despite media server 120 failures , document server 160 failures and wide area network service outages . this is accomplished because message storage from a local data store to the remotely located common message store can be asynchronous . that is , the subscribing caller does not need to wait on - the - line for acknowledgement of a successful transfer of the message . because the common message store comprises an array of disks , the messages and metadata stored therein can survive numerous device failures and request restarts for transfers of message blocks . fig2 is a functional block diagram illustrating an embodiment of a message durability subsystem 200 that can be implemented within the distributed messaging system 100 of fig1 . the message durability subsystem 200 comprises media server 120 , document server 160 , and common message store 170 . media server 120 comprises a message deposit application 222 coupled to vxml browser 224 . message deposit application 222 prepares and controls the media server 120 to enable message recording . vxml browser 224 is further coupled to sender 140 and local data store 220 . vxml browser 224 communicates with sender 140 via tcp / ip . local data store 220 comprises file system 226 , which provides a filename and path to associate with the actual voice data and database 228 , which saves and associates metadata with a recorded voice message . sender 140 communicates requests to document server 160 via simple object access protocol ( soap ). sender 140 provides a socket connection for vxml browser 224 . the socket connection can be accessed by multiple languages using multiple computing platforms . request information transferred to the document server 160 includes attachment file path and name , message type identifier , message status identifier , time for delivery , originator identifier , and identifiers for one or more recipients . sender 140 is configured to save the request including message request delivery state information into local data store 220 , send message header information ( metadata ) together with the attachment file to the document server 160 , delete the request and delivery information when the message has been successfully delivered to the document server 160 , and retry delivery for messages that are not successfully delivered . document server 160 comprises receiver 262 , message server 264 , message manager 266 , unified message service 280 , layered service provider server 268 , and application 270 . receiver 262 is configured to receive the soap requests from sender 140 , retrieve the message information and attachments , invoke the unified message service to create a java message service message and save the created message in message server 264 persistently . receiver 262 is further configured to handle soap fault reporting when data transfer errors occur . unified message service 280 communicates with message server 264 via connector 285 . message server 264 provides persistent storage to the message and related data on the document server 160 , asynchronous message delivery , ensures once - and - only - once delivery of the message to the common message store 170 , and deletes the message when the message has been successfully stored in the common message store 170 . message manager 266 gets messages from the message server 264 , then forwards them to the common message store 170 using the link provided by the unified message service application interface and the layered service provider server 268 . message manager 266 is configured to status the message server 264 regarding whether the message was successfully delivered to the common message store 170 . message manager 266 is further configured to retry message delivery for messages that were not successfully uploaded and integrated with the common message store 170 . two approaches for providing message attachment are contemplated . the first approach is that the attachment content of the soap message received by the receiver 262 is delivered to the message server 264 together with the header information or metadata as one java message service compatible message without writing to an intermediate file . using this approach , the receiver 262 and the message server 264 have the flexibility to be distributed so that any document server is able to deliver a message stored in the message server 264 to the common message store . the alternative approach is that the attachment content of the soap message received by receiver 262 is saved into a file , then the file name and message metadata are delivered to the message server 264 . using this approach , the message server handles text data only . application server 270 , interposed between unified message service 280 and vxml browser 224 , exposes previously stored messages to one or more subscribers communicatively coupled to media server 120 . fig3 is a functional block diagram of an embodiment of a message channel 300 that links document server 160 to the common message store 170 of the message durability subsystem 200 of fig2 . as indicated in fig3 , application 270 , operable on or in communication with document server 160 , is coupled via unified message service 280 and a layered service provider ( lsp ) server 268 to an upper library 340 and lower library 350 . the unified message service 280 includes a connector 285 configured as a common object request broker architecture ( corba ) client . layered service provider server 268 is configured as corba server . layered service provider server 268 provides a robust , efficient and scalable message and subscriber preference adjustable service . connector 285 communicates with layered service provider server 268 via internet inter - orb protocol ( iiop ). upper library 340 is a high - level application interface that encapsulates device - specific logic in lower library 350 . upper library 350 includes multiple functions for supporting messaging services . lower library 350 uses a peer - to - peer protocol to communicate with storage device 360 , storage device 362 , and storage device 368 and additional storage devices ( not shown ) under the management and control of common message store 170 . fig4 is a system diagram illustrating the components and data flow within the distributed messaging system 100 . distributed voice messaging system 100 includes a message durability subsystem 200 , which comprises media server 120 , document server 160 , and a common message store ( not shown ). the media server 120 can be configured with internal and or externally coupled data storage devices used to provide the previously introduced file system 226 and local data store 228 functions . media server 120 is communicatively coupled to remotely located document server 160 via a packet - switched wide area network . media server 120 is further coupled to pstn 115 . in operation , subscriber 405 initiates a call with a telephone 410 at a location coupled to pstn 115 . the call is established over pstn 115 and terminated by media server 120 , which provides the telephony interface between pstn 115 and distributed messaging system 100 . message deposit application 222 , operable within media server 120 , generates a new filename for the message about to be recorded and collects or otherwise generates new metadata 432 in accordance with one or more identifiers used to classify or otherwise describe the nature of the call , subscriber , and the voice message . metadata 432 is associated with the filename . the message deposit application 222 addresses the vxml browser 224 , sender 140 , file system 226 , and local data store 228 to ensure the media server 120 is prepared to record the voice message . if any of these devices reports a non - ready condition to the message deposit application 222 , the message deposit application 222 immediately informs the subscriber 405 that a system failure has occurred that the message cannot be recorded and aborts the recording process . otherwise , if each of the media server devices is ready , voice message 434 is recorded and temporarily stored within media server 120 . thereafter , the subscriber 405 can access other system functions or terminate the call without waiting for acknowledgment that the voice message 434 has been saved in the common message store 170 . the message deposit application 222 in accordance with a self - generated initialization trigger or an externally generated signal forwards a request to sender process 440 to forward the data to remotely located document server 160 . sender process 440 accepts the request 444 , saves the request 444 and metadata 442 in a local database , and forwards the request 444 via an ip based network to a receiver associated with the document server 160 . the document server 160 , in turn saves a received copy of metadata 462 and message 464 in a common data store 170 ( not shown ). fig5 is a schematic diagram illustrating an embodiment of the distributed messaging system of fig1 when a subscriber retrieves a voice message . as indicated by the illustrated embodiment , document server 160 may be associated with or controlled by various applications operable on application server 150 . thus , a subscribing user with appropriate access to an ip based network that is coupled to application server 150 can access , review , comment , and forward previously stored voice messages integrated via document server 160 in common message store 170 . in addition to providing access to subscribers via application server 150 , previously stored voice messages can be returned to a subscribing caller 405 coupled to the distributed voice messaging system 100 via pstn 115 . one or more applications operable on or in communication with document server 160 can return voice messages via vxml browser 224 associated with media server 120 . fig6 is a flow diagram illustrating an embodiment of a method 600 for generating and locally storing a voice message . as described above , the media server 120 is configured to record and locally store incoming voice messages . media server 120 provides the locally stored voice messages to document server 160 at an appropriate time for transfer to common message store 170 . media server 120 is configured with appropriate processing resources to concurrently store one or more incoming voice messages in a local data store coupled to the media server 120 , while allowing access to previously stored “ local ” voice messages . method 600 begins with block 602 where a call , originated by a subscriber of the distributed voice messaging system 100 ( fig1 ) is serviced by media server 120 . next , as indicated in block 604 , the subscriber is prompted to record a voice message at some time during the call . the subscriber records the voice message , as shown in block 606 . thereafter , media server 120 generates a filename for the voice message and associates appropriate metadata for identifying the voice message , as indicated in block 608 . after the voice message has been recorded , the filename , voice message and any header information , such as metadata is stored in a local data store 228 , as indicated in input / output block 610 . metadata associated with the voice message includes storage location , type , caller , session , urgency , and confidentiality identifiers . the local storage location identifier contains an absolute path and filename of the data file on local file system 226 . the type identifier indicates whether the processed message is a voice or a fax message . the caller identifier indicates a subscriber identification if the message depositor is a subscriber of the system . otherwise , the caller is identified as a “ guest .” the session identifier indicates a depositor session identification . the urgency identifier indicates whether the associated message is a high priority message or a standard priority message that may be processed and addressed in due course . the confidentiality identifier indicates whether the message is designated for access to a limited number of recipients . metadata associated with the voice message also identifies the message sender and one or more message recipients . additional and optional metadata associated with a voice message may include information indicative of a preferred date and time for delivery . when not associated with the message the media server 120 is configured to periodically initiate the transfer of a new message to common message store 170 . conditional metadata is also associated with some messages processed by the distributed messaging system 100 . for example , conditional metadata identifies when the stored voice message is a comment referring to an attached forwarded message . in addition to a forwarded message identifier , conditional metadata includes forwarded message note and dictation length identifiers . the forwarded message identifier is the message identifier associated with the forwarded voice message . the forwarded message note identifier is a separate identifier associated with a note or comment regarding the forwarded message . the dictation length identifier indicates the length of the forwarded message associated with the note . fig7 is a flow diagram illustrating an embodiment of a method for message storage assurance 700 that can be implemented using the distributed messaging system 100 of fig1 . the method for message storage assurance 700 involves forwarding the locally - recorded and stored messages at the appropriate time to the common message store 170 and sending confirmation back to the media server 120 that the message has been stored . the method for storage assurance 700 begins with block 702 by polling the local data store associated with the media server 120 for new voice messages 434 . when a new voice message 434 has been detected , as indicated by a positive response from query 704 , the media server 120 provides an indication to the document server 160 , which in turn , notifies the common message store 170 in block 706 of the presence of the new message . as indicated in block 708 , the common message store prepares space for the new voice message designated for integration in common message store 170 . next , as shown in block 710 and query block 712 , common message store 170 requests message content using a block - by - block repetitive process until the entire message has been delivered via the document server 160 and received in the common message store 170 . once the entire message has been received , common message store 170 sends an acknowledgement that the entire message has been received , as shown in block 714 . the acknowledgement issued from the common message store 170 is received and forwarded by document server 160 as shown in block 716 . the acknowledgement received by document server 160 is forwarded to the media server 120 as shown in block 718 . the acknowledgement received by media server 120 confirms that the voice message has been successfully stored and integrated with common message store 170 . in an alternate embodiment , polling for new messages in the local data store 228 associated with the media server 120 may be performed by software or firmware operable within the document server 160 or by an application in communication with document server 160 . in this way , one or more remotely located devices can be configured to monitor multiple media servers . fig8 a and 8b are a flow diagram illustrating an alternative embodiment of a method 800 for message storage assurance that can implemented using the distributed messaging system 100 of fig1 . method 800 begins with block 802 where a local data store 228 co - located with a local voice mail system is polled to determine if a voice message has been stored to the data store 228 . thereafter , as indicated by input / output block 804 , the common message store 170 is notified that a new voice message is present in the ( remotely located ) local data store 228 . next , the voice message is transferred to the common message store 170 from the local data store 228 as illustrated in input / output block 806 . a query 808 and an associated wait process 810 are repetitively performed until the voice message has been successfully stored in its entirety in the common message store 170 . at this point , the voice message has been stored in the common message store 170 . as indicated by connector a , which associates the steps illustrated in fig8 a with those shown in fig8 b , method 800 continues with block 812 where the stored voice message is made available to the subscriber and those with access privileges that are communicatively coupled to the document server 160 and common message store 170 . in block 814 , the message stored in the local data store 228 is deleted . the functions illustrated in blocks 812 and 814 may be performed out - of - sequence or substantially simultaneously . fig9 a and 9b are a datagram illustrating an embodiment of message flow through the distributed message system 100 of fig1 during a message transfer from local data store 228 to common message store 170 . as shown in the sample embodiment , a host of communications are sent and received by various system entities . a caller device both records a message and forwards an object tag to a vxml browser . the vxml browser saves or otherwise associates the recorded message into a file and sends a request to temporarily store the message in the local data store . a sender process accepts the request , saves the request in a local database , forwards the request to a receiver associated with the document server 160 . the receiver delivers the message via a unified message service to a message server . the message server queues the message request , receives , and forwards the message to a message manager . the message server retains the message and associated metadata until it receives an acknowledgement from the message manager that the message has been successfully processed into the common message store . in the illustrated embodiment , once the message server queues the message , an acknowledgement is forwarded to the vxml browser via the unified message service connection , receiver , and sender in that order . when the sender receives the acknowledgement that the message has been queued in the message server , the sender deletes the message and associated data that were temporarily stored in the local data store . in an alternative embodiment , the acknowledgement stream from the message server to the vxml browser may be withheld or otherwise delayed until the message server receives a positive acknowledgment from the common message store . the message manager receives the message from the message server and forwards the message to a unified message service application interface , which in turn forwards the message via a lsp server that deposits the message in the common message store 170 . once the common message store has successfully deposited the message , an acknowledgement message identified by the associated message identifier is forwarded to the message server via the lsp server , unified message service application interface and message manager , in that order . in response , the message server deletes the message and associated metadata . fig1 a and 10b are a datagram illustrating an embodiment of message flow through the distributed messaging system 100 of fig1 during message or greeting retrieval from common message store 170 . as shown in the sample embodiment , a host of communications are sent and received by various system entities . a vxml browser initiates a request to get voice message blocks which is forwarded via a message application and message server to an upper or first library . when the request is for voice message blocks , the upper library responds to the request by issuing a get account data process . if the account data is not available in the upper library , the upper library forwards a request to get the account data from the lower or second library . the upper library caches the account data returned from the lower library . thereafter , the upper library uses the cached account data to issue a request for message record data . if the message record data is not available in the upper library , the upper library forwards a request to the record data from the lower library . thereafter , the upper library uses the record data to generate a request for a voice block . not illustrated but implied by the datagram , the lower library responds by forwarding the identified voice block from the common message store which is returned to the vxml browser via the upper library , message server , and message application interface in that order . when the request is for a greeting , the upper library responds to the request by issuing a get greeting message data process . if the greeting message data is not present in the upper library , the upper library forwards a request to get the greeting message data from the lower or second library . the upper library caches the greeting message data returned from the lower library . thereafter , the upper library uses the cached greeting message data to issue a request for a voice block that includes the greeting . not illustrated but implied by the datagram , the lower library responds by forwarding the identified voice block from the common message store which is returned to the vxml browser via the upper library , message server , and message application interface in that order . the flow diagrams of fig6 - 8b and the datagrams of fig9 and 10 show the architecture , functionality , and operation of a possible implementation via software and or firmware associated with a host of communicatively coupled hardware devices that causes the process of collection , integration and distribution of voice - based messages to be performed . in this regard , each block represents a module , segment , or portion of code , which comprises one or more executable instructions for implementing the specified logical function ( s ). it should also be noted that in some alternative implementations , the functions noted in the blocks may occur out of the order noted in the drawings . for example , two blocks shown in succession in the flow diagram of fig8 b may in fact be executed substantially concurrently or the blocks may sometimes be executed in the reverse order , depending upon the functionality involved . the operational software programs that may be used by the various devices of the distributed messaging system 100 , as well as operational software that may be used in conjunction with the vxml browser , telephonic devices , and applications that interface with distributed messaging system 100 , which comprise an ordered listing of executable instructions for implementing logical functions , can be embodied in any computer - readable medium for use by or in connection with an instruction execution system , apparatus , or device , such as a computer - based system , processor - containing system , or other system that can fetch the instructions from the instruction execution system , apparatus , or device and execute the instructions . in the context of this document , a “ computer - readable medium ” can be any means that can contain , store , communicate , propagate , or transport the program for use by or in connection with the instruction execution system , apparatus , or device . the computer - readable medium can be , for example but not limited to , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , device , or propagation medium . more specific examples ( a non - exhaustive list ) of the computer - readable medium would include the following : an electrical connection ( electronic ) having one or more wires , a portable computer diskette ( magnetic ), a random access memory ( ram ) ( magnetic ), a read - only memory ( rom ) ( magnetic ), an erasable programmable read - only memory ( eprom or flash memory ) ( magnetic ), an optical fiber ( optical ), and a portable compact disc read - only memory ( cdrom ) ( optical ). note that the computer - readable medium could even be paper or another suitable medium upon which the program is printed , as the program can be electronically captured , via , for instance , optical scanning of the paper or other medium , then compiled , interpreted or otherwise processed in a suitable manner if necessary , and then stored in a computer memory . while various embodiments of the systems and methods for message storage assurance have been described , it will be apparent to those of ordinary skill in the art that many more embodiments and implementations are possible that are within the scope of the accompanying claims . accordingly , the systems and methods for message storage assurance are not to be restricted beyond the attached claims and their equivalents . | 7 |
in fig1 a portion of a standard integrated circuit device is schematically depicted . the illustrative device includes two conductive elements 10 and 12 disposed on a substrate 14 . herein , for purposes of a specific example only , the elements 10 and 12 will be assumed to be made of doped polysilicon and the substrate 14 will be assumed to be made of silicon . deposited on the top surface of the substrate 14 and covering the elements 10 and 12 is a conventional passivating layer 16 of phosphorus glass . in accordance with standard steps of a known device fabrication sequence , openings or windows are formed in the layer 16 of fig1 in aligned registry with the conductive elements 10 and 12 . a conductive material such as aluminum is then deposited on the top surface of the device and in the aligned windows to establish electrical connections to the underlying elements 10 and 12 . as is well known in the art , the aforespecified windows in the layer 16 may be formed by depositing a radiation - sensitive resist layer 18 on the layer 16 . by standard patterning techniques , openings are made in the resist layer 18 directly overlying the windows to be formed in the passivating layer 16 . then , using the patterned resist as a masking layer , the desired windows are formed in the layer 16 by , for example , standard etching techniques . in one actual device embodiment , the steeply stepped elements 10 and 12 of fig1 each have a vertical height h above the top of the substrate 14 of approximately one micrometer ( μm ). as a result of the irregular topology introduced by the elements 10 and 12 , the overlying layer 16 typically exhibits a nonplanar top surface and a variable thickness . similarly , the resist layer 18 also has a variable thickness . in addition , as discussed earlier above , the layer 18 must as a practical matter be designed thicker than desired thereby to insure adequate step coverage over contours in the nonplanar top surface of the passivating layer 16 . consequently , it has been found in practice that a microminiature device made by techniques of the type represented in fig1 often does not possess adequate resolution and linewidth control to meet stringent requirements specified for certain categories of large - scale and very - large - scale integrated circuit devices . to illustrate the applicability of applicants &# 39 ; inventive principles to the fabrication of integrated circuit devices , a particular device structure of the same type as that depicted in fig1 will be assumed . it will be apparent though that these principles are general purpose in nature and thus applicable to making a wide variety of integrated circuit , as well as discrete , devices . moreover , although primary emphasis herein is on fabricating silicon devices , it is obvious that these principles are also applicable to various known magnetic devices , integrated - optics devices , etc . as in fig1 each of fig2 through 5 shows a portion of a specific illustrative device structure having a substrate 14 , conductive elements 10 and 12 and a passivating layer 16 . in accordance with the principles of the present invention , a relativvely thick sacrificial layer is applied to the top nonplanar surface of the layer 16 . as indicated in fig2 this thick layer ( designated by reference numeral 18 ) has a bottom surface that conforms to the contours of the top surface of the layer 16 . but in practice , in accordance with the specific teachings set forth in detail below , the top surface of the thick layer 18 can be accurately and reproducibly controlled to be essentially flat . accordingly , a basis is provided for depositing an extremely thin and uniform layer to be patterned on top of the essentially flat surface . step coverage considerations are thereby virtually removed as a factor in selecting the thickness of the layer to be patterned . in that way , very - high - resolution patterning , with excellent linewidth control , is achieved . in fig2 the aforementioned thin layer to be patterned is designated by reference numeral 20 . in accordance with one specific aspect of the principles of the present invention , a so - called intermediate masking layer 22 is interposed between the layers 18 and 20 . but , in appropriate circumstances , which will be specified later below , the layer 22 may be omitted . in that case , of course , the layer 20 is applied directly to the essentially flat top surface of the sacrificial layer 18 . for now , the layer 22 will be assumed to be included in the depicted structure . in accordance with the principles of the present invention , the thin layer 20 shown in fig2 comprises a positive or negative resist material that can be selectively patterned by , for example , directing light , electrons , x - rays or ions thereat . a wide variety of such materials are well known in the art . many standard techniques are available for selectively exposing and developing these materials to form a specified high - resolution pattern in the layer 20 . in accordance with the principles of this invention , the sacrificial layer 18 shown in fig2 comprises an organic material capable of conforming and adhering to the nonplanar top surface of the passivating layer 16 . advantageously , this material is applied on top of the layer 16 by standard spinning techniques . in practice , it has been found that as the thickness of such a spun layer 18 is increased , the degree of flatness of the top surface thereof increases . in one specific illustrative embodiment of the principles of the present invention , wherein each of the elements 10 and 12 of fig2 had a height h of one μm and the layer 16 had a thickness m of one μm , the layer 18 constituted a spun - on layer of a novalac - resin positive photoresist having a thickness n of approximately 2 . 6 μm . in one such particular case , the maximum variation between peaks and valleys in the top surface of the layer 18 was measured to be only about 1000 angstrom units ( a ). herein , such a surface will be termed essentially flat . by contrast , the corresponding variation p in the top nonplanar surface of the layer 16 was measured to be about one μm . in accordance with the present invention , a variety of organic materials characterized by ease of application ( spinning , spraying , etc .) and good adhesion to the underlying surface are suitable for forming the sacrificial layer 18 shown in fig2 . the material selected for the sacrificial layer should advantageously be respectively resistant or susceptible to the several processing techniques specified later below . moreover , for use in a photolithographic fabrication sequence , it is advantageous that the material of the layer 18 be highly absorptive of the light utilized to selectively expose the overlying resist layer 20 . in addition , it is often advantageous in such a sequence that the layer 18 have an index of refraction that closely matches those of the layers 20 and 22 . in that way , the common problems of standing waves and scattering in photolithography are minimized . further , for use in electron - beam and x - ray lithography , it is advantageous that the layers 18 and 22 be low - electron - scattering materials thereby to minimize proximity effects in the overlying resist material . in accordance with the principles of the present invention , a number of available organic materials are suitable for forming the sacrificial layer 18 of fig2 . such materials include a variety of known positive and negative resists such as , for example : standard novalac resins , polymethyl methacrylates , poly ( 2 , 3 - dichloro - 1 - propyl acrylate ), poly ( glycidyl methacrylate - co - ethyl acrylate ), combinations of the two last - specified materials and other poly isoprenes , materials of the type described in u . s . pat . no . 3 , 201 , 239 or u . s . pat . no . 3 , 770 , 433 , and hunt hpr - 104 which is commercially available from phillip a . hunt chemical corporation , palisades park , n . j . in addition , a variety of known polymides such as kapton ( which is a registered trademark of e . i . dupont de nemours and co .) or pyralin are suitable for forming the layer 18 . other such suitable materials include standard epoxy groups . in one specific illustrative embodiment of the principles of the present invention , the structure shown in fig2 comprises a one - μm - thick layer 20 made of poly ( 2 , 3 - dichloro - 1 - propyl acrylate ) ( a negative x - ray resist ), a 1500 - a - thick layer 22 of silicon dioxide and a 2 . 6 - μm - thick layer of a standard novalac - resin positive photoresist . in that particular embodiment , the layer 18 is characterized by an essentially flat top surface ( maximum peak - to - valley height of 1000 a ). the top surface of the layer 22 is similarly flat . as a result , the overlying thin resist layer 20 exhibits a substantially uniform thickness . patterning of the layer 20 of fig2 is done by conventional lithographic techniques . for the case wherein the layer 20 is made of an x - ray resist material , patterning is carried out by means of a known x - ray exposure tool . after being exposed and developed in standard ways , the patterned layer 20 typically exhibits a reduced uniform thickness . the remaining portions of the layer 20 , comprising a specified pattern , are shown in fig3 . each such portion is designated by reference numeral 24 . subsequently , using the portions 24 of fig3 as a mask , the layer 22 is correspondingly patterned . in accordance with one aspect of the principles of the present invention , this patterning is advantageously ( but not necessarily ) done by one of several techniques each of which achieves near - vertical walls and substantially no undercutting in the layer being patterned . accordingly , the resulting pattern in the layer 22 conforms substantially exactly to that originally formed in the resist layer 20 . the remaining conforming portions of the layer 22 are shown in fig4 wherein each such portion is designated by reference numeral 26 . patterning of the layer 22 ( fig3 ) may be carried out , for example , by a reactive sputter etching process of the type described in &# 34 ; profile control by reactive sputter etching ,&# 34 ; by h . w . lehmann and r . widmer , journal of vacuum science and technology , pages 319 - 326 , march / april 1978 . alternatively , the layer 22 may be plasma etched in accordance , for example , with the process described in a commonly assigned copending application of w . r . harshbarger , h . j . levinstein , c . j . mogab and r . a . porter , ser . no . 929 , 549 , filed july 31 , 1978 . in accordance with the harshbarger et al . technique , etching is based on establishing a plasma that contains both recombination centers and active etchant species . in a selectively controllable way , recombination centers effectively terminate etchant species lifetime in the immediate vicinity of etched walls , thus providing a means for precisely controlling etching and anisotropy . other known dry processing techniques characterized by controllable etching anisotropy may be utilized for patterning the layer 22 of fig3 . the relative etching rates of the layer 22 and the overlying masking regions 24 will be an important consideration in selecting an appropriate technique for patterning a particular combination of materials . moreover , although it may in some cases be particularly advantageous to utilize a dry processing technique characterized by anisotropy to pattern the layer 22 , it should be recognized that it is also feasible to employ isotropic techniques such as standard wet processing techniques therefor . next , using the patterned portions shown in fig4 as a mask , the thick sacrificial layer 18 is correspondingly patterned . in accordance with aspects of the principles of the present invention , patterning of the layer 18 is advantageously carried out by , for example , ion milling , sputter etching or reactive sputter etching , which dry processes are specified in detail below . significantly , applicants found that such processes are capable of patterning thick organic layers of the type described herein to achieve near - vertical walls while substantially avoiding undercutting therein . as indicated above , the sacrificial layer 18 shown in fig4 may be ion milled . this may be done in a standard ion milling apparatus utilizing , for example , an inert or substantially inert atmosphere of argon , helium , krypton , neon , xenon or nitrogen at a pressure in the range 1 to 100 μm at an operating voltage in the range 50 to 2000 volts . alternatively , the layer 18 may be sputter etched utilizing , for example , an inert or substantially inert atmosphere of argon , helium , krypton , neon , xenon or nitrogen at a pressure in the range 1 to 100 μm in an apparatus in which an asymmetrical dark space is established . this last - stated requirement minimizes contamination in the sputter etching apparatus during the etching process and insures that a sufficient ion - accelerating voltage is established in the apparatus between the plasma therein and the cathode on which the devices being processed are mounted . in addition , the layer 18 of fig4 may be patterned by reactive sputter etching in , for example , an atmosphere including a halocarbon such as carbon tetrafluoride and / or oxygen at a pressure in the range of 1 to 100 μm in an apparatus in which an asymmetrical dark space is established . during the course of etching or milling the sacrificial layer 18 of fig4 the patterned resist portions 24 are removed . by contrast , the patterned portions 26 are highly resistant to the aforespecified dry processing techniques and , accordingly , remain in place substantially unaffected . in one specific illustrative case in which the intermediate masking layer 22 originally comprised a 1200 - a - thick layer of plasma - deposited silicon dioxide , the thickness loss of the patterned portions 26 of the masking layer during sputter etching of the sacrificial layer 18 was less than 200 a . in accordance with the techniques described above , the masked sacrificial layer 18 of fig4 is processed to form therein a pattern that corresponds to the pattern defined by the portions 26 of the intermediate masking layer . the remaining patterned portions of the layer 18 are shown in fig5 and designated by reference numeral 28 . it is significant that the trenches or grooves formed in the sacrificial layer to establish the prescribed pattern therein are characterized by near - vertical walls and substantially no undercutting . importantly , the pattern formed in the thick layer 18 conforms substantially identically to the high - resolution pattern originally formed in the thin layer 20 . by using the patterned portions 28 ( fig5 ) as a mask , the layer 16 of the integrated circuit device being fabricated is then processed to form windows therethrough in alignment with the conductive elements 10 and 12 , as described earlier above . this is done , for example , in a standard plasma etching step . it is apparent that the particular window - forming sequence above is only illustrative of the applicability of the principles of the present invention to fabricating integrated circuit devices . by means of the thick patterned portions 28 shown in fig5 it is also , of course , feasible to treat exposed underlying regions of a device surface in accordance with a variety of standard fabrication processes ( such as deposition , diffusion , etching , implantation , etc .) after the patterned portions 28 ( fig5 ) have been utilized as a mask in the illustrative ways specified above , it is customary to remove the portions 28 from the surface of the device being fabricated . this is done , for example , by applying a suitable solvent to the structure depicted in fig5 or by processing the structure in a plasma etching step in an oxygen atmosphere . in either case , the portions 28 and the overlying portions 26 are thereby removed . the device is then ready for another step in its prescribed fabrication sequence , which may include further processing by means of a patterned sacrificial layer in accordance with the principles of the present invention . in some cases of practical interest , it has been observed that the presence of metals in the chamber in which dry processing of the sacrificial layer 18 is carried out causes so - called texturing ( metallic oxide fibers ) to occur on the device surface . the formation of such fibers can be prevented by avoiding the use of any exposed metallic surfaces in the processing chamber . this dictates , for example , that a nonmetallic material ( such as the aforespecified silicon dioxide , or boron nitride or silicon nitride or glass ) be utilized for the intermediate masking layer 22 . ( the term &# 34 ; glass &# 34 ; as employed herein includes , for example , a variety of spun - on liquid glasses , silica films , glass resins and spun - on oxides which are essentially ta 2 o 5 or tio 2 .) in accordance with the principles of the present invention , the intermediate masking layer 22 may in some cases be omitted altogether . this is feasible whenever the materials utilized to form the thin resist layer 20 and the thick sacrificial layer 18 exhibit relatively high and low resistance , respectively , to the particular dry processing technique employed to pattern the layer 18 . thus , for example , a 0 . 5 μm - thick layer 20 of a silver halide emulsion can serve , when patterned , as a mask for ion milling or sputter etching a corresponding pattern in the layer 18 . finally , it is to be understood that the above - described arrangements and techniques are only illustrative of the principles of the present invention . in accordance with those principles , numerous modifications and alternatives may be devised by those skilled in the art without departing from the spirit and scope of the invention . for example , although emphasis herein has been directed to applying applicants &# 39 ; inventive principles to the direct fabrication of integrated circuit devices , it is to be understood that those principles are also applicable to the fabrication of high - resolution mask structures which , in turn , are used to make integrated circuit devices . thus , illustratively , it is feasible to form patterned regions ( such as those designated 26 and 28 in fig5 ) on an essentially flat 0 . 02 - μm - thick film of gold which is deposited on top of a 0 . 01 - μm - thick layer of titanium supported on a planar polymide film . then , by using the patterned regions as a mask , a relatively thick layer of gold can be electroplated onto the exposed regions of the gold film . in that way , high - resolution gold elements definitive of a prescribed mask structure are formed for use , for example , in an x - ray lithographic system . moreover , in accordance with aspects of the principles of the present invention , a thick patterned sacrificial layer on a planar surface may be utilized as a masking layer for , for example , ion implantation purposes . | 7 |
the invention relates to a method and apparatus for dynamic programming across a computer network . the invention includes a method of programming a server computer from a client computer using logical components to build the program . each logical component has the capability to perform a function that is delivered to the client computer , and which performs tasks that adds value to the overall system . [ 0018 ] fig1 depicts a network of a server and clients such as is known on the world wide web and includes a large set of web servers and web clients . the servers are used to store and deliver information over a wide area network ( wan ) to clients . fig1 depicts a very small network 10 that contains five clients 12 , 14 , 16 , 18 and 20 and one server 22 . the clients normally make requests for information from the server over the network . as shown in fig2 a - 2 b , the server 22 can publish a static html page to the client 12 . alternately , as shown in fig2 c , the server 22 can utilize a user profile to publish a customized page to the client 12 . if a user profile is employed , the user profile is identified by the user logging onto the server or by the server retrieving client identification by a technique such as cookies ( information stored on the client ). this process normally uses a template similar to that shown in fig3 and replaces the “ tag ” with information provided in the user profile . the template shown in fig3 is coded in html and displays the open / close html tags . the program using this template is requested by the client 12 and the server 22 for the information to be merged and published to the client 12 . the server program that performs these tasks including the user interface must be pre - compiled prior to the client making the request . this pre - compilation is a conventional technique that does not allow program steps to be rearranged in order to perform a different task or process . the invention employs a computer structure 50 shown in fig4 . this structure includes a conventional cpu 52 such as an intel pentium running an operating system such as windows nt or unix . a memory 54 is connected to the cpu and includes a program portion 56 , a data portion 58 and a general portion 60 . the program portion 56 includes a server program 56 a for program execution and for retrieving logical components 56 b to assemble into the user program . the data portion 58 includes an available component portion 58 a , a user profile portion 58 b and a user specified component portion 58 c . by assembling the user specified logical components as described below and sequentially storing pointers in data portion 58 c , the server program 56 a can execute each user program according to each user &# 39 ; s specification , without the need for the user to have a compiler . the computer structure 50 also includes a web interface 62 for communicating with clients . this interface is configured to receive calls from the clients and to transmit responses to the clients . the server 50 is also a fully functional computer and can become a client to other servers on the network when desired by a user via user interface 64 . [ 0023 ] fig5 depicts logical components assembled into a user program 70 . this assembly of logical components comprises a user program . the exemplary program includes seven components that are assembled to perform a complex process . these components are stored within memory portion 58 a and are available to the cpu 52 . a reference to each logical component is stored in the user profile memory portion 58 b in sequence of the specific user program specified by the user . an exemplary user profile is shown in table 1 . the user profile is typically retrieved when the user requests execution of their user program . table 2 unique identifier interface definition task - summarized data action 1 - retrieve input arguments for the for the current month current month manufacturing workload action 2 - query database based on arguments and output to an html action 3 - sum the results from query format action 4 - format and output summed results in html format exception handling memory management with regard to the actions , each defined logical component performs a predetermined task . in a manufacturing plant example , the logical components 72 through 84 perform the following tasks shown in table 3 . [ 0027 ] fig6 depicts available logical components as stored in memory portion 58 a . these components are available for selection by the user in order to build a user program . when the user specifies the desired components , the components are arranged in sequence in the memory portion 58 b . once the specified components are arranged , the server program stored in memory portion 60 assembles the specified components and generates the user program 70 . each example task above represents a logical component . the user program 70 is assembled on the server over the computer network by the user specifying pre - programmed components and then initiating the assembly . these components can also be re - assembled across the network to perform a significantly different task for a different user without having to re - compile the server program 56 a . the invention is used to perform complex processes defined by the user or the requesting client on the server or a system connected to the server . the invention has the capability of performing actions programmed remotely across a computer network , these actions can be a variety of processes , such as producing pages from several databases or delivering any media that can be transmitted over a computer network or any set of program steps such as managing and controlling a manufacturing site . examples of other tasks and sub - tasks are : evaluating values from a chemical analysis ; identifying out of range values ; formatting the out of range values and valid ranges into a textural message for an user ; interrogating a database for a set of e - mail addresses for interested parties regarding test results ; and sending an email formatted message to each interested party . the server program execution is performed as described below . by constructing logical components and storing their pointers in sequence in data portion based on the user &# 39 ; s profile 58 b , the server program can execute each user program without the need to re - compile the server program . execution of the logical components requires the base programming language to have the ability to dynamically load , bind and execute pre - built logical component of programming code . fig7 is a flowchart of the server program depicting process steps under an execution of the logical components that are assembled into the user program according to an embodiment of the invention . this flowchart provides details of the actions required to load and execute an user program . in step 102 , the server program identifies the user and retrieves the user profile for that identified user . step 104 retrieves the specified logical components based on the user profile . step 106 retrieves the list of logical components that are to be executed in sequence and stored in memory . step 108 retrieves logical component defaults for the requested program and store in memory . step 110 allocates a memory work space of required details to execute each logical component . step 112 packages required parameters and arguments for each logical component . step 114 determines if the logical component is loaded into memory . step 116 checks if the logical component is not loaded , then it loads the logical component into memory . step 118 binds the call to the newly loaded logical component and pass the required parameters . step 120 retrieves the output from the logical component if an output was produced . step 122 appends the results to any previously constructed results . step 124 determines if all the logical components have been called . if more logical components need to be called , step 126 queues the next logical component and restarts the execution process at step 114 . if all the logical components have been called and executed then step 128 outputs the results of all logical components to the web interface 62 or the user interface 64 . this process describes the server program as it retrieves and binds logical components stored in memory portion 56 b to create the user program . within fig7 steps 106 and 118 are important to insure that the correct program is executed by calling and late - binding the call to the correct logical component . each logical component must have a defined interface so that the server program can identify and call it to perform the required task . the logical component can perform any variety of logical task by accessing a data source ( s ), formatting information , requesting data that the user has entered and acting on that data , such as storing the information into a database . each logical component can act independently of other requested logical components or act in concert with each other . the independent action of each logical component is important because it allows the assembly of logical components that have been constructed by different programmers and possibly by independent methodologies . this enables the workload for an entire system to be divided among a group of programmers , provided that they follow predetermined interface rules of the server program . the server program and these logical components work in concert to perform the tasks . because each logical component is called independently , they can access information across a system without concern of interference from other logical components . the following exemplary steps for logical components depicted in table 4 are generalized from a specific method . advantages of the invention include the ability for a network client or web - browser to program or re - program a remote server &# 39 ; s actions , tasks and methods without a compiler . this allows a variety of tasks to be combined to produce work output that is easily modifiable by the user over a wide area network . having disclosed exemplary embodiments and the best mode , modifications and variations may be made to the exemplary embodiments while remaining within the scope of the invention as defined by the following claims . | 7 |
throughout all the figures , same or corresponding elements may generally be indicated by same reference numerals . these depicted embodiments are to be understood as illustrative of the invention and not as limiting in any way . it should also be understood that the figures are not necessarily to scale and that the embodiments may be illustrated by graphic symbols , phantom lines , diagrammatic representations and fragmentary views . in certain instances , details which are not necessary for an understanding of the present invention or which render other details difficult to perceive may have been omitted . turning now to the drawing , and in particular to fig1 , there is shown a sectional view of a drive arrangement for driving a vertical mill , generally designated by reference numeral 2 . the drive arrangement includes a torque transmitter 12 and a fluid coupling 8 , with the torque transmitter 12 being arranged between the fluid coupling 8 and the vertical mill 2 . the vertical mill 2 operates as a work machine and has a grinding table 20 which is rotatable about a vertical rotation axis a . a grinding track is embodied on the top side of the grinding table 20 , upon which one or a number of grinding rollers 21 roll . the grinding table 20 is arranged in a torsion - resistant manner on a vertical upper end of a drive shaft 22 mounted in an axial bearing 23 and extending along the rotation axis a . a horizontally arranged gear rim 24 is arranged in a torsion - resistant manner on the shaft 22 below the grinding table 20 . a drive arrangement , comprising a motor 4 , a gearing 6 and a shaft 41 connecting the motor 4 and the gearing 6 serves to drive the drive shaft 22 . the shaft 41 comprises a first part , namely a drive shaft of the motor 4 , and a second part , a drive shaft of the gearing 6 . both parts are coupled by means of a fluid coupling 8 . the motor 4 drives an output - side pinion 61 of the gearing 6 by way of the fluid coupling 8 , said pinion 61 cogging with the gear rim 24 . a torque transmitter 12 is arranged between the fluid coupling 8 and the gearing 6 . this can be an automatically switching coupling , e . g . a free - wheel , if necessary with hydraulic support , or an externally - switched coupling , e . g . an electromagnetically or hydraulically switched multiple - disc coupling . during the milling operation , the torque of the motor 4 is transmitted via the shaft 41 , the fluid coupling 8 , the free - wheel 10 and the gearing 6 to the pinion 61 and the gear rim 24 . a rotation of the motor 4 therefore results in a rotation of the grinding table 20 in the work direction of the mill 2 . since the fluid coupling 8 in this case transmits the motor power to the gearing 6 , heat is generated in the fluid coupling 8 on account of the slip of the fluid coupling 8 . when operation of the mill 2 is now temporarily stopped , the fluid coupling 8 can be cooled down in this break of the drive by the torque transmission between the fluid coupling 8 and the mill 2 being temporarily interrupted and the fluid coupling 8 being rotated idling by the motor . since on account of the free - wheel 10 in this case the fluid coupling 8 transmits no power to the gearing 6 , the slip of the fluid coupling 8 is almost zero and there is no significant heat generation in the fluid coupling 8 . however , the rotation causes the fluid coupling 8 to “ ventilate ” and a large heat discharge from the fluid coupling 8 takes place so that the fluid coupling 8 essentially cools down more quickly than when stationary ; as a result the drive is ready to start again relatively quickly . in the case of the free - wheel , the motor 4 can be operated counter to the work direction of rotation , i . e . backwards . in the case of the detached multiple - disc coupling , the motor 4 can be operated in any direction , forwards or backwards . in the event that the mill has to be started up from stationary , the switchable torque transmitter 12 is also advantageous . by the torque transmission between the fluid coupling 8 and the mill 2 being temporarily interrupted , the motor can be brought to a predetermined speed without load . only after a defined speed of the motor has been achieved will the torque transmission between the fluid coupling and the work machine be re - established , i . e . the motor is coupled to the work machine again . this is particularly important when the mill has a number of drives , as shown in the exemplary embodiment shown in fig4 . the top view onto the vertical mill shows four drive arrangements arranged evenly around the mill axis a at the positions 0 , 90 , 180 , and 270 degrees , each comprising an electric motor 4 , a shaft 41 , a fluid coupling 8 , a switchable torque transmitter 12 and a gearing 6 with an output - side pinion 61 . the output pinions 61 of the drive arrangements all cog with a shared gear rim 24 , which is connected to a milling table 20 in a torsion - resistant manner . in this case the motors 4 can generally not be accelerated at the same time , because this would result in the electricity - supply system becoming overloaded . therefore , all motors 4 of the multiple point machine can be brought successively to idle speed , without the energy network being loaded with excessive current intensities . when all the motors 4 of the multiple point machine are up to speed , the clutch couplings 12 can be coupled simultaneously or according to a predetermined switching strategy . therefore all drive trains in an optimal case simultaneously generate the drive torque , wherein the drive torque is not restricted in terms of level and its temporal availability is at a maximum . fig2 shows a section of a drive arrangement for driving a vertical mill , in which a torque transmitter 11 is arranged between the motor 4 and the fluid coupling 8 . besides the difference that the torque transmitter 11 is arranged between the motor 4 and the fluid coupling 8 in the exemplary embodiment in fig2 , and not between the fluid coupling and the vertical mill in the exemplary embodiment in fig1 , the exemplary embodiment in fig2 corresponds to that in fig1 . when a temporary interruption in the torque transmission between the motor 4 and the fluid coupling 8 is effected by means of the switchable torque transmitter 11 , the motor 4 can be started up without the load of the work machine 2 . only after a defined speed of the motor 4 has been achieved will the torque transmission between the motor 4 and the fluid coupling 8 be re - established , i . e . the motor 4 is coupled to the work machine 2 again . this is particularly important when the mill has a number of drives , which cannot be started up simultaneously , because this would result in the electricity - supply system becoming overloaded . therefore , all motors of the multiple point machine can be successively brought to idle speed , without the energy network being loaded with excessive current intensities . when all motors of the multiple point machine are up to speed , the clutch couplings can be engaged simultaneously or according to a predetermined switching strategy . therefore in an optimal case all the drive trains generate the drive torque simultaneously , wherein the drive torque is not restricted in terms of degree and its temporal availability is at a maximum . fig3 shows a section of a drive arrangement for driving a vertical mill , in which a first torque transmitter 11 is arranged between the motor 4 and the fluid coupling 8 and a second torque transmitter 11 is arranged between the fluid coupling 8 and the vertical mill 2 . in this way the operator of the vertical mill 2 has complete freedom in terms of the manner in which he would like to perform the torque transmission , in order to achieve the afore - described advantageous technical effects . fig5 shows a time - temperature diagram with cooling curves of a stationary fluid coupling and a rotating fluid coupling , which clarifies the temporal advantage which can be achieved by the invention . the time t is plotted in the unit hours h and minutes min from 0 to 5 hours to the right on the horizontal axis . the temperature is plotted in the unit degrees celsius from 0 to 180 ° c . to the top on the vertical axis . the starting point of both curves is a fluid coupling heated to 160 ° c . the dashed curve is the cooling curve of the stationary fluid coupling . the stationary fluid coupling cools down relatively slowly and even after five hours of cooling time has still not reached the ambient temperature tu of 50 ° c . the solid curve is the cooling curve of the rotating fluid coupling . the fluid coupling can be operated by the motor without load due to a temporary interruption in the torque transmission between the fluid coupling and the work machine , i . e . can be rotated . this results in a cooling “ ventilation ” of the fluid coupling . the load - free rotating fluid coupling cools down considerably faster than the stationary fluid coupling and has reached the ambient temperature tu of 50 ° c . after approx . 50 minutes of cooling time . while the invention has been illustrated and described in connection with currently preferred embodiments shown and described in detail , it is not intended to be limited to the details shown since various modifications and structural changes may be made without departing in any way from the spirit and scope of the present invention . the embodiments were chosen and described in order to explain the principles of the invention and practical application to thereby enable a person skilled in the art to best utilize the invention and various embodiments with various modifications as are suited to the particular use contemplated . what is claimed as new and desired to be protected by letters patent is set forth in the appended claims and includes equivalents of the elements recited therein : | 5 |
fig1 is a diagrammatic drawing of a cam phaser system 10 of the present invention . the cam phaser system 10 is provided with pressurized hydraulic fluid such as oil by an oil pump 12 and an oil filter 14 . a four - way solenoid valve 16 controls the oil flow to a cam phaser 18 . the solenoid valve 16 is controlled by a powertrain control module 15 to pulse width modulate ( pwm ) the four - way valve 16 . the cam phaser 18 is coupled between a camshaft sprocket and the end of the camshaft . the camshaft sprocket is coupled to the crankshaft , as is commonly known in the art . the cam phaser 18 includes a piston 20 and spring 24 that are acted upon by oil pressure to move the piston 20 in the directions of arrow a . the sliding piston 20 will rotate sliding helical gears on the sprocket and camshaft to rotate the camshaft relative to the cam shaft sprocket and produce the variable cam phaser functionality of the present invention . oil pressure and flow is provided via the solenoid valve 16 to act upon both sides of the piston 20 . the spring 24 opposes movement of the piston 20 in one direction . the movement of the piston 20 , and thus the cam phaser 18 , will be controlled by the oil flow to either side of the piston 20 . the camshaft further includes target wheel and sensors 30 , 32 to detect the speed and position of the camshaft and / or crankshaft and provide feedback for a camshaft position algorithm . the amount of oil flow to the piston 20 is controlled by the modulation of the solenoid valve 16 . the powertrain controller 15 controls the duty cycle of the solenoid valve 16 to generate the desired position of the piston 20 and thus the cam phaser 18 . in certain situations , debris in the oil may restrict the solenoid valve 16 , preventing the modulation of oil flow through the solenoid . depending on operating conditions , the inability to modulate oil flow will result in uncontrolled movement of the cam phaser 18 , or inability to move the cam phaser 18 . the method and apparatus of the present invention will detect this jammed condition and generate a control current of cyclic output to the solenoid valve 16 to jar the debris loose and release the solenoid 16 . fig2 , 3 and 4 are flowcharts of preferred methods of the present invention . as the cam phaser 18 velocity and direction are related to solenoid position , and since the solenoid 16 can stick in any position , cam phase angle is difficult to use as an indication of a sticking solenoid . the present invention uses error counts ( time ) of two cam phase angle correlation diagnostic to determine if the solenoid 16 is stuck or jammed . once this determination has been made , the controller 15 will apply a cyclic current output to the solenoid 16 to allow the debris or other sticking conditions to be released . the output is preferably applied at a rate that prevents the cam phaser 18 from responding to the cyclic current output once the solenoid 16 has been released . the parameters of the cyclic output are preferably calibrated to ensure that enough force can be applied to release the solenoid 16 , while keeping the frequency high enough to prevent the cam phaser 18 from responding and creating another position error . fig2 is a flow chaff of a preferred solenoid release detection method of the present invention . the software routine of the present invention at block 50 determines if the controller 15 has provided a cyclic current output to the solenoid 16 to unstick the solenoid 16 at the current commanded cam phaser 18 position . this determination is made by checking the flag set at block 50 . the application of cyclic current to the solenoid 16 by the controller 15 will be termed as the “ cycler ” routine . the cycler routine may be executed only once per cam phaser 18 move . if the cycler has been active this cam phaser 18 move , then the routine will exit at block 100 . if the cyclor has not been active as this commanded cam phaser 18 position , the routine will continue to block 52 to determine if the cycler has been activated more than a certain calibrated number of times in this ignition cycle . if the cycler has been active more than the calibrated number of times in this ignition cycle , then the routine will exit at block 100 to allow the diagnostic to complete and indicate that there is a mechanical or engine problem . if the cycler has not been active more than the calibrated number of times in this ignition cycle , the routine will continue to block 54 . block 54 represents a diagnostics routine ( p0016 ) to detect a cam phaser 18 home position fault . the p0016 diagnostic runs when the cam phaser 18 is commanded to its home ( fully advanced ) position . the diagnostic compares the current position of the cam phaser 18 to its design intent home position . if these positions vary by more than a calibrated amount , the cam phaser is determined to be stuck and the p0016 diagnostic failure counter ( timer ) will increment . if the condition remains for a calibrated amount of time , the diagnostic will log a failure of this condition in the controller 15 and will disable the operation of the cam phaser 18 . the p0016 diagnostic is determined to have been passed ( i . e ., diagnostic indicates no faults ) when the current cam phaser 18 position is within a calibrated range of the design intent home position for a calibrated amount of time . if a cam phaser 18 fault has been detected by block 54 , the routine will continue to block 58 . the fault detection at block 54 occurs at a lower calibrated time , than failure of the p0016 diagnostic , and therefore before a cam phaser 18 fault is logged or cam phasing is disabled . if a cam phaser 18 fault has not been detected at block 54 , the routine will continue to block 56 having a second diagnostics routine ( p0014 ). the p0014 diagnostic runs when the cam phaser 18 is commanded to any position other than its home ( fully advanced ) position . the diagnostic compares the current position of the cam phaser 18 to its commanded position . if these positions vary by more than a calibrated amount , the cam phaser is determined to be faulted and the p0014 diagnostic failure counter ( timer ) will increment . if the condition remains for a calibrated amount of time , the diagnostic will log a failure of this condition in the controller 15 and will disable operation of the cam phaser 18 . the p0014 diagnostic is determined to have passed when the current cam phaser 18 position is within a calibrated range of the commanded cam phaser 18 position for a calibrated amount of time . if no cam phaser fault is detected at block 56 , the routine will end at block 100 . if a cam phaser fault has been detected at block 56 , the routine will continue to block 58 . the fault detection at block 56 occurs at a lower calibrated time , than failure of the p0014 diagnostic , and therefore before a cam phaser 18 fault is logged before cam phasing is disabled . the routine , at block 58 , sets a flag to indicate that the cyclic output should be enabled and continues to block 60 to set a flag indicating that the cycler has been activated at this commanded cam phaser 18 position . the flag set at block 60 will prevent the cycler from being activated again until the cam phaser 18 is commanded to a new position . continuing to block 62 , the routine increments a first counter that indicates how many times the cycler has been activated in this specific ignition cycle . the cycle counter at block 64 is initialized to allow the cycler to perform a calibrated number of square wave pwm cycles to release the sticking solenoid 16 . once a cam phaser fault has been detected by the algorithm in fig2 , the software routine to release the solenoid 16 is activated . fig3 is a flow chart of a preferred solenoid release control software routine of the present invention . starting at block 80 , the routine will determine if the solenoid release routine should be active . the flag set at block 58 will indicate if the solenoid release routine should be active . if the flag has not been set , the routine will return to normal closed loop control for the cam phaser 18 at block 82 . block 84 determines if the number of release cycles or current pulses initialized to a calibrated value at 64 have been completed , as determined by a first counter . the first counter indicates the number of square wave pwm output cycles remaining to be completed by the cycler . if the calibrated number of square wave pwm cycles are complete as indicated by the first counter being zero , then the solenoid release routine will be stopped at block 86 by clearing the flag set at block 58 and checked at block 80 , and the cam phaser 18 will be returned to normal closed loop control at block 82 . continuing to block 88 , when the release cycles have not been completed , block 88 determines if the output of the controller (“ control signal ”) to tile solenoid 16 should be in a high or on position for the current output cycle . this determination is made by comparing a second counter to a calibrated desired high time . if the control signal should be high , then the second counter is incremented at block 90 and the control signal is forced to a high condition for the current output cycle at block 92 . the routine then exits at block 94 . if the controller determines that the control signal for the current output cycle should not be high , the routine continues to block 96 . block 96 determines if the control signal should be low or off . this determination is made by comparing a third counter to a calibrated desired low time . if the control signal should not be low , the second and third counters are reset at block 98 and the first counter is incremented at block 100 . the routine will then continue to block 84 . if the controller determines that the control signal should be low at block 96 , the third counter will be incremented at block 102 and the control signal will be forced to a low condition for the current output cycle at block 104 . the routine will then exit at block 94 . the routine of fig3 will thus modulate a control signal to the solenoid that will be held high and low for a certain calibrated amount of time and a certain calibrated number of cycles to release the solenoid 16 from a jammed or stuck condition . fig4 is a flow chart of a preferred routine to clear the flag that indicates that the cycler has been active at the current desired cam phaser 18 position of the present invention . the routine starts at block 110 . at block 112 , the routine determines if the commanded cam phaser 18 position has changed . this determination is made by comparing the current commanded position to the previous commanded position . if the commanded position has changed , execution continues at block 114 . the flag to indicate that the cycler has been active at the current commanded cam phaser 18 position is cleared at block 114 . this action allows the cycler to be made active again at the current commanded cam phase position if necessary . this flag is checked at block 60 in fig2 . if the commanded cam phaser 18 position has not changed from the previous position , as determined in block 112 , the routine exits at block 116 . while this invention has been described in terms of some specific embodiments , it will be appreciated that other forms can readily be adapted by one skilled in the art . accordingly , the scope of this invention is to be considered limited only by the following claims . | 5 |
the invention is described hereinafter by way of a preferred embodiment as shown in the drawings , and specifically with respect to a smaller sized forklift truck of about 5 , 000 pounds lift capacity ; however , it will be appreciated that the invention is broader in scope and pertains to an alternative fuel system for other types of self - propelled vehicles where space on the vehicle and in the engine compartment is limited . referring to fig1 a lift truck ( 1 ) is propelled by drive wheels ( 2 ) in front and steered from the rear by steer wheels ( 3 ) while maneuvering and positioning pallet loads raised and lowered on the forks of the truck carried on an extendable mast ( 4 ). the body of the lift truck includes a counterweight structure ( 5 ) at the rear , which counterbalances the load lifted by the mast ( 4 ). a side door ( 6 ) is hinged along the front edge andmay be swung out of the way and the seat deck ( 7 ) raised , as in fig3 . a bulkhead extension plate ( 9 ), attached to the bulkhead ( 10 ) at the rear ofthe engine compartment , mates with the deck ( 7 ) when closed . a tank ( 12 ) containing compressed natural gas is mounted on top of the counterweight structure ( 5 ) by means of straps ( 13 ) encircling the cylindrical body portion of the tank and firmly clamping it to mounting legs ( 14 ) bolted to the counterweight structure . the tank is constructed of deep - drawn , seamless , steel reinforced with glass fibers producing a wall thickness of approximately 1 / 4 &# 34 ; to withstand the internal gas pressure of up to 3 , 000 psig . since compressed natural gas ( cng ) at sea level and ambient temperature of 70 ° remains a gas at 3 , 000 psi , unlike propane , which is liquified at these conditions , the manufacture ofa cng tank is strictly controlled under the u . s . department of transportation ( dot ) specifications and quality control . for example , cng tanks of various sizes may be obtained from pressed steel tank company in milwaukee , wis ., a certified dot manufacturer . in order to obtain the fuelcapacity required for a normal eight - hour shift , or the equivalent of about51 / 2 gallons of gasoline , or 33 pounds of liquid propane ( lpg ), the size ofthe tank ( 12 ) must be about twice the size of a standard propane tank in terms of overall dimensions . the tank in the case of a 5 , 000 pound lift truck , as illustrated in fig1 is approximately 32 &# 34 ; along its longitudinal axis , and is approximately 16 &# 34 ; in diameter , across the cylindrical body portion , creating an internal volume of 4 , 455 cubic inches ( 73 . 18 liters ) and weighing about 105 pounds ( 75 kilograms ). this tank will have a capacity of about 670 cubic feet of natural gas under 3 , 000 psi at 70 ° f . referring to fig4 a and 4b , a shutoff valve ( 16 ) is threaded into the mouth ( 15 ) of the tank in the neck ( 22 ). a pressure gauge ( 17 ) communicates upstream or above the shutoff in the chamber of valve ( 16 ) for registering the pressure in the tank ( 12 ) at all times . a cylindrical collar ( 18 ) is aligned with the axis of the tank and is bolted or otherwise firmly secured to a clamping ring ( 19 ) which has mating halves drilled and tapped at ( 20 ), ( 21 ) for securing it onto the neck ( 22 ) of thetank so that the collar ( 18 ) is in firm cylindrical engagement with the semi - spherical end of the tank . the collar extends laterally to surround the shut - off valve ( 16 ), and gauge ( 17 ), but not beyond the side plane of the lift truck . the collar ( 18 ) has an opening ( 23 ) through which a high - pressure line ( 24 ) extends . a fitting ( 25 ) threads into a right angleopening ( 26 ) communicating in the body of the shutoff valve ( 16 ) downstreamor below the seat in the valve chamber . the high - pressure line ( 24 ) is coiled , or looped at ( 28 ) to attenuate vibrations . it connects at the opposite end ( 29 ) to a fitting ( 30 ) threaded into a t - bulkhead fitting ( 31 ), the body of which has a cross passage at right angles opening down where a second high - pressure line ( 34 ) is connected by a fitting ( 35 ) to the lower outlet of the bulkhead fitting ( 31 ). at the opposite end of the line ( 34 ), an elbow ( 36 ) is connected to the inlet ( 39 ) to a high - pressure regulator ( 37 ). the line ( 34 ) also has a loop ( 38 ) intermediate the fitting ( 35 ) and elbow ( 36 ) to take out additional vibrations . the regulator ( 37 ) is a known type of industrial vehicle regulator which converts the 3 , 000 psig gas pressure atthe inlet ( 39 ) to 125 psi at the outlet ( 40 ). hoses ( 41 , 43 ) connect to thecooling system of the engine to deliver hot fluid to the body ( 42 ) of the regulator , circulating engine coolant at approximately 180 ° f . around passages surrounding the regulator nozzle and decompression chamberto prevent freeze - up . a regulator suitable for use in the system in accordance with the preferred embodiment of the invention is available from modern engineering company in st . louis , mo ., and is referred to as atype p , ngv regulator with enviroal - cap , model no . 8433 . gas from the outlet ( 40 ) is delivered by line ( 44 ) to a second stage regulator ( 45 ). gas outlet pressure from the first stage regulator enters the second stageregulator at the bottom through elbow ( 46 ) secured on the end of line ( 44 ). the regulator ( 45 ) is of the same type used in liquid propane fuel systems known as an ohg model x - 2 sold by the ohg corporation in santa fe springs , calif ., the operation of which is generally known , that is , it delivers gaseous fuel in the properly metered proportions to the engine carburetor ( 49 ) for mixing with air in the optimum proportions for the emission and performance requirements of the engine . the regulator ( 45 ) functions as both a lock - off and decompression chamber such that when the engine is shut off , and there is no vacuum to hold the valve open , the diaphragm internally of the regulator locks off the fuel pressure entering the regulator in a known manner . a feature of the invention with particular application in compact vehicles having limited space in the engine compartment is the mounting bracket ( 52 ) which bolts to the bulkhead section ( 53 ) ( see fig3 ). a horizontal upper surface ( 54 ) is provided for mounting the second stage regulator ( 45 ) while on the same bracket ( 52 ) a right angle surface ( 55 ) faces inwardly , providing a mounting for the high - pressure regulator ( 37 ). placing the regulators ( 37 ) ( 45 ) at ninety degrees to each other helps with space utilization in strict confines of the engine compartment . the hoses ( 41 ) ( 43 ) can reach the body ( 42 ) directly without having to bend ina ninety degree path . in addition , the bracket serves as a solid mounting structure and heat transfer member for the hoses and lines connected to the subassembly of regulators 37 , 45 , for more uniform counteraction of the refrigeration effect . referring to fig4 a , a refilling valve body ( 60 ) is threaded into the upper end of the bulkhead fitting ( 31 ) at its lower end . the valve body ( 60 ) has a valve chamber ( 62 ), fig5 c , in which a piston ( 63 ) is biased by spring ( 64 ) to a normally closed position with the passageway ( 65 ) communicating at right angles with a refilling receptacle passageway ( 66 ) which is normally closed by the dust plug ( 67 ), shown in fig5 a . a blow - off vent ( 68 ) connects with the passageway ( 65 ) in the case of an over - pressure situation . the dust plug ( 67 ) is removed and a hose nozzle ( 70 ) ( see fig2 ) is inserted in the filling receptacle passageway ( 66 ), when refilling the tank 12 . a shutoff valve at the nozzle ( 70 ), is manually opened releasing gas at high pressure for filling the tank ( 12 ) from a fuel dispensing tower ( not shown ) of the filling station . the gas pressure unseats the piston ( 63 ) against the force of spring ( 64 ), allowing gas to enter the upper end of the bulkhead fitting ( 31 ) and flow in reverse direction through the line ( 24 ), to the tank ( 12 ). a microswitch ( 72 ) ( see fig5 a , b ) has leads ( 73 ) which are wired into the ignition circuit of the truck so as to interrupt the circuit , when the nozzle ( 70 ) in inserted . so long as the nozzle ( 70 ) is fully inserted in the refueling receptacle passageway ( 66 ), the microswitch ( 72 ) is held open by the end of the nozzle engaging the switch actuator ( 74 ). referring to fig4 a , the bulkhead fitting ( 31 ) forms a bulkhead connectionwith the first and second high - pressure lines ( 24 ) ( 34 ) and the refilling valve ( 60 ) in the bulkhead extension plate ( 9 ). this assembly is protectedwithin a housing ( 75 ) from being struck by objects protruding in the aisle or by falling loads . an aperture ( 76 ) in the side of housing ( 75 ) facing to the right facing forward aligned with the refilling valve body passageway ( 66 ) of the refilling valve ( 60 ), and is normally closed by thedust plug ( 67 ) which is shown tethered by a chain ( 77 ) in fig2 to the topplate ( 78 ) of the housing ( 75 ). it will be appreciated from the foregoing description that according to thepresent invention , natural gas flows through the line ( 24 ) where it is decompressed by the high - pressure regulator ( 37 ). since the high - pressure regulator is located near the cng tank ( 12 ), the length of the high - pressure line is substantially shortened , decreasing the possibility of rupture or loosening of the fittings due to vibration . when the engine compartment is completely buttoned up , as it would be during normal operation or refueling , it is virtually impossible for the high - pressure lines to be damaged because the configuration of the lift truck itself is taken into account in designing the cng system . the overhead guard ( 74 ) has a right rear leg that provides a pillar guarding against protruding objects in the aisle striking the exposed portion of the fuel line ( 24 ) ( fig3 ). the line ( 24 ) comes out of tank ( 12 ) directlydownward after passing through opening ( 23 ) in the collar ( 18 ). the line isbent ninety degrees and routed along the top of counterweight ( 5 ) to the connection ( 30 ) with the bulkhead fitting ( 31 ). it is covered by a guard tunnel ( 79 ) ( fig4 a ) integral with the housing ( 75 ) that prevents damage to the line by heavy objects accidentally being dropped on it or the operator stepping inadvertently on the line . the line runs immediately behind the overhead guard leg ( 74 ) before taking a path along the surface of the counterweight behind the leg ( fig3 ) and thence inside the tunnel ( 79 ) behind the leg , and around to the opposite side to enter the bulkheadfitting ( 31 ) from the rear . of course , such precautions may be unnecessary , in many applications ; however , fork lift trucks encounter a variety of workplace hazards . for example , in traveling between narrow aisles , or through tight doorways in reverse , an unseen protruding object could easily rip off an otherwise unprotected high - pressure line . since fork lift trucks operate in reverse much of the time , the collar ( 18 ) clamps solidly onto the neck ( 22 ) of thetank to protect the line ( 24 ), the shutoff valve ( 16 ) and gauge ( 17 ). a short length of the high - pressure line ( 24 ) lays close to the rear of the guard leg such that it is virtually integral with it , and is protected by it . the housing ( 75 ) and guard tunnel ( 79 ) cooperates with the guard leg to protect the line ( 24 ) from being struck from above . should a leak nonetheless be caused by accidental impact directly to the high - pressure line at the only very short exposed section , the leak occurs outside of the engine compartment and behind the operator . since natural gas is lighter than air , it is quickly dissipated , rather than being trapped inside the engine compartment . once the high - pressure gas line enters the engine compartment below the bulkhead extension plate ( 9 ), line ( 34 ) is protected by the seat deck ( 7 ) and the side door ( 6 ) so that it is not possible for any falling object to strike the line or the components ( 37 ) ( 45 ). the compact arrangement takes part of its advantage from the bracket ( 52 ) which also enhances the heating effect by locating the components ( 37 , 45 ) in close proximity . the expansion of the gas takes place in these components , with accompanying cooling effect . this is more efficiently counteracted due to heating of these parts promptly after starting the engine by lines ( 41 , 43 ). the gas is maintained at a uniform temperature by the heat transferred through the bracket ( 52 ) to the regulators ( 37 ) ( 45 ) preventing freezing up of the lines , nozzles and associated parts . the mounting bracket ( 52 ) bolts to the bulkhead section ( 53 ) which , in part , provides a heat sink for the rear mounted radiator ( not shown ) and functions as a source of heat transferred tot he bracket ( 52 ) to assist inthe vaporization of the cng fuel . while these and other advantages will become more apparent in reference to the aforementioned description of the preferred embodiment of the invention , it will be appreciated that additional objects , features and advantages of the invention may take other forms without departing from the scope of the invention as defined in the appended claims . | 8 |
fig1 shows a toy archery set 10 of the present invention which comprises a bow 12 and arrows 14 . the bow 12 includes limb portions 16 , a bowstring 18 , barrel housing 19 , a barrel 20 , and a plunger 24 . the limb portions 16 are connected to , or integrally formed with the barrel housing 19 . the connection between the limbs 16 and barrel housing 19 may be formed by interlocking the two pieces , by using pins , or by applying any other method known in the art . the exterior of the barrel housing 19 has a lower end formed as a handhold 26 suitable for being grasped by the user operating the bow 12 . a quiver which may be a collet 28 may be mounted on the limb portions 16 on the barrel housing 19 or on any other appropriate portion of the bow 12 . the collet 28 has two rings 30 and 32 ( shown in fig2 ), which are each sized to receive an arrow 14 . the limb portions 16 of the bow 12 are connected to bowstring 18 . plunger 24 has a handle 34 for drawing the bow 12 . the handle 34 is grooved to receive bow string 18 . the handle 34 may have finger grooves ( not shown ). the handle 34 may also have a hand opening 35 . the bowstring 18 can be attached to handle 34 of the plunger 24 . rigid attachment of the bowstring 18 to handle 34 provides structural stability to the bow 12 through the plunger 24 . proximal to the handle 34 is a shoulder portion 39 . shoulder portion 39 may be tapered distally . the forward movement of the plunger 24 ( to be described later ) may halt before the shoulder portion 39 touches the barrel 20 . either the tapering or preventing the shoulder portion 39 from touching the barrel 20 helps protect the user &# 39 ; s fingers from being pinched . these two safety features are not necessary if the archery set is used properly . the barrel housing 19 is attached perpendicularly to the approximate longitudinal center of the bow 12 . barrel 20 is coupled within housing 19 generally perpendicular to the length of the bow 12 . the housing 19 and barrel 20 may be attached or integral with each other . an arrow support tip 36 is also coupled to housing 19 generally perpendicular to the length of the bow 12 , and opposite barrel 20 . arrow support tip 36 is a generally cylindrically shaped tip , having an opening ( s ) 38 is its arrow - engaging end . the opening ( s ) 38 are directed sideward for safety purposes . arrows 14 have an axial bore formed within them . the axial bore has an opening at a bow - engaging end 37 of arrows 14 . arrow support tip 36 has a diameter which is approximately the same as the diameter of the axial bore in arrows 14 . therefore , an arrow 14 can be mounted on bow 12 for firing by having tip 36 inserted in the axial bore of an arrow 14 . during operation , an arrow 14 is mounted for firing on tip 36 . the operator of bow 12 places one hand on handhold 26 and grasps handle 34 with the other hand . the operator pulls handle 34 away from housing 19 , thus moving plunger 24 to its drawn position ( shown in fig1 ). when plunger 24 is drawn , it compresses a spring , encased in barrel 20 . the operation of the spring mechanism will be described in more detail later in the specification . when the operator releases handle 34 , the force of the compression spring urges plunger 24 into barrel 20 . as a result , a compressed stream of air is forced through opening ( s ) 38 in tip 36 , thereby propelling the arrow 14 mounted on tip 36 . as a result , a compressed stream of air is forced through opening ( s ) 38 in tip 36 . the air acts as a driving force on the arrow and as a lubricant between the arrow 14 and the support tip 36 . the air also acts as a force to propel the arrow 14 mounted on tip 36 . fig2 shows a front view of archery set 10 . the elements corresponding to those shown in fig1 are correspondingly numbered . fig2 more clearly shows the arrangement of collet 28 and rings 30 and 32 . rings 30 and 32 are generally semi - circular rings , having openings 40 and 42 , respectively . arrows 14 are formed , preferably , of a compressible , resilient material such as foam . rings 30 and 32 each have an inner radius of curvature , which are sized to receive the arrows 14 . thus , arrows 14 , when pressed into rings 30 and 32 , are secured within the rings 30 and 32 . fig2 also shows a sight 44 formed in bow 12 . in this preferred embodiment , sight 44 is a circular opening formed through the barrel housing 19 in bow 12 . sight 44 may include a clear plastic lens with cross - hairs , or it may simply be an opening . bow string 18 can be used in alignment with sight 44 to aim bow 12 . fig3 shows a side sectional view of one preferred embodiment of bow 12 . some of the elements shown in fig3 are similar to those shown in fig1 and 2 . similar elements are correspondingly numbered . fig3 shows that barrel 20 defines a center opening 46 . plunger 24 has a shaft portion 48 that extends within center opening 46 . shaft portion 48 has a first end 50 which is attached to a collar 52 . in turn , collar 52 has a opening for receiving a spring mechanism 56 . collar 52 is also attached to annular ring 54 and mounting post 62 . annular ring 54 may be cup - shaped , opening towards tip 36 . spring mechanism 56 is inserted within collar 52 and rests against a shoulder 58 of collar 52 . spring mechanism 56 also rests against a back - spring stop 60 at the distal end of center opening 46 . shaft 48 of plunger 24 is rigidly attached to the collar 52 and to the annular ring 54 . therefore , when an operator draws bow 12 by pulling handle 34 , and consequently plunger 24 , away from barrel housing 19 , collar 52 and annular ring 54 are also pulled away from barrel housing 19 within barrel 20 . therefore spring 56 is compressed between spring stop 60 and shoulder 58 on collar 52 . arrow support tip 36 has a passage extending from opening ( s ) 38 to a base 59 . the passage at base 59 opens into center opening 46 in barrel 20 . center opening 46 and base 59 can be formed by a plurality of tubular pieces being joined together or by one integrally formed tube extending from opening ( s ) 38 to spring stop 60 . fig4 shows bow 12 in a partially drawn position . as the operator draws bow 12 , spring 56 compresses , thereby applying a spring force to urge collar 52 and annular ring 54 back toward base 59 . annular ring 54 snugly abuts the inner surface 55 of barrel 20 . also , a central opening in annular ring 54 snugly receives mounting post 62 of collar 52 . therefore , the combination of annular ring 54 and mounting post 62 forms a substantially air tight barrier within barrel 20 . the annular ring 54 helps draw air into the barrel 20 when the operator draws the bow 12 . when the operator releases handle 34 , spring mechanism 56 expands , and pushing collar 52 , as well as annular ring 54 and mounting post 62 , towards base 59 . spring mechanism 56 exerts enough force so that this movement is quite rapid . movement of this generally air tight barrier rapidly compresses air into a compressed air stream directed out through opening ( s ) 38 in tip 36 . this air stream has enough velocity to propel an arrow 14 mounted on tip 36 into flight . fig5 is an enlarged cross - sectional view of a portion of bow 12 wherein center opening 46 meets the base 59 of the tip 36 . fig5 shows that central opening 46 opens into a widened end 66 at shoulder 72 . annular ring 54 abuts the interior surface of the widened end 66 of center opening 46 and is urged against a stop 67 . fig5 also shows that collar 52 is attached to shaft 48 through the use of screws 68 and 70 . also , mounting post 62 is either frictionally fit into an opening in collar 52 or is formed integrally with collar 52 . as the operator draws bow 12 , annular ring 54 is pulled away from stop 67 in widened end 66 of center opening 46 . the annular ring 54 moves backward past shoulder 72 into a narrower portion of center opening 46 . annular ring 54 is formed of a compressible , resilient material . upon engaging shoulder 72 , the annular ring 54 compresses to snugly fit the interior surface of barrel 20 along the narrow portion of center opening 46 . the resilience of annular ring 54 assures that , when in the narrower portion of the center opening 46 , annular ring 54 along with mounting post 62 forms the substantially air tight barrier in barrel 20 referred to with reference to fig4 . once the operator releases the handle 34 of the bow 12 , compression spring 56 forces the air tight barrier back toward the widened end 66 and stop 67 in barrel 20 . this causes an air stream to rush through barrel 20 , into the bore in tip 36 and through opening ( s ) 38 until annular ring 54 comes to rest against stop 67 . thus , spring 56 , along with annular ring 54 , mounting post 62 and collar 52 essentially forms a pneumatic piston . spring 56 provides the driving force for the pneumatic piston . the piston creates a pressurized air stream with enough force to drive an arrow 14 mounted on tip 36 into flight . fig6 is a side view of a second embodiment of the present invention . in fig6 a second bow 80 is shown with portions of bow 80 broken away . fig6 also shows a portion of an arrow 81 broken away . bow 80 includes limb portions 82 , hand hold 84 , barrel 86 and plunger 88 . plunger 88 includes compression spring 90 , shaft 92 , back - spring stop 94 , front spring stop 96 , handle end 98 and arrow engaging end 100 . bow 80 may also have at least one arrow engaging ring 112 for holding an arrow 81 . bow string 102 is attached to limb portion 82 and may also be fixedly attached , through a handle 104 at handle end 98 . handle 104 includes a gripping portion which has finger grooves 106 . proximal to the handle 104 is a shoulder portion 110 which may taper distally . during operation , the bow operator may draw bow 80 while gripping handle 104 and hand hold 84 . the operator then draws handle 104 away from hand hold 84 . shaft 92 is slidably mounted within barrel 86 . therefore , when the operator draws bow 80 , front spring stop 96 compression spring 90 against back - spring stop 94 . arrow engaging end 100 of plunger 88 includes an arrow plug 108 which fits snugly into an axial opening in arrow 81 . thus , when he operator releases handle 104 , compression spring 90 acts on front spring stop 96 to urge handle 104 back toward hand hold 84 . handle 104 moves toward hand hold 84 quickly until the front spring stop 94 of the plunger 88 abuts a front spring stop 95 halting further movement before the shoulder portion 110 of plunger 88 abuts the back - spring stop 94 . this causes plunger 88 to come to an abrupt halt . the momentum of the arrow 81 causes it to disengage from the arrow plug 108 and become airborne . in the embodiments shown in fig1 and 6 , arrows 14 and 81 are primarily formed int eh same ( other than the axial bore of arrow 14 and axial opening of arrow 81 ). the arrows have a shank portion 114 formed of foam , or another appropriate soft , lightweight resilient material . arrows 14 and 81 may alternatively have a tip portion 116 formed of a grasping material , such as hook and loop - type material , a magnet , or a suction cup . arrows 14 and 81 have blades 118 which are attached to shank 114 through the use of adhesive , heat welding , or another appropriate attachment means . the individual blades 118 collectively comprise the fletching . the distal end of the shank 114 may have grooves or recesses ( not shown ) designed to receive the blades 118 . the blades 118 may be oriented such that the longitudinal axis of the shank 114 is in the longitudinal plane of the blades 118 . alternatively , the longitudinal access of the blades 118 may bisect the longitudinal axis of the shank 114 . preferably the blades 118 are equally spaced about the distal end of the shaft and formed integral with the shaft 114 . blades 118 , which can be formed of foam , plastic , or another suitable material , guide the arrow 14 or 81 in a generally predictable flight path . the present invention provides an archery set which substantially encloses the projective force used to project foam arrows . further , the archery set of the present invention provides a projective force which does not rely on either the elasticity of the bow string or the resiliency of the bow itself . therefore , operation of the bow is made significantly easier than operation of traditional archery sets which require a significant amount of coordination . the projective force can be provided by a number of suitable means including a spring mechanism , or a spring mechanism acting in conjunction with a pneumatic piston . although the present invention has been described with reference to preferred embodiments , workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention . | 5 |
the polyglycerol used in the examples below has the following composition ( in molar %): glycerol : about 27 % ( between 24 and 30 %); diglycerol : about 31 % ( between 28 and 34 %); triglycerol : about 23 % ( between 20 and 26 %); tetraglycerol : about 12 % ( between 9 and 15 %); pentaglycerol : about 7 % ( between 4 and 10 %); ie . it has a degree of polymerization ranging between 2 and 3 , in fact of about 2 . 4 , and an average number of hydroxyl funtions of about 4 . 4 . it is then esterified with a mole / mole stoichiometry with a c8 – c10 fatty acid to reach a mono - c8 – c10 polyglycerol majority distribution called pg 8 / 10 below , with a free oh / esterified oh molar ratio of about 3 . 4 : 1 . “ c8 – c10 fatty acid ” is understood to be an industrial acid consisting essentially of c8 or c10 acids , but possibly also containing small quantities of heavier or lighter acids , this resulting from the natural origin and from the manufacturing process . the purpose of tests or experiments in porous media is to simulate passage of the filtrate through a reservoir rock and to study the interaction thereof on the saturations in place in the rock . two types of experiments are conducted : in both cases , the residual water saturation of the rock is observed to change , as is the oil permeability in the direction opposite the filtration direction ( backflow ). the experimental device is diagrammatically shown in fig1 . the porous medium 2 is placed in a hassler cell 1 . a confining pressure of 2 mpa is applied to the medium by means of a squeeze cap 3 . brine , oil , or a simulated filtrate can be circulated in the porous medium . the flow rate of the injected solution is controlled by a pharmacia type piston pump 4 . a differential pressure sensor 5 is placed between the inlet and the outlet of the cell . the device is connected to a computer 6 which allows to calculate , among other things , the permeability of the rock to the injected liquid . core sample 2 is made of clashack sandstone for experiments ( i ) or vosges sandstone for experiments ( ii ). it has the following dimensions : length 60 mm , section 32 . 7 mm , pore volume vp approximately 8 . 5 cm 3 , porosity approximately 17 %. the porous medium must be under conditions similar to those of the reservoir . the core sample must therefore be saturated with brine , then with oil ( a ) saturating rock with brine : the core sample is saturated in a vacuum drier , then subjected to a confining pressure of 2 mpa and brine is passed therethrough ( 40 g / l nacl , 5 g / l kcl ) at 10 cm 3 / h for 48 hours with 10 bars pore pressure . ( b ) measuring permeability to brine : brine is passed through the core sample at different flow rates ( q : 300 , 200 , 100 cm 3 / h ) and the pressure difference ( δp ) between the ends of the porous medium is measured . the slope of the line q = f ( δp ) enables the permeability of the rock to brine kw ( in milidarcy ) to be calculated . ( c ) measuring permeability to oil : injection of soltrol 130 ® oil ( refined oil sold by phillips chemical co . having a viscosity 0 . 7 mpa . s at 80 ° c .) at 10 cm 3 / h for 24 hours , then gradual increase of the flow rate from 100 cm 3 / h to 500 cm 3 / h . the volume of water collected enables the saturation rate of the oil ( so ) and water ( sw ) to be calculated . oil is then passed through the core sample at different flow rates ( 300 , 200 , 100 cm 3 / h ) and the differential pressure δp is measured . the slope of line q = f ( δp ) enables the permeability of the rock to oil ko ( in millidarcy ) to be calculated . the solution simulating the filtrate ( brine or brine + additive or brine + polymers or brine + polymers + additive ) is injected at 10 cm 3 / h . the volume of oil collected enables the new water and oil saturation rates to be calculated . production start is simulated by backflow injection of oil ( i . e . in the opposite direction to injection of the filtrate ) at 10 cm 3 / h . the volume of water collected enables the new water and oil saturation rates sw and so to be calculated . oil is then passed through the core sample at various flow rates ( 300 , 200 , 100 cm 3 / h ) and the differential pressure δp is measured . the slope of line q = f ( δp ) enables the permeability of the rock to oil ko 1 ( in md ) to be calculated . 2 . dynamic filtration ( 600 s − 1 ) under pressure ( 3 . 5 mpa ) and temperature : once saturated under the conditions of a reservoir , the core sample is placed in a dynamic filtration cell . a water - based drilling mud is then filtered , and an external and internal cake forms during filtration . this experiment is closer to real conditions because a real water - based mud filtrate , and no longer a simple simulated filtrate , passes through the core sample . the core sample is then transferred into the hassler cell and the water and oil saturations and the return permeability to oil are measured as before , by backflow injection of oil . the tests consist in injecting a brine , to which the additive according to the invention is or is not added , into a porous medium previously saturated in the presence of oil and water under swi ( initial water saturation ) conditions ( type ( i ) test ). sw is the water saturation ( percentage water contained in the pore volume ) ko is the permeability of the core sample to oil expressed in millidarcy ( in si units , the conversion factor is : 1 darcy = 9 . 87 . 10 − 13 m 2 ). in the presence of 0 . 1 g / l of pg8 / 10 additive in the brine , the results become : these filtration tests show that addition of 0 . 1 g / l of pg8 / 10 additive allows to remove most of the residual water . addition of the additive to a brine injected into a porous medium thus enables the saturations to be changed by displacing residual water , thus leading to higher oil saturations . note that permeability to oil also increases after backflow . the same experiments are conducted in the presence of 0 . 5 g / l of polymer ( polyacrylamide pam ) to approximate the real composition of a water - based mud filtrate . in the presence of pam alone , there is no change in residual water saturation . however , the oil permeability is decreased due to adsorption of the polymer on the rock and to clogging of its pores by the polymer aggregates . as can be seen from the example below , when pg8 / 10 is added , most of the residual water is displaced . note also that the decrease in the oil permeability of the rock is less than when pam alone is present . one may conclude that , even in the presence of polymers , addition of pg8 / 10 removes most of the residual water and limits the reduction in oil permeability . to come closer to actual conditions , dynamic filtration is carried out , then reinstitution of well production is simulated ( type ( ii ) test ). the water - based mud formulation is called flopro , it is marketed by the mi drilling fluids company ( usa ). these tests , carried out on a complete formulation , confirm the good results obtained with saturation ( saturation with residual water after oil backflow of 29 % in the presence of 1 g / l pg8 / 10 is obtained , as opposed to 53 % without additive ). the goal is to show the effect of the additive on the wettability of the rock . for this purpose , spreading of a drop of oil on the surface of a rock ( claschach sandstone ) immersed in a salted aqueous solution that contains or does not contain the additive according to the invention is observed . the experimental device ( fig2 ) is a crystallizer 10 containing an aqueous solution 11 ( 40 g / l nacl , 5 g / l kcl ), a rock support 12 , a slice of rock 13 , and a drop of oil 14 ( soltrol ®) deposited with a syringe 15 . the method of operation is as follows : a slice of a claschach sandstone type rock is suspended in a salted aqueous solution that contains or does not contain the additive . after immersion for about 40 seconds , a drop of soltrol ® oil coloured with sudan blue is introduced at the surface of the rock with a needle . the form of the drop is then observed in the presence or not of the additive according to the invention contained in the solution . in the salted water alone , the oil drop is round and does not spread ( fig2 ). the rock is thus preferentially water wet . from a concentration of 0 . 3 g / l pg8 / 10 in the brine , the oil drop is observed to spread on the rock and it even penetrates it at 2 g / l of active product . these tests , not illustrated here , confirm that pg8 / 10 increases the oil wettability of the rock . the surface tension ( brine / air ) and interfacial tension ( brine / soltrol ) were measured at 25 ° c . the brine used contains 40 g / l nacl and 5 g / l kcl . with no additive , the brine / air surface tension is 72 mn / m . with 100 ppm of additive , it drops to 25 mn / m . without additive , the brine / soltrol interfacial tension is 38 mn / m . with 10 ppm of additive it drops to 19 mn / m , reaching 14 mn / m with 15 ppm of additive . the results show that pg8 / 10 has a definite interfacial activity because it can reduce the surface tension of water to 25 mn / m and the brine / soltrol interfacial tension to 14 mn / m for low concentrations , less than the cmc ( critical micellar concentration ) of pg8 / 10 which is approximately 100 ppm . the efficiency of the present invention is shown by a reservoir damage simulation test conducted on 40 - cm long rock samples . the details of the experiment can be found in the following document : “ performance evaluation and formation damage potential of new water based drilling formulations ,” argillier j - f , audibert a ., longeron d . spe drilling and completion , 14 , no . 4 , 266 – 273 , 1999 . the rock used is claschach sandstone with the following composition : 94 . 7 % quartz , 2 . 6 % potassium feldspar , 0 . 5 % chlorite , and 0 . 7 % illite ( including mica ). the conditions to which the sample is subjected are known as irreducible water saturation ( swi ) by evacuation , saturation with brine , then injection of soltrol 130 ® oil ( approximately 10 pore volumes ). the oil permeability of the sample is then measured ( ko at swi ). the rock sample is made to contact the drilling and / or workover fluid circulating along the front face of the sample under the following conditions : overpressure 0 . 35 to 2 mpa in stages of 0 . 5 mpa every 2 minutes , then stabilization at 2 mpa where the mud circulates at a rate of 5 l / min . during filtration , oil is produced at the end of the sample , corresponding to invasion of the core sample by the mud filtrate . the test is stopped at the filtrate breakthrough , i . e . when the first drop of filtrate comes out at the end of the core sample . the mud used here is a formulation marketed by mi drilling fluids ( usa ) and it contains : 6 g / l flovis ® ( xanthan ), 7 g / l flotrol ® ( starch ), 20 g / l nacl , 20 g / l kcl , and 360 g / l calcium carbonate ( test 1 ) to which 0 . 1 g / l pg8 / 10 may be added ( test 2 ). the results of these two tests are provided in the table hereafter for comparison : we observe a significant difference in return permeability ( after backflow ) when pg8 / 10 is added to the mud , particularly in the first few centimeters of the core sample . this indicates that , during backflow , the porous medium once more becomes more easily saturated with oil in the case of mud with the presence of additive . thus , the additive entrained with the filtrate preferentially clogs the adsorption sites , thus limiting adsorption / retention of polymers contained in the mud and hence entrained with the filtrate into the porous medium . this limits clogging or shrinking of the pores by polymers , thus improving oil permeability . since the additive is added to the drilling fluid or to the well fluid , it is essential for it to be able to penetrate the permeable rock formation . in the case of a drilling fluid , it is essential for the molecule to be able to pass through the cake into the filtrate . passage of the molecule through the cake was therefore studied . the tests presented below were conducted on green bond ( 70 g / l green bond ®, bentonite marketed by the sbf company ; 1 g / l of pac lv , an anionic low - viscosity cellulose polymer , 1 g / l nacl ), and flopro muds ( example 3 ). first , the muds are centrifuged with and without pg8 / 10 to find out the adsorption of pg8 / 10 and polymers on the clay . also , the muds are filtered for 30 minutes at 0 . 7 mpa and room temperature . all the solutions obtained are subjected to toc analysis in order to establish a material balance in ppm of carbon . to find out the correspondence between the ppm of molecule and of carbon , the pg8 / 10 calibration curve was obtained . for the green bond ® mud , the results show that 35 % of the gp8 / 10 adsorbs on clay and of the remaining 65 %, 84 % passes through the cake . for flopro ® mud , the material balance is more complex because of the presence of the polymers that contribute to the carbon value measured in the filtrate . even so , when pg8 / 10 is used , there is a sharp increase in carbon in the filtrate , due largely to the presence of pg8 / 10 in the filtrate . these tests show that part of the pg8 / 10 molecules passes through the cake and is thus available for modifying the saturations in the oil formation . the compatibility of the product with the various constituents of a mud was tested . for this purpose , the properties of the mud containing the additive were studied in terms of rheology and filtration . the results of this study on the green bond ® and flopro ® muds with and without pg8 / 10 , before ( a - v ) and after ( p - v ) aging , are summarized in the table below : addition of 1 g / l pg8 / 10 does not significantly affect the filtration or rheology properties of the muds tested , which shows that such an additive , as defined in the present invention , is compatible with the conventional constituents of drilling and / or workover fluids . in order to avoid any additional damage at the well bore , it is necessary to evaluate if any in situ emulsion can be generated between reservoir fluids ( brine , oil ) and the mud filtrate . thus , one of the conditions is that the water - based mud filtrate is compatible with the reservoir fluids . the proportion of each phase is varied in order to plot a ternary diagram . emulsion formation and stability are determined by means of the so - called “ bottle test ” as described hereunder . brine ( nacl 20 g / l ), an organic phase , i . e ., oil reservoir constituting reservoir fluids , are put into contact with a mud filtrate containing the additive of this invention . the filtrate is constituted from water , salts , and polymers ( xanthan 0 . 5 g / l , starch 0 . 5 g / l ). a mixture a composed of 80 ml of reservoir oil and 20 ml of aqueous phase and a mixture b composed of 60 ml of reservoir oil and 40 ml of aqueous phase are prepared . the aqueous phase is composed of brine ( reservoir fluid ) and mud filtrate containing 1 g / l of the additive here described with the following proportions 25 / 75 , 50 / 50 and 75 / 25 by volume . the agitation is performed with a magnetic stirrer for a reservoir oil ( low agitation during the drop by drop addition , followed by a high speed agitation during 15 min .) or with an hamilton beach for a model oil ( low speed agitation during the drop by drop addition , followed by an agitation period of 15 min . at the same speed ). the emulsion is transferred in a flask and it is observed whether the emulsion breaks or not . results are obtained with the following additives used at a concentration of 1 g / l . 1 . polyglycerol mono oleate ( c18 ) 2 . polyglycerol mono myristate ( c14 ) 3 . polyglycerol mono laurate ( c12 ) 4 . polyglycerol mono c8 – c10 5 . polyglycerol mono hexanoate ( c6 ) the reservoir oil is a real one with the following properties : density ( 20 ° c . ): 850 kg / m3 viscosity ( 20 ° c . ): 8 . 3 cp composition ( sara method ): some tests have been performed with a model oil ( soltrol 130 ®), which contains no natural surfactants . the risk of emulsion is indicated in the following table ( observation performed after 16 hours unless otherwise indicated ). in all the cases , the presence of the additive within the filtrate induces the emulsion breaking if any . the longer the alkyl chain , the faster the breaking . the results of the additional tests performed with a model oil , soltrol 130 ®, are summarized in the following table : it was further observed that , in the absence of stirring , the additives corresponding to the longer acid chains have the tendency of forming light white precipitates , this denoting approaching the solubility limit . such a phenomenon can cause interactions with the other components of the mud . | 2 |
with reference to the drawing , the first nomex ® layer 10 is fed from unwinder 12 , and the second support layer 14 is fed from unwinder 16 into juxtaposition with one side of first layer 10 . while it is not critical to the present invention , it is preferred that layers 10 and 14 both be preformed and prebonded layers , with known basis weights and other physical properties , so that the layers can be pre - inspected prior to lamination to minimize process start - up waste and to assure that only acceptable product is produced . alternatively , layers 10 and 14 may be formed in - line , and unwinders 12 and 16 can be eliminated . in either event , the layer 10 of nomex ® fibers may be formed by carding and airlaying , as is well understood in the art . support layer 14 may be a staple fiber web , such as a thermally point - bonded polyester spunbond web . alternatively , and preferably , layer 14 may be a continuous polyester filament web formed in accordance with the teachings of commonly assigned u . s . patent application ser . no . 09 / 287 , 673 , filed apr . 7 , 1999 , and its continuation - in - part application ser . no . 09 / 475 , 544 , filed dec . 30 , 1999 , the disclosures of such applications being expressly incorporated herein by this reference . such continuous filament webs are preferred , because they may be pre - bonded by thermal bonds , which do not interfere with the lamination bonding to the layer 10 of nomex ® fibers , as is hereinafter explained in detail . moreover , the filaments of such continuous filament webs are essentially endless , so that there are no ends that could penetrate the layer of nomex ® fibers and appear at the surface thereof . as a result , there is a surface richness , or high concentration , of nomex ® fibers at one face , or side , of the resulting laminate . while polyester is the preferred material for the support layer 14 , other high melting point thermoplastic materials , such as nylon , can also be used . moreover , the method of formation of layer 14 is not critical to the invention , and a wide variety of such techniques will be readily apparent to those of skill in the art . because the nomex ® fibers are relatively costly , particularly as compared to the cost of the fibers or filaments of layer 14 , the present invention contemplates that the basis weight of layer 10 will be substantially less than the basis weight of layer 14 . in this regard , it is contemplated that the basis weight of layer 10 may be from about 1 to about 3 oz ./ yd . 2 , whereas the basis weight of layer 14 may be from about 2 to about 5 oz ./ yd . 2 . when layer 14 is formed of spunbonded polyester fibers , it is also contemplated that layer 14 may comprise a plurality of sub - layers , with each sub - layer having substantially the same basis weight . referring again to the drawing , layers 10 and 14 are disposed in surface - to - surface juxtaposition with one another , and are fed over guide rollers 18 and 20 to entangling drum 22 . layer 14 is disposed against drum 22 , and layer 10 faces away from the drum . water , under high pressure from line 24 , is directed against layer 10 from high pressure water jets 26 that are spaced radially outwardly of drum 22 . entangling drum 22 and high pressure water jets 26 may be formed , and operated , as taught by evans u . s . pat . no . 3 , 485 , 706 . layers 10 and 14 are laminated to one another by the high pressure water streams emanating from jets 26 . the laminate l then is trained over a guide roller 28 and directed to an image transfer device 30 , where a three - dimensional image is formed in laminate l . the layer 10 of nomex ® fibers faces image transfer device 30 , and high pressure water from line 24 is directed against the outwardly facing layer 14 from jets 32 spaced radially outwardly of image transfer device 30 . image transfer device 30 and jets 32 may be formed , and operated , in accordance with the teachings of commonly assigned u . s . pat . nos . 5 , 098 , 764 , 5 , 244 , 711 , 5 , 822 , 833 , and 5 , 827 , 597 , the disclosures of which are expressly incorporated herein by this reference . it is presently preferred that the laminate l be given a corduroy appearance , and a three - dimensional forming surface like that illustrated in fig1 - 19 of commonly assigned u . s . pat . no . 5 , 997 , 986 ( also expressly incorporated herein by this reference ) may be suitable for this purpose . instead of the two - sided treatment described above , it is possible to produce some products with a single - sided treatment . in accordance with this aspect of the invention , bonding and patterning are completed in a single step and entangling drum 22 and jets 26 are eliminated . the resulting imaged laminate il is then fed to a drying station 34 , where some or all of the water is removed from the imaged laminate . in accordance with a further aspect of the invention , the imaged laminate is then fed to a chemical application station 36 where a fire - retardant binder is applied to the imaged laminate to stabilize the three - dimensional image , and to provide enhanced flame - retardant and durability properties . while in its broadest aspects , the present invention is not limited to any particular binder , it has been found that a binder with the following composition has been particularly useful . such a binder includes about 0 . 25 % defoam 525 , about 0 . 5 % chem wet mq2 , about 5 . 0 % antimigrant 942 , and about 20 . 0 % pyron 6133 , all of said constituents being expressed in weight percent and being available from chemonics industries . the constituents are mixed in water , about 75 % by weight , for about 15 minutes and then applied to the imaged laminate by an appropriate commercially available applicator , such as a standard textile padder . binder wet pick up of about 130 % are generally suitable for the purposes of the present invention . in addition to providing enhanced flame - retardant properties , the added binder imparts wash durability to the imaged laminate , which is important for certain end products . the imaged laminate with fire - retardant binder thereon is then fed from application station 36 to drying station 38 , which may include standard textile drying cans . once the imaged laminate with applied binder is dried , it is wound upon a winder drum 40 for storage prior to conversion into a final end product . in accordance with yet another aspect of this invention , the imaged laminate with binder thereon may be jet dyed subsequent to drying and being wound on drum 40 . in such a commercially available jet dyeing apparatus , it is possible to apply the dye to polyester layer 14 only , so that the resulting product has two different colors at opposite faces thereof . | 1 |
the structure of clomiphene , 2 -[ 4 -( 2 - chloro - 1 , 2 - diphenylethenyl )- phenoxy ]- n , n - diethylethanamine ; 2 -[ p -( 2 - chloro - 1 , 2 - diphenylvinyl ) phenoxy ] triethylamine ; 2 -[ p -( β - chloro - α - phenylstyryl ) phenoxy ] triethylamine ; 1 -[ p -( β - diethylaminoethoxy ) phenyl ]- 1 , 2 - diphenylchloroethylene ; clomifene ; chloramiphene ; c 26 h 28 clno ; mol . wt . 405 . 98 , is as follows : ## str1 ## allen et al , u . s . pat . no . 2 , 914 , 563 describes the preparation of clomiphene . clomiphene as used in this invention can also be utilized in its citrate form , i . e ., clomiphene citrate . clomiphene binds to the estrogen receptors and acts by stimulating the hypothalmic - pituitary - ovarian axis in a similar fashion as estrogen . the effectiveness of clomiphene in inducing ovulation relates to its ability to bind to the estrogen receptor for a prolonged period as opposed to naturally occurring estrogen . the hypothalamic - pituitary axis is then able to initiate the pre - ovulatory lh surge necessary for ovulation to occur . without wishing to be bound by any theory of operability , it is believed that clomiphene may act either indirectly via the hypothalamic - pituitary axis to promote increased bone formation , or directly on the bone itself in humans . based on animal studies it was believed that clomiphene would decrease bone mass . the applicants , however , have discovered that clomiphene actually increases bone mass in humans . clomiphene can , therefore , be utilized to treat disorders where decreased bone mass is a consequence , such as osteoporosis . clomiphene can also be used prophylactically to increase bone mass prior to the menopausal period , thereby avoiding the development of postmenopausal osteoporosis or decreasing the magnitude of the associated bone loss . clomiphene may also be used as a marker of potential fertility since increased bone formation occurs primarily in women who are capable of sustaining a pregnancy , but may not in women who remain infertile despite clomiphene therapy . clomiphene is presently sold by merrell dow pharmaceuticals inc ., indianapolis , indiana , under the name &# 34 ; clomid &# 34 ; and by serono under the name &# 34 ; serophene &# 34 ;. clomiphene is also sold under the names &# 34 ; clomphid &# 34 ;, &# 34 ; clomivid &# 34 ;, &# 34 ; clostilbegyt &# 34 ;, &# 34 ; dyneric &# 34 ; and &# 34 ; ikaclomine &# 34 ;. clomiphene can be utilized in the present invention as a pharmaceutical composition containing clomiphene ( the active ingredient ) in admixture with a solid , liquid or liquefied gaseous diluent . clomiphene may also be utilized as a pharmaceutical composition in the form of a sterile and / or physiologically isotonic aqueous solution . clomiphene may also be used as a medicament in dosage unit form or as a medicament in the form of tablets ( including lozenges and granules ), caplets , dragees , capsules , pills , ampoules or suppositories . &# 34 ; medicament &# 34 ; as used herein means physically discrete coherent portions suitable for medical administration . &# 34 ; medicament in dosage unit form &# 34 ; as used herein means physically discrete coherent units suitable for medical administration , each containing a daily dose or a multiple ( up to four times ) or a sub - multiple ( down to a fortieth ) of a daily dose of the compound of the invention in association with a carrier and / or enclosed within an envelope . whether the medicament contains a daily dose , or for example , a half , a third or a quarter of a daily dose will depend on whether the medicament is to be administered once or , for example , twice , three times or four times a day , respectively . the pharmaceutical compositions according to the invention may , for example , take the form of suspensions , solutions and emulsions of the clomiphene in aqueous or non - aqueous diluents , syrups , granulates or powders . the diluents to be used in pharmaceutical compositions ( e . g ., granulates ) adapted to be formed into tablets , dragees , capsules and pills include the following : ( a ) fillers and extenders , e . g ., starch , sugars , mannitol and silicic acid ; ( b ) binding agents , e . g ., carboxymethyl cellulose and other cellulose derivatives , alginates , gelatine and polyvinyl pyrrolidone ; ( c ) moisturizing agents , e . g ., glycerol ; ( d ) disintegrating agents , e . g ., agaragar , calcium carbonate and sodium bicarbonate ; ( e ) agents for retarding dissolution , e . g ., paraffin ; ( f ) resorption accelerators , e . g , quaternary ammonium compounds ; ( g ) surface active agents , e . g ., cetyl alcohol , glycerol monostearate ; ( h ) adsorptive carriers , e . g ., kaolin and bentonite ; ( i ) lubricants , e . g ., talc , calcium and magnesium stearate and solid polyethyl glycols . the tablets , dragees , capsules , caplets and pills formed from the pharmaceutical compositions of the invention can have the customary coatings , envelopes and protective matrices , which may contain opacifiers . they can be so constituted that they release the active ingredient only or preferably in a particular part of the intestinal tract , possibly over a period of time . the coatings , envelopes and protective matrices may be made , for example , from polymeric substances or waxes . clomiphene can also be made up in microencapsulated form together , with one or several of the above - mentioned diluents . the diluents to be used in pharmaceutical compositions adapted to be formed into suppositories can , for example , be the usual water - soluble diluents , such as polyethylene glycols and fats ( e . g ., cocoa oil and high esters , [ e . g ., c 14 - alcohol with c 16 - fatty acid ]) or mixtures of these diluents . the pharmaceutical compositions which are solutions and emulsions can , for example , contain the customary diluents ( with , of course , the above - mentioned exclusion of solvents having a molecular weight below 200 , except in the presence of a surface - active agent ), such as solvents , dissolving agents and emulsifiers . specific non - limiting examples of such diluents are water , ethyl alcohol , isopropyl alcohol , ethyl carbonate , ethyl acetate , benzyl alcohol , benzyl benzoate , propylene glycol , 1 , 3 - butylene glycol , dimethylformamide , oils ( for example , ground nut oil ), glycerol , tetrahydrofurfuryl alcohol , polyethylene glycols and fatty acid esters of sorbitol or mixtures thereof . for parenteral administration , solutions and emulsions should be sterile and , if appropriate , blood - isotonic . the pharmaceutical compositions which are suspensions can contain the usual diluents , such as liquid diluents , e . g ., water , ethyl alcohol , propylene glycol , surface - active agents ( e . g ., ethoxylated isostearyl alcohols , polyoxyethylene sorbite and sorbitane esters ), microcrystalline cellulose , aluminium metahydroxide , bentonite , agar - agar and tragacanth or mixtures thereof . all the pharmaceutical compositions for use in the invention can also contain coloring agents and preservatives , as well as perfumes and flavoring additions ( e . g ., peppermint oil and eucalyptus oil ) and sweetening agents ( e . g ., saccharin and aspartame ). the pharmaceutical compositions for use in the invention generally contain from 0 . 5 to 90 % of clomiphene by weight , relative to the weight of the total composition . in addition to clomiphene , the pharmaceutical compositions and medicaments used according to the invention can also contain other pharmaceutically active compounds . any diluent in the medicaments of the present invention may be any of those mentioned above in relation to the pharmaceutical compositions for use in the present invention . such medicaments may include solvents of molecular weight less than 200 as the sole diluent . the discrete coherent portions constituting the medicament for use in the invention will generally be adapted by virtue of their shape or packaging for medical administration and may be , for example , any of the following : tablets ( including lozenges and granulates ), pills , dragees , capsules , suppositories and ampoules . some of these forms may be made up for delayed release of the active ingredient . some , such as capsules , may include a protective envelope which renders the portions of the medicament physically discrete and coherent . the preferred daily dose for administration of the medicaments for use in the invention is 2 . 5 to 250 mg of clomiphene in the case of intravenous administration and 25 to 250 mg , preferably 150 mg , of clomiphene in the case of oral administration . the drug is generally administered for a portion of every month , but can be administered daily . the product of the above - mentioned pharmaceutical compositions and medicaments is carried out be any method known in the art , for example , by mixing the clomiphene with the diluents ( s ) to form a pharmaceutical composition ( e . g ., a granulate ) and then forming the composition into the medicament ( e . g . tablets ). this invention provides a method for treating the above - mentioned diseases in humans , which comprises administering clomiphene to a human , alone or in admixture with a diluent or in the form of a medicament according to the invention . it is envisaged that clomiphene will be administered perorally , parenterally ( for example , intramuscularly , intraperitoneally , subcutaneously or intravenously ), rectally , vaginally or locally , preferably orally or parenterally . preferred pharmaceutical compositions and medicaments are , therefore , those adapted for administration such as oral or parenteral administration . administration in the method of the invention is preferably oral . clomiphene can also be administered via a depot formulation , e . g ., a slow release form placed subcutaneously and / or intramuscularly . in general , it has proved advantageous to administer intravenously amounts of from 0 . 01 mg to 10 mg / kg , preferably 0 . 05 to 5 mg / kg , of body weight per day and to administer orally 0 . 05 to 20 mg / kg , preferably 0 . 5 mg to 5 mg / kg of body weight per day , to achieve effective results . nevertheless , it can at times be necessary to deviate from those dosage rates , and in particular to do so as a function of the nature and body weight of the human subject to be treated , the individual reaction of this subject to the treatment , type of formulation in which the active ingredient is administered , the mode in which the administration is carried out and the point in the progress of the disease or interval at which it is to be administered . thus , it may in some case suffice to use less than the above - mentioned minimum dosage rate , whilst other cases the upper limit mentioned must be exceeded to achieve the desired results . where larger amounts are administered , it may be advisable to divide these into several individual administrations over the course of the day . clomiphene may be used in the present invention as an effective estrogen alternative for action on bone , without the estrogenic side effects at other sites . clomiphene could be the ideal hormonal replacement for postmenopausal women who have or are at risk for endometrial and breast carcinoma , preserving the skeleton while reducing the risk of cancer . ( b ) to increase bone mass prior to an anticipated loss of bone thereby preventing osteoporosis or decreasing the magnitude of bone loss or ( c ) as a marker of potential fertility , since it appears that women with normal reproductive capacities primarily experience the increased bone mass following clomiphene therapy . although this invention may be used to predict fertility in women with noraml reproductive capabilities , clomiphene may also be utilized according the present invention to treat osteoporosis in perimenopausal and postmenopausal women in which fertility is not a consideration . the invention will now be described with reference to the following non - limiting examples . quantitative computer tomography ( qct ) of distal radius described in p . s . jensen , s . c . orphanoudakis , e . n . rauschkolb , r . baron , r . lang and h . rasmussen , &# 34 ; assessment of bone mass in the radius by computed tomography &# 34 ;, american journal of radiology , 134 , 285 - 292 , ( 1980 ) was used to measure bone mass in twenty women with endometriosis . it was found that trabecular mass was normal in the seventeen women with endometriosis and increased in three women . in addition , these three women with significantly increased trabecular bone mass had been treated with the drug &# 34 ; clomid &# 34 ; ( clomiphene ) in the past . trabecular bone mass was not , however , significantly different from normal in the women with endometriosis who were not treated with clomiphene . the magnitude of the increase in trabecular bone mass was dramatic , i . e ., equivalent to as much as a 50 % increase in contrast to normal subjects and other women with endometriosis who had not been treated with the drug &# 34 ; clomid &# 34 ;. bone density was reported in hounsfield units ( hu ). for reference , air has a value of - 1000 hu and water is set at 0 hu . mean (± sd ) of these results are shown below : table 1______________________________________mean cortical and trabecular bone massin women with endometriosiscortex ( hu ) trabecular ( hu ) number of age trabecularsubjects ( years ) cortex ( hu ) ( hu ) ______________________________________normal 10 31 . 7 ± 4 1267 ± 69 212 ± 51endo - metriosisno 17 29 . 6 ± 5 1105 ± 106 * 173 ± 68clomipheneclomiphene 3 30 . 3 ± 3 1137 ± 44 310 ± 64 * ______________________________________ * p & lt ; 0 . 05 when compared to normal conditions . cortical bone mass was found to be significantly decreased in women with endometriosis , ( f . comite , p . jensen , k . hutchinson , m . l . polan , f . haseltine and a . decherney , &# 34 ; reduced cortical bone mass in endometriosis &# 34 ;, ( in ) society for gynecologic investigation &# 34 ;, toronto , march , 1986 , # 357 ), comparable to that noted in the perimenopausal subjects . none of the twenty women treated were cigarette smokers . to applicants &# 39 ; knowledge endometriosis has heretofore not been described as a potential risk factor for osteoporosis . random hormonal measurements were obtained in the women with endometriosis . mean serum estradiol ( e 2 ) was 100 ± 36 pg / ml and progesterone ( p ) was 4 . 1 ± 2 . 3 ng / ml . although these values were within the normal range for the date of the last known menstrual cycle , they tended to be at the lower end of the normal range . all women cycled regularly , however , eleven of the twenty subjects were infertile secondary to endometriosis . fertility had not been determined in the nine remaining subjects , who had presented for treatment of pelvic pain secondary to endometriosis . decreased cortical bone mass is known to occur in association with estrogen deficiency , ( j . a . schlechte , b . sherman and r . martin , &# 34 ; bone density in amenorrheic women with and without hyperprolactinemia &# 34 ;, j . clin . endocrinol . metab ., 56 , 1120 - 1123 , ( 1983 )). although random estradiol levels were normal in this group of women with endometriosis , mean intergrated estradiol levels over time are unknown . however , this decrease in cortical bone suggests uncoupling of the normal bone resorption - formation sequence similar to that seen in perimenopausal women . trabecular bone is reported to be acutely affected by surgically induced menopause , ( a . horsman , m . simpson , p . a . kirby and b . e . c . nordin , &# 34 ; non - linear bone loss in oophorectomized women &# 34 ;, br . j . radiol ., 50 , 504 , ( 1977 )). however , cortical bone mass appears to decrease while trabecular bone is maintained in the period prior to the onset of menopause . it may be that cortical bone changes reflect the more subtle decrease in estradiol , such as that which occurs as women move from pre - to peri - to the postmenopausal period . trabecular bone mass was not significantly different from normal in the women with endometriosis who were not treated with clomiphene . however , there was a dramatic increase in the trabecular bone mass in three women who had been treated with clomiphene in the past and had conceived following this therapy . measurements of qct of the distal radius in a group of fertile and infertile patients previously treated with clomiphene ( within a period of six months to two years ) were obtained to determine a possible link between clomiphene and increased bone mass . this was a retrospective study which evolved as a result of the increased trabecular bone noted in the women with endometriosis who had been treated with clomiphene . it was believed that , although clomiphene is a mixed estrogen agonist - antagonist , it might have estrogen - like effects on the bone . eight of the twenty women had successfully sustained a pregnancy following the clomiphene therapy . twelve women have remained nulliparous . table 2______________________________________ number of age trabeculae subjects ( years ) cortex ( hu ) ( hu ) ______________________________________normal 10 31 . 7 ± 4 1267 ± 69 212 ± 51infertility + clomipheneno pregnancy 12 31 . 5 ± 4 1098 ± 132 * 150 ± 54 * pregnancy 8 33 . 3 ± 3 1184 ± 70 280 ± 45 * ______________________________________ mean ± sd * p & lt ; 0 . 05 when compared to normal controls table 3__________________________________________________________________________summary of quantitative computedtomography ( qct ) data number of subjects age ( years ) cortex ( hu ) trabeculae ( hu ) __________________________________________________________________________normal ( crc study ) 20 31 . 3 ± 4 1244 ± 85 206 ± 39normal non - smoking 10 31 . 7 ± 4 1267 ± 69 212 ± 51irregular menses 8 30 . 7 ± 4 1186 ± 120 157 ± 55 * primary amenorrhea 9 25 . 7 ± 6 911 ± 111 * 66 ± 45 * perimenopausal 10 48 . 8 ± 2 1089 ± 58 * 198 ± 26postmenopausal 20 64 . 7 ± 8 835 ± 160 * 72 ± 69 * endometriosisno clomiphene 17 29 . 6 ± 5 1105 ± 106 * 173 ± 68clomiphene 3 30 . 3 ± 3 1137 ± 44 * 310 ± 64 * infertility + clomipheneno pregnancy 12 31 . 5 ± 4 1098 ± 132 * 150 ± 54 * pregnancy 8 33 . 3 ± 3 1184 ± 70 280 ± 45 * __________________________________________________________________________ mean ± sd * p & lt ; 0 . 05 when compared to normal controls cortical and trabecular bone mass was significantly decreased in the group of infertile women treated with clomiphene in contrast to the fertile subjects and normal controls . a significant increase in the trabecular bone mass was demonstrated in the women who were proven to be fertile following clomiphene therapy . this study was limited by the fact that no baseline qct prior to pregnancy was obtained due to the retrospective design . therefore , it is not possible to rule out pregnancy as a significant factor in the increase in trabecular bone mass . it is of interest that the cortical bone mass in these women who were fertile was normal . this is in contrast to the significantly reduced cortical bone mass observed in the three fertile women with endometriosis who were also treated with clomiphene . the amount of cortical bone in the fertile women with endometriosis was similar to the cortical bone mass seen in the other women with endometriosis . without wishing to be bound by any particular theory of operability , this suggests that the factor ( s ) responsible for the cortical bone reduction in the patients with endometriosis may interfere with the gain in cortical bone that might be induced by clomiphene . it will be appreciated that the instant specification and claims are set forth by way of illustration and not limitation and that various modifications and changes may be made without departing from the spirit and scope of the present invention . | 8 |
the constituent elements of this transmission are distributed between two power trains , which connect internal combustion engine 1 in parallel to wheels 3 of the vehicle . according to the diagram , these means include two electric machines 2 , 4 forming a variator , a plurality of epicyclic gearsets 5 , 6 , 7 , two control devices 8 , 9 and a plurality of reducing stages 11 . this diagram shows the two power trains connecting internal combustion engine 1 to wheels 3 of the vehicle . the first train , or primary power transmission train , is reunited with the second in first epicyclic gearset 5 . first electric machine 2 is reunited with the power - splitting train in second epicyclic gearset 6 . the two electric machines are separated by a third epicyclic gearset 7 , associated with its two control devices 8 , 9 . finally , internal combustion engine 1 , the wheels and the two electric machines 2 , 4 are connected to reducing stages 11 , whose particular arrangement indicated in the figure does not have limitative character for the scope of the invention , because it is possible to envision a different number and / or arrangement of these reducing stages without departing from the scope thereof . this transmission has a primary power train via which a large part of the torque flows between the internal combustion engine and the wheels , and a secondary or power - splitting train on which there are disposed the two electric machines constituting the variator , in such a way as to achieve infinitely variable torque transmission between the engine and the wheels . it has two modes of operation , in which the first or the second control means 8 , 9 of the third epicyclic gearset are respectively active . the purpose of these two modes of operation is to broaden the operating ranges of the infinitely variable transmission . they correspond to the establishment of two different step - down ratios in third epicyclic gearset 7 , by virtue of the respective activation of associated first and second control means 8 , 9 . the infinitely variable transmission illustrated by the figures is said to be of the “ matching point ” and of the “ coupled input ” type , because power splitting at the output of the internal combustion engine is assured by a pair of power - splitting pinions ( not illustrated ), whereas the reuniting of the two power trains upstream from the wheels is effected in an assembler epicyclic gearset 5 . nevertheless , this particular arrangement does not have any limitative character , and the invention is equally applicable to any coupled - output , power - splitting , infinitely variable transmission provided with a torque - dividing gearset at the output of the engine and a pair of reassembler pinions upstream from the wheels . under the same conditions , the invention can be applied to any power - splitting infinitely variable “ two matching points ” type transmission provided with a torque - dividing epicyclic gearset and a torque - reassembler gearset ( which brings the total number of gearsets to four , counting gearset 6 , associated with the second electric machine , and operating mode - changing gearset 7 ). as indicated in the diagram , mode changing devices 8 , 9 are associated with this third gearset 7 . according to the invention , these control devices may consist of brakes , clutches or claw - coupling systems . according to the particular embodiment of the invention illustrated by the diagram , the closing of first control device 8 ensures relative immobilization of the constituent elements of the third gearset and rotation thereof as a whole , and the closing of second control device 9 ensures immobilization of an element of the third gearset relative to the case . as indicted hereinabove , the closing of the first or of the second control device 8 , 9 places the transmission in its first or in its second mode of operation respectively . in this context , a particularly advantageous but non - limitative arrangement of the invention comprises disposing first control device 8 between the ring gear and the planet carrier of third gearset 7 , and the second control device between the planet carrier of the third epicyclic gearset and the case . thus , in the first mode of operation , first control device 8 is closed and second 9 is open . gearset 7 rotates as a whole , and the step - down ratio introduced thereby into the power - splitting train is equal to unity . in the second mode , first device 8 is open and second device 9 is closed , in such a way as to immobilize one of the constituent elements of third gearset 7 relative to the case . gearset 7 then introduces its step - down ratio , which is different from unity , into the power - splitting train . finally , during the transient mode - changing phase , the two control devices can be closed simultaneously , a situation in which third gearset 7 is immobilized . in conclusion , the merit of replacing the two parallel reducing stages of the power - splitting transmission and two known modes of operation by a third planetary gearset is that a more compact architecture is achieved , wherein the three gearsets can be aligned along one and the same axis . in fact , the prior art solution involved providing a specific shaft for each reducing stage , whereas the invention makes it possible to align the third epicyclic gearset with the first two . finally , while the invention can be implemented by using brakes , clutches or claw - coupling systems , the use of the said systems is by far the most economical . | 8 |
the container 12 of the invention is shown assembled in fig1 - 5 and is shown disassembled in fig6 and 7 . as stated earlier , the container 12 has a two - piece construction . one piece forms the exterior of the container 12 and the other piece is a flexible sheet that seals the contents of the container . the basic two piece construction of the container enables it to be manufactured easily and inexpensively . this results in the container being offered to consumers at a reduced price . the first piece of the disassembled container is shown in fig6 . the first piece forms both the bottom part 14 and top part 16 of the container exterior . the two parts are connected by a hinge 18 that extends along the back of the assembled container . in the exemplary embodiment the bottom part 14 , top part 16 and hinge 18 are all molded of a semi - rigid plastic , or other similar material . although the parts of only one container 12 are shown in fig6 , it is possible that several containers can be molded from a single sheet of plastic material and then subsequently separated from each other . additionally , although the top part 14 and bottom part 16 of the container shown in fig6 have complementary rectangular configurations , the container 12 could be formed with other configurations such as a circular configuration , a triangular configuration , etc . the container bottom part 14 has a central area that is formed as a receptacle 22 for the ant bait to be contained in the container . the receptacle 22 has a generally rectangular bottom surface 24 defined by a rectangular perimeter edge 26 of the bottom surface . four sidewalls 28 , 32 , 34 , 36 extend upwardly from the bottom surface perimeter edge 26 . in another embodiment of the container having a circular configuration , the container receptacle would have a cylindrical configuration with a circular bottom surface and a single cylindrical sidewall . together the sidewalls 28 , 32 , 34 , 36 and the bottom surface 24 define the receptacle 22 . the top edges of the sidewalls 28 , 32 , 34 , 36 define a perimeter edge 38 of an open top of the receptacle 22 . a substantially flat , rectangular border surface 42 extends around the open top perimeter edge 38 . an upwardly angled rear flange 44 extends from the back of the border surface 42 to the hinge 18 . a pair of upwardly angled left 46 and right 48 flanges extend along the opposite sides of the border surface 42 as viewed in fig6 . the left 46 and right 48 side flanges extend upwardly to respective left 52 and right 54 side strips as viewed in fig6 . the two side strips 52 , 54 are substantially coplanar . an inclined surface 56 extends downwardly from the forward ends of the border surface 42 , the left 46 and right 48 flanges and the left 52 and right 54 side strips . as the incline surface 56 extends away from the receptacle 22 it angles downwardly to a forward edge 58 of the surface . the forward edge 58 is in substantially the same plane as the receptacle bottom surface 24 . the container top part 16 has a similar configuration to that of the bottom part 14 although it does not include a receptacle 22 . the top part 16 has a central area defined by a substantially flat top surface 62 . the top surface 62 has basically the same configuration as the bottom part border surface 42 , although slightly longer in length . although the top surface 62 is shown as a continuous surface , it could also have one or more holes . the top surface 62 is connected to the hinge 18 by a rear flange 64 . the rear flange 64 is angled upwardly as it extends from the hinge 18 to the top part 62 . the top part 16 also has an upwardly angled left flange 66 and an upwardly angled right flange 68 , as well as a left side strip 72 and a right side strip 74 . the left flange 66 and right flange 68 angle upwardly as they extend from the respective left strip 72 and the right strip 74 to the top surface 62 . the left strip 72 and right strip 74 are also substantially coplanar . a tab 76 is formed at the forward edge of the top surface 62 . the tab 76 is connected to the top surface 62 by a frangible connection , for example a line of perforations 78 . other types of frangible connections could be employed to secure the tab 76 to the top surface 62 . the flexible sheet 82 of the container 12 is shown disassembled from the container in fig7 . the sheet 82 can be constructed of any known material typically employed in hermetically sealing packages such as plastic , foil , etc . the sheet 82 has an elongate length with a pair of parallel left 84 and right 86 side edges that extend along a majority of the sheet length to an end edge 88 of the sheet . the end edge 88 is substantially perpendicular to the side edges 84 , 86 . the width of the sheet between the side edges 84 , 86 is substantially the same as the width of the flat border surface 42 of the container bottom part 14 . a pair of inwardly angled edges 92 , 94 extend forwardly from the respective left 84 and right 86 side edges of the sheet . the angled edges 92 , 94 extend forwardly to a tab 96 formed on the sheet 82 . the tab 96 has substantially the same configuration as the tab 76 on the container top part 16 . in an alternate embodiment the tab 96 could just be an extension of the sheet and not have the configuration shown . when the sheet is assembled into the container 12 it is folded over at a fold 98 . the folded sheet has a lower piece 102 and an upper piece 104 . after the ant bait or other substance 106 has been positioned in the receptacle 22 , the sheet 82 is assembled to the container 12 as shown in fig8 . the end edge 88 of the sheet is positioned adjacent the forward end of the border surface 42 of the container bottom part 14 . in an alternate embodiment the sheet end edge 88 could be positioned adjacent the forward edge 58 of the inclined surface 56 . the lower piece 102 of the sheet is laid across the border surface 42 and over the receptacle 22 . the portion of the sheet lower piece 102 that engages with the border surface 42 is removably secured to the border surface by adhesives , by heat sealing , by rf welding , or by other equivalent means . the fold 98 of the sheet is positioned adjacent the container hinge 18 . from the fold 98 the sheet upper piece 104 extends across the top surface 62 of the container top piece 16 . this portion of the sheet is not secured to the top surface 62 or any other portion of the container top piece 16 . however , the tab 96 of the sheet is secured by adhesives , heat sealing , rf welding or other equivalent means to the container top piece tab 76 . with the sheet 82 assembled to the container bottom part 14 and top part 16 as shown in fig8 , the container top part 16 is folded over the bottom part 14 to complete the assembly of the container 12 as shown in fig1 - 5 . the angled flanges of the bottom part 44 , 46 , 48 and the angled flanges of the top part 64 , 66 , 68 space the top part tab 76 above the inclined surface 56 and form an opening 108 into the container interior . the side strips 52 , 54 of the container bottom part 14 and the respective side strips 72 , 74 of the container top part 16 are secured together by adhesives , by heat sealing , by rf welding or by other equivalent means . this completes the assembly of the container . use of the container 12 is shown in fig9 - 12 . in use of the container 12 , the tab 76 of the container top part 16 and the connected tab 96 of the sheet 82 are manually grasped and pulled from the remainder of the container . when the top part tab 76 separates from the top surface 62 , continued pulling of the container tab 76 and the connected tab 94 of the sheet will pull the sheet through the container opening 108 . continued pulling will gradually cause the sheet lower piece 102 to peel away from the border surface 42 of the container bottom part 14 . continued pulling will remove the sheet 82 from the interior of the container 14 and expose the ant bait 106 in the receptacle 22 to the exterior environment of the container through the container opening 108 . still further pulling will separate the sheet 82 from the container 12 . the container 12 is then ready for use as an ant trap . when placed on a floor surface , the inclined surface 56 provides access to the opening 108 and the ant bait in the container interior . although the container 12 is described above is being used as an ant trap containing an ant bait , it should be appreciated that the container can be used to contain any substance , for example other types of insect baits , or air fresheners , or animal repellents , or other types of substances . additionally , although the container 12 is described as having only one receptacle 22 , it should be appreciated that the container could be formed with multiple receptacles positioned side - by - side along the flat border surface 42 of the container bottom part 14 . pulling the sheet 82 from the container could be stopped after one of the receptacles 22 is uncovered , exposing the substance of the one receptacle to the exterior environment of the container through the opening 108 . once the substance in the one receptacle is no longer useful , the sheet 82 could then be further pulled from the container to expose the second receptacle to the exterior environment . still further , although the container 12 has been described with the bottom part 14 and top part 16 being connected by a hinge 18 , the container could be constructed with the bottom part 14 and top part 16 being separate parts . as various modifications could be made in the construction of the invention herein described and illustrated without departing from the scope of the invention , it is intended that all matter contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative rather than limiting . thus , the breadth and scope of the present invention should not be limited by any of the above described exemplary embodiments , but should be defined only in accordance with the following claims appended hereto and their equivalents . | 0 |
the present invention now will be described more fully hereinafter with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . the present invention may take the form of a hardware embodiment , a software embodiment or an embodiment combining software and hardware aspects . the present invention will now be further described with reference to the block diagram illustration of embodiments of the present invention in fig2 . as shown in fig2 a signal s ( t ) is transmitted over a channel 202 having a channel characteristic c ( t ), such as a wireless cellular radio telephone communication channel . the transmitted signal , including channel induced effects , is received as a signal r ( t ) at the receiver / rf processor 200 which provides a front end receiver for a receiver device 204 according to an embodiment of the present invention . the receiver 200 may include a radio frequency ( rf ) processor which provides a front end receiver for receiving the communication signals r ( t ) which include a signal disturbance , more particularly which may be subject to a colored noise signal disturbance . the receiver 200 , as illustrated in fig2 down samples the received signals to a symbol rate of the communication signals to provide a receive signal r ( n ). as shown in fig2 the receiver device further includes an equalizer 205 which processes the received signal samples r ( n ) to generate estimates of the received signals s ( n ). the output of the equalizer 205 will typically be provided to further signal processing components , such as a decoder 210 . the equalizer 205 generates symbol estimates from the received signal samples utilizing associated channel coefficients of the equalizer 205 . a channel estimator 215 generates the channel coefficients based on the received wireless communication signals , predetermined information associated with the received wireless communication signals , such as a synchronization signal , and an associated noise color of the signal disturbance . as illustrated in the embodiment of fig2 the color of the noise may be characterized by its auto - correlation ρ vv ( k ). alternatively , an associated power spectrum may be provided as the color characteristic of the noise . more particularly , the channel estimator 215 is configured to iteratively estimate the channel coefficients c ( k ) and the associated noise color ρ vv ( k ). such an iterative estimate may be provided by setting one of the channel coefficients and the associated noise color to a value generated in a previous iteration and solving for the other of the channel coefficients and the associated noise color and then using the other of the channel coefficients and the associated noise color as a value generated in a previous iteration in a subsequent iteration . referring now to the flowchart illustration of fig3 operations according to embodiments of the present invention for receiving a communication signal subject to colored noise over a communication channel will now be further described . operations begin at block 300 when a communications signal , including the additive colored noise , is received at the receiver device . in accordance with embodiments of the present invention , a channel estimate for the communication channel based on the received signal , the predetermined information associated with the received signal and an estimated color characteristic of the colored noise , an auto - correlation for the illustrated example , is then generated as will be described with reference to blocks 305 - 325 . an initial channel estimate , a channel coefficient set in the illustrated embodiment , is first generated based on an assumed auto - correlation , preferably a white noise assumption , and the received signal and the predetermined information , preferably a synchronization signal in each burst of the communication signal ( block 305 ). an updated auto - correlation based on the initial channel estimate , the received signal and the predetermined information is then generated . ( block 310 ). the updated auto - correlation is then used in generating an updated set of channel coefficients which , in the illustrated embodiment , includes providing a whitening filter based on the updated auto - correlation ( block 315 ) and filtering the received signal to whiten the received signals and the predetermined information ( block 318 ). updated channel coefficients are then generated based on the filtered signals generated based on the updated auto - correlation ( block 320 ). it is to be understood that , for purposes of explanation in the various embodiments herein , the channel estimate may be provided in the form of channel coefficients generated by the channel estimator 215 for the equalizer 205 . operations as described at blocks 310 through 320 are repeated for a number of iterations ( block 325 ) such as a fixed predetermined number of iterations or a variable number of iterations depending upon a quality measure criteria for the channel coefficients . for example , operations could be repeated until the incremental improvement in the channel estimate , for example as measured by equation 7 below , is less than a specified value . a signal estimate for the received signal may then be generated using the determined channel coefficients ( block 330 ). operations as generally described with reference to fig3 will now be described in more detail for particular embodiments utilizing least squares optimization . in this example , the channel coefficients ĉ ( k ) and the auto - correlation of the baseband disturbance { circumflex over ( ρ )} vv ( k ) are jointly estimated . this estimation can be expressed as the solution of the following minimization criteria : c ^ ( k ) = ( c ( k ) , ρ vv ( k ) ) arg min ∑ n = n0 + l n0 + m - 1 r ( n ) - r ^ [ n | n - 1 ; c ( k ) ; ρ vv ( k ) ] 2 ( 7 ) where { circumflex over ( r )}[ n | n − 1 ; c ( k ); ρ vv ( k )] is the one - step ahead prediction of r ( n ) given { r ( k ): k & lt ; n }, { s ( k ): k ≦ n }, channel coefficients c ( k ) and the auto - correlation of the disturbance ρ vv ( k ). for this example , the pair ( c ( k ), ρ vv ( k )) is determined that minimizes the criteria in equation ( 7 ) using , for example , the generalized least squares ( gls ) algorithm , as described generally in l . ljung , system identification : theory for the user , prentice - hall , 1987 , an iterative approach which can be described by the following steps : 1 . find an initial least - squares estimate for the channel coefficients ĉ ( k ) using equation ( 4 ) with given { r ( n )} and { s ( n )} ( block 305 ). 2 . assuming that the previous channel estimate ĉ ( k ) is correct , obtain a new estimate of ρ vv ( k ) ( block 310 ). 3 . assuming that the previous auto - correlation estimate ρ vv ( k ) is correct , obtain a new estimate of ĉ ( k ) using equation ( 7 ) ( blocks 315 through 320 ). 4 . go back to step ( 2 ) and repeat for a desired number of iterations ( block 325 ). the above four steps provide one of many possible ways to implement equation ( 7 ) and are not intended to be limiting of the present invention . in embodiments of the present invention , the gls algorithm is applied in an adaptive manner which may provide improved channel estimates . operations for each of the steps will now be described in further detail for exemplary embodiments to obtain an adaptive channel estimate . step 1 may be implemented using a conventional least squares estimation as described in l . ljung , system identification : theory for the user , prentice - hall , 1987 . in step 2 , the disturbance correlation ρ vv ( k ) may be estimated from the received signal { r ( n )} and the known symbols { s ( n )} ad the previous channel estimate ĉ ( k ) by : ρ ^ vv ( l ) = 1 m - l ∑ n = n0 + l n0 + m - 1 - l ( r ( n + l ) - ∑ k = 0 l - 1 c ^ ( k ) s ( n + l - k ) ) ( r ( n ) - ∑ k = 0 l - 1 c ^ ( k ) s ( n - k ) ) * ( 8 ) where { circumflex over ( ρ )} vv ( l ) is an estimate of the l - the auto - correlation lag of the disturbance v ( n ), l is the auto - correlation lag , m is the number of known transmitted symbols , l is the length of the channel estimate ( such as the number of channel coefficients ), n 0 is the index of the first known transmitted symbol , ĉ ( k ) is a previously obtained channel estimate , r ( n ) is the discrete - time received signal and s ( n ) are the known transmitted symbols ĉ ( k ) is given by step 1 . 1 . compute a finite impulse response ( fir ) whitening filter { h ( k )} k = 0 k = q for the given { circumflex over ( ρ )} vv ( k ) using well - known algorithms , such as the levinson - durbin algorithm , cf . s . m . kay , modern spectral estimation : theory and application , prentice - hall , 1988 ( block 315 ). 2 . filter r ( n ) and s ( n ) to obtain r ′( n )= h ( n )* r ( n ) and s ′( n )= h ( n )* s ( n ) ( block 318 ). 3 . find a least - squares estimate for the channel coefficients ĉ ( k ) with the given r ′( n ) and s ′( n ), i . e . c ^ ( k ) = c ( k ) arg min ∑ n = n0 + l n0 + m - 1 r ′ ( n ) - ∑ k = 0 l - 1 c ( k ) s ′ ( n - k ) 2 ( 9 ) where r ′( n ) is r ( n ) filtered by the whitening filter , s ′( n − k ) is s ( n ) filtered by the whitening filter and delayed by k samples and q + 1 is the length of the whitening filter ( block 320 ). the determination and use of a whitening filter to whiten the received signals in steps 1 and 2 ( blocks 315 and 318 ) is further described in u . s . pat . application ser . no . 09 / 450 , 684 entitled “ methods , receiver devices and systems for whitening a signal disturbance in a communication signal ” which is hereby incorporated herein by reference as if set forth in its entirety . referring now to the block diagram illustration of fig4 further embodiments of a receiver device for receiving a communication signal subject to colored noise over a communication channel will now be further described . the receiver device 404 of the embodiments shown in fig4 includes a receiver 400 which operates in a manner similar to that described previously with reference to the receiver 200 of fig2 and further includes an equalizer 405 which may operate in a manner similar to that described for the equalizer 205 in fig2 . symbol estimates from the equalizer 405 may be provided to further signal processing circuitry , such as a decoder 410 . the receiver device of the embodiment of fig4 further includes a channel estimator 415 and an auto - correlation memory 420 coupled to the channel estimator 415 . the channel estimator 415 generates the channel coefficients c ( k ) and provides these channel coefficients to the equalizer 405 utilizing a plurality of candidate auto - correlations ρ i vv ( k ) obtained from the auto - correlation memory 420 . more particularly , the channel estimator 415 includes a plurality of coefficient estimation circuits 422 each including , in the illustrated embodiments , a whitening filter estimation circuit 425 , a whitening filter 430 and a least squares channel coefficient estimation circuit 435 . each of the plurality of candidate auto - correlations is processed by one of the coefficient estimation circuits 422 and the resulting plurality of channel coefficient sets is provided to the selection circuit 440 . the selection circuit 440 is configured to select one of the generated channel coefficient sets as the channel coefficients and provide the selected set to the equalizer 405 . referring now to the flowchart illustration of fig5 operations for receiving a communication signal subject to colored noise over a communication channel will now be described . operations begin at block 500 with receipt of the communication signal including the colored noise . in this embodiment , a plurality of candidate auto - correlations are selected for use in generating channel coefficients ( block 505 ). the candidate auto - correlation values are preferably selected to include a range of auto - correlations likely to be encountered on a communication channel . one of the plurality of candidate auto - correlations is then selected ( block 510 ). a whitening filter is determined based on the selected one of the plurality of auto - correlations ( block 515 ). alternatively , the whitening filters may be determined in advance for each candidate auto - correlation value and saved in memory , in which case , the predetermined whitening filter is selected at block 515 . the received signal and the predetermined information associated with the received signal , such as a synchronization signal , is filtered using the determined whitening filter ( block 520 ). a set of channel coefficients based on the filtered received signal and the filtered predetermined information is generated for the selected candidate auto - correlation ( block 525 ). if an additional candidate auto - correlation remains ( block 530 ) operations at blocks 510 through 525 repeat until a set of channel coefficients has been generated for each of the candidate auto - correlation values . among these n pairs of channel estimates and auto correlation estimates , the one that minimizes the ml criteria in equation ( 7 ) is chosen ( block 532 ). a signal estimate is then generated for the receive signal using the determined channel estimate ( block 535 ). operations as generally described with reference to fig5 will now be described in more detail for particular embodiments utilizing least squares optimization . in this example , the auto - correlation of the disturbance is assumed to belong to a finite set of candidate auto - correlations , and this set is either known or determined in advance ( block 505 ). for purposes of this description , these candidate auto - correlations shall be expressed as {{ circumflex over ( ρ )} 1 vv ( k )}, i = 1 n , where n denotes the number of candidate autocorrelations . for each candidate auto - correlation { circumflex over ( ρ )} 1 vv ( k ), the channel estimate , ĉ i ( k ), is generated using the equation ( blocks 510 - 530 ): c ^ i ( k ) = c ( k ) arg min ∑ n = n0 + l + q i n0 + m - 1 r i ′ ( n ) - ∑ k = 0 l - 1 c ( k ) s i ′ ( n - k ) 2 , ( 10 ) where r i ′( n ) is r ( n ) filtered by the whitening filter associated with this candidate autocorrelation , s ′( n − k ) is s ( n ) filtered by the whitening filter and delayed by k samples , and q i + 1 is the length of the whitening filter . finally , among these n pairs of channel estimates and auto - correlation estimates , the one that has the smallest associated squared - error given by the equation : ɛ i = ∑ n = n0 + l + q i n0 + m - 1 r i ′ ( n ) - ∑ k = 0 l - 1 c ^ i ( k ) s i ′ ( n - k ) 2 . ( 11 ) as noted above , because the candidate auto - correlations {{ circumflex over ( ρ )} 1 vv ( k )} i = 1 n are known in advance in this method , the whitening filter h ( n ) corresponding to each { circumflex over ( ρ )} 1 vv ( k ) can be pre - computed and stored in memory and selected from memory at block 515 . the present invention may benefit a variety of cellular receivers that perform channel estimation in the presence of colored baseband noise . such receivers include gsm receivers and enhanced data rates for global evolution ( edge ) receivers . a simulation has been performed implementing the present invention for 8psk ( 8 symbol phase shift keyed )- edge . in this simulation , the block error rate ( bler ) performance versus carrier to adjacent channel interference power ration ( c / iadj ) improves by more than 4 decibels at a 10 % block error rate in a typical channel at a speed of three kilometers per hour with ideal frequency hopping ( tu3ifh ) channel using the present invention . the results of this simulation are graphically illustrated in fig6 . the present invention has been described above with respect to the block diagram illustrations of fig2 and 4 the flowchart illustrations of fig3 and 5 . it will be understood that each block of the flowchart illustrations and the block diagram illustrations of fig2 through 5 , and combinations of blocks in the flowchart illustrations and the block diagram illustrations of fig2 through 5 , can be implemented by computer program instructions . these program instructions may be provided to a processor to produce a machine , such that the instructions which execute on the processor create means for implementing the functions specified in the flowchart and block diagram block or blocks . the computer program instructions may be executed by a processor to cause a series of operational steps to be performed by the processor to produce a computer implemented process such that the instructions which execute on the processor provide steps for implementing the functions specified in the flowchart and block diagram block or blocks . accordingly , blocks of the flowchart illustrations and the block diagrams support combinations of means for performing the specified functions , combinations of steps for performing the specified functions and program instruction means for performing the specified functions . it will also be understood that each block of the flowchart illustrations and block diagrams , and combinations of blocks in the flowchart illustrations and block diagrams , can be implemented by special purpose hardware - based systems which perform the specified functions or steps , or combinations of special purpose hardware and computer instructions . for example , while various components of receiver device 204 have been illustrated in fig2 in part , as discrete elements , they may , in practice , be implemented by a micro controller including input and output ports and running software code , by custom or hybrid chips , by discrete components or by a combination of the above . for example , the equalizer 205 and the channel estimator 215 may be implemented in part as code executing on a processor . the present invention has been described above primarily with reference to mlse equalizers . however , the present invention is not so limited and may also be applied to other types of equalizers , for example , decision feedback sequence estimator ( dfse ) equalizers . in the drawings and specification , there have been disclosed typical preferred embodiments of the invention and , although specific terms are employed , they are used in a generic and descriptive sense only and not for purposes of limitation , the scope of the invention being set forth in the following claims . | 7 |
the preferred embodiments of the present invention will now be described with reference to the drawings . to facilitate description , any identifying numeral representing an element in one figure will represent the same element in any other figure . fig1 - 3 illustrate a cargo lock 70 having a configuration which is generally applicable to the details in the cargo lock 70 a embodiment of fig4 - 6 or the cargo lock 70 b embodiment of fig7 . referring to fig1 - 6 , the cargo lock 70 / 70 a is connected to the seat track 40 arranged in the floor of the aircraft , the floor 50 being supported by beams 51 , 52 . the cargo lock 70 / 70 a comprises a frame or baseplate 10 , a pair of pawls 31 and 32 , shear ties 21 and 22 , and track connectors , shown as tensile studs 11 and 12 . the pawls 31 and 32 are located in the center of the cargo lock 70 / 70 a . the pawls 31 , 32 have a curved or hook portion which secure cargo pallets 33 and 34 to the cargo lock 70 / 70 a . for the purposes of this description , a pawl may comprise any suitable connector which secures the cargo pallet to the cargo lock . the shear ties 21 and 22 fit in scalloped holes 41 in the seat track 40 to prevent horizontal movement of the cargo lock 70 / 70 a . details of the tensile studs 11 , 12 are best shown in fig5 . the stud 11 is in the shape of an inverted “ t ” formed with a flange portion 11 a and a leg portion 11 b . typically , the leg portion 11 b may have threads 11 c at the end for attachment to the baseplate 10 either directly or via a nut or other suitable connection mechanism . the tensile studs 11 and 12 are inserted into the seat tracks 40 through the scalloped holes 41 and subsequently moved to a position in - between the holes 41 by sliding a short distance p along the length of the seat track 40 ( before the shear ties 21 and 22 are inserted ). in this position , the circular flange 11 a of each stud 11 is locked below the seat track inner flange 42 . the lock 70 / 70 a is secured in this position by inserting shear ties 21 and 22 . thus secured in seat track 40 , the lock 70 / 70 a is held in position both vertically and horizontally . the tensile stud 11 is located at one side of the pawls 31 and 32 on baseplate 10 and tensile stud 12 at the other side of the pawls 31 and 32 on baseplate 10 . the distance between the two tensile studs is d . the pawls 31 and 32 are centrally located near the middle of the distance d . the transverse floor beams 51 and 52 support the seat track 40 at an interval b . the cargo lock is designed with a distance d preferably selected to be as close to b as possible , with the maximum benefit realized as d is equal to b or as d exceeds b . the cargo lock 70 / 70 a includes a plurality of rollers 35 , 36 , 37 and 38 secured to the baseplate 10 . the rollers 35 - 38 extend outward from the bottom of the frame 10 and serve to allow the cargo pallets to roll along the cargo locks thereby facilitating movement of pallets 33 and 34 during loading and unloading . outer rollers 35 , 38 are located at the extremities of baseplate 10 . the purpose of these outer rollers 35 , 38 is to ensure that the pallets edge does not become blocked against the edge of the baseplate 10 . inner rollers 36 , 37 are located close to pawls 31 and 32 within a distance e . the purpose of locating inner rollers 36 , 37 close to the pawls 31 , 32 is to distribute a load from a single container in the downward direction over as much as possible the full length of the baseplate 10 . without these inner rollers , this down load would be concentrated at an extremity of baseplate 10 on either roller 35 or roller 38 . fig7 illustrates an alternative embodiment for a cargo lock in which the same reference numerals have been used as in fig1 through 6 to indicate corresponding parts . in the embodiment of fig7 the number of tensile studs has been increased to two per side resulting in studs 11 and 13 , the first track connector , on one side and studs 12 and 14 , the second track connector on the other side , which is the same number of studs as illustrated in fig1 - 3 . the centroid 71 of the group of tensile studs 11 and 13 is the location of the effective working axis of force when both tensile studs are equally loaded with a vertical force ( for groups comprising of two tensile studs the centroid is located half way between tensile studs ). similarly , the centroid 72 of the group of tensile studs 12 and 14 is located in between these studs . the distance between the centroids 71 and 72 of the two groups of tensile studs now defines d ′. the pawls 31 and 32 continue to be located near the middle of the distance d ′. one advantage of the alternative embodiment is that the load per tensile stud is reduced . in addition , the baseplate 10 and the seat track 40 are fixed together at the stud groups more securely . this arrangement may have several additional beneficial effects , including but not limited to : 1 ) preventing the potential rolling over of the top flanges 53 and 54 of the transverse floor beams 51 and 52 when the stud groups are located offset from the beams as shown ; and 2 ) reducing maximum bending moment in baseplate 10 which occurs near the pawls 31 and 32 . in use , the tensile studs secure the cargo locks to the tracks in the event of a downward acceleration of the vehicle resulting in large tensile forces being applied to the lock . the tensile force is transmitted from the pawls 31 , 32 , through the baseplate 10 , and to the studs 11 , 12 . the studs then transmit the upward force to the track 40 which in turn transmit the forces to the floor and support beams 51 , 52 . the distance d is defined as the length of the effective separation of the tensile attachment points of the cargo lock 70 a to the tracks . in the cargo lock 70 a of fig4 the tensile attachment points are located at the center of the tensile studs 11 and the center of tensile stud 12 . the tensile studs 11 , 12 are intentionally positioned at the outer ends of the cargo lock 70 a so as to provide desired separation between the attachment points . where additional tensile studs are provided such as in cargo lock 70 b of fig7 the attachment points ( i . e . the centroid of attachment ) are between the stud pairs , namely centroid 71 between stud pair 11 , 13 and centroid 72 between stud pair 12 , 14 . the stud pairs of cargo lock 70 b are still separated by a distance d ′ providing the desired effective separation between the attachment points . if additional studs are included along the length of the cargo lock ( for example studs 16 , 17 , 18 , 19 shown in fig4 in phantom ) such studs are preferably designed in conjunction with the flexibility of the tracks and aircraft floor so as not to negate the force separation quality of the primary attachment points at the outer ends of the cargo lock . such flexibility may be accomplished by including additional vertical spacing or elastomeric connection in the center studs 16 - 19 such that even though the upward tensile force is applied at the center of the cargo lock by the pawls 31 , 32 , the majority of the upward tensile force is transferred to the primary end studs 11 , 12 and thereby distributed between the support beams 51 , 52 . in a preferred construction , the cargo lock is elongated having a relatively low aspect ratio r defined as the ratio of the height h ( i . e . a maximum height of the lock as measured with the pawls 31 , 32 retracted ) to the length d ( the effective distance between the end attachment points ): preferably , the aspect ratio of an elongated cargo lock is less than about ⅛th ( 0 . 125 ) or even smaller , namely about 0 . 10 , with certain implementations being about0 . 06 . the aspect ratio h / d of the cargo lock 70 a of fig4 and the aspect ratio h / d ′ of the cargo lock 70 b of fig7 are about 0 . 05 . in a boeing 727 aircraft , the distance b between the support columns is about 20 inches . in actual construction , the dimensions of a cargo lock 70 b for this boeing 727 aircraft may be in smaller aircraft , the distance between support beams will be smaller , but the size of the cargo locks will also be smaller but would be designed such that d ≧ b and having an aspect ratio r less than 0 . 125 to provided the desired spacing of attachment points . one or more pawls to secure cargo pallets to the lock mounted on the baseplate ; a tensile stud set ( of one or more tensile studs ) mounted on the baseplate on each side of the pawl ( s ), the stud set being spaced from the pawl ( s ) at a distance that is about half the spacing of the seat track support points ; preferably , the distance between the pawl ( s ) and the tensile studs is larger than half the spacing of the seat track support points . the distance may be somewhat smaller , but if the distance is too small , the preferred weight distribution advantages may be lost . the rollers are preferably located a distance e ( see fig3 ) away from the pawl ( s ) where e is about less than one - fifth the spacing of the seat track support points . in another preferred configuration , a single stud is used on each side of the pawls . in another preferred configuration , a pair of tensile studs are disposed on each side of the pawls , the studs of the pair being separated by about one seat track hole distance ( 2 p ). in another preferred embodiment , a shear tie is located in - between the two tensile studs in a group . in another preferred embodiment , a single stud is replaced with a group of two or more tensile studs in any arrangement for which the distance between the pawl ( s ) and the closest tensile stud is about equal to half the distance between the seat track support points . in another preferred embodiment , a cargo lock may include additional rollers to further distribute the compressive load across the floor . the cargo locks 70 a / 70 b of fig4 and 7 have four rollers 35 - 38 . a cargo lock may include for example six rollers as the lock 70 in fig1 - 3 , which has a roller 39 a mounted to the baseplate 10 between rollers 35 and 36 and another roller 39 b mounted between rollers 37 and 38 at the other end of the baseplate 10 . the cargo lock may be provided with any number of additional rollers . the rollers are preferable separated as much as possible to distribute the loads . in the embodiment of fig1 - 3 , the center rollers 36 , 37 are located adjacent the pawls 31 , 32 . the rollers 36 , 37 are shown so close to the pawls 31 , 32 that the pawls 31 , 32 or the rollers 36 , 37 may require movable connections ( not shown ) to the baseplate 10 in order to accommodate retraction of the pawls 31 , 32 . though the present invention has been set forth in the form of its preferred embodiments , it is nevertheless intended that modifications to the disclosed embodiments may be made without departing from inventive concepts set forth herein . the invention , therefore , is not to be restricted except in the spirit of the claims that follow . | 1 |
fig1 is a schematic cross sectional view of a copying machine provided with a display device embodying this invention . a photosensitive member 2 is set in the substantially control part of a casing 1 of a copying machine . this photosensitive member 2 is coated with a selenium layer , and is made rotatable in a direction of an indicated arrow a . fitted to the top of the casing 1 is an original sheet table 3 on which a sheet bearing an original impression is to be placed . the original sheet table 3 reciprocates in the directions indicated by arrows b &# 39 ; and b . an exposure lamp 4 for illuminating the original sheet is provided below the original sheet table 3 . a light is shed from end to end of the original sheet , as the original sheet table 3 moves on . light beams reflected from the original sheet are projected on the surface of the photosensitive member 2 through a first mirror 5 , lens unit 6 and second mirror 7 collectively constituting an exposure device 8 . arranged near the photosensitive member 2 are discharging lamp 10 , for eliminating an electric charge accumulated on the surface of the photosensitive member 2 , and a charging device 11 , for electrically charging the surface of the photosensitive member 2 . when the surface of the photosensitive member 2 , which is charged after the preceding discharge , is exposed to a light emitted from the exposure device 8 , then a latent image is formed on said surface . set beyond the charging device 11 is a developing device 12 which renders the static latent image visible by a developing agent ( hereinafter referred to as &# 34 ; a toner &# 34 ;). this developing device 12 comprises a toner hopper 13 for holding the toner and a magnetic brush developer 15 which uniformly spreads the toner supplied from the toner hopper 13 in fine particles over the surface of the photosensitive member 2 by means of a transport magnet roller 14 rotating in a direction indicated by arrow c . the developing device 12 is detachably received in the casing 1 . a freely operable hopper cover 13a is mounted on the upper opening of the toner hopper 13 . further received in the casing 1 are a magnet 13b actuated in accordance with the opening and closing of the hopper cover 13a and a magnet switch 13c for detecting the opening and closing of the hopper cover 13a from the actuation of said magnet 13b . set below the developing device 12 is a sheet feeder 20 for carrying a copy sheet to the underside of the photosensitive member 2 . the sheet feeder 20 comprises a sheet - feeding cassette 21 which holds a plurality of copy sheets and is detachably positioned on a side of the casing 1 and a third sheet feed roller 22 for drawing out copy sheets from said sheet - feeding cassette 21 one after another . above the sheet - feeding cassette 21 and detachably portioned on a side of the casing 1 is a sheet feed cassette 23 by means of a sheet feed mechanism 24 . said sheet feed cassette 23 enables sheets to be supplied either manually or by means of a cassette . second sheet feed rollers 25 , 25 are provided to carry forward a sheet drum from the sheet feed cassette 23 . the sheet feeder 20 is provided with aligning rollers 26 , 26 for transporting a sheet pulled out of the sheet feed cassette 21 or 23 with the leading end portion of said sheet secured in a proper position . detachably provided beyond the sheet feeder 20 is a unit consisting of a transcription charger 27 for transposing a toner image formed on the surface of the photosensitive member 2 on to a sheet brought by the aligning rollers 26 and a separation charger 28 for releasing from the photosensitive member 2 a sheet on which a toner image has been transcribed . the photosensitive member 2 embodying this invention has an outer diameter of about 80 mm , thereby eliminating the necessity of providing a separation pawl as has been the case with the prior art when , a sheet is taken off the photosensitive member 2 . set beyond the separation charger 28 is a cleaning device 29 for recovering toner particles retained on the surface of the photosensitive member 2 after the transcription of a toner image on a copy sheet . the aforementioned discharging lamp 10 is fitted to the cleaning device 29 in a state length wise extending along part of the outer wall of the photosensitive member 2 at a prescribed distance therefrom . a suction sheet - carrying device 30 is provided to carry forward a sheet which has been taken off the photosensitive member 2 after the transcription of a toner image on said sheet . said suction sheet - carrying device 30 is constructed by a plurality of flat belts 31 , each of which is provided with a plurality of orifices and each of which is rotatably stretched over guide rollers 32 , 32 , 32 . a suction duct 33 connected to a suction blower ( not shown ) is pressed against part of the inner wall of said flat belts 31 . therefore , a copy sheet is carried forward in a state adsorbed to the flat belts 31 . application of such suction sheet - carrying device 30 enables copy sheets of various sizes to be transported very easily . moreover , air is guided through the suction duct 33 , thereby also providing the effect of cooling the interior of the casing 1 and the ventilating efficiency therein . a fixing device 36 is provided which is formed of heat rollers 35 , 35 designed to fix a toner image transcribed on a copy sheet brought by the suction sheet - carrying device 30 . a copy sheet on which a transcribed toner image is fixed is drawn into an external discharged copied sheet tray 38 through copied sheet - discharging rollers 37 , 37 . reference numeral 39 given in fig1 denotes an exhaust fan . the aforementioned exposure device 8 , developing device 12 , transcription charger 27 , separation charger 28 , cleaning device 29 and suction sheet - carrying device 30 are fully assembled into a unit . this unit is received in the casing 1 in an easily detachable state , thereby ensuring a reduction in the cost of manufacturing a copying machine and facilitating its maintenance . fig2 shows the layout of various patterns impressed on the display panel of the display device of this invention . the display panel is formed of a liquid crystal . in fig2 a reference numeral 41 denotes a liquid crystal display panel ; 42 a lower cover display segment ; 43 a closed upper cover display segment ; 44 an open upper cover display segment ; 45 a sheet feed cassette segment ; 46 a pictorial notation segment for indicating the absence of copy sheets in the sheet feed cassette ; 47 a manual sheet feed table segment ; 48 , 49 , 50 sheet passage segments ; 51 a pictorial notation segment for indicating a manual sheet feed passage jammed with sheets ; 52 a pictorial notation segment for indicating a sheet feed passage jammed with sheets ; 53 a pictorial notation segment for indicating the fixing device 36 or a sheet passage nearby which is jammed with sheets ; 54 a pictorial notation segment for indicating the photosensitive member 2 jammed with tightly wound sheets or the cleaning device 29 jammed with sheets carried thereinto ; 55 a segment for indicating the photosensitive member 2 intended to produce a toner image ; 56 a pictorial notation segment for indicating the cleaning device 29 fully filled with recovered toner particles ; 57 a pictorial notation segment for indicating that the toner has all been drawn from the toner hopper 13 of the developing device 12 ; 58 a pictorial notation segment for indicating that the original sheet table 3 or drive motor has become immovable , requiring maintenance or repair by a serviceman ; 59 a segment for indicating a tray into which copied sheets are collected ; 60 a pictorial notation segment for indicating that a key counter has been rendered ready for operation ; 61 a pictorial notation segment for indicating that full preparation has been made for the copying operation ; 62 a pictorial notation segment , which , with the aid of said segment 61 , shows that the copying machine has failed ; 63 a 2 - digits segment for indicating the number of copied sheets ; 64 a pictorial notation segment for indicating an enclosure in which a number of copied sheets is to be displayed ; 65 a pictorial notation segment for indicating that the displayed two digits denote the number of copied sheets ; 66 a pictorial notation segment for indicating that an image outline has been reduced in conformity to the size of a copy sheet used ; 67 a pictorial notation segment for indicating an upper copy sheet cassette already holding copy sheets ; 68 a pictorial notation segment for indicating a lower copy sheet cassette already holding copy sheets ; 69 a pictorial notation segment for indicating that the upper copy sheet cassette has been selected for use ; and 70 a pictorial notation segment for indicating that the lower copy sheet cassette has been selected for use . a common electrode ( not shown ) is provided at the back of the respective segments . some , ( for example , 42 , 47 , 59 ) of the above listed segments are connected together , in the display element 41 of fig2 to be lighted by the same signal . a light from a light source is projected on the respective segments through a color filter . before being impressed with voltage the whole of each segment presents a color ( for example , a black color ) peculiar to the color element of said color filter . when looking through the color filter , the operator can recognize the color of that part of the color filter which faces a segment impressed with voltage . a yellow color filter ( not shown ) is so set as to face the sheet feed cassette segment 45 and pictorial notation segments 46 , 51 , 60 , 62 , which , therefore , are displayed in yellow . a red color filter ( not shown ) is so positioned as to face the pictorial notation segments 52 , 53 , 56 , 58 , which , therefore , are displayed in red . fig3 is a schematic block circuit diagram of the display device embodying this invention . reference numeral 78 denotes a plurality of detectors which are set at those spots of the copying machine of fig1 at which the prescribed conditions thereof are to be detected . reference numeral 80 represents a main control section , which controls the operation of the body of the copying machine and converts output signals from the respective detectors into [ 1 , 2 , 4 , 8 ] weighted binary code signals , and delivers said converted binary code signals to an output terminal d , of the main control section 80 . fig4 is a schematic block circuit diagram of the main control section 80 of the display device of fig3 . a copying machine condition - judging circuit 80 1 ( hereinafter referred to as &# 34 ; a condition - judging circuit &# 34 ;) judges a given condition of the copying machine according to the contents of an output signal from the corresponding detector 78 , and sends forth a signal denoting the result of said judgment . a decoder 80 2 converts a received judgment signal into a binary code signal . table 1 below indicates the judged conditions and the corresponding output binary code signals from the decoder 80 2 . table 1__________________________________________________________________________judgedcondi - decoder outputtion 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32__________________________________________________________________________standby 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 1 1 1 1 1 1 0 0 0 0 0 0 0 0ready 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0no copy 1 1 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 0 0sheetpaper 1 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 1 1 0 0 0 0 0 0 0jammingin sup - ply unitkey 1 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1counterno toner 1 1 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1filled 1 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1with re - coveredtonercall for 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1service - manwrong 1 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1papersepara - tionfrommemberpaper 1 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1jammingin dis - chargeunit__________________________________________________________________________ a buffer 80 3 temporarily holds an output binary code signal from the decoder 80 2 . a timing circuit 80 4 sends forth clock signals and also latch signals in synchronization with the prescribed ones of the clock signals . the display device is operated in synchronization with the prescribed ones of the clock signals . data temporarily held in the buffer 80 3 is issued in synchronization with an output clock signal from the timing circuit 80 4 . the main control circuit 80 is formed of , for example , a microcomputer . reference numeral 81 denotes a liquid crystal drive circuit , whose input terminal d receives data signals from the main control circuit 80 , each time a clock signal is supplied to the input terminal c p of said liquid crystal drive circuit 81 . reference numeral 82 represents an oscillation circuit which oscillates signals in an optimum frequency for the drive of the liquid crystal . the oscillation circuit generates a drive pulse signal , and an inverter circuit 83 sends forth an inverted drive pulse signal . this inverted drive pulse signal is supplied to the liquid crystal drive circuit 81 . the output terminals o1 to o32 of the liquid drive circuit 81 issue output signals corresponding to the segments s1 to s32 of a liquid crystal display element received in the liquid crystal display panel 41 . an output drive pulse from the oscillation circuit 82 is delivered to the segment s33 of the liquid crystal display element . an output inverted drive pulse signal from the inverter circuit 83 is supplied to a common electrode 84 provided for the segments s1 to s33 . fig5 is a schematic block circuit diagram of the liquid crystal drive circuit 81 . data signals supplied from the input terminal d are supplied in succession to the thirty - two shift registers sr1 to sr32 , each time a clock pulse is delivered to the input terminal c p . directly connected to said shift registers sr1 to sr32 are store registers rg1 to rg32 for holding the contents of said shift registers sr1 to sr32 upon receipt of a latch signal from the input terminal l . the store registers rg1 to rg32 control the operation of thirty - two switches sw1 to sw32 according to the contents stored in said store registers rg1 to rg32 , and supply a drive pulse signal or inverted drive pulse signal to output terminals 01 to 032 . when the contents of some of the store registers rg1 to rg32 have a logic level &# 34 ; 1 &# 34 ;, then a drive pulse signal is issued to the corresponding output terminals . when the contents of some of the store registers rg1 to rg32 have a logic level &# 34 ; 0 &# 34 ;, then an inverted drive pulse signal is sent forth to the corresponding output terminals . the shift register sr1 , store register rg1 , switch sw1 and output terminal o1 correspond to each other . similarly , the other thirty - one shift registers sr2 to sr32 , thirty - one store registers rg2 to rg32 , thirty - one switches sw2 to sw32 and thirty - one output terminals o2 to o32 correspond to each other . reference numeral 85 denotes a cooled cathode discharge tube . when a light is allowed to pass through a color filter ( not shown ) from below the liquid crystal display panel 41 , then the color of said color filter is displayed . description is now given with reference to fig6 and 7 of the operation of a display device embodying this invention . when the power switch of a copying machine ( not shown ) is rendered conducting at time t0 ( fig6 a ), then the main control section 80 is operated in the previously programmed order . the main control section 80 causes a fixing heater to be supplied with power . at this time the fixing device 36 is not yet sufficiently heated to carry out fixing ( fig6 b ). therefore , the main control section 80 sends forth a binary code signal [ 0000 0000 0000 1100 0011 1111 0000 0000 ] denoting a standby state ( a state in which copying operation is impossible ) indicated in table 1 ( said binary code signal is hereinafter referred to as &# 34 ; a data a signal &# 34 ;) in synchronization with the prescribed ones of clock signals sent forth from the output terminal c p . ( fig6 c and 6d ). when the transfer of the data of the last 32nd bit is brought to an end , the main control section 80 issues a latch signal ( fig6 e ). as a result , the bits of the data a signal are held in the store registers rg1 to rg32 of the liquid crystal drive circuit 81 . drive pulse signals ( fig7 a ) are issued from the output terminals o13 , o14 , o19 , o20 , o21 , o22 , o23 , o24 corresponding to store registers rg13 , rg14 , rg19 , rg20 , rg21 , rg22 , rg23 , rg24 where contents are set at a logic level &# 34 ; 1 &# 34 ;. these drive pulses are supplied to the corresponding segments s13 , s14 , s19 , s20 , s21 , s22 , s23 , s24 shown on the liquid crystal display panel 41 ( fig7 d ). inverted drive pulses ( fig7 b ) are sent forth from the output terminals of the remainder ( whose contents are set at a logic level &# 34 ; 0 &# 34 ;) of the thirty - two store registers obtained by excluding the aforementioned store registers rg13 , rg14 , rg19 , rg20 , rg21 , rg22 , rg23 , rg24 . said inverted drive pulses are supplied to the other segments than the previously described segments of the liquid crystal display panel 41 . the common electrode 84 ( fig3 ) is supplied with an inverted drive pulse signal ( fig7 c ). as shown , therefore , in fig7 f , a voltage signal having a level equal to a difference between the level of fig7 d and the level of fig7 c is impressed between the common electrode 84 and the segments s13 , s14 , s19 , s20 , s21 , s22 , s23 , s24 , which in turn are lighted . in contrast , a voltage signal having the same level ( fig7 c and 7e ) as impressed between the common electrode 84 and the other segments of the thirty - two segments . as shown in fig7 g , therefore , no potential difference appears between the common electrode 84 and the remainder of the thirty - two segments arrived at by subtracting the aforesaid segments s13 , s14 , s19 , s20 , s21 , s22 , s23 , s24 , thereby preventing said remainder of the thirty - two segments from being lighted . the same a . c . voltage as shown in fig7 f is impressed between the common electrode 84 and the segment s33 which is always supplied with a drive pulse signal . therefore said segment s33 always remains lighted . as seen from fig8 therefore , there are lighted pictorial notation display segments 61 , 62 , and lighted digit display segments 63 , 64 , 65 corresponding to the segments s13 , s14 , s19 , s20 , s21 , s22 , s23 , s24 . the display pattern of fig8 shows that the copying machine remains in a standby state , that is , a state in which it is impossible to conduct a copying operation . when , after the standby state , the copying machine is sufficiently heated for fixing at time t1 and rendered ready for a copying operation ( fig9 b ), then the main control section 80 causes a binary code signal denoting full preparation for a copying operation which is represented by binary codes [ 0000 0000 0000 1000 0001 1000 0000 0000 ] as shown in table 1 ( said binary code signal is hereinafter referred to as &# 34 ; a data b signal &# 34 ;) to be issued in synchronization with the prescribed ones of clock signals sent forth from the output terminal c p ( fig9 c and 9d ). when the transfer of the data of the last 32nd bit is brought to an end , a latch signal is produced from the output terminal l . as a result , the data b signal is held in the store registers rg1 to rg32 of the liquid crystal drive circuit 81 , causing a drive pulse signal to be sent forth from the output terminals o13 , o20 , o21 corresponding to those store registers which store a signal having a logic level &# 34 ; 1 &# 34 ;. the drive pulses are respectively supplied to the corresponding segments s13 , s20 , s21 of the liquid crystal display panel 41 . an inverted drive pulse signal is issued from the other output terminals corresponding to those store registers which store a signal having a logic level &# 34 ; 0 &# 34 ;. as previously described , the common electrode 84 is supplied with an inverted drive pulses ( fig3 ), and the segment s33 is supplied with a drive pulse signal . as shown , therefore , in fig1 f , a voltage signal having a level equal to a difference between the level of the common electrode 84 and the level of the segments s13 , s20 , s21 , s33 is supplied , causing said segments s13 , s20 , s21 , s33 to be lighted . a voltage signal having the same phase is impressed between the common electrode 84 and the other segments of those described above , thereby giving rise to no potential difference as illustrated in fig1 g . consequently the segments other than the aforementioned segments s13 , s20 , s21 , s33 are prevented from being lighted . at this time , a pictorial relation display segment 61 , digit display segment 63 and segments 64 , 65 are lighted , thereby indicating that the copying machine has been made fully ready for a copying operation and that a number of copy sheets to be copied during a prescribed length of time is , for example , one , as illustrated by a digit &# 34 ; 1 &# 34 ; represented by said digit display segment 63 . when , as shown in fig1 a , copy sheets have all been drawn off from the sheet feed cassette 21 at time t2 during a copying operation and a detecting means ( not shown ) finds this event , then the main control section 80 stops the operation of the copying machine , and supplies to the output terminal d a binary code signal shown in table 1 as [ 1101 0000 0000 1000 0011 1111 1000 0000 ] which denotes the absence of copy sheets in the cassette 21 ( fig1 b , 12c and 12d ). as a result , there is supplied a voltage signal having a level equal to a difference between the level of the common electrode 84 and the level of the segments s1 , s2 , s4 , s13 , s19 , s20 , s21 , s22 , s23 , s24 , s25 and s33 . therefore these segments are lighted , and the other segments are prevented from being lighted . at this time , upper and lower cover segments 43 , 42 , manual sheet feed table display segment 47 , tray display segment 59 , pictorial notation display segment 61 , digit display segment 63 and other segments 64 , 65 are lighted . further , the sheet feed cassette display segment 45 and pictorial notation display segment 46 are intermittently displayed in yellow , thereby indicating that copy sheets have all been drawn off from the copying machine . the shift registers sr19 to sr32 and store registers rg19 to rg32 of the liquid crystal display drive circuit 81 are used to indicate a number of copied sheets . in the above - mentioned example of fig1 a number of &# 34 ; 1 &# 34 ; is subtracted from the digit represented by the digit display segment 63 , each time one copy sheet is copied . therefore , the digit &# 34 ; 8 &# 34 ; denoted by said digit display segment 63 means that copy sheets have all been drawn off from the sheet feed cassette 21 , though eight more copy sheets have to be copied . when , at time t3 ( fig1 a ) during the copying operation , copy sheets supplied from a sheet feed cassette ( not shown ) are jammed immediately after their feeding , and this event is detected by detection means ( not shown ), then the main control section 80 stops the operation of the copying machine in accordance with a program , and delivers to the output terminal d a binary code signal denoting the jamming of copy sheets , as [ 1010 1000 0000 0000 0010 1111 1000 0000 ] shown in table 1 ( fig1 b , 15c and 15d ). as a result there is supplied a voltage signal having a level equal to a difference between the level of the common electrode 84 and the level of the segments s1 , s3 , s5 , s19 , s21 , s22 , s23 , s24 , s25 , s33 , causing these segments to be lighted and preventing the other segments from being lighted . at this time , the upper and lower cover display segments 44 , 42 , photosensitive member display segment 55 , tray display segment 59 , digit display segment 63 , and other segments 64 , 65 are lighted as shown in fig1 . further , the manual sheet feed table display segment 47 , and sheet passage display segment 49 are intermittently displayed in yellow , and the pictorial notation display segment 52 is intermittently displayed in red . thus , the jamming of sheets has occurred in the copying machine . as seen from fig1 , the upper cover of the copying machine which has been closed up to this time is now shown to be opened . in the case of fig1 , the jamming of copy sheets has taken place , when for example , six more sheets have to be copied . as described above , the main control section 80 causes a binary code signal ( shown in table 1 ) corresponding to a prescribed condition of a copying machine to be issued to the liquid crystal drive circuit 81 upon receipt of an output signal from a detector positioned at that part of the copying machine where its prescribed condition is to be recognized . as a result , a desired pattern is shown on the liquid crystal display panel 41 . when a key counter is not set in a copying machine which can not carry out a copying operation under such condition , then the upper and lower cover display segments 43 , 42 , manual sheet feed table display segment 47 , tray display segment 59 , digit display segment 63 and other segments 64 , 65 are lighted , and a pictorial notation display segment 60 is intermittently displayed in yellow ( fig1 ). the above - mentioned operation is used to indicate that the setting of the key counter is commanded , and the copying machine still remains incapable of a copying operation . when the toner is all drawn from the toner hopper 13 , then the upper and lower cover display segments 43 , 42 , manual sheet feed table display segment 47 , tray display segment 59 , pictorial notation display segment 61 , digit display segment 63 and the associated segments 64 , 65 are lighted , and the pictorial notation display segment 57 is intermittently displayed in yellow ( fig1 ). the above - mentioned operation is used to indicate the absence of the toner in the toner hopper 13 . when the cleaning device 29 is fully filled with recovered toner particles , then the upper and lower cover display segments 43 , 42 , manual sheet feed table display segment 47 , tray display segment 55 , digit display segment 63 and the other associated segments 64 , 64 are lighted , and further a pictorial notation display segment 56 is intermittently displayed in yellow ( fig2 ). the above - mentioned operation is used to indicate that the discharge of recovered toner particles is pictorially instructed . when the motor ( not shown ) or the original sheet table 3 happens to become immovable , then a digit display segment 63 and the associated segments 64 , 65 are lighted , and further a pictorial notation display segment 58 is intermittently displayed in red ( fig2 ). the above - mentioned operation is used to indicate that a demand is pictorially instructed for the call of a serviceman . when a copied sheet fails to be released from the surface of the photosensitive member 2 , then the upper and lower cover display segments 44 , 42 , manual sheet feed table display segment 47 , photosensitive member display segment 55 , tray display segment 59 , digit display segment 63 and the associated segments 64 , 65 are lighted , and further a pictorial notation display segment 54 is displayed in red ( fig2 ). the above - mentioned operation is used to indicate that a copied sheet has failed to be taken off the photosensitive member , and the copying machine has become incapable of performing a copying operation . when sheet jamming arises in the fixing device 36 , or sheet passage , then the upper and lower cover display segments 44 , 42 , manual sheet feed table display segment 47 , photosensitive member display segment 55 , tray display segment 59 , digit display segment 63 , and the associated segments 64 , 65 are lighted , and further a sheet passage display segment 50 and a pictorial notation display segment 53 are intermittently displayed in red ( fig2 ). the above - mentioned operation is used to indicate that sheet jamming has taken place in the aforesaid fixing device 36 or sheet passage . when sheet jamming occurs in a manual sheet feed guide , then the upper and lower cover display segments 43 , 42 , manual sheet feed table display segment 47 , sheet passage 48 , tray display segment 59 , digit display segment 63 , and the associated segments 64 , 65 are lighted , and further a pictorial notation display segment 51 is intermittently displayed in yellow ( fig2 ). the above - mentioned operation is used to indicate that sheet jamming has occurred in the manual sheet feed guide . when a lens system fails to take a position where the original impression is to be magnified or reduced in size , then the digit display segment 63 and the associated segments 64 , 65 are lighted , and further another display segment 66 is intermittently displayed in green , and a pictorial rotation display segment 58 is intermittently displayed in red . the above - mentioned operation is used to indicate that a demand for the call of a serviceman is pictorially instructed . a display device embodying this invention which is arranged as described above has the advantages that the various conditions of a copying machine can be accurately and concretely indicated ; when sheet jamming arises , or a copied sheet fails to be released from the surface of a photosensitive member , then the operator can easily judge whether the upper cover should be opened or can be left closed or whether the power switch should be cut off or can remain conducting in order to resolve the above mentioned abnormal conditions ; the operator can become accustomed to the operation of the copying machine and consequently carry out the copying work more quickly than has been possible in the past ; and not only an accurate and distinct instruction can be given but also a proper easily understandable display can be made to the operator with respect to an abnormal condition of the copying machine . the foregoing description refers to the case where the display element was formed of a liquid crystal . however , the same effect can be assured , even if any other light - emitting element such as a light - emitting diode is jointly used with a well - matched drive device . the liquid crystal display element can be so arranged to make a positive or negative display . description was given of the case where the display device of the invention was applied to indicate the conditions of an ordinary electronic copying machine . however , the subject display device is not limited to said application , but can be used to display the various conditions of an electronic printer , facsimile transceiver or image - detecting device which has a construction similar to that of said ordinary electronic copying machine . the point is that the display device of the invention is applicable to any instrument where a movable section is so operated by the user as to meet the need . obviously , this invention can be applied in various modifications without departing from the object described above . | 6 |
the molding composition used in this invention is usually a mixture of 100 parts by weight of ethylenic polymer , 0 . 05 to 30 parts by weight , preferably 0 . 1 to 15 parts by weight , of a foaming agent and 0 . 05 to 10 parts by weight , preferably 0 . 1 to 5 . 0 parts by weight , of a cross - linking agent . furthermore , a molding composition suitable for forming cross - linked , foamed moldings possessing excellent abrasion resistance is a mixture of 100 parts by weight of ethylenic polymer , 1 . 0 to 15 parts by weight of a foaming agent , and 0 . 2 to 3 . 0 parts by weight of a cross - linking agent . if desired , an inorganic filler such as asbestos , talc , calcium carbonate , etc . ; a lubricant such as zinc stearate , stearic acid , etc . ; and a pigment may be incorporated in the molding composition . in order to simultaneously carry out foaming and cross - linking of the molding composition in the molding composition holding chamber and to further carry out continuous injection molding in the present invention , it is necessary that the decomposition temperature of the foaming agent and cross - linking agent be higher than the plasticizing temperature of the ethylenic polymer employed . further , if the temperature difference between the decomposition temperature of the foaming agent ( temperature at which the foaming agent generates a foaming gas by the thermal decomposition thereof ) and the decomposition temperature ( one minute half - life temperature ) of the cross - linking agent for forming radicals necessary for initiating cross - linking reaction is too large , the faults occur that the molding composition in the holding chamber loses fluidity due to non - foaming and excessive cross - linkage or cross - linking becomes insufficient , which sometimes makes it difficult to obtain satisfactory , homogeneous cross - linked , foamed moldings . thus , it is necessary that the decomposition temperature of the foaming agent used not differ too much from the decomposition temperature ( one minute half - life temperature ) of the cross - linking agent used , or the temperature difference between both decomposition temperatures be at most 20 ° c . the decomposition temperature of the foaming agent can be reduced using a foaming aid , and in the case of using such a foaming aid , the decomposition temperature means the thus obtained reduced decomposition temperature . the term &# 34 ; ethylenic polymer &# 34 ; used throughout the specification and claims includes homopolymers of ethylene such as high - pressure polyethylene , intermediate - pressure polyethylene and low - pressure polyethylene ; copolymers of ethylene and one or more comonomers such as vinyl acetate , propylene , acrylic acid , acrylic acid esters , etc . ; mixtures of two or more of such polymers ; and mixtures of the aforesaid polymers and other polymers miscible with the aforesaid polymers , such as natural rubber , ethylene - propylene rubber , styrene - butadiene copolymer , polybutene - 1 , butyl rubber , polyisobutylene , polystyrene , abs rubber , etc . ethylene - vinyl acetate copolymers are most preferable . examples of the foaming agents used are azodicarbonamide , p - toluenesulfonyl hydrazide , azobis - isobutyronitrile , dinitrosopentamethylene tetramine , etc ., all of which have a decomposition temperature higher than the plasticizing temperature of the ethylenic polymer . examples of the cross - linking agents used are 1 , 3 - di -( t - butyl - peroxy - isopropyl ) benzene , benzoyl peroxide , dicumyl peroxide , 1 , 1 - di - t - butyl - peroxy - 3 , 3 , 5 - trimethylcyclohexane , etc ., all of which have a decomposition temperature higher than the plasticizing temperature of the ethylenic polymer . the molding composition can be prepared by any mixing method , but it is necessary to mix at temperatures which do not cause decomposition of the cross - linking agent and the foaming agent . mixing in a henschel mixer , a tumbler mixer , etc ., may be used . also , for kneading the molding composition , a banbury mixer , a roll , a granulator , etc ., can be used . an example of the present invention will now be given by referring to the accompanying drawings . fig1 a shows a sectional side view of one embodiment of a cylinder head having a molding composition holding chamber provided at the exit end of the cylinder of an injection molding machine suitable for the practice of this invention . a molding composition comprising an ethylenic polymer , a foaming agent , a cross - linking agent , and , if desired , other additives is fused , kneaded , and passed by means of screw 1 for plasticization and injection through the area of cylinder 2 ( heated by heater 4 - 1 to a temperature which is higher than the plasticization temperature of the ethylenic polymer but lower than the temperature which would cause substantial decomposition of the foaming agent and cross - linking agent ), and then introduced into a molding composition holding chamber 5 formed at the exit end of cylinder head 3 . the molding composition holding chamber can be of the known accumulator type . the molding composition thus plasticized and introduced into the molding composition holding chamber 5 is heated therein to the proper temperature and retained therein for a proper residence time at a temperature suitable to cause foaming and cross - linking in the molding composition holding chamber ( which essentially functions as a reaction chamber until the molding composition is injected from injection nozzle 10 . the molding composition thus provided with the proper degree of cross - linking in the molding composition holding chamber is injected into a mold , wherein the molding composition is shaped and solidified by cooling in situ . the injection of the molding composition is carried out by moving spring bearing 7 to the left as shown in fig1 a and sliding needle 9 in a valve housing 8 to the left as shown in fig1 a . after the injection is completed , needle 9 moves to the right as shown in fig1 a , due to the action of spring 6 , to close nozzle 10 . the expansion ratio of the molding composition can be adjusted by controlling the amount of the molding composition fed to the mold . in fig1 a elements 4 - 2 and 4 - 3 represent heating means for the molding composition holding chamber and the injection nozzle , respectively . as will be appreciated from later discussion , the heating means 4 - 2 serves to heat the molding composition holding chamber , the walls of which can be considered &# 34 ; heat conductors &# 34 ; for purposes of determining the maximum cross - sectional length of the molding composition holding chamber . fig2 a and 2b show a further embodiment of apparatus for use in practicing the present invention wherein like numerals to those utilized in fig1 a and 1b are used . the only difference of substance between fig1 a and 1b and fig2 a and 2b is that an annular molding composition holding chamber is utilized in fig2 a and 2b , with a centrally disposed heated conductor 4 - 2a also being shown , wherein the inner radius of the annulus is shown as r 2 in fig2 b and the outer radius of the annulus is shown as r 1 in fig2 b . in the present specification , it will be appreciated by one skilled in the art that the cylinder portion of the injection molding machine represents that portion prior to the molding composition holding chamber . the examples shown below illustrate in detail the process of this invention for forming homogeneous cross - linked , foamed moldings of ethylenic polymer having excellent abrasion resistance . as shown in example 1 , it is necessary with a molding composition comprising an ethylene - vinyl acetate copolymer as the ethylenic polymer , 1 , 3 - bis -( t - butyl - peroxyisopropyl ) benzene as the cross - linking agent , and azodicarbonamide as the foaming agent , that the temperature of the cylinder portion ( pre - holding chamber area ) be kept below 200 ° c ( the one minute half - life temperature of the cross - linking agent plus 20 ° c ) and the highest temperature of the molding composition holding chamber be kept at 250 ° c ( the one minute half - life temperature of the cross - linking agent plus 70 ° c ) to increase the gel percentage of the molded article to higher than 30 %. furthermore , as shown in example 2 , it is necessary with a molding composition comprising an ethylene - vinyl acetate copolymer as the ethylenic polymer , 1 , 1 - di - t - butyl - peroxy - 3 , 3 , 5 - trimethyl cyclohexane as the cross - linking agent , and azodicarbonamide as the foaming agent , the temperature of the cylinder portion ( pre - holding chamber area ) be kept below 170 ° c ( the one minute half - life temperature of the cross - linking agent plus 20 ° c ) and the highest temperature of the molding composition holding chamber be kept at 220 ° c ( the one minute halflife temperature of the cross - linking temperature plus 70 ° c ) in order to increase the gel percentage of the molded article to higher than 30 % but less than about 40 % as particularly shown in fig8 and example 2 . in addition , it should be understood that the lowest temperature of the molding composition holding chamber is the temperature of the cylinder portion , i . e ., that portion of the apparatus prior to the molding composition holding chamber . when the temperatures of the cylinder portion and the molding composition holding chamber are too high , the gel percentage of the molded articles is reduced because the radicals generated by the decomposition of the cross - linking agent are disturbed by the foaming agent or the decomposition product of the foaming agent . this is supported by the results shown in the reference example described below , where with a molding composition containing no foaming agent no trouble occurred with the cross - linking reaction even when the temperature of the molding composition was increased to a temperature of 100 ° c higher than the one minute half - life temperature of the cross - linking agent in the molding composition . also , by referring to the results in the reference example where cross - linking was hindered by the foaming agent or the decomposition product of the foaming agent , it is clear that the above rules hold with ethylenic polymers other tha those illustrated in the examples , and thus the invention is not to be limited to the examples . if the gel percentage of the cross - linked , foamed moldings is lower than 30 %, the molded articles show insufficient abrasion resistance , i . e ., to obtain cross - linked , foamed moldings having excellent abrasion resistance , it is necessary that the gel percentage of the moldings be higher than 30 %. the term &# 34 ; gel percentage &# 34 ; in this specification is defined as follows : when 0 . 3 - 0 . 4 g of a sample from a cross - linked , foamed molding is placed in a metallic screen box ( 120 mesh ) in xylene at 80 ° c , the gel percentage of the sample is calculated as follows : wherein ( a ) is the weight of the sample remaining in the metal screen box after the test and ( b ) is the weight of the sample before the test . one embodiment of apparatus in accordance with the present invention for forming cross - linked , foamed moldings of excellent abrasion resistance will now be explained in detail . it is necessary that the molding composition holding chamber of the injection molding machine of this invention has a capacity sufficient to contain at least the amount of molding composition needed to form one molded article , i . e ., sufficient to complete one injection molding cycle , and , for commercial scale operation , the capacity of the molding composition holding chamber is greater than the amount of the molding composition injected into the mold for forming one molded article . if the capacity of the molding composition holding chamber is less than the amount of the molding composition injected into the mold to form one molded article , a part of the molding composition injected into the mold will not have been retained in the molding composition holding chamber for a sufficient time . in such a case , cross - linking and foaming do not occur uniformly and , since the foaming agent remains partially unreacted , the remaining foaming agent colors the molded article . thus , as described above , the capacity of the molding composition holding chamber of the injection molding machine of this invention must be at least equal to and can be larger than the volume of the molding composition injected into the mold to form one article . if the capacity of the molding composition holding chamber is larger than the volume of the molding composition to be injected into the mold , some of the molding composition introduced into the molding composition holding chamber may remain therein without being injected into the mold in the first injection step , but since the temperature of the molding composition holding chamber is selected according to the residence time of the molding composition in the holding chamber , good molded articles can be continuously formed even in such a case . as shown in example 3 , when the molding cycle ( i . e ., the residence time of the molding composition in the holding chamber ) is one minute , it is necessary , to obtain uniform foamed molded articles which have been cross - linked at a gel percentage of higher than 30 %, to employ a molding composition holding chamber having a cross section of less than 50 mm ( inner diameter ) in the case that the cross section of the molding composition holding chamber is circular and to employ a molding composition holding chamber having a cross section of wherein r 1 is the outer radius of the annular holding chamber and r 2 is inner radius of the annular holding chamber , in the case that the molding composition holding chamber is annular , as shown in example 3 , if the shape of the molding composition holding chamber differs from the aforesaid shape unfoamed portions of the molded articles can be foamed completely using a one minute molding cycle by increasing the temperature of the molding composition holding chamber , but in this case the gel percentage of the molded articles formed is low , and thus the products which have been cross - linked to a gel percentage of higher than 30 % and uniformly foamed cannot be obtained . it should be understood that the above parameters are also applicable to the molding composition holding chambers having forms other than those illustrated above , i . e ., to obtain molded articles which are cross - linked to a gel percentage of higher than 30 % and uniformly foamed it is only necessary to use a holding chamber for the molding composition which has a hollow form in which the greatest value of the shortest distance from any point in a cross - section of the molding composition holding chamber to a heat conductor is less than 25 mm or to use a holding chamber for the molding composition having an annular form in which the greatest value of the shortest distance from any point in a cross - section of the molding composition holding chamber to a heat conductor is less than 15 mm . several examples of cross sectional views of hollow and annular molding composition holding chambers which can be employed in this invention are illustrated in fig3 a to 3e , although the molding composition holding chambers are not to be limited thereto . the heat conductor is shown by the shaded portions in fig3 a to 3e . in each figure of fig3 a to 3e , the greatest value of the shortest distance from any point in the molding composition holding chamber to a heat conductor in the cross section is shown by an arrow . the above - described results are those obtained when the molding cycle is one minute on an industrial scale ; a molding cycle of one minute is considered to be the longest desirable commercial molding cycle , as if the molding cycle is longer than one minute , the time required for the formation of the moldings becomes undesirably high from a cost ( output ) viewpoint , and thus , the aforesaid results apply to the commercial use of this invention . in example 3 a molding composition consisting of an ethylene - vinyl acetate copolymer as the ethylenic polymer , 1 , 3 - bis -( t - butyl - peroxy - isopropyl ) benzene as the cross - linking agent , and azodicarbonamide as the foaming agent was used . since the decomposition temperature of the cross - linking agent is near that of the foaming agent , other molding compositions than the above , consisting of combinations or other cross - linking agents and foaming agents with an ethylenic polymer can be used , the decomposition temperatures of the agents are higher than the plasticization temperature of the ethylenic polymer , may be molded as in example 3 by only changing parallelly the temperature of the cylinder and the molding composition holding chamber of the injection molding machine as degree as the difference between the decomposition temperature of the crosslinking agent of this molding composition and that of the molding composition in example 3 . that is , the molding composition in this invention is not limited to the system of the ethylenic polymer , the cross - linking agent , and the foaming agent as described in example 3 . the process and the apparatus of this invention have the following merits : 1 . since foaming and cross - linking of the molding composition are carried out in the molding composition holding chamber and then the molding composition is injected followed by solidification by cooling , the dimensional accuracy and reproducibility are high for both low foaming ratio moldings and high foaming ratio moldings . 2 . since foaming and cross - linking are carried out simultaneously and continuously in a molding composition holding chamber and then the cross - linked , foamed composition is cooled immediately in a mold , the molding production rate is shortened , which is quite profitable from the viewpoint of cost . 3 . uniformly cross - linked , foamed moldings having excellent abrasion resistance and a cross - linkage of higher than 30 % ( gel percentage ) can be obtained in a continuous fashion . the invention will now be further illustrated by the following examples . a mixture of 100 parts by weight of an ethylene - vinyl acetate copolymer ( melt index , 20 dg / min ; vinyl acetate content , 20 % by weight ), 5 parts by weight of azodicarbonamide as the foaming agent ( decomposition temperature 200 ° c ; when 2 parts by weight of zinc stearate is added thereto , the decomposition temperature is reduced to about 180 ° c ), 0 . 6 part by weight of 1 , 3 - bis -( t - butyl - peroxy - isopropyl ) benzene ( one minute half - life temperature 180 ° c ; purity 40 %) as the cross - linking agent , 20 parts by weight of calcium carbonate as a filler and 2 parts by weight of zinc stearate as a foaming aid agent was kneaded on a 16 inch roll for 15 minutes at a temperature of 90 ° c to provide a molding composition . the molding composition thus prepared was injected into a mold for shoe soles having a volume of 600 cc using the apparatus shown in fig1 ( the volume of the molding composition holding chamber was 300 cc and the inner diameter of the holding chamber was 40 mm ), and a cross - linked , foamed molding having a gel percentage of more than 30 % was obtained . the foaming ratio of the product was 2 . 0 - 2 . 2 times . the relations between various moldings prepared in the same way as above and the gel percentages of the products are illustrated in fig4 fig5 and fig6 ( reference example ). a mixture of 100 parts by weight of an ethylene - vinyl acetate copolymer ( melt index , 20 dg / min ; vinyl acetate content , 20 % by weight ), 5 parts by weight of azodicarbonamide as the foaming agent ( decomposition temperature 150 ° c ), 1 . 5 parts by weight of 1 , 1 - di - t - butyl - peroxy - 3 , 3 , 5 - trimethylcyclohexane ( one minute half - life temperature 150 ° c ; purity 40 %) as the cross - linking agent , 20 parts by weight of calcium carbonate as a filler , and 1 part by weight of zinc stearate as a foaming aid agent was kneaded on a 16 inch roll for 15 minutes at 75 ° c to provide a molding composition . the molding composition thus prepared was injected into a mold for shoe soles having a volume of 600 cc using the apparatus shown in fig1 ( the volume of the molding composition holding chamber was 300 cc and the inner diameter of the holding chamber was 40 mm ) and a cross - linked , foamed molding having a gel percentage of more than 30 % was obtained . the foaming ratio of the product was 2 . 0 - 2 . 2 times and almost the complete molding composition in the holding chamber was injected per one shot . the relationship between the molding conditions and the gel percentages of the moldings are shown in fig7 fig8 and fig9 ( reference example ). by injecting the molding composition of example 1 using various mold volumes and the apparatus as shown in fig1 or fig2 having the various molding composition holding chambers as shown in table 1 , uniformly foamed , cross - linked moldings having a gel percentage of more than 30 % were obtained using a one minute molding cycle . the influence of the shape of the molding composition holding chamber and the molding conditions on the foaming state and the gel percentage of the moldings obtained are shown in table 1 together with those of the reference example . table 1__________________________________________________________________________one minute molding cyclecross section of moldingcomposition holding circular annularchamberlongest dimension of the ( d ) 40 mm ( d ) 50 mm ( d ) 60 mm ( r . sub . 1 - r . sub . 2 ) = 30 ( r . sub . 1 - r . sub . 2 ) = 40 mmcross section ( r . sub . 2 = 30 ( r . sub . 2 = 40 mm ) volume of holding 300 450 700 450 700chamber ( cc ) mold volume ( cc ) 600 900 1 , 400 900 1 , 400 cross - cross - cross - cross - cross - temp . of cylinder ( 180 ° c ) foaming linking foaming linking foaming linking foaming linking foaming linkingtemp . of molding 230 ° c o o o o x δ * o o x δ * compositionholding chamber 260 ° c o x o x * o x * o x * o x * temp . of cylinder ( 200 ° c ) temp . of molding 230 ° c 0 o o o x δ * o o x δ * compositionholding chamber 260 ° c o x * o x * o x * o x * o x * __________________________________________________________________________ in the above table , the foaming evaluation grades were as follows :? o : uniformly foamed moldings were obtained . x : moldings having considerable unfoamed portions were obtained ; and the cross - linking evaluation grades were as follows : o : gel percentage of more than 30 %. δ : gel percentage of 20 - 30 %. x : gel percentage of lower than 20 %. *: comparison example . the foaming ratio of all moldings was about 2 . 0 - 2 . 2 times . pre - heating condition : heated for 5 minutes at a contact pressure of 5 - 10 kg / cm 2 at the testing temperature pressing condition : after pre - heating , the sample was pressed for 10 minutes at 30 kg / cm 2 at the testing temperature cooling condition : after pressing , the sample was cooled under a pressue of 30 kg / cm 2 for 5 minutes by means of a cold press 3 . the results of measuring the gel percentages of various kinds of press cross - linked , foamed sheets are shown in fig1 where numbers 1 to 4 correspond to samples 1 to 4 described below . table 2__________________________________________________________________________sample foamingno . resin cross - linking agent foaming agent aid filler__________________________________________________________________________1 ethylene - vinyl acetate copolymer 1 , 3 - bis ( t - butyl - peroxy - azodicarbonamide zinc calcium ( melt index , 20 dg / min ; vinyl isopropyl ) benzene ( decomposition temp . 200 ° stearate acetate content , 20 % by weight 0 . 6 part 5 parts 2 . 0 parts carbonate 100 parts 20 parts2 &# 34 ; &# 34 ; &# 34 ; &# 34 ; &# 34 ; 100 parts 0 . 6 part 0 2 . 0 parts 20 parts3 &# 34 ; 1 , 1 - di - t - butyl - peroxy - azodicarbonamide zinc &# 34 ; 3 , 3 , 5 - trimetylcyclo - ( decomposition ) temp . 150 ° stearate 20 parts hexane 5 parts 1 . 0 part 100 parts 1 . 5 parts4 &# 34 ; &# 34 ; &# 34 ; &# 34 ; &# 34 ; 100 parts 1 . 5 parts 0 1 . 0 part 20__________________________________________________________________________ parts while the invention has been described in detail and with reference to specific embodiments thereof , it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof . | 1 |
referring to fig1 blood is drawn from a cannulated vein 10 of a diver or aviator &# 39 ; s arm 12 through a venous puncture . this is possible by the use , for example , of a commercially available single - access dual - flow catheter with a 18 - gauge needle , as is securely used in clinical hemodialysis . of course , conventional double - needle cannulas could also be used . the collected blood is transported through a conduit 14 to a gas exchange cell 16 . the cell may consist of a cylindrically - shaped container which is sealingly closed at opposite ends by means of caps or manifolds 18 and 20 , respectively provided with an inlet port 22 and an outlet port 24 . blood received in conduit 14 passes by an afferent flow monitor 25 to enter inlet port 22 and then passes through a plurality of hollow fibers 26 , each fiber having a gas permeable membrane into a liquid having high uptake capacities for gases . the blood then exits at the outlet port 24 and is returned to the vein through conduit 28 . blood flow is supported by a pump 30 . in the blood return conduit , an electronic air / foam detector 32 with a warning light is provided in order to stop pump 30 if a passing bubble changes the optical density in the conduit . an afferent flow monitor 34 is also provided in the return conduit as well as a further monitor 36 which is used to indicate the pressure of the blood being returned . the exchange cell further includes an inlet port 38 and an outlet port 40 to allow the dialysis liquid to pass along membranes 26 . conduits 42 and 44 connect the inlet and outlet ports to a reservoir 46 containing the perfluorocarbon or silicone liquid . pump 30 also serves to circulate the liquid between the reservoir 46 and the exchange cell 16 . the liquid is brought to the body temperature by means of a heating element 48 , controlled by a thermostat 50 . on return to the reservoir , the optical absorbance of the liquid is monitored at 52 , at the exit manifold , in order to detect possible blood leaks through the exchange surface . the exchange surface in the hollow fiber cartridge should be as large as possible . areas of up to 1 . 5 m 2 are typical for cartridges used in conventional hemodialysis . cartridges about 40 cm long can hold enough fibers with a diameter of 200 micrometers to give an exchange area of more than 3 m 2 . several valves ( not shown ) permit to interrupt the flow safely ; ports ( not shown ) are provided to inject heparin or other anticoagulants continuously . the maximum volume of metabolically inert gas that dissolves in the body tissues hyperbaric conditions is estimated to be about 4 . 5 liters , a value extrapolated from measurements performed normobarically . accordingly , the dialyzate reservoir should contain about 20 liters of perfluorocarbon liquid in order to maintain the appropriate partial pressure gradient with the blood at all times . in reality , the fluid volume can be much smaller than that since the release of nitrogen from the tissues is diffusion - limited and the 1 to 2 liters of circulating blood are rapidly cleared of gas . the apparatus illustrated schematically in fig1 will easily fit into a portable canister 58 appropriately armoured to withstand the water pressure . the equipment to be used for the cannulation of a blood vessel under water is shown in fig2 . a perspex cup 60 is attached to the bend of the arm by two straps 62 and 64 fixing it in an extended position . a piston 66 draws water out of the cup in order to establish a negative pressure with respect to the outside . this seals the cup with its cushioned rim 68 against the arm and makes the blood vessels under it stand out . the catheter and needle 70 enter the perspex cup at a shallow angle through a port 72 , closed by a rubber membrane 74 , to facilitate cannulation . the tubings , 14 and 28 from the cup to the canister containing the dialysis equipment is wrapped in a flexible armoured conduit 74 . only ab out 5 vol % of the oxygen bound to hemoglobin inside the red blood cells is normally used up by the body so that the hemoglobin on the venous side still holds about 16 of the 21 vol % to which the blood is charged in the lungs . the small fraction of oxygen dissolved physically in the plasma is in equilibrium with that bound to hemoglobin in the erythrocytes and decompression dialysis will thus also reduce the amount of oxygen carried by the red blood cells . it is therefore recommended that persons undergoing decompression dialysis respire an atmosphere enhanced in oxygen . before use , the apparatus for decompression dialysis is to be primed , on the blood side , with a degassed physiological saline solution and , on the side of the dialyzate , with the degassed perfluorocarbon liquid . this prevents that bubbles form in the tubing or that the procedure would be started with bubbles adhering to the surfaces . decompression dialysis as described will remove gases dissolved in the blood and the tissues of a diver much faster than they can be passed through the lungs during the slow ascent in stages prescribed by international diving tables . as a consequence , divers can be brought to the surface rapidly in an emergency , without suffering the effects of decompression sickness , or , suffering them to a much lesser extent . conceivably , many lives may be saved which are otherwise lost due to the fact that recompression facilities are not immediately at hand . the principles involved in decompression dialysis are simple and the apparatus required is far from complicated so that the divers themselves could be instructed in its use at the surface or even under water as a first - aid measure . the process of hemodialysis started at depth can then continue above the surface . decompression dialysis could also be used as a preventive measure to extent the diving times which are , at present , limited by the long ascent periods more than by the degree of physical exertion at depth . this application would require , of course , that divers submit to the inconvenience of having a vein cannulated before the dive , to permit prompt access to the dialysis equipment . | 0 |
in fig1 a router 100 and a bridge 102 are used to create four virtual lans ( identified as vlan 1 through vlan 4 ) from 12 individual lans , each represented by a single line on the right of the figure . router 100 is referred to herein as a vml client and bridge 102 is referred to as a vml server . bridge 102 is a large switch , such as dec &# 39 ; s gigaswitch , which has been modified to appear as four virtual bridges 104 ( 1 ) through 104 ( 4 ). virtual bridges 104 ( 1 )- 104 ( 4 ) communicate with each other through router 100 . in the described embodiment , the packets sent to router 100 by virtual bridges 104 ( 1 )- 104 ( 4 ) are multiplexed over a single line 106 that connects router 100 to bridge 102 . filters internal to bridge 102 are used to make the bridge appear as a plurality of virtual bridges . and the multiplexing of packet traffic over the single line connecting bridge 102 to router 100 is accomplished by an extra protocol between a vml client layer at router 100 and a vml server layer at bridge 102 . the following describes both the required bridge filters and the protocol between vml clients and servers in greater detail . the configuration in fig2 of a router 110 and a bridge 112 connected by two links 114 ( 1 ) and 114 ( 2 ) will be used to illustrate the interfaces that are used to set up a virtual lan . in that configuration two vlans are shown , namely vlan 1 and vlan 2 . the interfaces used to set up these vlans are shown in fig3 . a vlan is set up using five steps . first , the user uses a management interface at bridge 112 to create vlan 1 by declaring which bridge ports belong to this vlan ( i . e ., ports 8 and 12 in the figure ) and giving the vlan a name , which has purely local significance ( step 130 ). during this first step , the manager also gives the vlan a vlanid ( which in this case is 1 ). the vlanid is used to coordinate vlan set up at router 110 and bridge 112 . a similar procedure is used to set up vlan 2 at the bridge . also note that each vlan is given a type which represents the protocols that this vlan serves . in other words , bridge 112 can appear to be divided into different vlans for different protocol types . this allows protocols that cannot be connected through a router to be set up so that such protocols “ see ” bridge 112 as a single lan . however , any two vlans with the same type cannot have a common bridge port . in the next step , the manager specifies the bridge ports that are connected to vml clients ( i . e ., routers ) ( step 132 ). in the illustrated example , bridge ports 17 and 6 are connected to a client router . note that the manager does not specify which client ports are connected to the same router . the protocol figures this out by receiving “ hellos ” ( to be described later ) from client routers . after the clients have been defined , the next few steps occur at the router . the user creates a vml server at router 110 by specifying which router ports are connected to the same bridge ( in this case , ports 23 and 19 ) ( step 134 ). if router 110 was connected to another bridge , then the manager would create another vml server for the second bridge . the server is also given a local name . next , the user creates vlans at router 110 by specifying the local name of the server , the routing type , and the vlanid used to identify the vlan at the server end ( step 136 ). fig3 shows the creation of a vlan locally called “ foo ” at the router and which corresponds to vlan 1 at bridge 112 . the correspondence is made because they both use a common vlanid of 1 . the user creates a second vlan at router 110 corresponding to vlan 2 at bridge 112 . finally , for each routing type that is supported , the user creates a circuit corresponding to each vlan . thus , for example , a circuit is created corresponding to vlan 1 and a second circuit can be created corresponding to vlan 2 . the net result is that the router has circuits for each vlan . creating vlans at both bridge 112 and router 110 is necessary because current router interfaces require all router circuits to be declared in advance ( although their status can change to reflect whether the circuit is up or down ). also , an alternative would have been to put all the details of creating a vlan ( i . e ., which server , which vlanid etc .) in the circuit creation call at router 110 . however , it seemed more desirable to provide a routing layer with a clean abstraction ( i . e . a vlan ) that looks very much like a lan . it also seemed desirable that the routing layer interfaces required to create a vlan circuit be similar to the interfaces needed to create a lan circuit . the details of mapping vlans are present in the vml layer . when packets arrive at the router from the bridge , the router must be able to tell which vlan the packet was sent on . similarly when packets are sent by the router to the bridge on a specific vlan , the bridge must be able to tell which vlan the packet was sent on . these capabilities are provided through a mechanism by which information about a vlan ( specifically the vlanid described in the previous section ) is embedded in a packet . first , the mechanism will be described and then the manner by which the mechanism is used to provide the capabilities will be described . consider a data packet p . the system provides a function that adds to p some information ( e . g . the vlanid of the vlan ) that describes the vlan on which p was sent . the system also provides a second function that removes the vlanid field from p . there are two simple methods by which the vlanid can be added to packet p . the simplest method is to embed p in another packet q and to add a specially created vlanid field to the header of packet q . to remove the vlanid field , the system simply extracts p from q . another method is to use a redundant field in p . if there is some field in p that contains redundant information that can be derived from other fields in p , then that field can be used to encode the vlanid field . for example , there is a redundant field called the ssap field in the data link headers of most data packets on a lan . this field is almost always equal to another field called the dsap field . thus , to add the vlanid , the ssap can be set equal to the vlanid ; and to remove the vlanid , the ssap field can be set equal to the dsap field . the first method is more general but the second is more efficient as it does not require the addition of headers to the original packet p . referring to fig2 consider a packet p sent from router 110 to bridge 112 on vlan 1 . two cases must be distinguished , namely , p is either ( 1 ) a multicast packet or a unicast packet destined to another router or ( 2 ) a unicast packet other than one destined to another router . a multicast packet is defined as a message that is sent on a lan to a group of stations . the destination address in a multicast packet is a group or multicast address . a unicast packet is a message sent on a lan to a single station . the destination address in a unicast packet is an individual address . if p is a multicast packet , p has a destination address that is a group address which identifies a set of stations . in this case , it is crucial that p be sent only to bridge ports corresponding to vlan 1 . failure to do so can cause routing protocols to break because they use multicast packets to determine which stations are present on a lan . thus , multicast packet p sent by router 110 must carry some information so that the bridge can identify which vlan packet p is to be sent on . router 110 supplies this information by adding a vlanid field to multicast packets which it sends . the vlanid field identifies the vlan , in this case vlan 1 . in a previous section , two options were described for adding a vlanid field to a packet . both options for adding a vlanid require changing the normal forwarding process of a bridge . however , most bridges process multicast packets in software ; thus , the required changes to the forwarding process can easily be made in software . when bridge 112 receives multicast packet p , it reads the vlanid field in p to find which vlan p is to be sent on . it then sends p to only the bridge ports corresponding to vlan 1 . thus in fig2 p is only sent on ports 8 and 12 . p is not sent on ports 9 and 15 as these correspond to vlan 2 . however , before bridge 112 sends p on ports 8 and 12 , it removes the vlanid field because lan stations may detect an error if they receive a packet with a vlanid field . if p is a unicast packet destined for another router 111 ( also desingated r 2 in fig2 ), then the vlanid field is added to p before it is sent to the router . once again , although this is a non - standard packet format , the router is able to receive such packets with an encoded vlanid . if p is a unicast packet , p has a destination address that is an individual address which identifies a single station . router 110 could add a vlanid field to p as was done for multicast packets . however , many bridges forward unicast packets in hardware . thus , it is hard to add the changes required for vlanid processing without redesigning the hardware . another solution is to send a unicast packet p from the router without a vlanid field . when the packet p arrives at the bridge there are two possibilities . if the destination address da in packet p is known to the bridge , packet p is sent to the bridge port corresponding to da . if the destination address da in p is unknown to the bridge , the packet p is sent on all bridge ports . for example , if packet p was destined to a station a on vlan 1 , but the address of station a has not been “ learned ” by bridge 112 , then p will be sent on all ports , including that of vlan 2 . since station a is only on one bridge port , the other copies will be ignored . thus , until bridge 112 learns of station a , packets sent from router 110 to station a will cause redundant copies to be sent on all ports . this is much the same as normal bridge operation . referring again to fig2 suppose station a on vlan 1 sends a packet p that is destined to router 110 . bridge 112 forwards packet p to router 110 . when packet p arrives at router 110 , router 110 determines which vlan the packet was sent on . again , the two cases can be distinguished , one involving the handling of multicast packets and the other involving the handling of unicast packets . if the packet is a multicast packet , as noted above , bridge 112 adds a vlanid field before forwarding the packet . thus , when router 110 receives the packet , it decodes the vlanid field to yield the vlan the packet was sent on . if the packet is a unicast packet sent by a bridge , it will not carry a vlanid . thus , a different approach is necessary . there are at least two different solutions , which shall be referred to as method 1 and method 2 . according to method 1 , the router uses distinct source addresses for each vlan . the router is assigned a unique source address for each vlan it connects to . thus , for example , referring to fig4 if a router 140 has two vlans , vlan 1 and vlan 2 , the router is assigned an address x for vlan 1 and an address y for vlan 2 . when router 140 sends any packet p on vlan 1 to bridge 142 , it uses x as the source address ( in the data link header of packet p ). similarly , when router 140 sends any packet q on vlan 2 to bridge 142 it uses y as the source address . a station such station a on vlan 1 learns the address of router 140 from the source address of packets sent by router 140 to station a . thus , stations on vlan 1 , like station a and station b , will learn the router &# 39 ; s address as being x . similarly , stations on vlan 2 , like station c and station d , will learn the router &# 39 ; s address as being y . all unicast packets sent from vlan 1 to router 140 will be sent to x ; similarly all unicast packets sent from vlan 2 to router 140 will be sent to y . router 140 is thus able to distinguish the vlan on which a packet is sent by looking at the destination address . in the example , packets sent to x are for vlan 1 , while packets sent to y are for vlan 2 . method 1 is elegant but has two drawbacks . first , some routing protocols insist that the router uses the same source address on all lans that the router connects to , making this method inapplicable for such protocols . second , this method requires that there be multiple addresses for each vlan . this may be a problem for some implementations . method 2 avoids these drawbacks . referring again to fig4 according to method 2 the router keeps a source vlan table 144 that associates 48 - bit source addresses with vlans . received packets are distinguished by finding the vlan associated with the source address of a received packet . for example , the router &# 39 ; s table maps the address of station a to vlan 1 and the address of station c to vlan 2 . thus , any packet with source address of station a that is received at the router is assumed to have been sent on vlan 1 . source vlan table 144 at router 140 is updated by bridge 142 using the following mechanism . bridge 142 eventually learns the bridge port corresponding to each source address and enters this information into its forwarding database 146 . thus , bridge 142 will learn that station a belongs to bridge port 8 and station c belongs to bridge port 9 . whenever there is a change to forwarding database 146 , e . g . either a new entry is learned or a “ timed out ” entry is deleted , bridge 142 sends this information to router 140 using a reliable transport protocol . each update sent to router 140 also carries the mapping of ports to vlans , i . e ., bridge 142 also indicates that bridge ports 8 and 12 belong to vlan 1 , while bridge ports 9 and 15 belong to vlan 2 . on receiving such an update , router 140 has enough information to update its source vlan table 144 . method 2 is general but it requires extra processing for look - up in the source vlan table and for updating this table . however , most routers today are brouters , i . e ., they implement the bridge forwarding algorithm as well as the normal forwarding code . since a lookup of the source address is part of the bridge forwarding algorithm , the router often has hardware support for this operation , which makes the operation quite inexpensive . in sum , method 2 works for all routing protocols and can be efficient with a small amount of hardware support . in the description thus far , only lans have been connected to the bridge . however , there could also be wide area links connected to the bridge . the vml layer makes it appear that the wide - area link is directly connected to one particular router . in other words , if the router does not have an atm or sonet interface but the bridge does , then the vml layer can provide a lan “ pipe ” between the atm line on the bridge and the router . conceptually , this is no different from providing virtual lans except that these lines are typically point - to - point wide area links running protocols like hdlc and smds ( as opposed to a lan which has multiple stations whose addresses are unknown ). thus the source vlan table required for this kind of “ vlan ” is quite small and static , and hence can even be updated manually . a model implementation is shown in fig5 . a client 150 ( i . e ., a router ) and a server 152 ( i . e ., a bridge ) are each connected to a link 154 through respective data link layers 157 and 159 . in the figure , the solid lines denote the flow of packets ( data flow ) and the dotted lines denote the major control flow . thus , an arrow from a process to a database indicates that the process writes the database ; an arrow from the database to the process indicates that the process reads the database . each client has a single client vlan multiplexing layer ( vml client layer ) 156 which is responsible for multiplexing vlans on to physical links to servers . the multiplexing at the client is controlled by two data structures , namely , a serverlist 158 and a vlanlist 160 , that are set up by management . briefly , serverlist 158 contains an entry for every server the client is connected to , and lists the router links that are physically connected to the server . vlanlist 160 contains an entry for every vlan that the client wishes to connect to and lists information like the server on which this vlan belongs and the vlanid which helps identify the vlan at the server . client vml layer 156 reads serverlist 158 and vlanlist 160 and uses this and other state information to multiplex and demultiplex packets . client vml layer 156 offers the illusion of multiple vlans to routing protocols . the routing protocols interface to the vlans exactly as they do to lans , i . e ., they begin by opening a port , identifying which protocol types they wish to receive , and finally sending and receiving packets on the opened port . a routing protocol can also ( optionally ) open a port on what is referred to as an “ unknown ” vlan . suppose a packet is received by client vml layer 156 with a protocol type specified by the routing protocol . suppose also that client vml layer 156 is unable to decide which vlan the packet arrived on . then , client vml layer 156 queues the packet on the unknown vlan port . the routing protocol can then optionally decide to forward or discard the packet . forwarding packets received on unknown vlans can help data packets to be forwarded even during periods when client vml layer 156 is still learning the information needed to demultiplex packets . opening a port to the “ unknown ” vlan is just a way to model this mechanism . at the server end , there is a corresponding vml server layer 164 . unlike vml client layer 156 at client 150 , vml server layer 164 is only involved in setting up vlans at the server and not in the actual forwarding of data packets . all packets received by data link 159 are handed to a bridge forwarding layer 166 . bridge forwarding layer 166 forwards unicast packets to known destinations much as they would be handled in a normal bridge ; however , the handling of multicast and unicast packets to an unknown destination is quite different . bridge forwarding layer 166 consults a vlanlist 168 at server 152 which contains a record for every vlan declared at the server . vlanlist 168 is used to forward multicast packets received on a vlan only to the bridge ports corresponding to that vlan . vlanlist 168 is written by management , represented in fig5 by management interface 170 . vml server layer 164 sends hello messages on every link that is declared to be a link to a client / router . the hellos sent on a link 154 are used to set up a transport connection to the vml client layer at the other end of link 154 . if vml client layer 156 replies , a transport connection is set up . vml server layer 164 then begins to send updates reliably to vml client layer 156 on link 154 . as indicated in fig5 bridge forwarding layer 166 consults a forwarding database 172 , which models the standard forwarding database on a bridge . the learning process in the bridge is modelled by a learning process 174 which writes information to forwarding database 172 . there is also an interface between learning process 14 and vml server 164 . learning process 174 sends to all vml clients all updates that it has used to update bridge forwarding database 172 . when a new line to a vml client comes up , vml server 164 informs learning process 174 . learning process 174 then begins sending learning updates ( corresponding to the current state of forwarding database 172 ) to vml server 164 . vml server 164 packages this information and sends it to vml client 156 . finally , vml client 156 uses the updates to build a source vlan table . recall that the source vlan table , described in connection with fig4 is used by vml client layer 156 to demultiplex received packets . as learning process 174 gets new information it does not send a complete copy of the new database ; instead it only sends incremental updates . thus , a complete set of updates is only sent when a line to a vml client first comes up . later changes are sent as incremental updates . however , the use of incremental updates requires a reliable transport protocol between the server and client on each line . the transport protocol is responsible for retransmitting each update until an ack is received from the client . for the described embodiment , it is assumed that all vml servers are ieee 802 . 1 compliant spanning tree bridges . thus , there are two ways the spanning tree protocol can interact with the vml protocol . vml server 164 can implement a single spanning tree for all vlans or a separate spanning tree for each vlan . in the described embodiment , every vml server 164 implements a single spanning protocol for all vlans . in other words , each vml server implements the spanning tree protocol on all its links . once the spanning tree has stabilized , the vlan ports specified by management will define the breakup of the extended lan into vlans . similarly , vml server 164 builds a single learning database for the entire bridge and not a separate learning database for each vlan . as in the bridge architecture , the station addresses are unique over the entire extended lan ( as opposed to only requiring unique addresses for each vlan ). the principle data structures stored in memory at both client and server are shown in fig6 . considering first the data structures at the client end , there is a vlanrecord 200 for each vlan declared at the client and there is a serverrecord 202 for each server that the client knows about . each vlanrecord 200 points to the server record 202 corresponding to the server on which this vlan belongs . each serverrecord 202 points to a set of physical link interfaces that connect the client to the server . each such link interface has a linkrecord 204 which contains variables required to implement a reliable transport protocol . the transport protocol is used to send information ( from the server to the client ) that maps source addresses to vlans . this mapping information is stored in a sourcevlantable 206 at the client end . there is one sourcevlantable 206 per link at the client and it is pointed to by the corresponding linkrecord 204 . note that one may use multiple links between the router and the bridge as described in the u . s . patent application entitled “ system for achieving scalable router performance ”, by george varghese , david r . oran , and robert e . thomas , filed on an even date herewith , and which issued as u . s . pat . no . 5 , 905 , 723 on may 18 , 1999 and incorporated herein by reference . in that case , there would be multiple linkrecords . vlanrecords 200 are linked together in a vlanlist . serverrecords 202 are linked together in a serverlist . and linkrecords 204 are stored in an array indexed by the link number . each of the three records will now be described in greater detail . each vlanrecord 200 contains a vlanid 200 ( 1 ), which identifies the corresponding vlan at the server ; a name 200 ( 2 ), which only has local significance and is set according to the manager &# 39 ; s convenience ; a type 200 ( 3 ), which identifies the routing type of the vlan ; and a servername 200 ( 4 ), which identifies the name of the server on which this vlan belongs . these variables are set by management . each vlanrecord 200 also has two other variables , both of which are set by the protocol , namely , a status variable 200 ( 5 ) and an as signedlink variable 200 ( 6 ). status variable 200 ( 5 ) indicates if the vlan is correctly set up and if not , gives an indication of the type of error . the three possible errors are typemismatch , if the vlan type at the client does not match the vlan type of the corresponding vlan at the server ; idmismatch , if there is no vlan at the server with a vlanid equal to that declared at the client end ; and serverfailure , if none of the links to the server are considered operational . assignedlink variable 200 ( 6 ) describes the physical interface assigned to this vlan at the client . serverrecord 202 contains two variables that are set by management . the first is a name variable 202 ( 1 ) that is a local name assigned by management to this server . a vlanrecord v is made to point to a serverrecord s by setting v . servername = s . name . the second variable set by management is links 202 ( 2 ), a variable that identifies the set of physical interfaces that connect the client to this particular server . fig6 shows two links between the client and the server . thus , serverrecord 202 at the client points to the two corresponding link records . serverrecord 202 also contains two other variables that are set by the protocol . first , there is a livelinks variable 202 ( 3 ) which is the subset of physical links declared in links that are operational . the traffic from the client to the server must only be split among the set of livelinks . as links fail and recover livelinks is updated by the protocol . finally , there is a state variable 202 ( 4 ) which describes error conditions . the two possible errors are multipleservers , if any two links in links are connected to two distinct servers , and broadcast , if any link to links is not a point - to - point link to the server . each linkrecord 204 contains variables required to implement a reliable transport connection with a corresponding link at the server end . note that if there are multiple links between a client and a server , separate transport connections on each link are set up . serverid 204 ( 1 ) is a 48 - bit unique id of the remote server and connectid 204 ( 2 ) is a 32 bit connection identifier . state 204 ( 3 ) is the state of the connection ; the link is considered to be operational when the connection state is on . sequencenumber 204 ( 4 ) is the number of the last update successfully received from the server . each linkrecord contains a pointer to a sourcevlantable 206 that is used to map source addresses of received unicast packets to the vlan on which the packet was sent . finally , a clientaddresses variable 204 ( 6 ) is a list of addresses used by all vml clients on the same server , as reported by the server . a more comprehensive description of the client data structures can be found in the pseudocode that is presented in appendix i , attached hereto . the description uses the simple data types that are described appendix iii , also attached hereto . as at the client , the server keeps a vlanrecord 210 for every vlan declared at the server . the server also has a variable called clientlinks 212 that lists the set of server links that are connected to clients . for each such link , the server keeps a linkrecord 214 that has more fields than the corresponding linkrecord 204 kept at the client . finally , just as the client keeps a serverrecord 202 for each server , the server keeps a clientrecord 209 for each client it knows about . the clientrecord information is useful in implementing hunt groups at the server . for further discussion of hunt groups as they apply to the bridge see u . s . patent application ser . no . 07 / 542 , 856 , entitled fast arbiter having easy scaling for large numbers of requesters , large numbers of resource types with multiple instances of each type , and selectable queuing disciplines , incorporated herein by reference ). vlanrecord 210 includes vlanid , name , and type fields 210 ( 1 ), 210 ( 2 ), and 210 ( 3 ) the contents of which are declared by management just as at the client end . however , at the server end , management also specifies vlanlinks 210 ( 4 ) which is the set of bridge links that belong to this vlan . there are also two variables set by the protocol , namely , a clientlinks variable 210 ( 5 ) and a status variable 210 ( 6 ). clientlinks 210 ( 5 ) is a subset of the server variable clientlinks that represents the client links to which this vlan has been assigned . if there are multiple links between a server and a client , the client assigns each vlan to exactly one operational link . each client reports the link to which it assigns vlan v to the server , and the server stores the set of assigned links to clientlinks 210 ( 5 ). status variable 210 ( 6 ) is identical to status variable 200 ( 5 ) found in a client vlanrecord 200 . linkrecord 214 includes a clientid variable 214 ( 1 ), a connectid variable 214 ( 2 ), a state variable 214 ( 3 ), a sequencenumber variable 214 ( 4 ), all corresponding to previously described similar variables in the client linkrecord . server linkrecord 214 also includes additional variables . first , there is a buffer variable 214 ( 5 ) which is a buffer that stores the current update being transmitted on the link to the server . there is a retransmits variable 214 ( 6 ) that counts the number of times the update stored in buffer variable 214 ( 5 ) has been retransmitted to the client without receiving an acknowledgement . there is an other info field 214 ( 7 ) that contains various 48 - bit addresses that are used by the client . finally , there is a vlans variable 214 ( 8 ) that identifies the vlans that are assigned to the link . just as in a serverrecord at the client , each clientrecord 209 stores a clientid and a livelinks variable which represents the set of links to this client that are considered to be operational . a formal description of the server data structures can be found in appendix ii , attached hereto . there are four basic types of messages used by the vml protocol . first , servers send serverhello messages and clients respond with clienthello messages . these messages are used to set up the transport connections on links and also to coordinate vlan information between client and server . next , servers send update messages to clients containing mapping information that is used by clients to update information in the sourcevlantable of each link . each update message is numbered with a sequence number and clients respond to updates by sending an ack . the relevant fields in each message are shown in appendix iv , which presents only a logical view of the message formats . for example , in order to encode a variable length sequence ( such as a set of vlanrecords ), a length field is also needed . for the most part , the fields of the messages shown in appendix iv correspond to fields of similar names in the link records at client and server . the relevant state variables are copied into fields of the same name in the protocol message . thus , all fields in the client hello ( except the phaseiv address in the case of the decnet phase iv communication protocol ) are copied from fields of the same name in the corresponding link record at the client . the phaseiv address is copied from a global client variable that represents the 48 - bit address corresponding to the phaseiv address of the client ( i . e ., phase iv address prefixed by hi - ord ). if the client has no phase iv address , this field is set to all 0 &# 39 ; s . similarly , all fields except clientaddresses in the server hello are copied from fields of the same name in the corresponding link record at the client . the clientaddresses field is copied from a global server variable that represents all the 48 - bit addresses reported by clients . each update carries the server id , the connection identifier , a sequence number and the actual data . the ack has the same fields except for the data field . the state machine used for the transport protocol is shown in fig7 a - b . state machines attempt to set up a transport connection on each link between a client and a server . once management declares a clientlink at the server , the server creates a linkrecord for the link . on creation and on power up or reset of the link , the linkrecord is reset by setting the state of the link to init 300 . the init state causes a wait for a timeout period that is sufficiently long such that by the time the server link exits init state : ( 1 ) all old control messages sent by the server and the client on this link will have disappeared ( any control messages received by the server on a link in init state are ignored ); and ( 2 ) the client will have timed out all old state information it had . thus , the timer in init state ( called connecttimer ) is set to be large enough to “ flush ” all old messages and state information . on expiry of the connecttimer , the server sets the state of the link to req 302 ( i . e ., requesting a connection ) and sends a server hello periodically to the client . all hellos sent by the server list the vlan id and type of all vlans known to the server . all hellos ( sent by either the client or server ) carry the state of the sender ; a hello with state req is called a requesthello ; a hello with state on is called an onhello . if the client receives a requesthello while in req state , the client transitions to an on state 304 and sends back an onhello . while the server periodically sends hellos in the req and on state , the client only sends hellos in response to server hellos . the client is responsible for distributing the vlans heard from a server among the multiple lines going to the server that are on . it is also useful for deciding which links multicast traffic for a vlan will flow on . the client distributes vlans by setting the variable assignedlink in a vlanrecord to point to the assigned link . a simple policy would be to distribute the vlans in roughly equal fashion among all links to the server that are on . having distributed the vlans among links to the server , the client sends back a hello to the server on the link it received a hello . the client hello lists all vlans assigned by the client to this link . notice that the server lists all its vlans in its hellos , while the client lists the vlans assigned to the line on which the hello is sent . suppose an onhello comes back on link l to the server . suppose the hello is received while the server link record is in req state and the connection id in the hello matches the server connectionid . then the two way handshake to set up the connection is considered to be complete , and the server changes the state of the link to on state 304 . also if a vlan v is mentioned in the hello sent by the client , then the server updates the vlanrecord for v to include l in its list of clientlinks . the clientlinks for a vlan is a subset of the clientlinks of the server . basically , when a server has multiple links to a client , the server selects exactly one of these links for each vlan based on hellos sent by the client . the selected link is used by the server to send multicast traffic for the vlan to the client . in normal operation , once both client and server have turned a link on , the server periodically sends hellos to the client and the client responds with a hello . however , if the client does not hear a hello from the server for a timeout period , the client transitions the link to req state 310 . the default value of the timer in init state at the server is chosen to be three times as large as the client timeout . besides the normal operation , there are two other interesting cases . first , if the client receives a hello from the server with a new connection id or server id ( i . e ., if the old server is disconnected and a new server plugged in ) while in on state , the client remains in on state but essentially starts a new connection . if the client crashes and comes up , the client starts the link in req state . however , the client will not leave req state until the server sends an onhello to the client and the client responds with a requesthello . receipt of the requesthello causes the server to go into req state and restart the connection . this is important because when the client crashed it may have lost all previous updates ; thus it must force the server to send it all updates by restarting the connection . the hellos sent by the client also lists the 48 - bit addresses used by the client on the link , including any address derived from the client address . when the server gets the hello it sets up all bridge forwarding databases such that the address listed in the hello point to the link the hello was received on . the vmlserver also builds up a list of all client addresses ( using a variable clientaddresses ) that it reports back to clients in its server hellos . note that if a client r sends a packet to another vml client router s , client r then includes a vlanid in the packet . client r can distinguish packets sent to other vml clients by consulting a list of client addresses sent to r by the server . recall that the manager enters information at both client and server to set up vlans . the code has a few consistency checks on this information . recall that the server sends a list of all its vlans in its hellos with vlanid and type . consider a vlan v declared at the client with vlanid = i . the client will not assign vlan v to a line unless it finds that the server reports some vlan with vlanid = i in its hello . thus , if the manager incorrectly enters the vlanid field for a vlan at the server and client , the client will not “ bring up ” the vlan . instead the state of vlan v is reported as idmismatch . suppose by accident , the manager connects a client to two different servers using links l 1 and l 2 but declares l 1 and l 2 to be part of one server record at the client . the client will detect this since it receives hellos with two different server ids on both links . the state of the corresponding server record is set to multipleservers and all vlans that belong to this server have their state changed to serverfailure . if the state of a vlan is anything other than on , the client will not send any traffic on this vlan and will not assign this vlan to any link . the formal code used by the server to control vlans is presented in appendices v , vi , and vii . appendix v shows the timers , constants , and macros used by the server transport protocol on each link . the code describes the timers as constants . when a client hello is received on a link , the information in the link record for that link may change and the macros shown in appendix vi are used to update information about vlans , clients , and addresses . the first macro updateclientlist keeps track of the client links associated with each distinct client ( some clients may be connected to the server with multiple links ); if hunt groups are implemented , this information is used to create a single hunt group for all the on links connected to each client . updatevlanstatus is used to choose at most one assigned link per client for each vlan ; the assigned link is the link on which the client reports the vlan . this information is gathered into a set of client links for each vlan that is used to forward multicast traffic . ( exactly one copy of a multicast packet sent on a vlan is sent to each client by sending the packet to the assigned link for that client .) finally , updateaddresses ( in appendix vi ) updates the set of 48 - bit addresses reported by clients . it also makes forwarding database entries for these addresses . in the formal code for the server transport protocol ( appendix vii ), when some action on a link l is executed , it typically begins by obtaining the linkrecord by looking up linkarray [ l ]. it is , of course , assumed that there is a check as to whether l is a clientport and if l is not , the routine is not executed . the server code describes actions taken when a hello is received and transport timers expire . it follows the state transitions described earlier . the client code to control vlans is described in appendices viii and ix . appendix viii contains a set of useful macros that are called by the client transport protocol . initializeconnection is called when a connection first begins at a client and initializes transport variables . updateserverrecord and updatevlanstatus are called whenever the client receives a new server hello . updateserverrecord checks for server errors ( such as being connected to two different servers on two links that were declared to be part of one server record ) and updates the concerned server record . updatevlanstatus similarly checks for vlan errors ( i . e ., a vlan declared at the client does not have a matching vlan at the server ) and also distributes client vlans among all the on lines that connect the client and the server . finally , the main client code is described in appendix ix . it has routines to process a received server hello and for handling transport timer expiry . it follows the state machine described earlier . this section describes how the forwarding tables at the server are sent reliably to the client using the transport connections set up on links . as was previously described , when the server turns a link on , the server initializes the sequencenumber field ( for the link ) to 1 . similarly when the client starts a connection , the client initializes the sequencenumber field to 0 . the client also initializes its sourcevlantable to be empty . in normal operation , the server will send its forwarding table suitable encoded to the client on each line . the client will send acks backs separately on each line . this is redundant because if a client has multiple lines to the server it really only needs one copy of the forwarding table . however , by sending multiple copies parallel processing is possible . when a connection starts at the server , the server informs the update process using a routine called informupdateprocess together with a status variable that is set to “ new ”. it is assumed that the update process keeps track of the outstanding updates on each client link . when the update process gets a status of new for a line , it begins to send the entire forwarding database to the client as a sequence of updates . however , the update process sends only one update at a time . each update is numbered with the server sequence number ; when the client receives the update , the client incrementally updates its sourcevlantable using the update and sends back an ack . when the ack is received at the server , the server informs the update process using the routine informupdateprocess together with a status variable that is set to free . when this happens the update process sends the next outstanding update . if the forwarding database changes while the client is being loaded , the updateprocess must keep track of the outstanding updates for each client link . the current update being sent to a client is stored in a variable called buffer . if an ack is not received before a retransmittimer expires , the update is retransmitted from buffer . if more than a certain number of retransmissions takes place , the server starts a new connection by going into req state and incrementing the connection identifier . the net result is that on each line , the client will build up a sourcevlantable that maps source 48 - bit addresses to vlans . the server code for sending updates reliably is described in appendix x . it uses a macro that is an interface to the update process . it has routines to send a new update , to retransmit an update , and to receive an ack from the server . the client code for receiving updates reliably and sending updates is described in appendix xi . it uses a macro that encapsulates the implementation specific method used to update the sourcevlantable when a new update arrives . the code has only one routine , a routine that receives an update , checks whether it is a duplicate , and sends an ack back to the server . normally the interface to a data link is via a port . according to a simplified view of a port interface , a client opens a port and is given a descriptor ( much like a unix file descriptor ). the client then enables a certain protocol specifier ( includes information on saps , protocol types , multicast etc .) on the port . the specifier describes the kinds of packets the client wants to receive . finally , clients can transmit packets to the port ; these packets are then sent out on the link . also received packets of the specified type are queued to the port . the actual dna data link specifications are slightly different ; for instance , the client does not give the port a single protocol specifier but instead separately enables each sap , protocol type , etc . also , the interface to receive a packet is typically a polling interface . however , these are just details . one object is to make a vlan look just like a lan to clients and a similar port interface is offered to vlans except that the ports on a vlan are called vlanports to avoid confusion . thus a routing protocol ( e . g . phase v decnet ) begins by opening a virtual port on a specified vlan . then the routing protocol enables a single protocol specifier on the virtual port which describes all the kinds of packets that the routing protocol wishes to receive . finally , the routing protocol transmits to the vlanport and received packets are queued to the vlanport . when a virtual port is opened and given a protocol specifier , the vml layer at the client attempts to open up corresponding ports on all the physical links associated with this vlan . thus each vlan has a server and each server has a set of physical links . the client vml layer opens up data link ports on each such link and enables each such data link port with the specifier of the vlanport . the client stores the mapping between vlanports and data link ports in the portmappinglist . this list consists of a record for each association between a vlanport and a data link port . thus each vlanport has multiple records in the portmappinglist , one for each data link port it is associated with . the routing protocol can choose to open a port to the unknown vlan . in this case , the client opens associated physical ports on all server links . when forwarding a packet sent on vlanport vp on vlan v , the client first picks a link l among all the “ live ” links associated with vlan v . these are the links associated with v &# 39 ; s server that are in on state . next , the client searches the portmapping list to find the data link port lp associated with l . if the packet is multicast or is destined to another vml client , a vlanid field is added to the packet . finally the packet is queued to data link port lp . when a packet is received on link l with protocol specifier s , the client attempts to find the vlan v the packet was sent on by first looking for a vlanid field ( if it exists ) and then consulting the sourcevlantable ( if packet is unicast ). if such a v is found , the client searches the portmappinglist to find the vlanport vp associated with vlan v and specifier s ; the client then queues the packet to vp . if no such v is found , the client searches the portmappinglist to find the vlanport vp associated with the “ unknown ” vlan and specifier s . if such a port exists , the client queues the packet to vp . the server forwarding algorithm is essentially the bridge forwarding algorithm except for small changes to the way a server forwards : a ) multicast packets and b ) packets sent to an unknown destination address . the vlan associated with a received multicast packet p is determined by the type of link p was received on . if p was received on a client link , the vlan is determined from the vlanid field in p . if p was received on a client link , the vlan is determined from the vlanid field in p . if p was received on a vlan link l , the vlan is determined from the vlan that link l has been declared to be part of . multicast packets sent on a vlan v are forwarded only to vlan links associated with v and to client links that report vlan v in their client hellos . before a multicast packet is sent on a client link , a vlanid field is added ; similarly when a multicast packet is received from a client link , the vlanid field is removed before the packet is sent to vlan links . packets with unknown destination address that are received on client links are sent to all vlan links that are turned on in the spanning tree . packets with unknown destination address that are received on a vlan link are sent only on the vlan associated with that link . packets with unknown destination address are never sent on client links . this is because client hellos list all addresses of clients ; hence client destination addresses should be unknown only during the ( hopefully brief ) period when the protocol initializes . the server code for forwarding packets is formally described in appendices xii and xiii . the main server forwarding routines are in appendix xiii . the two main routines are multicast_forward ( which describes how multicast packets are forwarded ) and unknown_forward ( which describes how packets with unknown destination addresses are forwarded ). appendix xii describes the macros used by the main code in appendix xiii . the macros are mostly used to find the links associated with vlans and to add and remove the vlanid field in the packet . the formal code for the client forwarding protocol is described in appendices xiv and xv . the major routines in appendix xv are the transmit routine ( to transmit packets on a vlan , possibly adding a vlanid to a packet ) and the receive routine ( to demultiplex a received data link packet using either a vlanid field or the source mapping table ). appendix xiv describes the macros used by the main code in appendix xv . the macros are mostly used to search the portmappinglist . for mappings between virtual ports , link ports , and protocol specifiers . the sourcelookup macro finds the vlan associated with a source address . it uses two architectural constants , unknownvlanid ( vlanid of the unknown vlan ) and vmlrouterid ( a second vlanid reserved to denote that this source address is a vml router ). the receive macro finds the vlan associated with a packet as follows : if the packet is multicast , obtain vlan from the vlanid field in packet . if the result indicates the packet is from a vml router then find the vlan from the vlanid field in the packet . | 7 |
as a preliminary matter , it will readily be understood by one having ordinary skill in the relevant art (“ ordinary artisan ”) that the present invention has broad utility and application . furthermore , any embodiment discussed and identified as being “ preferred ” is considered to be part of a best mode contemplated for carrying out the present invention . other embodiments also may be discussed for additional illustrative purposes in providing a full and enabling disclosure of the present invention . moreover , many embodiments , such as adaptations , variations , modifications , and equivalent arrangements , will be implicitly disclosed by the embodiments described herein and fall within the scope of the present invention . accordingly , while the present invention is described herein in detail in relation to one or more embodiments , it is to be understood that this disclosure is illustrative and exemplary of the present invention , and is made merely for the purposes of providing a full and enabling disclosure of the present invention . the detailed disclosure herein of one or more embodiments is not intended , nor is to be construed , to limit the scope of patent protection afforded the present invention , which scope is to be defined by the claims and the equivalents thereof . it is not intended that the scope of patent protection afforded the present invention be defined by reading into any claim a limitation found herein that does not explicitly appear in the claim itself . thus , for example , any sequence ( s ) and / or temporal order of steps of various processes or methods that are described herein are illustrative and not restrictive . accordingly , it should be understood that , although steps of various processes or methods may be shown and described as being in a sequence or temporal order , the steps of any such processes or methods are not limited to being carried out in any particular sequence or order , absent an indication otherwise . indeed , the steps in such processes or methods generally may be carried out in various different sequences and orders while still falling within the scope of the present invention . accordingly , it is intended that the scope of patent protection afforded the present invention is to be defined by the appended claims rather than the description set forth herein . additionally , it is important to note that each term used herein refers to that which the ordinary artisan would understand such term to mean based on the contextual use of such term herein . to the extent that the meaning of a term used herein — as understood by the ordinary artisan based on the contextual use of such term — differs in any way from any particular dictionary definition of such term , it is intended that the meaning of the term as understood by the ordinary artisan should prevail . furthermore , it is important to note that , as used herein , “ a ” and “ an ” each generally denotes “ at least one ,” but does not exclude a plurality unless the contextual use dictates otherwise . thus , reference to “ a picnic basket having an apple ” describes “ a picnic basket having at least one apple ” as well as “ a picnic basket having apples .” in contrast , reference to “ a picnic basket having a single apple ” describes “ a picnic basket having only one apple .” when used herein to join a list of items , “ or ” denotes “ at lease one of the items ,” but does not exclude a plurality of items of the list . thus , reference to “ a picnic basket having cheese or crackers ” describes “ a picnic basket having cheese without crackers ”, “ a picnic basket having crackers without cheese ”, and “ a picnic basket having both cheese and crackers .” finally , when used herein to join a list of items , “ and ” denotes “ all of the items of the list .” thus , reference to “ a picnic basket having cheese and crackers ” describes “ a picnic basket having cheese , wherein the picnic basket further has crackers ,” as well as describes “ a picnic basket having crackers , wherein the picnic basket further has cheese .” turning now to the drawings , a right side elevational view and a right side cross - sectional view of a first embodiment 118 of an apparatus in accordance with the present invention are illustrated , respectively , in fig1 and 15 . a front elevational view of the apparatus 118 is illustrated in fig1 . the apparatus 118 is shown in fig1 - 15 in conjunction with a conveyor 12 of a shrink packaging machine 10 , wherein an article 146 to be shrink wrapped is just coming into contact with the apparatus 118 . the apparatus 118 includes a plurality of spaced apart rollers 20 and a support 122 for disposition of the plurality of rollers 20 above the conveyer 12 . the rollers 20 and their disposition above the conveyor 12 are similar to those described previously with regard to fig1 - 12 , and each roller 20 includes a central horizontal shaft 24 and a cylinder 26 that is rotatably mounted on the shaft 24 . the cylinder 26 of each roller 20 preferably is covered with a high temperature - resistant non - stick coating , such as silicon rubber or teflon ®. the covering may constitute an application of the material to the roller , thereby forming a coating , or , alternatively , the covering may constitute a piece of the material that is adhered , or otherwise attached to , the rollers 20 . the support 122 includes a pair of spaced apart side members comprising side rails 128 , 130 which define slots 132 for receiving opposite ends of the shaft 24 of each roller 20 . fig1 is a right side elevational view of one of the side rails 130 of the apparatus of fig1 . the slots 132 of the left side rail 128 are preferably directly opposite and identical in shape to corresponding slots 132 of the right side rail 130 so that each of the plurality of rollers 20 is oriented with its axis disposed generally orthogonal to the direction of motion 34 of the conveyer 12 . the support 122 also preferably includes at least one threaded stud 36 passing through both side rails 128 , 130 for securing the side rails 128 , 130 in their spaced apart relationship . in the embodiment shown , each threaded stud 36 is secured to the side rails 128 , 130 by inner nuts 38 and outer nuts 40 . each slot 132 preferably extends in a direction having both a vertical component 42 and a horizontal component 44 . the vertical component 42 allows vertical displacement of a corresponding one of the plurality of rollers 20 by an article 146 as the article 146 is conveyed past the roller 20 . the horizontal component 44 of each slot 132 allows horizontal displacement of a corresponding roller 20 whereby the corresponding roller 20 is pushed slightly backwards in the direction 34 of motion of the conveyer 12 , making it easier for the article 146 to lift the roller 20 . each side rail 128 , 130 may form regularly spaced pairs of apertures positioned just above the slots 132 for receiving the threaded studs 36 and / or for receiving mounts for mounting threaded legs ( not shown ). the rails 128 , 130 thus can be cut to any length without special manufacture , and both rails 128 , 130 can be cut from the same stock , simply reversing the direction which a particular rail faces to make it either a right side rail 130 or a left side rail 128 . the threaded legs may be generally similar to the threaded legs 48 of fig3 and have similar functionality and design . referring now to fig1 , a significant distinction is evident between the slots 132 in the side rails 128 , 130 of the apparatus 118 and the slots 32 shown and described previously with respect to the apparatus 18 of fig1 - 12 . specifically , as shown in fig1 , variations in slot length exist between a first subset of slots 133 , a second subset of slots 134 , a third subset of slots 135 , and a fourth subset of slots 136 of the apparatus 118 , wherein the apparatus 18 of fig1 - 12 include slots 32 having substantially uniform length , wherein each subset includes one or more slots . in this regard , each of the fourth subset of slots 136 are preferably of the same general size and design as the slots 32 shown , for example , in fig5 . the first , second and third subsets of slots 133 , 134 , 135 , however , are of progressively greater lengths , all of which are less than the slot length of the fourth subset of slots 136 . additionally , the lower end of each of the first subset of slots 133 preferably is positioned at a distance from the bottom of the rail 130 that is slightly greater than the distance from the bottom of the rail 130 of each lower end of the second subset of slots 134 . similarly , the lower end of each of the second subset of slots 134 is positioned at a distance from the bottom of the rail 130 that is slightly greater than the distance from the bottom of the rail 130 of each lower end of the third subset of slots 135 , and the lower end of each of the third subset of slots 135 is positioned at a distance from the bottom of the rail 130 that is slightly greater than the distance from the bottom of the rail 130 of each lower end of the fourth subset of slots 136 . when rollers having similar diameters ( such as illustrated rollers 20 ) are mounted in these slots , this arrangement creates a graduated or tapered opening into the upstream end of the shrink tunnel of the shrink packaging machine in which the apparatus 118 is included . this graduated or tapered opening provided by the relative positions of the rollers 20 retained by the first , second , and third subsets of slots 133 , 134 , 135 provides a significant advancement over the prior arrangements of rollers 20 , such as that shown in fig1 - 12 . in particular , relatively thicker articles , such as articles 146 of fig1 - 12 , are accommodated by the apparatus 118 of the present invention in contrast to the apparatus 18 of the prior art illustrated in fig1 - 12 . in operation , the article 146 first comes into contact with the lower front portion of a roller 20 retained in a slot 133 . because the article 146 engages the lower portion of the first roller 20 , i . e ., because the article 146 does not initially engage the first roller in a direction that is substantially perpendicular to the surface of the roller at the point of engagement , the first roller 20 is readily displaced for passage of the article 146 under the first roller 20 . once the article 146 passes beneath the first roller 20 , the article 146 comes into contact with the lower front portion of the next subsequent roller 20 retained in a slot 134 . because the first roller 20 rides on top of the article 146 when the article 146 comes into contact with the second roller 20 , the first roller 20 tends to exert pressure upon the article 146 and serves to counteract any tendency of the back portion of the article 146 to lift up from the conveyor 12 upon contact with the second roller 20 . consequently , the second roller is more readily displaced by the article 146 . the article 146 furthermore preferably engages the second roller in a direction that is not substantially perpendicular to the surface of the roller at the point of engagement , whereby the second roller is more readily displaced for passage of the article 146 there under . however , it will be appreciated that , because of the force exerted by the first roller on the article 146 , the article 146 may engage the second roller in a direction that is closer to being orthogonal to the surface of the roller at the point of engagement than the direction of contact at the point of engagement between the article 146 and the first roller . the article 146 then comes into contact with the lower front portion of the next subsequent roller 20 retained in a slot 135 . because one or more of the previous rollers continue to ride upon of the article 146 when the article 146 comes into contact with the next subsequent roller , pressure is exerted upon the article 146 that serves to counteract any tendency of the back portion of the article 146 to lift up from the conveyor 12 upon contact with the next subsequent roller . consequently , the next subsequent roller is more readily displaced by the article 146 . the article 146 furthermore preferably engages the next subsequent roller in a direction that is not substantially perpendicular to the surface of the roller at the point of engagement , whereby the next subsequent roller is more readily displaced for passage of the article 146 there under . however , it will be appreciated that , because of the continued force exerted by one or more previous rollers on the article 146 , the article 146 may engage the next subsequent roller in a direction that is closer to being orthogonal to the surface of the roller at the point of engagement than the direction of contact at the point of engagement between the article 146 and a previous roller . finally , the article 146 comes into contact with the lower front portion of the next subsequent roller 20 retained in a slot 136 . because one or more of the previous rollers continue to ride upon of the article 146 when the article 146 comes into contact with the next subsequent roller , pressure is exerted upon the article 146 that serves to counteract any tendency of the back portion of the article 146 to lift up from the conveyor 12 upon contact with the next subsequent roller . consequently , the next subsequent roller is more readily displaced by the article 146 . the article 146 furthermore preferably engages the next subsequent roller in a direction that is not substantially perpendicular to the surface of the roller at the point of engagement , whereby the next subsequent roller is more readily displaced for passage of the article 146 there under . however , it will be appreciated that , because of the continued force exerted by one or more previous rollers on the article 146 , the article 146 may engage the next subsequent roller in a direction that is closer to being orthogonal to the surface of the roller at the point of engagement than the direction of contact at the point of engagement between the article 146 and a previous roller . in fact , the point of engagement may be such that the roller would not be displaced by the article 146 but for the continued force being exerted upon the article 146 by one or more of the previous rollers . it will also be noted that the tapered opening provided by the apparatus 118 especially works well if the article 146 itself is compressible . in this regard , while the article 146 displaces the first roller 20 , the article 146 further may be compressed by the first roller 146 , thereby lowering the vertical height of its point of impact with the second roller . the degree of compression further may be increased by increasing the weight of the first roller , or by fixing the vertical disposition of the first roller as in other embodiment of the invention described below . compression of the article 146 also tends to facilitate passage of the article 146 under subsequent rollers . some overall benefits are shown , for example , in fig1 - 18 , which illustrate a right side elevational view and a right side cross - sectional view , respectively , of the apparatus 118 . as shown in fig1 - 18 , a thick article 146 to be shrink wrapped has been transported midway through the apparatus 118 on the conveyor 12 . as the article 146 has passed the various rollers 20 forming the tapered opening of the shrink packaging machine , the rollers 20 are successively displaced while their weight causes the article 146 to be compressed . in this way , article 146 , which would have been too thick to be reliably guided under the first roller 20 of the prior art apparatus 18 illustrated in fig1 - 12 without manual intervention and adjustment , now may be shrink wrapped without such manual intervention using the apparatus 118 of the present invention . apart from the aforementioned , the structure and operation of the apparatus 118 of the present invention is otherwise very similar to that of the apparatus 18 of fig1 - 12 . in this regard , the articles 146 is shrink wrapped by covering the article 146 with shrink film in the normal way , which is well known in the art ; conveying covered article 146 on conveyer 12 through the shrink tunnel ; holding the covered article 146 down by exerting pressure from at least one of the plurality of rollers ; and blowing hot air on the shrink film covering the article 146 in a hot air chamber while the article 146 is held down by the at least one roller 20 . furthermore , it will be appreciated that having a plurality of rollers 20 spaced apart from each other allows hot air to be blown in - between the rollers and around the article 146 . the cylinders 26 of the rollers 20 also may be disposed so as to rest upon the surface of conveyer 12 , thereby imparting to each cylinder 26 rotational motion around its respective shaft 24 and further facilitating movement of the article 146 underneath each of the plurality of rollers 20 during movement of the conveyor 12 . however , as will be appreciated , in order for all of the rollers 20 to be so driven by the conveyor 12 , the diameters of the rollers 20 will differ between the rollers 20 . it alternatively is contemplated that , while each of the rollers 20 preferably is disposed low enough to actually contact the particular article 146 to be shrink wrapped , it is possible to simply have rollers 20 disposed so as to be slightly positioned above the article 146 without actually contacting the article absent initial curling or deformation of the article , which would be sufficient to prevent the article 146 from curling or deforming more than a limited amount . a characteristic of the apparatus 118 of fig1 - 18 is that the angle of the tapered opening created by the rollers 20 retained by the four subsets of slots 133 , 134 , 135 , 136 is fixed , i . e ., the lowest point of slot 133 is vertically fixed relative to the lowest point of slot 134 , the lowest point of slot 134 is vertically fixed relative to the lowest point of slot 135 , and the lowest point of slot 135 is vertically fixed relative to the lowest point of slot 136 . in variations of the apparatus 118 of the first preferred embodiment , the cylinders of the rollers may include varying diameters ( rather than uniform diameters as described ) such that a tapered opening is not necessarily provided and such that the conveyor drives each of the rollers when disposed in its respective lowermost position . nevertheless , because the height of the axes of rotation of at least the first couple of the rollers successively decreases , articles having a greater height still are accommodated generally as described above . fig1 is a right side elevational view of a second preferred embodiment 218 of an apparatus in accordance with the present invention . this apparatus 218 is similar to the first preferred embodiment 118 except that one or both of the side rails 128 , 130 of the first preferred embodiment have been replaced by a side member such as the right side rail 230 shown in fig1 . this side rail 230 includes slots all having a substantially uniform slot length , such as the fourth subset of slots 136 ; however , the apparatus 218 also includes an adjustable positioning arm 270 mounted at a pivot point 272 . the arm 270 may have any one of various configurations so long as it serves the function of establishing a lower limit on the movement of the respective rollers 20 in one or more of the slots 136 . thus , an upper edge 274 of the arm 270 is arranged to receive and support the end of one or more of the roller shafts 24 , as shown in fig1 . the arm 270 is held in place by tightening a fastener 276 at the pivot point 272 . the arm 270 additionally , or alternatively , may be further reinforced by a second fastener 278 inserted through a curved slot 280 , located near the end of the arm 270 so as to optimize the moment of force relative to the pivot point 272 . as shown , the slot 280 may be arranged in the body of the side rail 230 , but it will be apparent that generally similar results may be achieved by locating the slot in the arm itself , provided that the arm is modified in such a way as to accommodate a slot 280 of suitable length . the second fastener 278 preferably includes a thumb screw with a relatively large diameter , thereby making adjustment thereof easier . when the second fastener 278 is used , the first fastener 276 may remain loosened . in operation , the thumb screw of the second fastener 278 then only need be loosened enough to permit the arm 270 to be positioned at a desired angle . once in place , the second fastener 278 is tightened so as to fix the lower range of movement of the roller shafts 24 in their respective slots 136 . the apparatus 218 may then be used in like manner to the one shown in fig1 - 18 . however , if unsatisfactory results are being achieved in the shrink wrapping operation , or if the size of the articles being shrink wrapped is changed beyond what otherwise can be accommodated by the prevailing setting , then the lower range of movement of the roller shafts 24 may be adjusted merely by loosening the thumb screw 278 , repositioning the arm 270 , and retightening the thumb screw 278 . the basic functionality of the present invention may also be accomplished in any of a variety of alternative configurations . for example , results similar to those achieved with the preferred embodiment 218 of fig1 may be achieved by replacing the pivoting arm 270 illustrated therein with a member that may be moved up and down at each end , by a plurality of separate pivoting arms or members that each control the position of a portion of the roller shafts 24 , or the like . further , each movable end of a member or pivoting arm may be secured using a fastener inserted through a slot , as illustrated in fig1 , by a ratcheting mechanism , by a slot arrangement having a plurality of detent positions , or any other suitable attachment means . additionally , in variations of the apparatus 218 of the second preferred embodiment , the cylinders of the rollers may include varying diameters ( rather than uniform diameters as described ) such that a tapered opening is not necessarily provided and such that the conveyor drives each of the rollers when disposed in its respective lowermost position . nevertheless , because the height of the axes of rotation of at least the first couple of the rollers successively decreases , articles having a greater height still are accommodated generally as described . fig2 illustrates a right side elevational view of a side rail 330 of yet a third preferred embodiment of an apparatus of the present invention ( not shown ). this side rail 330 is somewhat similar to the side rail 230 of fig1 , in that it includes slots all having a substantially uniform slot length , such as the fourth subset of slots 136 . however , the side rail 330 includes one or more slot inserts 90 , 92 , 94 ( more clearly shown in fig2 ), each of which is retained in place by a fastener arrangement 96 such as , for example , a nut , washer , and bolt assembly . these inserts 90 , 92 , 94 may be installed or removed as necessary from the slots 136 nearest the front of the apparatus of which side rail 330 forms a part in order to control the lower range of movement of the roller shafts 24 in their respective slots 136 . different sizes or numbers of inserts may be used in order to produce tapered openings of different lengths or angles . in variations of the apparatus of this third preferred embodiment , the cylinders of the rollers may include varying diameters ( rather than uniform diameters as described ) such that a tapered opening is not necessarily provided and such that the conveyor drives each of the rollers when disposed in its respective lowermost position . nevertheless , because the height of the axes of rotation of at least the first couple of the rollers successively decreases , articles having a greater height still are accommodated generally as described . fig2 illustrates a right side elevational view of a side rail 430 of a fourth preferred embodiment of an apparatus ( not shown ) in accordance with the present invention . this side rail 430 also provides some adjustability to the length or angle of the tapered opening , which is accomplished via the inclusion of one or more series of holes 97 , 98 in a pattern that facilitates the creation of the tapered opening . as shown in fig2 , a first series of holes 97 creates a first line , generally collinear with the bottom of the first slot 136 , while a second series of holes 98 creates a second line , also generally collinear with the bottom of the first slot 136 . rollers 20 inserted in either series of holes 97 , 98 thus form a gradual linear progression downward from high to low , thereby creating the tapered opening . additional series of holes , or series having different numbers of holes , may likewise be used . the opening further need not be linear and may be curved . the arrangement provide , though , suffers from the disadvantage of not permitting movement of the rollers 20 in the series of holes 97 , 98 , but provides for a tapered opening and adjustability of the angle or length of the opening that is provided . in variations of the apparatus of this fourth preferred embodiment , the cylinders of the rollers may include varying diameters ( rather than uniform diameters as described ) such that a tapered opening is not necessarily provided and such that the conveyor drives each of the rollers when disposed in its respective lowermost position . nevertheless , because the height of the axes of rotation of at least the first couple of the rollers successively decreases , articles having a greater height still are accommodated generally as described . it will be apparent to the ordinary artisan that the relatively short side rails 130 , 230 , 330 , 430 shown in fig1 - 22 may represent merely an end section of a longer side rail . for example , fig2 illustrates a right side elevational view of a portion of a long side rail that includes an end portion similar to the side rail 130 of fig1 . it also will be clear that the slot and hole arrangements described and illustrated above may be used in side rails of any length . alternatively , larger side rails may be constructed from shorter ones . for example , fig2 is a right side elevational view of the side rail 130 of fig1 connected to the side rail 30 of fig6 . connection may be accomplished in any of a variety of ways , including but not limited to the connection plate 100 fastened to respective ends of the side rails 130 , 30 as shown in fig2 . | 1 |
embodiments of the present disclosure may provide mosquito - repelling wearables that may be formed of repellent - treated mesh that is soft and breathable as it protects the wearer from insect bites . in embodiments of the present disclosure , the repellent technology used to treat the mesh may tightly bond a permethrin formulation into the actual fibers of the fabric during manufacturing , resulting in effectively , odorless insect protection . permethrin is a chemical that may be used as an insect repellent . it belongs to the family of synthetic chemicals called pyrethroids and functions as a neurotoxin , affecting neuron membranes by prolonging sodium channel activation , and it has been a u . s . environmental protection agency ( epa )- registered chemical for almost 40 years , with an excellent safety record . inclusion of the permethrin formulation into the fibers of the fabric may repel insects , including but not limited to , mosquitoes , ticks , ants , flies , chiggers , and midges ( no - see - ums ). while wearables according to embodiments of the present disclosure have been described as including the permethrin formulation bonded with the mesh , it should be appreciated that other repellent formulations may be utilized without departing from the present disclosure . the repelling nature of wearables according to embodiments of the present disclosure may last through approximately 25 launderings , which is the general expected lifetime of a garment . this life span is well beyond the life of most performance finishes commonly used in the technical - apparel industry . wearables according to embodiments of the present disclosure may be worn by adults and children alike . it should be appreciated that these wearables may be provided in a variety of colors , patterns , and styles , even including camouflage , according to embodiments of the present disclosure . in some embodiments of the present disclosure , these wearables may resemble mosquito netting but are formed of a three - dimensional mesh , similar to the top portion of running shoes ; this mesh may breathe but will reduce the likelihood that a mosquito will penetrate the spongy fabric when worn . in further embodiments of the present disclosure , these wearables are formed of a single - layer repellent - treated mesh , either in place of or in addition to the three - dimensional mesh . it should be appreciated that the three - dimensional mesh may or may not be repellent - treated in embodiments of the present disclosure . these wearables may be worn in warmer climates ; however , there may be embodiments of the present disclosure where heavier clothes may be worn underneath the wearable , such as when the climate is a little cooler but certain insects are still present . there may be further embodiments where more than one layer of repellent - treated mesh may be utilized , again when the climate is a little cooler . embodiments of the present disclosure may provide a wrap jacket ( see fig1 a - 1d ) that is treated with the permethrin repellent formulation , provided by insect shield ® in some instances . this type of jacket may be worn by women , including women that are pregnant and may be more susceptible to diseases such as the zika virus . the jacket may be constructed of repellent - treated mesh that is soft , lightweight , and / or breathable as it helps protect the wearer from insect bites . the repellent within the mesh is tightly bonded into the actual fibers of the fabric , thereby providing built - in protection from mosquitoes , ticks and other potentially dangerous biting insects . the mesh forming this wearable may be soft , breathable and may be stretchy / pliable in nature . the repellent may be effective for approximately 25 launderings . fig1 a - 1d depict different views of mosquito - repelling wrap jackets according to embodiments of the present disclosure . more specifically , fig1 a depicts a front view of a mosquito - repelling wrap jacket according to an embodiment of the present disclosure . in this embodiment , the wrap jacket is shown on a hanger ( i . e ., not being worn ), and this reflects the draping nature of the wrap jacket . while the wrap jacket may be sold in a variety of sizes , it should be appreciated that the draping nature of the wrap jacket may allow for people of differing sizes and shapes to wear it , including pregnant women , such as the wrap jacket depicted in the front view of fig1 b . it also should be appreciated that wrap jackets according to embodiments of the present disclosure may be provided in varying colors , patterns , and styles . fig1 b depicts front and back views of mosquito - repelling wrap jackets as worn according to an embodiment of the present disclosure . in this embodiment , belting mechanisms have been utilized to provide closure for the front of the wrap jacket , and the back view illustrates how the belting mechanism may wrap around the wearer . fig1 c depicts front and back views of a mosquito - repelling wrap jacket as worn according to an embodiment of the present disclosure . in this embodiment , the draping nature of the wrap jacket is visible from the back view . further , one of the front views depicts how the wrap jacket may be drawn over a wearer &# 39 ; s head in some embodiments of the present disclosure to provide additional protection for the wearer &# 39 ; s face , neck and head . however , there may be other embodiments wherein one may wear the wrap jacket and also utilize a scarf or head wrap formed of the repellent - treated mesh as described with respect to the wrap jacket . fig1 d depicts a front / side view of a mosquito - repelling wrap jacket as worn according to an embodiment of the present disclosure . in this embodiment , the wrap jacket has been belted to provide a more flattering silhouette for the wearer and make the wearer &# 39 ; s outfit more fashion - forward . in another embodiment of the present disclosure , a tracksuit ( fig2 a - 2c ) may be constructed of mesh ( i . e ., a single - layer repellent - treated mesh and / or a three - dimensional mesh , which may or may not be repellent - treated ) that is soft and breathable . such a tracksuit may be provided for adults and children alike . by wearing the tracksuit , a human may be protected from insect bites as the repellent within the mesh fabric is tightly bonded into the actual fibers of the fabric . this may provide built - in protection from mosquitoes , ticks and other potentially dangerous biting insects . like the net wrap jacket , a tracksuit according to embodiments of the present disclosure may be formed of soft and breathable stretch mesh having a repellent that is effective for approximately 25 launderings . fig2 a - 2c depict different views of mosquito - repelling tracksuits according to embodiments of the present disclosure . more specifically , these figures depict front and back views of children wearing tracksuits according to embodiments of the present disclosure . the trouser portion of the tracksuit may have a waistband , and the trousers may cover the lower torso and legs of the wearer , while the jacket portion may cover the upper torso and arms of the wearer in some embodiments of the present disclosure . as depicted , these tracksuits are suitable for girls as well as boys and may be provided in a variety of colors , patterns and styles . it also should be appreciated that tracksuits as well as other wearables according to embodiments of the present disclosure may include reflective patterns or other safety / design features . further , while the tracksuits of fig2 a - 2c are being worn by children , it should be appreciated that these tracksuits may also be formed in sizes / styles to be worn by men and women without departing from the present disclosure . in addition , tracksuits according to embodiments of the present disclosure may be provided in a variety of sizes ; however , there may be some embodiments of the present disclosure wherein tracksuits could be provided in a one - size - fits - most style . fig2 a - 2c depict the relatively see - through nature of tracksuits according to embodiments of the present disclosure ; accordingly , wearers generally wear the tracksuits in sizes that allow for their regular clothes to fit underneath the track suit when worn . fig2 a provides a front view of a tracksuit according to an embodiment of the present disclosure . in this embodiment , the fabric is formed in a gathered manner at various points of the track suit , particularly at the wrists , the waistband and the ankles of the wearer . this gathering may reduce the likelihood that a mosquito may reach the wearer &# 39 ; s skin through one of these more open areas of the tracksuit . the gathering may be a ribbed material in some embodiments of the present disclosure . the tracksuit also may include a collar that may have a fold on top but be seamed at the corner front in some embodiments of the present disclosure . this collar also may be formed of a ribbed material . fig2 a also depicts how the tracksuit according to an embodiment of the present disclosure may have a zippered front closure to allow for easy wearability ; the zipper may be attached to the track suit by way of fabric strips ; however , other methods of attachment may be used without departing from the present disclosure . it also should be appreciated that there may be other embodiments of the present disclosure where closure mechanisms other than a zipper may be utilized , for example , buttons or velcro . there may be further embodiments wherein the jacket portion of the track suit may be formed more like a pullover jacket in which case a closure mechanism may not be necessary . in addition , wearable may have reflective portions on one or more sections so that safety can be increase in low - light , hunting , or other similar situations . in a further embodiment of the present disclosure , a track jacket ( fig3 a - 3b ) may be provided . this track jacket may be constructed of a single - layer repellent - treated mesh that is soft and breathable as it helps protect the wearer from inspect bites . the repellent within the mesh may be tightly bonded into the actual fibers of the fabric . this may provide built - in protection that helps protect the wearer against mosquitoes , ticks and other potentially dangerous biting insects . like the other wearables previously described , the track jacket according to embodiments of the present disclosure may be formed of a soft and breathable stretch mesh having a repellent that is effective for approximately 25 launderings . fig3 b depicts how a track jacket according to an embodiment of the present disclosure may cover the upper torso of the wearer in the form of a jacket . while the wearer in fig3 b is depicted as a woman , it should be appreciated that jackets may be provided for men and children ( boys and girls ) as well without departing from the present disclosure . while not specifically depicted in fig2 a - 2c or fig3 a - 3b , it should be appreciated that a track suit or track jacket according to embodiments of the present disclosure may include a hood that connects to the track suit or jacket at a neck line . fig6 depicts a view of mosquito - repelling pants according to an embodiment of the present disclosure . like the pants described in fig2 a - 2c , a ribbed material may be utilized to form a waistband ; however , the pants in fig6 also depict a drawstring closure . further , the pants in fig6 also include drawstring closures at the ankle portions of the pants along with ribbed material . while drawstring closures are depicted in fig6 , it should be appreciated that these closures may not be utilized in all embodiments of the present disclosure . fig7 a depicts a view of a mosquito - repelling infant bunting according to an embodiment of the present disclosure . a hood may be provided as depicted in fig7 a . the bunting also may include a zipper to open and close the bunting , and the bunting also may include a front face that covers the zipper for cleaner finishing on the bunting . the arm portions of the bunting may include back pocket folds over the front to cover the infant &# 39 ; s fingers in some embodiments of the present disclosure . the bunting as depicted in fig7 a may provide a completely closed bottom , such as when the bunting may be employed for a sleeping infant ; however , it should be appreciated that there may be embodiments of the present disclosure where the bunting may not be completely closed and / or may not be used for a sleeping infant . fig7 b depicts a view of a mosquito - repelling infant bunting being worn by an infant according to an embodiment of the present disclosure . fig8 a and 8b depict mosquito - repelling cover - ups according to an embodiment of the present disclosure . more specifically , fig8 a depicts a front view of a cover - up including a hood where there is an overlapping edge between the hood and the body portion of the cover - up to improve skin coverage when worn . fig8 b depicts a cover - up that includes a hood , and this cover - up also includes a neck portion formed of a ribbed material . in some embodiments of the present disclosure , the neck portion may include a slit for the neck opening and / or a serge neckline seam . it should be appreciated that a cover - up may include openings for the arms to be received but otherwise may be closed at the sides . fig9 a depicts a front view of a mosquito - repelling poncho according to an embodiment of the present disclosure , and fig9 b depicts a back view of a mosquito - repelling poncho according to an embodiment of the present disclosure . as depicted herein , a poncho may include a hood that may be placed on the outside of the collar portion . a poncho may differ from the cover - ups depicted in fig8 a and 8b at least insofar as the poncho is open at the sides ( i . e ., does not contain armholes ). the neck portion of the poncho as depicted in fig9 a and 9b may include a ribbed material , and it also may include a button , elastic cord loop or another fastening mechanism around the neck portion to secure the poncho in place in some embodiments of the present disclosure . as depicted in fig9 b , the hood is outside the collar portion at the back of the wearer &# 39 ; s neck and may be gathered as described in other embodiments of the present disclosure . fig1 depicts a front view of a mosquito - repelling caftan cover - up according to an embodiment of the present disclosure . the caftan cover - up of fig1 is similar to the cover - ups and / or ponchos previously described in that it may include ribbed material around the neck portion ; however , it does not include a hood portion . fig4 depicts a mosquito - repelling mesh according to an embodiment of the present disclosure , and fig5 depicts a close - up view of a mosquito - repelling fabric forming the track jackets of fig3 a and 3b . while embodiments of the present disclosure have been described as having repellent within the mesh fabric tightly bonded into the actual fibers of the fabric , it should be appreciated that the repellent also may be woven into the fabric or may be sprayed onto or otherwise applied to the fabric without departing from the present disclosure . in addition , the mosquito - repelling fabric , in one embodiment , can be three - dimensional fabric / mesh , such as depicted in fig2 b and 2c . this three - dimensional mesh may or may not be repellent - treated in embodiments of the present disclosure . the type of fabric used to form wearables according to embodiments of the present disclosure may depend on the type of wearable . for example , a tracksuit may be formed from a combination of sheer stretch or spandex mesh ( approximately 82 % nylon and approximately 18 % spandex ) and milliskin tricot ( approximately 80 % nylon and approximately 20 % spandex ) while a wrap jacket may be formed of just the sheer stretch or spandex mesh ( i . e ., no milliskin tricot ). there also may be embodiments of the present disclosure where a three - dimensional mesh may be used in addition to or in place of the sheer stretch or spandex mesh and / or milliskin tricot . this three - dimensional mesh may or may not be repellent - treated in embodiments of the present disclosure . however , it should be appreciated that other similar materials may be utilized without departing from the present disclosure . the fabric forming wearables according to embodiments of the present disclosure may have a spongy or springiness that may resist compression and reduction in thickness of the fabric when in use ; this may lessen the likelihood that the insect stinger penetrates the wearer &# 39 ; s skin . the fabric also may provide for sufficient ventilation such that the resultant wearable is not too hot to wear when the weather is warm or when the wearer is engaging in physical activity . regardless the composition of the fabric , the fabric , particularly with respect to a three - dimensional mesh , should be formed of sufficient thickness to prevent an insect stinger bite from penetrating the skin of the wearer . this thickness may be approximately ⅛ inches thick ; however , the fabric may be thicker or thinner without departing from the present disclosure . further , the mesh pattern should be formed in such a way that the distance between the wearer &# 39 ; s skin and the insect stinger is as large as possible . also , because of the tightly woven nature of the fabric , the stinger is less likely to penetrate the fabric due to the lack of passageways through the fabric ; this is where the 3 - d nature of the fabric also may be helpful . thus , wearables according to embodiments of the present disclosure may place the repellent near the wearer &# 39 ; s skin instead of being applied to the skin itself . the repellent nature is long - lasting and does not have to be reapplied to the fabric . in addition , the wearables may also include sensors , gps sensors , bluetooth sensors , wi - fi sensors , watches , heart rate monitor , humidity sensor , phone , touchscreen , display , graphical user interface , voice recognition interface , temperature sensor , watch , blood sugar monitor , panic button , camera , drone interface , lte / wi - fi / bluetooth communication processors / sensors , used either alone or in combination with one another , to better improve the use of the wearable . while the embodiments described herein have focused on wearables for humans , there also may be embodiments of the present disclosure wherein pets , such as dogs and cats , may be provided with wearables that may reduce the risk of mosquito bites . for example , a jacket or vest may be provided that may be formed of repellent - treated mesh that a dog may wear when he / she is being walked outside . although the present disclosure and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the disclosure as defined by the appended claims . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , composition of matter , means , methods and steps described in the specification . as one of ordinary skill in the art will readily appreciate from the disclosure , processes , machines , manufacture , compositions of matter , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present disclosure . accordingly , the appended claims are intended to include within their scope such processes , machines , manufacture , compositions of matter , means , methods , or steps . | 0 |
referring to fig1 and 2 , there is shown a rotary sliding vane device or pump 10 comprising a casing 11 and a cartridge or subassembly 12 . casing 11 comprises a body 11b and a cover 11a . the cartridge 12 includes a cam ring 13 sandwiched between support plates 14 , 15 with intermediate cheek plates 16 , 17 , all of which are secured to each other by bolts 18 extending through support plate 14 and cam 13 into threaded holes in support plate 15 . the cover 11a is provided with an inlet supply connection port 19 leading into a pair of fluid port inlet openings 20 in cam 13 , as shown in fig2 and passages 23 formed in the support plates 14 and 15 as shown in fig1 and recesses 24 , in the cheek plates 16 and 17 as shown in fig1 and 2 . an outlet connection port 22 is provided in the body 11b which is directly connected by a passage 22a to a pressure delivery chamber formed in support plate 15 and passages 48 in the cheek plates 16 and 17 . a rotor 25 is rotatably mounted within the cam 13 on the splined portion 26 of a shaft 27 which is rotatably mounted within a bearing 28 in the support plate 14 and a ball bearing 29 mounted with the body 11b . cam 13 has an internal contour 30 which is substantially oval in shape and which together with the periphery of the rotor 25 and the adjoining surfaces of the cheek plates 16 , 17 define two opposed pumping chambers 31 , 32 , each of which traverse the fluid inlet , fluid transition , and fluid outlet zones . the fluid inlet zones comprise those portions of the pumping chambers or spaces 31 , 32 , respectively , registering with the fluid inlet port openings 20 and cheek plate passages 24 . the fluid delivery zones comprise those portions of the pumping chambers 31 , 32 registering , respectively , with opposed arcuately shaped fluid delivery port openings 48 in cheek plates 16 , 17 which are directly connected to the outlet connection port 22 . fluid flows to the inlet zones through inlet port openings 20 and also through the passages 23 formed in the support plates 14 , 15 and recesses 24 in the cheek plates 16 , 17 which permit the fluid to flow from the inlet 19 between the sides of cam 13 . the pumping device so far described is of the well known structure disclosed in the u . s . pat . no . 2 , 967 , 488 . it has been the practice in devices of this type to provide the rotor with a plurality of radial vane slots 35 , each of which has a vane 36 slidably mounted therein . the outer end or vane tip of vanes 36 engage the inner contour of cam 13 . the contour of cam 13 includes an inlet rise portion , an intermediate arcuate portion , an outlet fall portion , and another intermediate arcuate portion . the cam contour is symmetrical about its minor axis , thus each of the rise , fall and arcuate portions are duplicated in the other opposed portion of the contour . as the tips of vanes 36 carried by the rotor 25 and the vane tips traverse the outlet fall portions , the vanes 36 move radially inward . the spacing between each pair of vanes 36 is adapted to span the distance between each pair of ports in a manner to provide proper sealing between the inlet and outlet chambers of the pumping device . each vane 36 has a rectangular notch 37 extending from the inner end or base of the vane to substantially the mid - section thereof . a reaction member 38 comprises a flat sided blade substantially equal in width and thickness to that of the notch 37 in the vane so as to have a sliding fit within the vane and the side walls of each rotor vane slot 35 . the side walls of the rotor vane slot 35 , the vane 36 and the reaction member 38 define an expansible intra - vane chamber 39 . an undervane pressure chamber 40 is defined by the base of each vane 36 and the base and side walls of each rotor vane slot 35 . chambers 39 and 40 are separated by and sealed from each other by reaction member 38 . thus , the two chambers 39 , 40 are provided substantially the same as shown in u . s . pat . no . 2 , 967 , 488 which is incorporated herein by reference . referring to fig1 and 2 , the undervane chamber 40 associated with the base of each vane 36 is provided with fluid pressure by radial passage 41 in rotor 25 . the radial passages 41 transmit fluid to the undervane chambers 40 and , thus , to the bases of the vanes 36 . thus , the cyclically changing pressure which is exerted on the tips of the vanes 36 as they traverse the inlet and outlet portions of the cam contour is transmitted to the bases of the vanes 36 . fluid under pressure is supplied to the chamber 39 by transverse slots 42 in rotor 25 which communicate with arcuate grooves 44 in each face of each cheek plate 16 , 17 . each groove 44 extends about a portion of the travel of rotor 25 . grooves 43 are provided in the displacement zones in concentric relation with the grooves 44 for registry with the slots 42 . a pressure balancing pad 45 is provided on the opposite face of the cheek plate and is circumscribed by a seal . an opening 46 extends through the plate and communicates each groove 43 with the pressure pad 45 . two openings 47 extend through the plate and provide communication between groove 44 and pressure pad 45 . as the axial slots 42 move across the arcuate grooves 43 the displaced fluid at the intra - vane chamber 39 is transmitted to and is exhausted through the restricted opening 46 and into the cavity of the pressure balancing pad 45 . the resulting increased fluid pressure is transmitted to the intra - vane chambers 39 and acts to hold the reaction members 38 against the base of the undervane chamber 40 and also holds the vane on the cam 13 . as shown in fig1 each vane moves successively through the fluid inlet zone , the fluid precompression zone , the fluid discharge zone , and the fluid decompression zone . groove 44 associated with the intra - vane chambers 39 provides communication between adjacent intra - vane chambers as the vane moves through a portion of the decompression zone , the inlet zone , and a portion of the precompression zone . groove 43 associated with the intra - vane chambers 39 provides communication between adjacent intra - vane chambers as the vanes thereafter move through a portion of the precompression zone and the discharge zone . groove 33 associated with the undervane chambers 40 provides communication between adjacent undervane chambers as the vanes move through the inlet zone . groove 50 provides communication between the undervane chambers 40 as the vanes move through the discharge zone . during the pumping the cycles , the internal pressure distribution between the rotating group and the cheek plates is equalized or slightly exceeded by the hydrostatic pressure force of the balancing pads 45 . this feature is described in u . s pat . no . 3 , 752 , 609 . on the inlet rise portions of the cycle , the passages 41 function to maintain pressure at the inlet pressure . on the outlet fall portion of the cycle , passages 41 function to increase the undervane pressure and retard the radially inward movement of the vanes to maintain the vanes in contact with the cam 13 . on the minor dwell portion of the cycle between the outlet and inlet zones , the passages 41 function to decompress the volume not displaced . during the inlet to pressure transition , passage 41 in combination with the axial slot 42 encase the vane with a pressurized fluid film to ease the vane movement and to prevent the loaded rotor segment from pinching the vane in the rotor slot . although the invention has been described as used in a pump , it can also be used in a motor of the sliding vane type . in accordance with the invention , the vanes 36 which have an end configuration such as shown in fig4 are reversed in the slots 35 from the normal position in the prior art so that the radially outermost top portion t trails with respect to the direction of rotation . in addition , the pressure sensing passages 41 in the rotor 25 are positioned in advance of the respective vanes 36 with the respect to the direction of rotation so that they sense the pressure ahead of the vanes 36 and provide the fluid at that pressure to the appropriate chamber associated with the respective vane . the leading passages 41 also provide the path for exhausting the undervane displacement to ensure hydrostatic pressure bias on the vanes . this biased pressure is distributed in groove 50 to provide the added radial hydrostatic support for the vane in the displacement zone . it has been found that the resultant construction will permit operation at a higher pressure without significantly enlarging the radial size of the rotor . in addition , the operation will be without excessive noise , reduce the tendency of the vanes to wear in the rotor slots , will provide less sensitivity to radial unbalance as a result of vane tip wear and will provide more positive vane tracking of the cam contour . fig5 a and 5b are diagrammatic views of the prior art and the present device , respectively . in the prior art , the stress at the base of the slots 35 produces a tensile stress whereas the stress at the corresponding portion of the rotor 25 of the present device produces a compressed stress at the inner ends of the radial passages 41 which intersect the vane slots 35 . it has been found that on repeated cycle testing the fatigue strength of the rotor substantially improved in pumps embodying the invention . referring to fig6 a and 6b , which are diagrammatic views of the prior art and the present device , it has been found that since the undervane chambers 40 sense pressure ahead of the vanes 36 , the vane slots 35 become completely pressurized more quickly during the inlet to discharge transition , as compared with the prior design . as a result there is less coulomb friction and wear during the beginning of the inward displacement cycle as represented by the pressure distribution arrows . referring to fig7 a and 7b , which are diagrammatic views of the prior art and the present device , in the present device the discharge pressure is sensed ahead of the vane 36 and communicated beneath the vane 36 . in addition to centrifugal force , the radial outward force on the vane 36 is a product of the discharge pressure acting on the undervane area ; also included is the force of the system pressure acting on the intra - vane area . the total inward radial force on the vane &# 34 ; in the transition zone &# 34 ; ( inlet to discharge ) is the product of the discharge pressure on the vane tip area . the amount of the exposed vane tip area is determined by the location of the line contact of the vane tip tracking the cam contour . as the vane tip wears , the line contact shifts and reduces the amount of the area exposed to the internal discharge pressure and the net outward force becomes proportionately larger . in the prior art intra - vane pump designs the vane tip wear , with consequent shifting of the line contact on the cam contour , causes a reduction in the net outward force upon the vane . when the exposed area of the vane tip exceeds that of the intra - vane , vane instability can be expected . referring to fig8 a and 8b , which are diagrammatic views of the prior art and the present designs , it can be seen that in the prior art designs as shown in fig8 a the undervane volume is displaced into the trailing common chambers between the extended vane as shown in fig8 a . the pressure p 1 in the undervane chambers entering the discharge zone is momentarily lower than discharge pressure p because of the inherent pressurizing delay caused by the pressure sensing passages 41 completing the inlet to discharge transition . also the discharge pressure p includes the added potential energy due to the discharge flow changing direction from tangential flow to axial flow ; this added pressure becomes more pronounced with increased shaft speeds . if the discharge pressure p is greater than p 1 , there will be a tendency for the vane entering the discharge zone to become unstable . in the present design fig8 b , the undervane displacement is directed into the leading passages 41 which communicate directly into the pump discharge chamber . since the undervane displacement originates at the vane , the pressure p 1 has to be greater than the pressure p in the discharge chamber . the resulting net force bias will maintain the vane on the cam contour . in the prior design fig8 a , the discharge flow from the intra - vane chamber was restricted in the attempt to stabilize the vane in the discharge quadrant . this feature was limited because this displaced volume was relatively small and its discharge pressure was difficult to control ( increase ) because of the inherent leakage paths of the axial clearances between the cheek plates and the rotating group . in order to optimize the functioning of the passages 41 which lead the vanes 36 , undervane arcuate discharge grooves 50 are provided in each cheek plate ( fig3 ). these grooves 50 function to communicate the increased undervane pressures to the vanes 36 in the discharge zone and the vanes entering the pressure inlet transition zone , thereby assuring continuous vane contact on the cam contour 13 . in addition , a decompression groove 52 of uniform cross section is extended from the undervane filling openings 33 . the grooves 52 are positioned such that the passages 41 are exposed to the grooves 52 and the spaces 31 and 32 thereby provide early decompression of the scavenged volume between the vanes and in the passages 41 and also provide early filling of undervane chambers . this may be contrasted to the prior art cheek plate as shown in fig9 wherein the opening 33a provides a shorter period for filling the undervane chamber . each cheek plate is also provided with a pressure metering groove 48b associated with filling openings 48 to control the rate at which the volume is brought up to pressure during the discharge transition period . during the displacement cycle , a period of mechanical precompression is applied to the intervane volume about to be displaced . the principal purpose is to reduce the outgassing of the throttled flow admitted by the metering groove 48b . the mechanical precompression is controlled by delaying the combined openings of the metering groove 48b and port 48 . the leading porting passages 41 permit this precompression because the anticipated pressure delay between the vane tip and the undervane occur at the trailing vane and not at the leading vane which provides the seal between inlet and discharge . ( fig1 ) with the prior art vane pump design ( passages 41 trailing the vanes ) the anticipated momentary pressure ( created by the mechanical precompression ) unbalance would occur at the leading vane which provides the critical sealing between the inlet and discharge . although the grooves and pockets have been shown in cheek plates , they can be provided in fixed portions of the housing if flexible cheek plates are not used . in addition , the cheek plate embodying the invention includes erosion control pockets 53 in the area near the inlet in order to permit dissipation of the formation of bubbles in a pressure - inlet transition and accordingly prevent erosion damage to the critical surface of the cheek plates ( fig3 ). this may be contrasted to the prior art plate wherein the erosion pockets 53a are nearer the discharge than the inlet ( fig9 ). although the invention has been described in connection with pressure energy translating devices that have the intervane chamber provided as shown in fig1 the invention is also applicable to other types of vane type pressure energy translating devices such as shown in the aforementioned patents wherein there are two chambers associated with the vane . thus , as shown in fig1 and 11 , the pressure energy translating device 70 includes vanes 71 positioned so that the tip 71a trails the direction of rotation . pins 72 engage the base of the vanes and pockets 73 are provided to urge the pins radially outwardly . a passage 74 is defined by grooves 75 in the rotor and leads the respective vanes 71 in the direction of rotation . this such pressure energy translating device is shown in u . s . pat . no . 4 , 629 , 406 and is of the general type shown in fig1 and 13 wherein identical parts have the same reference numbers with the suffix &# 34 ; a &# 34 ;. as shown in fig1 and 13 , the passages 74a trail the vanes 71a and the tips ta lead the vane . as shown in fig1 in the prior art , the maximum of area pressure defined by the surface s of the vane slot is interrupted by the passage 72a . this may be contrasted to fig1 wherein in the pressure energy translating device embodying the invention the surface s is continuous without interruption , thereby providing a greater load bearing area in addition to the other advantages in the present invention . in the modified form shown in fig1 , the vanes 80 have portions 81 at their ends cut away to define radial passages which lead with respect to the direction of movement of the vanes 81 and the tips formed in the manner as shown in fig2 . in this form , the vanes are formed with intra - vane chambers 82 that communicate with one another through a circumferential passage 83 that in turn communicates with the periphery of the rotor which communicates through passage 84 with the periphery of the rotor 85 . the undervane chambers 86 communicate with the groove 87 in the cheek . this form is otherwise similar to that disclosed in the u . s . pat . no . 4 , 431 , 389 which is incorporated herein by reference . in the form of the invention shown in fig1 the leading passages are in the form of grooves 90 in the vanes 91 . each vane is formed with an intra - vane chamber 92 and an undervane chamber 93 which communicate with passages 94 and 95 as in the form shown in fig1 ; otherwise this form is identical to that shown in u . s . pat . no . 4 , 505 , 654 which is incorporated herein by reference . in both of the forms shown in fig1 and 15 the position of the vanes is reversed with respect to the direction of rotation so that the apex of the vane is in a trailing direction with respect to the direction of rotation . in this form of the invention shown in fig1 and 15 the trailing interrupted surface between the vane and rotor slot provides a superior load bearing support . | 5 |
the disclosure , including the accompanying drawings , is illustrated by way of example and not by way of limitation . it should be noted that references to “ an ” or “ one ” embodiment in this disclosure are not necessarily to the same embodiment , and such references mean at least one . referring to fig1 , an exemplary embodiment of a tweezers includes a main body with two resilient levers 10 , and two pincers 20 . first ends of the levers 10 are connected together , with an angle defined between the levers 10 to make second ends of the levers 10 opposite to the first ends spaced from each other . a slot 11 is defined in the second end of each lever 10 . a resilient tab 12 extends toward the first end of each lever 10 from a side bounding each slot 11 adjacent to the second end of the corresponding lever 10 . in this embodiment , a hollow and substantially rectangular shaped connection portion 21 extends from a first end of each pincer 20 , and defines a receiving space 22 with an opening 25 of the receiving space 22 opposite to a second end of the corresponding pincer 20 . a slot 24 is defined in a side of each connection portion 21 , communicating with the corresponding receiving space 22 . referring to fig2 , in assembly , the second ends of the levers 10 enter the receiving spaces 22 through the openings 25 of the corresponding connection portions 21 . the resilient tabs 12 engage in the corresponding slots 24 , to fix the pincers 20 to the corresponding levers 10 . in disengagement of the pincers 20 from the corresponding levers 10 , the resilient tabs 12 are pressed toward the corresponding receiving spaces 22 to withdraw in the receiving spaces 22 , thereby readily disengaging from the corresponding receiving spaces 22 . thereby , the pincers 20 can be removed from the corresponding levers 10 easily . referring to fig3 , in other embodiments , the tabs 12 and the slots 21 can be omitted , and the levers 10 may be engaged in two receiving spaces 22 of two pincers 30 tightly and directly . moreover , distal ends of the corresponding pincers 20 opposite to the corresponding connection portions 21 can be any shaped , such as cuspate , or hamulus - shaped . it is believed that the present embodiments and their advantages will be understood from the foregoing description , and they will be apparent that various changes may be made thereto without departing from the spirit and scope of the description or sacrificing all of their material advantages , the examples hereinbefore described merely being exemplary embodiment . | 1 |
while useful , the random surfer model for page ranking ignores the reality that not all web pages are equal . that is , some web pages are clearly more popular than others . hence , links associated with such pages are more likely to be traversed by actual web surfers and , accordingly , should be accorded more weight than links which are unlikely to be selected by web surfers . accordingly , the present inventor has developed a new procedure for ranking web pages which takes into account the actions of an actual web surfer . the process and system implementing same are described below . in the definition of pagerank , the coefficient 1 / l ( pg j ), which is multiplied by pr ( pg j ) in computing the rank value of a particular page , can be viewed as the probability that a random surfer will select ( e . g ., click on ) a particular link on page pg j . the same value , 1 / l ( pg j ), is used in computing pagerank values for all pages to which page pg j points . because the same value is used for outgoing links to pages , the random surfer model of pagerank assumes that all outgoing links have equal probability of being followed . in other words , a random surfer will click on a link on a particular page with equal probability . the present invention , however , recognizes that the probabilities of following links on a particular page pg j do not have to be equal . accordingly , in computing rank values , we replace the single coefficient 1 / l ( pg j ), which is constant for pg j , with a set of probabilities p ij . probability p ij is the probability that a surfer will click the link to the page p i on the page p j . thus , in accordance with the present invention , the rank a web page is computed as follows : pr ( pg i ) = 1 - d n + d ∑ j pr ( pg j ) p ij . the set of probabilities p ij for a given page , pg j , represent a discrete probability distribution satisfying the following constraints : in order to determine probabilities p ij , we keep track of actual web surfer behavior by monitoring user selection of links on a page and counting same . this is done , in one embodiment of the invention , using a browser extension or other application installed on an individual user &# 39 ; s computer system . when a user loads a web page in the browser , the identity of the page is recorded ( e . g ., using the uniform resource locator ( url ) of the page , or some other identifier ) and when a user selects a link on the page a counter associated with that link is incremented . in one embodiment of the invention , the counter is implemented in a distributed network organized as a distributed hash table . in other instances , the counters can be stored in a centralized system of computers connected through a local network or a hybrid combination of distributed and centralized systems . for every page pg j then , there is a set of counters , one each for each link on that page . every time an user selects a link to page pg i on page pg j , the corresponding counter is incremented . now , if we let v ij be the value for the counter for the link to page pg i on page pg j , and v j be the sum of all v ij on page pg j , i . e ., the sum of all selections of all links on page pg j : note that p ij forms a discrete probability distribution by definition : ∑ i p ij = ∑ i v ij iv j = 1 as noted , the probabilities p ij are intended to measure actual probabilities of users following links on pages , as determined by actual link selections from a set of users , instead of assuming an uniform probability . in one embodiment of the present invention , the links selections are counted by a computer - implemented process running on a user &# 39 ; s computer system . an example of such a computer system is shown in fig1 . computer system 100 , upon which the link selection monitoring software may be installed , includes a bus 102 or other communication mechanism for communicating information , and a processor 104 coupled with the bus 102 for processing information . computer system 100 also includes a main memory 106 , such as a ram or other dynamic storage device , coupled to the bus 102 for storing information and instructions ( such as instructions comprising the link selection monitoring software when the program is running ) to be executed by processor 104 . main memory 106 also may be used for storing temporary variables or other intermediate information during execution of instructions to be executed by processor 104 . computer system 100 further includes a rom 108 or other static storage device coupled to the bus 102 for storing static information and instructions for the processor 104 . a storage device 110 , such as a hard disk , is provided and coupled to the bus 102 for storing information and instructions ( such as instructions comprising the link selection monitoring software ). computer system 100 may be coupled via the bus 102 to a display 112 for displaying information to a computer user . an input device 114 , including alphanumeric and other keys , is coupled to the bus 102 for communicating information and command selections to the processor 104 . another type of user input device is cursor control device 116 , such as a mouse , a trackball , or cursor direction keys for communicating direction information and command selections to processor 304 and for controlling cursor movement on the display 112 . computer system 100 also includes a communication interface 118 coupled to the bus 102 . communication interface 108 provides for two - way , wired and / or wireless data communication to / from computer system 100 , for example , via a local area network ( lan ). communication interface 118 sends and receives electrical , electromagnetic or optical signals which carry digital data streams representing various types of information . for example , two or more computer systems 100 may be networked together in a conventional manner with each using a respective communication interface 118 . network link 120 typically provides data communication through one or more networks to other data devices . for example , network link 120 may provide a connection through lan 122 to a host computer 124 or to data equipment operated by an internet service provider ( isp ) 126 . isp 126 in turn provides data communication services through the internet 128 , which , in turn , may provide connectivity to multiple remote computer systems 130 a - 130 n ( any or all of which may be similar to computer system 100 . lan 122 and internet 128 both use electrical , electromagnetic or optical signals which carry digital data streams . computer system 100 can send messages and receive data through the network ( s ), network link 120 and communication interface 118 . fig2 illustrates the same computer system 100 , this time from an architectural standpoint . in this simplified representation , the computer system includes a hardware layer 202 , which is abstracted by an operating system 204 . any conventional operating system may be used . the operating system may be stored in storage device 110 and read into memory 106 when executing . running on top of the operating system are the programs which make up the application layer 206 , including a web browser 208 . as shown , the link monitoring software can be implemented in form of a browser extension or plug - in 210 , or in other cases may be a separate program in application layer 206 . browser plug - ins and extensions are computer implemented processes integrated into a browser environment and which are capable of performing miscellaneous actions in response to user actions within the browser . fig3 illustrates a process 300 that highlights the operations of the link selection monitoring software . every time an user clicks on a link within a browser ( 302 ), an http request is initiated by the browser ( 304 ). the request includes the url of the page which is being requested ( the requested page ), i . e ., the url of the link on which the user clicked . in addition , it includes the url of the page which the user was looking at ( the requesting page ) and on which the requested link exists . the url of the requesting page is specified in the “ referer ” field of the http request initiated by the browser . in other words , a request for the link to page pg i on page pg j will have the http referer field of the header set to the url of page pg j and the requested url will be the url of page pg i . in accordance with the present invention , such a request causes an increase in the count of selections for the link to page pg i on page pg j ( 308 ). this process repeats for each link selection from each page being browsed by the user ( 310 ). that is , the browser extension software on the user &# 39 ; s computer system observes the user &# 39 ; s link selections and initiates actions for updates of counts of such selections on the referer pages . preferably , and in accordance with an embodiment of the present invention , the counters of link selections v ij are distributed in a peer - to - peer network , comprising a distributed file system . such a system 400 , is illustrated in fig4 . each computer 402 a - 402 n is communicatively coupled via one or more networks 404 ( such as the internet ) and can be responsible for handling counters for a set of pages . the name space of urls for all pages is divided among computers 402 a - 402 n using a distributed hash table ( dht ) and each respective counter for a given url is stored at a location determined by the dht . in other instances , the counters of link selections can be stored in a centralized system of computers connected through a local network or a hybrid combination of distributed and centralized systems . for example , the counts of the link selections may be stored at locations determined by arrangement of nodes in a network with a logarithmic network diameter where the time to find any node in the network is a logarithmic function of a size of the network . a hash table is a function that uniformly and , often uniquely , maps strings to a range of numbers . the number to which a hash function maps a given string is called the key for that string . a dht then is a means for partitioning the space of all possible keys among a set of computers connected through a network . one or more of the computer systems 402 a - 402 n may be configured with the link selection monitoring software and each may be configured to perform the data storage and synchronization processes associated with the dht - based distributed file system ( dhtfs ), for example through the use of appropriately coded computer - readable instructions stored on computer - readable media and executed by computer processors associated with each computer system . the dhtfs stores content across the address space defined by the storage devices of computer systems 402 a - 402 n using the dht keys as partitions for that address space . in practice , the number of individual computer systems that make up distributed system 400 may be very large . in accordance with the present invention then , the file system used by distributed system 400 relies on the mappings provided by a dht to partition the storage of content items within the distributed system so that content items ( the count values for the link selections observed by the link selection monitoring software ) are stored at individual ones of computer systems 402 a - 402 n , but are accessible to all such computer systems . the storage and retrieval of content items are facilitated through two principal kinds of messages : the dht put message is used for storing an arbitrary sequence of bytes value under the key key . the dht get message returns the last value stored in the dht under a given key . thus , each increase in count for a counter v ij can be encoded as a dht put request to the hash corresponding to the url of page p j . for instance , such a dht put could be encoded as the second argument encodes a message to increment the counter for pg i . this increment request is automatically routed by the dht to the computer responsible for handling counters for page pg j . creation of replicas of the stored data and synchronization among them is handled by the underlying distributed file system as more fully discussed in a co - pending u . s . patent application entitled , “ dht - based distributed file system for simultaneous use by millions of frequently disconnected , world - wide users ”, ser . no . 12 / 608 , 932 , filed on even date herewith , assigned to the assignee of the present invention and incorporated herein by reference in its entirety . in one embodiment of the invention , the computers in the distributed network compute rank values of all pages by performing a distributed computation and communicating values of probabilities p ij as well as values for intermediate computations . in another embodiment , the individual computers monitoring http requests send information about the observed link selections to a common server , a collection of servers connected through a local network , or a hybrid system consisting of a combination of distributed and centralized systems . the server , or servers , use information received from the individual computers to compute probabilities p ij and compute the rank values as described above . in response to a search request , the rank of each page associated with a result for the request can be read ( e . g ., using a get operation ) and the urls for such pages listed in an order determined by such ranks . such organization may be accomplished at each browser , or at a central server or servers before the results are passed to an individual computer system &# 39 ; s browser . as should be apparent from the foregoing discussion , various embodiments of the present invention may be implemented with the aid of computer - implemented processes or methods ( i . e ., computer programs or routines ) or on any programmable or dedicated hardware implementing digital logic . such processes may be rendered in any computer language including , without limitation , a object oriented programming language , assembly language , markup languages , and the like , as well as object - oriented environments such as the common object request broker architecture ( corba ), java ™ and the like , or on any programmable logic hardware like cpld , fpga and the like . it should also be appreciated that the portions of this detailed description that are presented in terms of computer - implemented processes and symbolic representations of operations on data within a computer memory are in fact the preferred means used by those skilled in the computer science arts to most effectively convey the substance of their work to others skilled in the art . in all instances , the processes performed by the computer system are those requiring physical manipulations of physical quantities . the computer - implemented processes are usually , though not necessarily , embodied the form of electrical or magnetic information ( e . g ., bits ) that is stored ( e . g ., on computer - readable storage media ), transferred ( e . g ., via wired or wireless communication links ), combined , compared and otherwise manipulated . it has proven convenient at times , principally for reasons of common usage , to refer to these signals as bits , values , elements , symbols , keys , numbers or the like . it should be borne in mind , however , that all of these and similar terms are to be associated with the appropriate physical quantities and are merely convenient labels applied to these quantities . unless specifically stated otherwise , it should be appreciated that the use of terms such as processing , computing , calculating , determining , displaying or the like , refer to the action and processes of a computer system , or similar electronic computing device , that manipulates and transforms data represented as physical ( electronic ) quantities within the computer system &# 39 ; s registers , memories and other storage media into other data similarly represented as physical quantities within the computer system memories , registers or other storage media . embodiments of the present invention can be implemented with apparatus to perform the operations described herein . such apparatus may be specially constructed for the required purposes , or may be appropriately programmed , or selectively activated or reconfigured by a computer - readable instructions stored in or on computer - readable storage media ( such as , but not limited to , any type of disk including floppy disks , optical disks , hard disks , cd - roms , and magnetic - optical disks , or read - only memories ( roms ), random access memories ( rams ), erasable roms ( eproms ), electrically erasable roms ( eeproms ), magnetic or optical cards , or any type of media suitable for storing computer - readable instructions ) to perform the operations . of course , the processes presented herein are not restricted to implementation through computer - readable instructions and can be implemented in appropriate circuitry , such as that instantiated in an application specific integrated circuit ( asic ), a programmed field programmable gate array ( fpga ), or the like . thus , methods and systems for determining user - driven page rankings of web pages have been described . although discussed with reference to certain examples , the present invention should not be limited thereby . instead , the invention should be measured only in terms of the claims , which follow . | 6 |
fig1 shows a stand consisting of five vertical square tubes 1 - 5 , which are welded together by twelve iron rails . in this way , a parallelopiped - like skeleton or frame is formed . the lower ends of the four corner posts 2 - 5 are welded together with four iron rails 6 - 9 . in this way , the rectangular basal area of the stand according to fig1 is formed . two iron rails with u - shaped profiles , 6 and 8 , are welded together with two further iron rails 10 and 11 . these two iron rails 10 and 11 are affixed to iron rails 6 and 8 in such a way that the space between these two iron rails 10 and 11 is exactly in the middle of the basal area . this space between the two iron rails 10 and 11 is determined by square tube 1 , which is fixed in the center of the basal area of the stand . at the upper ends of the four corner posts 2 - 5 four iron rails with u - shaped profiles , 12 - 15 , are also attached . these form the upper surface of the parallelopiped - shaped skeleton frame . two iron rails , 12 and 14 , which are above iron rails 6 and 8 , are also connected by two iron rails 16 and 17 , which are above iron rails 10 and 11 . in the space between iron rails 16 and 17 is the upper end of square tube 1 , which is welded to iron rails 16 and 17 . this vertically standing square tube 1 accordingly forms an opening into which tubes with a smaller cross - section can be inserted from above . these tubes are then secured against collapse , as the basal area of the stand forms a safe base for the inserted tube . any sign or signholder can then be affixed to the inserted tube . it is therefore possible to set up a stand according to the invention at any point and to set up a sign at this point simply by inserting a tube in square tube 1 , whereby the tube is affixed to the sign . fig2 shows a square tube 18 , which is closed or terminated on one side by means of an iron plate 19 , which projects along the edges . this square tube 18 has a smaller cross - section than the square tubes 2 - 5 , shown in fig1 which serves as corner posts of the stand . hence , it is possible to insert from below square tubes with welded iron plates , as shown in fig2 into the square tubes 2 - 5 , as shown in fig1 . to one side of each corner post iron plates 20 and 21 have been welded , and the iron plate for each corner post contains at least one threaded hole 22 . if a foot , as shown in fig2 is inserted from below into the corner post 4 , then the square tube 18 in corner post 4 can be held securely at any point or place along its side by means of a screw inserted in threaded hole 22 through iron plate 20 and corner post 4 . it is possible in this way to alter at will the length of the part of the square tube 18 projecting downwardly from corner post 4 . if one carries out this procedure on all four corner posts of the stand , then a foot with the desirable length projects from the lower end of each of the corner posts . in this way , the basal area of the stand shown in fig1 can be adapted at will to the ground beneath the stand . thus , it is possible to set up the stand even when the ground is slanting or uneven . pointed or rounded pins or pegs 43 can be welded to the iron plates 19 ; these pins or pegs 43 enable the foot shown in fig2 to become firmly anchored to the ground underneath . at the two corner posts 3 and 4 , shown in fig1 iron plates 23 and 24 are welded . these iron plates 23 and 24 project somewhat beyond the lower end of corner posts 3 and 4 and serve to dig into the ground when the stand is set up and thus contribute to its stabilization . fig1 furthermore shows holding devices 25 - 28 , which consist of a piece of iron rail with a u - shaped profile . these devices are attached to the corresponding horizontal iron rails 7 , 9 , 13 and 15 . the opening of the u - shaped profile of the holding devices 25 - 28 extends away from the stand . on each side two holding devices , 25 and 26 , and 27 and 28 , are arranged one above the other . all the holding devices are attached in the middle of their respective iron rails ; e . g ., holding device 25 is in the middle of iron rail 13 . these holding devices 25 - 28 form the guide for cantilevers . one such cantilever is shown in fig3 . this cantilever is formed from a flat iron which is welded to form a triangle . side 30 of the triangle extends beyond vertex 31 and forms hook 32 . to stabilize the triangle , a round iron or rod 33 was welded to the two sides 34 and 35 of the triangle . at the vertex formed by the two sides 34 and 35 , there is a square tube 36 , which has been provided with a threaded hole 37 . an iron plate 38 is welded to side 34 . pointed or rounded pegs or pins 44 may be welded to this iron plate 38 to make it possible for the end of the cantilever shown in fig3 to maintain a secure hold to the ground underneath . the cantilever shown in fig3 is placed with side 30 along a side of the stand shown in fig1 ; on this side , there are two of the holding devices 25 - 28 described above . if this cantilever is placed along the side which has holding devices 25 and 26 , then hook 32 is interlocked from below with the u - shaped profile of iron rail 7 . it should be noted that side 30 would be located in the u - shaped profile of holding devices 25 and 26 . in this way , the shifting of the cantilever shown in fig3 is avoided . it is desirable that the holding devices have borehold openings . these boreholes , 29 and 39 , are shown in fig2 as being located on the free sides of the u - shaped profile of the holding device 26 . when a cantilever is located in the u - shaped profile of holding device 26 , a pin can be pushed through the openings 29 and 39 to prevent the cantilever from changing its position . similarly , openings 29 &# 39 ; and 39 &# 39 ;, which are located on holding device 25 , serve to receive such a pin or stop . at the outer end of the cantilever shown in fig3 iron plate 38 is welded to the bottom . this plate 38 serves as the base of the cantilever at its outer point . it is desirable to have this base surface 38 somewhat larger than the base surface formed by the outer end of side 34 . according to a preferred embodiment , there is a square tube 36 with a threaded hole 37 at the outer vertex of the cantilever formed by the intersection of sides 35 and 34 . into this square tube 36 , a foot , as shown in fig2 can be inserted from below if the cross - section of the square tube 18 is smaller than the cross - section of square tube 36 . after this foot has been inserted from below into square tube 36 , square tube 18 can be secured at any place along one of its sides by means of a screw inserted through threaded hole 37 . thus , the length of the part of square tube 18 projecting downwardly can be chosen at will . when a stand as illustrated in fig1 having a cantilever as illustrated in fig3 is set up on an uneven surface , the stand can nevertheless be erected vertically since the inserted foot with its variable length can be adjusted to traverse the distance between the end of the cantilever and the ground surface . in fig1 moreover , two rods , 40 and 41 , are shown connecting the two corner posts 2 and 3 and 4 and 5 , respectively . the rod 41 connecting corner posts 4 and 5 is solidly welded to both of the corner posts , whereas rod 40 is attached in a movable manner to corner posts 2 and 3 . rod 40 can be removed from hook 42 by pushing it upwardly , thus making the interior of the stand accessible . it therefore becomes possible to insert batteries from the front into the interior of the stand shown in fig1 . these batteries may then be placed in their proper position within . when rod 40 has been reattached with its outer end behind hook 42 , the batteries inside the stand are protected against falling out . if the stand is intended to serve as the base element for the erection of a sign that is to be illuminated , then these batteries provide the energy source for the electric light or lights . it is furthermore possible to introduce into the free space in the interior of the parallelopiped - shaped frame bodies ( i . e ., so - called center of gravity bodies ) which serve to increase the stability of the stand according to the invention . such center of gravity bodies may consist of concrete blocks . it is to be understood that , for illustrative purposes only , the elements of the stand according to the present invention have been described as being of iron . it is understood that other metals ( e . g ., aluminum , steel , etc .) or nonmetals ( e . g ., fiberglass ) could also be substituted . similarly , other cross - sectional shapes could be substituted for the square cross - sectional shapes described above . | 4 |
various embodiments and aspects of the disclosure will be described with reference to details discussed below . the following description and drawings are illustrative of the disclosure and are not to be construed as limiting the disclosure . the drawings are not necessarily to scale . numerous specific details are described to provide a thorough understanding of various embodiments of the present disclosure . however , in certain instances , well - known or conventional details are not described in order to provide a concise discussion of embodiments of the present disclosure . as used herein , the terms , “ comprises ” and “ comprising ” are to be construed as being inclusive and open ended , and not exclusive . specifically , when used in this specification including claims , the terms , “ comprises ” and “ comprising ” and variations thereof mean the specified features , steps or components are included . these terms are not to be interpreted to exclude the presence of other features , steps or components . as used herein , the term “ exemplary ” means “ serving as an example , instance , or illustration ,” and should not be construed as preferred or advantageous over other configurations disclosed herein . as used herein , the terms “ about ” and “ approximately ”, when used in conjunction with ranges of dimensions of particles , compositions of mixtures or other physical properties or characteristics , are meant to cover slight variations that may exist in the upper and lower limits of the ranges of dimensions so as to not exclude embodiments where on average most of the dimensions are satisfied but where statistically dimensions may exist outside this region . it is not the intention to exclude embodiments such as these from the present disclosure . as used herein , the phrase “ rigidized ” refers to a joint , union or contact between two items where a predetermined amount of stiffness has been achieved between the two items . the term “ rigidizing ” refers to the process of achieving this condition . the capture device disclosed herein has been conceived to address two types of spacecraft / space object capture . in general , it is for capturing “ non - prepared ” objects . this refers to a class of client spacecraft which were not designed with purpose - made features that would be used for later capture by a servicing spacecraft once the client spacecraft was in orbit . the capture device has been designed to capture through a grasping action of natural features like launch adapter rings which are present on most spacecraft for the purposes of attachment to the launch vehicle prior to release on - orbit . other natural features such as rails would also be applicable . a secondary feature of these non - prepared spacecraft for which this proposed capture device is intended is non - cooperative spacecraft . these are client spacecraft which are no longer under standard attitude control with the spacecraft no longer held in a stable attitude , but are instead are tumbling , i . e . rotating in one or more axis with respect to their desired pointing direction . in non - tumbling capture , the rendezvousing servicer spacecraft generally is moving relative to the client on a single axis of motion . in capturing a tumbling spacecraft , the servicer spacecraft and / or its manipulator arm must close the separation between it and the client in a number of axes . this puts a premium on the capture device being able to quickly grasp the tumbling spacecraft in what is a much narrower capture zone time , generally limited by the responsiveness of the spacecraft attitude and orbital control system and the responsiveness and peak rates of the manipulator arm . the pool of viable clients will increase with the capture mechanism &# 39 ; s ability to more quickly capture a mechanical feature on the client over a larger range of relative motion . in addition , the spacecraft carrying the capture mechanism will not have to control its own position as precisely , which will result in less propellant being needed and less complex avionics being required resulting in lower overall mission costs . this premium on quickly grasping the client which is potentially tumbling presents a challenge for typical robotic grippers . they first must quickly close trapping or soft capturing the mechanical feature , and then very quickly produce a sufficiently high applied gripping load to ensure that the captured spacecraft remains grasped while resisting the forces and moments that develop at the interface as the servicer spacecraft and manipulator arrest the relative motion of the client . this presents a challenge for typical single action gripping devices which generally use some sort of gearing or transmission in the clamping action . in space systems , this gearing is needed because there is a need for lightweight actuators . as the gearing is increased to compensate for the low torque of the actuator , the penalty is a lower closure rate . this design trade - off in single action robotic grippers is a primary motivation for the two - stage , capture device disclosed . as discussed above , the spacecraft being captured are generally moving relative to one another and the physical grasping of one spacecraft by another is a principle method of cancelling out the relative motions between the two spacecraft . once a rigid grasp has been obtained upon the client spacecraft it is then necessary that the grasp between the two spacecraft be strong enough to absorb the forces and moment generated as the disparate motions between the two spacecraft are absorbed by the positioning mechanism and capture mechanisms now connecting the vehicles . even with small relative motions between spacecraft , significant forces can be generated at the grasp points and within the capture mechanism . spreading out the stance of the grasp reduces many of the internal forces permitting the mechanism to be lighter and achieve a better grasp with lower forces . broadly speaking , there is disclosed herein a system for capturing a rail and or flange feature ( herein all referred to as a “ capture feature ”) on a free flying spacecraft . the system includes a capture mechanism which includes what may be characterized as a quick grasp mechanism mounted for movement in a housing with the quick grasp mechanism including at least one pair of grasping jaws . the quick grasp mechanism is configured to grasp the capture feature when the capture feature is in sufficiently close proximity , the trigger mechanism is initiated causing the the at least one pair of grasping jaws to quickly close to soft capture the capture feature . the capture mechanism includes an opening / closing mechanism which force the grasping jaws of the quick grasp mechanism further together to a closed position . the capture mechanism also includes a rigidizing contact . after the grasping jaws have been quickly closed to soft capture the capture feature , the rigidizing contact is driven into contact with the capture feature within the grasping jaws to secure the capture feature between the rigidizing contact and the closed grasping jaws , thereby to rigidize the capture feature and hence spacecraft within the capture mechanism . this embodiment of the capture mechanism tool is comprised of the following parts : the structure of the capture mechanism will first be described and particular reference is made to a feature on most spacecraft named a marman flange which is used as a launch adapter ring between the launching booster and the client spacecraft but it will be understood the present capture mechanism can be configured to capture any available similar feature on a spacecraft not necessarily intended to be grasped . referring to fig3 and 36 , using known methods not part of this disclosure the servicer spacecraft 500 approaches the client spacecraft 503 and manoeuvres within the reach of the robotic arm 501 attached to the client spacecraft 500 . the robotic arm 501 manoeuvres the capture device to within a prescribed distance from the launch adapter ring 502 on the client spacecraft 503 either by autonomous control from the computer system 600 or with partial or full control by human operators located either on the servicer spacecraft or at a remote location . once the capture mechanism 100 is at the prescribed distance , the computer system 600 assumes automatic control of the final grasping and rigidisation actions . providing position information to the computer system 600 , the vision system 602 receives input from the cameras 150 within the mechanism as well as other sensors on the servicer spacecraft 500 . the computer system 600 uses these inputs to calculate requited motions needed to manoeuvre the robotic arm 501 and the capture mechanism 100 into the final positions near the launch adapter ring 502 while tracking any motions of the client spacecraft 503 . at the proper moment , the computer system 600 directs the robotic arm 501 to advance the capture mechanism 100 into contact with the launch adapter ring 502 . it will be appreciated that if the servicer spacecraft is particularly maneuverable , an arm may not be required or needed at all and the spacecraft attitude and orbital control system ( aocs ) could be used to manoeuvre the capture tool 100 into the proper relative position with respect to the client spacecraft launch adapter ring 502 . fig1 shows a perspective view of the capture mechanism 100 of the present invention in the open position as if approaching a bracket such as a rail and or a flange feature on a free flying spacecraft , or any other part that can be grasped , collectively referred to as a capture feature located on a free flying spacecraft to be captured . fig2 is a side view of the capture mechanism of fig1 in the open position . fig3 shows a perspective view of the capture mechanism 100 of fig1 but from a different perspective than shown in fig1 . fig4 is a perspective view similar to fig1 but with a capture feature ( in this case a bracket , rail or launch adapter ring 502 located on the free flying spacecraft ) being grasped by two clamp jaw assemblies 200 forming part of the capture mechanism 100 , which is shown in the closed position . while fig1 , 3 and 4 show a pair of clamp jaw assemblies 200 pivotally mounted on the main housing 110 , it will be appreciated that the capture mechanism 100 may have only one clamp jaw assembly 200 or may have more than two clamp jaw assemblies 200 . as best seen in fig1 and 4 , forward and rear light sources 154 and 155 respectively are mounted on one end of a light curtain support 153 and produce front and rear light beams 300 and 301 respectively . front and rear detectors 156 and 157 are mounted on the other end of light curtain support 153 and located to receive the beams 300 and 301 respectively . the light sources 154 and 155 and their associated detectors 156 and 157 are positioned on light curtain supports 153 with respect to the clamp jaw assemblies 200 so that when capture feature 502 on the free flying spacecraft is in close proximity to the clamp jaw assemblies 200 the beams of light 300 and 301 are broken which triggers the clamp jaw assembly 200 to close around capture feature 502 , discussed in more detail below . the collection of light sources and receivers and the appropriate circuitry ( including in this embodiment the computer 600 ) comprise the optical initiator . each clamp jaw assembly 200 includes a variable jaw assembly 210 pivotally mounted with respect to a locking jaw assembly 230 which will be discussed in great detail hereinafter . fig5 is a partial cross sectional view of the clamp jaw assembly 200 in the open position taken along line 5 - 5 of fig8 . the combination of the local shape of the jaw cam surfaces 302 and the location of the cam rollers 248 allow the variable jaw assembly 210 and the locking jaw assembly 230 , rotating about hinge pins 204 to be biased apart by the jaw hinge springs 207 . fig6 is a partial cross sectional view of the capture mechanism in the closed and locked position taken along line 5 - 5 of fig8 except the jaws are in the closed position . in this view the cam follower assembly 240 has been moved forward ( to the left in the figure ) and as the cam rollers 248 move along the contours of the jaw cam surfaces 302 , they force the variable jaw assembly 210 and the locking jaw assembly 230 together against the forces of the jaw hinge springs 207 ( see also fig5 ). the capture feature 502 has been pressed down into the contact plunger 217 compressing the contact spring 218 which is within the spring housing 219 . at the same time , the contact feature 246 has been pressed into the face of the capture flange 502 compressing the contact spring 245 contained within the contact housing 247 . the combination of compressed spring 245 and compressed contract spring 218 act together to hold the capture flange 502 against the fixed elements of the clamp jaw assembly 200 with the desired level of security or contact stiffness . the cam follower assembly 240 has advanced to its furthest forward limit and the lock roller 252 has forced the lock 235 inwards against the capture feature 502 thereby mechanically securing the capture flange 502 in place . fig7 is a top view of the capture mechanism 100 taken along arrow 7 of fig2 . this view shows how the shuttle 114 is linked to the draw bars 116 which are flexibly connected to associated contact shafts 242 that serve to advance their associated cam follower assemblies 240 . fig8 is a view of the front of the capture mechanism 100 with the clamping jaw assemblies 200 in the open position and illustrates the relative positions of the cameras 150 , line - producing lasers 151 and the clamp jaw assemblies 200 . it also shows how the situational camera assembly 152 can be positioned to oversee the operation of the capture mechanism 100 . fig9 is a view of the back of the capture mechanism 100 with the clamping jaw assemblies 200 in the open position . fig1 is a section view of the capture mechanism taken along the line 10 - 10 in fig9 and shows how the guide shaft bearings 112 and guide shaft bearing spacer 113 act to support the guide shaft 111 . it also shows how the shuttle 114 is connected to the draw bars 116 . fig1 is a perspective view of the cross sectional view in fig1 . it shows how the plunger springs 171 acts upon the spring housings 172 and the plungers 170 to force the draw bars 116 forward . the spring housings 172 are attached to the main housing 110 . fig1 is a close up of fig1 with gearbox cover 183 removed showing the arrangement of gears 184 , 185 and 186 that transmit torque from the actuator 180 to the ball screw shaft 120 . fig1 is a close up of the trigger mechanism in the armed condition with several structural elements of the capture mechanism not shown for clarity . fig1 is a repeat of fig1 except showing a partial cross section of the trigger reset pawl 135 and how it is mounted to the trigger reset lever 136 and how the trigger reset pawl relates to the trigger pawl surface 304 on the trigger bar support 131 . it also shows how the trigger bar 130 sits within the trigger bar support 131 and how the sear 141 is biased by the sear spring 139 acting upon the spring retaining pin 138 . fig1 is a repeat of fig1 except showing a further partial cross section of the trigger reset arrangement showing how , when the trigger reset lever 136 is rotated when the trigger pawl surface 304 moves the trigger reset pawl 135 it causes the sear reset rod 143 to rotate the sear 141 . it also shows how the motion of the trigger reset lever 135 is limited in the aft direction by the trigger lever stop 147 and how the motion of the trigger bar 130 is restrained by the contact with the sear 141 along the trigger bar surface 307 . fig1 is a repeat of fig1 except showing a further partial cross section of the trigger mechanism showing how the trigger bar 130 rests upon the sear 141 and how the trigger roller 145 holds the sear 141 in place . fig1 is a close up of the solenoid 160 and how it interacts with the trigger mechanism with the reciprocating motion of the solenoid 160 being transmitted and the force amplified by the solenoid lever 162 which forces the trigger striker 165 into contact with the trigger 140 forcing it to rotate . fig1 is a sectional view through the lines 18 - 18 in fig9 showing the guide shaft 111 , shuttle 114 , and how the ball screw shaft 120 interacts with the shuttle 114 via the ball screw nut 124 and shock absorber mount plate 126 to force the shuttle 114 and therefore the draw bars 116 and the contact shaft 242 forwards . fig1 a to 19e are partial sectional views similar to fig5 illustrating the bracket 502 capture sequence when viewed in alphabetical order . fig1 a shows the capture mechanism 200 at the moment the trigger 140 is struck and the sear 141 is free to rotate releasing the trigger bar 130 allowing the shuttle 114 to move . fig1 b shows the jaw assembly 200 closed to the soft capture position just as the rigidisation starts . the plunger springs 171 are at minimum compression and , via the plungers 170 , have driven the draw bars 116 and contact shafts 242 as far forward as they can . fig1 c shows the cam follower assembly 240 having been pushed further forward by the action of the ball screw shaft 120 on the ball screw nut 124 with the bracket 502 fully captured and seated within the jaws 210 and 230 but without any preload applied , fig1 d shows the clamp jaw assembly 200 fully preloaded with the forward motion of the cam rollers 248 forcing the jaw cam surfaces 302 together forcing the bracket 502 into the contact plunger 217 and the contact 246 . this motion is resisted by spring 216 and contact spring 245 creating a connection of known rigidity between the bracket 502 and the capture mechanism 100 . fig1 e shows the cam follower assembly 240 even further forward where the lock roller 252 has pushed the optional lock 235 into position against the bracket 502 to restrain the bracket 502 within the jaws 210 and 230 . fig2 is a partial sectional view along the line 21 - 21 of fig2 showing the installation of the shock absorbers 125 attached to the shock absorber mount plate 126 which is then attached to the nut plate 127 capturing the ball screw nut 124 between them . the three assembled items 125 , 126 and 127 are then free to move within the ball screw nut slot 308 in the shuttle 114 . fig2 is a partial exploded view of the main housing 110 showing installation of the shaft 111 and ball screw 120 . the shock absorbers 125 are attached to the shock absorber mount plate 126 which is then attached to the nut plate 127 capturing the ball screw nut 124 between them . the shuttle 114 moves back and forth guided by the guide shaft 111 with friction being reduced by the guide shaft bearings 112 that are spaced appropriately by the guide shaft bearing spacer 113 . the ball screw shaft 120 is secured to the main housing 110 by the ball screw thrust bearing 121 and stabilised by the ball screw tail bearing 122 which is secured by the bearing cover 123 . fig2 shows details of the shuttle 114 , the trigger bar 130 and the trigger bar supports 131 that secure the trigger bar 130 to the shuttle 114 . the ball screw nut slot 308 is sized such that with the ball screw nut 124 in the ready - to - latch position as shown in fig2 , the free play in the slot permits the shuttle 114 to advance very rapidly under the influence of the plunger springs 171 without requiring the ball screw shaft 120 to rotate . this permits the rapid soft capture action of the capture mechanism 100 . fig2 shows details of the trigger mechanism . the trigger mechanism is comprised of three parts , the trigger reset lever 136 , the sear 141 and the trigger 140 all mounted such that they are free to rotate and yet biased into preferred positions by the trigger lever return spring 146 , the sear spring 139 and the trigger spring 142 , respectively . the trigger reset pawl 135 transmits motion from the trigger bar support 131 to the trigger reset lever 136 , which then moves the trigger reset rod 143 which rotates the sear 141 out of the way permitting the trigger 140 to return to the armed position driven by the trigger spring 140 . fig2 is a partial exploded view showing the optical elements of the vision system 602 showing the positions of the cameras 150 , and the line - producing lasers 151 mounted on the main housing 110 . fig2 showing details of the trigger - actuating solenoid subassembly . the solenoid 161 , mounted to the solenoid mounting plate 160 , acts when commanded by the computing system 600 . the shaft of the solenoid retracts into the body of the solenoid 161 when activated , which causes the solenoid lever 162 to rotate . this solenoid lever 162 is connected to the solenoid 161 by the solenoid pin 163 and to the solenoid mounting plate 160 by the lever pin 164 . the trigger striker 165 is mounted to the solenoid lever 162 such that it forces the trigger 140 to rotate sufficiently to activate the capture mechanism 100 . fig2 is a partial exploded view showing installation of the shuttle plungers 170 . microswitches 117 are mounted to the main housing 110 such that as they open or close , they provide desired information on the location of the shuttle 114 to the computer system 600 . guide shaft retainer 115 secures the guide shaft 111 to the main housing 110 . the plungers 170 are free to move reciprocally within the spring housings 172 which are secured to the main housing 110 . the forward end of the plungers 170 butt against the aft face of the draw bars 116 ( not shown ). the aft motion of the plungers 170 is constrained by the plunger springs 171 , which in the armed condition , are compressed sufficiently to propel the plungers 170 forward forcing the draw bars 116 and cam roller assemblies 240 to complete the soft capture action . the plungers 170 are contained within the spring housings 172 by the retainer nuts 173 . fig2 shows details of the actuator 180 and associated gearing . the actuator 180 is secured to the motor output gear 184 which rotates the idler gear 185 , secured by the idler axle 181 to the actuator mounting 182 which is attached to the main housing 110 . the idler gear 185 rotates the ball screw input gear 186 which is secured to the ball nut shaft 120 rotating the ball nut shaft 120 and transmitting the actuator 180 torque to the ball nut shaft 120 . fig2 shows how the draw bars 116 assemble into the shuttle 114 and how the plungers 170 interfaces with the draw bars 114 . it also shows the relationship between the stereo pair of cameras 150 , situational cameras 152 , the solenoid mounting plate 160 , the microswitches 117 and the main housing 110 . fig2 is an exploded view showing details of the clamp jaw assembly 200 . the variable jaw assembly 210 and the locking jaw assembly 230 are flexibly mounted to the clamp housing 201 by hinge pins 204 and biased to a preferred position by jaw hinge springs 207 . bearing cover plate 202 secures the clamp housing bearing 202 to the clamp jaw assembly 200 . the cam rollers 248 and lock roller 252 are secured to the cam follower assembly 240 but free to rotate by the roller axles 250 and located by the spacers 249 . the links 251 maintain the correct spacing between the cam rollers 248 when under load during the rigidising action . the jaw bearing plate 205 , in conjunction with the clamp housing bearing 203 , permits the clamp jaw assembly 200 to rotate with respect to the main housing 110 while being axially and laterally supported in the main housing 110 . the journal bearing 206 permits the cam follower assembly to move axially with respect to the rest of the clamp jaw assembly 200 . fig3 showing details of the variable clamp jaw assembly 210 . the clamp hinge plate 212 is secured to the jaw hinge 211 . the spring mounts 213 permit jaw hinge springs 207 ( not shown ) to be mounted to the assembly . the variable jaw 214 is attached to the clamp hinge plate 212 by the clamp hinge pin 215 , but is free to rotate . the position of the variable jaw 214 is biased to a preferred position by the spring 216 . the contact plungers 217 are secured to the spring housing 219 by the plunger retaining nuts 220 such that they may move axially and trap the contact springs 218 . the spring housings 219 are attached to the variable jaws 214 by the plunger mounting plate 221 . fig3 shows details of how the clamp jaw assembly 200 is free to move within the main housing 110 . the jaw bearing plate 205 is fastened to the main housing 110 which , in concert with the clamp housing bearing 203 permits the clamp jaw assembly 200 to rotate with respect to the main housing 110 . the contact shaft 242 is secured to the draw bar 116 using the clamp retainer 261 . the compliance spring 260 and the journal bearing 262 permit the draw bar 116 to move axially with respect to the clamp jaw assembly 200 reducing the chances of damage at the end of draw bar 116 travel . fig3 shows details of the mechanism that restrains rotary motion of the clamp jaw assembly 200 . with the brackets 281 secured to the main housing 110 , the torque rod 284 is placed with a slot in the bracket 281 . a spring 283 is placed over each end of the torque rod 284 such that the bracket 281 is sandwiched between them . the springs 283 are secured by a rod retainer nut 285 on the interior end and by a link 282 on the external end . the hole in the link 282 is secured to a clevis in the clamp housing 201 by a link pin 286 and a link pin nut 287 . the torque rod 284 is free to move within the slot in the bracket 281 yet is centred by the opposing actions of the springs 283 thus centring the position of the clamp jaw assembly 200 with respect to the main housing 110 . fig3 shows details of the cam follower assembly 240 . the contact shaft 242 is attached to the housing 241 by the shaft retaining nut 244 . the contact housing 247 is fastened to the housing 241 permitting the contact 246 to move axially within it constrained by the contact spring 245 . guide pins 243 are fastened to the housing 241 and engage axial slots on the clamp housing 201 to prevent the cam follower assembly 240 from rotating about the axis of the clamp shaft 242 while permitting it to move freely axially with respect to the clamp housing 201 . fig3 showing details of the locking jaw assembly 230 . the clamp plate 233 is secured to the jaw hinge 231 . the spring mounts 213 permit jaw hinge springs 207 to be mounted to the assembly . the lack 235 is attached to the clamp plate 233 by the lock hinge pin 234 , but is free to rotate . the position of the lock 235 is biased to a preferred position by the lock spring 236 . contact rods 232 are secured to the clamp plate 233 and the jaw hinge 231 and provides a hard contact surface that the feature 502 can abut to . fig3 is an overall view of an alternate embodiment of the tool 900 that has been fitted with a mechanical trigger for the mechanism in addition to the solenoid trigger method shown in fig1 and 17 . in this embodiment a pusher plate 650 has been arranged such that it is a back - up activating method and thus is not engaged unless the electronic triggering method fails . it will be understood that should it be required , this arrangement can be reversed so that the mechanical trigger is the primary method and the electronic triggering method is the back - up method . the pusher plate 650 is connected to a rod 653 that transmits the contact force via the trigger pin 670 to the trigger 140 ( best seen in fig3 ). the rod 653 is supported at the front by support 652 and at the rear by bushing block 656 which is fastened to the main housing 110 . the rod 653 is guided by bushings 651 and terminates in a pin support 671 . fig3 is a sectional view taken in the same plane as the section for fig1 as shown in fig9 . it shows how the pusher plate 650 is connected by rod 653 to the trigger pin 670 which then contacts the trigger 140 . the motion of the pusher plate 650 and rod 653 are controlled by spring 655 , the effect of which is adjusted by securing collar 654 at various points along the rod 653 . a second collar 654 prevents the rod 653 from extending too far out of the tool 900 . depending upon the final purpose to which the tool 900 will be put , the adjustability of the securing collar 654 may be limited to establishing the correct performance of the tool 900 by being adjusted only during manufacture or , in an alternate embodiment not shown , by the use of an additional actuator ( s ) to vary the position of the securing collar 654 on the rod 653 thus varying the performance of the spring 655 and the performance of the mechanical triggering portion of the tool 900 as a whole . a slot 658 in rod 653 is engaged by a pin 657 that is secured within the bushing block 656 and keeps the trigger pin 670 properly aligned by preventing the rod 653 from rotating around its long axis . fig3 is a detailed view showing how the trigger pin 670 acts in parallel with and independently of the trigger striker 165 to contact the trigger 140 and release the sear 141 to activate the mechanism . aftward motion of the rod 653 forces the trigger pin 670 against the surface of trigger 140 . pin support 671 is threaded for trigger pin 670 and the exact timing of when the trigger pin 670 strikes the trigger 140 is set by advancing or retarding the position of the trigger pin 670 within the pin support 671 . an alternate embodiment of the tool , as shown generally at 940 in fig4 , includes a shock absorber system to reduce the internal forces generated by the powerful plunger spring 171 when the mechanism is activated . these forces can cause damage to tool or impose shock loads on the servicer spacecraft 500 or the client spacecraft 503 . fig4 is an overall view of the alternate embodiment of the tool 940 fitted with a shock absorber system 702 showing the general arrangement from the back of the tool . when the mechanism is activated the draw bars 116 are forced forward by the plunger springs 171 acting upon the plungers 170 . in this embodiment the plungers 171 are connected together by the connector plate 700 which transfers some of the plunger spring 171 forces to the shock absorbers 702 through the pistons 701 ( best seen in fig4 ). the shock absorbers 702 slow the motion of the draw bars 116 and reduce the internal forces acting upon the housing 110 to decelerate the mechanism at the end of its stroke . the drag caused by the shock absorbers 702 and the spacing 707 ( shown in fig4 ) between the connector plate 700 and the pistons 701 can be varied to fine tune the timing and forces required by the tool 100 to perform successfully . fig4 is a section showing the arrangement of the shock absorber system taken along the line 42 - 42 of fig9 . the shock absorber 702 is secured to the housing 110 by mounting plate 704 . both mounting plate 704 and the exterior of the shock absorbers 702 are threaded such that the axial position of the shock absorber 702 can be varied to set the spacing 707 . once located correctly , nut 703 is tightened securing the shock absorber 702 in the correct position . bumper 706 acts to spread the load from plunger 170 to the draw bars 116 . an additional alternate embodiment of the tool 980 equipped with a jaw adjustment mechanism 800 for altering the angular position , also known as the pose , of the clamp jaw assemblies 200 is shown in fig4 . the jaw adjustment system 800 both coordinates the motion of the two clamp jaw assemblies 200 and allows the clamp jaw assemblies 200 to be adjusted to capture launch adapter rings 502 , or other features , of varying diameters . the jaw adjustment system 800 also incorporates features that provide compliance to the individual clamp jaw assemblies 200 to accommodate small misalignments and client satellite 503 movements . the coordinated motion function is accomplished by the combination of components , drive gear 809 , idler gear 805 and bell crank 807 . a rotational input , in this case affected by the linear actuator 801 , to one clamp jaw assembly 200 ( the left side , for example ) will cause the clamp jaw assembly 200 to rotate about the clamp housing bearing 203 ( best seen in fig5 ). this will move the arm securing the link 282 ( best seen in fig3 ) or jaw compliance mechanism 810 to the link pin 286 . the jaw compliance mechanisms 810 are free to rotate about either the link pin 286 or the pin 806 at either end . movement of the jaw compliance mechanism 810 moves the moment arm 803 connected to the idler 805 . rotation of the idler 805 rotates the drive gear 804 , but in the opposite direction , which then moves the connected moment arm 803 . that moment arm 803 is connected to the shaft 802 and the linear actuator 801 each of which has a pin that is free to rotate at the end . for embodiments where varying the nominal capture radius of the tool is unnecessary , the linear actuator 801 and shaft 802 may be replaced with a single rigid component fitted with free rotating pins on either end ( not shown in this embodiment ). rigid motion of the linear actuator 801 causes the bell crank 807 to rotate about axle 809 causing the second jaw compliance mechanism or link to be rotated and then transfer the rotation to the sending clamp jaw assembly 200 , but with an opposite and coordinated rotation . fig4 is a detail view showing how a linear actuator 801 is integrated within the jaw adjustment system 800 of fig4 . when it is desired to vary the radius of curvature that the clamp jaw assemblies 200 can accommodate the linear actuator 801 can extend or contract the shaft 802 . as configured in fig4 , extending the shaft 802 will enable the clamp jaw assemblies 200 to grasp a smaller radius feature through the motion of the gears 804 and 805 , bell crank 807 and compliance mechanisms 810 as described above . retracting the shaft 802 will enable the clamp jaw mechanisms to grasp a larger radius feature , adjusting their pose or rotational position relative to their link pin axes 286 on the main housing 110 . the axles 809 are mounted rigidly to the bracket 808 which is rigidly mounted to the housing 110 . different arrangements of gears 804 and 805 and bell cranks 807 can be created to change the motion parameters of the system . in addition , as an alternate method of adjusting the grasp radius , the linear actuator 801 can be replaced by a rigid shaft and a rotary actuator or motor connected rigidly to the axle 809 of either gear 804 or 805 . fig4 is a detail that shows how the jaw compliance mechanism 810 ( fig4 ) is integrated within the jaw adjustment system 800 ( fig4 ). undesirable motion variances of the individual clamp jaw assemblies 200 can be accommodated through the introduction of compliance between the two clamp jaw assemblies 200 and between the two clamp jaw assemblies 200 and any actuator 801 used to adjust the nominal clamping radius of curvature . an un - commanded motion of the clamp housing 201 will apply a force on one end of the housing 811 of the jaw compliance mechanism 810 through link pin 286 . springs 814 within the jaw compliance mechanism 810 ( see fig4 ) permit the exterior components of the jaw compliance mechanism 810 to move relative to the compliance shaft 813 which is connected to the rest of the jaw adjustment system 800 . the strength and configuration of the springs 814 within the jaw compliance mechanism 810 determine the compliance performance of the jaw compliance mechanism 810 . fig4 is a section through the jaw compliance mechanism 810 . in this example , the jaw compliance mechanism consists of housing 811 connected by a link pin 286 to the clamp housing 201 part of the clamp jaw assembly 200 . the parts internal to the jaw compliance mechanism 810 are secured by a cap 812 . the housing 811 contains a piston 813 with a central stop 815 and springs 814 that act upon the central stop and upon the housing 811 at one end and upon the cap 812 on the other end . the opposing springs 814 act to centralise the piston 813 , returning the mechanism to a preset neutral position if perturbed . the details of each spring 814 may be varied to provide specified piston performance to suit the desired overall requirements of the tool . in addition , a damping element , not shown in this embodiment , may be added to the mechanism to further customise its performance . piston 813 is then connected to the rest of the jaw adjustment system 800 through pin 806 connected to moment arm 803 . an alternate embodiment , not shown , may omit the actuator 801 and any linkage between the bell crank 807 and the idler gear 805 and add actuators to drive the bell crank 807 and idler gear 805 independently of one another . this would further increase the capability of the tool 980 to grasp capture features of varying shapes . it will be understood that the alternate embodiments described above may be incorporated in the tool 100 of fig1 singly or in any combination depending upon the demands of the purpose for which the tool 100 is being used . the exact alternate embodiments described above are also exemplary , there being other arrangements of mechanical triggers , shock absorbers and actuators that will perform the same functions as those listed above . the operation of clamping mechanism 100 of fig1 will now be described but it will be understood that this description applies also to the embodiments shown in fig3 to 46 , noting that the operation of the additional features shown in these figures have been largely described above . in operation , referring to fig1 and 4 , when the launch adapter ring 502 breaks the forward light beam 300 formed between the forward light 154 and the forward receiver 156 a signal is sent to and interpreted by the computer system 600 . any differences in the signals sent by the forward receivers 156 on each clamp jaw assembly 200 ( shown in more detail in fig2 ) are interpreted as errors by the computer system 600 and may be used , as part of a broader control system , to correct the position of the capture mechanism 100 in real time . the capture mechanism 100 continues to be advanced over the launch adapter ring 502 until the aft light beams 301 formed by the aft lights 155 and the aft receivers 157 are broken by the launch adapter ring 502 . if the two forward light beams 302 remain broken and at least one of the aft light beams 301 is broken , the capture mechanism is configured to be in an acceptable position to grasp the launch adapter ring 502 . this prompts the optical initator &# 39 ; s activation of the trigger 140 whereby the computer system 600 generates a signal that causes the solenoid 161 ( fig1 ) to activate , causing the solenoid lever 162 ( fig1 and 25 ) to rotate and forcing the trigger striker 165 to contact the trigger 140 causing it to rotate . fig2 shows an exploded view of the solenoid assembly which includes solenoid 161 , solenoid lever 162 , trigger striker 165 , a lever pin 164 , solenoid pin 163 and solenoid mounting plate 160 . an alternate embodiment to initiating the motion of the trigger 140 would be to introduce a mechanical initiator that is activated by physical contact of the capture mechanism with the launch adapter ring 502 or other bracket to be grasped . this mechanical initiator would include a contact rod secured to the main housing 110 in such a way that the contact force as the rod strikes the client bracket is transmitted directly to the trigger 140 . the use of sliding bearings , bell cranks and other methods of mechanical force transmission well known in the art , permit the location of the contact rod to be optimised to the client bracket and the design of the rest of the capture mechanism 100 . this mechanical contact means of initiating the trigger 140 could be the primary trigger initiation method or act as a secondary or back - up to the electromechanical trigger initiation method . a second alternative embodiment for initiating the rotation of the trigger 140 would involve replacing the optical light curtain with inductive sensing means which detected when the launch adapter ring 502 is sufficiently aligned over the inductive sensors . once the trigger 140 rotates , the trigger roller 145 ( fig1 , 14 , 15 and 17 ) rolls up the face of the sear 141 , the trigger roller 145 acting to reduce friction and ensuring a smooth and repeatable release . fig2 is a partial exploded view showing installation of the shuttle plungers 170 . referring to fig1 and 26 , the plunger springs 171 and plungers 170 push against the draw bars 116 attached to the shuttle 114 and apply a force that attempts to move the shuttle 114 forward . the sear 141 is in contact with the trigger bar 130 ( fig1 ) attached to the shuttle 114 preventing the shuttle 114 from moving forward . see fig1 , 14 , 15 and 16 that illustrate how the trigger 140 and sear 141 resist the motion of the trigger bar 130 . when the trigger roller 145 has moved far enough that it no longer restricts the rotation of the sear 141 , the sear 141 is rotated by the forces generated by the plunger springs 171 and the shuttle 114 and draw bars 116 are free to move forward very quickly . referring to fig1 , as the shuttle 114 moves forward it is guided by sliding on the guide shaft 111 , friction being reduced by the use of the guide shaft bearings 112 , appropriately spaced by the guide shaft bearing spacer 113 . should the capture mechanism 100 be triggered in error or fail to capture the client spacecraft 503 the shuttle 114 may continue too far forward striking the ball screw nut 124 ( fig9 ). to prevent damage in such a condition , the ball screw nut 124 is fitted with two shock absorbers 125 that will absorb the impact of the shuttle 114 from a failed capture . referring to fig1 a and 33 , the forward motion of the draw bars 116 also forces the cam follower assembly 240 forward . the cam follower 240 assembly is connected to the main housing 110 by journal bearings 206 and 262 ( fig2 and 31 ) that restrict lateral movement but permit rotational and axial movement and by a compliance spring 260 that prevents damage at the extremes of motion which is contained by the clamp retainer 261 which is bolted to the main housing 110 . fig1 a shows the configuration of the clamp jaw assembly 200 at the instant the shuttle 114 begins to move . the launch adapter ring 502 is in the correct position to be grasped . as the cam follower assembly 240 moves forward the cam rollers 248 move along a predetermined jaw cam surface 302 ( fig5 ) and force the variable jaw assembly 210 and the locking jaw assembly 230 closer towards each other overcoming the biasing effect of the jaw hinge springs 207 . fig1 b shows the clamp jaw assembly 200 at the end of the plunger spring 171 stroke with the variable jaw assembly 210 and the locking jaw assembly 230 closed sufficiently such that the launch adapter ring 502 cannot escape , yet there is no actual contact with the launch adapter ring 502 . the launch adapter ring 502 is now considered “ soft captured ” and the first , automatic step of the two - step capture is complete . referring to fig1 , 11 , 26 , 27 and 28 , microswitches 117 ( fig1 ) within the capture mechanism 100 are closed as the shuttle 114 passes by them providing a signal to the computer system 600 that soft capture has been achieved . the computer system 100 then commands the actuator 180 to rotate such that the torque is transmitted from the motor output gear 184 through the idler 185 and to the ball screw input gear 186 causing the ball screw 120 to rotate . the ball screw 120 rotates within and is connected to the main housing 110 by the ball screw thrust bearing 121 and the ball screw tail bearing 122 ( fig2 ). as shown in fig2 , ball screw 120 also rotates within the ball nut 124 which is fixed within the shuttle 114 by the shock absorber mount plate 126 and the nut plate 127 . because the ball nut 124 is constrained from rotating within the shuttle 114 , the actuator 180 torque results in an axial force on the shuttle 114 forcing the shuttle to continue to move forward also driving the two cam follower assemblies 240 further forward . during the rotation of actuator 180 during the capture sequence , the rotation location of the actuator shaft may be continuously monitored and stored in the computer 600 . alternatively , calibration during assembly will reveal the number of rotations of the actuator shaft of actuator 180 required to perform the capture sequence and hence the reset sequence . as the cam follower assembly 240 moves further forward , the shape of the jaw cam surfaces 302 forces the variable jaw assembly 210 and the lock jaw assembly 230 closer together , as shown in fig1 c . part of the cam follower assembly 240 is the contact 246 . in the position defined as “ seated ”, shown in fig1 c , the jaws 210 and 230 are closed to the point that they just about touch the outer and inner diameters of the launch adapter ring 502 and the contact 246 almost touches the face of the launch adapter ring 502 . as the actuator 180 continues to apply torque the cam follower continues to move forward and the variable jaw assembly 210 and the lock jaw assembly 230 continue to get closer together . the launch adapter ring eventually contacts the contact rods 232 on the locking jaw assembly 230 , the contact plungers 217 on the variable jaw assembly 210 and the contact 246 on the cam follower assembly 240 . the actuator 180 continues to force the cam follower assembly 240 further forward and , as shown in fig1 c , the shape of the jaw cam surface 302 forces the variable jaw assembly 210 and the lock jaw assembly 230 even closer together . in doing so , the contact rods 232 ( fig3 ) force the launch adapter ring 502 down onto the contact plungers 217 compressing the contact springs 218 ( fig3 ). at the same time the contact 246 in fig3 is pushed into the face of the launch adapter ring 502 compressing the contact spring 245 in fig3 . when the desired level of force is generated in the contact springs 218 and 245 the launch adapter ring 502 is considered fully preloaded to the point where the attachment between the capture mechanism 100 and the launch adapter ring 502 has achieved the desired level of stiffness ( i . e . has been “ rigidised ”) to permit the attachment to resist loads generated during spacecraft stabilisation and other servicing tasks . this condition is shown in fig1 d . in order to provide a further lock between the two spacecraft , the locking jaw assembly 230 in fig3 is equipped with a lock that physically prevents the launch adapter ring 502 from being removed from the capture mechanism 100 . as shown in fig1 e , when the cam follower assembly 240 has reached the position where the full preload has been developed , it is advanced still further . the combination of the cam rollers 248 and the jaw cam surface 302 do not act to compress the jaws 210 and 230 further , but the lock roller 252 now engages with the lock cam surface 303 on the back of the lock 235 and overcomes the biasing effect of the lock spring 236 ( shown in fig3 ) to force the lock 235 into a position where it prevents the movement of the launch adapter ring 502 . the capture mechanism 100 and the launch adapter ring 502 are now preloaded and locked together completing the second stage of the two - stage capture sequence . referring again to fig1 e to 19a , to permit the servicing of several spacecraft or to permit additional attempts to capture a client spacecraft that might not have been captured on the first attempt , the capture mechanism 100 can be unlatched and reset to its initial condition . to do so generally amounts to running the actuator 180 in the opposite direction and causing the cam follow assembly 240 to move aft , moving the cam rollers 248 in the reverse direction down the lock cam surface 302 and the jaw cam surface 301 which , in sequence allows the lock 235 to be biased away from the launch adapter ring 502 and then unloads the contact 246 and the contact plungers 217 . the jaw hinge springs then can bias the jaws 210 and 230 away from the launch adapter ring 502 . at any point between fig1 b and 19a it is possible for the capture mechanism to be maneuvered away from the launch adapter ring 502 by the robotic arm 501 . to fully reset the capture mechanism 100 , the trigger 140 must be reset in its initial position . to do so , the actuator 180 continues to force the shuttle 114 aftwards within the capture mechanism 100 until the trigger reset pawl 135 , see fig1 , located on the trigger reset lever 136 , contacts the trigger pawl surface 304 on the trigger bar support 131 . the trigger reset lever 136 is biased in the untriggered position by the trigger lever reset spring 146 and prevented from rotating too far by the trigger lever reset stop 147 as shown in fig1 . as the shuttle 114 is pushed aft , the contact between the trigger reset pawl 135 and the trigger pawl surface 304 rotates the trigger reset lever 136 . the sear reset rod 143 contacting the back of the lever slot 305 then forces the sear 141 to rotate along with the trigger reset lever 135 . the trigger 140 and trigger roller 145 are flexibly secured within the trigger housing 132 and biased to the untriggered position by the trigger spring 142 . as the trigger roller 145 is moved out of the way by the motion of the sear 141 , the trigger 140 rotates until the trigger roller 145 passes over the top of the sear 141 and then starts to contact the trigger surface 306 , see fig1 . prior knowledge of how many actuator 180 turns are required to reset the trigger 140 allows the computer system 600 or a human operator to know when the trigger 140 has been reset . alternately , a position sensor ( not shown in the embodiment ) may be used to determine when the sear 141 had returned to the untriggered state . the trigger spring 142 biases the trigger 140 into the correct position against the trigger surface 306 on the sear 141 . the rotation of the actuator 180 is once again reversed to drive the shuttle 114 forward . as the shuttle 114 moves forward the trigger bar 130 contacts the trigger bar surface 307 on the sear 141 . the trigger mechanism is now reset , however the ball screw nut 124 continues to be driven forward in the ball screw nut slot 308 , ( fig2 and 24 ) leaving the shuttle 114 to be retained by the trigger mechanism . the ball screw nut 124 has been moved forward sufficiently that when the capture mechanism 100 is triggered the shuttle 114 can move forward far enough to attain the soft capture state without being restricted by the shuttle 114 prematurely striking the ball nut screw 124 . the capture mechanism 100 is now completely reset and ready for another capture . referring to fig1 , in order to service a wider range of clients and to accommodate variations in bracket size and position , the capture mechanism 100 may include additional features . to accommodate differences in launch adapter ring 502 diameter , the two clamp jaw assemblies 200 are mounted on clamp housing bearings 203 as shown in fig2 . these bearings 203 permit the clamp housing 201 to rotate about the axis of the cam follower assembly 240 with respect to the main housing 110 . in this embodiment the two clamp jaw assemblies 200 are free to rotate independently . to keep the clamp jaw assemblies 200 in their nominal positions , each assembly 200 is connected to a torque rod 284 ( fig3 ) by a link 282 and then connected to the main housing 110 by a bracket 281 . to keep the torque rod 284 centred on the bracket 281 a spring 283 is located on either side of the bracket 281 . rotations of the clamp jaw assembly 200 are accommodated by the sliding of the torque rod 284 within a slot in the bracket 281 which compresses one or the other spring 283 which generates a righting moment that returns the clamp jaw assembly 200 to the nominal position . as shown in fig3 , to accommodate launch adapter rings 502 of differing profile shape the variable jaw assembly 210 incorporates a two - part jaw with a fixed clamp hinge plate 212 connected flexibly to a variable jaw 214 by a clamp hinge pin 215 . rotation of the variable jaw 214 is limited to a desired range by features machined into the variable jaw 214 and the clamp hinge plate 212 and the variable jaw 214 is biased to any desired position relative to the clamp hinge plate 212 by the spring 216 . when the variable jaw assembly 210 is closed over varying profiles within a known range of shapes , the shape and flexible position of the variable jaw 214 permits the entire clamp jaw assembly 200 to correctly grasp varying shapes within a predetermined range . an alternate embodiment can incorporate a linking mechanism that coordinates the rotation of the two clamp jaw assemblies 200 so that a wider range of launch adapter ring 502 diameters can be accommodated . to further increase the range of launch adapter ring 502 diameters , each bracket 281 can be connected to an actuator that changes the nominal position of the bracket , and therefore the changes nominal diameter of launch adapter ring 502 being grasped . an alternate embodiment has the entire capture mechanism 100 as a separate tool that the robotic arm 501 may releasably grip to permit the robotic arm to perform additional functions . the separate tool embodiment would include a releaseable interface between the robotic arm 501 and the capture mechanism 100 such that mechanical forces , electrical power and sensor signals can be transmitted across the interface . several such interfaces exist in prior art and they are not part of this invention . an alternate embodiment would delete the vision system 602 , and the line producing lasers 151 and rely exclusively upon human control to maneuver the capture mechanism 100 and upon mechanical contact to actuate the trigger mechanism per the alternate embodiment above . the capture mechanism disclosed herein is very advantageous over the spacecraft capture mechanism disclosed in us patent publication 2013 - 0249229 - a1 published sep . 26 , 2013 , ( hereinafter &# 39 ; 229 ), for the following reasons . the capture mechanism disclosed in &# 39 ; 229 has a very limited range of objects that it can optimally grasp , while the mechanism disclosed herein is designed for a much greater range of objects that it can optimally grasp and that adjustment can be varied during the use of the tool to greatly increase the utility of the tool . as one example of this , the pairs of grasping jaws include structural features configured to accommodate local variations in size and shape of the capture feature at the two locations on the capture feature being grasped by the two pairs grasping jaws . further , mechanism disclosed in &# 39 ; 229 has a single set of grasping members , or jaws , which results in larger forces within the entire capture mechanism during the rigidising operation thereby requiring members of greater size and mass to withstand those forces . larger and more massive members not only reduce response time , but also lead to a higher overall mechanism size and mass which is highly undesirable for spacecraft systems . the single set of grasping members in &# 39 ; 229 is manufactured to optimally grasp features of a limited range of sizes . this range cannot be changed once the grasping members are manufactured and installed in the mechanism . to increase its adjustability and utility , the mechanism in the current disclosure has multiple grasping mechanisms which may be adjusted in service to optimally grasp a much wider range of features and that may be changed for each grasping operation to greatly increase the utility of the tool . in addition , the individual grasping members or pairs of grasping jaws of the capture mechanism disclosed herein also have adjustability designed into them to allow each of the grasping members to optimally contact and grasp objects with their anticipated relative motion with respect to the capture mechanism . this greatly enhances the tool &# 39 ; s ability to accommodate varying objects to be grasped and increases the utility of the tool . as an example of this , at least one grasping jaw of each pair of grasping jaws has a distal end locking portion which is flexibly mounted to a remainder of the grasping jaw and includes a cam surface which when in contact with an associated cam follower is forced into a locking position to lock the feature within the grasping jaws . in addition the present capture mechanism includes positioning mechanisms connected to each of the pairs of grasping jaws configured to vary a pose of each pair of grasping jaws with respect to the capture feature being grasped prior to being grasped . the quick grasp mechanism is configured such that each pair of grasping jaws is positioned independently of all other pairs of grasping jaws . it will be understood that while the above discussion relates to an embodiment with at least two pairs of grasping jaws spaced from each other , it will be understood that more than two pairs of grasping jaws may be used , as the present disclosure is not meant to be limited to two pairs . in addition , the present disclosure may encompass an embodiment where only one pair of grasping jaws are needed . as the grasping jaws disclosed herein have various structure features that allow them to be adjusted for various sizes and shapes of capture features . this would be beneficial when the satellite being captured is very small and the capture feature is such that it is more amenable to grasping by one pair of grasping jaws . in addition , a satellite may be produced with the capture system as part of the satellite . referring again to fig3 , a block diagram showing those items pertaining to the capture of a client spacecraft 503 in addition to the capture mechanism 100 . these include the servicer spacecraft 500 , the client spacecraft 503 with launch adapter ring 502 to be captured , a robotic arm 501 to which the capture mechanism 100 is interfaced and a communication system 506 to provide a two - way radio link 504 to earth 505 ( or space station or mother ship , whichever is the location of the teleoperation control ). in addition , the servicer spacecraft 500 includes an onboard computer control system 600 ( see fig3 ) which may be interfaced with the capture mechanism 100 , so that it can coordinate all the components that are involved in the capture process , including the vision system 602 , robotic arm ( s ) 501 ( if more than one capture mechanism 100 is used ). this control system 600 is also interfaced with any sensors used to determine the position and loading state of the soft capture or rigidise mechanisms . these sensors may include contact or non - contact sensors used to trigger the quick grasp mechanism ( in lieu of the plunger ) and position sensors to determine the degree of closure of the mechanisms using continuous means ( encoders or resolvers ) or discretely ( using limit switches ). with the presence of the computer system 600 interfaced with the capture mechanism 100 , the capture process may be autonomously controlled by a local mission manager or may include some levels of supervised autonomy so that in addition to being under pure teleoperation there may be mixed teleoperation / supervised autonomy . referring again to fig3 , an example computing system 600 forming part of the servicing system is illustrated . the system includes a computer control system 601 configured , and programmed to control movement of the robotic arm 501 during the entire procedure of capturing launch adapter ring 502 on the client satellite 503 . the command and control system is also configured to control movement of the robotic arm 501 and for controlling the action of the capture mechanism 100 . this may be the same command and control system that is interfaced with the capture mechanism 100 , for example a computer mounted on the servicer spacecraft which is programmed with instructions to carry out all operations needed to be performed by the servicer satellite during approach , capture / docking with the client satellite and refueling operations . it may also be a separate computer system . communication system 506 is interfaced with the robotic arm 501 and configured to allow remote operation ( from the earth 505 or from any other suitable location ) of the vision system 602 ( which may include one or more cameras ), the robotic arm 501 and hence the capture mechanism 100 . the vision system 602 may include distinct markers mounted on the capture mechanism 100 . the communication system allows local automatic or autonomous control , and may send a ) vision system information robot control computer on spacecraft , where it processes visual information to determine relative pose and allow the arm / positioning device to position the capture mechanism relative to the capture 500 ; and / or b ) capture tool information / telemetry including the light beam state and trigger information . alternatively , it may be under teleoperated control from a remote location ( earth ) where the vision system information and other telemetry is provided to the operator to make decisions and control the action of the positioning device ( arm ) and the capture tool . in one form , the vision system 602 may include one or more video cameras . to improve depth perception , it may be augmented with a range finding device , such as a laser range finder or radar . the cameras of vision system 602 may be used within a telerobotic control mode where an operator controlling the servicing actions on earth or from some other remote location views distinct views of the worksite on display screens at the command and control console . in an alternative mode , the position of elements of the capture mechanism 100 or launch adapter ring 502 may be determined by either a stereo camera and vision system which extracts 3 d points and determines position and orientation of the capture mechanism 100 or other relevant features on the ring 502 , client spacecraft 503 or capture mechanism 100 from which the robotic arm 501 can be driven to desired locations according the sensed 6 degree - of - freedom coordinates . it should be noted that the term position in the context of the positioning of the servicing spacecraft with respect to the spacecraft to be captured includes the orientation of the object as well as the translation vector between the two objects , i . e . the overall relative pose of the capture feature on the client spacecraft with respect to servicer spacecraft . the stereo camera could also be replaced with a scanning or flash lidar system from which desired 6 degree - of - freedom coordinates could be obtained by taking measured 3 - d point clouds and estimating the pose of desired objects based on stored cad models of the desired features or shapes on the refueling worksite . for those applications where the spacecraft was designed with the intention to be serviced , a simple target such as described in ogilvie et al . ( ogilvie , a ., justin allport , michael . hannah , john lymer , “ autonomous satellite servicing using the orbital express demonstration manipulator system ,” proc . of the 9th international symposium on artificial intelligence , robotics and automation in space ( i - sairas &# 39 ; 08 ), los angeles , calif ., feb . 25 - 29 , 2008 ) could be used in combination with a monocular camera on the servicing robotics to locations items of interest . finally , the robotic arm or device used to position the capture mechanism 100 may include a sensor or sensors capable of measuring reaction forces between the capture tool and the bracket being captured . these can be displayed to the operator to aid the operator in teleoperation control or can be used in an automatic force - moment accommodation control mode , which either aids a tele - operator or can be used in a supervised autonomous control mode . as mentioned above , computer control system 603 is interfaced with vision system 602 and robotic arm 501 . previously mentioned communication system 506 is provided which is interfaced with the robotic arm 501 and configured to allow remote operation ( from the earth 506 or from any other suitable location ) of the vision system 602 ( the robotic arm 501 and capture mechanism 100 . a system of this type is very advantageous particularly for space based systems needing remote control . the robotic arm 501 possesses its own embedded processor and receives commands from the servicing spacecraft computer . the robotic arm 501 also passes power and data from the central computer through to the capture mechanism 100 in the event there are sensors of any type , gauges or other power requiring devices some aspects of the present disclosure can be embodied , at least in part , in software . that is , the techniques can be carried out in a computer system or other data processing system in response to its processor , such as a microprocessor , executing sequences of instructions contained in a memory , such as rom , volatile ram , non - volatile memory , cache , magnetic and optical disks , or a remote storage device . further , the instructions can be downloaded into a computing device over a data network in a form of compiled and linked version . alternatively , the logic to perform the processes as discussed above could be implemented in additional computer and / or machine readable media , such as discrete hardware components as large scale integrated circuits ( lsi &# 39 ; s ), application - specific integrated circuits ( asic &# 39 ; s ), or firmware such as electrically erasable programmable read - only memory ( eeprom &# 39 ; s ). fig3 provides an exemplary , non - limiting implementation of computer control system 601 , forming part of the command and control system , which includes one or more processors 603 ( for example , a cpu / microprocessor ), bus 609 , memory 607 , which may include random access memory ( ram ) and / or read only memory ( rom ), one or more internal storage devices 604 ( e . g . a hard disk drive , compact disk drive or internal flash memory ), a power supply 606 , one more communications interfaces 605 , and various input / output devices and / or interfaces 608 . although only one of each component is illustrated in fig3 , any number of each component can be included in computer system 600 . for example , a computer typically contains a number of different data storage media . furthermore , although bus 609 is depicted as a single connection between all of the components , it will be appreciated that the bus 609 may represent one or more circuits , devices or communication channels which link two or more of the components . for example , in personal computers , bus 609 often includes or is a motherboard . in one embodiment , computer control system 601 may be , or include , a general purpose computer or any other hardware equivalents configured for operation in space . computer control system 601 may also be implemented as one or more physical devices that are coupled to processor 603 through one of more communications channels or interfaces . for example , the computer control system 601 can be implemented using application specific integrated circuits ( asic ). alternatively , computer control system 601 can be implemented as a combination of hardware and software , where the software is loaded into the processor from the memory or over a network connection . the computer control system 601 may be programmed with a set of instructions which when executed in the processor causes the system to perform one or more methods described in the present disclosure . computer control system 601 may include many more or less components than those shown . while some embodiments have been described in the context of fully functioning computers and computer systems , those skilled in the art will appreciate that various embodiments are capable of being distributed as a program product in a variety of forms and are capable of being applied regardless of the particular type of machine or computer readable media used to actually effect the distribution . a computer readable medium can be used to store software and data which when executed by a data processing system causes the system to perform various methods . the executable software and data can be stored in various places including for example rom , volatile ram , non - volatile memory and / or cache . portions of this software and / or data can be stored in any one of these storage devices . in general , a machine readable medium includes any mechanism that provides ( i . e ., stores and / or transmits ) information in a form accessible by a machine ( e . g ., a computer , network device , personal digital assistant , manufacturing tool , any device with a set of one or more processors , etc .). examples of computer - readable media include but are not limited to recordable and non - recordable type media such as volatile and non - volatile memory devices , read only memory ( rom ), random access memory ( ram ), flash memory devices , floppy and other removable disks , magnetic disk storage media , optical storage media ( e . g ., compact discs ( cds ), digital versatile disks ( dvds ), etc . ), among others . the instructions can be embodied in digital and analog communication links for electrical , optical , acoustical or other forms of propagated signals , such as carrier waves , infrared signals , digital signals , and the like . the present system is also configured for full autonomous operation . a fully autonomous system is a system that measures and responds to its external environment ; full autonomy is often pursued under conditions that require very responsive changes in system state to external conditions or for conditions that require rapid decision making for controlling hazardous situations . the implementation of full autonomy is often costly and is often unable to handle unforeseen or highly uncertain environments . supervised autonomy , with human operators able to initiate autonomous states in a system , provides the benefits of a responsive autonomous local controller , with the flexibility provided by human teleoperators . | 1 |
while the specification concludes with claims defining the features of the invention that are regarded as novel , it is believed that the invention will be better understood from a consideration of the following description in conjunction with the drawing figures , in which like reference numerals are carried forward . referring now to fig1 , a virtual lattice network with ubication bread crumbs 100 illustrates operation of the invention as used by a firefighter when entering a building . as the firefighters or rescuers enter the building , they can decide the first placement of a ubication repeater 101 . the ubication repeater may be enabled merely by pulling the repeater from the user &# 39 ; s fire jacket or , alternatively , by squeezing the bread crumb ubication repeater which would switch it to an active state . repeaters in the invention are referred to as “ ubication ” repeaters since they refer to a quality or state of being in a place , local relation , position or location . the ubication repeater 101 can only be enabled by a firefighter with location capable technology . this enables the firefighter &# 39 ; s two - way radio 102 or other device to convey location information to the ubication repeater 101 as it is activated at its selected location . thus , each repeater is automatically position stamped prior to placement , allowing the ubication repeater 101 to convey its position to both an oncoming firefighter or a central network station 104 . the central network station might typically be located at a command post or at the fire truck located outside the building . this allows information to be reviewed by a rescue intervention team ( rit ) using a heads up display ( hud ) to provide a composite overview of all ubication information in the event there is no visibility within the building . once enabled , the environmental status with position is continuously transmitted or “ chirped ” to the central network station or other firefighter in close proximity to the ubication repeater 101 . this ubication information represents environmental data including but not limited to ambient temperature , air pressure , relative humidity and / or the presence of any harmful airborne chemicals or biotoxins that would be harmful to the firefighter . as the firefighter moves through the building , additional ubication repeaters 103 , 105 , 107 are similarly positioned that will convey position and environmental information to the central network station . the ubication repeaters may be activated as needed in order to cover a predetermined route until the firefighter or rescuer exits the building . any number of ubication repeaters may be used as needed to establish coverage zones within a building , allowing the firefighter the ability to be alerted when approaching a ubication repeater that senses a dangerous condition . since each ubication repeater is not formally networked with other repeaters in a backbone , i . e ., each ubication repeater does not communicate with others to establish communication , only a “ virtual ” network is established with the radio system used by the firefighters . for example , only the central station 104 used for communication by the firefighters would be able to interpret data from all of the ubication repeaters . communication from the ubication repeaters 101 , 103 , 105 , 107 to the central station 104 is achieved through background or manually initiated communication via a firefighter &# 39 ; s radio 102 that is in proximity to a given repeater . thus , when multiple firefighters , operating over a wide area , are periodically passing through multiple ubication repeaters zones enabling updates by the ubication repeater to the central station via the firefighters &# 39 ; radios , the central station is able to obtain a general overview of the operational environment for the area surrounding the repeaters . this enables firefighter command personnel to communicate pertinent information to all or any group of firefighters who may be outside a specific ubication repeater zone , even though any approaching firefighter could be alerted by the ubication repeater directly when in its immediate zone . given that in an emergency situation , a first responder &# 39 ; s ingress and egress routes for a building are often consistent and are vital to personal safety , placement of the ubication repeaters upon initial building entry enables those persons operating at the central station to monitor the overall usability of a vital route within a building , enhancing firefighter safety in a fire or other emergency situation . the wireless communications between the ubication repeater and the firefighter &# 39 ; s portable radio , and communication between the portable radio and the central station can be structured as simply as deemed necessary . for example , a “ bluetooth ” asynchronous connection link ( acl ) could be established between the firefighter &# 39 ; s radio and the ubication repeater during initial position - stamp and placement of the ubication repeater . the firefighter &# 39 ; s radio would then communicate the pertinent information received from the ubication repeater back to the central station on secondary frequencies utilizing the association of public safety communications officials ( apco ) protocol structure , or using asynchronous aloha protocol for very simple applications . if asynchronous collisions between the radio and central station increased beyond an acceptable threshold , synchronous time division multiple access ( tdm ) communication using protocols such as are being made available in the 700 mhz public safety band could be utilized . it will be apparent to those skilled in the art that any number of wireless protocols and technologies could be employed to establish connectivity between the ubication repeater and portable radio , and between the portable radio and the central station without departing from the spirit of this invention fig2 illustrates a block diagram of a ubication bread crumb repeater 200 where a plurality of sensors are used to determine environmental conditions . a first sensor 201 , second sensor 203 are shown connected to a microprocessor 205 that works to interpret incoming environmental data such as temperature , pressure , relative humidity , harmful chemicals or biotoxins . a third sensor 207 or up to n sensors 209 may be used externally with the ubication repeater 200 to provide any needed environmental data to the microprocessor 205 . the ubication repeater 200 further includes a two - way radio transceiver 211 used to communicate information to an external radio transceiver 213 either worn by the firefighter or received by a central network station ( not shown ). the ubication repeater 200 further includes a power - on circuit 215 and a battery 217 allowing it to operate portably with its own internal power supply . fig3 illustrates a front elevational view of the physical model for the ubication repeater 300 . the ubication repeater typically may take the form of a disk - like housing 301 that may be easily worn or carried by a firefighter on his fire jacket or the like . when pulled from the jacket , the firefighter may activate the repeater with a top mounted push button switch 303 . the firefighter might typically position the repeater on the floor of the building where a plurality of feet 305 might be used to hold the ubication repeater in a fixed position . thus , to summarize , a virtual lattice or trail of ad hoc bread crumbs are generated in real time by first firefighter responders as they first enter a building . when each bread crumb ubication repeater is activated , a location stamp is automatically registered between the firefighter &# 39 ; s tactical position via his two - way radio . the ubication repeater is deployed and subsequent repeaters are activated and left at intervals of approximately 50 to 100 meters at the firefighter &# 39 ; s discretion . the stamped location registered at repeater placement during entry is continuously chirped after deployment as the firefighter continues to penetrate the building . small environmental sensors located within the ubication repeater monitor the local ambient environment with reference and real - time calibration . should the environment degrade beyond the environmental stress threshold after placement , a warning signal is chirped along with the location stamp that will alert the firefighter to an environmental danger should that firefighter attempt to egress the building in the manner in which he entered . the bread crumb ubication repeater is a low - cost throwaway solution with very low transmit power which is not interfaced to any backbone network . the information is registered by the individual firefighter when he is in proximity to the ubication repeater which is later decoded by a receiver . the ubication repeater can also be used as a damage assessment module ( dam ) that allows the firefighter to activate the bread crumb and toss the sensor into an unknown room . this allows the firefighter a great deal of versatility , allowing him to verify environment remotely before exposing himself physically to a potential hazard . while the preferred embodiments of the invention have been illustrated and described , it will be clear that the invention is not so limited . numerous modifications , changes , variations , substitutions and equivalents will occur to those skilled in the art without departing from the spirit and scope of the present invention as defined by the appended claims . | 0 |
an embodiment of the invention , being an ice skate 100 ( for the right foot ), is shown in fig1 . ( other embodiments of the invention include , but are not limited to , left ice skates , and inline roller skates .) skate 100 has a skate boot 102 and a skate blade assembly 104 . skate has a skate boot shell 106 , which is shown with a cut - away to reveal the sub - shells 120 , 122 thereof described in further detail below . skate boot 102 also has a skate boot toe cap 108 , a skate boot tongue 110 , a skate boot liner 118 , and skate boot facing 112 . skate blade assembly 104 has a skate blade 114 and a skate blade holder 116 . the skate boot toe cap 108 , skate boot tongue 110 , skate boot liner 118 , and skate blade assembly 104 and their various components are conventional , and their manufacture , assembly , and use are within the knowledge of one skilled in the art of skate design , and will not be described further herein . fig2 shows an exploded view of the ice skate 100 of fig1 , to allow for a better understanding of the various components thereof . referring particularly to skate boot shell 106 , it will be seen that in this embodiment , skate boot shell 106 has two sub - shells , an outer sub - shell 120 and an inner sub - shell 122 . skate 100 also has an associated reinforcing element 124 ( being a conventional molded plastic ankle protector ), a conventional lace bite protector 128 , and a conventional mid - sole 123 ( for securing the skate blade assembly 104 to the skate boot 102 ). skate liner 118 also has conventional foam ankle padding 126 . fig3 shows an exploded view of the boot shell 106 , showing the two sub - shells , outer sub - shell 120 and inner sub - shell 122 . each of outer sub - shell 120 and inner sub - shell 122 have a three - dimensional shape having a heel portion 120 h and 122 h ( respectively ), an ankle portion 120 a and 122 a ( respectively ), a lateral portion 120 l and 122 l ( respectively ), a medial portion 120 m and 122 m ( respectively ), and a sole portion 120 s and 122 s ( respectively ). thus , referring to fig4 , the boot shell 106 itself , when assembled , has a three - dimensional shape having a heel portion 106 h , an ankle portion 106 a , a lateral portion 106 l , a medial portion 106 m , and a sole portion 106 s . outer sub - shell 120 is a vacuum - molded three - dimensional structure made of surlyn ®, made via a conventional vacuum molding technique . outer sub - shell 120 is three - dimensionally shaped ( when molded ) so as to ( when incorporated into boot shell 106 and when boot shell 106 is incorporated into skate 100 ) conform well to the foot of a wearer during use of the skate 100 . various views of the three - dimensional shape of outer sub - shell 120 can be seen in fig6 and 8 . referring to fig5 , which shows outer sub - shell 120 in cross - section , the thickness 120 t of the outer sub - shell 120 can vary from between about 0 . 1 mm to about 5 mm . preferably , the thickness 120 t is between about 0 . 5 mm to about 5 mm , and more preferably between about 1 mm to about 3 mm . the density of outer sub - shell 120 can vary between about 0 . 75 g / cm 3 and about 1 . 1 g / cm 3 . preferably , the density is between about 0 . 85 g / cm 3 and about 1 . 0 g / cm 3 . more preferably , the density is between about 0 . 9 g / cm 3 to about 1 . 0 g / cm 3 . most preferably , the density is between about 0 . 95 g / cm 3 to about 0 . 98 g / cm 3 . inner sub - shell 122 is an injection molded three - dimensional structure made of epp , made via a conventional injection technique ( with resin being injected into and then being allowed to expand in the mold ). inner sub - shell 122 is shaped so as to ( when incorporated into boot shell 106 and when boot shell 106 is incorporated into skate 100 ) conform well to the foot of a wearer during use of the skate 100 . various views of the three - dimensional shape of the inner sub - shell 122 can be seen in fig7 and 9 , showing the assembled boot shell 106 . although not shown , the thickness of the inner sub - shell 122 is generally constant in this embodiment ( although it may vary in others ). preferably , the thickness of the inner sub - shell 122 is between about 1 mm to about 15 mm . more preferably , the thickness of the inner sub - shell 122 is between about 2 mm to about 10 mm . still more preferably , the thickness of the inner sub - shell 122 is between about 4 mm to about 8 mm . yet more preferably , the thickness of the inner sub - shell 122 is between about 5 mm to about 6 mm . most preferably , the thickness of the inner sub - shell 122 is about 5 . 4 mm . the density of inner sub - shell 122 can vary between about 0 . 016 g / cm 3 ( 1 lb / ft 3 ) and about 0 . 32 g / cm 3 ( 20 lb / ft 3 ). preferably , the density is between about 0 . 032 g / cm 3 ( 2 lb / ft 3 ) and about 0 . 16 g / cm 3 ( 10 lb / ft 3 ). more preferably , the density is between about 0 . 80 g / cm 3 ( 5 lb / ft 3 ) and about 0 . 96 g / cm 3 ( 6 lb / ft 3 ). most preferably , the density is about 0 . 83 g / cm 3 ( 5 . 2 lb / ft 3 ). referring to fig3 , inner sub - shell 122 has an outer surface 122 o having a contoured three dimensional shape . outer sub - shell 120 has an inner surface 120 i having a contoured three dimensional shape . the contoured shapes of the outer surface 122 o and the inner surface 120 i are complimentary such that when the inner sub - shell 122 is placed within the outer sub - shell 120 , the surfaces 122 o , 120 i register well in forming the boot shell 106 . further , as can be seen in the figures , both the outer sub - shell 120 and the inner sub - shell 122 are shaped so as to have ridges 120 r , 122 r ( respectively ) on their outer surfaces 120 o , 122 o ( respectively ) to provide reinforcement . the ridge 122 r on the outer surface 122 o of the inner sub - shell 122 is complimentary with a ridge - receiving shape 125 on the inner surface 120 i of the outer - shell 120 , such that they register when the boot shell is formed ; and , together with the ridge 120 r of the outer sub - shell , form boot shell reinforcement ridge 106 r . referring to fig4 , 7 and 9 , when the inner sub - shell 122 is placed within the outer sub - shell 120 to form boot shell 106 , in this embodiment , the entirety of the outer surface 122 o of the inner sub - shell 122 is covered by the inner surface 120 i of the outer sub - shell 120 . boot shell 106 is assembled by first coating the outer surface 122 o of inner sub - shell 122 with a conventional adhesive and then placing inner sub - shell 122 within outer sub - shell 120 . once boot shell 106 is assembled , skate 100 is assembled in a conventional manner with the exception of facing 112 ( which is made of eva ). in skate 100 , ( in contrast with conventional facings ) facing 112 is secured to boot shell 106 via stitching 113 only along the bottom portion of the facing . thus , the majority of the body 117 of facing 112 ( including the eyelets 115 ) neither underlies nor overlies the boot shell 106 and it is not secured to the boot shell . this leaves the majority of the body 117 of facing 112 free to stretch , move , contract , etc . during use of the skate 100 , adding to the skate &# 39 ; s flexibility . referring now to fig1 and 11 , there is shown a second embodiment of the present invention , being skate boot shell 206 ( for a right skate — the full skate has been omitted for ease of illustration since it is otherwise conventional ), which is similar to the skate boot shell 206 with some exceptions . in this embodiment each of the outer sub - shell 220 and inner sub - shell 222 are formed as two halves . thus , outer sub - shell 220 has a right half 236 and a left half 234 . similarly inner sub - shell 222 has a right half 232 and a left half 230 . outer sub - shell 220 has a heel portion 220 h , a part of which is located on right half 236 and a part of which is located on left half 234 . outer sub - shell 220 also has an ankle portion 220 a , a part of which is located on right half 236 and a part of which is located on left half 234 . outer sub - shell 220 also has a medial portion 220 m located on the left half 234 and a lateral portion 220 l located on the right half 236 . outer sub - shell 220 also has a sole portion 220 s , a part of which is located on right half 236 and a part of which is located on left half 234 . inner sub - shell 222 has a heel portion 222 h , a part of which is located on right half 232 and a part of which is located on left half 230 . inner sub - shell 222 also has an ankle portion 222 a , a part of which is located on right half 232 and a part of which is located on left half 230 . inner sub - shell 222 also has a medial portion 222 m located on the left half 230 and a lateral portion 222 l located on the right half 232 . inner sub - shell 222 also has a sole portion 222 s , a part of which is located on right half 232 and a part of which is located on left half 230 . inner sub - shell 222 has an outer surface 222 o ( split across its left half 230 and its right half 232 ). outer sub - shell 220 has an inner surface 220 i ( split across its left half 234 and its right half 236 ). the outer surface 222 o of the inner sub - shell 220 is complimentary with the inner surface 220 i of the outer sub - shell 220 such that the two register well when the sub - shell halves 230 , 232 and 234 , 236 are formed into a whole sub - shell 222 and 220 ( respectively ) and the resultant sub - shells 220 , 220 are assembled into boot shell 206 . outer sub - shell halves 234 , 236 are each a vacuum - molded three - dimensional structure made of surlyn ®, made via a conventional vacuum molding technique . once manufactured , outer sub - shell halves 234 , 236 are secured together at surfaces 243 via any suitable conventional technique ( e . g . bonding , fastening , stitching etc .) to form joint 244 ( in fig1 ) and thus outer sub - shell 220 ( which is otherwise similar to outer sub - shell 120 of the first embodiment , skate 100 ). once manufactured , inner sub - shell halves 230 , 232 are secured together at surfaces 242 via any suitable conventional technique ( e . g . bonding , fastening , stitching , etc .) to form joint 245 ( in fig1 ) and thus inner sub - shell 222 ( which is otherwise similar to inner sub - shell 220 of the first embodiment , skate 100 ). boot shell 206 is then assembled as is described above in relation to the first embodiment , skate 100 . modifications and improvements to the above - described embodiments of the present invention may become apparent to those skilled in the art . the foregoing description is intended to be exemplary rather than limiting . the scope of the present invention is therefore intended to be limited solely by the scope of the appended claims . | 0 |
fig1 is an illustration of exemplary flow 100 , adapted according to one embodiment . exemplary flow 100 may be performed entirely by a health care provider , though one or more actions may be performed by other entities , as explained further below . in block 110 , a recommendation is provided to a patient to participate in an at - home electronically - provided physical therapy regime . for instance , a physician may recommend , refer , dispense , sell , give , or prescribe an at - home electronically - provided physical therapy instruction program to the patient in response to a diagnosis of a physical limitation ( e . g ., back or shoulder pain , foot or leg sprain or pain , work injury , etc .). in another example , an employer may recommend , give sell , or provide an at - home electronically - provided physical therapy instruction program to the employee , or the patient may be referred by a physician to a physical therapist who then provides , sells , dispenses , gives , or utilizes an at - home electronically - provided physical therapy program as part of a proposed therapeutic regimen . in the present embodiment , the recommended physical therapy program is not the conventional out - patient or in - patient physical therapy regimen that is typically performed at a facility . instead , the present embodiment includes a regimen that can be completed remotely from conventional in - or out - patient therapy at home by the patient using standard home technology , such as a television , dvd player , blu - ray player , gaming console , or computer , or combination thereof . it is an advantage of some embodiments that some patients may feel more comfortable at home and more appreciative of the lower - cost and substantial time - savings of the home option , thereby inviting at least a subset of patients to get involved and stay involved with the regimen . this can advantageously reduce recidivism , recurring or chronic pain , etc . through at least increased compliance , or even completion , of recommended physical therapy . in block 120 , the patient is provided access to the electronic - media - based physical therapy instruction resources . in one example , the physician may sell access in his or her office by dispensing or providing a disc to the patient or signing the patient up for on - line services . in another example , the physician may give the patient a prescription ( or “ script ”) for the physical therapy program , and the patient then goes to a third party , such as a pharmacy , a company store at an employer , a retail store , or an on - line retailer , to get access to the electronic - media - based physical therapy instruction resource ( s ). block 120 may include being reimbursed for the electronic - media - based physical therapy instruction resources . for instance , the physician or third party may receive payment for providing access to the resources . in some instances , insurance may cover all or a part of the patient &# 39 ; s access to the resources , e . g ., there may be a small or no co - pay as a financial incentive by the insurance company to encourage patients to comply with a healthcare - professional - recommended physical therapy regimen . in block 130 , a health - care provider may track the patient &# 39 ; s progress in the physical therapy regimen . in one example , the patient &# 39 ; s participatory information may be available electronically and / or inferable from a subsequent physical exam , such as increased time between visits , fewer visits for pain management , decreased analgesic medication usage , or actual improvement in the condition being treated or managed . fig2 is an illustration of exemplary flow 200 , adapted according to one embodiment . flow 200 is from the perspective of a patient . in block 210 , the patient accesses the electronic - media - based physical therapy regimen instruction resources . block 210 may include using any of a variety of household technology to execute computer - readable data and provide a user interface with instructions for exercises . in one example , the patient inserts an optical disc into a digital video disc ( dvd ) player or blu - ray player , and the physical therapy regimen instructions are displayed on a television , projected , or on a computer monitor similarly to a movie . in another example , the patient inserts a computer - readable medium into a computer , and the computer provides interactive instructions to the patient . in yet another embodiment , the patient inserts a disc or other medium into a gaming console ( e . g ., wii ™ or x - box ™), and the gaming console provides interactive physical therapy instructions through its typical input components , such as a camera and motion sensors , a device including one or more accelerometers , or any combination thereof , and , for example , a connected television . in any embodiment , it is possible to provide some or all of the computer - readable code via a network rather than by a disc or other physical medium . in fact , some embodiments include access through a smartphone , television , or other device with specialized network applications (“ apps ”). various embodiments are not limited by any particular technique for accessing the electronic - media - based resources . in block 220 , the patient participates in the physical therapy program . in one example , the patient adheres to a suggested regimen that lasts , e . g ., around six to eight weeks and includes exercises to focus on particular physical limitations . the physical therapy program may be interactive , with intelligent , real - time feedback , or may be non - interactive with the patient keeping track of his or her own progress . in certain embodiments , the physical therapy program can increase in difficulty over time , or be based on real - time feedback or patient - selected increases in difficulty . fig3 is an illustration of exemplary flow 300 , adapted according to one embodiment . flow 300 shows the actions taken by some interactive embodiments , though it is understood that other embodiments may not be interactive . in block 310 , instructions for the physical therapy regimen are presented to the user via a display . the physical therapy regimen includes exercises that are indicated for treatment of physical limitation . the instructions may be presented to the user as an audio and video experience , though the scope of embodiments is not limited to a particular type , or combination of types , of media . examples of instructions include a human image or computer graphic avatar performing exercises and encouraging the patient to complete the exercises by following the image or avatar . furthermore , some embodiments include an avatar of the patient to encourage the patient , illustrate exercises , and / or guide the patient through the program . this user avatar may be alternatively or additionally to an avatar instructor . in some embodiments , other sensory inputs , such as tactile inputs via a handheld controller , may be provided to the user as well . in block 320 , data is received from a user interface device that indicates physical movements and / or feedback of the patient . in one example , the patient holds a motion - sensing controller and / or stands on a weight / balance sensing device . in another example , the patient stands in front of a camera that monitors the patient &# 39 ; s motion . in a third example , the patient responds to an inquiry from the program through the use of a keyboard , controller or by speaking . in all three examples , the interface hardware sends signals to a computer processor that are indicative of the patient &# 39 ; s motion and / or feedback . various embodiments are not limited by any particular interface hardware , as other interface hardware now known or later developed may be adapted for use in association with some embodiments . in block 330 , the data from the user interface device is analyzed to discern patient achievement within the physical therapy regimen . for instance , the computer processor analyzes the data in real time to determine whether the user is at least approximating the movements of the exercise or whether the user is having difficulty with the exercise based upon the user &# 39 ; s feedback . the computer processor may also generate cumulative scores and health data as the patient participates over time . in block 340 , subsequent exercises are selected for the patient based at least in part on the analyzed data . for instance , the patient &# 39 ; s approximation of the movements of the exercise can be an indication as to whether more repetitions of the exercise are appropriate or whether the patient needs more instruction on performing the exercise or more exercises at that level to be better prepared for handling increased repetitions or complexity of exercise . also , a patient &# 39 ; s performance and / or their feedback in one exercise may be used to determine whether the patient should move on to a different exercise and which different exercises are appropriate . blocks 310 - 340 illustrate a feedback loop where the patient receives instructions , performs movements in response to the instructions , and subsequent instructions are affected by the patient &# 39 ; s performance and / or feedback in this embodiment . there is also an electronic feedback loop where the user interface devices provide patient movement data to the computer processor , which instructs the patient to move and cause the user interface devices to generate further data . when implemented via computer - executable instructions , various elements of embodiments are in essence the software code defining the operations of such various elements . the executable instructions or software code may be obtained from a tangible readable medium ( e . g ., a hard drive media , optical media , ram , eprom , eeprom , tape media , cartridge media , flash memory , rom , memory stick , network storage device , and / or the like ). in fact , readable media can include any medium that can store information . fig4 illustrates an example computer system 400 adapted according to one embodiment . that is , computer system 400 comprises an example system on which embodiments may be implemented ( such as a computer , a smartphone , or a gaming console ). central processing unit ( cpu ) 401 is coupled to system bus 402 . cpu 401 may be any general purpose or specialized purpose cpu . however , the present invention is not restricted by the architecture of cpu 401 as long as cpu 401 supports the inventive operations as described herein . cpu 401 may execute the various logical instructions according to embodiments . for example , one or more cpus , such as cpu 401 , may execute machine - level instructions according to the exemplary operational flow described above in conjunction with fig3 . computer system 400 also preferably includes random access memory ( ram ) 403 , which may be sram , dram , sdram , or the like . in this example , computer system 400 uses ram 403 to store data and instructions as it executes code to perform actions illustrated in fig3 . computer system 400 preferably includes read - only memory ( rom ) 404 which may be prom , eprom , eeprom , or the like . ram 403 and rom 404 hold user and system data and programs , as is well known in the art . computer system 400 also preferably includes input / output ( i / o ) adapter 405 , communications adapter 411 , user interface adapter 408 , and display adapter 409 . i / o adapter 405 , user interface adapter 408 , and / or communications adapter 411 may , in certain embodiments , enable a user to interact with computer system 400 in order to input information , such as selecting a particular exercise . i / o adapter 405 , user interface adapter 408 , and / or communications adapter 411 may also receive data on the user &# 39 ; s movements and feedback to prompts and provide that data to cpu 401 . i / o adapter 405 preferably connects to storage device ( s ) 406 , such as one or more of hard drive , compact disc ( cd ) drive , floppy disk drive , tape drive , etc . to computer system 400 . the storage devices may be utilized when ram 403 is insufficient for the memory requirements associated with storing multi - media data . communications adapter 411 is preferably adapted to couple computer system 400 to network 412 ( e . g ., the internet , a lan , a cellular network , etc .) to , e . g ., receive computer - readable code that embodies all or a portion of a physical therapy instruction computer program . user interface adapter 408 couples user input devices , such as keyboard 413 , pointing device 407 , and microphone 414 and / or output devices , such as speaker ( s ) 415 to computer system 400 . display adapter 409 is driven by cpu 401 to control the display on display device 410 to , for example , display a human user or avatar during physical therapy . while fig4 shows a general - purpose computer , it should be noted that the exact configuration of a portion of a system according to various embodiments may be somewhat different . for example , the same basic architecture is adapted into smaller or more specialized forms for gaming consoles and smartphones . in the cases of gaming consoles and smartphones , the user interface devices may include motion sensing controllers , touch screens , and / or the like . moreover , embodiments may be implemented on application specific integrated circuits ( asics ) or very large scale integrated ( vlsi ) circuits . in fact , persons of ordinary skill in the art may utilize any number of suitable structures capable of executing logical operations according to various embodiments . patients can access electronic - media - based physical therapy instruction resources through any market channel , including the following four examples . first , national and regional healthcare insurance companies ( hics ) are aggressively seeking to cut the utilization expenses of their millions of covered lives through preventative measures and less costly therapeutic options . present high cost expenditures include but are not limited to healthcare provider visits , emergency room visits , physical therapy , medications , injections , other pain management services , and surgery . partners / distributors such as kaiser permanente , blue cross / blue shield , aetna , and other commercial insurers , as well as governmental programs such as medicare and medicaid are interested in broadly disseminating a comparatively lower cost therapeutic program throughout their insurance networks . in some embodiments , hics provide access to electronic - media - based physical therapy instruction resources by , e . g ., providing , as covered a benefit , a disc to a patient , providing web access to the resources , and / or the like . second , healthcare providers ( hcps ) are another market channel through which patients may access resources . there are thousands of hcps who are experiencing diminishing annual income , e . g ., due to recent healthcare payment changes . many hcps are presently seeking additional sources of income in their practices and would utilize a product that provides additional income to them while providing accessible and affordable treatment options to their patients . examples of hcps include , but are not limited to , physicians , physician specialties of primary care , orthopedics , occupational medicine , physiatrists , neurosurgeons , pain management specialists , neurologists , and rheumatologists , as well as chiropractors , nurses and nurse practitioners , physical therapists , and the like . in one example , a hcp sells , dispenses , or gives a disc directly to a patient , or instructs the patient to go to a third party ( or provides a prescription to be filled by a third party ), such as a pharmacy , drug store , retail establishment , or website to receive the electronic - media - based physical therapy instruction resources . in some scenarios , hcps may receive a profit from sales or distribution of the electronic - media - based physical therapy instruction resources . third , large organizations are yet another marketing channel encompassed by the present disclosure . governmental organizations and large corporate employers responsible for servicing vast numbers of individuals typically have a need to provide lower - cost but effective health care options . in fact , many large employers often seek low - cost options for employee injury treatment . in some examples , a large organization may give a disc directly to a patient or employee , recommend this disc be dispensed by their contracted or employed healthcare practitioners , or instruct the patient to go to a third party , such as a pharmacy , drug store , retail establishment , or website to receive the electronic - media - based physical therapy instruction resources . in some scenarios , organizations may receive volume discounts for large orders of the electronic - media - based physical therapy instruction resources . fourth , many individuals will be interested in obtaining the program outside of the aforementioned channels and may self - direct purchase of the product for themselves , relatives , friends or others . if they are unable or unwilling to gain access through the aforementioned channels , they will have the option of buying electronic - media - based physical therapy instruction resources directly through a number of channels , including , but not limited to , websites ( e . g ., by mail order , streaming , etc . ), pharmacies ( e . g ., by dvd , audiovisual cd for computer , etc . ), drug stores , retail establishments , health care providers ( e . g ., doctor &# 39 ; s office , testing / diagnostic lab , etc . ), health clubs , gyms , and infomercials . the electronic - media - based physical therapy instruction resources can be offered in any number of forms . in one example , resources are sold in discrete units ( e . g ., discs , downloadable files ) that are targeted at single , specific body areas . examples of resources that focus on single areas are back , hip , shoulder , knee , neck , wrist , foot , ankle , joints and muscles , and areas affected by fibromyalgia . in some instances , the resources include a core component of generalized and comprehensive exercises of importance that are central to sustainable health and fitness . a physical therapy regimen provided by electronic - media - based physical therapy instruction resources may include one or more of the following features . the scope of embodiments is not so limited , as any number of features for treatment of physical limitations may be included . in one example , a regimen is a 4 to 12 week , optionally a 6 - 8 week , program that is similar to a course of traditional physical therapy , with the option for the individual to progress as they are able and with elements for maintenance . however , any length is possible for a given program depending on the physical therapy needed to manage or treat the condition , optionally but preferably as monitored by a subsequent visit to a healthcare provider if relevant . some programs include a module for “ assessment of capabilities ” and appropriateness of participation . examples include questionnaires , real - time performance analysis , feedback , or combinations thereof that estimate a patient &# 39 ; s capabilities . such module may also query to determine specific reasons for participation and goals for each patient . furthermore , the module may also include a body mass index ( bmi ) assessment or other general health measures and goals for a patient to explore if desired . if the assessment identifies the need for weight loss , then separate promotional information , products and resources can be offered as part of the program . this may be particularly the situation for embodiments where the physical therapy regimen is focused on upper back , lower back , foot , ankle , knee , leg , neck , or hip - related pain . interactions preferably include a high degree of positive reinforcement and encouragement to prolong participation and enhance effectiveness . various embodiments may also include interval assessment of progress and achievement of goals that can be accessed by the patient and / or other entities , such as hcps , insurance companies , and large organizations . for instance , some embodiments include an option to track progress online so the data analysis can be utilized for further enhancement , marketing and sales , determination of credibility , corporate utilization , and insurance coverage benefits . there are a wide variety of physical therapy exercise programs that can be constructed based upon a set of possible exercises . in one example , the programs include a core or fundamental exercise program , which encompasses the total body to provide stretching , strengthening , conditioning , and maintenance with the following emphases : yoga , tai chi , stretch , mild cardio exercise , and preferably combinations thereof . and in another example , there is provided specific body area exercise resources , such as regimens directed to lower backs , knees , shoulders , hips , wrists , necks , foot and ankle , musculoskeletal and joint , and fibromyalgia among others . any given program may be tailored to functional restoration through flexibility enhancement , strength enhancement , fitness enhancement , and weight loss . exercises can be loosely categorized by type . examples of types include , e . g ., warm - up / cool - down , stretching , rehabilitative , flexibility ( e . g ., pilates ), movement ( e . g ., yoga , tai chi ), strength ( e . g ., upper body , lower body , core , etc . ), toning , and cardio fitness . there is cross - over of exercises into types , and most exercises can have differing degrees ( levels ) of difficulty . some exercises are preferably performed independently on both sides of the body , or optionally one side depending on the condition or body part ( s ) being addressed . workout routines may have a broad set of options , as depicted in fig5 . routine 510 includes a fixed sequence of fixed exercises . routine 520 includes a fixed sequence of level - based exercises . routine 530 includes a variable sequence of fixed exercises . routine 540 includes a variable sequence of level - based exercises . exercises can be mixed and matched as appropriate for any given patient &# 39 ; s treatment . exercises and curriculum are preferably developed in conjunction with respected , credible , e . g ., peer - qualified hcps in specialties of orthopedics , physiatry , neurosurgery , occupational medicine , pain management , chiropractic and physical therapy . the acumen and expertise of the hcps may be used to create resources that are directed at treating physical impairments , pain , and / or disorders of the lumbar spine , cervical spine , knee , hip , shoulder , wrist , foot , ankle , and other particular joint or muscle injuries , fibromyalgia , or other conditions . in some embodiments , each patient progresses through increasing difficulty levels as the patient improves and becomes more capable . some embodiments also offer patients the ability to skip some exercises if needed due to impairment , lack of time , or improvement of a particular ability , thereby allowing patients some customization of their regimens . furthermore , in order to keep patients involved , encouraged , and not pushed beyond their physical limits , each body area program preferably lasts no greater than about 35 - 40 minutes , though different lengths are possible in other embodiments . there are options for physical therapy with and without equipment . examples of equipment include , but are not limited to , resistance bands , body bands , yoga mats , yoga blocks , inflatable exercise balls , exercise roller wheels , low weight dumbbells / wrist and ankle weights , push up assistive devices , hot packs , cold packs , support garments for lower backs and knees , pain relief gels , recovery drinks , nutritional meals and supplements , weight loss programs , and the like , typically equipment that is present or readily available for home use . the electronic - media - based physical therapy instruction resources offer an opportunity for upsale to other products or other exercise / fitness programs , which is an additional revenue generator for the creator of the resource as well as for other entities that might supply the equipment . examples of other materials include , but are not limited to , a product guide which will provide information about the product , help elicit and define the end user &# 39 ; s motivations and reasons for participation in the product , educate and describe the products therapeutic objectives , instruct the end user in the use of the product and program , and provide an explanation of the product &# 39 ; s efficacy . an assessment guide and recommended tests may also be included to determine baseline physical degree of impairment and appropriate level of participation . the assessment guide may be accompanied by an online test collection of results for later analysis and use by hcps and other entities . some examples additionally include an assessment of end user objectives and goals through a formatted questionnaire . other materials may include a program schedule , a nutrition guide , website forums , opportunities to buy or rent equipment , other educational resources , and the like . the electronic - media - based physical therapy instruction resources can be used on a variety of platforms , including , for example : pcs attached to tv sets / monitors , connected to the internet , running hosted software any streamable portable device , including without limitation a cell phone , tablet device , laptop , netbook , etc . regarding any streamable device or other internet connected device , the connectivity may be wired , wireless , radio frequency , cellular data , sms , satellite , or any other type of internet connection available . also , there are varying degrees of interaction with the user . dvd systems are generally not very interactive , whereas computer - based systems and game console - based systems are generally more interactive . platforms with such interactive intelligence , including web - based platforms with real - time or periodic human input , query the patient , adjust the workouts accordingly , interact on an individual basis , and record performance , amongst other capabilities . platforms with interactive feedback monitor the patient in real - time , giving constant feedback on how well the patient is performing the exercise routines . the scope of embodiments includes multiple products with different levels of interaction , where examples of the products include , but are not limited to : various embodiments include one or more advantages over conventional physical therapy . in one aspect , the electronic - media - based physical therapy instruction resources preferably : 1 ) increase compliance with a medically recommended or prescribed treatment plan and 2 ) decrease the recidivism of functional impairment and pain and 3 ) decrease the requirement for additional healthcare utilization through a sustainable maintenance program . furthermore , some embodiments provide comparatively lower cost option compared to present physical therapy options , optimal and flexible scheduling for participation as time of day is entirely end user determined , and elimination of the need for transportation to / from a physical therapy center . moreover , the ability to use the physical therapy instruction resources in the home provides an enjoyable and convenient environment that users are able to utilize daily without an associated per visit / treatment cost that is typically associated with traditional physical therapy programs . in various embodiments , there is a creating party behind the physical therapy instruction resources . an example is a person or company designing , programming , and / or distributing the physical therapy resources . in one other embodiment , the creating party designs , programs , and distributes one or more physical therapy resource ( s ). in this example , however , the creating party is the originator of the resources and provides the resources to a hcp , a hic , a government or private employer , or directly to the end - user or through a third party such as a pharmacy . an originating party may also include a person or company who purchases the rights to distribute the resources from a creating party . further in this example , the originating party acts a resource , either directly to the patient , or through a third party , such as a hcp , an hic , or an employer . for instance , the originating party may have a website and / or phone line set up to assist patients and / or third parties and to generally facilitate the provision and use of the resources . for instance , the originating party may have network resources that track progress of individual patients and then report on the progress to the patients themselves and / or to employers , hcps , hics . in fact , in some instances , the originating party may act as a resource to both the patient ( by providing the resources ) and the employer / hcp / hic by reporting on progress and status . in some instances , the electronic resources that the patient uses manually or automatically report on the patient &# 39 ; s progress . the employer / hcp / hic then uses a web portal or other electronic resource to receive the reporting . the originating party may also act as a reference for education for patients and prospective patients through , for example , a web portal or other media . education may focus on physical therapy generally , one or more specific body parts , pain , success , etc . some embodiments also include the originating party offering personal interaction to the patients , either in - person or electronically . for instance , an originating party may be affiliated with service providers around the country or around the world . in one example , the originating party has a network of physical therapists available for phone consultations , video consultations , in - person visits , and / or the like . in fact , any type of health service provider , such as a physical therapist , md , chiropractor , etc ., may be affiliated with the originating party to supplement the electronic resources . in some instances , the network of health service providers may be geographically linked so that patients may be referred to local or regional health service providers . referrals may be made in any manner , including by a web resource of the originating party ( e . g ., sites to “ find a physical therapist in your area ,” “ find a chiropractor in your area ,” etc .). furthermore , the patient may receive access to the network of health service providers included in a set of services with the electronic resources , a la carte , or in any other manner . the network of health services may provide one or more of any of the following services : one - on - one time with patients , personalized tailoring of regimens , patient follow - up , patient analysis , patient confidence building , patient education , etc . the originating party may receive payment in any of a variety of ways , including directly from a patient and / or through a employer / hcp / hic . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , system , means , methods and steps described in the specification . as one of ordinary skill in the art will readily appreciate from the disclosure of the present invention , processes , machines , manufacture , systems , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention . accordingly , the appended claims are intended to include within their scope such processes , machines , manufacture , compositions of matter , means , methods , or steps . | 6 |
fig1 is a top plan view of a seven gang mower unit carried on a trailer 11 pulled by an industrial or farm type tractor 13 . a hydraulic pump and reservoir unit 15 is mounted on a frame 17 which is attached to the three point hitch 18 of the tractor . the trailer 11 is intended for supporting reel mowers 19 which are hydraulically driven and are of the type having front caster wheels 21 and a rear roller 23 . each reel mower is driven by an independent hydraulic motor 25 . the trailer 11 includes a u - shaped frame 31 with its open end extending in the forward direction of the trailer . the frame has longitudinally extending side members 33 joined by an end cross member 35 at its rear . rearwardly and outwardly diagonally extending beams 37 are connected intermediate their ends to the forward ends of the longitudinally extending side members 33 . front cantilever beams 39 extend upwardly and laterally outwardly from the longitudinal side members 33 and are fastened to the rearward ends of the diagonal members 37 . rear cantilevered beams 41 extend upwardly and laterally outwardly from the longitudinally extending side members 33 in alignment with the end cross member 35 . a wheel support beam 43 is mounted on plates 45 which are supported on the longitudinally extending side members 33 of the frame . the beam extends beyond the side members 33 and spindles 47 which are attached to opposite ends of the wheel support beam have wheels 49 rotatably mounted thereon . three of the mowers 19 are fastened to the frame 31 generally inside the dimensions of the frame with each attached by an arm 53 which is pivotally mounted to the frame for up and down movement . each arm is connected to a mower by a ball connector 55 . the two mowers 19 which are carried behind the trailer are each connected to a mower arm 57 by a ball joint 59 . each mower arm 57 is pivotally connected at its inner end to an arm 61 extending at right angles thereto which arm in turn is pivotally mounted to the frame 31 for rotation about a horizontal axis at 63 . the side mowers 19 are connected to the outer ends of irregularly shaped side mower arms 67 which arms are fastened to tubes 69 mounted in sleeves 71 . sleeves 71 are supported at the ends of the front and rear cantilever beams 39 and 41 , respectively . the mowers are connected to the side mower arms 67 by ball connectors 73 . the ball connectors 73 generally align with the wheel support beam 43 and the wheel spindles 47 to provide stability for the trailer during lifting and lowering of the mowers mounted on the arms 67 . the positioning of the mowers relative to the frame 31 applies most of the weight to the support beam 43 and thus to the wheels 49 and not to the trailer 13 . the hydraulic system for raising and lowering the mowers 19 is shown in detail in fig3 and will be described hereinafter . for clarity of illustration , many of the details of the mower lifting system have been omitted from these drawings but the system is similar to that shown and described in u . s . pat . no . 3 , 832 , 835 assigned to the same assignee as this specification . the trailer 11 may be connected to the frame 17 of the hydraulic pump and reservoir unit 15 which is mounted on the tractor 13 by a tow bar assembly 77 shown in enlarged detail in fig2 of the drawings . the tow bar assembly includes a pair of upstanding plates 79 which are located at opposite ends of a cross plate 81 . two rows of openings 83 are formed in each of the plates 79 . the openings are sized to receive bolts ( not shown ) which also fit in openings ( not shown ) in angles 85 attached to the forward ends of the diagonal members 37 of the frame 31 . the rows of openings permit vertical adjustable attachment of the tow bar assembly relative to the trailer 11 . a tube 87 extends in a forwardly direction from the cross plate 81 and is fastened thereto . the eye 89 of a spring loaded bolt extends out of the tube 87 and is fastened by a pivot pin 91 to a bracket 93 which is in turn fastened by a pivot pin 95 to the frame 17 . the spring loaded bolt which moves in and out of the tube 87 permits the tractor to make a turn of 90 ° relative to the trailer without permitting the tractor to strike the trailer . a hose support 97 is pivotally mounted in an upstanding position on the tube 87 . the hose support includes a rectangularly shaped opening 99 for receiving the hydraulic mower hoses ( not shown ) and a stirrup portion 101 for supporting the hydraulic cylinder hoses shown in fig3 . a trailer parking wheel 103 which can be raised and lowered is mounted on one of the rearwardly extending diagonal members 37 of the trailer frame . fig3 of the drawings shows the hydraulic system for operating the hydraulic cylinders which raise and lower the hydraulic driven mowers 19 carried on the trailer 11 . the pressurized hydraulic fluid for operating the hydraulic cylinders is provided from the hydraulic system of the tractor 13 by means of hydraulic hoses 107 having quick connect and disconnect fittings 109 . the hoses 107 connect to lever operated ganged spool valves 111 which are mounted in a housing 113 . the housing is supported on a tubular post 115 . the tubular post 115 telescopes inside a tubular socket 117 which is supported on a frame 119 . the frame 119 is mounted on the hydraulic pump and reservoir unit 15 . a removable locking pin ( not shown ) extends through alignable openings in the tubular post 115 and tubular sockets 117 to secure the spool valve housing 113 in proper position . hydraulic hoses 121 extend from the spool valves 111 to a support block 123 mounted on a cross beam 125 of the trailer frame 31 . hydraulic hoses 127 lead from the support block 124 to the individual hydraulic cylinders 129 which are pivotally mounted on the longitudinally extending side members 33 and end cross member 35 of the trailer frame 31 . since there are five hydraulic cylinders 129 , there are five lever operated spool valves 111 and ten sets of hydraulic hoses 121 and 127 with a set of hoses leading to each hydraulic cylinder . when the trailer 11 is to be disconnected from the tractor 13 , it is only necessary to disconnect the two hydraulic lines 107 leading from the tractor hydraulic power supply to the housing 113 containing the handle lever operated spool valves 111 . since the hydraulic fluid lines 107 from the tractor have quick disconnect fittings 109 , this is easily accomplished . the pin holding the tubular post 115 in place in the tubular socket 117 is removed and the housing 113 is lifted from the socket 117 carrying its hydraulic hoses 121 along with it . a tubular socket 131 identical to the tubular socket 117 is provided on the frame 31 of the trailer 11 to receive the tubular post 115 and thereby support the housing 131 , spool valves 111 and hoses 121 on the trailer 11 . thus , the hydraulics applied to the hydraulic cylinders 129 can be disconnected and connected simply by disconnecting or connecting two hoses 107 rather than the ten hydraulic hoses 121 which normally would have to be manipulated . | 0 |
in conventional backpacks , comfort is not optimized even when comfort - enhancing features are incorporated into the backpack . the novel arrangement , positioning , and dimensions of features in the ergonomic backpacks with enhanced fit described in this application provide a user with optimal fit and comfort . fig1 - 6 illustrate examples of the present invention designed as unisex backpacks . fig7 - 8 illustrate examples of the present invention designed specifically for women . fig1 illustrates an ergonomic backpack with enhanced fit 100 . backpack 100 includes a storage portion 102 that includes one or more compartments capable of storing cargo . storage portion 102 has a top side 104 , a bottom side 106 , a left side 108 , and a right side 110 . when backpack 100 is worn by a user ( as illustrated in fig2 - 3 ), top side 104 is nearer to the user &# 39 ; s head than bottom side 106 , bottom side 106 is nearer to the user &# 39 ; s legs than top side 104 , left side 108 is nearer to the user &# 39 ; s left shoulder than right side 110 , and right side 110 is nearer to the user &# 39 ; s right shoulder than left side 108 . storage portion 102 is connected to a first end 112 of a primary left shoulder strap 114 along a first connection area 116 . first connection area 116 is on the top and left side of storage portion 102 . storage portion 102 is also connected to a first end ( not shown ) of a primary right shoulder strap 118 along a second connection area ( not shown ). the second connection area is on the top and right side of storage portion 102 . secondary left shoulder strap 120 is attached at a first end 122 to the bottom and left side of storage portion 102 . secondary left shoulder strap 120 is also connected to a second end 124 of primary left shoulder strap 114 . similarly , secondary right shoulder strap 126 is attached at a first end 128 to the bottom and right side of storage portion 102 . secondary right shoulder strap 126 is also connected to a second end 130 of primary right shoulder strap 118 . fig1 illustrates buckles 132 and 134 connecting primary left shoulder strap 114 and primary right shoulder strap 118 to their respective secondary shoulder straps . any number of connecting devices or techniques may be used to facilitate these connections . in some examples , the connections are detachable and / or adjustable . fig2 illustrates ergonomic backpack with enhanced fit 100 while being worn by a user 200 . primary left shoulder strap 114 is worn over the user &# 39 ; s left shoulder 202 , and primary right shoulder strap 118 is worn over the user &# 39 ; s right shoulder 204 . to better illustrate some of the novel features of the invention , fig3 - 8 show examples of an ergonomic backpack with enhanced fit with the primary and secondary shoulder straps not connected and the primary straps raised such that they extend upward and away from the body of a user wearing the backpack . as stated above , in some examples the primary and secondary shoulder straps may be detachable . fig3 - 8 are also intended to illustrate examples in which the primary and secondary shoulder straps are not detachable , even though the primary and secondary straps are shown not connected for illustration purposes . fig3 illustrates a user 300 wearing ergonomic backpack 100 . a dashed line represents a vertical plane 302 extending through the body of user 300 . primary right shoulder strap 118 and primary left shoulder strap 114 ( not shown ) are raised such that primary right shoulder strap 118 and primary left shoulder strap 114 extend upward from the body of user 300 and are substantially parallel with vertical plane 302 . primary right shoulder strap 118 and primary left shoulder strap 114 also extend away from the center of backpack 100 when the primary straps are in this position , as is clearly illustrated in fig4 - 8 . fig3 is intended for illustration purposes . it should be appreciated that gravitational force would cause backpack 100 to fall off of user 300 if user 300 attempted to wear backpack 100 with the primary straps in a raised , substantially vertical position as shown . fig3 establishes a frame of reference for a more complete discussion of the novel features of backpack 100 in subsequent figures . fig4 is a plan view of backpack 100 looking at the surface of backpack 100 that rests against a user &# 39 ; s back . primary shoulder straps 114 and 118 are raised to a substantially vertical position as shown in fig3 . secondary shoulder straps 120 and 126 are also shown , and storage portion 102 is shown as a dotted line so as to not distract from the explanation of novel features of backpack 100 . as discussed with regard to fig1 , first end 112 of primary left shoulder strap 114 is connected to storage portion 102 along first connection area 116 . first end 402 of primary right shoulder strap 118 is connected to storage portion 102 along second connection area 404 . first connection area 116 and second connection area 404 are each spaced approximately the same distance from a substantially vertical bisecting line 406 extending through backpack 100 from top side 104 to bottom side 106 . first connection area 116 and second connection area 404 are substantially collinear with a substantially horizontal line 408 extending across top side 104 of backpack 100 . primary left shoulder strap 114 connects to first connection area 116 and primary right shoulder strap 118 connects to second connection area 404 at substantially equal angles relative to substantially horizontal line 408 . in some examples , the material comprising primary shoulder straps 114 and 118 extends beyond connection areas 116 and 404 and along the surface of storage portion 102 and may meet at approximately substantially vertical bisecting line 406 , as indicated by dotted lines in fig4 . in other examples , primary straps 114 and 118 end at connection areas 116 and 404 or extend a different length and / or geometry along storage portion 102 . primary left shoulder strap 114 , primary right shoulder strap 118 , and substantially horizontal line 408 are all tangential to a first circle 410 having a radius 412 of approximately between 8 and 12 centimeters . first circle 410 is substantially parallel to vertical plane 302 shown in fig3 . in one example , radius 412 measures approximately 10 centimeters . primary left shoulder strap 114 and primary right shoulder strap 118 curve away from substantially vertical bisecting line 406 at between approximately one - third to two - thirds of the length of each strap , the curve being substantially equal to the curve of an arc 414 of a second circle 416 having a radius 418 of approximately between 7 and 11 centimeters . arc 414 measures approximately between 25 and 45 degrees . in one example , radius 418 measures approximately 9 . 5 cm . in another example , arc 414 measures approximately 36 degrees . as used herein , an arc measurement of a certain number of degrees is defined by the angle whose sides are extended until the circumference of the circle is intersected . for example , when a 36 - degree angle &# 39 ; s sides are extended to the circumference of a circle from the center , the portion of the circumference between the extended sides is a 36 - degree arc . fig4 shows primary shoulder straps 114 and 118 as having the same amount of curve . in other examples , the curve could vary slightly to account for an individual &# 39 ; s physique . primary shoulder straps 114 and 118 may be of varying width . a range of desirable widths is shown in fig4 , with the white areas representing the minimum desired width of each strap and the gray areas representing the maximum desired extent for optimal comfort . as illustrated , the width of each strap may vary within the range of approximately 2 centimeters and approximately 12 centimeters . as noted in some examples below , however , variation to greater and / or lesser widths do not depart from the scope of the present invention . in one example , at the area where the straps attach to storage portion 102 , the minimum desired width of each strap is approximately 3 centimeters , and the maximum desired width is approximately 8 centimeters . in another example , at the second ends of the primary shoulder straps where the primary straps connect to the secondary straps , the minimum desired width of each strap is approximately 1 centimeter , and the maximum desired width is approximately 5 centimeters . in a further example , at the area where the straps attach to storage portion 102 , the minimum desired width of each strap is approximately 4 . 125 ( 4 and ⅛ ) centimeters , and the maximum desired width is approximately 4 . 75 ( 4 and ¾ ) centimeters . in still a further example , at the second ends of the primary shoulder straps where the primary straps connect to the secondary straps , the minimum desired width of each strap is approximately 1 . 375 ( 1 and ⅜ ) centimeters , and the maximum desired width is approximately 3 . 5 ( 3 and ½ ) centimeters . the specific strap width selected can vary depending upon the activity for which backpack 100 is designed , anticipated size of the user , mobility concerns , anticipated clothing that will be worn under the backpack , and other considerations . as shown in fig4 , the minimum desired strap width tapers from widest at connection areas 116 and 404 to narrowest where primary shoulder straps 114 and 118 connect to secondary shoulder straps 120 and 126 . although not shown in the figures , a sternum strap and / or waist strap may be included in backpack 100 . in examples including a sternum strap , the sternum strap may attach to primary shoulder straps 114 and 118 from approximately where primary shoulder straps 114 and 118 begin to curve to second ends 124 and 130 of primary shoulder straps 114 and 118 . the maximum desired extent 420 of bottom side 106 of storage portion 102 is approximately 55 centimeters in the vertical direction from substantially horizontal line 408 . in one example , maximum desired extent 420 is approximately 50 centimeters . the first ends 122 and 128 of secondary shoulder straps 120 and 126 attach to storage portion 102 at a minimum desired vertical distance 422 of approximately 35 centimeters from substantially horizontal line 408 . in one example , minimum desired vertical distance 422 is approximately 39 centimeters . in another example , minimum desired vertical distance 422 is approximately 38 . 8 centimeters . it is appreciated that approximately 38 . 8 centimeters can be considered to be approximately 39 centimeters . the vertical distance 424 between substantially horizontal line 408 and both the midpoint of second end 124 of primary left shoulder strap 114 and the midpoint of second end 130 of primary right shoulder strap 118 is approximately between 20 and 35 centimeters . in one example , vertical distance 424 measures 28 centimeters . the horizontal distance 426 between the midpoint of second end 124 of primary left shoulder strap 114 and the midpoint of second end 130 of primary right shoulder strap 118 is approximately between 65 and 85 centimeters . in one example , horizontal distance 426 is approximately 75 centimeters . fig5 illustrates in detail the attachment of first end 128 of secondary right shoulder strap 126 to storage portion 102 . strap 126 attaches to storage portion 102 such that when strap 126 is extended toward top side 104 , strap 126 forms an angle having a desired range of approximately between 0 and 45 degrees , measured down ( and to the left ) from vertical . in some examples , the desired maximum of this angle is between 15 and 30 degrees . in other examples , the desired minimum of this angle is between 0 and 10 degrees . combinations of desired minimum angles between 0 and 10 and desired maximum angles between 15 and 30 are also contemplated . in one specific example , the desired minimum angle is approximately 5 degrees , and the desired maximum angle is approximately 20 degrees . in another specific example , the desired minimum angle is approximately 10 degrees , and the desired maximum angle is approximately 15 degrees . when first end 128 is substantially perpendicular to sides 502 and 504 of secondary right shoulder strap 126 such that strap 126 appears rectangular , the attachment angle 506 of first end 128 to storage portion 102 corresponds to the angle of strap 126 from vertical . that is , attachment angle 506 is between 0 and 45 degrees measured up ( and left ) from horizontal line 508 and the angle of strap 126 measured down ( and left ) from vertical is also between 0 and 45 degrees . dashed lines 510 and 512 indicate the desired angle range of sides 502 and 504 of strap 126 when sides 502 and 504 are substantially parallel , first end 128 is connected to storage portion 102 , and strap 126 is extended toward the top side 104 from first end 128 . dashed line 510 indicates the maximum desired angle of sides 502 and 504 , which , when first end 128 is perpendicular to sides 502 and 504 , occurs when angle 506 is at the maximum desired . that is , when connection angle 506 is at the maximum desired , sides 502 and 504 are substantially parallel to dashed line 510 . similarly , dashed line 512 indicates the minimum desired angle of sides 502 and 504 , which , when first end 128 is perpendicular to sides 502 and 504 , occurs when angle 506 is at the minimum desired angle of 0 , resulting in sides 502 and 504 being substantially vertical . in some examples , dashed line 510 is at an angle of approximately 45 degrees measured down ( and to the left ) from vertical . in other examples , dashed line 510 is at an angle of between approximately 10 and 30 degrees measured down from vertical . in still a further example , dashed line 510 is at angle of approximately 20 degrees measured down from vertical . dashed line 512 is substantially vertical . in other examples , dashed line 512 is at an angle of between approximately 0 and 10 degrees measured down ( and to the left ) from vertical . in other examples , first end 128 is not perpendicular to sides 502 and 504 , and first end 128 is attached at an angle selected to cause sides 502 and 504 to have an angle between dashed lines 510 and dashed lines 512 , as described above . it should be appreciated that fig5 illustrates strap 126 attached such that sides 502 and 504 of strap 126 have an angle measured down and to the left of vertical between the angles represented by dashed lines 510 and 512 . solid lines 514 and 516 , along with dashed lines 510 and 512 represent an approximate area of storage portion 102 on which it is desirable to attach first end 128 . as discussed above , minimum desired vertical distance 422 in fig4 indicates the minimum desired vertical distance between substantially horizontal line 408 of fig4 and the midpoint of first end 128 when attached to storage portion 102 . in some examples , the attachment illustrated in fig5 is mirrored for secondary left shoulder strap 120 . fig6 illustrates ergonomic backpack with enhanced fit 600 that has a “ yoke ” strap configuration . backpack 600 is substantially similar to backpack 100 of fig1 - 5 except for the connection of the primary shoulder straps to the storage portion . primary left shoulder strap 614 attaches to storage portion 602 along first connection area 620 , and primary right shoulder strap 618 connects to storage portion 602 along first connection area 622 . in fig4 , the primary straps were shown as being tangential , along with a substantially horizontal line , to a circle . in the example shown in fig6 , the area between the points along primary shoulder straps 614 and 618 that first touch circle 624 is filled in with material to form a yoke connection . primary left shoulder strap 614 and primary right shoulder strap 618 are connected to each other and to storage portion 602 adjacent to first and second connection areas 620 and 622 with one or more pieces of material such that the one or more pieces of material form a curve between primary left shoulder strap 614 and primary right shoulder strap 618 substantially the same as the curve of circle 624 . many backpacks , such as the backpacks illustrated in fig1 - 6 , are designed to be “ unisex ” and fit both men and women . women often still prefer backpacks designed especially for the female physique . fig7 and 8 illustrate ergonomic backpacks with enhanced fit similar to the backpacks shown in fig4 and 6 but that are specifically designed for women . fig7 illustrates an ergonomic backpack with enhanced fit 700 . as with backpack 100 of fig1 - 6 , backpack 700 includes primary left shoulder strap 702 , primary right shoulder strap 704 , storage portion 706 , and secondary shoulder straps 708 and 710 . in contrast to circle 410 of fig4 , the circle 712 tangential to primary left shoulder strap 702 , primary right shoulder strap 704 , and substantially horizontal line 714 has a smaller radius 716 of between approximately 5 and 10 centimeters . in one example , radius 716 measures approximately 7 . 5 centimeters . the vertical distance 718 between substantially horizontal line 714 and both the midpoint of second end 720 of primary left shoulder strap 702 and the midpoint of second end 722 of primary right shoulder strap 704 is approximately between 20 and 35 centimeters . in one example , vertical distance 718 measures approximately 28 centimeters . in another example , vertical distance 718 measures approximately 27 . 3 centimeters . the horizontal distance 724 between the midpoint of second end 720 of primary left shoulder strap 702 and the midpoint of second end 722 of primary right shoulder strap 704 is approximately between 65 and 85 centimeters . in one example , horizontal distance 724 is approximately 75 centimeters . in another example , horizontal distance 724 is approximately 75 . 1 centimeters . backpack 700 also differs from backpack 100 in the amount of curvature of primary shoulder straps 702 and 704 as represented by circle 726 . arc 728 of circle 726 is between approximately 35 and 55 degrees . in one example , arc 728 measures approximately 45 degrees . radius 730 is approximately between 7 and 11 centimeters . in one example , radius 7 30 measures approximately 9 . 5 centimeters . other dimensions , such as the maximum extent of storage portion 706 relative to substantially horizontal line 714 , may be the same as for backpack 100 or may be smaller to account for the smaller size of the average woman relative to the average man . fig8 illustrates an ergonomic backpack 800 with enhanced fit having a yoke connection between primary left shoulder strap 802 , primary right shoulder strap 804 , and storage portion 806 , similar to that discussed with regard to claim 6 . the present invention has been described in relation to particular examples , which are intended in all respects to be illustrative rather than restrictive . alternative examples will become apparent to those of ordinary skill in the art to which the present invention pertains without departing from its scope . from the foregoing , it will be seen that this invention is one well adapted to attain all the ends and objects set forth above , together with other advantages which are obvious and inherent to the system and method . it will be understood that certain features and subcombinations are of utility and may be employed without reference to other features and subcombinations . this is contemplated by and is within the scope of the claims . | 0 |
or a salt , ester or derivative thereof , wherein : r1 represents angeloyl group ; r2 represents angeloyl group ; r3 represents oh or h ; r4 represents ch3 or ch 2 oh ; and r5 represents d - glucose or d - galactose . or a salt , ester or derivative thereof , wherein : r1 represents angeloyl group ; r2 represents angeloyl group ; and r3 represents ac or h . or a salt , ester or derivative thereof , wherein : r1 represents angeloyl group ; r2 represents angeloyl group ; r3 represents oh or h ; r4 represents ch3 or ch2oh ; and r5 represents sugar moiety or sugar chain selected from the group consisting of : d - glucose , d - galactose , l - rhamose , l - arabinose , d - xylose , alduronic acid , d - glucuronic acid and d - galacturonic acid . r1 represent angeloyl group ; r2 represent angeloyl group ; r3 represents ac or h ; r4 represents h or oh ; and r5 represents sugar moiety or sugar chain selected from the group consisting of : d - glucose , d - galactose , l - rhamnose , l - arabinose , d - xylose , alduronic acid , d - glucuronic acid and d - galacturonic acid . in an embodiment , the angeloyl groups are in the trans - position on a planar structure . this invention provides a composition for inhibiting tumor cell growth , comprising the above - described compounds . in an embodiment , the composition comprises a suitable carrier . in another embodiment , the composition comprises a pharmaceutically suitable carrier . this invention provides a method for treating ovarian cancer in a subject , comprising administering to said subject an effective amount of the above - described compositions . a method for isolating compounds from xanthoceras sorbifolia herb or plants from the sapindaceae family comprising the steps of : ( a ) extracting xanthoceras sorbifolia or plant powder with organic solvents to obtain an organic extract ; ( b ) collecting the organic extract ; ( c ) refluxing the organic extract to obtain a second extract ; ( d ) removing the organic solvent from the second extract ; ( e ) drying and sterilizing the second extract to obtain a crude extract powder ; ( f ) fractionating the crude extract powder into components using hplc and fplc chromatography with silica gel , c18 and other equivalent solid phase materials ; ( g ) monitoring absorption wavelength at 207 nm or 254 nm ; ( h ) identifying the bioactive components of the crude extract powder ; ( i ) purifying one or more bioactive components of the crude extract powder with fplc to obtain one or more fraction of the bioactive component ; and ( j ) isolating the desired fraction of the bioactive component with preparative hplc . this invention provides a compound comprising the following structure , i . e ., see fig1 , with the formula of c 57 h 88 o 23 and the name of 3 - o -[ β - d - galactopyranosyl ( 1 → 2 )]- α - l - arabinofuranosyl ( 1 → 3 )- β - d - glucuronopyranosyl - 21 , 22 - o - diangeloyl - 3β , 15α , 16α , 21β , 22α , 28 - hexahydroxyolean - 12 - ene , also known as xanifolia - y . this compound was isolated from xanthoceras sorbifolia . this compound belongs to an oleanene triterpenoidal saponin with a trisaccharide chain attached at c - 3 of the aglycone and two angeloyl groups acylated at c - 21 and c - 22 . this compound has anti - cancer activity , the assignment of this structure is supported by spectral data , i . e ., h - nmr , 2d nmr ( hmbc , hmqc ), and ms ( maldi - tof , ems ). accordingly , this compound has the characteristic property as shown in fig1 - 22 or table 5 . 1 . this invention provides another compound comprising the following structure , i . e ., see fig2 , with the formula of c 65 h 100 o 27 and the name of 3 - o -[ β - d - galactopyranosyl ( 1 → 2 )]- α - l - arabinofuranosyl ( 1 → 3 )- β - d - glucuronopyranosyl - 21 - o -( 3 , 4 - diangeloyl )- α - l - rhamnophyranosyl - 22 - o - acetyl - 3β , 16α , 21β , 22α , 28 - pentahydroxyolean - 12 - ene , also known as xanifolia - y1 . this compound is a bisdesmosidic polyhydroxyoleanene triterpenoidal saponin with a trisaccharide chain at c - 3 of the backbone and a monosaccharide moiety at c - 21 where two angeloyl groups were acylated at c - 3 and c - 4 position . this compound has anti - cancer activity . the assignment of this structure is supported by spectral data , i . e ., h - nmr , 2d nmr ( hmbc , hmqc , cosy ), and ms ( maldi - tof ). accordingly , this compound has the characteristic property as shown in fig2 - 27 . this invention provides a third compound comprising the following structure , i . e ., see fig2 , with the formula of c 57 h 88 o 24 and chemical name of 3 - o -[ β - d - glucopyranosyl -( 1 → 2 )]- α - l - arabinofuranosyl ( 1 → 3 )- β - d - glucuronopyranosyl - 21 , 22 - o - diangeloyl - 3β , 15α , 16α , 21β , 22α , 24β , 28 - heptahydroxyolean - 12 - ene , also known as y2 . this compound ( y2 ) belongs to saponins comprising a triterpene , a sugar moiety and angeloyl groups linked to the backbone . the angeloyl groups are linked to the backbone at c21 and c22 positions . this compound has anti - cancer activity . the assignment of this structure is supported by spectral data , i . e ., h - nmr , c - nmr , 2d nmr ( hmbc , hmqc , tocsy ), and ms ( maldi - tof ). accordingly , this compound has the characteristic property as shown in fig2 - 34 . this invention provides a fourth active compound y8 and the structure was determined by 1d nmr , 2d nmr , and ms analysis . the compound comprises the following structure , i . e . see fig3 , with the formula of c 57 h 87 o 23 and chemical name of 3 - o -[ β - glucopyranosyl ( 1 → 2 )]- α - arabinofuranosyl ( 1 → 3 )- β - glucuronopyranosyl - 21 , 22 - o - diangeloyl - 3β , 16α , 21β , 22α , 24β , 28 - hexahydroxyolean - 12 - ene . the assignment of this structure is supported by spectral data , i . e ., h - nmr , c13 - nmr and 2d nmr ( hmqc ). accordingly , this compound has the characteristic property as shown in fig3 - 38 . this invention provides a fifth active compound y9 and the structure was determined by 1d nmr , 2d nmr , and ms analysis . the compound comprises the following structure , i . e ., see fig3 , with the formula of c 63 h 98 o 26 and chemical name of 3 - o -[ β - galactopyranosyl ( 1 → 2 )]- α - arabinofuranosyl ( 1 → 3 )- β - glucuronopyranosyl - 21 - o -( 3 , 4 - diangeloyl )- α - rhamnopyranosyl - 3β , 16α , 21β , 22α , 28 - pentahydroxyolean - 12 - ene . the assignment of this structure is supported by spectral data , i . e ., h - nmr , 2d nmr ( hmqc and hmbc ). accordingly , this compound has the characteristic property as shown in fig4 - 42 . this invention provides a sixth active compound y10 and the structure was determined by 1d nmr , 2d nmr and ms analysis . the compound comprises the following structure , i . e ., see fig4 , with the formula of c 57 h 87 o 22 and chemical name of 3 - o -[[ β - galactopyranosyl ( 1 → 2 )]- α - arabinofuranosyl ( 1 → 43 )- β - glucuronopyranosyl - 21 , 22 - o - diangeloyl - 3β , 16α , 21β , 22α , 28 - pentahydroxyolean - 12 - ene . the assignment of this structure is supported by spectral data , i . e ., h - nmr , c13 - nmr and 2d nmr ( hmqc ). accordingly , this compound has the characteristic property as shown in fig4 - 46 . this invention provides a compound comprising a sugar and a triterpene or sapogenin , wherein the triterpene or sapogenin is acylated at carbon 21 and 22 with angeloyl groups . in an embodiment , the compound comprises one or more sugars . this invention shows that extracts of xanthoceras sorbifolia have anticancer activity . the experiments for determining the anti - cancer activity employ human cells lines derived from eleven human organs ( htb - 9 ( bladder ), hela - s3 ( cervix ), du145 ( prostate ), h460 ( lung ), mcf - 7 ( breast ), k562 ( leukocytes ), hct116 ( colon ), hepg2 ( liver ), u2os ( bone ), t98g ( brain ) and ovcar - 3 ( ovary )). among the 11 cell lines studies , their sensitivity toward xanthoceras sorbifolia extract can be divided into four groups : ( a ) most sensitive : ovary , see fig1 ; ( b ) sensitive : bladder , bone , ( c ) srmi - sensitive : prostate , leukocyte , liver , breast , and brain ; and ( d ) lease sensitive : colon , cervix , and lung . see fig1 a - d . their ic50 values are listed in table 3 . 1 . table 3 . 1 ic50 values of xanthoceras sorbifolia extract determined in different cancer cells ic50 determined by cancer cells from different organs mtt assay ( ug / ml ) ovary ( most sensitive ) 15 - 15 bladder ( sensitive ) 45 - 50 bone 40 - 55 prostate ( semi - sensitive ) 40 - 50 leukocyte 45 - 50 liver 45 - 65 breast 65 brain 70 - 85 colon ( least sensitive ) 90 cervix 115 lung 110 in order to identify the active compounds of xanthoceras sorbifolia , the extracts from xanthoceras sorbifolia were separated by chromatography comprising fplc ( fast protein liquid chromatography ) and hplc ( high preferment liquid chromatography ). multiple fractions were obtained by fplc procedures , i . e ., see fig9 and hplc , i . e ., see fig8 . analysis of the fractions by hplc shows that the extract comprises 26 identifiable fractions , designated as a to z , which are shown in fig8 . anti - cancer activities of these fractions were determined by the mtt assay . fplc fraction 5962 , i . e ., see fig1 , which coresponding to fraction y in hplc , i . e ., see fig8 , has the anti - cancer activity . fraction 5962 was further separated into 4 components y1 to y4 , i . e ., see fig1 . fraction 6365 was further seperated into 5 - 6 components , designated as y5 - y10 . see fig1 . the compounds y or y3 , y1 and y2 show strong anti - tumor activity , i . e ., see fig2 - 3 , and were therefore isolated . similarly , compounds y8 , y9 and y10 also show strong anti - tumor activity , i . e ., see fig4 , and were therefore purified . see fig1 . the structures of these active compounds , i . e ., y , y1 , y2 , y8 , y9 and y10 and their uses are the subject of this application . the inhibition effects of the compounds of the present invention on ovarian cancer cells were evaluated with the mtt assay . compound y shows at least 10 times higher potency ( ic50 = 1 . 5 ug / ml ), i . e ., see fig2 , than the original crude extract as shown in fig1 ( ic50 = 20 ug / ml ). the selectivity of compound y toward different cell lines was tested , and it was found that compound y has a much higher potency toward ovarian cancer cells as compared to the cervical cancer cells . see fig1 . this invention provides a method for identifying and isolating the active compounds from plants , herbs or plant extracts . in an embodiement , the extracts include extracts of xanthoceras sorbifolia or of plants from the sapindaceae family . this invention provides the chemical structures of six active compounds obtainable from xanthoceras sorbifolia or of plants from the sapindaceae family . the compounds are shown in fig1 . this invention provides spectral data including h - nmr , c - 13 - nmr , 2d nmr ( hmbc , hmqc , cosy , tocsy ), and ms ( maldi - tof , esi - ms ) in supporting the assigned structures . this invention provides a consensus sub - structure or functional group from the active compounds purified from fraction y . the compounds , such as y or y3 , y1 , y2 , y8 , y9 and y10 , obtainable from fraction y are collectively referred to as “ ys ”. the consensus sub - structure or functional group of these compounds is the biangeloyl groups located on adjacent carbons . for example , in compound y , y2 , y8 and y10 , the biangeloyl are located at 21β and 22α of the triterpene backbone . see fig5 . in compound y1 and y9 , the biangeloyl groups are located at c3 and c4 of the sugar ring . see fig6 . accordingly , the biangeloyl groups of these active compounds are situated in trans - position with respect to each other on a planar structure . see fig7 . the results of this invention indicate the active functional group of these compounds is a biangeloyl group attached in - trans to adjacent carbons located in a planar structure . see fig7 . this invention provides a composition comprising the above - described compounds and a suitable carrier . this invention provides a pharmaceutical composition comprising an effective amount of the above - described compounds and a pharmaceutically acceptable carrier . this invention provides an anti - ovarian cancer agent or composition comprising the above - described compositions . this invention provides a composition effective against cancer growth . the cancer includes but is not limited to bladder cancer , bone cancer and ovary cancer . this invention provides a composition comprising the above - described compounds and their salts , esters , derivatives or metabolites capable of inhibiting tumour growth . this invention provides a composition comprising the above - described compounds and their salts , esters , derivatives or metabolites capable of inhibiting virus growth and / or activities . in addition to the compound ys , other compounds were also purified from fraction r and fraction o of the extract of xanthoceras sorbifolia , which are designated herein as r1 and o54 , respectively . their structures were determined . preliminary experiments indicate both r1 and o54 do not have anticancer activity . the structure of compound r1 shown below and in fig4 , has a chemical formula of c 65 h 106 o 29 and chemical name of 3 - o -[ angeloyl -( 1 → 3 )- β - d - glucopyranosyl -( 16 )]- β - d - glucopyranosyl - 28 - o -[ α - l - rhamnopyranosyl -( 1 → 2 )- β - d - glucopyranosyl -( 1 → 6 )- β - d - glucopyranosyl - 3β , 21β , 22α , 28 - tetrahydroxyolean - 12 - ene , also known as xanifolia - r1 . the assignment of this structure is supported by spectral data , i . e ., h - nmr , c - 13 - nmr , 2d nmr ( hmbc , hmqc , cosy ), and ms ( maldi - tof , ems ). accordingly , this compound has the characteristic property as shown in fig4 - 52 . this invention provides a compound o54 purified from the extract of xanthoceras sorbifolia . the structure of o54 was determined and has a formula of c 60 h 100 o 28 . the structure of compound o54 is shown below , i . e ., see fig5 : the assignment of this structure is supported by spectral data , i . e ., 1h - nmr , 2d nmr ( hmbc , hmqc ). accordingly , this compound has the characteristic property as shown in fig5 - 56 . this invention provides methods for identifying and purifying compounds from the plant extract of xanthoceras sorbifolia . six compounds have been identified and purified , and have been shown to have anticancer activity . these compounds are collectively referred to as triterpenoidal saponins . a consensus sub - structure is identified from these active compounds . a consensus sub - structure or active functional groups of these compounds is the biangeloyl groups located on adjacent carbons . the biangeloyl groups are located at 21β and 22α of the triterpene backbone , i . e ., see fig5 , or located at c3 and c4 of the sugar ring , i . e ., see fig6 . accordingly , the biangeloyl groups of these active compounds are situated in trans - position in respect to each other on a planar structure . see fig7 . the structures or derivatives of the compounds of the present invention are also obtainable by chemical systhesis or from biological sources . this invention will be better understood from examples which follow . however , one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the invention as described more fully in the claims which follow thereafter . ( a ) extracting xanthoceras sorbifolia powder of husks or branches or stems or leaves or kernels or roots or barks with organic solvent at ratio of 1 : 2 for 4 - 5 times for 20 - 35 hours each time to form an organic extract ; ( b ) collecting the organic extract ; ( c ) refluxing the organic extract for 2 - 3 times at 80 ° c . to form second extracts ; ( d ) removing the organic solvent from the second extract ; and ( e ) drying and sterilizing the extract to form a xanthoceras sorbifolia extract powder . experiment 2 : analysis of xanthoceras sorbifolia extract components by hplc chromatography hplc . a c - 18 reverse phase μbondapak column ( water p / n 27324 ) was equilibrated with 10 % acetonitrile , 0 . 005 % trifluoroacetic acid ( equilibration solution ). an extract of xanthoceras sorbifolia prepared using the methods described in experiment 1 was dissolved in equilibration solution ( 1 mg / ml ) before applying into the column . 20 ug of samples was applied into column . elution conditions : fractions were eluted ( with flow rate 0 . 5 ml / min .) with acetonitrile gradient from 10 % to 80 % in 70 min , and then remains at 80 % for 10 min . the acetonitrile concentration then decreased to 10 % and remained at 10 % for 25 min . the fractions were monitored at 207 nm and recorded in chart with a chart speed of 0 . 25 cm / min and with od full scale of 0 . 128 . instruments . waters model 510 solvent delivery system ; waters 484 tunable absorbance detector ; waters 745 / 745b data module . absorbance analysis . the absorption profile of xanthoceras sorbifolia extract at various wavelengths was determined . an extract of xanthoceras sorbifolia of the present invention was dissolved in 10 % acetonitrile / tfa and scanned at 200 - 700 nm with a spectrophotometer [ spectronic ins . model gene sys2 ]. hplc . about 60 - 70 peaks can be accounted for in the profile . among them four are major peaks , 10 are of medium size and the rest are small fractions . the peaks are labelled with a to z following increased concentration of acetonitrile elution . see fig8 . absorption maximum . three absorption maximum were identified for xanthoceras sorbifolia plant extract ; 207 nm , 278 nm and 500 nm . see fig5 . experiment 3 : determination of the cell - growth activity effected by xanthoceras sorbifolia extract with cancer cells derived from different human organs using mtt assay cells . human cancer cell lines were obtained from american type culture collection : htb - 9 ( bladder ), hela - s3 ( cervix ), du145 ( prostate ), h460 ( lung ), mcf - 7 ( breast ), k562 ( leukocytes ), hct116 ( colon ), hepg2 ( liver ), u2os ( bone ), t98g ( brain ) and ovcar - 3 ( ovary ). cells were grown in culture medium ( hela - s3 , du145 , mcf - 7 , hep - g2 and t98g in men ( earle &# 39 ; s salts ); htb - 9 , h460 , k562 , ovcar - 3 in rpmi1640 ; hct - 116 , u2os in mccoy - 5a ) supplemented with 10 % fetal calf serum , glutamine and antibiotics in a 5 % co 2 humidified incubator at 37 ° c . mtt assay . the procedure for mtt assay followed the method described in ( carmichael et al ., 1987 ) with only minor modifications . cells were seeded into a 96 - wells plate at concentrations of 10 , 000 / well ( htb - 9 , hela , h460 , hct116 , t98g , ovcar - 3 ), 15 , 000 / well ( du145 , mcf - 7 , hepg2 , u2os ), or 40 , 000 / well ( k562 ), for 24 hours before drug - treatment . cells were then exposed to drugs for 48 hours ( 72 hours for hepg2 , u2os , and 96 hours for mcf - 7 ). after the drug - treatment , mtt ( 0 . 5 mg / ml ) was added to cultures for an hour . the formation of formazan ( product of the reduction of tetrazolium by viable cells ) was dissolved with dmso and the o . d . at 490 nm was measured by an elisa reader [ dynatech . model mr700 ]. the mtt level of cells before drug - treatment was also measured ( to ). the % cell - growth (% g ) is calculated as : where tc or td represent o . d . readings of control or drug - treated cells . when t0 & gt ; td , then the cytotoxicity ( lc ) expressed as % of the control is calculated as : among the 11 cell lines studies , inhibition of cell - grwoth after exposure of plant extract was observed . however , their sensitivity toward xanthoceras sorbifolia extract is different . it can be divided into four groups : most sensitive , i . e ., ovary ; sensitive , i . e ., bladder , bone ; semi - sensitive , i . e ., prostate , leukocyte , liver , breast , and brain ; and least sensitive , i . e ., colon , cervix , and lung . see fig1 , 15 and 16 a - d . their ic50 values are listed in table 3 . 1 . table 3 . 1 ic50 values of xanthoceras sorbifolia extract determined in different cancer cells ic50 determined by cancer cells from different organs mtt assay ( ug / ml ) ovary ( most sensitive ) 15 - 15 bladder ( sensitive ) 45 - 50 bone 40 - 55 prostate ( semi - sensitive ) 40 - 50 leukocyte 45 - 50 liver 45 - 65 breast 65 brain 70 - 85 colon ( least sensitive ) 90 cervix 115 lung 110 in addition to cell - growth inhibition , the xanthoceras sorbifolia plant extract also stimulate a minor cell growth at low concentrations in bladder , bone and lung cells . results indicate that there is a cell or tissue stimulation component ( s ) in the extract . see fig1 a and 16d . to investigate the inhibition components of the xanthoceras sorbifolia plant extract , the plant extract was fractionated . fig1 shows the results of the screening of fractions obtained after fplc chromatography for cell growth - inhibition activity . the assay was conducted with bladder cells . the fractions obtained from fplc , as shown in fig9 , were used . as shown in fig9 , different components of xanthoceras sorbifolia extracts cause either growth or inhibition effects on cells . only fractions 5962 , designated as fraction y , cause cell growth inhibition . abscissa : concentration ( ug / ml ). ordinate : % cell growth ( determined by mtt assay ). experiment 4 : purification of the inhibition components in the xanthoceras sorbifolia extract . column . octadecyl functionalized silica gel . column dimension : 2 cm × 28 cm ; equilibrated with 10 % acetonitrile — 0 . 005 % tfa before use . gradient elution condition : 10 - 80 % acetonitrile in a total volume of 500 ml . the elution profile of the chromatography shows 4 - 5 broad fractions . see fig9 . these fractions were analyzed with hplc . specific components , corresponding to a - z as specified in fig8 , are then assigned in these fplc fractions . fplc fractions are then grouped into 7 pools and analyzed for cell growth activity in bladder cells with mtt assay . see experiment 3 . it was found that only pool # 5962 , corresponding to fraction y in hplc , contains inhibition activity . see fig1 . it was also found in later experiments that fractions beyond 62 also show inhibition activity . the components isolated from fractions 63 - 65 showed inhibition activities . see fig4 and 13 . elution conditions : 45 % acetonitrile isocratic elution with flow rate of 1 ml / min . final separation of y fractions was achieved by hplc with a preparative column . see fig1 and 12 . these fractions , which include compound y1 , y2 , y or y3 and y4 , were collected . re - chromatography of compound y showed a single peak in hplc with a c18 reverse phase column . see fig1 a and 11b . re - chromatography of the compound y8 , y9 and y10 showed a single peak in hplc with a c18 reverse phase column . see fig1 . the pure compound ys is an amorphous white powder , soluble in aqueous alcohol , i . e ., methanol or ethanol , 50 % acetonitrile and 100 % pyridine . inhibition analysis of compound y was determined with mtt assay . fig2 shows that compound y has activity against ovarian cancer cells ( ocar - 3 ) with ic50 value of 1 . 5 ug / ml which is 10 - 15 times more potent than the unpurified extract shown in fig1 . fig1 shows the selectivity of compound y to ovarian cancer cells compared with cervical cancer cells ( hela ). fig3 shows the inhibition activities of compound y1 and y2 on the growth of ovarian cancer cells ( ocar - 3 ). fig4 shows the inhibition activities of compound y , y8 , y9 and y10 on the growth of ovarian cancer cells ( ocar - 3 ). nmr analysis . the pure compound y of xanthoceras sorbifolia was dissolved in pyridine - d5 with 0 . 05 % v / v tms . all nmr spectra were acquired using a bruker avance 600 mhz nmr spectrometer with a qxi probe ( 1h / 13c / 15n / 31p ) at 298 k . the numbers of scans for 1d 1h spectra were 16 to 128 , depending on the sample concentration . 2d hmqc spectra were recorded with spectral widths of 6000 × 24 , 000 hz and data points of 2024 × 256 for t2 and t1 dimensions , respectively . the number of scans were 4 to 128 . 2d hmbc were acquired with spectral widths of 6000 × 30 , 000 hz and data points of 2024 × 512 for t2 and t1 dimensions , respectively . the numbers of scans were 64 . the 2d data were zero - filled in t1 dimension to double the data points , multiplied by cosine - square - bell window functions in both t1 and t2 dimensions , and fourier - transformed using software xwin - nmr . the final real matrix sizes of these 2d spectra are 2048 × 256 and 2048 × 512 data points ( f2 × f1 ) for hmqc and hmbc , respectively . mass spectral analysis . the mass of samples was analyzed by ( a ) maldi - tof mass spectrometry and by ( b ) esi - ms mass spectrometry . ( a ) samples for maldi - tof were first dissolved in acetonitrile , and then mixed with the matrix chca , i . e ., alpha - cyano - 4 - hydroxycinnamic acid , 10 mg chca / ml in 50 : 50 water / acetonitrile and 0 . 1 % tfa in final concentration . the molecular weight was determined by the high resolution mass spectroscope analysis with standards . ( b ) for esi , the sample was analyzed with lcq deca xp plus machine made by thermo finnigan . it is ionized with esi source and the solvent for the compound is acetonitrile . the profile of the proton nmr is presented in fig1 . the 2d nmr profiles of hmqc and hmbc are shown in fig1 and 20 , respectively . table 5 . 1 summarizes the 2d nmr chemical shift data and the assignment of functional groups derived from these data . based on these data and analysis , the structure of compound y ( y3 ) is assigned as shown below . table 5 . 1 13c and 1h nmr data for compound y ( in pyridine - d5 ) a position c h key hmbc correlations 1 38 . 7 0 . 83 , 1 . 40 c - 3 , c - 5 , c - 9 2 26 . 4 1 . 81 , 2 . 14 — 3 89 . 6 3 . 25 , 1h , dd , c - 23 , c - 24 , glca c - 1 ′ 12 . 0 / 4 . 0 hz 4 39 . 4 — — 5 55 . 3 0 . 78 — 6 18 . 5 1 . 55 , 1 . 59 c - 8 , c - 10 7 36 . 5 2 . 00 , 2 . 10 c - 5 , c - 9 8 41 . 2 — — 9 47 . 0 3 . 06 c - 7 , c - 8 , c - 12 , c - 14 , c - 26 10 37 . 2 — — 11 23 . 7 1 . 74 , 1 . 89 — 12 125 . 2 5 . 49 , 1h , br s c - 9 , c - 11 , c - 14 , c - 18 13 143 . 4 — — 14 47 . 5 — — 15 67 . 3 4 . 21 c - 8 , c - 27 16 73 . 6 4 . 45 c - 14 , c - 15 , c - 18 17 48 . 3 — — 18 40 . 8 3 . 07 c - 12 , c - 13 , c - 14 , c - 16 , c - 19 , c - 20 , c - 28 , 19 46 . 8 1 . 41 , 1 . 69 — 20 36 . 2 — — 21 79 . 3 6 . 71 , 1h , d , 10 hz c - 20 , c - 22 , c - 29 , c - 30 , 21 - o - ang c - 1 ′′′′ 22 73 . 5 6 . 32 , 1h , d , 10 hz c - 16 , c - 17 , c - 21 , c - 28 , 22 - o - ang c - 1 ′′′′ 23 27 . 7 1 . 26 , 3h , s c - 3 , c - 4 , c - 5 , c - 24 24 16 . 5 1 . 16 , 3h , s c - 3 , c - 4 , c - 5 , c - 23 25 16 . 0 0 . 81 , 3h , s c - 1 , c - 5 , c - 9 , c - 10 26 17 . 3 0 . 99 , 3h , s c - 7 , c - 8 , c - 9 , c - 14 27 21 . 0 1 . 85 , 3h , s c - 8 , c - 13 , c - 14 , c - 15 28 62 . 9 3 . 50 , 1h , d , 11 . 0 hz , c - 16 , c - 17 , c - 18 , c - 22 3 . 76 , 1h , d , 11 . 0 hz , 29 29 . 2 1 . 09 , 3h , s c - 19 , c - 20 , c - 21 , c - 30 30 20 . 0 1 . 32 , 3h , s c - 19 , c - 20 , c - 21 , c - 29 glca 1 ′ 104 . 9 4 . 89 , 1h , d , 7 . 8 hz c - 3 2 ′ 79 . 1 4 . 38 glca c - 1 ′, c - 3 ′, gal c - 1 ′′ 3 ′ 86 . 1 4 . 20 glca c - 2 ′, c - 4 ′, ara c - 1 ′′′ 4 ′ 71 . 5 4 . 42 glca c - 3 ′, c - 5 ′, c - 6 ′ 5 ′ 78 . 0 4 . 52 glca c - 4 ′, c - 6 ′ 6 ′ 171 . 9 — — gal 1 ′′ 104 . 6 5 . 32 , 1h , d , 7 . 7 hz glca c - 2 ′ 2 ′′ 73 . 6 4 . 42 gal c - 1 ′′, c - 3 ′′ 3 ′′ 74 . 9 4 . 10 gal c - 2 ′′ 4 ′′ 69 . 5 4 . 56 gal c - 2 ′′, c - 3 ′′ 5 ′′ 76 . 4 3 . 94 gal c - 4 ′′, c - 6 ′′ 6 ′′ 61 . 6 4 . 43 , 4 . 52 gal c - 4 ′′, c - 5 ′′ ara - f 1 ′′′ 110 . 6 6 . 03 . 1h , br s glca c - 3 ′, ara c - 2 ′′′, c - 4 ′′′ 2 ′′′ 83 . 4 4 . 94 ara c - 3 ′′′ 3 ′′′ 78 . 3 4 . 78 ara c - 2 ′′′ 4 ′′′ 85 . 2 4 . 82 ara c - 5 ′′′ 5 ′′′ 62 . 2 4 . 12 , 4 . 28 ara c - 3 ′′′ 21 - o - ang 1 ′′′′ 167 . 7 — — 2 ′′′′ 129 . 6 — — 3 ′′′′ 137 . 2 5 . 96 , 1h , dq , 7 . 0 / 1 . 5 hz ang c - 1 ′′′′, c - 4 ′′′′, c - 5 ′′′′ 4 ′′′′ 15 . 5 2 . 10 , 3h , dq , 7 . 0 / 1 . 5 hz ang c - 2 ′′′′, c - 3 ′′′′ 5 ′′′′ 20 . 8 2 . 00 , 3h , s ang c - 1 ′′′′, c - 2 ′′′′, c - 3 ′′′′ 22 - o - ang 1 ′′′′ 167 . 9 — — 2 ′′′′ 129 . 8 — — 3 ′′′′ 136 . 3 5 . 78 , 1h , dq , 7 . 0 / 1 . 5 hz ang c - 1 ′′′′, c - 4 ′′′′, c - 5 ′′′′ 4 ′′′′ 15 . 5 1 . 93 , 3h , dq , 7 . 0 / 1 . 5 hz ang c - 2 ′′′′, c - 3 ′′′′ 5 ′′′′ 20 . 5 1 . 74 , 3h , s ang c - 1 ′′′′, c - 2 ′′′′, c - 3 ′′′′ a the data were assigned based on hmqc and hmbc correlations . the mass spectrum of compound y as determined by maldi - tof and esi - ms , i . e ., see fig2 , 22 , indicates that the mass of compound y is 1140 . 57 which agree with the theoretical mass of the compound y . the active compound y isolated from extract of xanthoceras sorbifolia is an oleanene triterpenoidal saponin with a trisaccharide chain attached at c - 3 of the aglycone and two angeloyl groups acylated at c - 21 and c - 22 . the formula of y is c 57 h 88 o 23 , and the chemical name of compound y is : 3 - o -[ β - d - galactopyranosyl ( 1 → 2 )]- α - l - arabinofuranosyl ( 1 → 3 )- β - d - glucuronopyranosyl - 21 , 22 - o - diangeloyl - 3β , 15α , 16α , 21β , 22α , 28 - hexahydroxyolean - 12 - ene . experiment 6 : determination of the chemical structure of compound y1 of xanthoceras sorbifolia extract the method for nmr and ms analysis for compound y1 is similar to the method described in experiment 5 . the spectrum of the h - nmr is presented in fig2 . the 2d nmr spectra of hmqc , hmbc and cosy are shown in fig2 , 26 and 27 , respectively . table 6 . 1 summarizes the chemical shift data and the assignment of functional groups derived from these data . table 6 . 1 13c and 1h nmr data for compound y1 ( in pyridine - d5 ) position c h 1 38 . 6 0 . 85 , 1 . 33 2 26 . 3 1 . 86 , 2 . 10 3 89 . 7 3 . 25 , 1h , dd 4 39 . 5 — 5 55 . 5 0 . 75 6 18 . 3 1 . 40 , 1 . 43 7 33 . 1 1 . 20 , 1 . 50 8 40 . 0 — 9 46 . 7 1 . 69 10 36 . 5 — 11 22 . 5 2 . 30 12 123 . 6 5 . 36 , 1h , br s 13 143 . 5 — 14 41 . 8 — 15 34 . 7 1 . 53 , 1 . 73 16 68 . 5 4 . 45 17 48 . 2 — 18 39 . 9 3 . 04 19 47 . 6 1 . 30 , 3 . 05 20 36 . 7 — 21 85 . 3 5 . 05 , 1h , d 22 73 . 8 6 . 17 , 1h , d 23 27 . 7 1 . 29 , 3h , s 24 16 . 5 1 . 16 , 3h , s 25 15 . 5 0 . 81 , 3h , s 26 17 . 1 0 . 82 , 3h , s 27 20 . 6 1 . 83 , 3h , s 28 63 . 7 3 . 42 , 1h , d , 3 . 60 , 1h , d 29 29 . 9 1 . 42 , 3h , s 30 19 . 9 1 . 37 , 3h , s glca 1 105 . 0 4 . 88 , 1h , d 2 79 . 0 4 . 37 3 86 . 0 4 . 20 4 71 . 6 4 . 43 5 78 . 0 4 . 50 6 171 . 8 — gal 1 104 . 5 5 . 31 , 1h , d 2 73 . 5 4 . 43 3 74 . 9 4 . 10 4 69 . 5 4 . 57 5 76 . 3 3 . 95 6 61 . 1 4 . 44 , 4 . 53 ara - f 1 110 . 9 6 . 04 . 1h , br s 2 83 . 3 4 . 95 3 78 . 3 4 . 78 4 85 . 2 4 . 82 5 62 . 0 4 . 13 , 4 . 31 21 - o - rha 1 105 . 1 4 . 92 , 1h , d 2 70 . 5 4 . 25 3 74 . 0 5 . 59 4 71 . 5 5 . 70 5 68 . 5 3 . 89 6 17 . 6 1 . 18 , 3h , d rh - 3 - ang 1 167 . 2 — 2 127 . 9 — 3 138 . 7 5 . 92 , 1h , q 4 15 . 7 2 . 02 , 3h , d 5 20 . 6 1 . 92 , 3h , s rh - 4 - ang 1 167 . 2 — 2 128 . 0 — 3 137 . 9 5 . 87 , 1h , q 4 15 . 5 1 . 96 , 3h , d 5 19 . 8 1 . 85 , 3h , s 22 - o - ac 1 171 . 4 — 2 21 . 8 2 . 31 , 3h , s based on these data and analysis , the structure of compound y1 is assigned and shown below . compound y1 isolated from extract of xanthoceras sorbifolia is a bisdesmosidic polyhydroxyoleanene triterpenoidal saponin with a trisaccharide chain at c - 3 of the backbone and a monosaccharide moiety at c - 21 where two angeloyl groups were acylated at c - 3 and c - 4 position . the formula of y1 is c 65 h 100 o 27 , experiment 7 : determination of the chemical structure of compound y2 of xanthoceras sorbifolia extract . the method for nmr and ms analysis for compound y2 is similar to the method described in experiment 5 . the 1 d and 2 d nmr spectra of h - nmr , c - 13 nmr , hmqc , hmbc and ( tocsy ) and ms ( maldi - tof ) of y2 are showed in fig2 - 34 . table 7 . 1 summarizes the 1 d and 2d nmr chemical shift data and the assignment of functional groups derived from these data . table 7 . 1 13c and 1h nmr data for y2 ( in pyridine - d5 ) a position c h 1 38 . 4 0 . 83 , 1 . 36 2 26 . 4 1 . 89 , 2 . 25 3 91 . 3 3 . 39 , 1h , m 4 43 . 4 — 5 56 . 7 0 . 87 , 1h , d , 12 . 0 hz 6 18 . 6 1 . 31 , 1 . 57 7 36 . 3 1 . 97 , 2 . 12 8 40 . 7 — 9 46 . 7 1 . 63 10 36 . 6 — 11 23 . 9 1 . 69 , 1 . 89 12 125 . 1 5 . 48 , 1h , br s 13 143 . 4 — 14 47 . 5 — 15 67 . 1 4 . 18 , 1h , d , 4 . 1 hz 16 73 . 2 4 . 43 17 48 . 1 — 18 41 . 4 3 . 06 19 46 . 6 1 . 40 , 3 . 08 20 36 . 1 — 21 78 . 3 6 . 69 , 1h , d , 10 . 2 hz 22 73 . 1 6 . 30 , 1h , d , 10 . 2 hz 23 22 . 0 1 . 29 , 3h , s 24 62 . 9 3 . 28 , 1h , d , 11 . 2 hz ; 4 . 32 25 15 . 6 0 . 64 , 3h , s 26 17 . 1 0 . 94 , 3h , s 27 20 . 8 1 . 84 , 3h , s 28 63 . 1 3 . 48 , 3 . 72 ( each , 1h , d , 10 . 6 hz ) 29 29 . 3 1 . 09 , 3h , s 30 20 . 0 1 . 32 , 3h , s 3 - o - glca 1 104 . 5 4 . 87 , 1h , d , 7 . 2 hz 2 78 . 6 4 . 31 3 86 . 5 4 . 23 4 71 . 6 4 . 45 5 77 . 4 4 . 53 6 171 . 9 glc 1 103 . 7 5 . 48 , 1h , d , 7 . 8 hz 2 75 . 3 4 . 02 3 78 . 0 4 . 31 4 69 . 3 4 . 52 5 78 . 2 3 . 62 6 61 . 5 4 . 33 , 4 . 50 ara 1 110 . 1 6 . 05 , 1h , br s 2 83 . 5 4 . 97 3 77 . 8 4 . 74 4 85 . 0 4 . 84 5 62 . 2 4 . 18 , 4 . 33 21 - o - ang 1 167 . 5 — 2 128 . 7 — 3 137 . 2 5 . 95 , 1h , dd , 14 . 4 / 7 . 2 hz 4 16 . 7 2 . 08 , 3h , d , 7 . 2 hz 5 20 . 6 2 . 00 , 3h , s 22 - o - ang 1 167 . 9 — 2 128 . 9 — 3 136 . 3 5 . 76 , 1h , dd , 14 . 4 / 7 . 2 hz 4 15 . 6 1 . 95 , 3h , dd , 7 . 2 hz 5 20 . 4 1 . 74 , 3h , s a the data were assigned based on cosy , hmqc and hmbc correlations . based on these data and analysis , the compound y2 isolated from extract of xanthoceras sorbifolia is an oleanene triterpenoidal saponin with a trisaccharide chain attached at c - 3 of the aglycone and two angeloyl groups acylated at c - 21 and c - 22 . the chemical structure of y2 is shown below . see also fig2 . the formula of y2 is c 57 h 88 o 24 , and the chemical name of compound y2 is : 3 - o -[ β - d - glucopyranosyl -( 1 → 2 )]- α - l - arabinofuranosyl ( 1 → 3 )- β - d - glucuronopyranosyl - 21 , 22 - o - diangeloyl - 3β , 15α , 16α , 21β , 22α , 24β , 28 - heptahydroxyolean - 12 - ene . the profile of the proton nmr of y4 is presented in fig5 . the profiles of 2d nmr ( hmqc ) of y4 is presented in fig5 . experiment 8 . purification of the inhibition components y8 - y10 in the xanthoceras sorbifolia extract ( a ) fractionation of xanthoceras sorbifolia extracts components with fplc methods the methods for this experiment are similar to the methods decribed in experiment 4 section ( a ) and ( b ). the elution profile shows 4 - 5 broad fractions . see fig9 . these fractions were analyzed with hplc . fplc fractions 63 , 64 and 65 are further separated on 45 % isocratic analysis , 4 - 5 major components were separated ( fig1 ). these fractions were assigned designations y8 , y9 and y10 . these fractions were collected . re - chromatography of the compound y8 , y9 and y10 showed a single peak in hplc with a c18 reverse phase column . see fig1 . inhibition analysis of purified compounds was determined with the mtt assay . results indicate that compound y8 , y9 and y10 has activity against ovarian cancer cells ( ocar - 3 ) with ic50 values of 3 , 4 and 1 . 5 ug / ml , respectively . see fig4 . experiment 9 . determination of the chemical structure of compound y8 of xanthoceras sorbifolia extract the method for nmr and ms analysis for compound y8 is similar to the method described in experiment 5 . the spectral profiles of the h - nmr , c13 - nmr 2d nmr ( hmqc ) of compound y8 are presented in fig3 - 38 . based on these data and analysis , the compound y8 isolated from extract of xanthoceras sorbifolia is an oleanene triterpenoidal saponin with a trisaccharide chain attached at c - 3 of the aglycone and two angeloyl groups acylated at c - 21 and c - 22 . the formula of compound y8 is c 57 h 87 o 23 , and the chemical name of y8 is : 3 - o -[ β - glucopyranosyl ( 1 → 2 )]- α - arabinofuranosyl ( 1 → 3 )- β - glucuronopyranosyl - 21 , 22 - o - diangeloyl - 3β , 16α , 21β , 22α , 24β , 28 - hexahydroxyolean - 12 - ene . the chemical structure of compound y8 is presented in the following figure . see also fig3 . experiment 10 . determination of the chemical structure of compound y9 of xanthoceras sorbifolia extract the method for nmr and ms analysis for compound y9 is similar to the method described in experiment 5 . the spectral profiles of the h - nmr , 2d nmr , i . e ., hmqc and hmbc , of y9 are shown in fig4 - 42 . based on these data and analysis , compound y9 isolated from extract of xanthoceras sorbifolia is a bisdesmosidic polyhydroxyoleanene triterpenoidal saponin with a trisaccharide chain at c - 3 of the backbone and a monosaccharide moiety at c - 21 where two angeloyl groups were acylated at c - 3 and c - 4 position . the formula of compound y9 is c 63 h 98 o 26 , and the chemical name of y9 is : 3 - o -[ β - galactopyranosyl ( 1 → 2 )]- α - arabinofuranosyl ( 1 → 3 )- β - g lucuronopyranosyl - 21 - o -( 3 , 4 - diangeloyl )- α - rhamnopyranosyl - 3β , 16α , 21β , 22α , 28 - pentahydroxyolean - 12 - ene . the chemical structure of compound y9 is presented in the following figure . see also fig3 . experiment 11 . determination of the chemical structure of compound y10 of xanthoceras sorbifolia extract the method for nmr and ms analysis for compound y10 is similar to the method described in experiment 5 . the profile of the h - nmr , c13 - nmr and 2d nmr ( hmqc ) are shown in fig4 - 46 . based on these data and analysis , compound y10 isolated from extract of xanthoceras sorbifolia is an oleanene triterpenoidal saponin with a trisaccharide chain attached at c - 3 of the aglycone and two angeloyl groups acylated at c - 21 and c - 22 . the formula of compound y10 is c 57 h 87 o 22 , and the chemical name of y10 is : 3 - o -[ β - galactopyranosyl ( 1 → 2 )]- α - arabinofuranosyl ( 1 → 3 )- β - glucuronopyranosyl - 21 , 22 - o - diangeloyl - 3β , 16α , 21β , 22α , 28 - pentahydroxyolean - 12 - ene . the chemical structure of compound y10 is presented in the following figure . see also fig4 . experiment 12 . purification of component r from xanthoceras sorbifolia extract ( a ) purification of xanthoceras sorbifolia extracts components with fplc and hplc the methods used are similar to the methods described in experiment 4 , section ( a ) and ( b ) except a 30 % acetonitrile isocratic elution was used in hplc for isolation of the compound r . fraction no . 39 - 41 from gradient elution of fplc were pooled and further purified with an open ods - c18 column with isocratic 30 % acetonitrile elution . six identifiable fractions in two groups were collected . fractions 6 - 13 were further characterized with hplc . these fractions were further separated into 4 - 5 components with the 30 % acetonitrile isocratic elution in a deltapak column . the fraction designated herein as “ r1 ”, is the major component . see fig6 a . the pure r1 was subsequently collected from the column elution . see fig6 b . the pure r1 appears as an amorphous white powder , soluble in aqueous alcohol , i . e ., methanol or ethanol , 50 % acetonitrile and 100 % pyridine . the nmr and ms analysis of r1 is similar to the method described in experiment 5 . the nmr spectra of pure r1 is presented in fig4 - 52 . based on chemical shift analysis , compound r1 isolated from extract of xanthoceras sorbifolia is a triterpenoid saponins with five sugars and one angeloyl group attached to the sugar moiety . the chemical structure of r1 is shown in following figure . see also fig4 . the formula of compound r1 is c 65 h 106 o 29 , and the chemical name of r1 is : 3 - o -[ angeloyl -( 1 → 3 )- β - d - glucopyranosyl -( 1 → 6 )]- β - d - glucopyranosyl - 28 - o -[ α - l - rhamnopyranosyl -( 1 → 2 )- β - d - glucopyranosyl -( 1 → 6 )- β - d - glucopyranosyl - 3β , 21β , 22α , 28 - tetrahydroxyolean - 12 - ene . ( a ) fractionation of xanthoceras sorbifolia extracts components with fplc and hplc the methods used are are similar to the methods described in experiment 4 , section ( a ) and ( b ) except a 20 % acetonitrile isocratic elution was used in hplc for isolation of the compound o . fractions obtained from fplc were analyzed with hplc . by comparison with the profiles of the original sample , a specific component , in this case fraction o , was identified (# 28 - 30 ). fraction o was collected for further purification . sixteen identifiable hplc fractions were observed in the elution profiles . see fig6 . fractions 28 , 34 and 54 were further purified . see fig6 - 63 . these purified components are named as compound o28 , o34 and o54 , respectively . the purified compound o23 and o34 are light yellow amorphous powder , soluble in aqueous alcohol , i . e ., methanol , ethanol , 50 % acetonitrile and 100 % pyridine . the purified compound o54 is a white amorphous powder , soluble in aqueous alcohol , i . e ., methanol , ethanol , 50 % acetonitrile and 100 % pyridine . the nmr and ms analysis of o54 is similar to the method described in experiment 5 . the nmr spectra of compound o54 is presented in fig5 - 56 . based on the chemical shift analysis , compound o54 isolated from extract of xanthoceras sorbifolia is a bisdesmosidic polyhydroxyoleanene triterpenoidal glycoside with a disaccharide chain [ βd - glucopyranosyl -( 1 → 6 )- β - d - glucopyranoside ] affixed to c - 3 and a trisaccharide chain [ a - l - rhamnopyranosyl -( 1 → 2 )- β - d - glucopyranosyl -( 1 → 6 )- β - d - glucopyranosyl ester ] attached to c - 28 . the chemical structure of compound o54 is presented in the following figure . see also fig5 . the formula of compound o54 is c 60 h 100 o 28 , and the chemical name of o54 is : 3 - o - β - d - glucopyranosyl -( 1 → 6 )]- β - d - glucopyranosyl - 28 - o -[ α - l - rhamnopyranosyl -( 1 → 2 )- β - d - glucopyranosyl -( 1 → 6 )- β - d - glucopyranosyl - 3β , 21β , 22α , 28 - tetrahydroxyolean - 12 - ene . although the present invention has been described in detail with particular reference to preferred embodiments thereof , it should be understood that the invention is capable of other different embodiments , and its details are capable of modifications in various obvious aspects . as is readily apparent to those skilled in the art , variations and modifications can be affected while remaining within the spirit and scope of the invention . accordingly , the foregoing disclosure , description , and figures are for illustrative purpose only , and do not in any way limit the invention which is defined only by the claims . 1 . carmichael , j ., degraff , w . g ., gazdar , a . f ., minna , j . d . and mitchell , j . b . : evaluation of a tetrazolium - based semiautomated calorimetric assay : assessment of chemosensitivity testing . cancer res . 47 : 936 - 942 ( 1987 ). 2 . chen , q . 1995 . methods of study on pharmacology of chinese medicines . press of people &# 39 ; s public health , beijing . p 892 . 3 . huang , zh . sh ., liu , m . p ., chen , ch . zh . 1997 . study on effects of yangshou dan on improving learning and retention . chinese journal of combination of chinese and west medicine , 9 ( 17 ): 553 . 4 . zhang , y ., zhang , h . y ., li , w . p . 1995 . study on effects of anjifu on improving intelligence , chinese bulletin of pharmacology , 11 ( 3 ): 233 . 5 . yang , j ., wang , j ., feng , p . a . 2000 . study on effects of naokkangtai capsule on improving learning and retention in mice , new chinese medicine and clinical pharmacology , 1 ( 11 ): 29 . 6 . yang , j ., wang , j ., zhang , j . ch . 2000 . study on effects of crude saponins of peonies on improving learning and retention in mice , chinese journal of pharmacology , 2 ( 16 ): 46 . 7 . xia , w . j ., jin , m . w ., zhang , l . 2000 . study on treatment of senile dementia caused by angio - aging with didang tang , pharmacology and clinical of chinese medicines , 16 ( 4 ). 8 . bian , h . m ., yu , j . z ., gong , j . n . 2000 . study on effects of tongmai yizhi capsule on improving learning and retention in mice , pharmacology and clinical of chinese medicines , 16 ( 5 ): 40 . 9 . wei , x . l ., zhang , y . x . 2000 . study of animal model for studying senile dementia , chinese journal of pharmacology , 8 ( 16 ): 372 . 10 . bureau of medicinal police , department of public health . guide line for study of effect of medicines for treatment of nervous system diseases , in guidebook of study of new medicine . p 45 . 11 . zhang , d . sh ., zhang , j . t . 2000 . effects of crude ginseng saponins on improving impairment induced by b - peptide , chinese journal of pharmacology , 8 ( 16 ): 22 . | 2 |
referring first to fig1 there is illustrated a broken away portion of a prior art optical disk 6 . in the foreground the break is along a radial thereof . many different forms of optical disks 6 are known . thus , there are optical disks of the read - only , write - once / read - many , erasable , and the like forms . information readout by reflection from formations , magneto - optical processes , and the like from such disks are all contemplated . disk 6 has a reflective upper surface 6a with preformatted guide tracks 12 ( three , 12a , 12b , and 12c being shown ) machined or otherwise formed in substrate 6b thereof . the guide tracks 12 alternate with information tracks 14 ( two , 14a and 14b , being shown ). the information tracks are imaginary regions in a layer 6c atop substrate 6b and below surface 6a in which layer magneto - optic domains can be formed ( written ), recognized ( read ), and rewritten ( erased ) although other forms can also be utilized . in point of fact , guide tracks 12 and information tracks 14 may each simply be one continuous track , spiraling outward from a central axis ( not shown ) which would be to the right of disk 6 as illustrated in fig1 . although guide tracks 12 are illustrated as being depressed in fig1 they may , in fact , be raised or , said another way , information tracks 14 may be lowered or depressed into the disk surface 6a . the guide tracks , if they are depressed , and typically they are , are machined or replicated into surface 6a at the time of manufacture of the disk . because the forming process is not perfect , the edges such as 12 - 1 and 12 - 2 of the guide tracks and bottom 12 - 3 tend to be rough . as such , it is known in the prior art to provide a small guard space between the guide tracks 12 and the information tracks 14 as indicated by dashed lines 16 - 1 and 16 - 2 to allow the spot intensity to decrease before the edge of the guide track is encountered thus decreasing crosstalk . exemplary , though not limiting dimensions for disk 6 , are to have guide tracks of approximately 0 . 6 micrometers ( μm ), information tracks of approximately 0 . 8 μm micrometers and the spacing between the guide tracks and the information tracks of approximately 0 . 1 μm . thus , it will be understood that information tracks are 0 . 8 μm apart , or the full width of an information track apart , and that the track - to - track ( information track - to - information track or guide track - to - guide track ) spacing is typically 1 . 6 μm . for reasons which will become evident as the discussion proceeds , the depth of guide track 12 below surface 6a is somewhat critical . for tracking purposes it is desirable that the depth of track 12 be λ / 8n , where λ is the wavelength of an impinging light source to be described hereinafter and n is the index of refraction of the media of propagation . an exemplary value of λ is 830 nm and an exemplary value of n is 1 . 5 . for information reading purposes it is desirable that the depth be λ / 4n . as a compromise , typically the depth is made λ / 6n . a typical prior art so - called &# 34 ; two spot &# 34 ; tracker is illustrated in fig2 to which attention is now directed . in reality there are three focussed illumination spots labelled a , b , and c all from a source ( not shown ) and all directed toward surface 6a and normal thereto . spots a and b are utilized for tracking . spot c is used solely for reading , writing or erasing information in such a system . it should be understood that the various spots a , b , and c are not shown to the diameter of their full power , but rather shown to the diameter of half power . the half power dimension of spots a and b is typically equal to the width of an information track . the illumination spots are mechanically coupled together to be moved as indicated by arrow 7 in directions normal to the tracks ( 12 and 14 ) directions . at the indicated 50 % power level the spots touch a common line 8 parallel to the tracks and spot c is centered on that line . when a spot such as a is half over an information track 14 and half over a guide track 12 , reflected light as measured by a detector ( not shown ) which is functionally positioned along a line normal to surface 6a and in line with spot a is at a minimum due to diffraction caused by the λ / 6n depth of the guide track . this is illustrated in fig3 as waveform a where distance is on the horizontal axis and response ( r ) is on the vertical axis . if spot a moves either left or right from a position centered half over guide track 12 and half over information track 14 , as illustrated , the reflected light increases . a similar statement applies to spot b the reflection of which is identical in shape to that of spot a only displaced therefrom . the lower waveform in fig3 is the summation of waveform a with the inverse of waveform b . with spots a and b as illustrated in fig2 a zero crossing occurs at point 9 in the bottom waveform of fig3 . known servoing techniques can be used to position spots a and b so that spot c is centered over information track 14 . referring now to fig4 there is shown a broken away portion of an optical disk 11 in accordance with the present invention . as with the disk 6 of fig1 the foreground break is along a radial . as with the disk 6 in fig1 there is a top surface 11a , similar to surface to 6a , of a substrate 11b similar to substrate 6b . there are guide tracks 12 , two , 12a and 12b being shown by way of example , and there are information tracks 14 . it will be noted , however , that in fig4 there are , in fact , with two tracks information tracks 14 between successive guide tracks 12 . or said another way , there is an information track 14 flanking each guide track 12 that is not in common with any information track 14 that flanks any other guide track 12 as viewed along a radial of the disk . thus , by way of example , information tracks 14 - 1a and 14 - 2a flank guide track 12a while information tracks 14 - 1b and 14 - 2b flank guide track 12b . as with the disk of fig1 there may be a single guide track 12 and two flanking information tracks 14 which spiral outward relative to a central disk axis not shown but which would be to the right in fig4 . as was mentioned in connection with fig1 it is desirable to have a guard band between successive information tracks . in fig1 the guard band was provided by the guide track plus a small space on either side of each guide track . in fig4 however , because there are two information tracks between each successive pair of guide tracks , an additional spacing portion is needed . thus , between successive information tracks there is either a guard track 18 such as 18 - 1 , 18 - 2 , and 18 - 3 or a guide track 12 plus adjacent areas 16 . as with the disk of fig1 exemplary though not limiting dimensions are 0 . 6 μm for each guide track 12 plus a small guard track of 0 . 1 μm on either side thereof , 0 . 8 μm for each information track 14 , and also 0 . 8 μm for each guard track 18 . thus , an exemplary guide track - to - guide track spacing is on the order of 3 . 2 μm . as with the disk of fig1 the depth of the guide tracks is ideally λ / 8n for tracking purposes and λ / 4n for information reading and writing purposes . so , again , a good compromise is a depth of λ / 6n . referring now to fig5 tracking spots a and b are similar to tracking spots a and b in fig2 and are identical in shape to each other except that their spacing is such with reference to a line ( not shown ) normal to the track direction that when properly positioned they are centered over two information tracks 14 flanking a guide track 12 . the spots are mechanically coupled together to be moved in directions indicated by arrow 7 normal to tracks 12 and 14 . in fig5 the innermost circle represents the 50 % power level of illumination and successive larger circles represent power levels at 25 % and somewhat greater than 0 %, respectively . it will be noted that at the 25 % and at the somewhat greater than 0 % power levels that the light beam does extend into the intermediate guide track 12 . with reference now to fig6 the waveforms a and b correspond to responses received back from disk 11 as the spots track across the disk in the directions indicated by arrow 7 . the waveform indicated as - b + a is the sum of waveform a and the negative of waveform b and differs from the equivalent waveform in fig3 because the spacing of spots a and b are further apart than are spots a and b in fig2 . nevertheless , in the - b + a waveform in fig6 there is a pronounced null at point 9 which , as with the prior art , can be used to center spots a and b with regard to the center of a guide track 12 . however , unlike the prior art , spots a and b are also properly positioned to read , write , or erase information from information tracks 14 . thus , unlike the prior art in which a third spot , c , is required , no third spot is required with the present invention . a system 10 for tracking and reading / writing / erasing in accordance with the present invention is illustrated in fig7 to which attention is now directed . disk 11 is identical to disk 11 in fig4 . that portion of system 10 closest to disk 11 is a tracking and focus assembly 20 which includes a first lens means 22 , carried by a mechanically movable member 24 , movable for focusing purposes toward and away from the disk surface , in the directions of arrows f . member 24 is movable , by means well known but not shown , with respect to another member 26 which is itself movable in a radial direction with respect to the disk , and transverse to the focusing direction of arrows f , as shown by transverse arrows t . member 26 may carry additional lens means 28 and means 30 for redirecting the light beams impinging upon , or reflected from , disk 11 . as is well known in the art , optical assemblies in this form can be utilized to radially move from track to track of the disk , while still focusing the various light beams and changing the direction thereof . thus , a group of substantially parallel light beams generally labelled 36 , symmetrical about a central axis 36a , are provided by an array of illumination sources 34 , such as a laser diode array and the like , with the illumination source producing beams 36b and 36c symmetrical about central axis portion 36a . the substantially parallel , collimated beams 36b and 36c may be passed through a beam expansion means 40 to provide a set of output beams 42b and 42c about central axis portion 42a equal in number to the input beams 36b and 36c , but having smaller angular spacings s relative to axis portion 42a . the distance between the focussed beams 42b and 42c measured along a radial of the disk is determined by rotation of laser array 34 about the line of travel of beams 36b and 36c . axis 42a is coextensive with axis 36a . beams 42b and 42c impinge upon the disk 11 surface as spots 43b and 43c with a spacing equal to the information track - to - information track spacing which for the exemplary disk is 1 . 6 μm . the spots are reflected therefrom and pass back through lenses 22 and 28 , are redirected by means 30 , enter a beam splitting means 44 and are reflected to pass into a reading means 50 . for reading a magneto - optic disk ( m - o ), beam splitter 44 must be polarized and light source 34 must produce linearly polarized light , a small percent in amplitude of which is directed through beam splitter 44 to reading means 50 . means 50 may include a quarter - wave plate 52 , lens means 54 , a wollaston polarized prism 56 and the like for focusing two pairs of spaced apart read beams 57a1 / 57b1 and 57a2 / 57b2 , respectively , upon first and second pairs 58a1 / 58b1 and 58a2 / 58b2 of detectors elements 58 - 1 and 58 - 2 of a solid state optical detection means 58 . each of the detector elements provides a separate electrical output signal , e . g . detector element 58a1 providing an output signal vr1 and separate detector 58a2 providing a separate output signal vr2 , both for the left information tracks such as 14 - 1a , while detector elements 58b1 / 58b2 provide separate output signals v11 and v12 for the right information tracks such as 14 - 2a , all as viewed in fig7 . the track recovered information signal is the difference between the formation output signals , e . g . left track information is ( v11 - v12 ), and right track information is ( vr1 - vr2 ). further detail of one read process may be found , e . g . in challener and rinehart , &# 34 ; jones matrix analysis of magneto - optical media and read - back systems ,&# 34 ; applied optics , vol . 26 , no . 12 , pp . 3974 - 3980 , ( sep . 15 , 1987 ). an archival disk can be processed in an identical way except that only elements 58a1 and 58b1 ( or 58b2 and 58a2 ) are employed and the light beams need not be polarized . in accordance with the invention , the same output signals are also used for centering axis 42a over guide track 12 such as guide track 12a . this is accomplished by subtracting the sum of vr1 and vr2 from λ the sum of vl1 and vl2 . the resultant value , if not 0 , is used by feedback means well known to the art , to move assembly 20 in the direction of arrows to reacquire central guide track 12 and thus to position beams 42b and 42c over information tracks on either side of the central guide track 12 . thus , the system 10 just described using just two light spots can both track and read / write / erase . it will be understood that the reading , writing , and erasing functions are performed by a combination of the power produced by laser array 34 and the presence or absence of magnetic field ( not shown ) at disk 11 all as is well known to the practitioners in the art . | 6 |
with reference to fig1 in an open mri system , an imaging region 10 is defined between an upper pole assembly 12 and a lower pole assembly 14 . a pair of magnetic flux sources are disposed adjacent to upper and lower pole pieces 16 , 18 generating a temporally constant , main magnetic field b 0 through the imaging region 10 . it is to be appreciated that the open mri apparatus may have a variety of pole pieces or , in some instances , no pole pieces at all . the magnets for generating the main magnetic field can be positioned at other locations . a ferrous flux return path 20 is provided between the pole assemblies remote from the imaging region 10 . the flux return path in the preferred embodiment is a c - shaped path that supports the upper pole assembly . alternately , the flux return path 20 could be an h - shaped arrangement , a four - poster arrangement , imbedded in the walls , or the like . the use of a pair of pole pieces with no defined flux path , just the ambient surroundings through which flux returns , is also contemplated . for imaging , magnetic field gradient coils 22 , 24 are disposed on opposite sides of the imaging region 10 adjacent the pole pieces 16 , 18 . in the preferred embodiment , the gradient coils are planar coil constructions which are connected by gradient amplifiers 26 to a gradient magnetic field controller 28 . the gradient magnetic field controller 28 causes current pulses which are applied to the gradient coils 22 , 24 such that gradient magnetic fields are superimposed on the temporally constant and uniform field b 0 across the imaging region 10 . the gradients of the fields aligned with the main field are typically oriented along a longitudinal or y - axis , a vertical or z - axis and a transverse or x - axis . for exciting magnetic resonance in selected nuclei , an upper radio frequency coil 30 and a lower radio frequency coil 32 are disposed between the gradient coils 22 , 24 adjacent the imaging region 10 . the coils 30 , 32 generate narrow spectrum rf magnetic fields in a band around a selected resonance frequency , typically denoted b 1 , within the imaging region . the coils 30 , 32 are connected to one or more rf transmitters 34 that transmits pulses designated by an rf pulse controller 36 . rf screens are disposed between the rf coils 30 , 32 and the gradient coils 22 , 24 to minimize the generation of rf eddy currents in the gradient coils 24 , 26 . the rf coils 30 , 32 transmit b 1 , magnetic field pulses into the imaging region . a sequence controller 40 accesses a sequence memory 42 to withdraw one or more rf and gradient pulse imaging sequences , which are implemented by the gradient controller 28 , and the rf pulse controller 36 in a coordinated relationship . typically , the sequence controller 40 causes the pulse controller and the rf transmitter to transmit pulses into the imaging region commensurate with the application . that is , different sequences are designed to illustrate different features of the subject . in applications in which the radio frequency coils 30 , 32 operate in both transmit and receive modes , magnetic resonance signals are picked up by the radio frequency coils 30 , 32 . the resonance signals are demodulated by one or more receivers 50 , preferably digital receivers . the digitized signals are processed by a reconstruction processor 52 into volumetric or other image representations which are stored in a volumetric image memory 54 . a video processor 56 , under operator control , withdraws selected image data from the volume memory and formats it into appropriate data for display on a human readable display 58 , such as a video monitor , active matrix monitor , liquid crystal display , or the like . in order to sense environmental disturbances that result in the vibration of the floor or any other support structure of the magnet assembly , a force transducer 60 is disposed underneath the lower pole assembly 14 between the lower pole assembly and the floor in the preferred embodiment . preferred sensors have accurate , readily anticipated responses to frequencies in the 2 - 70 hz range . the force transducer is preferably a strain gauge type transducer , and has approximately the same compressibility of hard rubber shoes previously used to dampen vibrations , which compressibility dampens vibrations in the 20 - 70 hz range . alternately , piezoelectric discs can be used . the force transducer produces an output voltage waveform at least in the 5 - 20 hz frequency range indicative of any vertical compressions experienced by the pole assemblies . the output waveform is processed by a vibration analyzer 62 which determines the corresponding changes in the distance between the upper pole assembly 12 and the lower pole assembly 14 due to the vibration , the attractions in the main b 0 field due to the changes , and ultimately the corrections to compensate . preferably , the signal may be processed by a digital signal processor to have a high degree of control intelligence before being fed to the vibration analyzer 62 . in the preferred embodiment , higher frequency vibrations are dampened by the transducer and do not affect the stability of the system . frequencies below 2 hz are filtered by high pass filters because their effect on the magnet is not significant . the effect of the voltage waveform components in the range of 5 - 20 hz on the b 0 field is measured during initial calibration and appropriate corrections are calculated . in one preferred embodiment , the analysis of the vibration waveform is used to correct the b 0 field strength . as the mr assembly is vibrated up and down , the massive upper pole assembly 12 has such inertia that the interpole spacing between pole pieces 16 , 18 expands and contracts . this variance causes the strength of the main field to vary . as the pole pieces come closer together , the field strengthens . conversely , as they move apart , the field weakens . given the vibration waveform from the transducer 60 , a variance of the distance with time is found by measurement during design and set up . mathematically it is relatively simple to take an instantaneous δd of the gap between pole pieces and convert it into a δb 0 . look up tables are also contemplated . at least one and preferably a pair of shim coils 70 , 72 controlled by a shim coil control 74 produces a magnetic field to counteract the calculated change in the magnetic field due to vibrations . for example , an activity waveform of the shim coil is inverted and scaled in comparison to the vibration waveform . the resultant effect of both the vibrations and shim coil counteract , resulting in a temporally constant main field . in a second preferred embodiment , the vibration waveform is used to adjust the spatial encoding gradient pulses . the resonant frequency is a function of the field strength . in one common mode , the rf pulse has a frequency which excites a whole slice or slab at the location where the sum of a slice select gradient and the b 0 field has a preselected strength . subsequent gradient fields vary the main field to shift the frequencies of the resonating dipoles to preselected frequencies at each spatial increment . however , when vibrations vary the main b 0 field , the spatial location at which expected resonant frequencies occur are shifted . the receiver 50 correlates frequency of received signals with spatial position in the read gradient dimension . thus , if dipoles are resonating at a shifted frequency under the read gradient , the reconstruction processor 52 assigns a shifted spatial position in that read direction . thus , if the b 0 field oscillates or varies with time , a ghosted , blurred image results . in this second embodiment , the vibration analyzer 62 uses the vibration waveform to variably shift at least the frequency sensitivity of the receiver , as ghosted in fig1 to hold the total magnetic field constant at each spatial location along the read direction constant . preferably , a local oscillator / synthesizer 80 generates an rf pulse modulated by the vibration waveform such that the receiver signal is substantially unaffected by the vibrations . this eliminates read direction ghosting . in a third preferred embodiment , the sensed vibrations or oscillations are correlated to oscillating shifts in the resonance frequency and phase . the reconstruction processor 52 is programmed to alter the phase encoding of the signal corresponding to the vibration induced force changes . optionally , a correction is made to spatial location as well as corresponding to frequency effects in the read direction . the transmitter and receiver may be adjusted , as necessary to transmit and demodulate in a frequency spectrum corresponding to the shifting resonance frequencies across the examination region . in an alternate embodiment , multiple force transducers are disposed underneath the mr assembly . their contributions are mathematically weighted according to their position . this embodiment is useful for non - uniform variations in the main magnetic field . if the distance between the sides of the pole pieces move less than the other sides , non - uniform changes in the b 0 field can be sensed and corrected . optionally , a hinge 80 supports the back of the magnet assembly , while the front of the magnet assembly under the pole is supported by the force transducer 60 . in another alternate embodiment , one or more force transducers adjacent to a firm support or accelerometers are placed on the vertical portion of the flux return path to measure horizontal displacement . the vibration analyzing processor 68 generates analogous corrections to those discussed above for horizontal vibration induced b 0 field variations . the invention has been described with reference to the preferred embodiment . modifications and alterations will occur to others upon a reading and understanding of the preceding detailed description . it is intended that the invention be construed as including all such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof . | 6 |
advantages of the present invention will become more apparent from the detailed description given hereinafter . however , it should be understood that the detailed description and specific examples , while indicating preferred embodiments of the invention , are given by way of illustration only , since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description . fig1 shows an ink jet printer that includes a platen 10 which serves to transport a recording paper 12 in a subscanning direction ( arrow a ) past a printhead unit 14 . the printhead unit 14 is mounted on a carriage 16 that is guided on guide rails 18 and is movable back and forth in a main scanning direction ( arrow b ) relative to the recording paper 12 . in the example shown , the printhead unit 14 includes four printheads 20 , one for each of the basic colors cyan , magenta , yellow and black . each printhead has a linear array of nozzles 22 extending in the subscanning direction . the nozzles 22 of the printheads 20 can be individually energized to eject ink droplets onto the recording paper 12 , thereby printing a pixel on the paper . when the carriage 16 moves in the direction b across the width of the paper 12 , a swath of an image can be printed . the number of pixel lines of the swath corresponds to the number of nozzles 22 of each printhead . when the carriage 16 has completed one pass , the paper 12 advances by the width of the swath , so that the next swath can be printed . the printheads 20 are controlled by a printhead controller 24 that receives print data in the form of a multi - level pixel matrix from an image processor 26 that is capable of high speed image processing . the image processor 26 may be incorporated in the printer or be in a remote device , e . g ., a print driver in a host computer . the printhead controller 24 and the image processor 26 process the print data in a manner that will be described in detail below . the discussion will focus on printing in black color , but is equivalently valid for printing in the other colors . fig2 a shows an array of 8 × 8 pixels 28 of a binary image 30 that is to be printed with the printer shown in fig1 . the print data representing the binary image 30 are created in or supplied to the image processor 26 . in the example shown , the image 30 comprises a thin horizontal line 32 having only a width of one pixel , and a thin diagonal line 34 . the pixels having a binary value “ 1 ”, i . e ., the pixels to be printed in black , are indicated by hatching . fig2 b shows a printed image that would be obtained by printing the binary image 30 when one of the nozzles 22 of the printhead 20 fails . in fig2 b , as in the rest of this specification , pixel lines are indicated by their line index ranging from i − 4 to i + 3 , and pixel columns are indicated by their column index ranging from j − 4 to j + 3 . individual pixels will be referred to by their coordinates , i . e ., a pair of a line index and a column index such as ( i , j ). it has been assumed in fig2 b that the nozzle 22 responsible for printing the line i is defective . as a result , the black line 32 of fig2 a is missing in the printed image . fig2 c shows a multi - level pixel matrix 38 , a three - level pixel matrix in this exemplary case , which is obtained by applying an image processing routine to the binary image 30 by means of the image processor 26 . in the pixel matrix 38 , each pixel may have one of three pixel values : “ 0 ”, “ 1 ” and “ 2 ”. the image data representing the pixel matrix 38 are transmitted to the printhead controller 24 and will be interpreted by the printhead controller as follows . a pixel value “ 0 ” means that the pixel shall not be printed , i . e ., shall be left blank or white . a pixel value of “ 2 ” means that the pixel shall be printed ( black ). a pixel value of “ 1 ” means that the pixel shall be treated as a “ 0 ”- pixel and shall not be printed , unless a nozzle failure occurs for one of the pixel lines immediately above and below this pixel . in the latter case , the pixel shall be treated as a “ 2 ” pixel and shall be printed . for example , the value “ 1 ” of the pixel ( i − 1 , j − 1 ) means that this pixel shall only be printed if either the nozzle needed for printing the line i or the nozzle needed for printing line i − 2 is defective . the printer may be arranged to automatically detect nozzle failures , as is generally known in the art . thus , the information needed to determine whether or not a nozzle is defective will be available in the printhead controller 24 which interprets the pixel matrix 38 . as an alternative , nozzle failures may be manually detected by an operator who will analyse a specific test image and will enter the information identifying the defective nozzles into the printhead controller 24 by using a suitable input . in the example shown in fig2 c , the pixel matrix 38 is derived from the binary image 30 by means of the following algorithm . every “ 1 ” ( black pixel ) in the binary image 30 is translated into a “ 2 ” in the pixel matrix 38 . for example , this leads to the pixel value “ 2 ” for the pixel ( i + 3 , j − 4 ) in fig2 c . in addition , the pixel immediately below this “ 2 ”- pixel is changed from “ 0 ” to “ 1 ”. this is the case , for example , for the pixel ( i + 2 , j − 4 ). if , however , the pixel immediately below the “ 2 ”- pixel was already a black pixel , then it will be changed to “ 2 ” similar to every other black pixel . an example of this is the pixel ( i − 1 , j ). fig2 d shows the printed image 40 obtained as a result of this image processing step and its interpretation in the printhead controller 24 . it can be seen that , thanks to the algorithm described above , the image information of the black line 32 is not lost , but is replaced by a black line 32 ′ immediately below the defective nozzle . in other words , the line 32 is shifted by one pixel , and this shift will be hardly perceptible to the human eye . in all the pixel lines that are not directly adjacent to the line i of the defective nozzle , ( lines i − 4 to i − 2 , i + 2 and i + 3 ) the original image information is preserved without any changes . in line i + 1 , an additional black pixel ( i + 1 , j − 3 ) occurs close to the position , where the diagonal line 34 crosses the horizontal line 32 ′. this additional black pixel stems from the “ 2 ”- pixel ( i + 2 , j − 3 ) fn fig2 c , in which this pixel has caused a “ 1 ” occurring immediately below . the main purpose of this “ 1 ” was to replace the “ 2 ”- pixel in line i + 2 if the nozzle for line i + 2 should fail . however , since the printhead controller 24 of this embodiment does not distinguish whether a line is located below or above a defective line , the pixel ( i + 1 , j − 3 ) will be printed black , even though there is no defect in the line i + 2 . this behaviour leads to a slight overcompensation of the nozzle defect , but is highly welcome here , because it camouflages , to some extent , the gap occurring in the diagonal line 34 in pixel line i . the algorithm illustrated in fig2 c is particularly useful for images , such as cad graphics , which include thin horizontal lines . of course , instead of shifting the line 32 one pixel downward , an equivalent strategy would be to shift this line one pixel upward . if a horizontal line has a width of two pixels and covers , for example , the lines i and i − 1 , then the algorithm shown in fig2 c would have the effect that the pixel is thinned from a width of two pixels to a width of one pixel ( the pixels in line i − 2 would be changed to “ 1 ”, but would not be printed , because the nozzle defect is two pixels away ). this would be quite an acceptable result . in this case , however , the alternative strategy , where a “ 1 ” is added above each “ 2 ”- pixel , would have the result that the two pixel wide line would be split into two one - pixel - lines separated by a one pixel gap . a similar gap and a one - pixel line would occur the line i forms the upper boundary of a solid black area in the original image 30 . in this case , the occurrence of a thin line isolated from the rest of the black area would be less favourable . another possible strategy would be to insert a “ 1 ” pixel alternately above and below each “ 2 ” pixel . this strategy would be suitable , for example , for images consisting of extended grey areas , but would be unfavourable for horizontal high - contrast boundaries , because the boundary would become jagged if a nozzle failure occurs right at the boundary . it will therefore be preferable to adopt the most suitable strategy depending on the contents of the image 30 to be processed . this can be achieved in a straightforward manner by a user defined setting or by employing image processing routines which comprise , for example , image segmentation in order to classify different types of image elements , such as thin lines , high - contrast boundaries , grey - shade areas and the like . in general , the image processing algorithm aims to obtain a printed image 40 that resembles as far as possible the original image 30 , regardless of the position where the nozzle failure occurs . fig3 a - c illustrate an embodiment , in which “ 1 ”- pixels are alternately added above and below each “ 2 ” pixel . as mentioned already , this embodiment is particularly suitable for a binary image 30 , as shown in fig3 a , in which the black pixels appear to be scattered randomly over the image area . the corresponding pixel matrix 38 shown in fig3 b is constructed almost in the same way as the pixel matrix in fig2 b , with the only difference that , for the “ 2 ”- pixels , the corresponding “ 1 ” pixels are alternately inserted above and below the “ 2 ” pixel , as is symbolised by arrows in fig3 b . the “ 1 ”- pixel that would be created by the “ 2 ” pixel ( i + 3 , j + 2 ) is not visible here , because it is outside of the image area . the printhead controller 24 interprets the pixel matrix 38 in the same way as in fig2 b - c . as shown in fig3 c , the resulting printed image 40 is hardly distinguishable from the original image 30 , in spite of the nozzle failure in line i . again , one observes that the sum of black pixels in the lines i − 1 , i , and i + 1 in fig3 c is slightly larger than in fig3 a , because “ 1 ”- pixels are also created by black pixels in the lines i − 2 and i + 2 . if this effect is not desirable , for example for image areas with a relatively high average density , the image processing algorithm may be modified by suppressing some of the additional “ 1 ”- pixels . for example , when the pixels are processed line by line , the first “ 2 ”- pixel may create a “ 1 ” pixel above , the second “ 2 ”- pixel creates a “ 1 ”- pixel below , and the third “ 2 ”- pixel does not create any “ 1 ” pixel at all , and then the sequence will be repeated . another possible modification that may be suitable for relatively dark image areas would be that the “ 1 ”- pixel is not always inserted immediately above or below the “ 2 ” pixel , but is shifted to an empty position in the vicinity of the “ 2 ” pixel . another embodiment of the invention will now be described in conjunction with fig4 a - d . the binary image 30 , shown in fig4 a , has the lines i − 2 to i + 1 forming an extended dark area with an average density of 50 %. an isolated black pixel is present at ( i − 4 , j ). fig4 b shows the corresponding printed image 36 that would be obtained if the nozzle failure in line i were not camouflaged . fig4 c shows a corresponding multi - level pixel matrix 38 , which in this case is a four - level matrix . here , the pixel value “ 3 ” means that a back pixel shall be printed unconditionally . the pixel value “ 0 ” stands again for pixels that are to be left blank , unconditionally . the pixel value “ 1 ” means that the pixel shall be printed in black if a nozzle failure occurs in the line immediately below . conversely , the pixel value “ 2 ” means that the pixel shall be printed in black on condition that a nozzle failure occurs in the line immediately above . when constructing the pixel matrix 38 of fig4 c , every black pixel in the original image 30 is changed to a “ 3 ”. the algorithm for assigning the conditional pixel values “ 1 ” and “ 2 ” becomes more complex in this case . since the lines i + 2 and i + 3 include no black pixels , the line i + 1 forms the upper boundary of a grey area . for this reason , no “ 1 ”- pixels are provided in line i + 2 . thus , even when a nozzle failure would occur for the line i + 1 , this would not be compensated by any black pixels in line i + 2 . nor would there be any additional black pixels in line i for compensating the nozzle failure , because the line i does not contain any “ 2 ”- pixels . thus , when the nozzle for line i + 1 fails , this line is simply left white without any compensation , with the result that the boundary between the dark and the white area shifts by one pixel . this has the advantage that a smooth appearance of the boundary is preserved . in line i of fig4 c , a first “ 3 ” occurs at the position j − 3 . for this reason , a “ 1 ” has been assigned to the pixel ( i + 1 , j − 3 ). thus , if the nozzle for line i fails , then an additional black pixel will be printed in the line i + 1 , as shown in fig4 d . the next “ 3 ”- pixel in line i is at the position j − 1 . here , the pixel value “ 2 ” is assigned to the pixel ( i − 1 , j − 1 ). thus , a nozzle failure in line i will in this case be compensated by an extra pixel in the line i − 1 below , as is also shown in fig4 d . for the subsequent “ 3 ”- pixels in line i , a “ 1 ” and a “ 2 ” are alternately inserted in lines i + 1 and i − 1 , respectively . the same algorithm is also applied to the “ 3 ”- pixels in line i − 1 . the line i − 2 forms the lower boundary of the grey area , and the smooth appearance of this boundary should be preserved . for this reason , similarly as for line i + 1 , there are no “ 2 ”- pixels in line i − 3 , and the pixels above the “ 3 ”- pixels at j − 3 and j + 1 are left at “ 0 ”. thus , if a nozzle failure should occur in the boundary line i − 2 , this failure would have no compensation at all . the isolated “ 3 ”- pixel in line i − 4 is treated in the same way as the pixels in lines i and i − 1 . thus , a “ 1 ” pixel is inserted at the position ( i − 3 , j ). in the occurrence of a nozzle failure for line i − 4 , the missing pixel would be shifted one position upwardly . when the algorithm described above for lines i and i − 1 in fig4 c is applied to a larger number of subsequent pixel lines , then , depending on the image contents , a conflict situation may occur for specific pixels . for example , a “ 3 ” above such a pixel may require the pixel value “ 2 ”, whereas a “ 3 ” below this pixel may require a pixel value “ 1 ” for the same pixel . this conflict may be resolved by giving priority to either the “ 2 ” or the “ 1 ”. in this case , however , a nozzle failure for one of the two adjacent lines may not be completely compensated . in view of this problem , a more elaborate embodiment of the invention may provide that all the black pixels in the original image 30 obtain the pixel value “ 4 ” instead of “ 3 ”. then , the pixel value “ 3 ” would indicate that a black pixel shall be printed on condition that a nozzle failure occurs in anyone of the adjacent upper and lower lines . thus , if a “ 2 ” is required because of a black pixel in the upper line , and at the same time a “ 1 ” is required because of a black pixel in the lower line , then the values “ 1 ” and “ 2 ” are added to give the conditional pixel value “ 3 ”. the embodiments described above require only minimal data processing in the printhead controller 24 . all that has to be done to print a given pixel is to decide whether a nozzle failure occurs in the line above or below this pixel , and then adopt the pertinent interpretation for the conditional pixel values . this can , for example , be achieved using a simple hardware implementation with a network of and and or gates . fig5 a - c illustrate a modified embodiment of the invention which requires slightly more processing capability of the printhead controller 24 . the image processor 26 constructs the pixel matrix 38 shown in fig5 b on the basis of the binary image 30 shown in fig5 a . the pixel matrix is again a three - level matrix , wherein the pixel value “ 2 ” is assigned to each of the black pixels in the image 30 . in addition , for each of the “ 2 ”- pixels in fig5 b , a “ 1 ” is inserted in the line immediately above and another “ 1 ” in the line immediately below . in the event of interference , as for example for the pixel ( i + 2 , j + 2 ) in fig5 b , the pixel value is left at “ 1 ”, although both the pixels ( i + 3 , j + 2 ) above and ( i + 1 , j + 2 ) below have the value “ 2 ”. when no nozzle failure occurs , the printhead controller 24 interprets the pixel value “ 2 ” as black and the pixel values “ 0 ” and “ 1 ” as white . when , however , a nozzle failure occurs in the line i , as shown in fig5 c , a special treatment is applied to the lines i − 1 and i + 1 . in the example shown , this special treatment consists of a simple one - dimensional error diffusion process with threshold 2 . starting with the first pixel ( j − 4 ) in line i + 1 , the pixel value “ 1 ” is below the threshold 2 , so that the pixel is left white in fig5 c . the residual ( 1 ) is added to the pixel value of the next pixel ( i + 1 , j − 3 ). since the latter pixel value is “ 0 ”, the sum is still below the threshold , and this pixel is left white as well . the residual ( 1 ) is then added to the pixel value “ 2 ” of the next pixel ( i + 1 , j − 2 ). since the sum ( 3 ) is now larger than the threshold 2 , the pixel is printed in black , and the sum is decremented by the threshold value 2 , giving a residual of 1 . the same procedure then applies to the next pixel ( i + 1 , j − 1 ), giving again a black pixel and a residual of 1 . for the next pixel ( i + 1 , j ) the sum reaches the threshold value 2 , so that this pixel will be printed in black ( although this pixel was white in fig5 a ). since there is no residual to be added to the next pixel ( i + 1 , j + 1 ), this pixel is left white . the procedure described above is iterated for the subsequent pixels in line i + 1 and then in line i − 1 , with the residual from the pixel ( i + 1 , j + 3 ) being carried over to the first pixel ( i − 1 , j − 4 ) in the next line . the resulting printed image 40 is shown in fig5 c . as a result of the error diffusion process and the selection of the threshold , the average optical density in the lines i − 1 , i , and i + 1 in fig5 c will approximately equal to the average optical density in the corresponding lines in fig5 a , so that the nozzle failure is compensated . compared to the previous embodiments , the embodiment described here has the advantage that the image information which has been spread from line i to the adjacent lines will not be lost , even when the position right above or below is already occupied by a black pixel . thanks to the error diffusion , the image information will instead be propagated to the next empty pixel position . this embodiment can of course be modified in various ways . for example , it is possible to adopt more complex error diffusion schemes , including also 2 - dimensional error diffusion ( where part of the error is diffused , for example , from line i + 1 to i − 1 ). the threshold employed in the error diffusion process does not have to be an integral number . it would be possible for example to adopt a threshold of 1 . 8 or 2 . 2 , resulting in a slight tendency towards overcompensation or undercompensation , respectively , of the nozzle failure . the error diffusion process may also be replaced by other suitable algorithms . for example , the pixel values in lines i − 1 and i + 1 may each be compared to a respective threshold which varies randomly between 0 and 2 , and a black pixel may be printed , when the threshold is exceeded . the result will be that a “ 1 ”- pixel will be printed as a black pixel with a probability of 50 %. since every “ 2 ” pixel in line i generates two “ 1 ” pixels , one in line i − 1 and one in line i + 1 , the average density will be preserved if each of these “ 1 ” pixels is printed with a probability of 50 %. the embodiments described above are adapted to a single - pass print mode , in which a nozzle failure leads to the loss of a complete pixel line , but the invention is also applicable to multi - pass printing , where multiple nozzles contribute to a given pixel line . in this situation , the failure of a single nozzle leads only to a loss of a fraction of the pixels of the line . if no substantial post - processing shall be performed in the printhead controller 24 , the methods for multi - pass printing will be analogous to what has been described in conjunction with fig2 to 4 . however , this application will possibly have the additional feature that , in the construction of the pixel matrix , a distinction is made as to which of the nozzles that contribute to the same line is defective . fig6 and 7 illustrate two embodiments that are specifically adapted to two - pass printing and involve some post - processing such as error diffusion in the printhead controller 24 . however , the invention also applies to higher multiple - pass printing . fig6 a shows a binary image that is processed in the image processor 26 so as to construct the pixel matrix 38 shown in fig6 b . this pixel matrix is a 8 - level matrix having the pixel values ranging from “ 0 ” to “ 8 ”. the construction scheme for the pixel matrix 38 is symbolically shown in fig6 c . every black pixel “ 1 ” of the original image 30 changes to a “ 4 ”, and the pixel values of the upper , lower , left and right neighbours of this pixel are increased by 1 . in case of interference , the increments of the pixel value are summed . thus , the pixel value “ 2 ” of the pixel ( i , j − 3 ) in fig6 b is obtained by adding a “ 1 ” from pixel ( i , j − 4 ) and another “ 1 ” from pixel ( i , j − 2 ). depending upon the configuration of black pixels in the image 30 , the sum may reach the maximum value of “ 8 ” ( a “ 4 ” for the central pixel plus four “ 1 ” s from four black neighbours ). the pixel matrix 38 is interpreted and post - processed in the printhead controller 24 . again , it shall be assumed for this illustration that a nozzle failure occurs in line i . however , in the two - pass mode , this will have the effect that every second pixel in line i can still be printed . the remaining pixels that cannot be printed , have been crossed out in fig6 b . by way of an example , it is assumed that these are the pixels at positions j − 4 , j − 2 , j and j + 2 . since three of these pixels happen to be black pixels in fig6 a , the loss of image information that needs to be compensated amounts to 3 pixels . the pixels in the lines i − 1 , i and i + 1 are subjected to error diffusion with a threshold of 5 . in this error diffusion process , the non - printable pixels in line i are skipped . when the “ 1 ”- pixels and “ 2 ”- pixels occurring in the lines i − 1 , i + 1 and at the printable positions in line i are summed , the result is 18 . because of the threshold of 5 , the number of additional pixels that will be printed in these lines is 18 / 5 = 3 with a remainder ( residual ) of 3 . thus , the three missing pixels in line i will be compensated by three extra pixels in the neighbourhood , and the residual of 3 will be discarded . the reason for selecting the threshold value 5 in this embodiment will be explained in conjunction with fig6 d . the upper block in fig6 d shows the lines i − 1 , i and i + 1 of an original binary image , where the lines i − 1 and i + 1 are white , i is a continuous black line , and black pixels are indicated by the pixel value “ 1 ”. here , the total number of black pixels in lines i − 1 to i + 1is 8 . the lower block in fig6 d shows the corresponding pixel matrix constructed in accordance with fig6 c . summing the pixel values “ 1 ”, “ 6 ”, and “ 5 ” of all the pixels that participate in the error diffusion gives 39 . with a threshold value 5 , the number of pixels that will actually be printed is 39 / 5 = 7 with a remainder ( residual ) of 4 , and this is the best match to the total number of 8 pixels that should have been printed in line i . the error diffusion technique is used very locally and requires less computing power , and the error diffusion scheme and the threshold value may therefore be varied as desired . the embodiment shown in fig6 a - d may in some rare cases lead to artefacts in the form of extra pixels that are added to the original image 30 , even when no nozzle failure occurs . as an example , consider the case that the pixel ( i , j ) is white in the original image 30 , but the four adjacent pixels ( i + 1 , j ), ( i , j − 1 ), ( i , j + 1 ) and ( i − 1 , j ) are black . then , the increments from the surrounding pixels will sum up to a pixel value of “ 4 ” for the pixel ( i , j ), and this pixel value would unconditionally be interpreted as black , so that a white pixel would be turned into a black one even when no nozzle failure occurs . this effect may be compensated by providing appropriate modifications in other image processing steps , such as halftoning , gamma correction , and the like . as an alternative , this embodiment may be modified as follows . instead of encoding an original black pixel by the pixel value “ 4 ”, it is encoded by the pixel value “ 5 ”. this pixel value or a higher pixel value can only be reached when the original pixel was already black . in the printhead controller 24 , only pixel values of “ 5 ” or higher will now be interpreted unconditionally as black , and the pixel value “ 4 ” is interpreted as white when no error diffusion is performed . in the error diffusion process , the pixel value of “ 5 ” will only be counted as 4 , a pixel value of “ 6 ” will be counted as 5 , and so on up to the highest possible pixel value of “ 9 ”, which will be counted as 8 . fig7 a and b illustrate another embodiment of the invention , which is also adapted to a two - pass print mode . the binary image 30 shown in fig7 a is the same as in fig6 a . however , as is shown in fig7 b , the black pixels of the binary image are in this case translated only into the pixel value “ 2 ”, and an increment of “ 1 ” is added only to one of its four neighbours . the selection of the neighbour , to which the increment of “ 1 ” is added , rotates counter - clockwise , when the “ 2 ”- pixels are processed line by line . this counter - clockwise rotation is indicated by arrows in fig7 b . thus , for the first “ 2 ”- pixel ( i + 3 , j + 2 ), an increment of “ 1 ” is added only to its right neighbour ( i + 3 , j + 3 ). for the next “ 2 ”- pixel ( i + 2 , j − 3 ) an increment is only added to its upper neighbour ( i + 3 , j − 3 ), and so on . in this case , the incremented pixel values may range from “ 0 ” to “ 4 ”, and the values “ 2 ”, “ 3 ” and “ 4 ” will be interpreted as black pixels , where no error diffusion is performed . the pixels in the line i of the nozzle failure and the lines immediately above and below are subjected to error diffusion with a suitable threshold value . a consideration similar to the one explained in conjunction with fig6 d shows that a threshold value of 3 would be suitable in this situation . in fig7 b , it has been assumed that the nozzle failure causes defects in the pixel positions ( i , j − 3 ), ( i , j − 1 ), ( i , j + 1 ), and ( i , j + 3 ). since these pixels happen to be white in fig7 a , no extra black pixels would have to be added in order to compensate for the nozzle failure . as can be seen in fig7 a , the total number of black pixels in the lines i − 1 , i and i + 1 is 5 . summing the pixel values of the printable pixels in these lines in fig7 b gives 14 , and the number of black pixels that will actually be printed , if the error diffusion threshold is 3 , will be 14 / 3 = 4 with a remainder ( residual ) of 2 , which is very close to the ideal number of 5 . on the other hand , if the other one of the two nozzles that are used for printing the line i becomes defective , then the non - printable pixels would be ( i , j − 4 ), ( i , j − 2 ), ( i , j ) and ( i , j + 2 ). this would be almost the “ worst case ” scenario because three of the four pixels happen to be black . in this case , the sum of the pixel values of the printable pixels would be 10 , and the number of pixels that are actually printed would be 10 / 3 = 3 rest 1 . this is smaller than the ideal number 5 but larger than the number ( 2 ) of black pixels that would be obtained without any failure compensation . in other words , at least one extra black pixel would be added in the three lines from i − 1 to i + 1 . one might assume from the above examples that the nozzle failure is somewhat undercompensated in this embodiment . it should be noted , however , that in these examples the black pixels in the lines i − 2 and i + 2 do not contribute to the pixel values in the lines i − 1 and i + 1 . this is because the “ 2 ”- pixel ( i + 2 , j − 3 ) accidentally leads to an increment in the upper line i + 3 , and the “ 2 ”- pixel ( i − 2 , j ) leads to an increment in the lower line i − 3 . the opposite result , leading to an extra “ 1 ” in each of the lines i − 1 and i + 1 could , however , have occurred with the same likelihood . thus , considering a larger image area , the average result would be better than in the specific examples that have been discussed here . of course , the modifications that have been explained in conjunction with fig6 can be equivalently applied to the embodiment of fig7 . moreover , it will be possible in both embodiments to consider not only the four neighbouring pixels , i . e ., the left and right , upper and lower neighbours , but to spread the pixel value of a given pixel to all its eight neighbours , including the “ diagonal ” neighbours such as the pixels ( i + 1 , j − 1 ), ( i + 1 , j + 1 ), ( i − 1 , j − 1 ) and ( i − 1 , j + 1 ) for the central pixel ( i , j ). it is to be understood that the foregoing descriptions and specific embodiments shown herein are merely illustrative of the best mode of the invention and the principles thereof , and that modifications and additions may be easily made by those skilled in the art without departing for the spirit and scope of the invention , which is therefore understood to be limited only by the scope of the appended claims . | 6 |
this invention provides that the aav itr is independently able to influence gene expression . this reflects a previously unrecognized ability of aav itr to function as a fully competent transcription promoter . this is proven by constructing an aav vector in which the reporter gene , cat , is linked directly to the itr and is expressed when introduced into cells . aav vectors containing the full length cftr cdna are larger than wild type aav and are difficult to package into aav transducing particles . however , the invention provides that a cftr cdna expressed from an aav itr promoter is able to complement the cf defect and is regulated appropriately as indicated by functional assays . the invention also demonstrates that this truncated cftr cdna could be packaged into an aav vector and infected into ib3 cells such that the bulk culture could be complemented for the cf defect . therefore , the invention provides that it is possible to obtain efficient complementation of the cf defect with aav transducing vectors . therefore , the present invention provides an adeno - associated viral vector comprising the inverted terminal repeat ( itr ) sequences of adeno - associated virus and a nucleic acid , wherein the inverted terminal repeat sequences promote expression of the nucleic acid in the absence of another promoter . by &# 34 ; adeno - associated viral vector &# 34 ; is meant any vector which has the itr sequences necessary to package the viral genome , integrate into a host chromosome and promote transcription of additional sequences . thus , any changes in the itr which retain these essential functions is considered within the meaning of itr . the nucleic acid promoted by itr can be any desired sequence . in one embodiment , the nucleic acid can encode a polypeptide which has a desired function in the cell in which the vector is expressed . for example , the polypeptide can be a protein having a desired function in a cell , on the surface of the cell , or when secreted . one example of a protein is cftr . as described above and in more detail below , the vector is ideally suited for larger nucleic acids , like cftr , which approach the maximum packaging size for standard aav vectors and for therapy purposes should be integrated into the genome . alternatively , the nucleic acid sequence simply can encode an antisense rna for use in antisense related therapy . the viral vector can be contained in a suitable host . any cell can be a suitable host so long as the vector is capable of infecting the cell type . one example of a suitable host is an epithelial cell containing a non - functional cftr sequence for use when the vector contains a functional cftr sequence . the vector can contain additional sequences , such as from adenovirus , which aid in effecting a desired function of the vector . for example , the addition of adenovirus dna sequences enclosing the aav vector could provide an approach to packaging aav vectors in adenovirus particles . the vector can also be contained in any pharmaceutically acceptable carrier for administration or the like . examples of suitable carriers are saline or phosphate buffered saline . as used herein , aav means all serotypes of aav . thus , it is routine in this art to use the itr sequences from other serotypes of aav since the itrs of all aav serotypes are expected to have similar structures and functions with regard to replication , integration , excision and transcriptional mechanisms . the invention provides a method of delivering a protein to a subject comprising infecting the subject with the vector of the invention . while not limited to humans , most therapy uses of the vector will be applicable mainly to humans . in this regard , the invention provides a method of delivering a functional cystic fibrosis transmembrane conductance regulator to a human subject comprising infecting the subject with the cftr containing vector of the invention . this method thus can be utilized to treat cystic fibrosis . also provided is an isolated nucleic acid consisting essentially of the inverted terminal repeat sequences of adeno - associated virus . in addition , the invention provides a vector comprising this nucleic acid provided the vector is not an adeno - associated virus vector . this vector can be contained in a suitable host and in a pharmaceutically acceptable carrier . thus , as described in more detail below , the specific promoter sequences can be determined and utilized to promote expression in other vectors . the invention also provides a vector comprising a polya site that is capable of being translationally read in the reverse direction . the specific sequence disclosed below can be modified by standard procedures and still maintain this capability . the invention also discloses a viral vector comprising a polya site that is capable of being translationally read in the reverse direction ; the itrs of adeno - associated virus ; and a nucleic acid encoding a polypeptide . in this vector , the inverted terminal repeat sequences promote expression of the nucleic acid in the absence of another promoter . thus , this vector has the advantages of maximum packaging capabilities and the capability to be read in the reverse direction . finally , a functional cystic fibrosis transmembrane conductance regulator protein having a deletion of the amino terminal sequence is provided . while the particular deletion disclosed is in amino acids 1 through 118 , the invention provides the first documentation of an amino terminal deletion which maintains function . given this discovery , it would be routine to delete various alternative amino terminal deletions to accomplish the same purpose by following the methods set forth below . the cfbe ib3 - 1 cell line ( ib3 cells ) is a human bronchial epithelial cell line derived from a cf patient and immortalized with an adeno / sv40 hybrid virus ( luo et al ., 1989 , pflugers arch . 415 : 198 - 203 ; zeitlin et al ., 1991 , am . j . respir . cell mol . biol . 4 : 313 - 319 ). these cells retain characteristics of epithelial cells and are deficient in protein kinase a activation of chloride conductance . ib3 cells were grown at 37 ° c . in 5 % co 2 in lhc - 8 medium ( biofluids , inc . md ) plus 10 % fetal calf serum with added endothelial cell growth supplement ( 15 ug / ml ) in culture flasks or dishes coated with collagen ( 150 ug / ml ), fibronectin ( 10 ug / ml ) and bovine serum albumin ( 10 ug / ml ). the 293 - 31 cell line ( 293 cells ), originally derived from human embryonic kidney cells transformed with the adenovirus type 5 e1a and e1b genes , were grown at 37 ° c . in 5 % co 2 in eagle &# 39 ; s minimal essential medium with 10 % fetal calf serum and were used for transfection assays of cat vectors and for packaging aav vectors into virus particles ( tratschin et al ., 1984 , mol . cell . biol . 4 : 2072 - 2081 ). plasmids were constructed and grown using standard methods ( sambrook et al ., 1989 , molecular cloning , cold spring harbor laboratory , cold spring harbor , n . y .). the aav - cat plasmids were constructed as follows . the parental plasmid , pav2 , contains the entire 4681 nucleotide sequence of aav2 inserted in a pbr322 derived plasmid via a polylinker and bglii linkers ( laughlin et al ., 1983 , gene 23 : 681 - 691 ). from this a plasmid pyt45 was obtained which contained a prokaryotic cat gene immediately downstream of aav nucleotides 1 to 263 ( which placed the cat gene under control the aav p 5 promoter ) followed by aav nucleotides 1882 - 1910 and 4162 - 4681 ( containing the polya signal and right hand itr ) downstream of the cat gene . pro1472 was derived from pyt45 by first deleting a snabi / ndei fragment ( aav nucleotide 4498 to pbr322 nucleotide 2295 ) to yield pro45 . this removed the right hand aav itr but retained the aav polyadenylation ( polya ) site downstream of the cat gene . pro1472 was then constructed by insertion of a synthetic double - stranded oligonucleotide into the hindiii site of pro45 . the oligonucleotide consisted of aav nucleotides 266 - 321 flanked by hindiii overhangs such that only the 5 &# 39 ; end of the insert had a complete hindiii site after ligation . proper insertion was confirmed by sequencing . the final construct pro1472 contains aav nucleotides 1 - 321 upstream of the cat gene ( except that nucleotides 264 and 265 are changed from the wild type sequence cc to tt ) and aav nucleotides 1882 - 1910 and 4162 - 4492 ( containing the polya signal ) downstream . psa60 was derived from pyt45 . 1 ( which is a derivative of pyt45 obtained by filling in ( i . e ., inactivating ) the bamh - i site in the poly - linker sequence immediately upstream of the left - hand itr ) by cleaving pyt45 . 1 with kpni and snab to remove the region containing the aav polya signal ( aav nucleotides 4162 to 4495 ) and inserting a 60 base - pair synthetic oligonucleotide ( spa ) containing a synthetic polya site ( modified from levitt et al ., 1989 , genes and development 3 : 1019 - 1025 ) having kpni and snab compatible termini . this spa was obtained by synthesizing two single oligonucleotides having the following sequences : and annealing these two oligonucleotides to generate the 60 base - pair nucleotide with kpni and snab compatible termini . this spa was designed such that in the sense direction it is a functional polya site and in the other orientation it can be translated through as an open reading frame . the presence of the spa in psa60 was verified by dna sequencing . psa665 was derived from psa60 by inserting at the hindiii site a 54 base - pair oligonucleotide ( representing the 54 bases upstream of the initiation codon of the cftr gene , i . e ., nucleotides aa to bb in the cftr sequence of drumm et al ., 1990 ) via a hindiii site at one end and a hindiii compatible site at the other . this 54 base oligonucleotide was derived by synthesizing and annealing the two oligonucleotides : psa673 was derived in a similar fashion except that the inserted oligonucleotide contained only 27 nucleotides of the upstream cftr sequence ( i . e ., cftr cdna nucleotides aa to bb ). the 27 base - pair oligonucleotide was derived by synthesizing and annealing the two 27 base oligonucleotides : ptrf46 was derived by generating via the pcr reaction a 842 base - pair fragment of pro1472 comprising the region from the pbr322 pvui site to the nucleotide 145 of the aav itr using primers that gave a pvui site in the pbr322 region and a hindiii site adjacent to the aav itr . this was then inserted into psa60 that had been cleaved with pvui and hindiii . the effect of these operations was to generate ptrf46 that is identical to psa60 except that it is deleted for nucleotides 146 to 263 of aav ( i . e ., the entire p 5 promoter ) and places the cat coding region adjacent to the aav itr . the sequence of the entire aav itr region and junction with the cat sequence in ptrf46 was verified by dna sequencing . paavp 5 neo is analogous to pyt45 except that it has a neo coding sequence in place of the cat gene and the downstream aav nucleotides 1882 - 1910 and 4162 - 4492 ( the kpni / snab fragment ) were replaced 60 bp spa . psa313 is analogous to paavp 5 neo except that the neo sequence was replaced with the cftr coding sequence contained in a 4502 bp aval - ssti fragment excised from a plasmid pba - cftrbq ( drumm et al ., 1990 , cell 62 : 1227 - 1233 ). this cftr cdna sequence contains the three silent point mutations in exon 6a which eliminate the prokaryotic promoter sequence . in psa313 , the cftr gene is under control of the aav p 5 promoter . the plasmid psa315 is analogous to psa313 , except that the cftr cdna is inserted in the opposite direction . the plasmid psa306g is analogous to psa315 except that it has a deletion of the cftr nucleotides 131 to 486 . in both psa315 and psa306 the cftr gene is expressed from the aav itr as discussed below . the junction sequences between the cftr insert and the aav termini and spa regions of psa313 , psa315 , and psa306 were verified by dna sequencing . psa464 was derived from psa306 by cleaving with aflii at nucleotide of the cftr sequence and filling in and blunt - end ligation with t4 dna polymerase and t4 dna ligase . this generated a frameshift in the cftr sequence . the presence of this mutation was verified by dna sequencing . dna transfection in ib3 was performed in 6 - or 24 - well dishes using lipofection . thirty ug of lipofection reagent ( brl , gaithersburg , md .) was used for each 5 to 6 ug of dna transfected . lipofectin and dna were mixed in 1 . 0 ml of lhc - 8 serum - free medium and added to cells ( 5 × 10 5 to 5 × 10 6 in 35 mm wells ) already covered with 0 . 5 ml of medium . cells were exposed to dna for 4 hours , rinsed with pbs and then grown in 2 ml of fresh medium . dna transfection in 293 cells was performed by the standard dna - calcium phosphate precipitation procedure . ib3 cells used for stable neo expression were split 1 : 3 into 10 cm dishes at 24 to 48 hours after transfection and geneticin sulfate was added 72 to 96 hours after transfection at a concentration of 120 ug / ml . the amount of geneticin used was based on a minimal lethal dose titration . geneticin resistant ( gen r ) colonies were counted at 14 to 16 days after beginning selection . ib3 cells were plated at approximately 5 × 10 5 cells 35 mm dish . twenty - four hours after plating , cells were transfected using either 6 ug of paavp 5 neo or 1 ug of paavp 5 neo together with 5 μg of psa313 , psa315 , psa306 , or psa464 by lipofection , and geneticin selection was performed as described above . gen r colonies were isolated at 14 days after beginning selection from each of the other two sets of plates . each isolated colony was trypsinized using a cloning cylinder and expanded from 10 mm wells . after expanding each clone , cells were prepared for 36 cl - efflux assays and western blot analysis . chloride efflux assays were performed as described ( trapnell et al ., 1991 , j . biol . chem . 266 : 10319 - 10323 ) on individual clones at passage 4 to 8 . briefly , cells were grown in 35 mm dishes and loaded with 3 uci of 36 cl - in bicarbonate - free ringer &# 39 ; s balanced salt solution for 2 to 9 hours . initial experiments involving repeated assays on the same clone of cells did not reveal significant differences in efflux following different loading times and a 2 hr loading period was then used for subsequent experiments . after loading the cells were washed 2 to 3 times in ice cold 0 . 15 m nacl , 5 mm hepes , pi 7 . 4 . one ml of ringer &# 39 ; s solution was added and removed immediately ( time zero ) and replaced with 1 ml of ringer &# 39 ; s . this process was repeated at various time points over a 15 min period . the amount of radioactivity in each 1 ml sample of medium was determined by liquid scintillation counting . after the last sample was removed at 15 min , residual radioactivity remaining in the cells was determined by lysing the cells in 0 . 2 n naoh and scintillation counting . the total radioactivity from all time points and the final cell lysate was then summed and the efflux was expressed as a percent of total radioactivity remaining in the cells at each time point . effluxes were then repeated for each clone tested , using 10 um forskolin dissolved in the ringer &# 39 ; s efflux solution , starting at time zero . the relative stimulation by forskolin was then expressed by calculating the rate ( k a ) of efflux in the presence of forskolin and expressing this as a ration relative to the rate of efflux in the absence of forskolin . for ib3 cells which exhibit the cf defect this ratio is 1 . 0 or less . for cells complemented by cftr vectors this ration is greater than 1 . 0 . cells used for transient expression of cat vectors were harvested at 48 hours after transfection , lysed by three cycles of freezing and thawing , and assayed for cat activity ( tratschin et al ., 1984 , mol . cell . biol . 4 : 2072 - 2081 ). packaging of aav2 vectors was accomplished by first infecting 293 - 31 cells ( grown to semiconfluence in 100 mm dishes ) with adenovirus type 5 ( ad5 ) ( at a multiplicity of 5 to 10 infectious units / cell ) and then co - transfecting the vector plasmid , psa306 or psa464 ( 1 μg ) and the packaging paav / ad ( 5 μg ) using the capo 4 transfection procedure ( tratschin et al ., 1984 , mol . cell . biol . 4 : 2072 - 2081 ). medium was replaced 2 hr prior to transfection and ad5 was inoculated into the medium 1 hr prior to transfection . the medium was changed 4 hr after transfection . cells were grown for 3 to 4 days then harvested by gently scraping into the medium . for direct analysis of packaging , the lysates were frozen and thawed three times , debris was removed by low speed centrifugation , then heated at 60 ° c . for 15 min to inactivate adenovirus . for use of vectors in transduction of ib3 cells the scraped cells were concentrated by low - speed ( 4000 rpm ) centrifugation and resuspension in 10 mm tris - hcl buffer , ph 8 . 0 . cells were lysed by freezing and thawing three times and the virus was concentrated and purified using cscl density gradient ultracentrifugation ( carter et al ., 1979 , virology 92 : 449 - 462 ). fractions taken for transduction assays were then dialyzed against 1 × ssc three times for 1 h at room temperature and heat - treated at 60 ° c . for 15 minutes to inactivate any possible residual adenovirus . the titer of the vector preparation was determined by dna slot - blot hybridization ( samulski et al ., 1989 , j . virol . 63 : 3822 - 3828 ). virus particle - mediated neo transduction of ib3 - 1 cf bronchial epithelial cells was accomplished by infecting 10 3 to 4 × 10 4 cells in individual wells of a 24 well dish with a known number of aav - cftr vector particles per cell . the cells were grown for several weeks and assayed for complementation of the cf defect . to test the efficiency of the aav p 5 promoter in aav vectors in human cells ( flotte et al ., 1992 ) constructed several p 5 cat plasmids . the plasmid pro1472 contains the cat coding sequence positioned immediately downstream of aav nucleotides 1 to 321 ( fig1 ). this region of aav includes several notable features including an aav inverted terminal repeat ( itr ) from aav nucleotides 1 to 145 and the tata box of the p 5 promoter at nucleotide 255 . nucleotides 204 to 213 constitute a binding site for the mltf ( usf ) transcription factor and nucleotides 217 to 236 comprise a 10 bp repeat that constitutes a novel response element for the adenovirus transcription factor e1a ( chang et al ., 1989 ). a previous report indicated that an aav promoter consisting of nucleotides 190 - 310 had only minimal activity in hela cells unless activated by the e1a protein ( chang et al ., 1989 ). in contrast , an aav promoter comprising the nucleotides 145 - 310 had significant activity in hela cells in the absence of e1a ( beaton et al ., 1989 ). these differences may reflect the presence , between nucleotides 160 to 180 , of the sequence gtgacgtgaattacgtcatag [ seq id no : 7 ], which has homology to the camp response element ( cre ) and the binding site for the creb / atf transcription factor family ( hai et al ., 1988 ; montminy et al ., 1990 ). flotte et al . ( 1992 ) examined several aspects of the aav p 5 promoter vectors . the p 5 - cat plasmid , pro1472 was tested for cat expression after transfection into ib3 ( airway epithelial ) cells and cfpac ( pancreatic adenocarcinoma ) cells and showed efficient cat expression . furthermore , the activity of the p 5 promoter in pro1472 was nearly 10 - fold higher than that of the sv40 early promoter in psv2cat . the cre element mediated a positive response to stimulation with forskolin to activate camp . these results suggested that , in the context of the entire left hand terminus of aav in the complete p 5 promoter camp could mediate a modest induction of expression . the aav p 5 promoter was also efficient for stable expression of a gene , neo , which mediates resistance to the antibiotic geneticin ( gen r ) in mammalian cells . the plasmid aavp 5 neo had neo expressed from a p 5 promoter similar to that in pro1472 and was much more efficient than psv2neo for gen r colony formation when transfected into ib3 cells . also , when the aavp 5 neo vector was packaged into aav transducing particles and infected into cells up to 60 to 70 percent of the cells were transduced to the gen r phenotype . these experiments showed that the aav p 5 promoter was efficient for integration and stable expression of a selective marker in human cells when used in aav vectors . expression of a gene from a promoter comprised only of the aav itr the experiments of flotte et al . ( 1992 ), summarized above , showed that the aav p 5 promoter could function well in aav promoters and this is extremely useful . all aav vectors that are to be used as aav transducing vectors ( i . e ., by packaging into aav particles ) to promote efficient uptake must have an aav itr at each end of the packaged vector genome . that is because the itr sequences contain all of the cis - acting sequence that is required for the aav replication origin , for encapsulation of the genome into particles and for efficient integration into the host cell chromosome . in this context , the p 5 promoter is very useful because it forms a convenient cassette with the itr region and adds only about 120 additional nucleotides . this helps to maximize the amount of space available for packaging foreign dna into aav vectors . these considerations are particularly important for encapsulation of larger genes or cdnas which approach or exceed the packaging capacity of aav as discussed above . as noted above , one such example is the cftr cdna which encodes the gene product which is responsible for the defect in the genetic disease cystic fibrosis . in the course of constructing vectors that were designed to express genes such as cftr from the aav p 5 promoter , we inadvertently made one such plasmid construct in which the gene was inserted in the opposite direction . this vector plasmid would not have been expected to function because it did not have a known promoter in the correct orientation . however , due to a serendipitous mistake in a laboratory experiment , we tested this plasmid construct and discovered that it functioned to express the gene . this caused us to examine the construct carefully and we concluded that the itr may be functioning as a transcription promoter . as a result , we performed specific experiments detailed in this specification which demonstrate that the itr can act as a transcription promoter . thus , aav vectors need have only the itr sequences and a polya site in order to express a foreign gene . this is a new and novel finding and indeed is against the expectation based on previously taught work , in which there was a commonly accepted agreement that the itrs of aav are not transcriptionally active ( walsh et al ., 1992 , pnas [ in press ]). we show here that the aav itr is transcriptionally active in transient assays to express the cat gene and in stable integration assays to express a functional cftr cdna . fig1 shows the construction of several aav - cat vector plasmids . pro1472 has the complete aav p 5 promoter ( nucleotide 145 - 263 ) and itr ( 1 - 145 ) upstream of the cat gene as well as the aav rna start site ( 263 - 320 ) and the aav polya site downstream ( kpni / snab region ). psa60 has the polya site deleted and replaced with a smaller synthetic polya site which increases the packaging capacity of the vector . this polya site also has an additional property that it is translationally open in the reverse orientation ( i . e , reading from the right hand itr ). in psa665 and psa673 , respectively , an additional 54 or 27 nucleotides , derived from the cftr cdna sequence immediately upstream of the presumptive cftr initiation codon , is inserted immediately upstream of the cat gene . in ptrf46 , the cat gene is inserted immediately following the aav itr sequence . these aav - cat plasmids were transfected into human ( 293 ) cells and cat activity was measured in extracts prepared 48 hr later . as shown in table i , pro1472 efficiently expressed cat . also , the plasmid , psa60 , having a full p 5 promoter and a synthetic polya site was as efficient as pro1472 . psa665 and psa673 were about 1 . 5 fold more efficient presumably because the aug initiation codon for the cat coding region was moved away from the immediate proximity of the 5 &# 39 ; cap region of the mrna as compared to psa60 . surprisingly , ptrf46 , expressed cat as efficiently as pro1472 or psa60 , even though it contains none of the previously characterized p , promoter ( i . e ., nucleotides 145 to 320 ). this shows that the aav itr sequence is itself capable of acting as an efficient promoter for gene expression . this is an unprecedented and novel finding for aav that this region is also a promoter . table i______________________________________expression of gene activity from aav vectorsvector . sup . a cat activity (%). sup . b______________________________________pr01472 27 . 5psa60 28 . 2ptrf46 26 . 6psa665 43 . 1psa673 40 . 1control 0 . 02______________________________________ . sup . a human 293 cells ( 10 . sup . 6 cells per 35 mm dish ) were transfected with 5 μg of the indicated vector plasmid . the control culture was not transfected . . sup . b 48 hr after transfection cell lysates were prepared and cat activity was measured as the amount (%) of . sup . 14 cchloramphenicol which was acetylated by incubation with 20 μl of lysate ( equivalent to 1 . 3 × 10 . sup . 5 cells ) at 37 ° c . for 1 hr followed by separation of the acetylated and unacetylated substrate by silicagel thinlayer chromatography and scintillation counting to determine radioactivity . fig2 shows several aav - cftr vectors designed to express cftr either from the aav p 5 promoter as in psa313 or from the aav itr as in psa313 or psa306 . in psa313 , the cftr cdna of 4500 nucleotides is inserted downstream of the aav promoter analogous to that in psa60 , i . e , aav nucleotides 1 to 263 , at the left . in psa315 the cftr cdna was inserted in the opposite orientation such that it is downstream of the right - hand aav itr sequence and the synthetic polya site . in this configuration the cftr is expressed from the right - hand itr and the polya site can be read through translationally in the reverse direction as noted above . in psa306 , the construct is exactly analogous to psa315 except that 350 nucleotides of the amino terminal region of cftr cdna have been deleted . this results in expression from the right - hand itr of a fusion protein consisting of a n - terminally deleted cftr protein having a fusion region at its n - terminus derived from reading through the synthetic polya site in the reverse direction i . e ., from right to left in the orientation of fig2 . the plasmid psa464 is a control derived from psa306 by introducing a frameshift mutation such that it can not produce a functional cftr protein . expression of cftr and complementation of the cf defect in stable transfectants of cf airway cells to examine the efficiency of the aav - cftr vectors for expression of the cftr gene , the plasmids shown in fig2 were each transfected using cationic liposomes ( lipofectin reagent , brl , gaithersburg , md .) into ib3 cells , together with paavp 5 neo . control cells were transfected with paavp 5 neo alone . gen r colonies were picked from the original plates and expanded into stable cultures and characterized for functional expression of the cftr protein . all of these clones were stable for neo expression during repeated passage over several months in culture . expression of cftr can be detected in functional assays in ib3 cells which have the cystic defect a functional cftr protein should restore to these cells a cl - conductance which is regulated by camp and thus is stimulated by forskolin ( drumm et al ., 1990 , cell 62 : 1227 - 1233 , hwang et al ., science 244 : 1351 - 1353 ; li et al ., 1988 , nature ( london ) 331 : 358 - 360 ; li et al ., 1989 , science 244 : 1353 - 1356 ; rich et al ., 1990 , nature 347 : 358 - 363 ). examples of cl - efflux are shown in fig3 and a summary of the rate constants calculated from this data are shown in fig4 . both the parental ib3 cells and the control n6 clone ( transfected with paavp 5 neo alone ) exhibited a relatively slow cl - efflux rate that was not responsive to forskolin ( fig3 a and 3b ). in contrast , a number of the clones of aav - cftr transfectants , as shown in fig3 for clones c35 ( fig3 d ) and c38 ( fig3 c ) ( both derived from transfection of psa306 ), exhibited significantly increased basal rates of efflux but more significantly showed the characteristic additional increase in efflux in response to forskolin . as shown in the summary ( fig4 ) 28 % ( 4 / 14 ) of the psa313 transfectants , and 50 % ( 6 / 12 ) of the transfectants with either psa315 or psa306 were complemented for the defect . this shows that all three vector constructs were functional . the increased number of functional clones with psa313 or psa306 may indicate that the itr promoter in the vectors was more efficient than the p 5 promoter in psa313 . none of the clones transfected with the control vector psa464 were complemented . these results show two novel findings . first , the aav itr sequence functions efficiently also as a promoter when stably integrated into cells as shown by the function of both psa313 and psa306 . second , the truncated cftr protein expressed from psa306 is also functional for complementation of the cftr defect . in the psa306 vector the largest open reading frame expresses a fusion protein by reading through most of the synthetic polya sequence in the reverse direction . the observations with psa306 are especially pertinent because it was taught previously that the region of cftr that is deleted in psa306 was in fact essential for cftr function when cftr is expressed from various others vectors such as vaccinia ( andersen et al ., 1991 , science 251 : 679 - 682 ). also , the overall size of the aav - cftr vector in psa306 is equivalent to the size of wild type aav dna and thus this vector should be packageable into aav particles to use as a transducing vector . we examined packaging of the psa306 vector into aav particles . to examine packaging of aav - cftr vector psa306 into aav particles adenovirus - infected 293 cells were transfected with the aav - cftr vector ( psa306 ) in the presence (+) or absence (-) of the aav packaging plasmid ( paav / ad ). lysates of the cultures were prepared 72 hr after transfection and used to infect fresh cultures of adenovirus - infected 293 cells in the absence ( minus wt ) or presence ( plus wt ) of added wild type aav particles ( m . o . i 3 ). 40 hr after infection , hirt lysates of the cells were prepared and viral dna was electrophoresed in an agarose gel , blotted to nitrocellulose , and hybridized with a cftr 32 p - dna probe specific for the sa306 vector ( 306 ) or with aav 32 p - dna probe specific for wild - type aav ( aav ). replication of the sa306 vector was only detected in lysates that had been packaged in the presence of paav / ad and were subsequently infected in the presence of added wild - type aav particles . this showed that the aav - cftr vector could be packaged into aav transducing particles . to demonstrate the functionality of the sa306 aav - cftr transducing vector ib3 cell cultures were infected with vector preparations containing packaged sa306 or a control sa464 vector at a multiplicity of 400 vector particles per cell . the cultures were grown several weeks in culture and assayed for functional expression of the cftr . as shown in fig5 the culture infected with the sa306 vector ( a0 cells ) was functionally complemented for the cf defect as shown by the response to forskolin . in contrast the control culture infected with the control sa464 vector ( 2f2 cells ) was not complemented as shown by the lack of response to forskolin . the results shown in fig3 , and 5 have been confirmed by other functional assays including immunofluorescent detection of the cftr protein and electrophysiological assays using patch - clamp techniques . the results described above demonstrate complementation and stable correction of the cf defect in airway epithelial cells after cationic liposome mediated transfection with aav - cftr vector or after infection of the cells with aav - cftr transducing vector particles . these results demonstrate the utility of the aav vectors and the invention as practiced with aav vectors using an itr as the promoter and incorporating a synthetic polya site having special features . our studies with the aav - cftr vectors were performed as an initial step in evaluating the feasibility of using an aav vector for gene therapy . in this respect it is important that we have demonstrated stable complementation of the cf defect in cells derived from bronchial epithelium since this the site of the major clinical manifestation of the disease and is the most likely site for targeting of gene therapy vectors . the complementation experiments reported with a retroviral vector ( drumm et al ., 1990 , cell 62a : 1227 - 1233 ) were performed in cfpac cells which are pancreatic cells rather than airway cells . aav vectors , especially those expressing a gene from the itr , can be used to treat human patients in the following general way . if the vector is to be delivered as transducing particles , it can first be packaged into aav particles , in the general way described here for the aav - cftr vector sa306 , or using any other suitable packaging system . the aav transducing vector can be purified to remove and / or inactivate any adventitious agents or toxic compounds by banding in cscl or any other appropriate procedure . for aav vectors expressing a functional cftr gene , or any other gene for treating a pulmonary disease , the vector can be delivered directly in vivo to the lung either by intubation and bronchoscopy or by a nebulizer or by a nasal spray or by inhalation as an appropriate formulation of nose drops . for this or other diseases , the aav vector particles can be delivered in vivo by intravenous or enteric administration or perhaps subcutaneously . the vector can also be used in ex vivo gene therapy procedures by removal of cells from a patient that is then infected with the aav vector particles and the cells are returned to the patient after a period of maintenance and / or growth ex vivo . the aav vectors can also be administered in either in vivo or ex vivo gene therapy procedures in various other formulations in which the vector plasmid is administered as free dna either by direct injection or after incorporation into other delivery systems such as liposomes or systems designed to target by receptor - mediated or other endocytosis procedures . the aav vector can also be incorporated into an adenovirus , retrovirus or other virus which can be used as the delivery vehicle . an additional use of the present discovery is to utilize the sequences of itr which are responsible for promotion in other vectors . the itr region of aav does not have a normal tata motif common to many eukaryotic promoters and was not previously recognized to function within the context of an aav genome as a transcription promoter . it is likely that in the context of the aav genome this itr does not function as a promoter perhaps because of effects of the other known aav promoters downstream of this . however , not all eukaryotic transcription promoters require or possess the tata motif . after we demonstrated that the aav itr functions as a promoter we examined the itr sequence for elements that are likely to explain this function . inspection of the itr sequence shows two motifs that are likely to be important in its function as a promoter . first , in the region between aav nucleotide 125 and 145 ( commonly known as the aav d sequence ) there is the sequence 5 &# 39 ;- aactccatcact - 3 &# 39 ; [ seq id no8 ]. this is only one base different from similar sequences at the 5 &# 39 ; start site of the promoters for human terminal deoxynucleotidyl transferase gene and for the adenovirus major late gene promoter and matches closely the consensus sequence for an element described as an inr ( initiator ) element ( smale , s . t . and baltimore , d ., 1989 , cell 57 : 103 - 113 ; smale et al ., 1990 , proc . natl . acad . sci . u . s . a . 87 : 4509 - 4513 ). a second series of gc - rich elements is present in the itr region between nucleotides 1 and 125 including the elements , ggccgcccgggc [ seq id no9 ] from nucleotides 41 to 50 , aaagcccgggcgtcgggcgacc [ seq id no10 ] from nucleotides 51 to 73 , ggtcgcccggcctca [ seq id no11 ] from nucleotides 76 to 90 , and cagcggcgagag [ seq id no12 ] from nucleotides 101 to 112 which have strong homology with the series of consensus sites shown to be sites for the common transcription factor sp1 ( pitluck and ward , 1991 , j . virol . 65 : 6661 - 6670 ). finally , it is now known that an inr sequence in the presence of sites for other factors such as sp1 can function as a transcription promoter ( smale and baltimore , 1989 ; smale et al ., 1990 ). it is likely that these or other regions of the itr may be important in allowing it to function as a transcription promoter . it is now straightforward and obvious to others experienced in the field to perform standard mutagenesis techniques to alter the itr sequence ( for instance , in the context of the plasmid ptrf46 ) to determine precisely the controlling elements and to modulate the transcriptional activity of the itr either up or down . throughout this application various publications are referenced . the disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains . although the present processes have been described with reference to specific details of certain embodiments thereof , it is not intended that such details should be regarded as limitations upon the scope of the invention . __________________________________________________________________________ # sequence listing - ( 1 ) general information :- ( iii ) number of sequences : 13 - ( 2 ) information for seq id no : 1 :- ( i ) sequence characteristics :# pairs ( a ) length : 58 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 1 :- caggcctaat aaagagctca gatgcatcga tcagagtgtg ttggtttttt gt - # gtgtac 58 - ( 2 ) information for seq id no : 2 :- ( i ) sequence characteristics :# pairs ( a ) length : 62 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 2 :- gtacacacaa aaaaccaaca cactctgatc gatgcatctg agctctttat ta - # ggcctggt 60 # 62 - ( 2 ) information for seq id no : 3 :- ( i ) sequence characteristics :# pairs ( a ) length : 54 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 3 :- agctggtctt tggcattagg agcttgagcc cagacggccc tagcagggac cc - # ca 54 - ( 2 ) information for seq id no : 4 :- ( i ) sequence characteristics :# pairs ( a ) length : 54 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 4 :- agcttggggt ccctgctagg gccgtctggg ctcaagctcc taatgccaaa ga - # cc 54 - ( 2 ) information for seq id no : 5 :- ( i ) sequence characteristics :# pairs ( a ) length : 27 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 5 :# 27 gcag ggaccca - ( 2 ) information for seq id no : 6 :- ( i ) sequence characteristics :# pairs ( a ) length : 27 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 6 :# 27 aggg ccgtgtc - ( 2 ) information for seq id no : 7 :- ( i ) sequence characteristics :# pairs ( a ) length : 21 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 7 :# 21 cata g - ( 2 ) information for seq id no : 8 :- ( i ) sequence characteristics :# pairs ( a ) length : 12 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 8 :# 12 - ( 2 ) information for seq id no : 9 :- ( i ) sequence characteristics :# pairs ( a ) length : 12 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 9 :# 12 - ( 2 ) information for seq id no : 10 :- ( i ) sequence characteristics :# pairs ( a ) length : 22 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 10 :# 22cga cc - ( 2 ) information for seq id no : 11 :- ( i ) sequence characteristics :# pairs ( a ) length : 15 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 11 :# 15 - ( 2 ) information for seq id no : 12 :- ( i ) sequence characteristics :# pairs ( a ) length : 12 base ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 12 :# 12 - ( 2 ) information for seq id no : 13 :- ( i ) sequence characteristics :# pairs ( a ) length : 58 base ( b ) type : nucleic acid ( c ) strandedness : double ( d ) topology : linear - ( ii ) molecule type : dna ( genomic )- ( xi ) sequence description : seq id no : 13 :- caggcctaat aaagagctca gatgcatcga tcagagtgtg ttggtttttt gt - # gtgtac 58__________________________________________________________________________ | 0 |
fig3 illustrates one embodiment of the present invention wherein the stator wafer 20 surface closest to the micro - mover 50 has upon it not only stator electrodes 80 but also a bumper 120 . although the bumper 120 is positioned adjacent to only one stator electrodes 80 , this configuration is not restrictive of the present invention . in fact , as shown in fig4 the bumper 120 can easily be position between any two of the stator electrodes 80 . fig5 illustrates another embodiment of the present invention with two bumpers , a first bumper 120 on the surface of the stator wafer 20 closest to the micro - mover 50 , and a second bumper 121 on the surface of the micro - mover 50 closest to the stator wafer 20 . although both bumpers 120 , 121 illustrated in fig5 are positioned to the outside of the electrodes 80 , 90 , either or both of the bumpers can be positioned between two electrodes 80 , 90 , as shown in fig4 . fig6 a and 6b illustrate yet other embodiments of the present invention wherein three and four bumpers 120 are present in a micro - machined actuator 10 . in fig6 a , the three bumpers 120 are arranged in a triangular configuration . dependent upon the particular embodiment of the present invention , each of the three bumpers 120 can be positioned either on the stator wafer 20 or on the micro - mover 50 . for example , a first and second bumper can be positioned on the stator wafer 20 while a third bumper can be positioned on the micro - mover 50 . also , each of the bumpers 120 can be positioned either adjacent to one electrode 80 , 90 or between two electrodes 80 , 90 . in fig6 b , four bumpers 120 are positioned in a square or rectangular configuration wherein each bumper 120 can be either on the stator wafer 20 or the micro - mover 50 . each of the bumpers 120 can be adjacent to one electrode 80 , 90 or positioned between two electrodes 80 , 90 . in addition to the configurations illustrated in fig6 a and 6b , more than four bumpers 120 can also be positioned between the stator wafer 20 and micro - mover 50 . regardless of how many bumpers 120 are present , no limitations are made regarding the geometric arrangement of the bumpers 120 . for example , although fig6 a shows the bumpers 120 to be in a triangular configuration , the three bumpers 120 can be in a linear , random , or other geometrical configuration . the same is true for the four bumpers 120 illustrated in fig6 b and for higher - bumper number embodiments of the present invention . according to the embodiments illustrated in fig3 - 6b , each of the bumpers 120 protrude a greater distance from the surfaces to which they are attached than the electrodes 80 , 90 protruding from those same surfaces . although no particular restrictions are placed on how far the bumpers 120 and electrodes 80 , 90 protrude from their respective surfaces , certain embodiments of the present invention provide for the electrodes 80 , 90 to protrude 75 % as far as the bumpers 120 . other embodiment of the present invention have electrodes 80 , 90 that protrude from the surfaces to which they are attached 90 %, 50 %, 10 %, 5 % and 1 % as far as the bumpers 120 attached to the same surfaces . the bumpers 120 can be made from many different materials and are not restricted in its geometry . hence , the bumpers 120 can be circular protrusions , square protrusions , or protrusions of other geometrical shapes . also , although the bumpers 120 discussed above have been either adjacent to one electrode 80 , 90 or positioned between two electrodes 80 , 90 , certain embodiments of the present invention include bumpers 123 that overlap at least portions of one or more electrodes 80 , 90 . such a configuration is shown in fig7 a and 7b , where fig7 a illustrates a cross - sectional view of an actuator 10 and fig7 b illustrates a top perspective view of the surface of the stator wafer 20 that contains stator electrodes 80 . the bumper 122 is shown in fig7 b as overlapping two stator electrodes 80 partially . for the purposes of simplicity , the bumpers described above are preferably made from the same material as the surface from which they protrude . however , this is in no way restrictive of the present invention and the bumpers , according to certain embodiments , can be made from materials different from those of the surfaces from which they protrude . for example , metal , insulator , dielectric , semiconductor or polymer bumpers could be formed on the surface of a semiconductor stator wafer 20 . according to certain embodiments of the present invention , electrically grounded metal bumpers are used . the overall dimensions of the bumper 120 are typically on the order of microns , though these dimensions are in no way limiting of the present invention . in fact , if the electrodes 80 , 90 were made from nanowires , the bumper 120 could have nanometer dimensions . although it was mentioned above that , without the bumper 120 positioned between the micro - mover 50 and the stator wafer 20 , the actuator electrodes 90 and stator electrodes 80 could fuse , the actual method of fusion was not described . for the sake of completeness , the fusion occurs as , when the electrodes 80 , 90 come in close enough contact to each other , a current path forms between the electrodes 80 , 90 and the electrodes 80 , 90 melt together . the actuator described above can be included in many types of devices . for example , any micro - machine or nano - machine having a suspended platform above a surface is within the scope of the present invention . this includes , but is not limited to , all sorts of sensors , data storage devices , and other devices that require micro - actuators . the distance separating the micro - mover 50 and stator wafer 20 is generally on the order of 1 - 10 microns . however , this is in no way limiting of the present invention and any actuator wherein the electrodes 80 , 90 can exert enough force on each other to move the micro - mover 50 without coming into such close contact that they fuse together are also within the scope of the present invention . one method of manufacturing some of the actuators within the scope of the present invention includes forming stator electrodes 80 on a first surface of a stator wafer 20 . then , a micro - mover 50 is formed and positioned adjacent to the first surface of the stator wafer 20 . on the surface of the micro - mover 50 closest to the stator wafer are formed actuator electrodes 90 . at least one bumper 120 is formed on either the first surface of the stator wafer 20 or of the micro - mover 50 . this bumper 120 can be formed by selective etching , deposition , or another method of forming a protrusion from a surface . the foregoing detailed description has been given for understanding exemplary implementations of the invention only and no unnecessary limitations should be understood therefrom as modifications will be obvious to those skilled in the art without departing from the scope of the appended claims and their equivalents . | 7 |
fig1 and 2 depict preferred fuel filter embodiments containing adsorbent material in accordance with the present invention . for purposes of illustrating these preferred embodiments , al 2 o 3 impregnated with ag ions ( hereafter referred to as ag - ap - al 2 o 3 ) will be used as the adsorbent material . however , nothing in this illustration should be taken as a limitation upon the overall scope of the invention . turning now to fig1 which depicts a single - connector type fuel filter 10 comprising housing 12 having a plurality of sorbent ag - ap - al 2 o 3 pellets 14 located therein . the flow of incoming fuel into filter 10 is indicated by arrow 16 . the incoming fuel 16 enters the filter through a central orifice 18 and then flows through cylinder 20 and into chamber 22 where it contacts pellets 14 . as the fuel contacts pellets 14 , organosulfur contaminants in the fuel are adsorbed by the pellets . the purified fuel denoted by arrows 24 then leaves the chamber 22 ( and consequently filter 10 ) through a plurality of orifices 26 . filter 10 is equipped with a male threaded ring section 28 which may be received in a corresponding female threaded opening ( not shown ) of , for example , an engine block . additionally , solvent resistant gaskets ( not shown ) may be used with filter 10 in order to properly seal the filter orifices 18 , 26 with the engine block so as to avoid leaking . fig2 depicts another preferred fuel filter apparatus 30 which is suitable for in - line connection . like the embodiment of fig1 , filter 30 comprises a housing 32 having a plurality of sorbent ag - ap - al 2 o 3 pellets 34 located therein . the flow of fuel through the filter is depicted by arrows 36 , 38 . the fuel enters filter 10 through orifice 40 and enters chamber 42 whereupon it comes into contact with pellets 34 . again , as the fuel contacts pellets 34 , organosulfur contaminants in the fuel are adsorbed by the pellets . the purified fuel denoted by arrows 38 then leaves the chamber 42 through orifice 44 . filter 30 is configured for in - line placement in a fuel delivery system . filter 30 may be attached directly to the fuel line using connectors 46 , 48 . brackets 50 allow filter 30 to be fixedly secured to a solid portion of the vehicle in order to avoid damage to the fuel line or filter attributable to vehicle motion and vibrations . the following examples set forth preferred methods of synthesizing nanocrystalline mesoporous metal oxide compounds in accordance with the present invention . it is to be understood , however , that these examples are provided by way of illustration and nothing therein should be taken as a limitation upon the overall scope of the invention . in this example , nanosized al 2 o 3 particles were impregnated with silver ions . in a 250 ml round bottom flask , about 0 . 2 g of nanosized al 2 o 3 ( also referred to as ap - al 2 o 3 ) prepared by the aerogel method described by utamapanya et al ., chem . mater ., 3 : 175 - 181 ( 1991 ), incorporated by reference herein , 0 . 11 g of silver acetylacetonate ( aldrich ), and 25 ml of tetrahydrofuran ( fisher ) were combined . the resulting slurry was stirred at room temperature for about 24 hours and protected from exposure to light with aluminum foil . after stirring , the mixture was centrifuged , washed with tetrahydrofuran approximately 4 - 5 times to remove excess silver acetylacetonate , and dried in a drying cabinet for about 2 hours . the brown powder that remained was heated at 500 ° c . under an air atmosphere inside a muffle furnace for about 3 hours . the final product was a brownish black powder and was designated ag - ap - al 2 o 3 . this example describes the adsorption of thiophene using ag - ap - al 2 o 3 prepared according to example 1 . to about 0 . 1 g of ag - ap - al 2 o 3 , 10 ml of thiophene solution in pentane ( 9 . 9 × 10 − 5 m ) was added . the sorption of thiophene was allowed to proceed at room temperature for about 15 hours . the degree of thiophene sorption on ag - ap - al 2 o 3 was determined by measuring the uv - v is spectrum of the supernatant solution . analysis showed that the silver ion impregnated ap - al 2 o 3 was successful in scavenging thiophene from the pentane solution . this example relates to impregnation of nanocrystalline mgo with nickel ions ( ni 2 + ), the final product being designated ni 2 + - ap - mgo . in a 250 ml round bottom flask , 0 . 2 g of nanosized mgo ( also referred to as ap - mgo ) prepared by the aerogel method , 0 . 1 g of nickel acetylacetonate , and 25 ml of tetrahydrofuran are combined . the slurry is stirred at room temperature for about 24 hours . the mixture is centrifuged , washed with tetrahydrofuran , and dried in a drying cabinet for about 2 hours . the resulting powder undergoes calcination for about 3 hours inside a muffle furnace at 500 ° c . initially under an air atmosphere switching over to a vacuum . ni 2 + - ap - al 2 o 3 may be prepared in a similar manner by substituting ap - al 2 o 3 for mgo . similarly , cu + , au + , ga 3 + , and in 3 + may be substituted for ni 2 + in this process and the metal oxide impregnated therewith . this example describes impregnation of a nanocrystalline metal oxide with a second metal oxide which exhibits the properties of a lewis acid . specifically , this example describes the impregnation of al 2 o 3 with ga 2 o 3 ( the lewis acid ). in a 250 ml round bottom flask , 0 . 2 g of nanosized al 2 o 3 ( also referred to as ap - al 2 o 3 ) prepared by the aerogel method , 0 . 1 g of gallium acetylacetonate , and 25 ml of tetrahydrofuran are combined . the slurry is stirred at room temperature for about 24 hours . the mixture is centrifuged , washed with tetrahydrofuran to remove the excess gallium acetylacetonate , and dried in a drying cabinet for about 2 hours . the resulting powder undergoes calcination for about 3 hours inside a muffle furnace at 500 ° c . under an air atmosphere . it is important to note that mgo may be substituted for al 2 o 3 and indium acetylacetonate for gallium acetylacetonate with little modification of the overall method . this example pertains to the preparation of nanocrystalline ga 2 o 3 having a high surface area useful as a sorbent for thiophene removal from a fluid . in this procedure , 7 % by weight gallium ethoxide in ethanol solution is prepared and 63 % by weight toluene solvent is added . the solution is then hydrolyzed by the addition of 0 . 5 % by weight water dropwise while the solution is stirred and covered with aluminum foil to avoid evaporation . to ensure completion of the reaction , the mixture is stirred overnight . this produces a gel which is treated in an autoclave using a glass lined 600 ml capacity parr miniature reactor . the gel solution is placed in the reactor and flushed for 10 minutes with nitrogen gas , whereupon the reactor is closed and pressurized to 100 psi using nitrogen gas . the reactor is then heated up to 265 ° c . over a 4 hour period at a heating rate of 1 ° c ./ min . the temperature is equilibrated at 265 ° c . for 10 minutes ( final reactor pressure is about 900 psi ). at this point , the reactor is vented to release the pressure and vent the solvent . finally , the reactor is flushed with nitrogen gas for 10 minutes . the resulting ga ( oh ) 3 particles undergo calcination and are converted to ga 2 o 3 . the calcination proceeds for about 6 hours under an air atmosphere up to a maximum temperature of 500 ° c . the indium ethoxide may be substituted for gallium ethoxide in the preceding method for production of in 2 o 3 . | 2 |
referring to fig1 shown generally at 10 is the motor starting device of the present invention . starting device 10 is shown connected to a capacitor - start , capacitor - run motor indicated generally at 12 . motor 12 includes a main or run winding 14 , a start or auxiliary winding 16 , a run capacitor c1 and a start capacitor c2 . starting device 10 includes a relay comprising a coil 18 and a set of normally - closed contacts 20 . one side of coil 18 is connected through the main terminals 22 and 24 of a triac q1 , a lead 26 and a lead 28 to one side of a conventional 240 volt alternating current power source at a terminal 30 . the other side of relay coil 18 is connected through a lead 32 and a lead 34 to the other side of the power source at a terminal 36 . the relay contacts 20 are connected in series with start winding 16 and start capacitor c2 between leads 28 and 34 . run capacitor c1 is connected between lead 34 and a junction 38 between relay contacts 20 and start winding 16 , and main winding 14 is connected between leads 28 and 34 . starting device 10 includes a microcomputer m1 which , in the preferred embodiment , is a motorola mc68hc705ko . for brevity , only those ports and bits therein necessary to disclose the present invention are shown . also for brevity , the various ports and bits therein are hereinafter referred to as pins . for example , port pa , bit 7 , will be referred to as pin pa7 . a filter capacitor c3 is connected at one end through lead 28 to terminal 30 , and at its other end through a lead 40 , a series pass resistor r1 , a controlled rectifier cr1 and lead 34 to terminal 36 . a voltage regulator vr1 is connected in parallel with capacitor c3 . lead 28 is also connected to pin v dd of microcomputer m1 , and lead 40 is also connected to pin v ss . capacitor c3 , regulator vr1 and resistor r1 function to provide a 5 volt unidirectional power source between pins v dd and v ss . a circuit for monitoring start winding voltage is indicated generally at 42 . circuit 42 comprises a pair of resistors r2 and r3 connected in series between lead 28 and junction 38 through a lead 44 and a controlled rectifier cr2 . a junction 46 between resistors r2 and r3 is connected by a lead 48 to pin pbo , and by lead 48 and a controlled rectifier cr3 to lead 40 . a circuit for monitoring main winding voltage is indicated generally at 50 . circuit 50 comprises a pair of resistors r4 and r5 connected in series between lead 28 and lead 34 through lead 44 , a lead 52 and controlled rectifier cr1 . a junction 54 between resistors r4 and r5 is connected by a lead 56 to pin irq . an oscillator circuit comprises a resistor r6 and a capacitor c4 connected in series between pin osc2 and lead v ss . the junction 58 between resistor r6 and capacitor c4 is connected by a lead 60 to pin osc1 . the oscillator circuit provides a clock frequency of 2 megahertz . with such clock frequency , the timing resolution is 4 microseconds . a gate terminal 62 of triac q1 is connected through a resistor r7 to pin pa4 . a resistor r8 is connected between main terminal 24 and gate 62 to prevent unwanted triggering of triac q1 . a snubber network comprising a resistor r9 and a capacitor c5 is connected across main terminals 22 and 24 of triac q1 . a resistor r10 is connected across start capacitor c2 . resistor r10 provides a discharge path for capacitor c2 . a resistor r11 and an led1 ( light emitting diode ) are connected in series between lead 28 and pin pa7 . led1 is energized in the event of a failure of specific hardware or software that is being monitored . in operation , when electrical power is initially applied to terminals 30 and 36 , the 5 volt power source established by capacitor c3 , regulator vr1 and resistor r1 is applied to pins v dd and v ss , causing microcomputer m1 to be initialized . concurrently , main winding 14 is energized . pin pa4 is held at a logic high so that triac q1 is off . with triac q1 off , relay coil 18 is de - energized so that its normally - closed contacts 20 remain closed . with relay contacts 20 closed , start winding 16 is energized through contacts 20 and start capacitor c2 . run capacitor c1 is also energized . under these conditions , the motor develops a starting torque which , if greater than the load requirements , causes the motor to start rotating . when power source terminal 30 is positive and increasing in value , the voltage at junction 54 between resistors r4 and r5 is also positive and increasing in value due to current flow through resistors r4 and r5 . when terminal 30 is negative , rectifier cr1 blocks current flow through resistors r4 and r5 so that the voltage at junction 54 is essentially zero . the voltage at junction 54 is applied through lead 56 to pin irq of microcomputer m1 . when junction 54 , and thus pin irq , is a few volts above zero and increasing , microcomputer m1 executes an interrupt and stores a value of time indicative of when the interrupt occurred . as the motor begins to rotate , the voltage across start winding 16 begins to increase . as the voltage across start winding 16 increases , the voltage at junction 46 between resistors r2 and r3 increases due to current flow through resistors r2 and r3 . rectifier cr2 prevents a reversal of current flow through resistors r2 and r3 . the voltage at junction 46 is applied through lead 48 to pin pbo . rectifier cr3 clamps pin pbo at a voltage slightly below the voltage at v ss so as to prevent an excessive voltage value from being applied to pin pbo . when junction 46 , and thus pin pbo , is a few volts above zero and increasing , microcomputer m1 stores a value of time indicative of when this condition occurred . resistors r2 and r4 are preferably 10k ohms and resistors r3 and r5 are preferably 720k ohms . with such voltage divider values , the times at which the voltages across windings 14 and 16 reach the &# 34 ; few volts above zero &# 34 ; voltage levels are very close to the repetitive times at which the voltages are zero and increasing . microcomputer m1 is programmed to monitor junctions 46 and 54 in the manner previously described and preferably every line - cycle , and to determine the difference in time between the times at which the main winding voltage and the start winding voltage reach the &# 34 ; few volts above zero &# 34 ; voltage level . such time difference defines a phase angle relationship between the two windings 14 and 16 . microcomputer m1 is further programmed to compare the time difference value relating to the instant one of such monitoring events with the time difference value relating to the monitoring event immediately prior to the instant monitoring event so as to determine whether the time difference ( phase angle ) is increasing or decreasing . as will hereinafter be described , the present invention utilizes changes in such time difference ( phase angle ) for determining when to disconnect start capacitor c2 . referring to fig2 a curve 70 illustrates the manner in which a phase angle between windings 14 and 16 changes with respect to motor speed in a particular motor tested , such motor being a 5 - horsepower motor of the capacitor - start , capacitor - run type . as shown , the phase angle is approximately 105 degrees when the motor speed is zero . as the motor speed increases , the phase angle decreases . at a speed s1 of approximately 3000 rpm , when the phase angle is approximately 62 degrees , the phase angle stops decreasing and begins to increase . microcomputer m1 responds to this increase in phase angle by disconnecting start capacitor c2 . specifically , microcomputer m1 monitors the phase relationship of main winding 14 and start winding 16 at its pins irq and pbo , respectively , in the manner previously described . when the phase angle stops decreasing and begins to increase , microcomputer m1 provides a logic low at pin pa4 . the logic low enables triac q1 to be gated on through resistor r7 . with triac q1 conducting , relay coil 18 is energized whereby its controlled contacts 20 open thereby disconnecting start capacitor c2 from start winding 16 . as previously described , it is desirable that a start capacitor be disconnected at approximately 80 percent of synchronous speed , which disconnecting speed would be 2880 rpm with a motor whose synchronous speed is 3600 rpm . while 3000 rpm is approximately 83 percent of the synchronous speed , it is sufficiently near the desired disconnecting speed . while normal fluctuations in applied line voltage cause the value of the voltage across start winding 16 to fluctuate , such fluctuations do not appreciably affect the phase angle motor speed relationship illustrated in fig2 . specifically , while curve 70 represents the phase relationship at a specific value of applied line voltage , the illustrated phase relationship remains essentially the same with any applied line voltage within the allowable limits of such fluctuations , such limits being , for example , plus 10 percent and minus 15 percent of 230 volts . curve 72 in fig2 illustrates the torque developed in the tested motor with respect to motor speed . it is noted that the maximum torque occurs at a speed slightly less than speed s1 . at speed s1 , the torque is just a few pound - feet less than its maximum value . thus , the torque being developed when the start capacitor c2 is disconnected is very near its maximum value . that the torque is at or near its maximum value when the start capacitor c2 is disconnected ensures that the motor will not stall but rather will continue to run properly . when start capacitor c2 is disconnected , the values of the torque and phase angle change . referring to fig3 curves 80 and 82 therein illustrate the phase angle and torque versus motor speed relationships , respectively , of the tested motor with start capacitor c2 disconnected . motor speed s2 is the same speed as the 3000 rpm speed s1 of fig2 . when start capacitor c2 is disconnected , the torque decreases from approximately 44 pound - feet indicated at t1 in fig2 to approximately 36 pound - feet indicated at t2 in fig3 ; the phase angle increases from approximately 62 degrees indicated at p1 in fig2 to approximately 73 degrees indicated at p2 in fig3 . typically , the motor has started properly so that the small drop in torque when start capacitor c2 is disconnected does not cause the motor to stall due to the load requirements exceeding the available torque . the motor increases its speed past speed s2 to a speed at which the torque produced by the motor equals the torque required by the load , such speed being slightly less than synchronous speed and sometimes being referred to as the slip speed . as previously described , relay coil 18 is initially energized in response to a reversal from a decreasing to an increasing phase angle . also as previously described , the phase angle increases abruptly when start capacitor c2 is disconnected at speed s2 . also , as shown in fig3 the phase angle continues to increase as the motor increases its speed past speed s2 . such increases in phase angle enable continued energizing of relay coil 18 and thus enable continued disconnection of start capacitor c2 . for the purpose of preventing start capacitor c2 from being damaged , microcomputer m1 includes an internal timer which provides a specific time period , such as 5 seconds , for limiting the amount of time that start capacitor c2 can be energized . if start capacitor c2 is not disconnected within 5 seconds of the motor 12 being energized , microcomputer m1 provides a logic low at pin pa4 to enable triac q1 to be gated on , thus enabling relay coil 18 to be energized and thus causing start capacitor c2 to be disconnected . preferably , microcomputer m1 is programmed to provide for reconnection of start capacitor c2 , and thereby provide an increase in torque , in the event that the motor begins to stall . it should be noted that this feature of providing for reconnection of start capacitor c2 can be omitted if it is not desired . the basic logic utilized in microcomputer m1 is to monitor the phase angle as previously described and to de - energize relay coil 18 when the phase angle reverses . accordingly , referring to curve 80 in fig3 as the motor speed decreases , the phase angle decreases . at a motor speed s3 of approximately 2000 rpm , the phase angle begins to increase . the phase angle at speed s3 is indicated as phase angle p3 . referring to curve 82 in fig3 the torque at motor speed s3 is indicated as torque t3 . at speed s3 , when the phase angle reverses , triac q1 turns off , thus effecting de - energizing of relay coil 18 . with coil 18 de - energized , its contacts 20 close thereby reconnecting start capacitor c2 . when start capacitor c2 is reconnected , the values of the torque and phase angle change . referring to fig2 motor speed s4 is the same speed as speed s3 in fig3 . when start capacitor c2 is reconnected , the torque increases from approximately 24 pound - feet indicated at t3 in fig3 to approximately 39 pound - feet indicated at t4 in fig2 ; the phase angle increases from approximately 66 degrees indicated at p3 in fig3 to approximately 70 degrees indicated at p4 in fig2 . if the increased torque is sufficient to satisfy the load requirements , the motor speed will then increase ; if not sufficient , the motor will stall . while a preferred embodiment of the present invention has been illustrated and described in detail in the drawings and foregoing description , it will be recognized that many changes and modifications will occur to those skilled in the art . it is therefore intended , by the appended claims , to cover any such changes and modifications as fall within the true spirit and scope of the invention . | 7 |
fig1 shows the basic circuit of the pin card . the microcontroller 1 is a microcomputer system that contains control software and means to interface with the keypad 5 and ram 2 . it also contains software necessary to communicate with the authorization terminal and implement encryption . the keypad 5 might typically be a membrane type unit feeding directly into the microcontroller 1 . the ram 2 is used to store the matrix and other encryption parameters : i . e ., the user &# 39 ; s pin code and the random number , as they come in from their input points . in this case , the ram is a static ram and must be powered by a battery 26 so as not to lose the matrix . the battery might be a lithium button cell . the uart 4 ( which could be a usart ) is used to tailor data from the microcontroller 1 into a form required for communication with authorization terminals . the interface between the pin card and the authorization terminal is critical . if there is an electrical connection between the two units , as shown in fig9 and 10 , the system is subject to problems caused by contamination and static discharge . fig5 is a circuit which allows the pin card to communicate with the authorization terminal by means of induction . this allows communication without direct electrical contact thus rendering the system impervious to water , dirt , and static discharge . the pin card contains an input - output buffer / amp 6 as does the authorization terminal as shown by element 9 . the purpose of this unit is to condition signals received from the microcontroller 1 , for output , and to condition the output from the input / output coil 7 . these signals will be weak and must be amplified for good communication . the authorization terminal has an identical input / output pair including input / output coil 8 and input - output buffer / amp 9 . for error free communication , one input / output pair must be quiescent while the other pair is active and vice versa . communications protocols must schedule data flow so that both pairs are not in conflict with each other . fig6 shows a communication system based on opto - electric principles . the pin card has an on - board led 12 for data output and a photocell 14 for data reception . signals from the microcontroller would have to be conditioned by the buffer / amplifier 16 before being output . input signals from the photocell would have to be conditioned by a similar buffer / amplifier 17 before sending the data to the microcontroller 1 . the authorization terminal has a similar ( positionally opposite ) input / output pair . data from the pin card will be converted into a series of light impulses by the led 12 and will be picked up and converted into electrical signals by the photocell 14 in the authorization terminal . this weak electrical signal will have to be conditioned by the input buffer / amplifier 15 before it can be sent on to the authorization terminal microcontroller 10 . fig7 shows communications via hall effect devices . a hall effect device senses changes in magnetic flux density . in this application , the hall effect device serves as a data receptor while a coil might serve as the data transmitter . the pin card and the authorization terminal each contain a transmitter / receptor pair 18 and 19 . as in the previous cases , communications protocols must coordinate the timing of data transfer . the battery 26 ( fig1 ) is meant only to maintain ram and to allow non - connected entry of a user &# 39 ; s pin code . if a pin card is powered by an external source , while communicating with an authorization terminal , its on - board battery will have a greatly extended life . fig8 shows a non - contact method of powering the pin card while it is in the authorization terminal . the addition of outside power also makes the communication techniques shown in fig5 , and 7 more practical . fig8 shows the communication technique of fig5 teamed with an inductive power transfer method . a magnetic field , created by a coil 20 in the authorization terminal , cuts across a coil in the pin card 21 and induces an electrical current . the output driver 22 and the rectifier / filter 23 are needed to tailor the power for use by the microcontroller 1 . the advantage of inductive coupling is that the environment and the state of the card ( dirt , scratches , etc .) have no effect on system operation . this is not the case with cards that have electrical contacts . static discharge is also a problem with contact cards . if a user were to touch the contacts after building a static charge , ( by walking across a rug , for example ), he could damage the card &# 39 ; s on - board chip . fig9 shows a chip card to terminal connection as most cards are configured today . the interface 24 consists of simple metallic patches on the card and wiper contacts in the authorization terminal . fig1 shows a contact type communication interface paired with a contact type power transfer interface 25 . this is a common configuration for chip cards today and has all the liabilities of electrical contacts mentioned previously . the cgipin is generated in the following manner . fig4 is an example of a two dimensional matrix that might be carried in a pin card and a central computer . it consists of ten columns of twenty numbers each . the columns repeat themselves after the first ten digits . the central computer also contains the user &# 39 ; s pin code , in this example 2548 . as an example , when the central computer receives a signal indicating that an authorization is required , it generates and outputs a pseudo - random number that is one digit longer than the user &# 39 ; s pin code , in this case 48901 . the pseudo - random number may be generated by any seed . time of day was used in this example . the first digit of the pseudo - random number represents the offset used when working the matrix . in this example , the offset is 4 . the rest of the digits call out the numbers of the columns in the matrix to be used in generating the cgipin . in this example , column 8 is used first , column 9 is used second , etc . to work the matrix , one locates the first digit of the cardholder &# 39 ; s pin code in column 8 , then looks down 4 more numbers , ( the offset ), to come up with the digit 0 , the first digit of the cgipin . the process is followed through with the rest of the cardholder &# 39 ; s pin code and the resulting cgipin is 0182 . this process is being duplicated by the user &# 39 ; s pin card . the cgipin , 0182 , not the user &# 39 ; s pin , is output by the pin card to the central computer for comparison with the reference cgipin . referring to fig4 a , 4b and 4c , the pseudo - random number is 48901 , and pin code is 2548 , the offset , which is the first digit of the pseudo - random number , is 4 , and the direction of the offset is &# 34 ; down &# 34 ;. the encryption system is implemented in this manner : 1 ) the second number in the pseudo - random number is 8 . this is the column number for first digit of the cgipin . the first instance of the first number of the pin , 2 , is found in column 8 , ( see fig4 ). the offset is introduced by going down four numbers , ( see indicator line , fig4 ), and selecting 0 . thus the first digit of the cgipin is 0 . 2 ) this process is repeated with the next number of the pseudo - random number , 9 , and the next digit of the pin , 5 , ( see fig4 a ). the resulting number selection is 1 . this is the second digit of the cgipin . 3 ) this process is repeated with the fourth digit of the pseudo - random number , 0 , and the third digit of the pin , 4 , ( see fig4 b ), with 8 being the resulting selection . this is the third number of the cgipin , 8 . 4 ) the final digit of the pseudo - random number , 1 , and the final digit of the pin , 8 , are used to arrive at 2 , ( see fig4 c ). thus 2 is thus the final digit of the cgipin . 5 ) as a result of this procedure , the cgipin is 0182 . since the pseudo - random number is changed for each verification , tapping the communication lines would not allow intruder to determine the components needed to generate the cgipin . while the matrix used in this example is two dimensional , and the offset is simple , one could use a multi - dimensional matrix and a multipath offset to complicate the process . it should also be said that the algorithm and matrix could be changed at will . we have used the example of a restaurant . the card can be used in other situations such as gaining access to restricted areas and equipment . additionally , the user may enter an optional &# 34 ; mayday &# 34 ; pin code into the pin card in emergency cases , such as an access made under duress . thus , the system is alerted to the fact that an individual &# 39 ; s card has been taken and that the cardholder has been forced to reveal his pin . when the central computer determines that the pin code entered into the pin card matches the &# 34 ; mayday &# 34 ; pin code which was previously placed in the central computer , the central computer would take appropriate action , such as notifying the police . to protect the cardholder , the system would appear to operate normally until such time as the criminal is apprehended . other embodiments of this invention might include a pin card without a keypad . while the pin card system was designed with a card having an on - board keypad , an alternative embodiment of the invention includes a fixed keypad at the merchant &# 39 ; s place of business . with the embodiment using the fixed keypad system , the merchant would place the card in an authorization terminal and ask the customer to enter his pin on the fixed pad at the proper time . the user &# 39 ; s pin is sent to the card from the fixed keypad and then the system operates as has been previously described . as a further alternative , in addition to a fixed pin pad , a merchant might want to use a portable pin pad . this unit has a keypad that communicates with an authorization terminal by remote means such as infra - red . the user enters his pin on the keypad of the portable pin pad , then gives his pin card and the pin pad to the merchant . the pin card and the pin pad are inserted in the authorization terminal . the system then operates as has been previously described . in conclusion , the pin card system offers up to three levels of security . 1 . the top level of security for the pin card system uses a pin card with an on - board keypad . the user enters his pin directly into the card . there is no transmission of the pin from the card , so that there is no chance that a thief could get the user &# 39 ; s pin by tapping the authorization terminal &# 39 ; s communication line . a thief could steal the pin card , but without the pin , ( which is present in the card for only a short time ), there could be no access to a user &# 39 ; s account . 2 . a middle level of security involves the use of a keypad remote from the pin card . in this case , a sophisticated thief could obtain the pin by tapping the remote keypad . the thief would still have to steal the user &# 39 ; s pin card to gain access to accounts , but his knowledge of the pin removes a level of security from the system . 3 . the lowest level of security involves the use of a card without a user entered pin . in this case , the thief need only steal the card to gain access to a user &# 39 ; s account . all levels of security are immune to counterfeiting of the card because the encryption system is complex enough to render computerized interrogation of the card impractical . the card could be configured so as to self - destruct upon repeated interrogation within a set time . also , the matrix and the algorithm are kept in ram so any attempt to gain knowledge through card disassembly would be pointless . all levels are immune to tapping of communication lines to the central computer because the numbers sent back and forth change with every verification . in addition , at all three levels of security , it is impossible to gain authorization without use of the actual card . obviously , many modifications and variations of the invention are possible in light of the above description . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described . | 6 |
the methods and systems of the present invention are described herein with reference to the rotational indexing of a print drum connected , by means of a timing belt and idler pulley , to a stepper motor . although the methods of the present invention are well suited to this type of drive system , they are not limited to this application . methods of the present invention may be utilized to generate and implement motion profiles for any system wherein one or more masses are driven by a common drive means . a conventional motor drive system for rotating a print drum during printing operations is illustrated in fig2 . motor drive 10 is preferably a two phase stepper motor . a two phase stepper motor may be controllably rotated by applying a sequence of current magnitudes to each motor phase . a typical stepper motor generates about two hundred whole steps per revolution . whole stepping is therefore a relatively crude method of driving a motor when precise motor movements are required . the technique known as microstepping facilitates more precise motor control by providing hundreds or thousands of positions per revolution . more specifically , input pulses are communicated to a microstep current driver which directs the advance of the phase currents of both phases of the motor by one microstep , as illustrated schematically in fig3 ( a ). for purposes of the present invention , a microstep current driver generating eight hundred ( 800 ) microsteps per revolution was utilized . the phase current advance therefore resulted in one eight - hundredth of a revolution per input pulse . the timing of these input pulses determines the motion profile of the system , as schematically illustrated in fig3 ( b ). the system of the present invention preferably employs an open loop control system and does not require more complex , closed loop control features . motor 10 is preferably controlled by a microprocessor ( not shown ) that can be programmed to start and stop the motor , as well as to implement desired motion profiles . the microprocessor controls the precise timing between microstep pulses . more specifically , a position v . time history can be generated by summing the microstep pulses , as shown schematically in fig3 ( b ). the three individual masses in the system illustrated in fig2 are connected by means of flexible members , such as timing belts . motor rotor 12 is connected via timing belt 14 to idler pulley 16 , and idler pulley 16 is connected , via timing belt 18 , to drive pulley 20 rigidly mounted on print drum 22 . the gear ratio of the timing belt drive is adjusted so that one whole step at the stepper motor rotor corresponds to one pixel at the drum surface . for the purposes of the present invention , the timing belts may be modelled as elastic springs arranged in parallel to damping elements , such as dashpots , as shown in fig4 . use of such a model captures the elastic properties as well as the energy dissipation properties of the timing belt . the position of each of the masses after the entire zero velocity position to zero velocity position movement must be consistent with that of the other masses and with the gear ratio of the timing belts , so that no energy is stored in the belts as a result of rotational indexing . if this position / gear ratio consistency is lacking , the belt will be stretched and will store strain energy . release of the stored strain energy will disrupt the final zero velocity condition of the three mass system . fig4 illustrates a mathematical model of the drive system dynamics for an exemplary system in which three masses -- the motor rotor , the idler pulley and the print drum -- are moved from one position to another . t a is the torque applied to the first mass , the rotor , by the motor . the first mass has a mass moment of inertia j 1 and the rotary position of the rotor is represented by θ 1 in the time domain . the second mass , the idler pulley , has a mass moment of inertia j 2 , torque t 2 , and its rotary position is represented by θ 2 in the time domain . the third mass , the drum , has a mass moment of inertia j 3 , a frictional torque t f , and its rotary position is represented by θ 3 in the time domain . b 12 and b 23 represent internal damping in the flexible belts between the rotor and idler pulley and the idler pulley and print drum , respectively . b 1 , b 2 and b 3 represent viscous damping to ground of each mass , respectively . n 12 and n 23 represent frictionless gear ratios for each timing belt , and k 12 and k 23 represent the elastic coefficients for each timing belt . equations of motion were written for each of the masses in the system based upon the following assumptions : ( 1 ) the system is frictionless , except for viscous damping represented by b 12 and b 23 , viscous damping represented by b 1 , b 2 and b 3 , and coulomb frictional torque t f ; ( 2 ) belts can be modelled by an elastic coefficient k and viscous damping parameter b combined with a frictionless gear ratio n ; and ( 3 ) motor command angle φ is changed instantaneously . the equations for rotary motion of the motor rotor , the idler pulley , and the print drum are as follows : ## equ1 ## where θ represents position , θ represents velocity ; and θ represents acceleration , all in the time domain . the above equations can be rewritten to eliminate &# 39 ; θ 1 and &# 39 ; θ 2 ( mass position adjusted for timer belt gear ratio ) using the equalities ## equ2 ## as follows : ## equ3 ## viscous damping for the second mass , the idler pulley in the system illustrated in fig2 was negligible and was therefore dropped from the system motion equations . in order to generate an optimum motion profile for a system of the type illustrated in fig2 the following conditions are preferably satisfied by the three mass system : ( 1 ) all three masses must have zero velocity at the initial and final time points ; ( 2 ) the motor motion profile ( position v . time ) is monotonic ; ( 3 ) the final positions of the three masses are consistent with their gear ratios to prevent storage and release of strain energy . the second condition is not a prerequisite for all motion systems , but it may be critical for particular applications . using the mathematics of state variable dynamics , a linear system of differential equations may be represented as a dynamic , linked system by a set of first order differential matrix equations . for the equations of motion of a multi - mass system , the dynamic equation is as follows : in this equation , x ( t ) is the generalized state vector for the system where suitable choices of states are the positions and velocities of each of the masses . thus , the following six states are required to describe a system involving movement of three masses at any time : also , u ( t ) is the input to the system which corresponds to the input profile to the microstep driver . the derivative of the state at any given time , designated x ( t ), is therefore a function of the system matrix a , the state vector x ( t ), an input matrix b and an input scalar u ( t ). such a dynamic equation is useful if the system behaves linearly or may be approximated as such . the linearity restriction of the state variable approach also requires that t f at the drum be approximated by b 3 , a viscous damping coefficient . the following mathematical equation , based upon the kalman controllability formulation , expresses the continuous input function u ( t ) required to transfer a system from an initial state x 0 = x ( t 0 ) to a desired state x 1 = x ( t 1 ) as follows : where k is a matrix expressed as follows : ## equ4 ## and φ ( t )= e at is the matrix exponential of a . the variables in the above equation are as follows : a = the system matrix , a 6 × 6 matrix in the exemplary , three mass embodiment superscript t is the matrix transpose ( e . g ., b t ) superscript - 1 indicates the inverse of a matrix ( e . g ., k - 1 ) a , the system matrix , uses the motion equations of the three system masses and is derived and defined as follows : the dynamic equation then becomes : ## str2 ## b , the input matrix , is expressed above . the non - zero value in the b matrix indicates that the input acts on the motor mass of the three mass system . an expression was then developed for the applied torque , t a . in general , for a locked rotor of a stepper motor , t = t h sin 50φ , where t h is the peak holding torque for the prevailing current in the motor , and φ is the motor command angle . in the system illustrated in fig4 both the command angle φ and the rotor position θ 1 are variable . the applied torque , t a , is therefore expressed as follows : t a = t h sin 50 ( φ - θ 1 ). as such , t a introduces non - linearity into the system . if the value of φ - θ 1 is small enough , however , sin 50 ( φ - θ 1 ) is approximately equal to 50 ( φ - θ 1 ). for example , if φ - θ 1 is 0 . 003 radians , sin 50 ( φ - θ 1 ) is 0 . 149 , and 50 ( φ - θ 1 ) is 0 . 150 . for small or negligible differences φ - θ , the system behaves in a manner approximating a linear system . the continuous input function , u ( t ), was determined for a system of the type shown in fig3 . values for system constants were as follows : ## equ6 ## the total motion time interval was set at 0 . 35 sec . the a and b matrices were as set forth above . the beginning and end position points were defined as follows : the x 11 , x 13 , and x 15 values are consistent with the values for the frictionless gear ratios n 12 and n 23 , as required . these values are first used to derive the continuous input function u ( t ) capable of driving the system from x 0 to x 1 . the continuous input function derived using these values is shown in fig5 . the kalman controllability formulation for a continuous input u ( t ) is then implemented using matlab software available from the math works inc ., 21 elliot street , south natick , ma 01760 . the analysis uses the equation : ## equ7 ## to determine the position and velocity profiles of the masses corresponding to the input function u ( t ). the ideal motor position and velocity profiles derived using this equation are shown in fig6 ( a ) and 6 ( b ), respectively . the intermediate idler position and velocity profiles are substantially the same as those for motor position velocity , except that the values are reduced as a result of the gear reduction . the ideal print drum position and velocity profiles are shown in fig7 ( a ) and 7 ( b ). these plots demonstrate that each mass would reach zero velocity at the end time point , 0 . 035 sec . using the ideal position and velocity profiles generated as described above , the actual delay lengths of microstep input pulses were apportioned to match the ideal profiles . curve fitting the ideal motor position and velocity profiles shown in fig6 ( a ) and 6 ( b ) is therefore a major factor in the choice of microstep delay times to serve as input in a numerical integration simulation of three mass system motion . additionally , the difference between the motor command angle φ and motor position θ is preferably monitored and maintained as small as possible , consistent with the ideal position and velocity profiles . derivation of the actual microstep input pulse delay lengths by curve fitting , for example , may be accomplished in any convenient manner . a numerical integration simulation of the differential system motion equations was conducted using the continuous system modeling program ( csmp ), available from california scientific software . the system constants used in the numerical integration were as described above for ideal input and motion profile generation , with the addition of t s , the microstep timing constant having a value of 6 . 25 × 10 - 5 seconds . also , since numerical integration simulations are not limited to linear systems , physical constants were developed to describe the influence of coulomb friction on the three mass system and were incorporated in the simulation . the controlling parameter for the friction effects was the sign of the velocity of the mass upon which the frictional torque is acting , x 3 ( t ). the frictional force applied for positive velocities , shown for t f in fig4 was valued at 2 . 4 lb - in . the frictional force for negative velocities was valued at - 2 . 2 lb - in . the frictional force acting when the mass is at rest was valued at 2 . 4 lb - in . these four parameters were input into a function switch function of the csmp system to generate a value for the frictional torque , t f . fig8 shows the simulated motor input microsteps ; fig9 ( a ) and 9 ( b ) show the simulated motor position and velocity profiles especially ; and fig1 ( a ) and 10 ( b ) illustrate the simulated drum position and velocity profiles based upon the motor input illustrated in fig8 . the ideal motor position profile generated using the kalman controllability formulation illustrated in fig6 ( a ) corresponds closely to the motor profile generated using the numerical integration simulation shown in fig9 ( a ) that is based upon the microstep delay times illustrated in fig8 . the microstep delay times approximating the ideal motor profile of fig4 a , x theoretical versus t , were implemented as microstep impulse inputs to a three mass system as illustrated in fig2 . oscilloscope photographs of the drum position v . time performance and the current wave form in one motor phase are presented in fig1 ( a ) and 11 ( b ). the actual drum position profiles shown in the oscilloscope photographs for a three mass system of the type illustrated in fig2 corresponds closely to both the ideal and simulated profiles . the system implementation resulted in smooth drum motion without ringing or overshoot at the inflection points . moreover , the system produced significantly reduced audible noise . although the methods and systems of the present invention have been described with reference to a three mass system for driving a print drum , it will be obvious that the methods may be applied to generate motion profiles for a wide variety of systems requiring precise movement of system components from one state ( position ) to another . while in the foregoing specification , this invention has been described in relation to certain preferred embodiments thereof , and many details have been set forth for purposes of illustration , it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention . | 6 |
fig1 is a longitudinal sectional view showing an integrated circuit device in accordance with the present invention . the integrated circuit device 100 comprises an integrated circuit chip 1 of a wafer size , for example , which is fabricated using one semiconductor wafer , and a wiring substrate 2 . various logic circuits are formed inside the integrated circuit chip 1 . the integrated circuit chip 1 is connected to the wiring substrate 2 by solder bump terminals 6 , 6 &# 39 ;, etc , and the logic circuits inside the integrated circuit chip 1 can be mutually connected inside the wiring substrate 2 through a through - hole 4 , a signal wiring 5 inside the wiring substrate and a through - hole 4 &# 39 ;. this signal wiring 5 is connected to a termination resistor 9 on a far - end side through the wiring 7 and the through - hole 8 , so that signal transmission by a far - end termination system becomes possible . input / output pins 3 for signal connection between the integrated circuit device 100 and an external device ( not shown ) and for the supply for a power source voltage to the integrated circuit device are brazed to the back ( or rear face ) of the wiring substrate 2 . it is possible to use a ceramic as the material of the wiring substrate 2 and a cover , as the material of the input / output pins 3 , for example . fig2 is a plan view which shows a wiring method inside the integrated circuit chip and on the wiring substrate in the embodiment described above . fig2 a shows the signal wirings inside the integrated circuit chip 1 and fig2 b shows the signal wirings for connecting the logic circuits with one another inside the wiring substrate through the solder bump terminals 6 , 6 &# 39 ;. in fig2 a , reference numerals 10 , 10 &# 39 ;, 11 and 11 &# 39 ; represent the logic circuits inside the integrated circuit chip 1 . reference numerals 12 , 13 and 13 &# 39 ; represent the signal wirings of aluminum wirings , or the like , which are formed inside the integrated circuit chip 1 by the application of the present invention . reference numeral 14 represents the signal wiring for connecting the logic circuits 11 and 11 &# 39 ; without using the present invention . the logic circuits 10 , 10 &# 39 ; inside the integrated circuit chip 1 are disposed adjacent to each other and are connected mutually by the signal wiring 12 such as the aluminum wiring inside the integrated circuit chip . signal transmission between the logic circuits 10 and 10 &# 39 ; is made by the signal wiring 12 . a termination resistor is connected to the signal wiring 12 on its near - end side in the same way as in the connection method in accordance with the conventional near - end termination system . the termination resistor is formed as part of the logic circuit 10 on the nearend side inside the wafer by the use of a resistance made by diffusion process , though not shown in drawings . in contrast , the logic circuits 11 and 11 &# 39 ; are disposed in the spaced - apart relation with each other . the output of the logic circuit 11 is connected to the solder bump terminal 6 by the aluminum wiring 13 and is once taken outside the integrated circuit chip 1 . it is then connected to the signal wiring 5 inside the wiring substrate 2 through the solder bump terminal 6 and the through - hole 4 as shown in fig1 and 2b . similarly , the input of the logic circuit 11 &# 39 ; is connected to the solder bump terminal 6 &# 39 ; by the aluminum wiring 13 &# 39 ; and then to the signal wiring 5 inside the wiring substrate 2 through the solder bump terminal 6 &# 39 ; and the through - hole 4 &# 39 ;. in this manner , signal transmission between the logic circuits 11 and 11 &# 39 ; can be made by the signal wiring 5 inside the wiring substrate 2 . the far - end side of the signal wiring 5 is connected to the termination resistor 9 on the wiring substrate 2 through the wiring 7 and the through - hole 8 as shown in fig1 and is driven by the far - end termination system . unlike the logic circuit 10 , therefore , the termination resistor is not formed on the logic circuit 11 side . by the way , the amplitude of the output signal of the logic circuit 11 is so small that the signal wiring 5 inside the wiring substrate 2 cannot directly be driven . for this reason , a buffer for driving the signal wiring inside the substrate is practically connected between the logic circuit 11 and the solder bump terminal 6 , though it is not shown in the drawings . as described above , when the connection between the logic circuits 11 and 11 &# 39 ;, which are disposed in the mutually spaced - apart relation , is made by the use of the signal line 5 inside the wiring substrate 2 , the signal propagation time can be shortened much more than in the connection using the signal wiring 14 inside the integrated circuit chip 1 . next , the signal propagation delay time of the wiring portion in the near - end termination system and in the far - end termination system will be explained . for example , the far - end voltage waveform when a signal of a predetermined voltage is applied to the near - end of a transmission line and the far - end is opened is compared with the far - end current waveform when the far - end is short - circuited . it is known in this case that in comparison with the rise time of the far - end voltage waveform when the far - end is released , the rise time of the far - end current waveform when the far - end is short - circuited is smaller by 3 to 10 times . the conventional near - end termination system corresponds to the case where the far - end is released in the example described above , and can be said to be the most disadvantageous system as to the rise time of the signal waveform at the far - end . in contrast , the far - end termination system can accomplish the rise time between the rise time when the far - end is released in the example described above and the rise time when the far - end is short - circuited . the factor that determines the rise time is the termination resistor value at the far - end , and the smaller the resistor value , the smaller becomes the rise time . it could be therefore understood that the far - end termination system can make signal transmission at a higher velocity than the near - end termination system . the signal wiring 5 inside the wiring substrate 2 is not so thin as the signal wiring 12 inside the integrated circuit chip 1 , and a metal having low resitivity such as cu can be used as the wiring material . for this reason , the wiring resistance of the signal wiring 5 can be incomparably reduced than the wiring resistance of the signal wiring 12 inside the integrated circuit chip 1 . to make far - end termination , the wiring resistance must be sufficiently low ( below 0 . 5 ω / cm ) and in this point , the signal wiring 5 inside the wiring substrate 1 is advantageous . in contrast , the signal wiring inside the integrated circuit chip 1 has a wiring resistance of as large as about 10 ω / mm , and is therefore not suitable for the far - end termination system . therefore , the near - end termination system is applied to the signal wiring inside the integrated circuit chip 1 because it can transmit the signals without lowering the amplitude even by a wiring having a large wiring resistance , although it has a large signal propagation delay time . in the present invention , too , the near - end termination system is applied to the signal wiring 12 inside the integrated circuit chip 1 . however , since the signal wiring 12 inside the integrated circuit chip 1 in the present invention is used for short - range signal transmission , it has a short wiring length and the signal propagation delay time does not become a critical problem . next , an example of the design flow , which is employed for determining which of the signal wiring among the signal wiring 12 inside the integrated circuit chip 1 and the signal wiring 5 inside the wiring substrate 2 should be applied to the signal wiring for mutually connecting the logic circuits in the integrated circuit device in accordance with the present invention , will be illustrated . to begin with , a system is designed by the signal wiring inside the integrated circuit chip 1 in the same way as in the conventional integrated circuit device . next , the signal propagation delay time between arbitrary gates is checked by simulation . this simulation can be carried out by a delay check system which is known in the art as a design tool of a large scale computer available at present . the signal wiring which generates a delay exceeding a certain predetermined value is changed to the signal wiring of the far - end termination system through the signal wiring 5 inside the wiring substrate 2 in accordance with the results of simulation . the system designed in this manner is again checked by the delay check system and its effect is confirmed . besides the checking procedure using the simulation from the beginning as described above , higher design efficiency can be obtained by using the signal wiring 5 inside the wiring substrate 2 from the start for those signal wirings inside the integrated circuit chip 1 which have a large wiring length and can therefore be judged in advance as unsuitable for the signal wiring 5 . fig3 shows the relationship between the signal wiring inside the integrated circuit chip , the wiring length of the signal wiring inside the wiring substrate and the signal propagation delay time in the integrated circuit device in accordance with the present invention . the wiring length between the logic circuits which are to be mutually connected are plotted on the abscissa of the diagram in fig3 and the delay time required for the signal to propagate between the logic circuits is plotted on the ordinate . dash line represents the case where the signal wiring inside the integrated circuit chip in accordance with the near - end termination system is used and solid line does the case where the signal wiring inside the wiring substrate in accordance with the far - end termination system is used . in fig3 circuit constants of the signal wiring inside the integrated circuit chip include the wiring resistance r = 10 ω / mm and the wiring capacitance c = 0 . 2 pf / mm , by way of example . the dielectric constant of the wiring substrate is εr = 6 . here , the signal propagation delay time t1 of the signal wiring inside the integrated circuit chip can be expressed by the following equation : the signal propagation delay time t 2 of the signal wiring inside the wiring substrate can be expressed by the following equation : ## equ1 ## where a , b and d are constants depending on the design of the integrated circuit chip and packaging system . it can be understood from the diagram shown in fig3 that the signal wiring inside the integrated circuit chip and the signal wiring inside the wiring substrate may be used appropriately with the wiring length of about 3 cm being the boundary , for example . as already described , the wiring delay time increases in proportion to the square of the wiring length of the signal wiring in the signal transmission of the near - end termination system using the wiring inside the integrated circuit chip . therefore , when the wiring length of the signal wiring exceeds 5 cm , the wiring delay time increases drastically and a high signal propagation velocity cannot be expected any more . in contrast , in accordance with the far - end termination signal transmission system using the wiring inside the wiring substrate , the wiring delay time is proportional to the wiring length of the signal wiring ; hence , the increase in the wiring delay time is not very great as the wiring length increases . even when the wiring length is as great as about 15 cm , for example , the signal propagation delay time still remains at a relatively small level of about 2 ns , as can be appreciated from the diagram . if the wiring inside the wiring substrate is used , the wiring substrate cannot be directly driven by the signal having a low amplitude inside the integrated circuit chip , and a buffer circuit for driving the wiring inside the substrate is required . in the diagram shown in fig3 the signal propagation delay time when the signal wiring inside the wiring substrate in accordance with the far - end termination system is used is depicted while it includes about 1 ns of the delay time due to the delay time of this buffer circuit and to the increase in the delay time by the solder bump terminals . even when the increase in the signal propagation delay time due to the propagation delay in such a buffer circuit is taken into consideration , the present invention would maintain its superiority to the conventional integrated circuit device . the integrated circuit device in the embodiment given above has been explained about the integrated circuit chip of a wafer size by way of example , but the present invention is in no way limited thereto but can of course be applied to those integrated circuit devices which include an integrated circuit chip in which the wiring length of the signal wiring becomes large and the signal propagation delay time becomes a problem . in accordance with the present invention , the signal wiring inside the integrated circuit chip and the signal wiring inside the wiring substrate are used appropriately for the signal transmission between the logic circuits inside the integrated circuit chip . accordingly , the present invention provide signal transmission without increasing the signal propagation delay time . where the signal transmission distance becomes great , the present invention uses the signal wiring inside the wiring substrate . for this reason , it is not necessary to increase the width of the signal wiring in order to reduce the wiring resistance of the signal wiring inside the integrated circuit chip , and a higher integration density of the integrated circuit chip can therefore be accomplished . in other words , the present invention can accomplish a higher density and higher velocity integrated circuit device than the conventional semiconductor circuit devices . | 7 |
currently , there is desire to mount cpus in area array interposer sockets . the manner of mounting a cpu in an interposer socket requires supporting the ceramic body at discrete locations around the periphery of the device . because the ceramic body of high performance processors is brittle , these support points can then become origins for cracks when the device is subjected to assembly and impact type forces . the present invention provides a positive means for controlling cracking in the ceramic body of the processor by providing assembly support and shock / vibration isolation through an energy dissipation device , or dynamic isolating mount . the preferred embodiment of the invention is described below in the context of a processor chip and heat sink combination mounted on a circuit board with an interposer socket . it should be noted , however , that the chip need not be a processor nor is the heat sink required . broadly , the invention is useful to reduce vibration for any type of component mounted to a circuit board . referring initially to fig1 system 100 includes a backing plate 10 with a plurality of recesses 20 , a pwb 30 , interposer socket 40 , a landgrid array ( lga ) or processor 42 , interposer columns 45 , a heat sink 55 , and at least one dynamic isolating mount 65 . when combined , interposer columns 45 and processor 42 are referred to as cpu assembly 50 . as is known in the art , heat sink 55 is held in place by an assembly 60 in such a manner as to achieve sufficient thermal contact therewith . if desired , a material such as thermal grease ( not shown ) can be used at the interface to enhance the flow of heat from cpu assembly into heat sink 55 . assembly 60 preferably comprises a standoff 90 , a helical coil spring 120 , and a capscrew 110 . each standoff 90 is mounted on or pressed into backing plate 10 and passes through a corresponding hole 57 in the base of heat sink 55 . standoff 90 each preferably comprise a generally cylindrical member having a threaded internal bore 92 . each capscrew 110 includes a head 112 and a male threaded body 114 sized to threadingly engage bore 92 . a plurality of interposer columns 45 connects pwb 30 to cpu assembly 50 . while this configuration has many benefits associated with it , interposer columns 45 transfer vibrational energy from pwb 30 to cpu assembly 50 . according to a preferred embodiment , dynamic isolating mount 65 is placed between pwb 30 and cpu assembly 50 . prior to engagement of cpu assembly 50 with pwb 30 , dynamic isolating mount 65 is placed on pwb 30 where pwb 30 contacts cpu assembly 50 . dynamic isolating mount 65 may comprise a continuous piece or small , fragmented pieces . dynamic isolating mount 65 is preferably somewhat taller than the space between pwb 30 and cpu assembly 50 when it is in its natural or non - compressed state . thus , when it is desirable to assemble system 100 , cpu assembly 50 is placed on top of dynamic isolating mount and secured in place by methods known by one of ordinary skill in the art . in this manner , a dynamic isolating force is applied to cpu assembly 50 to maintain it in contact with the pwb while simultaneously damping vibrations or shocks that would otherwise be transmitted from the pwb to the cpu . in order to describe the operation of the present invention , reference will briefly be made to fig2 a schematic of a simple spring - dashpot system . fig2 includes a kelvin element comprising a linear spring in parallel with a viscous damper . kelvin model 200 includes a spring component 210 , a dashpot component 220 , and a fixed origin 230 . in a kelvin model , spring component 210 functions according to hookean elastic behavior . for example , when a force is applied to spring 210 it deforms by an amount that is directly proportional to the applied force . the classical solid behavior is given by equation 1 . where f is force ( stress ), x is the extension distance ( strain ), and k is the proportionality constant . this constant is also called a modulus . the deformation is reversible when the stress is removed . however , if stress is continuously applied , a hookean solid does not deform any further ; it shows no time - dependant deformation . dashpot , or damper 220 , functions according to newtonian viscous behavior . for example , the applied force ( stress ) is proportional not to the distance ( strain ), but rather to the rate of strain . this classical viscous behavior is given by equation 2 . where f is force , dx is the rate of extension ( strain ), and k is the proportionality constant . in shear this equation is written : and the proportionality constant η is viscosity . the damping material continues to deform as long as force is applied . the deformation is not reversible ; when the force is removed , the damping material ceases to deform . it should be understood that the only material that exhibits true newtonian viscous behavior is a viscous liquid . in reality , a “ viscous ” solid displays viscous and elastic behavior . however , for explanatory purposes only , in the current invention , the interposer columns 40 are assumed to display purely elastic behavior and the dynamic isolating mount is assumed to display purely viscous behavior . when these two components are combined , the viscoelastic behavior of the system can be modeled using the elastic and viscous elements in parallel ; the strain of the two elements in parallel is the same and the total stress is the sum of the stress in the two elements . as the load is applied , the viscous element resists deformation but slowly deforms , transferring the applied stress to the elastic element . thus , the deformation of this two - element model is limited by the extensibility of the elastic element . when load is removed , the “ transient creep ” strain is recovered . more specifically , this model exhibits a “ delayed elastic ” or viscoelastic response to applied loads . after sudden imposition of a shear stress , spring 210 will eventually reach the expected strain , but is retarded in doing so by dashpot 220 . dashpot or dynamic isolating mount 65 of the present invention accordingly prevents column 45 from reaching its expected strain , thus limiting vibrational motion . in order to ensure that vibrational motion is minimized , dynamic isolating mount 65 should possess the following properties . it should be resistant to temperatures is below 130 ° c ., possess a loss factor of at least 0 . 010 , and be easily manufactured by companies such as sorbothane . examples of such materials include , but are not limited to , rubbers , silicones , and neoprenes . the simple kelvin model described above describes a simple spring - dashpot system which is useful to understanding the following model which more accurately models the behavior of dynamic isolating mount 65 . referring now to fig3 spring - mass - dashpot system 300 preferably includes a heat sink assembly - cpu package 57 , interposer columns 45 , a pwb 30 , and a dynamic isolator 65 . interposer columns 45 possess a total spring constant k ( lb / in ), heat sink assembly - cpu package 57 possesses mass w / g ( lb - sec 2 / in ), and dynamic isolator 65 possesses a damping value c ( lb - sec / in ). the magnification factor of a single degree of freedom spring - mass - damper system can be determined according to equation 4 : x / x 0 = 1 /[{ 1 −( ω / ω n ) 2 } 2 +{ 2ξ ( ω / ω n )} 2 ] 1 / 2 ( 4 ) n is the number of clamping springs , in this case 4 , g is a gravitational constant , or 386 in / sec 2 , and f 0 is the total static clamping force applied ( lb ). for a resonant , critically damped system ξ = 1 , and equation 4 becomes x / x 0 = 0 . 5 . thus , for a critically damped isolator , the dynamic amplitude will equal half of the static compression of interposer columns . since the columns will equal eventually compress approximately 0 . 010 ″, the above analysis suggests that a critically damped dynamic isolator will prevent dynamic motion greater than 0 . 005 ″. thus , using a critically damped isolator , 0 . 005 ″ of compression is attainable . the critical damping value of the dynamic isolator can be determined by equation 5 : thus , equation 5 defines the amount of damping necessary in the dynamic isolator to provide a critically damped system . critical damping refers to zero amplitude for a damped oscillator ; the body returns back to its equilibrium position at an optimum rate . critical damping is desirable because vibrational oscillations cease , preventing intermittent motion . by tuning the dynamic isolating mount 65 to equal approximately twice the product of the mass weight and natural frequency , critical damping is obtained . in order to tune a dynamic isolating mount , a critical damping value is mathematically projected , similar to that shown in equation 5 . a material possessing a damping value equal to a fraction of the projected critical damping value is then employed as the damper . for example , according to equation 5 , if the weight of the heat sink is 0 . 10 lb and the natural frequency of the system is 500 rad / sec , then the critical damping value , c 0 is 100 lb - rad / sec , because c 0 = 2wω n . if two dynamic isolating mounts are used , each mount should possess a damping factor c of approximately 50 lb - rad / sec . the dynamic isolating mount may be produced in the form of a picture - frame , square tabs , or any form capable of damping the interposer columns , including incorporating the dynamic isolating mount into the interposer socket . additionally , the dynamic isolating mount may be part of a kelvin system as described above ( e . g ., spring and dashpot in parallel ) or part of a maxwell system ( e . g ., spring and dashpot in series ) and the spring ( s ) and damper ( s ) need not necessarily be positioned adjacent to each other . it should be understood that the damping assemblies and systems described herein may be used in a computer system including a chassis , a system board , and an input device . in a preferred embodiment , the input device is either a mouse or a keyboard . the above discussion is meant to be illustrative of the principles and various embodiments of the present invention . numerous variations and modifications will become apparent to those skilled in the art once the above disclosure is fully appreciated . it is intended that the following claims be interpreted to embrace all such variations and modifications . | 8 |
referring to fig1 there is illustrated a presently preferred embodiment of a spread spectrum radiotelephone 10 in accordance with this invention . as will become apparent , certain ones of the blocks of the radiotelephone 10 may be implemented with discrete circuit elements , or as software routines that are executed by a suitable digital data processor , such as a high speed signal processor . alternatively , a combination of circuit elements and software routines can be employed . as such , the ensuing description is not intended to limit the application of this invention to any one particular technical embodiment . in the preferred embodiment of this invention the spread spectrum radiotelephone 10 operates in accordance with the tia / eia interim standard , mobile station - base station compatibility standard for dual - mode wideband spread spectrum cellular system , tia / eia / is - 95 ( jul . 1993 ). however , compatibility with this particular interim standard is not to be considered a limitation upon the practice of this invention . the radiotelephone 10 includes an antenna 12 for receiving rf signals from a cell site , hereafter referred to as a base station ( not shown ), and for transmitting rf signals to the base station . when operating in the digital ( spread spectrum or cdma ) mode the rf signals are phase modulated to convey speech and signalling information . coupled to the antenna 12 are a gain controlled receiver 14 and a gain controlled transmitter 16 for receiving and for transmitting , respectively , the phase modulated rf signals . a frequency synthesizer 18 provides the required frequencies to the receiver and transmitter under the control of a controller 20 . the controller 20 is comprised of a slower speed mcu for interfacing , via a codec 22 , to a speaker 22a and a microphone 22b , and also to a keyboard and a display 24 . in general , the mcu is responsible for the overall control and operation of the radiotelephone 10 . the controller 20 is also preferably comprised of a higher speed digital signal processor ( dsp ) suitable for real - time processing of received and transmitted signals . the received rf signals are converted to base band in the receiver and are applied to a phase demodulator 26 which derives in - phase ( i ) and quadrature ( q ) signals from the received signal . the i and q signals are converted to digital representations by suitable a / d converters and applied to a three finger ( f1 - f3 ) demodulator 30 , each of which includes a local pn generator . the output of the demodulator 28 is applied to a combiner 30 which outputs a signal , via a deinterleaver and decoder 32 , to the controller 20 . the digital signal input to the controller 20 is expressive of speech samples or signalling information . the further processing of this signal by the controller 20 is not germane to an understanding of this invention and is not further described , except to note that the signalling information will include transmitter power control bits that are sent from the base station as a continuous stream to the radiotelephone 10 . the i and q signals output from the i - q demodulator 26 are also applied to a receiver agc block 34 which processes same to produce an output signal to an amplifier slope corrector block 36 . one output of the slope corrector block 36 is the rx gain set signal which is used to automatically control the gain of the receiver 14 . the output of the receiver agc block 34 is also applied to a tx open loop power control block 38 . a tx closed loop control block 40 inputs the received transmitter power control bits from controller 20 . an adder 42 adds the output of the tx open loop control block 38 to the output of the tx closed loop control block 40 and generates a sum signal which is the tx - gain signal that is selectively applied , via a limiter 43 ( fig7 and 8 ), to the transmitter 16 to control the output power thereof . preferably this signal is slope corrected as required for the transmitter amplifier . an input to the transmitter 16 ( vocoded speech and / or signalling information ) is derived from the controller 20 via a convolutional encoder , interleaver , walsh modulator , pn modulator , and i - q modulator , which are shown generally as the block 46 . fig2 is a high level block diagram of the spread spectrum agc system . a purpose of the receiver agc is to optimize the received signal level before a / d conversion , while having sufficient speed to follow signal fades . the transmitter power is linked to the received power accordingly to the formula : as a result , for the open loop power control case a 1 db increase in the received signal power level causes the tx power level to be decreased by 1 db . the tx - offset is used to change the tx power so that all mobile stations transmitting on the same channel are received at the base station at the same signal strength . to achieve the required closed loop control , the base station controls the offset of each mobile by sending a constant bit stream ( power control bits ) which command the mobile to increase or decrease the offset value . in accordance with the is - 95 interim standard the offset can be changed by ±- 1 db every 1 . 25 ms . the transmit power can be linked to the received signal level by using the same variable gain amplifier ( vga ) 50 in the transmitter as the vga 52 in the receiver . for this case , and for a 1 db increase in receiver gain , the tx gain is correspondingly increased 1 db . the 30 ms block 54 is an rc lowpass filter with a 30 ms time constant . the filter block 54 is used so that the transmitter can follow the average rx - level , and not the fast fading . a detector 56 is used to detect the received signal level , which is then integrated by block 58 to form the rx agc signal . the rx agc signal is also applied to the filter 54 , and the filtered agc signal is summed at block 60 with the tx offset signal that is derived from the power control bits . the output of the sum block is the tx agc signal which is applied to the tx vga 50 . in accordance with the is - 95 interim standard the specifications for the gain control system depicted in fig2 are as follows : rx - vga control range is minimum - 105 dbm to - 25 dbm ( 80 db ), tx - vga control range is minimum - 50 dbm to + 23 dbm ( 73 db , portable ), the open loop power estimate should be within ± 6 db and shall be within ± 9 db of the actual received power , the tx - offset range is a minimum of ± 32 db , the accuracy of the 30 ms time constant shall be better than ± 20 %. for a change ( dpin ) in the rx level of ± 20 db or less , the tx power must be within the limits : ( a ) upper limit : for 0 & lt ; t & lt ; 24 ms : max [ 1 . 2 *| dpin |*( t / 24 ), | dpin |*( t / 24 )+ 0 . 5 db ] for t & gt ; 24 ms : max [ 1 . 2 *| dpin |, | dpin |+ 0 . 5 db ] where dpin is in db and t is in milliseconds . as an example , for an received signal change = 20 db =& gt ; tx change = 20 db + 4 /- 4 . 5 db . the tx offset must change the tx power in 1 db steps , and the accuracy must be better than ± 20 % or ± 0 . 5 db within any 10 db tx offset range . by example , a 5 db tx offset change =& gt ; 5 db ± 1 db tx power change , and a 1 db tx offset change =& gt ; 1 db ± 0 . 5 db tx power change . and finally , following a 1 db step change in the tx offset , the tx - power must be within 0 . 3 db of the final value in less than 500 microseconds . this invention teaches an agc system ( rx and tx ) that meets the requirements imposed by the foregoing specification . a function of the signal strength detector 56 is to measure the power of the received spread spectrum signal . it is not required to directly measure the received power so long as the measurement has a constant relationship to the received power . the detector 56 preferably has a ± 20 db dynamic range in order to fulfill the step response specifications ( up to ± 20 db rx step ). the output of the amplifier 52 driving the detector also preferably has a ± 20 db dynamic range . with less than a ± 20 db dynamic range the step response will be delayed , although this may be acceptable for certain implementations . a number of different detector embodiments may be employed with this invention , including a logarithmic detector , an absolute value detector , an rms power detector , and an approximating detector . each is now described . the output of a logarithmic detector is : vdet = average ( log (| vsignal |)). this detector works well for signals without am modulation ( e . g ., fm modulation ). with am modulation the log - function will tend to distort the am information and , as a result , the detector 56 may measure too low a signal strength . the advantage of the logarithmic detector is that it has a wide dynamic range ( 80 - 100 db ). the logarithmic detector can be used at if ( not base band ) for receiving a spread spectrum signal with the following assumptions . with more than 10 - 20 users it can be assumed that the forward link i and q components are gaussian distributed ( without fading ). the am information (= sqrt [ i 2 + q 2 ]) will then be rayleigh distributed . the rayleigh distribution has a low density at low levels . as a result , the logarithmic distortion will not have a significant impact on accuracy . with fewer users the ratio between detector output and input power will change , and the detector will measure a lower power level . if the detector is used at base band , only the i or q channel is used for input to the detector . the output of the absolute value detector is given by the expression : vdet = average (| vsignal |). this detector works well with gaussian distributed signals such as the cdma i and q signals at base band ( forward link ). with a changing distribution ( fewer users ) the absolute value detector may out - perform the logarithmic detector . although this detector has a smaller dynamic range than the logarithmic detector , the range is sufficient for the spread spectrum application which is of the most concern to this invention . the output of the rms power detector is : vdet = average ( vsignal 2 ). this is an optimum detector because it measures true power , however it is difficult to implement in a practical manner . furthermore , the squaring function transforms a 40 db range to an 80 db range , which adversely impacts the noise performance of the detector . an approximating detector is presently preferred in the digital agc detector that is described below . this detector yields an optimum detector performance with a low gate count . reference is now made to fig3 for a description of a cdma analog agc system . the rx gain control is comprised of two loops . the first loop is essentially analog and comprises the rx - vga 52 , i / q demodulator 62 , detector 56 , and integrator 58 . the first loop is used for coarse agc setting . the second loop is essentially digital and comprises the rx - vga 52 , i / q modulator 62 , a / d converter 64 , digital control block 66 , agc - ref signal 68 , and the integrator 58 . the agc - ref signal 68 is a feedback signal from the digital loop to the integrator 58 . the second , digital loop is used to correct offset errors in the first , analog loop . in the circuit of fig3 the rx - vga 52 and tx - vga 50 each have a variable gain range of 80 db , the integrator 58 sets the time constant for the analog loop , and the detector 56 is implemented as a logarithmic absolute value detector where : where avg | vin | is the average of the absolute value of vin . the time constant for the detector 56 is 10 % of the time constant of the analog loop . the block rc - delay 70 is comprised of an rc circuit with a time constant of 30 ms . as a result , the tx - vga 50 tracks the rx - vga 52 with a 30 ms time constant delay . the tx -- gain -- adj signal 72 is used , in conjunction with the multiplier 61 and the tx -- slope signal 74 , to offset the gain of the tx - vga 50 from the gain of the rx - vga 52 . the magnitude of tx -- gain -- adj signal 72 is controlled by the base station by the power control bits . a minimum resolution of a d / a converter ( not shown ) that generates the tx -- gain -- adj signal is preferably equivalent to a 1 db gain change . the tx -- slope signal 74 is used to correct the slope of the tx - vga 52 in reference to the tx -- gain -- adj signal . this signal is required in order to accurately translate a given change in the tx -- gain -- adj signal 72 into a given change in tx power , and thus is useful in compensating for variations between vgas . the rx -- slope signal 76 is the complementary receiver - side signal to the tx -- slope signal 74 , and is used for compensation purposes for correcting the slope of the rx - vga 52 so that it essentially matches the slope of the tx - vga 50 . the multiplier 59 is used to multiply the rx -- slope signal 76 by the output of the integrator 58 . the multiplier 61 multiplies the tx -- slope signal by the tx -- gain -- adj signal , and supplies the product to the summer 60 for addition to the output of the rc - delay block 60 to form the tx -- agc signal , shown in fig3 as the transmitter gain control signal tx - gset . an input of the tx - vga 50 is supplied with information to be transmitted from a d / a converter 80 and an i / q modulator 82 . a bias control block 106 also receives the tx - gset signal and is used to generate a bias signal for a tx power amplifier 102 . the operation of the blocks 102 and 106 is described in greater detail in fig9 and 11 . fig4 is a block diagram that shows in greater detail the rx - agc circuits of fig3 . the transfer function for the exp block 58a is : rx -- out = ic rx -- in , where ic is the gain control signal , in db format : as a result , by measuring rx -- in and rx -- out in db ( log ), and by using the exp block 58a , the loop is made linear . the integrator 58 operates in such a manner as to set the gain so that vd = agc - ref . the transfer function for the integrator is : by combining the rx - vga 52 and the exp block 58a , and adding a scaling constant k2 , there is obtained : which is equivalent to a single pole high pass filter with a time constant of τ2 . reference is now made to fig5 and 7 for a description of the digital agc system . fig5 is a block diagram that illustrates a first embodiment of the digital agc system , specifically an all digital agc control system . the two variable gain amplifiers vgas 50 and 52 are controlled directly from the digital block 90 . in a presently preferred embodiment of this invention the digital block 90 is embodied within an application specific integrated circuit ( asic ). it should be realized that discrete integrated circuits could be used as well , as could a suitably programmed high speed processing device . the detector 56 , integrator 58 , multiplier 59 , summer 60 and delay 70 of fig3 are implemented as digital circuits within the digital block 90 . the vgas 50 and 52 may be either stepped vgas controlled digitally , or continuously variable vgas controlled by the outputs of suitable d / a converters . the latter approach , which is preferred , is illustrated in fig5 as the tx - vga - d / a 92 and the rx - vga - d / a 94 . the accuracy of gain of the each vga is set by the associated controlling d / a converter 92 and 94 , and by the linearity of the vga control slope . the slope nonlinearity is correctable by the digital block 90 . the gain increment size for the rx - vga 52 is determined by the dynamic range of the rx - a / d converter 64 , and is preferably not smaller than 1 db in order to limit the number of required bits for the rx - vga - d / a converter 94 . the gain increment size for the tx - vga 50 is a maximum of 0 . 75 db , in accordance with the current is - 95 interim specification . in order for the tx power level to track the rx power level , the rx power level is measured with better than 0 . 05 db resolution . correction of the vga slopes can be accomplished either by multiplication or by table look up . a look up table ( 90a ) is not presently preferred due to the required number of gates to implement the storage registers for the look up values . in the preferred embodiment the multiplier 90b can use either analog or digital techniques . analog multiplying requires a separate d / a to set the reference voltage for the primary d / a 92 . although a digital multiplier requires some number of gates to implement , a digital multiplier is presently preferred because of reduced complexity over the analog approach . correction of nonlinear slope ( change in slope vs . gain ) is accomplished for the vga 50 by using the three most significant bits of the tx gain word to select one of five scaling words . this provides five ranges of 16 db , each of which can be individually scaled . the number of bits for each scaling word is a function of the desired range and resolution . fig6 shows a further embodiment of the invention wherein the digital agc is provided with analog tx / rx tracking . compared to fig5 the delay block 70 and summer block 60 are moved outside the digital block 90 , and are implemented with analog circuits as in fig3 . as a result , the accuracy of rx - vga - d / a 94 does not contribute to the tx gain setting accuracy . the tx - vga - d / a 92 provides a minimum of 1 db resolution with ± 0 . 5 db accuracy over a ± 32 db range . the digital agc with analog tx / rx tracking embodiment of fig6 is similar to the analog agc system of fig3 . major differences are that the detector 56 and integrator 58 are implemented digitally ( as in fig5 ), and that the nonlinear slope of the tx - vga 52 is correctable . reference is now made to fig9 for showing in greater detail an embodiment of the transmitter circuitry , including the tx - vga 50 . the function of the transmitter output power control circuit , when operating in the spread spectrum cdma mode , is to limit the maximum output power so that the transmitter power amplifier 102 operates in the linear mode . for a dual mode ( cdma digital / fm analog ) radiotelephone the same circuitry is preferably also used to set the transmitter power level when operating in the analog mode . the output power is controlled by using the tx - vga 50 before the final transmitter power stage ( 102 ). this is shown in fig1 , wherein the rx - agc is not activated , the tx - vga 50 is controlled by an analog agc signal , and the i / q modulator 82 is not used . an audio signal is used to control the output frequency of an if phase locked loop ( pll ) 130 which generates a 90 mhz fm signal . the output of the if pll 130 is applied to the input of the tx - vga 50 . in this mode of operation the bias signal for the tx power amplifier 102 is changed only to compensate for temperature variations . this differs from the bias control employed when operating in the digital ( spread spectrum ) mode , as will be detailed below with respect to fig1 . referring again to fig9 when operating in the spread spectrum mode the maximum output power can be limited by limiting the vga 50 control voltage to a predefined level . this is a simple method but is inherently inaccurate , due to a possible large variation in gain for a given vga control level . alternatively , using a feedback control method a tx power indicator 104 generates an output signal txpi which is used to limit the maximum output power . when the magnitude of txpi is greater than a given set point the vga control signal is modified so that the tx output power is equal to the set point . this is preferably accomplished with nonlinear feedback . although this technique is relatively simple to implement for a continuously transmitted signal , for variable data rate spread spectrum transmissions this method is too slow to limit the maximum output power . that is , in the cdma mode each tx burst can be at a different power level than the previous burst , because of the open loop power control wherein the rx level is used to estimate the tx level . as a result , the tx power amplifier 102 may saturate in the beginning of each burst until the txpi indicator 104 settles the txpi signal . if the txpi signal response is made too fast , the tx power estimate may include excessive noise . a presently preferred technique to achieve transmitter output power control is shown in fig7 wherein the limiter 43 of fig1 is shown in greater detail . this technique is referred to herein as a direct control method with adaptive feedback . generally , when power limiting is activated the set point for limiting is modified until the magnitude of the txpi signal is approximately equal to a txpi set point . a direct control set point is used as a first estimate , and txpi is subsequently used to adaptively update this set point . although this method may saturate the tx power amplifier 102 ( fig9 ), this will only occur during the first few milliseconds of a new call . fig7 shows a digital implementation of the direct control method with adaptive feedback . the system clock signal is employed to synchronize all of the circuits . the tx - gain - set signal sets the gain of the transmitter vga 50 and , as a result , the transmitter output power . for this description it is assumed that an increase in tx - gain - set causes an increase in transmitter gain and power . as in fig9 the txpi signal is a measurement of the transmitter power at the output . for this description it is assumed that an increase in transmitter power causes an increase in the magnitude of txpi signal . the agc ctrl block 110 is a control circuit that sets the transmitter output power in the spread spectrum mode . the agc ctrl block 110 may function in a manner depicted in fig2 of commonly assigned u . s . patent application ser . no . 08 / 312 , 813 , filed sep . 27 , 1994 , entitled &# 34 ; digital agc for a cdma radiotelephone &# 34 ; by kjell ostman reference in this regard can also be made to u . s . pat . no . 5 , 107 , 225 which presents a different solution and implementation . in the preferred embodiment the tx - gain signal is derived from a combination of open loop power control circuit 38 and the closed loop power control circuit 40 , wherein the open loop portion generates a signal that is derived from the received signal level , and wherein the closed loop portion includes the contribution of the power control bits that are transmitted continuously from the base station ( see fig1 ). the tx - gain signal is applied to the limiter block 43 , which is shown and described herein with respect to fig7 and 8 . in fig7 the transmitted power is set by controlling the gain in the transmitter with the tx - gain signal . the tx limit register or counter 112 generates a signal tx - max which represents a maximum value of the tx - gain signal . the setup input is used to preset the counter 112 with a setup estimate of the maximum value of the tx - gain signal . when the signal tx -- on is active the counter 112 counts up or down on each system clock , depending on the state of count up / down signal provided from a comparator 114 . when the signal up - enable is not asserted , the counter 112 will only count down . when the signal up - enable is asserted , the counter 112 is enabled to also count up . the multiplexer ( mux ) 116 is employed to select either the tx - gain signal or the tx - max signal as the gain control for the tx - vga 50 , via the slope corrector ( shown generally in fig2 as the block 36 ) and the tx - vga - d / a 92 ( fig5 and 6 ). a digital comparator 118 operates in such a manner that when tx - gain is greater than tx - max : ( a ) the tx limit counter 112 is enabled ( with signal up - enable ) to count up , and ( b ) the select ( sel ) input of the mux 116 is controlled to select tx - max . otherwise the counter 112 only counts down , and the tx - gain digital signal is selected by the mux 116 . the before - mentioned comparator 114 determines if the tx limit counter 112 counts up or down . if txpi is higher than txpi - ref , the counter 112 counts down , otherwise , it counts up ( if enabled by tx - on ). the txpi and txpi - ref inputs to the comparator 114 are analog , and the output signal count up / down is digital ( high or low ). the d / a 120 is used to generate the analog reference level of txpi - ref . the mode control input signal forces the digital comparator 118 to enable the limit mode as if tx - gain was higher than tx - max . this input is useful when operating the radiotelephone in the fm analog mode , where the transmitter power is controlled by tx - max . tx - max settles to a value where txpi is equal to txpi - ref and , as a result , txpi - ref defines the transmitter power level . when the transmitter output power is less than the maximum , the power is controlled by the agc control block 110 ( power is set by the gain in the transmitter ). the power limiting is enabled either by txpi being greater than txpi - ref , or if tx - gain is higher than tx - max . if txpi is higher than txpi - ref the tx -- limit counter 112 counts down , thereby decreasing tx - max , until tx - gain is higher than tx - max . when tx - gain is higher than tx - max it is assumed that the transmitter power has passed the maximum limit . this condition causes the comparator 118 to switch the multiplexer 116 so that the transmitter power is set by the current value of tx - max , and it simultaneously enables the tx - limit counter 112 to also count up ( without the up - enable signal being asserted it can only count down ). tx - max is an estimate of the maximum gain needed to set maximum power . due to temperature variations of the transmitter gain tx - max is optimized for different temperatures to determine the relationship between gain and output power . the adaptive adjustment of tx - max is done with txpi , which is a measurement of the actual transmitter output power . if txpi is less than txpi - ref , the output power is less than maximum if tx - gain & gt ; tx - max . in this case the tx - limit counter 112 is incremented until txpi is higher than txpi - ref . in this manner tx - max is adaptively updated until it represents the maximum output power . if txpi is initially less than txpi - ref the tx - limit counter 112 counts down instead of up . the counter 112 does ] lot stop counting so long as tx - gain is higher than tx - max . as a result , and when the circuit has stabilized , the tx limit counter 112 oscillates between two levels . that is , if txpi is higher than txpi - ref the counter 112 counts down by one count and thereby decreases the transmitter power and txpi . on the next clock txpi may be lower than txpi - ref . as a result the counter 112 counts up by one count , bringing the counter 112 back to the previous state , and the cycle repeats . the tx - on signal is used to indicate if the txpi measurement is valid . if the transmitter is operated in burst mode ( transmitter turned on / off for short periods of time as in the tdma and cdma cellular standards ) the txpi indicator does not measure any power during an off period . tx - on is thus used to disable up / down counting when the transmitter is off . however , the previous tx limit count is maintained within the counter 112 during the transmitter off - time , and the counter 112 thus serves as a memory device that retains the transmitter power control state for initial use during a next burst . fig8 depicts an analog embodiment of the circuit shown in fig7 . in the analog embodiment the tx gain and tx max digital signals are converted to corresponding analog voltages with d / as 122 and 124 . the analog embodiment also uses a tx max - controlled analog limiter 126 in place of the digital multiplexer 116 and the digital comparator 118 . it can be appreciated that the teaching of this invention provides for the transmitter power feedback signal to be used for controlling a maximum transmitter power setting , and not for achieving a closed loop power control . that is , the txpi signal , in combination with txpi - ref , is employed to limit the gain of the transmitter so that it does not exceed a setpoint . reference is now made to fig1 which illustrates a presently preferred technique for controlling the operation of the tx - vga 50 and the tx power amplifier 102 . a fixed input power ( tx signal ) is fed to the input of the tx - vga 50 . the tx - gain set signal from d / a 92 ( fig7 ) is employed to set the gain of the tx - vga 50 and , through the bias control block 106 , to control the linearity of the transmitter power amplifier 102 . the bias control signal ( bcs ) is employed to control the dc bias point of the transmitter power amplifier 102 to keep the amplifier operating in a linear mode ( class a or class ab ). the linearity of the transmitter power amplifier is maintained by controlling the consumption of dc power ( volts and / or current ) from the dc power supply ( not shown ). when the tx - gain set signal increases the output power of the tx - vga 50 the dc power requirement of the transmitter power amplifier 102 increases accordingly . as such , the bias control 106 generates the bias signal so as to accommodate the increased dc power requirement of the transmitter power amplifier 102 , thereby maintaining the desired linearity of the transmitter power amplifier . this serves to optimize the current consumption and linearity of the transmitter power amplifier 102 over the required range of output power . the bias control block 106 may be implemented with an operational amplifier having suitable scaling resistors for generating the dc bias signal in an analog form . the bias control block 106 may also generate the bias signal in a digital form . for this latter case a digital to analog converter ( dac ) 107 can be employed to convert the digital bias signal to an analog form if such is required by the transmitter power amplifier 102 . in either case , the bias point of the transmitter power amplifier 102 is established in accordance with the tx - gain set signal that is applied to the tx - vga 50 . as will be recalled , the level of the tx - gain set signal is determined partly in accordance with the txpi signal which reflects the actual transmitted power . while the invention has been particularly shown and described with respect to preferred embodiments thereof , it will be understood by those skilled in the art that changes in form and details may be made therein without departing from the scope and spirit of the invention . | 7 |
the system shown in fig1 is effective to produce significant quantities of nitrogen oxides which are converted into a fertilizer . the energy requirements for the formation of nitrogen oxides in the electric arc process are given by one or more of the following reactions : in the system shown and with optimum air flow rates , the principle end product in the electric arc reaction cell is nitrogen dioxide ( no 2 ). the nitrogen dioxide is readily trapped in water to form nitric acid ( hno 3 ) and nitrous ( hno 2 ) acids . the chemical progression of the process is : n 2 + o 2 → 2no ; no + 1 / 2o 2 → no 2 ; 2no 2 + h 2 o ⃡ hno 3 + hno 2 . by the addition of line , caco 3 to the water , these acids are converted primarily into calcium nitrate fertilizer ( caco 3 + 2hno 3 → ca ( no 3 ) 2 + co 2 + h 2 0 ). the nitrogen fertilizer may be used as it is produced by spraying , incorporating into a hydroponic system , or alternately , if an existing irrigation system exists at the site , the nitrogen fertilizer simply may be fed into the irrigation feed water . a third option is to store the fertilizer as calcium nitrate ( a very stable compound ) in tanks , open basins or plastic lined trenches , and used when needed . the system may consist of a small capacity system for the consumer market and which is designed to produce liquid fertilizer in a semi - permanent storage vessel from which it is syphoned into the water stream of a garden hose when the lawn , garden or other crop is watered . the system may also consist of a larger capacity field unit which utilizes either commercial or wind - electric generated power by manifolding a large number of smaller units to increase the capacity of fixed nitrogen production . electrical energy to drive the nitrogen fertilizer production system on a farm location may be obtained from a conventional 110 volt or 220 volt power source which incorporates a step - up transformer to obtain the higher voltages desirable for electric arc processes . a more economical , and generally available , power source can be the 7200 volt system commonly used for distribution of residential power by most utility companies in the united states . the following projected economic calculations are based on using power drawn from a 7200 volt transmission line power source to eliminate the need for a step - up voltage transformer . as indicated by the calculations , economic costs for the system , assuming 10 % efficiency of the overall process , are competitive based on present day costs of anhydrous ammonia . starting with theoretical energy requirements and assuming 10 % efficiency for the formation of nitrogen dioxide by the arc discharge through air process , electrical energy costs are projected based on a system to produce one ton of fixed nitrogen . all estimates and assumptions are believed to be conservative . assuming 10 % efficiency of the above reaction , one ton of fixed nitrogen would require 2000 × 4 . 690 = 9380 kwh per ton . based on a commercial rate of two cents per kwh , projected electrical energy costs per ton of fixed nitrogen would be : as stated previously , wind - electric or other forms of power generation may be used to drive the system in which case the cost per ton of fixed nitrogen would be more dependent on capital costs for equipment and maintenance requirements for the equipment . the liquid fertilizer generating system illustrated in fig1 includes a nitrogen generating unit 15 for producing nitrogen dioxide gas which is directed through a line 16 to a liquid fertilizer generating unit 18 . the nitrogen generating unit 15 incorporates a sheet metal cabinet 20 having sidewalls 23 and 24 ( fig2 ) rigidly connected by a bottom wall 26 , the cabinet 20 also includes a front wall 28 and a removable combined top and rear wall cover 29 . the cabinet 20 encloses a parallet - series air combustion unit 35 ( fig2 and 3 ) which includes an elongated metal bar or body 36 having a series of longitudinally spaced threaded counterbores 37 ( fig5 ) each of which receives a tubular fitting 38 . each of the fittings 38 encloses a combined combustion cylinder and electrode 41 which defines an hour - glass combustion chamber 42 formed by converging frusto - conical surfaces 43 and 44 connected by a circular restriction orifice 46 . a threaded hole 48 is formed within the body 36 concentrically with each of the orifices 46 and receives an electrode element 50 in the form of a sparkplug 50 . each of the sparkplugs 50 has an inner electrode tip 52 which is located concentrically within the orifice 46 , and the spark generated by the sparkplug or electrode 50 jumps across the annular gap between the electrode element 52 and the sharp edge defining the orifice 46 . compressed air is supplied to each of the combustion chambers 42 through a generally tangential passage 56 ( fig6 ) which connects with an air supply line 58 extending downwardly from an air supply manifold 62 ( fig3 ). the air supply manifold 62 is divided by an internal wall 64 into two chambers 66 and 67 . a pair of tie bolts 68 connect the manifold 62 to the bar or body 36 , and the manifold 62 supports a needle valve assembly 72 for each of the air supply lines 58 . each of the needle valve assembly 72 has an inlet 73 which connects with the corresponding chamber . compressed air is supplied to the chamber 66 ( fig3 ) of the manifold 62 through a t - fitting 74 connected by a line 76 to a combined motor driven air compressor 78 ( fig2 ) located within the bottom portion of the cabinet 20 . the compressed air flows from the chamber 66 of the manifold 62 through the corresponding two needle valves 72 and to the inlet passages 56 of the corresponding two air combustion chambers 42 . high voltage power , for example , on the order of 5 , 000 volts , is supplied to each of the electrodes 50 from the corresponding transformer 81 ( only one shown in fig2 ) located within the lower portion of the cabinet 20 and adapted to receive a power supply of 120 volts . as the compressed air flows into each of the combustion chambers 42 , the air spirals inwardly along the surface 43 and increases in velocity towards the orifice 46 where all of the air is required to pass through the orifice . the swirling air causes the arc to rotate rapidly and , in effect , produces an annular flame within the orifice . the combustion of the air produces oxygen which recombines with the nitrogen in the air to form nitrogen dioxide . this gas flows from the chamber 42 through a series of tangential outlet ports 84 ( fig7 ) and into an annular chamber 86 defined by the fitting 38 . as shown in fig5 a circular quartz lens 88 is retained within each of the tubular fittings 38 and is confined between the fitting 38 and the tubular electrode 41 adjacent the outlet ports 84 . the fittings 38 and corresponding lens 88 projects through corresponding holes 91 ( fig2 ) formed within the front wall 28 of the cabinet 20 and provide for visually observing the rotating spark and flame and the combustion of the air within each of the chambers 42 . while the flame is being observed , the needle valves 72 may be precisely adjusted to obtain maximum production of nitrogen dioxide . the combustion gases produced in the two combustion chambers 42 connected in parallel to the air manifold chamber 66 are directed through the corresponding outlet lines 94 ( fig3 and 5 ) to a chamber 96 defined within the right end portion of a tubular outlet manifold 98 ( fig3 ). from the chamber 96 , the gases are directed through a line 102 to the chamber 67 within the manifold 62 and from the chamber 67 , the gases are directed through the outer two parallel connected combustion chambers 42 at the left of the body 36 . this series connection of the two pairs of combustion chambers 41 provides for more complete combustion of the oxygen within the air and the formation of more concentrated nitrogen dioxide gas . the gas flowing through the two outlet lines 94 shown at the left in fig3 are collected within a second chamber 104 within the outlet manifold 98 , and the chamber 104 is separated from the chamber 96 by an internal wall 106 . as shown in fig2 the finger operated valve stems of the needle valves 72 project through corresponding holes 107 within the top cover 29 of the housing or cabinet 20 to facilitate convenient adjustment of each needle valve and thereby provide the desired flow rate of gas into each of the combustion chambers 42 for obtaining the optimum combustion within the chamber . the front panel 28 of the cabinet 22 also supports a set of control switches 108 , one of which controls the air compressor 78 and another of which controls the spark generators of power supplied to the transformers 81 . a control timer 110 is also supported by the front panel 28 and provides for selecting the desired operating time for the nitrogen generating unit 15 , for example , up to 24 hours . fig2 also shows a set of motor driven fans 112 which are mounted on the walls 24 and 28 and serve to cool the transformers 81 and the interior of the cabinet 20 . the nitrogen oxides or gases supplied to the chamber 104 within the outlet manifold 98 , are directed through a solenoid control valve 115 ( fig2 ) which is connected to a liquid collecting filter unit 117 . the gases flow from the liquid filter unit 117 into an aspirator 120 ( fig4 and 8 ) having a tapered venturi passage 122 defined by a coupling 123 . the aspirator 120 is located within a molded plastic tank 125 which forms part of the liquid fertilizer generating unit 20 . as illustrated in fig1 the tank 125 has a capacity of approximately fifty gallons of water and is closed by a removable lid or cover 126 which is also preferably formed of a plastics material . a submersible motor - pump unit 128 ( fig4 ) is located within the lower portion of the tank 125 and has an inlet line 129 adjacent the bottom of the tank . the outlet of the unit 128 is connected by a line 132 to the aspirator 120 where the nitrogen gases supplied through the flexible line 16 are aspirated into the water flowing upwardly through the line 132 and aspirator 120 . the third switch 108 on the front panel 28 controls the pump unit 128 . the upper end or outlet of the aspirator 120 is connected to a tubular sight - glass 134 which is confined between fittings 136 clamped between a set of plates 138 mounted on the cover 126 for the tank 125 . the sight - glass 134 provides for observing the flow of water and combined nitrogen gases to assure that the pump 128 is operating properly and that nitrogen oxides are being introduced into the water . a line 142 is connected to the upper end of the sight - glass 134 and extends downwardly to the bottom of the tank 125 . the line 142 connects with the lower end of a long plastic tube 144 which extends in a helical manner within the tank 124 ( fig4 ) to form a gas absorption coil 145 . preferably , the tube 144 has substantial length , for example , on the order of two hundred or more feet , and the upper end of the tube 144 connects with a line 147 which projects upwardly through the cover 126 to a fitting 148 positioned between a pair of valves 151 and 152 . a line 154 extends from the valve 152 back downwardly into the lower portion of the tank 125 so that when the valve 152 is open , the water within the tank 124 is recirculated by the motor - pump unit 128 through the aspirator 120 and the absorption coil 145 . this recirculation of the water and nitrogen dioxide progessively increase the concentration of the nitric acid and nitrous acid produced within the tank 125 . when it is desired to withdraw some of solution from the tank 125 , the valve 151 is opened and the valve 152 is closed . additional water may then be supplied to the tank 125 to maintain a water level within the upper portion of the tank . referring to fig1 and 4 , an air supply line 161 is connected to the fitting 74 mounted on the back of the air supply manifold 62 and extends outwardly from the cabinet 20 and downwardly through the cover 126 to the bottom of the tank 125 . the tube 161 connects to an air sparging or dispersing tube 162 which has fine holes so that air from the compressor 78 is introduced into the lower portion of the tank 125 , as illustrated by the bubbles in fig4 . calcium hydroxide or calcium carbonate , in the form of limestone or hydrabed lime , is added to the lower portion of the tank 125 and combines with the additional oxygen supplied through the tube 162 to release the calcium for combining with the nitrogen to produce calcium nitrate in the water solution within the tank 125 . the additional oxygen added to the water through the line 161 and tube 162 also cooperates in converting the unstable nitrous oxide gas ( no 2 ) produced by the combustion units into a more stable nitric acid solution ( hno 3 ). the desired reaction accomplished by introduction of additional oxygen is : hno 2 + 1 / 2o 2 → hno 3 . the cover 126 further limits the nitrous oxide gas ( no 2 ) from escaping from the tank to atmosphere thereby forcing it to continue in the above reaction to obtain a more concentrated solution of nitric acid . other materials , such as potash and phosphate rock , may also be added to the recirculating tank 125 according to the fertilizer characteristics desired within the water removed from the tank through the valve 151 . from the drawings and the above description , it is apparent that the method and apparatus of the invention for producing a liquid nitrate fertilizer , provides desirable features and advantages . for example , the portable apparatus shown in fig1 is adapted for on - sight , low cost production of a stable water - based nitrogen solution , and the concentration of the solution is determined by selecting the operating time of the apparatus through control of the timer 110 . as mentioned above , trace elements may also be conveniently added to the tank 125 to meet specific or customized plant requirements . while the apparatus illustrated is ideally suited for use by a small commercial operation such as a greenhouse operation , it is apparent that the apparatus may be constructed on a larger scale for use wherever a supply of water and a supply of electrical power are available . for example , in a larger system , two sets of the air combustion units 35 may be arranged in parallel to provide for a greater demand for nitrogen gases . in addition , the parallel - series arrangement of the combustion chambers 41 assures that all of the air flowing through the unit is required to pass through rotating arcs or flames within the orifices 46 , thereby obtaining a high efficiency of combustion . the compact liquid fertilizer generating unit 20 , including the tank 124 , cover 126 , aspirator 120 , recirculating pump 128 and absorbtion coil 145 , further provides for increasing the volume of hot nitrogen gases which go into solution before the gases have an opportunity to recombine . the recirculation also progressively increases the concentration of the nitric acid within the tank 124 , resulting in a more efficient production of nitrate fertilizer . in addition , the air supplied to the tank through the line 161 , provides more oxygen to the water for producing additional nitric acid , and the cover 126 inhibits the escape of the nitrous oxide to atmosphere prior to combining with the oxygen to form nitric acid . another feature is provided by the solenoid valve 115 which automatically closes when the air pump 78 stops to assure that no water or acid within the tank 124 can flow backwards in the line 16 and enter the combustion unit 35 and thereby damage the unit . while the method and form of liquid fertilizer generating apparatus herein described constitute a preferred embodiment of the invention , it is to be understood that the invention is not limited to the precise method and form of apparatus described , and that changes may be made therein without departing from the scope and spirit of the invention as defined in the appended claims . | 1 |
an embodiment of a system of the invention is illustrated in the accompanying drawings , wherein like reference numerals refer to like elements throughout the drawings . although the drawings are intended to illustrate an embodiment of the present invention , the drawings are not necessarily drawn to scale . a calibration system of the invention may be used with an external drum imaging system that is configured to record digital data onto imaging media . although described below with regard to an external drum platesetter , many aspects of the present invention may be used in conjunction with a wide variety of other types of external drum , internal drum , or flatbed imaging systems , including imagesetters and the like , without departing from the intended scope of the present invention . as shown in fig1 in accordance with an embodiment of the invention , imaging media may be placed onto an input tray 30 of an image recorder , such as a platesetter 10 having a housing 2 . the imaging media is then imaged , and a portion of the imaged media may then be scanned by a calibration unit . the imaging system may then be adjusted responsive to the output of the calibration unit , and imaging of the media may continue . the media is then output from the platesetter 10 via output port 4 , passed to a processing station 6 , and then deposited onto a table 8 as shown in fig1 . the imaging system generally includes a front end computer or workstation ( not shown ) for the design , layout , editing , and / or processing of digital files representing pages to be printed , a raster image processor ( rip ) for further processing the digital pages to provide rasterized page data ( e . g ., rasterized digital files ) for driving an image recorder , and an image recorder , such as an external drum platesetter 10 , for recording the rasterized digital files onto a printing plate or other recording media . the external drum platesetter 10 records the digital data provided by the rip onto a supply of photosensitive , radiation sensitive , thermally sensitive , flexographic or other type of suitable printing plate . in the present embodiment , the printing plate is manually loaded onto a staging area of the external drum platesetter 10 by an operator . alternately , or in addition to manual loading , the printing plate may be provided and loaded onto the external drum platesetter 10 by a media supply or autoloading system , which may accept a plurality of the same size or different size printing plates . as shown in fig2 the external drum platesetter 10 includes an external drum 12 having a cylindrical media support surface 14 for supporting the printing plate 16 ( shown in fig3 ) during imaging . the external drum platesetter 10 further includes a writing and calibration system 18 , coupled to a movable carriage 20 , for recording digital data onto the imaging surface 22 of the printing plate 16 using a single or multiple imaging beams 24 ( shown in fig2 ). the carriage 20 rides along a stable base 26 , and the drum 12 rotates about a drum drive system 28 . the base 26 may be formed of heavy material , such as a polymer - concrete mixture , granite , or the like , to vibrationally isolate the external drum 12 and writing and calibration unit 18 from external vibrations . generally , during use a plate is positioned on an input tray 30 , and transferred to an imaging station in a direction as indicated at a . after imaging , the plate is transferred from the imaging station to an output tray in a direction as indicated at b using transfer belts 32 that are driven by pulleys 34 about pulley shafts 36 . from the output tray , the plate may be exited from the platesetter 10 in either of a direction as indicated at c or a direction as indicated at d by rollers 40 that contact the plate after the pulleys 34 and belts 32 are lowered with respect to the rollers 40 . in further embodiments , the plate may be exited from the platesetter 10 in a direction as indicated at e . as shown in fig2 the scanning system 18 is displaced by the movable carriage 20 in a slow scan ( axial ) direction along the length of the rotating external drum 12 to expose the printing plate 16 in a line - wise manner when a single beam is used or in a section - wise manner for multiple beams . other types of imaging systems may also be used in the present invention . the external drum 12 is rotated by a drive system 28 in a clockwise or counterclockwise fast scan direction , typically at a rate of about 100 - 1000 rpm . in an embodiment , the printing plate 16 is loaded onto the external drum 12 while rotating the drum in a first clockwise direction . the printing plate 16 is then imaged while the drum is rotated in the first , or in an opposite second , direction . finally , the printing plate 16 is unloaded from the external drum 12 while rotating the drum in the second direction . as shown in fig3 a plate 16 is positioned on the input tray 30 above a pair of resilient input nip rollers 50 , one of which may be driven by a drive assembly 52 . the leading edge 38 of the plate 16 is positioned by the input tray 30 to rest substantially between the input nip rollers 50 . the rollers 50 are positioned above the external drum 12 , and are oriented such that the common tangent of the rollers 50 is tangent to the media support surface 14 . the input tray 30 is oriented such that the loading path of the plate 16 extends along a line that is tangent to the external drum 12 at a leading edge clamping mechanism 40 . a curved input / output guide platen 54 , mounted to a frame member ( not shown ) of the external drum platesetter 10 may be provided to direct the leading edge 38 of the printing plate 16 toward the leading edge clamping mechanism 40 during the loading of the printing plate 16 onto the external drum 12 . in addition , the curved input / output guide platen 54 is configured to direct the printing plate 16 off of the external drum 12 toward the plate output area after imaging is complete . during loading of a plate 16 , the drum 12 is rotated until the leading edge clamping mechanism 40 is positioned to receive the leading edge 38 of the plate 16 . a clamping portion 54 of the clamping mechanism 40 is held in an open position by an actuator 56 , exposing registration pins 58 . a trailing edge clamping mechanism 44 is rotated by the drive system 28 , if necessary , to position a clamping bar 60 out of the way of the loading path of the plate 16 . an actuation system 62 for the trailing edge clamping mechanism 44 , and an ironing roller system 64 , may also be retracted away from the media support surface 14 of the external drum 12 out of the way of the loading path . after the leading edge 38 of the plate 16 is properly positioned against the registration pins 58 , the leading edge clamping mechanism is closed , thereby pinching the plate 16 against the external drum 12 while the leading edge 38 remains in contact with the registration pins 58 . after the leading edge clamping operation , the external drum 12 is rotated a few degrees by the drive system 28 . the ironing roller assembly of the stationary ironing roller system 64 is then extended and positioned against the plate 16 by an actuating system . the plate is drawn around the drum 12 until the trailing edge 42 of the plate 16 is positioned adjacent the trailing edge clamping mechanism 44 . the clamping bar 60 is then positioned over the trailing edge 42 of the plate 16 . if the size of the plate is not known and pre - programmed into the system , a sensor 68 may be used to detect the trailing edge of the plate 16 . the drum and clamping bar 60 are then rotated together , and the clamping bar 60 , which is normally biased away from the drum 12 , is then forced against the drum 12 by the actuation system 62 . vacuum may also be used to facilitate securing the plate to the drum . during imaging , the leading edge 38 of the plate 16 is held in position against the media support surface 14 by the leading edge clamping mechanism 40 . similarly , the trailing edge 42 of the printing plate 16 is held in position against the media support surface 14 by the trailing edge clamping mechanism 44 . both the trailing edge clamping mechanism 44 and the leading edge clamping mechanism 40 provide a tangential friction force between the printing plate 16 and the external drum 12 sufficient to resist the tendency of the edges of the printing plate 16 to pull out of the clamping mechanisms 40 , 44 , at a high drum rotational speed . in accordance with the present invention , only a small section ( e . g ., 6 mm ) of the leading and trailing edges 38 , 42 , is held against the external drum 12 by the leading and trailing edge clamping mechanisms 40 , 44 , thereby preserving as much of the available imaging area of the printing plate 16 as possible . as shown in fig4 a calibration image 80 is recorded on a portion of the surface 14 of the imaging media 12 by a writing illumination source 82 of the writing and calibration unit 18 . the calibration image 80 may then be viewed by a calibration detection unit 84 within the unit 18 as shown in fig5 . the calibration detection unit 84 may include , in particular , a dispersing filter 86 and a charge couple device ( ccd ) camera 88 . as shown in fig6 a and 6b , the calibration image 80 may include an checkerboard - type array of black and white boxes , and may , for example be about 1 inch by 1 inch in size . if the writing source 82 is improperly calibrated , then the individual boxes 90 may be slightly undersized as shown at 90 a in fig6 a , or slightly oversized as shown at 90 b in fig6 b . because the calibration detection unit 84 includes a dispersing filter 86 , the ccd camera 88 receives a blurred homogenous image of the calibration image 80 , rather than distinguishing between individual boxes . the blurred homogenous image will be recorded by the ccd camera and accompanying computer system as a shade having a particular shade value . if the calibration image includes undersized boxes as shown at 90 a in fig6 a , then the shade value of the image received by the ccd camera 84 will be lower than a desired target shade value . if the calibration image includes oversized boxes as shown at 90 b in fig6 b , then the shade value of the image received by the ccd camera 84 will be higher than the desired target shade value . finally , if the calibration image includes correctly - sized boxes as shown at 90 c in fig6 c , then the shade value of the image received by the ccd camera 84 will be equal to the desired target shade value . the position of the writing unit 82 may then be adjusted as indicated at 92 in fig5 responsive to the shade value of the received image to achieve an optimal calibration for that particular imaging media . in various embodiments , the system may adjust to any shade value , e . g ., 50 % as described above , or any value between 0 % and 100 %. further , the system may record and analyze either the brightness ( the white areas ) and / or the dark areas , and may record the brightness / darkness for a variety of shades ( e . g ., 25 %, 50 % and 75 %) and provide the appropriate ( linear or non - linear ) correction as needed . in other embodiments , the system may not blur the image , but rather may record the actual shapes ( e . g ., each square shape ) in the calibration image . moreover , the calibration image may form a part of the overall image being recorded on the plate . the calibration image may be written on a small portion of the media near an edge in order to preserve as much of the media as possible for imaging of the desired image during pre - press imaging . in further embodiments , the calibration image may be written over a large portion of imaging media that is used only for the calibration process . with reference again to fig3 during output of the plate 16 from the drum 12 , the drive system 28 rotates the drum 12 in a counterclockwise direction , the trailing edge clamping mechanism 44 is released , and the leading edge clamping mechanism 40 is released . the trailing edge 42 of the plate 16 is guided by the input / output platen 54 toward resilient output nip rollers 70 , one of which may include a drive system 72 . the plate 16 is then received in the output area 47 by the belts 32 that are rotated about pulleys 34 in a direction that causes the top surface of the belts 32 to travel with the plate as it emerges from the imaging area , and thereby carry the plate away from the imaging area . once the plate reaches a stop surface , the plate stops moving and the drive system for the pulleys 34 is turned off . in other embodiments , plate advancement may cease responsive to the output of a position sensor . those skilled in the art will appreciate that numerous modifications and variations may be made to the above disclosed embodiments without departing from the spirit and scope of the present invention . | 7 |
the disclosure is illustrated by way of example and not by way of limitation in the figures of the accompanying drawings in which like references indicate similar elements . it should be noted that references to “ an ” or “ one ” embodiment in this disclosure are not necessarily to the same embodiment , and such references can mean “ at least one .” fig1 illustrates an array substrate 12 of an lcd panel of an exemplary embodiment . fig2 illustrates a cross - sectional view of the array substrate 12 . referring to fig1 and 2 , the array substrate 12 includes a substrate 120 , a first wiring layer 121 , a second wiring layer 122 , an insulating layer 123 , a semiconductor film 124 , a passivation layer 125 , a conductive film 126 , and a plurality of spacers 129 . the substrate 120 is transparent , for instance , made of glass . the spacer 129 is a laminating structure . the first wiring layer 121 is set on a surface of the substrate 120 and includes a gate line 130 extending along a first direction , a gate electrode 132 connected to the gate line 130 , and a first laminating layer 136 . in this embodiment , the gate electrode 132 protrudes from a side of the gate line 130 . a first photoresist layer 138 applied to the first wiring layer 121 is exposed and developed to form the gate line 130 , the gate electrode 132 , and the first laminating layer 136 . apart of the first photoresist layer 138 covering the first laminating layer 136 remains as one layer of the laminating structure of the spacer 129 . in this embodiment , the first laminating layer 136 is a first layer of the spacer 129 and the first photoresist 138 is a second layer of the spacer 129 . the insulating layer 123 is formed on the substrate 120 to cover the gate line 130 , the gate electrode 132 , the first laminating layer 136 , and the first photoresist layer 138 . the insulating layer 123 is used as a gate insulator . in this embodiment , a part of the insulating layer 123 which overlaps with the first photoresist layer 138 is a third layer of the spacer 129 . the semiconductor film 124 is formed on a surface of the insulating layer 123 . a second photoresist layer 148 applied on the semiconductor film 124 is exposed and developed to form a channel layer 140 and a second laminating layer 146 . the channel layer 140 is located to correspond to the gate electrode 132 . the second laminating layer 146 is stacked with the first photoresist layer 138 . a part of the second photoresist layer 148 which covers the second laminating layer 146 remains as one layer of the laminating structure of the spacer 129 . in this embodiment , the second laminating layer 146 is a fourth layer of the spacer 129 and the second photoresist layer 148 is a fifth layer of the spacer 129 . the second wiring layer 122 is formed on the semiconductor film 124 and the insulating layer 123 . the second wiring layer 122 is electrically isolated from the first wiring layer 121 . a third photoresist layer 158 applied to the second wiring layer 122 is exposed and developed to form a source line 150 , a source electrode 152 , a drain electrode 154 , and a third laminating layer 156 . the source electrode 152 and the drain electrode 154 overlap with the semiconductor film 124 . the third laminating layer 156 is stacked with the second photoresist layer 148 . a part of the third photoresist layer 158 which covers the third laminating layer 156 remains as one layer of the laminating structure of the spacer 129 . in this embodiment , the third laminating layer 156 is a sixth layer of the spacer 129 and the third photoresist layer 158 is a seventh layer of the spacer 129 . the source line 150 extends along a second direction different from the first direction . the source line 150 crosses with the gate line 130 to define a pixel area . the source electrode 152 is connected to the source line 150 . the source electrode 152 is electrically connected to the drain electrode 154 via the channel layer 140 . the source electrode 152 , the drain electrode 154 , and the channel layer 140 together comprise and function as a thin film transistor ( tft ) 159 . in this embodiment , the thin film transistor 159 is located at a corner where the source line 150 crosses the gate line 130 . the passivation layer 125 is formed on the substrate 120 to cover the insulating layer 123 , the semiconductor layer 124 , the second wiring layer 122 , and the third photoresist layer 158 formed on the third laminating layer 156 . in this embodiment , a part of the passivation layer 125 which covers the third photoresist layer 158 is an eighth layer of the spacer 129 . the conductive film 126 is formed on the passivation layer 125 . a fourth photoresist layer 168 applied to the conductive film 126 is exposed and developed to form a pixel electrode 160 and a fourth laminating layer 166 . the pixel electrode 160 is electrically connected to the drain electrode 154 via a connecting through hole 125 a defined in the passivation layer 125 . a part of the fourth photoresist layer 168 covering the fourth laminating layer 166 remains as one layer of the laminating structure of the spacer 129 . in this embodiment , the fourth laminating layer 168 is a ninth layer of the spacer 129 and the fourth photoresist layer 168 is a tenth layer of the spacer 129 . it is understood that a sequence of laminating layers of the spacer 129 can be changed according to a priority of manufacturing steps of the first wiring layer 121 , the second wiring layer 122 , the insulating layer 123 , the semiconductor film 124 , the passivation film 125 , and the conductive film 126 . the first photoresist layer 138 , the second photoresist layer 148 , the third photoresist layer 158 , and / or the fourth photoresist layer 168 can be omitted from the laminating structure of the spacer 129 . fig3 is a flowchart of an exemplary embodiment of an array substrate manufacturing method for an lcd panel . the spacer 129 of the array substrate 12 is formed with the tft 159 and the pixel electrode 160 of the array substrate 12 . in this embodiment , the tft 159 is a bottom gate type tft . it is understood that , in the other embodiments , the tft 159 can be different types of tfts , for instance , a top gate type tft . a priority of the manufacturing steps can be changed according to the structure of the tft 159 . in block 801 , referring also to fig4 , the substrate 120 is provided and the first wiring layer 121 is formed on the substrate 120 . the substrate 120 can be made of an insulating material , for example , glass , quartz , or a ceramic . the first wiring layer 121 can be made of a conductive material , for example , aluminum , molybdenum , chromium , tantalum , or copper . in block 802 , the first photoresist layer 138 is formed on the first wiring layer 121 to pattern the first wiring layer 121 . a first mask 300 is placed above the first photoresist layer 138 . the first mask 300 is a gray tone mask and includes a plurality of first areas 301 , two second areas 302 , and a third area 303 . transparencies of the first areas 301 , the second areas 302 , and the third area 303 gradually decrease . in this embodiment , the third area 303 is opaque , the first areas 301 of the first mask 300 are entirely transparent , and the second areas 302 allow a portion of light to pass through . the second areas 302 are respectively aligned with positions of the gate line 130 and the gate electrode 132 ( see fig1 ). the third area 303 is aligned with a position of the spacer 129 ( see fig1 ). the first areas 301 are aligned with the remaining portions of the array substrate 12 . ultraviolet light passes through the first mask 300 to irradiate the first photoresist layer 138 . the transparencies of the first areas 301 , the second areas 302 , and the third area 303 are different from each other , thus different parts of the first photoresist layer 138 aligned with the first areas 301 , the second areas 302 , and the third areas 303 are irradiated at different intensities . referring to fig5 , the first photoresist layer 138 is developed . a plurality of first parts of the first photoresist layer 138 aligned with the first areas are totally removed . two second parts of the first photoresist layer 138 aligned with the two second areas 302 are partially removed . a third part of the first photoresist layer 138 aligned with the third area 303 remains unremoved . a thickness of the third part of the first photoresist layer 138 aligned to the third area 303 is greater than a thickness of the second parts of the first photoresist layer 138 aligned to the second areas 302 . referring to fig6 , a part of the first wiring layer 121 uncovered by the first photoresist layer 138 is etched away . that is , the part of the first wiring layer 121 aligned to the first areas 301 is etched away . in block 803 , referring to fig7 , the first photoresist layer 138 is etched until the second parts of the first photoresist layer 138 aligned with the second areas 302 are totally removed . since the thickness of the third part of the first photoresist layer 138 aligned with the third area 303 is greater than the thickness of the second parts of the first photoresist layer 138 aligned with the second areas 302 of the first mask 300 , the third part of the first photoresist layer 138 aligned with the third area 303 of the first mask 300 remains unremoved when the second parts of the first photoresist layer 138 aligned with the second areas 302 of the first mask 300 are totally removed . a part of the first wiring layer 121 uncovered by the first photoresist layer 138 is used as the gate line 130 and the gate electrode 132 . the other parts of the first wiring layer 121 covered by the remaining third part of the first photoresist layer 138 is used as the first laminating layer 136 of the spacer 129 . in block 804 , also referring to fig8 , the insulating layer 123 is formed on the substrate 120 to cover the first wiring layer 121 and the remaining third part of the first photoresist layer 138 . a part of the insulating layer 123 covering the remaining third part of the first photoresist layer 138 is used as one layer of the laminating structure of the spacer 129 ( see fig2 ). in block 805 , the semiconductor film 124 is formed on the insulating layer 123 . the semiconductor film 124 can be made of a metal oxide semiconductor material . in block 806 , the second photoresist layer 148 is formed on the semiconductor film 124 to pattern the semiconductor film 124 . a second mask 400 is placed above the second photoresist layer 148 . the second mask 400 is a gray tone mask and includes a number of first areas 401 , a second area 402 , and a third area 403 . the respective transparencies of the first areas 401 , the second area 402 , and the third area 403 gradually decrease . in this embodiment , the third area 403 is opaque , the first areas 401 are transparent , and the second area 402 allows a portion of light to pass through . the second area 402 is aligned with a position of the channel layer 140 ( see fig1 ). the third area 403 is aligned with the position of the spacer 129 ( see fig1 ). the first areas 401 are aligned with the remaining portions of the array substrate 12 . ultraviolet light passes through the second mask 400 to irradiate the second photoresist layer 148 . referring to fig9 , the second photoresist layer 148 is developed . a number of first parts of the second photoresist layer 148 aligned with the first areas 401 are totally removed . a second part of the second photoresist layer 148 aligned with the second area 402 of the second mask 400 is partially removed . a third part of the second photoresist layer 148 aligned to the third area 403 remains unremoved . a thickness of the third part of the second photoresist layer 148 aligned with the third area 403 is greater than a thickness of the second part of the second photoresist layer 148 aligned with the second area 402 . referring to fig1 , a part of the semiconductor film 124 uncovered by the second photoresist layer 148 is etched away . that is , the part of the semiconductor film 124 aligned with the first area 401 is etched away . a part of the semiconductor film 124 aligned with the second area 402 is patterned to form the channel layer 140 . a part of the semiconductor film 124 aligned with the third area 403 is patterned to form the second laminating layer 146 of the spacer 129 . the second laminating layer 146 is stacked with the first laminating 136 layer . in block 807 , referring also to fig1 , the second photoresist layer 148 is etched away until the second part of the second photoresist layer 148 aligned with the second area 402 is totally removed . since the thickness of the third part of the second photoresist layer 148 aligned to the third area 403 is greater than the thickness of the second part of the second photoresist layer 148 aligned with the second area 402 , the third part of the second photoresist layer 148 aligned with the third area 403 remains unremoved when the second part of the first photoresist layer 148 aligned with the second area 402 is totally removed . the remaining third part of the second photoresist layer 148 is used as one layer of the laminating structure of the spacer 129 ( see fig2 ). referring to fig1 , in block 808 , the second wiring layer 122 is formed on the substrate 120 to cover the insulating layer 123 , the semiconductor film 124 , and the second photoresist layer 148 . in block 809 , the third photoresist layer 158 is formed on the second wiring layer 122 to pattern the second wiring layer 122 . a third mask 500 is placed above the third photoresist layer 158 . the third mask 500 is a gray tone mask and includes a plurality of first areas 501 , three second areas 502 , and a third area 503 . respective transparencies of the first areas 501 , the second areas 502 , and the third area 503 gradually decrease . in this embodiment , the third area 503 is opaque , the first areas 501 are transparent , and the second areas 502 allow a portion of light to pass through . the three second areas 502 are respectively aligned with positions of two branches of the source electrode 152 and the drain electrode 154 ( see fig1 ). the third area 503 is aligned with the position of the spacer 129 . the first areas 501 are aligned with the remaining portions of the array substrate 12 . ultraviolet light passes through the third mask 500 to irradiate the third photoresist layer 158 . referring to fig1 , the third photoresist layer 158 is developed . a plurality of first parts of the third photoresist layer 158 aligned with the first areas 501 are totally removed . three second parts of the third photoresist layer 158 aligned with the three second areas 502 are partially removed . a third part of the first photoresist layer 158 aligned with the third area 503 remains unremoved . a thickness of the third part of the third photoresist layer 158 aligned with the third area 503 is greater than a thickness of the second parts of the third photoresist layer 158 aligned with the second areas 502 . referring to fig1 , a part of the second wiring layer 122 uncovered by the third photoresist layer 158 is etched away . that is , the part of the second wiring layer 122 aligned with the first areas 501 is etched away . a portion of the second wiring layer 122 aligned with the second areas 502 is patterned to form the source line 150 ( see fig1 ), the source electrode 152 , and the drain electrode 154 . a portion of the second wiring layer 122 aligned with the third area 503 is patterned to form the third laminating layer 156 of the spacer 129 . the third laminating layer 156 is stacked with the first laminating layer 146 and the second laminating layer 136 . in block 810 , referring also to fig1 , the third photoresist layer 158 is etched away until the second parts of the third photoresist layer 158 aligned with the second areas 502 are totally removed . since the thickness of the third part of the third photoresist layer 158 aligned with the third area 503 is greater than the thickness of the second parts of the third photoresist layer 158 aligned with the second areas 502 , the third part of the third photoresist layer 158 aligned with the third area 503 remains unremoved the second parts of the third photoresist layer 158 aligned with the second areas 502 is totally removed . the remaining third part of the third photoresist layer 158 is used as one layer of the laminating structure of the spacer 129 ( see fig2 ). referring to fig1 , in block 811 , the passivation layer 125 is formed to cover the insulating layer 123 , the semiconductor film 124 , the second wiring layer 122 , and the third photoresist layer 158 . a part of the passivation layer 125 covering the remaining third part of the third photoresist layer 158 is used as one layer of the laminating structure of the spacer 129 ( see fig2 ). in block 812 , a conductive film 126 is formed on the passivation layer 125 . in this embodiment , the conductive film 126 is made of indium tin oxide ( ito ). in block 813 , the fourth photoresist layer 168 is formed on the conductive film 126 to pattern the conductive film 126 . a fourth mask 600 is placed above the fourth photoresist layer 168 . the fourth mask 600 is a gray tone mask and includes a plurality of first areas 601 , a second area 602 , and a third area 603 . respective transparencies of the first areas 601 , the second area 602 , and the third area 603 gradually decrease . in this embodiment , the third area 603 is opaque , the first areas 601 are transparent , and the second area 602 allows a portion of light to pass through . the second area 602 is aligned with a position of the pixel electrode 160 ( see fig1 ). the third area 603 is aligned with the position of the spacer 129 ( see fig1 ). the first areas 601 are aligned with the remaining portion of the array substrate 12 . ultraviolet light passes through the fourth mask 600 to irradiate the fourth photoresist layer 168 . referring to fig1 , the fourth photoresist layer 168 is developed . a number of first parts of the fourth photoresist layer 168 aligned with the first areas 601 are totally removed . a second part of the fourth photoresist layer 168 aligned with the second area 602 is partially removed . a third part of the fourth photoresist layer 168 aligned with the third area 603 remains unremoved . a thickness of the third part of the fourth photoresist layer 168 aligned with the third area 603 is greater than a thickness of the second part of the fourth photoresist layer 168 aligned with the second area 602 . referring to fig1 , a portion of the conductive film 126 uncovered by the fourth photoresist layer 168 is etched away . that is , the portion of the conductive film 126 aligned to the first area 601 is etched away . a portion of the conductive film 126 aligned with the second area 602 is patterned to form the pixel electrode 160 . a portion of conductive film 126 aligned with the third area 603 is patterned to form the fourth laminating layer 166 of the spacer 129 ( see fig2 ). the fourth laminating layer 166 is stacked with the first laminating layer 136 , the second laminating layer 146 , and the third laminating layer 156 . in block 814 , referring also to fig1 , the fourth photoresist layer 168 is etched away until the second part of the fourth photoresist layer 168 aligned with the second area 602 is totally removed . since the thickness of the third part of the fourth photoresist layer 168 aligned with the third area 603 is greater than the thickness of the second part of the fourth photoresist layer 168 aligned with the second area 602 , the third part of the fourth photoresist layer 168 aligned with the third area 603 remains unremoved when the second part of the fourth photoresist layer 168 aligned with the second area 602 is totally removed . the remaining third part of the fourth photoresist layer 168 is used as one layer of the laminating structure of the spacer 129 ( see fig2 ). it is believed that the present embodiments and their advantages will be understood from the foregoing description , and it will be apparent that various changes may be made thereto without departing from the scope of the disclosure or sacrificing all of its material advantages , the examples hereinbefore described merely being preferred or exemplary embodiments . | 6 |
fig1 schematically illustrates a blow molding machine m for containers , e . g . a stretch blow molding machine for plastic bottles . a blow molding station b comprising a non - illustrated star - shaped rotor equipped with blow molds is connected to a production line f , which extends at least section - wise through a heater h for preforms p to be treated by exposing them to radiation or in any other way by externally heating them or treating them thermally . the conveying direction of the production line f is shown by an arrow 1 . the production line f comprises a plurality of mandrel devices d located closely adjacent to each other , each with a suspended holder 2 mounted thereon and at least one fitting g 1 in the form of a preform mandrel 3 , which is exchangeably mounted on the holder 2 and which is inserted into an orifice 4 ( fig2 ) of a respective preform p . in operation , the preform mandrels 3 are , if necessary , rotated about their axes , while they are thermally pretreated . the orifice 4 of the preform p comprises , for example , an external supporting ring 5 ( fig2 ) and an external thread 6 . specifically this portion ( supporting ring 5 and at least a portion of the external thread 6 ) must be shielded during the thermal pretreatment of the preform because it already has the later shape as in the finished blown container and could become damaged by the thermal pretreatment required by the other part of the preform p . to this end , a so - called shielding plate 7 having one or two plug - in feet 9 is mounted on the holder 2 as an additional exchangeable fitting g 2 , which shields this sensitive region of the orifice 4 of the preform p with an inner bore 8 . the plug - in foot 9 is inserted with a peg - shaped or tubular end portion 11 into a plug receptacle 10 of the holder 2 , which is formed as a blind hole , where it is secured by a quick - change element s . thus , the fitting g 2 cannot be detached from the holder 2 . to be able to remove the fitting g 2 from the holder 2 , the application of an external force to the quick - change element s is necessary , for example in the direction of an arrow 12 . then ( fig3 ) the fitting g 2 , i . e . the shielding plate 7 , can be separated by means of the plug - in feet from the holder 2 ( in the direction of an arrow 13 ) and can be replaced by another fitting g 2 which , upon another application of force to the quick - change element s in the direction of arrow 12 , is inserted into the plug receptacle 10 and automatically secured by the quick - change element s . the newly inserted fitting g 2 differs , for example , by another size and design from the shielding plate 7 and the inner bore 8 thereof , whereas its end portion 11 mates the plug receptacle 10 . the end portion 11 of the plug - in foot 9 additionally includes a circumferential cavity 16 for the form - closed engagement of the quick - change element s , expediently a circumferential groove 16 , which shall be explained in more detail by means of fig4 . an exchange can be accomplished manually , by exerting the force on the quick - change element s in the direction of arrow 12 with a finger or a tool and by manually removing or inserting the fitting g 2 , or mechanically by an automatic or semiautomatic quick - change machine , which performs all or at least some of the aforementioned steps . in the embodiment shown in fig2 to 4 , the quick - change element s must be displaced by the application of an external force to allow the insertion and the removal of the fitting . alternatively , it would be possible to shape the tip of the end portion 11 designated with 15 in fig4 conically or radiused in such a way that alone by introducing the end portion 11 the quick - change element s is temporarily pushed aside until the end portion 11 is seated in the plug receptacle 10 and is secured . in the embodiment shown in fig4 , the quick - change element s comprises a press - button head 17 , which is positioned on the holder 2 to be accessible from outside . a stop face 18 on the lower side of the press - button head 17 is oriented towards a stop face 19 on the holder and towards the opening of a channel 22 , respectively , which channel 22 passes through the holder 2 in a direction transverse with respect to the plug receptacle 10 . a pin - like shaft 20 is adjacent to the press - button head 17 , the free end of which projects out of the channel 22 and carries a limit stop 26 interacting with a stop face 24 of the holder so as to prevent the quick - change element s from falling out . a collar 21 is formed on the shaft 20 , while a collar 23 is formed in the channel 22 . a spring element 25 , e . g . a helical spring , is seated between the collars 21 and 23 , which prestresses the quick - change element s in the direction towards the secured position shown in fig4 and , without the end portion 11 in the plug receptacle 10 , makes the limit stop 26 rest against the stop surface 24 . the limit stop 26 is detachable , for example , for disassembling the quick - change element s . the shaft 20 passes through a passage 27 which , in a direction perpendicular to the plane of projection in fig4 , at least has a width in correspondence with the outer diameter of the end portion 11 and which , in the direction of adjustment of the quick - change element s in channel 22 , has a dimension x which may be greater than the outer diameter of the end portion 11 . expediently , the passage 27 is an oblong hole , as is shown in fig4 by the bent lines of intersection on the periphery of the shaft 20 . in the holder 2 , a clearance 28 is recessed in the crossing area between the channel 22 and the plug receptacle 10 , into which the collar 21 of the shaft 20 can be moved when the quick - change element s is displaced against the force of the spring element 25 to abut between faces 18 , 19 . expediently , the circumferential cavity 16 in the end portion 11 is a circumferential groove having a core diameter x 2 smaller than the outer diameter x 1 of the end portion 11 . the end portion 11 forms a collar 29 at plug - in foot 9 , which delimits the insertion depth into the plug receptacle 10 . the end portion 11 and / or the quick - change element s may be cylindrical or may have any other optional cross - sectional shape . in the secured position shown in fig4 , parts of the edges of the opening of passage 27 grip behind the boundaries of the circumferential cavity 16 . this position is secured by the spring element 25 . the plug - in foot 9 cannot be unplugged . if an external force is then applied to the quick - change element s , for example in the direction of arrow 12 shown in fig3 and 4 , which overcomes the force of the spring element 25 , the quick - change element s is displaced into its release position in which , for example , faces 18 , 19 contact each other . thus , the engagement between the edges of the opening of passage 27 and the boundaries of the circumferential cavity 16 is released . the plug - in foot 9 can be drawn out of the plug receptacle 10 by means of the end portion 11 . upon inserting the new fitting , again , the securing element s is moved into the release position against the force of the spring element 25 ( if appropriate , by the wedge effect of the tip 15 ) until the end portion 11 is properly placed in the plug receptacle 10 . upon releasing the press - button head 17 ( without any manipulation of the quick - change element s ) the spring element 25 then presses the quick - change element s into the secured position shown in fig4 . fig5 schematically illustrates an automatically operable quick - change system for the fittings g 2 and shielding plates 7 , respectively , in the production line f of the blow molding machine m . a stationarily arranged automatic changer 30 is provided at the production line f , which could be moved to the production line f and , if necessary , docked to the same , for example , for a changing procedure . in another alternative , the automatic changer 30 could be integrated in a star - shaped rotor , which operates in cycles according to the change cycles of the production line and exchanges one fitting g 2 after the other or a group of fittings at once . the automatic changer 30 , which is movable to the production line , for example , in the direction of arrow 36 , comprises at least one driven actuator 32 oriented toward the respective securing element s and applying the force to allow the removal or insertion of the fitting g 2 in the direction of the double arrow 13 , 14 . the removal and insertion , respectively , is accomplished by correspondingly controlled grippers 31 , 32 , 33 . moreover , the automatic changer 30 is provided with at least one magazine 35 , 34 , expediently a magazine 34 for removed fittings g 2 and a magazine 35 for fittings g 2 to be inserted . although the automatic changer shown in fig5 is only explained and illustrated in connection with the exchange of the fittings g 2 in the form of shielding plates 7 , it could in an alternative embodiment simultaneously also perform the exchange of other fittings , e . g . of the preform mandrels 3 . the respective automatic changer 30 could act as a semiautomatic machine , which means that one or the other manipulation is carried out by the automatic changer and / or an operator . | 1 |
as described above , the mobile station may be used in a wireless embodiment which is shows schematically in fig1 . a cellular phone providing voice service could constitute such a station . a plurality of cells c 1 to c 12 are serviced by respective base station bs 1 to bs 12 . when the mobile station is in cell c 1 , it may be camped on to the control channel from base station bs 1 . the control channel bs 1 will transmit a list of neighboring control channels . the list will include control channels associated with base station bs 2 , base station bs 5 and base stations that service other cells adjacent to cell c 1 furthermore , the list of neighboring channels may include a list of control channels that are related to fax services or data services . in addition , the list may include a control channel associated with a private system such as that shown in cell c 1 . typically such a private system is overlaid by the public system so that the area covered by the private system is covered by both the public and private system , but access to the private system itself , for example , a wireless pbx on a party &# 39 ; s premises , is not permissible except by members of that private system . when the mobile station receives the neighbor list from the control channel on which it is camped , it stores that neighbor list in memory . the mobile station may be a cellular phone which complies with the is - 136 standards . such a mobile communications device 400 as illustrated if fig4 includes processing capabilities 410 and memory , both read only ( rom ) 420 and random access memory ( ram ) 430 . the rom 420 stores control programs for operating the device while the ram 430 stores dynamic information which can be updated over time , such as the neighbor list transmitted from a control channel on which the station is camped . in its memory the mobile station 400 would track the identification of the control channels included in the list . furthermore , in compliance with the is - 136 standard , the neighbor list would also provide certain parameter information which relates to the characteristics of the control channel . for example , the parameter information would indicate whether a control channel is associated with a private , a public , or a semi - private system . the identification of the particular system to which the control channel is associated would not necessarily be presented in the neighbor list . instead only the type of system to which the control channel is associated would be supplied . similarly , the parameter information could indicate whether the control channel is designed to provide voice service , data service , or fax service . other parameter information which defines the characteristics of the control channel could also be supplied with a neighbor list , ( e . g ., cell type , protocol version , cell sync , etc .). an example of a correlation of the information presented by the control channel , in which the mobile station is camped , is shown in fig2 . in this tabular representation of the data which might be stored in the mobile station , a first control channel in the list has an id of “ xxxxx ”. the parameter information indicates that this control channel is associated with a private system and provides voice services . the control channel identified by “ yyyyy ” is by contrast associated with the public system while still providing voice services . the control channel “ zzzzz ” is also associated with the public system , but provides fax services . similar information would be provided for each control channel identified in the neighbor list provided by the control channel on which the mobile station is camped . this parameter information can then be used to modify or control the process by which an alternative control channel can be selected . a flow chart illustrating the process for controlling re - selection using the received neighbor list is illustrated in fig3 . in step 300 , the mobile station 400 receives the neighbor list from the control channel on which it is presently camped . in step 301 , the mobile station 400 processor 420 scans the neighbor list in accordance with a stored control program and examines the entries in the list to determine whether any of the control channels ( the candidate control channels ) are ineligible because of a lack of compatibility between the mobile station and the control station . as an example , incompatibility could arise where the mobile station 400 does not have access to any private network or system . the mobile station memory 420 , 430 would store system ids for those systems with which the mobile station is allowed to communicate . it could also store a flag indicating whether the mobile station has access to any private system . under those circumstances where there is access to private systems , any control channel which is related to a private system is incompatible with the mobile station . similarly , if the mobile station seeks voice services , then any control channel associated with fax or data services would be incompatible with the mobile station . once a candidate control channel is detected or recognized to be ineligible in step 302 , then each of those ineligible control channels is marked as ineligible in the neighbor list . in particular , the processor in the mobile station modifies the neighbor list to somehow mark a control channel as ineligible . one way of doing this is to include an eligibility flag in the neighbor list . all control channels in the neighbor list would initially haste their eligibility flags set as indicated an eligible control channel . then , when a control channel is marked as ineligible the flag would be reset to an ineligible state . alternatively , it is possible that other steps could be taken to effectively remove the ineligible control channels from subsequent consideration in the re - selection process . in step 304 , a process , known in the prior art , is initiated for studying or analyzing candidate channels to try to select the optimal candidate channel for re - selection . this process is referred to in fig3 , as “ analyzing candidate control channels .” that step of analysis is limited to only those control channels which are deemed to be eligible . that is , if the eligibility status reflected in the neighbor list in step 303 indicated that a control channel is ineligible , then that control channel mill not be included in the analysis operation beyond that point . it will , in essence , be ignored and will not figure in the calculations of determining the best candidate control channel for the re - selection process . in the analysis operation , each of the eligible control channels will be tested for certain criteria such as rf level . once each of the eligible control channels is tested a primary candidate channel is selected ( step 305 ) as the processor identifies which of the eligible control channels is the best candidate for re - selection based on the test results obtained during the analysis of step 304 . this may arise under the circumstance where the processor will run tests on each of the eligible control channels . as an example a result of the tests on such things as the rf level in step 305 the processor may determine that one or more of the candidate control channel satisfy certain criteria to be selectable by the mobile station . then , in step 305 the processor could go through this subset of selectable candidate control channels and select the optimal or primary candidate control channel based on the parameters associated with that control channel . thus , a primary candidate channel could be as in step 305 . once such a primary candidate channel is identified , the mobile station attempts to re - select to the primary candidate channel in step 306 . if the re - selection attempt is successful as detected in step 307 , then the mobile station camps onto the primary candidate channel in step 308 and receives a new neighbor list from the primary candidate control channel identifying neighbors associated with that control channel . if , however , the attempt to re - select is unsuccessful , then the processor can make a determination as to why the re - selection attempt failed . if the failure is due to a mismatch of certain predetermined criteria as referred to in step 309 , then the channel identified as the primary candidate control channel could then be treated as an ineligible candidate channel . the eligibility status within the neighbor list would be modified to reflect this change of status and the processor could then resume the re - selection process from step 304 , where the processor could begin again the analysis of the candidate control channels focusing only on those which remain as eligible control channels . the system will then select another primary candidate and attempt to reselect to that second primary candidate channel . this process will continue until the mobile station camps onto an alternative control channel . as has been described above , a candidate channel could be ineligible because the control channel is associated with a private system , whereas the mobile station is not affiliated with any private system . furthermore , a control channel may be deemed ineligible because of the tyke of service that it provides and the lack of compatibility between that service and the service of the mobile station . the predetermined criteria referred to in connection with step 309 can be any condition that causes the failure of a reselect attempt . typically one such event would be where the primary candidate channel is associated with a private system and the mobile station is also associated with a private system . in that circumstance , then , the primary candidate channel would not then be marked ineligible in step 303 . then , during the reselect attempt the private system identifier associated with the primary candidate channel would be provided to the mobile station . if the mobile station private system identifier stored in memory does not match the private system id received from the primary candidate channel during the attempt to re - select , then the mobile station will not get access to the private system associated with that primary , candidate channel . therefore , there is an incompatibility between the mobile station and the system associated with that primary candidate channel . in view of this incompatibility , it is consistent with the exemplary embodiment to now mark this primary control channel as ineligible as in step 310 . then if it is necessary to analyze the neighbor list again ( step 304 ) to find a candidate channel for re - selection , the newly designated ineligible control channel will not be analyzed . in accordance with the alternative embodiments , other parameter information associated with a control channel could be used to determine whether the control channel is eligible for re - selection by this particular mobile station . furthermore , modifications to the process of fig3 are also possible . for instance , in one variation steps 301 , 302 and 303 would be eliminated , that is the processor would not do any preliminary examination of the neighbor list to determine if any candidate channels are ineligible . instead , the system would simply rely on marking primary candidate channels as ineligible for subsequent re - selection attempts . alternatively , the control method of an exemplary embodiment could rely simply on the ineligibility determination made at the beginning of the analysis process and not dynamically evaluate ineligibility based on whether an attempt to reselect a particular candidate channel was successful . thus steps 309 and 310 could be eliminated and benefits would still be obtained from the remaining process . since an exemplary embodiment includes a method by which the mobile station selects an appropriate re - selection candidate and since it is implemented using software running on a processor within the mobile station , it must be recognized that variations on the order in which certain steps are performed and the specific techniques or parameters involved in the process could be modified while still falling within the spirit of the disclosure . for example , it is conceivable that in one variation the station microprocessor could scan the entire list of neighbors and adjust the eligibility status where appropriate for all ineligible control channels before proceeding with the analysis of the eligible control channels . in an alternative embodiment , the first time through the neighbor list the processor could first determine whether a given control channel is eligible and then , if it is eligible , perform the analysis with respect to that control channel . then the microprocessor would turn to the next control channel on the list , determine whether it should be considered eligible and if so conduct the evaluation with respect to that control channel and so on . in this second configuration , the processor does not scan the entire list before beginning the evaluation process . instead , in combines the marking and evaluation steps . other modifications might include other techniques for marking a control channel as ineligible . in yet another embodiment it is conceivable that the mobile station could select for analysis a subset of the control channels form the neighbor list ; the subset being based on any one or combination of parameters . in accordance with an exemplary embodiment , a mobile station can more optimally control the process by which it selects alternative control channels . it provides the mobile station with a way to focus only on those candidate control channels with which the mobile station can effectively communicate . | 7 |
before explaining the disclosed embodiments of the present invention in detail it is to be understood that the invention is not limited in its application to the details of the particular arrangements shown since the invention is capable of other embodiments . also , the terminology used herein is for the purpose of description and not of limitation . “ seating device ” is used interchangeably with “ tripod stool ” and “ chair ” herein . however , it is readily apparent that the novel device is much more than a stool or chair and much more than a seating device , because it is multifunctional , including , but not limited to a seat , a cane , a protective covering from sun , rain , snow and the like . it can also provide relief from aching feet , legs and back muscles . in fig1 , the fully assembled seating device is shown with the umbrella 10 open and in a raised position . the shaft 15 supporting the umbrella 10 comprises a telescoping umbrella pole 11 , fitted with a socket - like connection 12 that receives the lower most portion of the umbrella pole 11 and the upper most end of a flexible tubing piece 14 . the gooseneck flexible tubing 14 is preferably 304 stainless steel tubing approximately 1 inch in diameter and available from a supplier of flexible metallic tubing , such as , armor associates , inc . in malvern , pa . the umbrella 10 and telescoping umbrella pole 11 are commercially available from any establishments selling umbrellas , such as sharper image or brookstone &# 39 ; s ( in usa ); it is preferable to use an umbrella that opens automatically and has a gust proof canopy construction . the umbrella canopy can be of any color , including the camouflage design and camouflage color used in military and outdoor activities such as hunting , bird - watching and the like . the socket - like connection 12 that receives the umbrella pole 11 on the upper end and the gooseneck flexible tubing piece 14 on the lower end can be formed of any rigid , break - resistant material , including , but not limited to , fiberglass , polyvinyl chloride , aluminum , titanium or other metal or even wood . the umbrella pole 11 and gooseneck flexible tubing 14 are secured in the socket - like connection 12 with glue , screws or other means to connect all segments of shaft 15 , so that there are no loose parts . referring again to fig1 , the remainder of the novel seating device includes a cane handle 16 , covered by a rubber gripping surface 17 with a plastic end cap 19 . the end cap 19 covers and provides an aesthetic appearance to the end of the tubular handle 16 on leg 22 . a yoke 18 forms an integral part of the lower most end of the gooseneck flexible tubing 14 and is secured by a clamping mechanism to cane handle 16 . the yoke 18 controls the overall position of shaft 15 , including the raising and lowering of the shaft and umbrella in a direction that is approximately 180 degrees to the left of the seat 20 and approximately 180 degrees to the right of seat portion 20 . the yoke 18 can rotate 360 degrees around handle 16 . thus , yoke 18 can rotate in two ways ; first , by loosening it from wherever it is attached or clamped and second , by rotating the handle as shown in fig1 a as discussed in greater detail below . details of the yoke 18 are also shown in fig1 to 23 and further discussed below . it is readily apparent that the yoke 18 with the unique clamping and rotating mechanism can be attached or clamped to any structure or chair wherein it can be clamped about a portion of the structure or chair , such as , but not limited to , a wheelchair , an electric cart and the like . the yoke 18 with umbrella 10 attached to a flexible and bendable gooseneck tubular segment or rod can provide hands - free , portable , adjustable shade and protection . the cane handle 16 is the uppermost end of a supporting leg 22 hinged to seat 20 , which is also hinged to additional supporting legs 24 and 26 . the cane handle 16 is preferably covered with a rubber grip 17 designed ergonomically for comfort and convenience when the seating device is in the collapsed position and used as a walking support . referring now to seat 20 , the shape can have any comfortable configuration with rounded edges , such as the substantially circular shape of a stool seat . the seat 20 can be made of any solid , break - resistant material , such as wood , metal or plastic , preferably a strong , lightweight material such as lightweight injection molded plastic . fig1 to 6 , 9 to 11 , 24 and 25 show the seat 20 with the optional removal seat cushion attached to the solid seat surface . turning now to the plurality of leg assemblies 22 , 24 , and 26 , these can be formed of hollow support tubes , or alternatively , formed of solid shafts or other suitable configuration , with the lower most end portion having an adjustable feature that is known in the art , and disclosed in u . s . pat . nos . 6 , 135 , 557 and 6 , 467 , 843 b1 , and incorporated herein by reference . the major requirement of the leg supports is that they be attached to communicating hinges or couplings on the seat 20 allowing the seat to fold in a flat vertical position when the seating device is collapsed . for some applications , hollow support tubes made of a lightweight and strong material , such as aluminum may be preferable to minimize the weight of the seating device . the diameter of the leg tubes and the tube wall thickness is preferably selected based on an expected support weight capability . it is desirable to obtain the maximum strength for a minimum tube wall thickness . in one embodiment , the hollow aluminum leg cylinders are approximately 1 inch in diameter and can support the weight of a person weighing approximately 325 pounds . a bottom end of each lower leg 22 , 24 , 26 includes a rubber cover 70 attached thereto . fig2 is a front view of the fully assembled seating device showing how the raised and opened umbrella 10 can be repositioned from left 10 a to right 10 b with reference to handle 16 because of the flexible metallic tubing 14 . additionally , the front view of the tripod leg assemblies shows one leg 22 with handle 16 is a long straight cylindrical leg while legs 24 and 26 are bent into a k shape and positioned as mirror images of each other using the straight cylindrical leg 22 and the vertical part of the k . each k - shaped supporting leg 24 and 26 has a compressed uppermost end attached to hinges or coupling means under the seat 20 . the waist 25 of each k - shaped leg 24 , 26 is pivotally attached to the long straight cylindrical leg 22 . the pivot joint is connected by threaded or riveted members to provide stability of the legs and prevent mobilization of the legs with respect to one another . the feet of the leg assemblies are angled radially outward from the waist connection 25 to maximize ground surface contact and further stabilize the seating device of the present invention . fig3 is a side view of the fully assembled seating device showing how the umbrella 10 can be repositioned from front 10 d to back 10 e because of the flexible metal tubing 14 , attached by yoke 18 to the uppermost portion of the long , straight cylindrical leg 22 . the long straight cylindrical leg 22 is attached to the seat 20 by a sleeved hinge 30 that allows the seat 20 to drop to a flat vertical position when the seating device is collapsed . fig4 is another perspective view of the seating device with the umbrella 10 raised and the umbrella canopy closed and secured with fasteners 41 and 42 . the fasteners used to secure the umbrella canopy or the umbrella attachment to the seating device when collapsed , can be made of material selected from the group consisting of nylon , string , leather , material with snaps , hooks and eyes and the like ; the preferred fastening means is a hook and loop fastener , such as velcro ®, a nylon fabric that can be fastened to itself . fig5 is a front view of fig4 showing the position of yoke 18 on handle 16 and the ergonomically curved handle at the upper most end of the long straight cylindrical leg 22 . also shown are the communicating hinges or couplings 50 and 52 that attach the k - shaped legs 24 and 26 respectively , to the bottom of seat 20 . fig6 provides a side view of fig5 with umbrella 10 flexed slightly forward by the flexible tubular connection 14 . also shown is the sleeve - like hinge 30 on leg 22 that is connected to seat 20 . fig7 shows the seating device being used as a chair by a person 500 who grasps the socket - like connection 12 to move the flexible tubular connection 14 and thereby position the umbrella 10 as desired . there are unlimited adjustments and positions that can be assumed with the novel arrangement of the umbrella shaft 15 for the present invention . fig6 shows person 500 with the umbrella closed and secured with fasteners 41 and 42 . the person can straddle the seat with the leg 22 between their legs . fig9 is a side view of the seating device with the umbrella 10 closed , secured with fasteners 41 , 42 and flexed slightly forward with the flexible tubular connection 14 . fasteners 41 and 42 are sewn into the seams of the umbrella 10 . the seat 20 is positioned to receive an occupant and a fastener strap 90 fits as a sleeve over the straight cylindrical leg 22 and extends downward . optionally , fastener 42 could be elongated and serve as a dual fastener for closed umbrella 10 and for securing the closed umbrella 10 to the straight cylindrical leg 22 . fig1 shows the seating device beginning to fold . the communicating hinges 50 ( not shown ), 52 under the bottom of the seat 20 are releasing in the direction of arrow a and urging the hinge or coupling 30 to move upward in the direction of arrow b , while supporting k - shaped legs 24 ( not shown ) and 26 move to a parallel position with leg 22 in the direction of arrow c . fig1 is a side view of the fully collapsed seating device with the closed umbrella 10 parallel to the seat 20 and leg assemblies 22 , 24 , 26 and fastener 90 is securing the closed umbrella 10 to the straight cylindrical leg 22 . fig1 – 15 provide the following views of the completely folded and collapsed seating device . fig1 is a view of folded , collapsed seating device when a user is holding the cane in the left hand for walking or hiking . fig1 is a side view of fig1 . fig1 is a view of the folded , collapsed seating device being held in the right hand of a user employing the device as a cane . fig1 is a plan view of the collapsed device showing how compact and portable it can be , without any loose parts . referring now to fig1 to 23 , the primary focus is on the clever and unusual yoke 18 that secures the umbrella 10 and shaft 15 to cane handle 16 , including an alternate embodiment for the umbrella shaft . in fig1 , the bottom of seat 20 shows the communicating hinges 50 and 52 and the placement of a u - shaped clip 54 to hold the long straight cylindrical leg 22 in the collapsed position . the location of yoke 18 on handle 16 is also shown . fig1 a shows a knob 110 that is spring loaded ( see 111 fig2 ) and used to tighten the gripping parts 112 and 114 to handle 16 . also molded into this yoke 18 is a socket 116 to hold the lower most end of the umbrella shaft 15 . the socket 116 is connected to a rotating mechanism with a button release 118 . another button 120 is used to release the handle 16 so that the yoke mechanism can rotate 360 degrees in the direction of arrow f . fig1 illustrates the rotation of yoke 18 and the attached umbrella 10 to a position that is perpendicular to handle 16 . fig1 shows the rotation of yoke 18 and the attached umbrella 10 to a position that is parallel with the straight cylindrical leg 22 in a fully collapsed position . fig1 , 17 and 18 show that by pressing a spring biased button or nipple 120 located at the upper most end of leg 22 and protruding through an engaging cavity on cane handle 16 , it allows handle 16 to rotate yoke 18 a total of approximately 180 degrees from the raised position in fig1 to the collapsed position in fig1 . thus , by depressing button 120 , the handle 16 which is an outer cylinder , covered by a rubber gripping surface 17 , is released and free to rotate 360 degrees around the inner , upper most tubular end of the straight cylindrical leg 22 . another embodiment of the yoke clamp is shown in fig2 to 23 show a fixed handle that allows the yoke clamp 18 to do the work of raising and lowering the umbrella . fig1 shows the function of button 118 , which is attached to socket 116 that receives the lower most end 120 of the flexible metal tubing 14 . when button 118 is pressed inward , it releases a locking mechanism that holds the umbrella shaft in a given position . thus , when button 118 is engaged , the yoke and attached umbrella can be rotated 180 degrees to the left in the direction of arrow g or 180 degrees to the right in the direction of arrow h . umbrella rotation can be stopped at any position along the 180 degree rotation arc because of there are notches in increments . and fig2 shows how yoke 18 is clamped to handle 16 . when knob 110 is turned in a tightening direction according to arrow j , the clamping jaws 112 and 114 are moved in the direction of arrow k . rotating knob 110 clockwise can move gripping part 112 and 114 against one another compressing spring 111 there between . rotating knob 110 counterclockwise reverses the operation and loosens the clamp portion 112 , 114 and allows rotation about or around handle 16 . fig2 to 23 show an alternate embodiment of the yoke 18 wherein the rotating mechanism controlled by button 118 ( shown in fig1 and 20 ) is replaced by a stationary female socket - like connection 216 with cavities 211 and 215 . the female socket - like connection can receive a male connection 218 attached to the lower most end of the flexible metal tubing 14 on the umbrella shaft 15 ( not shown ). a nipple 217 on male connection 218 can be a spring - biased protrusion that can be retracted under pressure and permitted to protrude and snap into a cavity such as , 211 and 215 when pressure is released . fig2 shows male connection 218 with nipple 217 snapped into female socket - like connection 216 at cavity 211 to position the umbrella shaft 15 ( not shown ) in an upward vertical position . fig2 shows male connection 218 with nipple 21 snapped into female socket - like connection 216 at cavity 215 to position the umbrella shaft 15 ( not shown ) in a downward vertical position . fig2 is a perspective view of the collapsed seating device of the present invention highlighting the position of the telescoping section 300 of the lower most end of the leg assemblies 22 , 24 , 26 . fig2 a shows an outer hollow tubular section held by an upper band 72 with an opposing rubber end cap 70 . the outer tubular section having a series of cavities or openings 75 is positioned over a slightly smaller hollow tubular section having a spring - biased nipple 74 that is retracted under pressure and allowed to protrude and snap into the cavity or opening 75 thereby extending or shortening the length of each leg in increments , as desired in the direction of arrow m . the telescoping function of each leg is not a limitation of the present invention and can be accomplished by a variety of means , such as disclosed in u . s . pat . nos . 6 , 135 , 557 and 6 , 467 , 843 b1 and incorporated herein by reference the overall vertical dimensions of the legs of the seating device are approximately 18 inches in height from a ground surface to the bottom of the seat 20 when fully retracted . the k - shaped legs are also approximately 18 inches in height from a ground surface to the bottom of the seat 20 when fully retracted . the incremental telescoping adjustments can be used to increase the length of each leg from approximately 1 inch up to approximately 6 inches in 1 inch increments for a total overall increase of 6 inches in height above a ground surface to the bottom of the seat 20 . thus , as can be recognized , any reasonable seating height can be selected , if desired , the seating height can be quite low to the ground , e . g ., for a child &# 39 ; s chair , or alternatively , a larger seating height can be provided for a tall person &# 39 ; s chair . in the preferred embodiment of the present invention , the telescoping legs are comprised of aluminum , due to its superior weight / strength characteristics , ease of fabrication and formation of the final product , and high resistance to atmospheric corrosion . aluminum requires no protective coating to prevent corrosion , thereby providing a long lasting seating device especially suited for outdoor use . fig2 depicts a person 500 using the left hand to grip handle 16 with the seat 20 facing away from the body and the seating device being used as a walking support or cane . it is appreciated that the seating device of the present invention has no loose parts . there is nothing to leave behind , nothing to unscrew , nothing to lose or forget . the seating device is of lightweight construction and weighs approximately six pounds , including the detachable cushion for the seat 20 , making it ideal for recreational activities such as , camping , hunting , fishing , spectator sports , including baseball , golf tournaments , parades and waiting in line at amusement parks . indoors and outdoors it can be used as a cane or footrest . further , the ease of set - up and collapsible folding provides a comfortable , durable , portable seating device . while the invention has been described , disclosed , illustrated and shown in various terms of certain embodiments or modifications which it has presumed in practice , the scope of the invention is not intended to be , nor should it be deemed to be , limited thereby and such other modifications or embodiments as may be suggested by the teachings herein are particularly reserved especially as they fall within the breadth and scope of the claims here appended . | 0 |
in the following , embodiments of the present invention will be described . in the following embodiments , descriptions will be made with reference to an image stabilization apparatus equipped in a binocular . however , it should be understood that the present invention may also be applied to other optical apparatus . for example , the invention may be applied to a monocular apparatus such as a telescope etc . first , a description will be made of a binocular equipped with an image stabilization apparatus as a first embodiment of the present invention . referring to fig1 and fig2 a , the binocular equipped with an image stabilization apparatus according to the embodiment has a binocular optical system 10 , a housing 1 accommodating the binocular optical system , and an image stabilization apparatus 100 . the image stabilization apparatus 100 is adapted to detect vibration generated during use of the binocular , such as vibration applied to the housing 1 due to hand shake , and to suppress such vibration . as shown in fig1 , the binocular optical system 10 includes an objective optical system 11 , an eyepiece optical system 13 , an intermediate optical system 12 disposed between the objective optical system 11 and the eyepiece optical system 13 . as illustrated in fig1 and 3 , the objective optical system 11 includes objective lenses 11 r and 11 l . as shown in fig1 and 5 , the eyepiece optical system 13 includes eyepiece barrels 101 r and 101 l and eyepiece lenses 13 r and 13 l . the intermediate optical system 12 functions to direct a light flux from the objective optical system 11 to the eyepiece optical system 13 . the intermediate optical system 12 is provided for performing , when vibration occurs in the binocular , optical compensation to prevent an object from disappearing out of the field of view . in this embodiment , the intermediate optical system 12 includes erecting prisms 12 r and 12 l . the image stabilization apparatus 100 has a gimbal mechanism 110 . the gimbal mechanism 110 includes an outer gimbaled member 111 having a rotation axis parallel to x - axis and an inner gimbaled member 112 having a rotation axis parallel to y - axis . the inner gimbaled member 112 is supported by rotation shaft 112 a in such a way as to be rotatable relative to the outer gimbaled member 111 . the outer gimbaled member 111 is supported by rotation shaft 111 a in such a way as to be rotatable relative to the housing 1 . the inner gimbaled member 112 holds the erecting prisms 12 r and 12 l between two plate members 112 b and 112 c . the plate members 112 b and 112 c have openings 112 d and 112 e respectively at the positions of the left and right optical paths . with the above - described structure , when vibration or panning / tilting of the housing 1 occurs , the gimbaled members 111 and 112 are rotated relative to the housing respectively by inertial force so that the direction of the optical axes of the erecting prisms 12 r and 12 l would be kept unchanged with respect to the inertial system ( i . e . with respect to the earth ). on the outer gimbaled member 111 , there is mounted an angular velocity detector 121 for detecting the angular velocity ωx of the rotational movement about the rotation axis 111 a parallel to x - axis . on the inner gimbaled member 112 , there is mounted an angular velocity detector 122 for detecting the angular velocity ωy of the rotational movement about the rotation axis 112 a parallel to y - axis . each of the angular velocity detectors 121 and 122 may be composed , for example , of a piezoelectric vibration gyro sensor . in addition , an angular displacement detector 141 for detecting an angular displacement amount ( i . e . a change in the angular position ) θx caused by the rotation is attached to the rotation shaft 111 a for rotation about the axis parallel to x - axis . furthermore , an actuator 131 for rotationally driving the rotation shaft 111 a that has been rotationally displaced in the rotational direction for returning the rotation axis 111 a is also attached to the rotation shaft 111 a . similarly , to the rotation axis 112 a for rotation about the axis parallel to y - axis , there is attached an angular displacement detector 142 for detecting an angular displacement amount θy caused by the rotation and an actuator 132 for rotationally driving the rotation shaft 112 a that has been rotationally displaced in the rotational direction for returning the rotation axis 112 a . thus , the angular displacement of the rotation of the outer and inner gimbaled members 111 and 112 about axes parallel to x - axis and y - axis can be detected based on outputs of the angular displacement detectors 141 and 142 . the directions of rotational drive by the actuators 131 and 132 are such directions with which the optical axis of the erecting prism 12 r and 12 l mounted on the gimbaled member 111 and 112 that have been rotated by inertial force would be restored to the original position ( i . e . the optical axis of the objective optical system 11 ). each of the actuators 131 and 132 may include , for example , a servo mechanism . each of the angular displacement detectors 141 and 142 may include a rotary encoder . as shown in fig4 , the image stabilization apparatus 100 is further provided with a button 251 for turning on / off the vibration reduction function disposed on the top surface of the housing 1 , a sound generator 254 and a battery box 108 . in addition , as shown in fig5 , the image stabilization apparatus 100 is provided with a switch 107 for switching a navigation display disposed on the front surface of the housing 1 and a mode setting dial 105 . furthermore , referring to fig6 , the image stabilization apparatus 100 has a cpu ( central processing unit ) 601 , an amplifier section 602 , an a / d converter 603 , a reference value storing section 604 , a d / a converter 605 and a calculator section 606 . the control system as described above is accommodated in the interior of the housing 1 . the image stabilization apparatus 100 is further provided with a display within the field of view 201 disposed within the field of view of either one of the eyepiece lenses 13 r and 13 l . in addition , a display 109 and a focus knob 106 are also provided on the front side surface of the housing 1 . the mode setting dial 105 is a dial type switch used for selecting the vibration reduction mode of the image stabilization apparatus 100 . the apparatus according to this embodiment has two vibration reduction modes ( mode vr 1 and mode vr 2 ) and an automatic mode for switching the mode vr 1 and the mode vr 2 automatically . while the apparatus according to this embodiment is described to have two modes vr 1 and vr 2 by way of example , the apparatus may be adapted to have more than two modes to be switched . the mode vr 1 is a mode that is suitable for stabilizing the image at the occasion of performing observation on a steady ground or observation which involves frequent panning and tilting operations ( e . g . at the time of bird watching ). on the other hand , the mode vr 2 is a mode suitable for stabilizing the image at the occasion of performing observation on a swinging or wavering board of a conveyance ( e . g . a ship , a vehicle , an airplane or a helicopter etc .). the mode setting dial 105 has five positions to be switched , that is , “ power - off ” position 1051 , “ power - on ( vr auto : auto vibration reduction )” position 1052 , “ vr 1 ” position 1053 , “ vr 2 ” position 1054 and “ shift ” position 1055 . when the mode setting dial 105 is set to the “ power - off ” position 1051 , power supply from the battery box 108 to each section of the image stabilization apparatus 100 is turned off and disabled , so that the gimbal mechanism 110 is placed into a locked state in which the gimbal mechanism 110 is maintained at the position of the center of the optical axis without angular displacement . under this state , the binocular behaves as an ordinary binocular that is not provided with a vibration reduction function . when the mode setting dial 105 is set to the “ power - on ( vr auto )” position 1052 , the image stabilization apparatus 100 is turned on , and the vibration reduction mode is set to the automatic switching mode . when the mode setting dial 105 is set to the “ vr 1 ” position 1053 or the “ vr 2 ” position 1054 , the vibration reduction mode is set to the vibration reduction mode vr 1 or vr 2 respectively . the operation under the dial setting to the “ shift ” position 1055 will be described later . in the following , functions characterizing the present invention will be specifically described . as shown in fig1 , the display within the field of view 201 is composed , for example , of an led or other elements , and it is disposed in the field of view 200 of either one of the eyepiece lenses 13 r and 13 l . under the state in which a vibration reduction mode is selected by setting of the mode setting dial 105 to the “ vr 1 ” position 1053 or the “ vr 2 ” position , if it is determined , based on the level or degree of the external vibration actually applied to the housing 1 , that the selected mode is not the optimal mode , the display in the field of view 201 indicates with red light . this prompts the user to change the mode selected by the mode setting dial 105 to another mode . such a prompting function for changing the mode is referred to in this embodiment as a vibration reduction mode navigation function . referring to fig9 , a navigation display changing switch 107 has multiple positions to be switched , namely , a “ navi - off ” position 901 , an eye - mark position 902 and an ear - mark position 903 . when the navigation display changing switch 107 is set to the eye - mark position 902 , the prompt for changing the vibration reduction mode is performed by means of the display within the field of view 201 . on the other hand , when the navigation display changing switch 107 is set to the ear - mark position 903 , the indication by the display within the field of view 201 is not performed , but prompt for changing the vibration reduction mode is performed by beep sound or voice sound for prompting mode change generated by the sound generator 254 . when the beep sound is used , its sound duration time or its frequency may be modulated in accordance with the vibration reduction mode . when the navigation display changing switch is set to the “ navi off ” position 901 , the vibration reduction mode navigation function is disabled . the vibration reduction on / off button 251 is enabled when the mode setting dial 105 is set to either one of the “ power - on ( vr auto )” position 1052 , the “ vr 1 ” position 1053 , the “ vr 2 ” position 1054 or the “ shift ” position 1055 . when the mode setting dial 105 is set to either one of the “ power - on ( vr auto )” position 1052 , the “ vr 1 ” position 1053 or the “ vr 2 ” position 1054 , the state in which the vibration reduction mode is disabled and the state in which the vibration reduction mode is enabled are alternately switched by manipulation of the vibration reduction on / off button . under the state in which the vibration reduction mode is disabled , the gimbal mechanism 110 is placed in the locked state in which the gimbal mechanism is positioned at the original position without angular displacement . under the state in which the vibration reduction mode is enabled , the vibration reduction mode corresponding to the setting of the mode setting dial 105 ( i . e . either one of the auto switching mode , the vr 1 mode or the vr 2 mode ) is enabled . therefore , during observation under the vibration reduction mode ( i . e . either one of the auto switching mode , the vr 1 mode or the vr 2 mode ), the vibration reduction on / off button is useful for the user , when the user wants to disable the vibration reduction mode to lock the gimbal mechanism instantaneously for power saving or other reasons . on the other hand , when the mode setting dial 105 is set to the “ shift ” position 1055 , the vibration reduction mode is alternately switched between vr 1 and vr 2 by manipulation of the vibration reduction on / off button 251 . therefore , during observation under the mode vr 2 , the mode setting dial 105 may be set to the “ shift ” position in preparation for panning and tilting operation for following up an object such as a bird or an airplane that may possibly comes within the field of view , so that the vibration reduction mode can be changed to the mode vr 2 by manipulating ( or pressing ) the vibration reduction of / off button 251 . in connection with this , when the mode setting dial 105 is set to the “ shift ” position 1055 , the automatic vibration reduction mode change and the information by the display within the field of view 201 will not be enabled . the above - described navigation function is so adapted to prompt the user to change the vibration reduction mode selected by the mode setting dial 105 into another mode . however , it may be modified to inform the user of the optimal mode determined by the external vibration level actually applied to the housing 1 . if the function is so modified , the user can know the optimal mode determined by the apparatus , and therefore the user can be aware of the difference between the optimal mode and the mode selected by the user . in addition , if the mode selected by the user is also displayed together with the optimal mode determined by the apparatus , the user can recognize the difference in the modes easily . next , in the following , control operations by the cpu 601 of the image stabilization apparatus will be described . the cpu 601 reads a program stored in the reference value storing section 604 upon turning - on of the power supply and executes the program to operate in the manner described in the flow chart presented in fig8 . first , in step 801 , the cpu 601 receives , via the a / d converter 603 , signals vωx and vωy that have been obtained by amplifying angular velocity ωx and ωy detected by the angular velocity detector 121 and 122 by a predetermined gain in the amplifier section 602 . in addition , the cpu 601 also receives via the a / d converter 603 , signals vθx and vθy that have been obtained by amplifying angular displacement amounts θx and θy detected by the angular displacement detectors 141 and 142 by a predetermined gain by the amplifier section 602 . next in step 802 , the cpu 601 compares the received angular velocity signals vωx and vωy with reference angular velocity values ± vc 1 stored in the reference value storing section 604 in advance respectively . in addition , the cpu 601 compares the received angular displacement amount signals vθx and vθy with reference angular displacement values ± vc 2 stored in the reference value storing section 604 in advance respectively . based on the above - mentioned comparison , the cpu 601 determines whether the optimal mode is the mode vr 1 or the mode vr 2 . in the apparatus according to this embodiment , the angular velocity signals vωx and vωy are used as information for detecting vibration caused by conveyance . specifically , as will be seen from fig1 a , if at least one of the angular velocity signals vωx and vωy becomes larger than + vc 1 or smaller than − vc 1 , it is determined that the user is on a conveyance and so the mode vr 2 is appropriate . in addition , in order not to mistakenly interpret angular velocity signals vωx and vωy corresponding to an user &# 39 ; s unintentional action as those corresponding to vibration of a conveyance , a sampling time ts is set in the apparatus according to this embodiment as shown in fig1 a . if the state in which at least one of the angular velocity signals vωx and vωy becomes larger than + vc 1 or smaller than − vc 1 occurs more than once during the sampling time ts , it is determined that the optimal mode is the mode vr 2 . on the other hand , the angular displacement amount signals vθx and vθy are used as information for detecting panning and tilting operations . specifically , as will be seen from fig1 b , if at least one of the angular displacement amount signals vθx and vθy becomes larger than + vc 2 or smaller than − vc 2 , it is determined that the user is performing a panning or tilting operation and so the mode vr 1 is appropriate . as in the case of the angular velocity signals , in order to prevent erroneous interpretation of output corresponding to an user &# 39 ; s unintentional action , if the state in which at least one of the angular displacement amount signals vθx and vθy becomes larger than + vc 1 or smaller than − vc 2 occurs more than once during the sampling time ts , it is determined that the optimal mode is the mode vr 1 . in the case in which the determination of the optimal mode conflicts between vr 1 and vr 2 ( for example , when a user on a conveyance is performing panning or tilting operation ), in other words , in the case in which at least one of vωx and vωy becomes larger than + vc 1 or smaller than − vc 1 more than once within the sampling time ts and at least one of vθx and vθy becomes larger than + vc 2 or smaller than − vc 2 more than once within the sampling time ts , it is determined in the apparatus according to this embodiment that the mode vr 1 for panning / tilting is the optimal mode . the above - described criteria in step 802 are summarized as follows : ( 1 ) when during the sampling time ts , both vωx and vωy are within the range larger than − vc 1 and smaller than + vc 1 ( or deviate from this range only once ) and at least one of vθx and vθy becomes smaller than − vc 2 or larger than + vc 2 more than once , it is determined that the optimal mode is the mode vr 1 ; ( 2 ) when during the sampling time ts , both vωx and vωy are within the range larger than − vc 1 and smaller than + vc 1 ( or deviate from this range only once ) and both vθx and vθy are within the range larger than − vc 2 and smaller than + vc 2 ( or deviate from this range only once ), it is determined that the optimal mode is the mode vr 2 ; ( 3 ) when during the sampling time ts , at least one of vωx and vωy becomes smaller than − vc 1 or larger than + vc 1 more than once and at least one of v θx and vθy becomes smaller than − vc 2 or larger than + vc 2 more than once , it is determined that the optimal mode is the mode vr 1 ; and ( 4 ) when during the sampling time ts , at least one of vωx and vωy becomes smaller than − vc 1 or larger than + vc 1 more than once and both vθx and vθy are within the range larger than − vc 2 and smaller than + vc 2 ( or deviate from this range only once ), it is determined that the optimal mode is the mode vr 2 as per the above , in step 802 , it is possible to determine the vibration reduction mode vr 1 or vr 2 that is optimal to the vibration level applied to the binocular , by comparing the angular velocity signals vωx and vωy and angular displacement amount signals vθx and vθy with the reference values ± vc 1 and ± vc 2 respectively . next in step 803 , the cpu 601 reads to which position 1052 to 1055 the mode setting dial 105 is set . when the mode setting dial 105 is set to the “ power - on ( vr auto )” position 1052 , which means that automatic switching of the vibration reduction mode is selected , the process proceeds to step 804 . in step 804 , the cpu 601 controls to create outputs for causing the actuators 131 and 132 to rotationally drive the rotation shafts 111 a and 111 b of the gimbal mechanism 110 in accordance with the optimal vibration mode vr 1 or vr 2 determined in step 802 . specifically , in step 804 , if the vibration mode determined in step 802 is the mode vr 1 , the cpu 601 controls to amplify the angular velocity signals vωx and vωy at a predetermined gain α 1 and to amplify the angular displacement amount signals vθx and vθy at a predetermined gain 11 and to output them . the output signals α 1 × vωx , α 1 × vωy , β 1 × vθx and β 1 × v θy are converted by the d / a converter 605 into analog signals and then input to the calculation section 606 . the calculation section 606 performs predetermined calculation processing such as addition or integration on the output α 1 × vωx and the output β 1 × vθx and outputs the results to the actuator 131 for rotationally driving the rotation shaft 111 a about x - axis . thus , the actuator 131 rotationally drives the rotation shaft 111 a with a driving voltage reflecting the outputs of the angular velocity signal vωx and the angular displacement amount signal vθx so as to rotate the outer gimbaled member 111 in the direction for bringing the optical axis of the erecting prism 12 r and 12 l closer to the original position ( i . e . the optical axis of the objective optical system 11 ). in addition , the calculation section 606 also performs calculation processing such as addition or integration on the output α 1 × vωy and the output β 1 × vθy and outputs the results to the actuator 132 for rotationally driving the rotation shaft 112 a about y - axis . thus , the actuator 132 rotationally drives the rotation shaft 112 a with a driving voltage reflecting the outputs of the angular velocity signal vωy and the angular displacement amount signal vθy so as to rotate the inner gimbaled member 112 in the direction for bringing the optical axis of the erecting prism 12 r and 12 l closer to the original position ( i . e . the optical axis of the objective optical system 11 ). on the other hand , in the case in which the vibration reduction mode determined in step 802 is vr 2 , the cpu 601 also controls in step 804 to amplify the angular velocity signals vωx and vωy and the angular displacement amount signals vθx and vθy so as to output them , but the amplification is performed at gains α 2 and β 2 respectively . while gains α 1 and β 1 are predetermined values for realizing the vibration mode vr 1 that is suitable for panning and tilting operations , gains α 2 and β 2 are predetermined values for realizing the vibration reduction mode vr 2 that is suitable for the vibration of a conveyance . the gains α 1 and β 1 in the mode vr 1 are set in such a way that the gimbal mechanism 110 is restrained to the original position more strongly than in the mode vr 2 . in other words , the gains α 1 and β 1 for the mode vr 1 are so set that the field of view follows the movement of the housing upon panning and tilting operations . on the other hand , the gains α 2 and β 2 in the mode vr 2 are set in such a way that the restraint of the gimbal mechanism 110 to the original position is weaker than in the mode vr 1 . in other words , the gains α 2 and β 2 in the mode vr 2 are so set that the field of view is kept as constant ( or steady ) as possible relative to the inertial system ( i . e . relative to the earth ) even if the binocular vibrates due to vibration of a conveyance . specifically , the ratio of the gain α 1 for the angular velocity signal to the gain β 1 for the angular displacement amount signal in the mode vr 1 is made larger than the ratio of the gain α 2 for the angular velocity signal to the gain β 2 for the angular displacement amount signal in the mode vr 2 . as per the above , the automatic switching of the vibration reduction mode between vr 1 and vr 2 is realized in step 804 . on the other hand , when it is turned out in step 803 that the mode setting dial 105 is set to the “ vr 1 ” position 1053 or the “ vr 2 ” position 1054 , the process proceeds to step 805 . in step 805 , it is further determined whether the mode setting dial 105 is in the “ vr 1 ” position 1053 or in the “ vr 2 ” position 1054 . when it is determined that the mode setting dial 105 is in the “ vr 1 ” position 1053 , the process proceeds to step 806 . in step 806 , it is determined whether or not the optimal vibration reduction mode determined in step 802 is identical to the mode vr 1 set by the mode setting dial 105 . if they are not identical , the process proceeds to step 807 , in which information for prompting mode change is presented to the user , since the currently set vibration reduction mode is not appropriate . the way of informing the user is pursuant to the setting by the navigation information changing switch 107 . specifically , when the eye - mark position 902 is selected , the led in the display within the field of view 201 is turned on in red , while when the ear - mark position 903 is selected , a beep sound or a voice sound is generated from the sound generator 254 , and then the process proceeds to step 808 . in connection with this , when the navigation information changing switch 107 is set to the “ navi off ” position 901 , the information is not presented and the process proceeds to step 808 . in the process shown in the flow chart of fig8 , it is determined in step 806 whether or not the optimal vibration reduction mode determined in step 802 is identical to the mode set by the user , which is determined in step 805 . however , as described before , in the present invention the process may be modified in such a way as to inform the user of the optimal vibration reduction mode determined in step 802 . in that case , step 806 for determining whether or not the optimal vibration reduction mode determined in step 802 is identical to the mode set by the user is not necessary ( i . e . can be omitted ). therefore , the information made in step 807 will be information on the optimal vibration reduction mode determined in step 802 . in step 808 , in order to realize the mode vr 1 , the cpu 601 controls to amplify the angular velocity signals vωx and vωy at a predetermined gain α 1 and to amplify the angular displacement amount signals v θx and vθy at a predetermined gain β 1 and to output them in like manner as in step 804 . thus , the actuators 131 and 132 rotationally drive the rotation shafts 111 a and 112 a respectively with driving voltages reflecting the outputs of the angular velocity signals and the angular displacement amount signals so as to realize the vibration reduction mode vr 1 . in step 808 , the vibration reduction mode is switched to the optimal vibration reduction mode determined in step 802 automatically . however , in the present invention , whether or not the mode suggested by the information in step 807 is to be selected may be left to user &# 39 ; s discretion . in that case , step 808 is not necessary ( i . e . can be omitted ). therefore , if the user considers that observation under the mode selected by himself or herself is satisfactory , the user can continue the observation while maintaining the current mode without following the information . in addition , even if the user considers that observation under the current mode selected by himself or herself is satisfactory , the user can change the mode once when a mode different from the currently selected mode is suggested by the information and if the suggested mode provides better observation , the user would observe with the suggested mode . if the user finds , after changing the mode to the suggested mode , that observation under the mode selected by himself or herself is more preferable for him or her than observation under the suggested mode , the user would change the mode from the suggested mode to the mode previously selected by the user again . as per the above , the present invention can provide an apparatus that reflects user &# 39 ; s intention or taste to a greater degree . after the above - described steps , the process proceeds to step 812 , in which the cpu 601 detects whether or not the vibration reduction on / off button 251 has been manipulated within a predetermined time . when it is detected that the vibration reduction of / off button has been manipulated , the process proceeds to step 813 , in which the cpu 601 outputs a signal for commanding the actuators 131 and 132 to return the rotation shafts 111 a and 112 a to the original positions and to maintain ( or lock ) them at that state . that signal is sent to the actuators 131 and 132 via the d / a converter 605 , the calculation section 606 , and the actuators 131 and 132 return the rotation shafts 111 a and 112 a to their original positions to maintain ( or lock ) them in that state . thus , the gimbal mechanism 110 of the image stabilization apparatus 100 will not rotate from the original position , and therefore the binocular behaves as an ordinary binocular that does not have a vibration reduction function . the locking of the rotation shafts 111 a and 112 a is maintained until it is detected that the vibration reduction on / off button 251 is manipulated ( or pressed ) again . if it is determined in step 814 that the vibration reduction on / off button 251 is pressed again and the locking is released , or if it is determined in step 812 that the vibration reduction on / off button 251 has not been manipulated , the process returns to step 801 . referring back to step 805 , if it is determined in step 805 that the mode setting dial 105 is in the “ vr 2 ” position 1054 , the process proceeds to step 809 . in step 809 , it is determined whether or not the optimal vibration reduction mode determined in step 802 is identical to the mode vr 2 set by the mode setting dial 105 . if they are not identical , the process proceeds to step 810 , in which information for prompting mode change is presented to the user in like manner as in step 807 , since the currently set vibration reduction mode is not appropriate . as described before , the process may be modified in such a way as to inform the user of the optimal vibration reduction mode that is determined in step 802 . in that case , step 809 for determining whether or not the optimal vibration reduction mode determined in step 802 is identical to the mode set by the user determined in step 805 is not necessary ( i . e . can be omitted ). therefore , step 809 and step 810 are not necessary , and information of the optimal vibration reduction mode determined in step 802 is made only in step 807 . then the process proceeds to step 811 . in step 811 , in order to realize the mode vr 2 , the cpu 601 controls to amplify the angular velocity signals vωx and vωy at a predetermined gain α 2 and to amplify the angular displacement amount signals vθx and vθy at a predetermined gain 2 and to output them in like manner as in step 804 . thus , the actuators 131 and 132 rotationally drive the rotation shafts 111 a and 112 a respectively with driving voltages reflecting the outputs of the angular velocity signals and the angular displacement amount signals so as to realize the vibration reduction mode vr 2 . after that , the process proceeds to step 812 . as described before , whether or not the mode suggested by the information in step 810 is to be selected may be left to user &# 39 ; s discretion . in that case , step 810 is not necessary ( i . e . can be omitted ). referring back to step 803 , if the mode setting dial 105 is set to the “ shift ” position 1055 , the process proceeds to step 815 . in step 815 , it is determined whether the vibration reduction on / off button 251 has been manipulated ( or pressed ) within a predetermined time . in the state in which the mode setting dial 105 is set to the “ shift ” position , the vibration reduction mode is switched between vr 1 and vr 2 automatically . therefore , if it is determined in step 815 that the vibration reduction on / off button 251 has not been pressed , the process proceeds to step 816 , and in order to realize the vibration reduction mode same as the previously set mode , which is assumed here to be the mode vr 1 for example , if the mode set in the latest step 816 is vr 1 , the cpu 601 controls to amplify the angular velocity signals vωx and vωy at a predetermined gain α 1 and to amplify the angular displacement amount signals vθx and vθy at a predetermined gain β 1 and to output them . on the other hand , if it is determined in step 815 that the vibration reduction on / off button 251 has been pressed , the process proceeds to step 816 , and in order to realize the vibration reduction mode different from the previously set mode ( i . e . in order to realize the mode vr 2 , if the mode set in the latest step 816 is vr 1 ,), the cpu 601 controls to amplify the angular velocity signals vωx and vωy at a predetermined gain α 2 and to amplify the angular displacement amount signals vθx and vθy at a predetermined gain β 2 and to output them . thus , the actuators 131 and 132 rotationally drive the rotation shafts 111 a and 112 a so as to realize vibration reduction mode vr 1 or vr 2 . as per the above , in the binocular having the image stabilization apparatus 100 according to this embodiment , it is possible to realize a mode with which vibration reduction mode is automatically switched in accordance with the level or degree of vibration of the binocular . under this automatic mode , it is possible , by setting a sampling time ts , to distinguish movement of the binocular caused unintentionally by the user from intentional panning / tilting operations or vibration caused by conveyance . in addition , even if there is a time lag between detection of the angular velocity of the gimbal mechanism and detection of the angular displacement amount of the gimbal mechanism , it is possible to determine the optimal vibration reduction mode . in addition , when a vibration reduction mode is set by a user at his or her will , the apparatus can inform the user whether that mode is the optimal vibration reduction mode or not , based on the above - described determination of the optimal vibration reduction mode , to prompt the user to change the vibration reduction mode to the optimal mode . in this way , the user can notice whether or not the vibration reduction mode selected by him or her is appropriate , and even inexperienced user can appropriately select the mode . therefore , it is possible to bring out the performance of the image stabilization apparatus fully . in the apparatus according to the above - described embodiment , the optimal vibration reduction mode is determined based on whether the angular velocity signal or the angular displacement amount signal deviates from a reference range more than once within the sampling time ts . however , the frequency criterion is not limited to “ more than once ”, but it may also be “ more than twice ” or other desirable frequency . in steps 804 , 808 , 811 and 816 in fig8 , the gains are varied in accordance with the vibration reduction mode in order to realize modes vr 1 and vr 2 . but the apparatus may be modified in such a way that the modes vr 1 and vr 2 are realized not only by varying the gains but by performing calculation or other processing that is predetermined for each mode . next , as a second embodiment , an apparatus in which a modification is made to the displayed mark that appears , in accordance with the informing process of steps 807 and 810 , in the display 201 within the field of view 200 in the apparatus according to the first embodiment is modified . in the second embodiment , as shown in fig1 , a display within the field of view 200 includes a display 203 indicating an upward red triangle mark , a display 204 indicating a downward red triangle mark and a display 202 disposed between these displays indicating a green circular mark . these displays can be realized by leds or other devices . on the upper surface of a housing 1 of the binocular , as shown in fig1 , there is provided vibration reduction mode changing buttons 104 a and 104 b having the shapes corresponding to the shapes of the marks of the displays 203 and 204 . the button 104 a is to be operated upon changing the vibration reduction mode to mode vr 2 when the currently set mode is mode vr 1 , while the button 104 b is to be operated upon changing the vibration reduction mode to mode vr 1 when the currently set mode is mode vr 2 . when in step 807 ( in the process shown in the flow chart of fig8 ) the currently set mode vr 1 is not the optimal mode , the cpu 601 causes the upward triangle mark of the display within the field of view 203 to be turned on in red . if the user presses the changing button 104 a of the same shape in response to the turned - on mark , the cpu 601 causes the circular mark of the display within the field of view 202 to be turned on in green , and the process proceeds to step 811 , in which the process for the vibration reduction mode vr 2 ( that is the mode set after the mode change ) is performed . on the other hand , if the user does not press the changing button 104 a of the same shape in step 807 , the process proceeds to step 808 , in which the process for the vibration reduction mode vr 1 is continued without a mode change . similarly , when in step 810 the currently set mode vr 2 is not the optimal mode , the cpu 601 causes the downward triangle mark of the display within the field of view 204 to be turned on in red . if the user presses the changing button 104 b of the same shape in response to the turned - on mark , the cpu 601 causes the circular mark of the display within the field of view 202 to be turned on in green , and the process proceeds to step 808 , in which the process for the vibration reduction mode vr 1 ( that is the mode set after the mode change ) is performed . on the other hand , if the user does not press the changing button 104 b of the same shape in step 810 , the process proceeds to step 811 , in which the process for the vibration reduction mode vr 2 is continued without a mode change . the binocular provided with the image stabilization apparatus according to the second embodiment having the above - described structure realizes an advantageous effect that the user can change the vibration reduction mode to select the optimal mode by operating the button 104 a or 104 b by a finger in accordance with a figure indicated in the display within the field of view during observation without detaching the eyes from the eyepiece lenses 13 r and 13 l . in the process of providing information on the optimal mode determined in step 802 , the information may be provided by visual displays or sounds specific to the respective modes that are different from each other . it is preferable that the mode selected by user be indicated in the field of view to inform the user of the mode . when both the mode selected by the user and the optimal mode determined in step 802 are displayed , the user can conveniently recognize the difference between those modes at sight . the displays within the field of view 203 and 204 may be composed of leds or other elements that can emit a color light selected from more than two color lights . in that case , the comparison of the angular velocity signal and the angular displacement amount signal with the reference ranges may be arranged in such a way that the degrees of deviations of those signals from the respective reference ranges are classified into two or more levels . thus , in the process of informing the user in steps 807 and 810 , those levels ( or degrees ) of the deviation are represented by corresponding colors of light . for example , when the degree of the deviation is relatively low , the displays within the field of view 203 and 204 are caused to emit yellow light , while when the degree of the deviation is relatively high , the displays 203 and 204 are caused to emit red light . thus , the user can make a decision on the vibration reduction mode in a customized way in accordance with his or her intention , for example , in such a way as to change the vibration reduction mode only when the degree of the deviation is high . therefore , it is possible to enlarge the variety of use for user of the binocular . the apparatus according to the above - described embodiment has two vibration reduction modes ( vr 1 , vr 2 ), but the present invention is also applicable to more than two vibration reduction modes ( vr 1 , vr 2 , vr 3 , . . . , vrn ). the apparatus according to the above - described embodiment is provided with a gimbaled member on which prisms are mounted , angular velocity feedback control means and position feedback control means for controlling the position of the gimbaled member . however , the present invention is also applicable to other types of optical elements . for example , the present invention can be applied to an apparatus that uses a variable - angle prism for vibration reduction , which is composed of two glass plates and liquid having a high refractive index included between the glass plates in a sealed manner . ( the variable - angle prism itself has been already known , and described for example in japanese patent application laid - open nos . 10 - 319325 and 2000 - 10143 .) in that case , the present invention can be applied to an apparatus that has a variable - angle prism position detector that detects an inclination angle of one of the glass plates and a driving device such as a motor for driving that glass plate in a direction for correcting an inclination of the optical system based on the detection result . the present invention can be applied to various apparatus in which an inclination of the optical axis of an observation optical system having an erecting prism or other element is detected and the inclination is corrected based on a detection result . the apparatus according to the present invention may be provided with a mode selecting switch with which a user can select automatic mode switching and manual mode switching that allows the user to select desired mode . in this case , the user can select a desired mode at his or her will depending on circumstances and the user &# 39 ; s operation skill . as per the above , the present invention can provide an image stabilization apparatus having a good usability . | 6 |
referring to fig1 , a continuous web printing press layout 10 includes a series of stations or printing towers 12 for printing different colors onto a moving web 14 . the web 14 is driven from a supply roll 15 on stand 16 onto a paper path that leads sequentially to print stations 12 . the four print stations define a print zone 18 in which ink is applied to the substrate . an optional dryer 17 may be placed after the final print station . after printing , the web is slit into sheets that are stacked at station 19 . for printing wide - format webs , such as newsprint , the print stations typically accommodates a web width of about 25 - 30 inches or more . a general layout for offset lithographic printing that can be adapted for ink - jet printing is further described in u . s . pat . no . 5 , 365 , 843 , the entire contents of which is hereby incorporated by reference . referring also to fig2 , each print station includes a print bar 24 . the print bar 24 is a mounting structure for printhead modules 30 which are arranged in an array and from which ink is ejected to render a desired image on the web 14 . the printhead modules 30 are mounted in print bar receptacles 21 such that the faces ( not shown in fig2 ) of the printhead modules from which ink is ejected are exposed from the lower surface of the print bar 24 . the printhead modules 30 can be arranged in an array to offset nozzle openings , thereby increasing print resolution or printing speed . in a printing condition , the print bar 24 is arranged above the web path to provide proper alignment and a uniform stand - off distance between the printhead modules 30 and the web 14 . the printhead modules 30 can be of various types , including piezoelectric drop on demand ink - jet printhead modules with arrays of small , finely spaced nozzle openings . examples of piezoelectric ink - jet printhead modules are described in hoisington u . s . pat . no . 5 , 265 , 315 ; fishbeck et al . u . s . pat . no . 4 , 825 , 227 ; hine u . s . pat . no . 4 , 937 , 598 ; bibl et al . u . s . patent application ser . no . 10 / 189 , 947 , entitled “ printhead ,” filed jul . 3 , 2002 , and chen et al . u . s . provisional patent application 60 / 510 , 459 , entitled “ printhead module with thin membrane ,” filed oct . 10 , 2003 , the entire contents all of which are hereby incorporated by reference . other types of printhead modules can be used , such as , for example , thermal ink - jet printhead modules in which heating of ink is used to effect ejection . continuous ink - jet heads , that rely on deflection of a continuous stream of ink drops can also be used . in a typical arrangement , the stand off distance between the web path and the print bar is between about 0 . 5 and one millimeter . in order to minimize drop placement errors , the printhead modules are accurately aligned relative to each other and relative to the web . in addition to having appropriate angular orientation , a properly aligned printhead module 30 has nozzles appropriately located with respect to three translational degrees of freedom relative to the web . these are represented by x -, y -, and z - positions in the cartesian co - ordinate system shown in fig2 . the web advances in the y - direction ( the process direction ) and the stand off distance corresponds to the nozzles &# 39 ; location along the z - axis . ideally , each nozzle is located at a nominal location from which a defect - free printhead module produces images with no drop placement errors . practically , however , printhead modules can be aligned with its nozzles within some range of their nominal locations and still provide adequate drop - placement accuracy . exact tolerances for printhead module alignment depend on the specific application , and can vary for different degrees of freedom . for example , in some embodiments , tolerances for x - axis placement should be smaller than z - and / or y - axis placement . for example , where nozzles from different printhead modules are interlaced to provide increased resolution , constraints on the relative alignment of printhead modules in the x - direction are more stringent that those in the y - and z - directions . in some embodiments , nozzles should be located within about 0 . 5 pixels ( e . g ., within about 0 . 2 pixels ) of their nominal locations in the x - direction , while alignment of the nozzles to within about 1 - 2 pixels of their nominal location in the y - direction can provide sufficient drop placement accuracy . in applications having 600 dpi resolution , for example , one pixel corresponds to about 40 microns . therefore , where an application demands alignment accuracy to within 0 . 5 pixels in one direction , a 600 dpi system should have its printhead modules aligned to within about 20 microns of their nominal positions . referring to fig3 a and fig3 b , in some embodiments , a print bar includes a frame 310 and other support elements 330 , 340 , and 350 . a number of openings 360 ( i . e ., 12 openings in the present embodiment ) are provided in frame 310 in which printhead modules 320 are mounted . also shown in fig3 a and 3b is inlet port 370 and outlet port 372 which couple to an ink supply ( not shown ). referring also to fig4 a , the edge of each opening 360 includes alignment datums 410 , 420 , and 430 , which form planar protrusions from opening edges 401 a and 401 b . in addition , frame 310 includes alignment datums 440 , 442 , and 444 that register frame 310 relative to neighboring frames or to other elements of the print bar . referring additionally to fig4 b , 4c , and 4 d , a printhead module 450 includes a printhead module frame 451 in which is mounted a nozzle plate 470 including a row of nozzles 475 . printhead module frame 451 includes alignment datums 455 , 460 , and 465 , which protrude from edges of printhead module frame 451 and each include a planar surface . when printhead module 450 is properly mounted in opening 360 , the planar surface of each of alignment datums 410 , 420 , and 430 in frame 310 contact corresponding planar surfaces of alignment datums 455 , 465 , and 460 on the printhead module . alignment datums 410 and 455 register printhead module 450 in the x - direction and alignment datums 420 , 430 , 460 and 465 register printhead module 450 in the y - direction . accordingly , once printhead module 450 is mounted in frame 310 with corresponding alignment datum surfaces in contact with one another , the printhead module is aligned relative to the frame in the x - direction and y - direction . assuming the frame is properly installed on the print bar , the printhead modules are ready for jetting without additional adjustment . the alignment datums provide accurate registration of the printhead module to the frame because distances between the planar surfaces of the printhead module alignment datums and the orifices are sufficiently close to a predetermined distance to accurately offset the orifices from the alignment datums of the frame . for example , referring specifically to fig4 d , an orifice 475 a is a predetermined distance x 475a from planar surface 455 a of alignment datum 455 . similarly , orifices 475 are a predetermined distance y 475 from a plane defined by surface 465 a of alignment datum 465 . accordingly , when printhead module 470 is mounted in the frame , orifice 475 a is offset a distance x 475a from surface 410 a of alignment datum 410 in the x - direction and a distance y 475 from surface 420 a from alignment datum 420 in the y - direction . when the locations of the frame alignment datums are made to similar accuracy , they allow accurate alignment of printhead modules relative to one another in the frame . similarly , accurate placement of the frame within the printing device aligns all the printhead modules in the frame relative to the substrate . the planar surfaces of the alignment datums ( also referred to as “ precision surfaces ”) should be sufficiently smooth to maintain accurate registration of the printhead module to the frame along an axis regardless of which portion of the planar surfaces of the printhead module alignment datums is in contact with the planar surfaces of corresponding frame alignment datums . in other words , the planar surfaces should be sufficiently smooth so that small shifts of the printhead module position in one direction , due to , e . g ., thermal expansion of the printhead module and / or frame , do not appreciably change the orientation of the nozzles or the location of the nozzles with respect to an orthogonal direction . typically , the printhead module frame is manufactured so that the planar surface portions of the alignment datums are smoother than adjacent portions of surfaces of the printhead module frame . this can reduce manufacturing time and complexity because , for a particular surface of the printhead module frame , only the alignment datum surfaces , which form only a portion of a printhead module surface , need to be manufactured to high accuracy . for example , for a printhead module having a surface extending for several centimeters or tens of centimeters in one direction , only a small fraction ( e . g ., a few millimeters ) of that surface needs to be precisely manufactured to provide the alignment datum . in some embodiments , the planar surfaces are prepared to have an arithmetical mean roughness ( r a ) of about 20 microns or less ( e . g ., about 15 microns or less , about 10 microns or less , about 5 microns or less ). the r a of a surface can be measured using a profilometer , such as an optical profilometer ( e . g ., wyko nt series profilometer , commercially available from veeco metrology group , tucson , ariz .) or a stylus profilometer ( e . g ., dektak 6m profilometer , commercially available from veeco metrology group , santa barbara , calif . ), for example . alignment datums can be made by placing a printhead module frame blank ( e . g ., a monolithic printhead module frame blank ) on a precision machining device ( e . g ., a dicing saw or a cnc mill ) and removing material from the printhead module frame blank to form the alignment datum . such manufacturing methods are particularly useful where at least one axis of the printhead module cannot easily be cost - effectively controlled using conventional manufacturing processes . alternatively , or additionally , an attachment including a precision surface can be bonded onto the printhead module frame . the frame can also be manufactured using a precision manufacturing process , such as wire electrical discharge machining ( edm ), jig grinding , laser cutting , computer numerical control ( cnc ) milling or chemical milling . the frame should be formed from a material that is rigid , sufficiently stable , and has a low thermal coefficient of expansion . for example , the frame can be formed from invar , stainless steel , or alumina . in the present embodiment , the jetting assemblies are aligned by slipping each into a corresponding opening such that the corresponding alignment datums contact each other . once a printhead module is inserted into a opening , it is clamped to the frame . in general , a clamp fastens a printhead module to a frame by pressing the printhead module against the frame or against an opposing portion of the clamp . typically , the clamp holds the printhead module in the frame until it is loosened or released . the type of clamp used to secure a printhead module can vary . one type of clamp that can be used is a c - clamp . in certain embodiments , clamps can be secured to the frame using adjustable fasteners ( e . g ., screws ). an example of a clamp is shown in fig5 a . clamp 530 secures a printhead module 520 in a opening 501 of a frame 510 . clamp 530 includes portions 532 which contact printhead module 520 and press the module against other portions of the clamp ( not shown in fig5 a ). clamp 530 is secured to frame 510 by a fastener 531 . when secured , alignment datums 521 , 522 , and 523 on printhead module 520 contact alignment datums 511 , 512 , and 513 on frame 510 , respectively , registering the printhead module with respect to the frame . frame 510 also includes openings 502 , 503 , and 504 , which are shown in fig5 a . in some embodiments , printhead modules can be clamped to the frame using one or more screws . the torque associated with screw tightening can be decoupled from the printhead module by providing an appropriate clamping element . an example of such a clamping element is a bracket as shown in fig5 b . printhead module 550 clamped to a frame 560 using a clamping bracket 570 . printhead module 550 includes alignment datum 551 that contacts corresponding alignment datum 561 on an edge of a opening in frame 560 . clamping bracket 570 is secured to frame 560 using a screw 575 which inserts through a hole 572 in bracket 570 into a threaded hole 565 in frame 560 . torque applied to screw 575 during clamping is decoupled from printhead module 550 by bracket 570 , and does not substantially affect alignment of the printhead module . in some embodiments , different portions of a printhead module can be clamped with varying force . for example , were thermal stresses are significant , a point near an alignment datum can be clamped with higher force than other points . such an arrangement can cause any induced slipped , due to thermal expansion , for example , to occur in a predictable / controllable manner , and in a manner that does not cause corresponding alignment datums to become disconnected . alternatively , or additionally , to fastening each printhead module to the frame , each printhead module can be loaded against the frame using , e . g ., one or more spring elements . a spring element refers to an element that spring loads the printhead module against the frame . examples of spring elements include coiled springs and flexures . referring to fig6 a , an example of a flexure is shown . a frame 610 includes four openings , 601 , 602 , 603 , and 604 , each having two flexures ( e . g ., flexures 640 and 642 in opening 601 ). in this example , the flexures are cantilevers that spring load the printhead module ( e . g ., printhead module 620 ) in the y - direction . flexures 640 and 642 load alignment datums 621 and 622 on printhead module 620 against frame datums 611 and 612 , respectively . printhead module 620 also includes an alignment datum 623 which contacts frame alignment datum 613 , registering the printhead module in the x - direction . a clamp 630 secures printhead module 620 to frame 610 . referring to fig6 b , in another embodiment , a frame 710 includes openings 701 , 702 , 703 , and 704 that have spring elements for loading printhead modules in the x - and y - directions . for example , opening 701 includes a flexure 730 that loads a printhead module against alignment datum 713 , which registers the printhead module in the x - direction . in addition , frame 710 includes flexures 720 and 722 which load a printhead module against alignment datums 711 and 712 for y - direction registration . in the foregoing embodiments shown in fig6 a and 6b the spring elements are incorporated in the frame . however , spring elements may also be discrete components that are attached to the frame . for example , referring to fig7 , in some embodiments , a printhead module 750 can be spring loaded against the edge of a opening 761 of a frame 760 using discrete coiled springs 770 and 772 . coiled springs 770 and 772 are attached to frame 760 by bolts 771 and 773 , respectively , and spring load printhead module 750 in the y - direction . each coiled spring has an arm ( i . e ., arms 775 and 776 ) that couple to frame 760 via holes 777 and 778 . the force each coiled spring applies to printhead module 750 can be adjusted by changing the hole to which its arm couples . a flexure 780 spring loads printhead module 750 against frame 760 in the x - direction . mounting printhead modules in a frame using spring elements can be advantageous because the spring elements accommodate volume changes in the printhead module relative to the frame &# 39 ; s opening , e . g ., due to thermal expansion , without substantially changing the amount of force applied to the printhead module . in contrast , where a printhead module is tightly clamped to the frame , an increased clamping force that can accompany an increase in the printhead module &# 39 ; s size due to thermal expansion can cause undesirable stress on the printhead module . in aforementioned embodiments that include alignment datums , the alignment datums are planar surfaces . however , in general , alignment datums can take other forms . in general , the alignment datum can take any form that provides sufficiently accurate registration of the printhead module to the frame in at least one degree of freedom . the alignment datums should also be sufficiently large and robust so as not to be deformed by mechanical mounting . in some embodiments , some alignment datums can be recessed ( e . g ., in the form of a bored hole ) and can mate with corresponding protrusions . for example , referring to fig8 a and fig8 b , a printhead module 800 can include alignment datums in the form of posts 830 and 832 , which insert into corresponding holes 841 and 842 in a frame 840 . these alignment datums register printhead module 800 with respect to the x - axis and y - axis . posts 830 and 832 can be adjusted during assembly of printhead module 800 so that they are correctly oriented with respect to nozzles 820 in nozzle plate 810 . furthermore , although the foregoing embodiments include alignment datums for registering a printhead module in the x - and y - directions , alignment datums can also be used to register a printhead module in the z - direction . referring still to fig8 b , for example , frame 840 includes alignment datums 853 and 855 which contact corresponding alignment datums 852 and 854 on printhead module 800 , respectively . these alignment datums offset the printhead module from the frame in the z - direction , positioning nozzles 820 a desired distance from a substrate ( not shown ). another embodiment of a frame is shown in fig9 . in this embodiment , frame 1100 has four openings 1101 - 1104 for mounting printhead modules . frame 1100 is a laminate structure and includes registration plates 1110 and 1130 , and a spacer 1120 . registration plate 1110 includes alignment datums 1111 , 1112 , and 1113 for registering a printhead inserted into opening 1101 in the x - and y - directions . in particular , alignment datums 1113 provide registration of a printhead in the x - direction , while datums 1111 and 1112 provide registration of a printhead in the y - direction . registration plate 1110 includes corresponding alignment datums for registering printheads in the x - and y - directions in openings 1102 - 1104 . registration plate 1130 includes alignment datum 1114 for registering a printhead inserted into opening 1101 in the z - direction . registration plate 1130 includes another alignment datum ( not shown in fig9 due to the perspective of the figure ) on the opposite side of opening 1101 from alignment datum 1114 . furthermore , registration plate 1130 includes corresponding alignment datums for registering printheads in the z - direction in openings 1102 - 1104 . furthermore , frame 1100 includes alignment datums for registration to other frames . alignment datums 1131 and 1132 , on the edge of registration plate 1130 , register the frame to another frame in the y - direction , while alignment datums 1135 and 1136 register the frame to another frame in the x - direction . registration plate 1130 also includes holes 1141 - 1143 for bolting the frame to a print bar or other structure of the printing system in which the frame is mounted . frame 1100 can be relatively thin ( i . e ., in the z - direction ). for example , frame 1100 can have a thickness of about 2 cm or less ( e . g ., about 1 . 5 cm or less , about 1 cm or less ). in embodiments , registration plates 1110 and 1130 can be formed from a rigid material , such as materials that include one or more metals ( e . g ., alloys , such as invar ). the material can have similar thermomechanical properties ( e . g ., coefficient of thermal expansion ( cte )) as the material ( s ) from which the printheads are formed . for example , the cte of the material ( s ) from which the registration plate materials are formed can be within about 20 percent or less ( e . g ., about 10 percent or less , about 5 percent or less ) over a range of temperatures at which the printheads usually operate ( e . g ., from about 20 ° c . to about 150 ° c .). registration plates 1110 and 1130 can be formed by sheet metal processing methods , such as stamping , and / or by edming . the alignment datums on registration plates 1110 and 1130 can be formed by gouging and / or edming , for example . spacer 1120 can be formed from a material having similar thermomechanical properties as the material ( s ) used to form registration plates 1110 and 1130 . in some embodiments , spacer 1120 can be formed from a material having a high thermal conductivity , and spacer 1120 can act as a thermal node . alternatively , or additionally , the material forming spacer 1120 can exhibit relatively low thermal expansion . furthermore , spacer 1120 can be formed from a material which has a high level of chemical inertness , to reduce any undesirable chemical reactions of the spacer with other materials in the frame and / or with the environment . in some embodiments , spacer 1120 can be formed from a material having a high electrical conductivity . high electrical conductivity can reduce build up of static charge on the frame . as an example , spacer 1120 can be formed form a liquid crystalline polymer ( lcp ) ( e . g ., coolpoly ® e2 commercially available from cool polymers inc ., warwick , r . i .). in some embodiments , spacer 1120 is injection molded . alternatively , the spacer can be machined from a blank sheet of material . spacer 1120 can include registration features which couple to corresponding features in other layers of frame 1100 ( e . g ., in the registration plates ), aligning the apertures in each layer to provide openings 1101 - 1104 . registration plates 1110 and 1130 are secured ( e . g ., bonded or screwed ) to either side of spacer 1120 . in some embodiments , an epoxy ( e . g ., a b - stage epoxy ) is used to bond registration plates 1110 and 1130 to spacer 1120 . in some embodiments , additional layers can be included in the laminate structure of frame 1100 . as an example , frame 1100 can include a heater layer . the heater layer can be bonded to a surface of registration plate 1110 or registration plate 1130 . a heater layer can be formed from a kapton flex circuit , for example . although the foregoing embodiments relate to printhead modules which do not require adjustment along various degrees of freedom due to registration using alignment datums , in other embodiments printhead modules can include one or more actuators that adjust the printhead module position with respect to one or more degrees of freedom . for example , referring to fig1 , a frame 910 includes an actuator 940 that is coupled to a surface 960 of a printhead module 920 in a frame opening 901 . printhead module 920 includes an orifice plate 925 having an array of orifices 930 . during operation , actuator 940 adjusts the position of printhead module 920 in the x - direction as necessary . printhead module 920 also includes alignment datums 921 and 922 which contact corresponding frame alignment datums 911 and 912 . actuator 940 can be an electromechanical actuator , such as a piezo - electric or electro static actuator . examples of piezo - electric actuators include stacked piezo - electric actuators that include multiple layers of piezo - electric material stacked to increase the actuators dynamic range compared to a single layer of piezo - electric material . stacked piezo - electric actuators are available commercially ( e . g ., from companies such as pi ( physik instrumente ) l . p ., auburn , mass .). the actuator should have a minimum range of motion on the order of the image pixel spacing . stacked piezo - electric actuators , for example , can have a dynamic range of about 5 to about 300 microns . actuator 940 responds to drive signals from an electronic controller 950 . in some embodiments , controller 950 causes actuator 940 to adjust the position of printhead module 920 in the x - direction in response to a signal from a monitoring system 970 ( e . g ., an optical monitoring system , such as including a ccd camera ). monitoring system 970 monitors images ( e . g ., test images ) printed using printhead module 940 for drop placement errors associated with misalignment of printhead module 940 in the x - direction . where a drop placement error is detected , electronic controller 950 determines the magnitude and direction of printhead module misalignment that gave rise to the error . based on this determination , the controller sends a signal to actuator 940 . the actuator changes the position of the printhead module in order to reduce or eliminate errors arising from printhead module misalignment . in some embodiments , actuator 940 can dither printhead module 920 back and forth in the x - direction during printing . this can reduce the effect of drop placement errors due to x - axis alignment on image quality by introducing controlled noise to the image which can mask the errors . preferably , the printhead module should be dithered a fraction of a pixel ( e . g ., about ½ a pixel or ¼ of a pixel ). dither frequency can be variable or fixed . preferably , dither frequency should be lower than jetting frequency ( e . g ., about 0 . 1 , 0 . 05 , 0 . 01 times the jetting frequency ). however , in embodiments where the dither frequency is comparable or higher than jetting frequency , dither frequency should not be at the jetting frequency or its harmonics . in embodiments where multiple printhead modules are interlaced , each printhead module can be actuator adjusted . in addition , or alternatively , to adjusting the x - direction alignment of each printhead module to mitigated alignment errors , the actuators can adjust the interlace pattern of the printhead modules . the actuators allow the interlace spacing and / or pattern to be varied rapidly and reliably . thus , the interlace pattern can be adjusted during printing ( e . g ., between images ) without down time of the printing press . while in the foregoing embodiments the printhead module alignment datums register the printhead module directly to the frame , in other embodiments alignment datums can be used to register printhead modules directly to other printhead modules . for many applications , particularly those in which printing is completed with a single pass of the substrate relative to the jetting assembly , several printhead modules are positioned along the process direction ( i . e ., the y - direction ) to achieve the requisite spatial density for the desired print quality . to reduce adverse effects of process variation on image quality , printhead modules should preferably placed very close together in the process direction . referring to fig1 a , in some embodiments , close printhead module spacing is achieved by stacking multiple printhead modules together to form a 2 - d jetting array 1000 . while jetting array 1000 includes six printhead modules ( i . e ., printhead modules 1010 , 1020 , 1030 , 1040 , 1050 , and 1060 ), in general , the number of printhead modules in a jetting array can vary as desired . adjacent printhead modules are registered in the y - direction via alignment datums . for example , printhead module 1010 has alignment datums 1013 and 1014 , which register it to printhead module 1020 via alignment datums 1021 and 1022 . in addition , printhead module 1010 includes alignment datums 1011 and 1012 , which register the printhead module in the y - direction to a frame ( not shown ). a clamp 1090 clamps the subassembly together once the printhead modules have been stacked with corresponding datums aligned ( e . g ., using a c - clamp ). the printhead modules in jetting array 1000 can share a common ink supply and temperature control system . corresponding nozzles in adjacent printhead modules can be offset along the x - axis to increase the print resolution of the jetting array . for example , referring to fig1 d , a jetting array 1200 includes three printhead modules 1210 , 1220 , and 1230 that are stacked together . corresponding nozzles in printhead modules 1210 and 1220 are offset by an amount approximately equal to d / n , where d is the spacing between adjacent nozzles ( e . g ., between nozzles 1211 a and 1211 b , 1221 a and 1221 b , and 1231 a and 1231 b ) in a nozzle array , and n is the number of printhead modules in stacked in the jetting array . similarly corresponding nozzles in printhead modules 1220 and 1230 are also offset by d / n in the x - direction . accordingly , the print resolution in the x - direction of the jetting assembly is reduced by a factor of n . as an example , a jetting array having a resolution of about 50 μm can be assembled from six printhead modules each having an individual resolution of about 300 μm . in some embodiments , the alignment datums on the printhead modules can include features that allow alignment of the printhead modules in the x - direction to provide the desired jet pitch . for example , referring to fig1 b , protruding alignment datums 1050 and 1060 can each include multiple precision surfaces which register the printhead modules relative to one another in both the x - and y - directions . in the present embodiment , alignment datum 1050 includes precision surfaces 1051 , 1052 , and 1053 . similarly , alignment datum 1060 includes precision surfaces 1061 , 1062 , and 1063 . surfaces 1051 and 1061 register the printhead modules in the x - direction , while surfaces 1052 , 1053 , 1062 , and 1063 register the printhead modules in the y - direction . another example of alignment datums that register printhead modules relative to two degrees of freedom are shown in fig1 c . in this example , a protruding alignment datum 1070 inserts into a recessed alignment datum 1080 . protruding alignment datum 1070 includes precision surfaces 1071 and 1072 . surface 1071 contacts surface 1081 of alignment datum 1080 , registering the printhead module in the x - direction . similarly , surface 1072 contacts surface 1082 of alignment datum 1080 , registering the printhead module in the y - direction . stacking printhead modules in a compact 2 - d jetting array can reduce the dimensions over which precision should be maintained in any given part . since the arrays are modular and can share common ink ports and temperature control , the size , cost , and complexity of the system can be reduced relative to systems in which individual jetting assemblies are each served by their own ink supply , temperature controller , and / or are individually mounted . furthermore , individual printhead modules can be replaced should they become defective instead of replacing an array . a number of embodiments of the invention have been described . nevertheless , it will be understood that various modifications may be made without departing from the spirit and scope of the invention . accordingly , other embodiments are within the scope of the following claims . | 1 |
the following description of various embodiments implemented in the context of monitoring the volume or weight of feed bins and installing such monitoring systems is to be construed by way of illustration rather than limitation . this description is not intended to limit the invention or its applications or uses . for example , while various embodiments are described as being implemented in this context , it will be appreciated that the principles of the disclosure are applicable to other environments , as will be apparent to one of ordinary skill in the art . in the following description , numerous specific details are set forth in order to provide a thorough understanding of various embodiments . it will be apparent to one skilled in the art that some embodiments may be practiced without some or all of these specific details . in other instances , well known components and process steps have not been described in detail . embodiments of the bin monitoring system are illustrated in fig1 a - 6 . referring now in particular to fig1 a - 3c and 6 , a bin monitoring system 10 includes a frame 12 . in some embodiments , the frame 12 is a - shaped and has a top 14 and two supports 20 a and 20 b extending diagonally downward from the top 14 . in the illustrated embodiments , each support 20 a and 20 b has a respective flange 24 a and 24 b with at least one respective flange aperture 28 a and 28 b for anchoring the frame 12 to a foundation such as a concrete slab c , as most bins are installed on concrete slabs . the top 14 includes a bolt aperture 16 that receives a bolt 18 for securing the frame 12 to the top of a load cell 50 . in some embodiments , the frame 12 can be constructed of fabricated iron , as shown in fig1 a . alternatively , as shown at reference numeral 12 ′ in fig7 , the frame 12 ′ can be constructed of fabricated channel iron . in some embodiments , the load cell 50 is implemented as an s - type load cell for measuring the tension or changing weight of a bin b . the bin monitoring system 10 incorporates the load cell 50 to measure the weight and changes of weight of the bin b . an example implementation of the load cell 50 is disclosed in u . s . patent application ser . no . 11 / 422 , 910 of jaeger et al ., the teachings of which are herein incorporated by reference in their entirety . in some embodiments , the load cell 50 includes an electrical connection 52 that passes through an aperture 22 in one of the supports 20 a and 20 b to a transmitter ( not shown ) such that data collected from the load cell 50 can be accessed via a remote location such as , for example , by a wired , wireless , or mobile telephone or using a network such as the internet . it is further contemplated that the bin monitoring system 10 may be an element of a larger system in which the data transmitted may be compiled with other data , such as animal weights , so that multiple variables can be monitored and tracked in one central location . such a larger system can also include , for example , a component for generating reports , such as a bin status report , a configuration report , an alarm settings report , a feed usage report , and a bin summary report . the bin status report may illustrate an image of a feed bin showing the current weight , alarm settings , and alarm conditions . the configuration report may list the configuration for the setup menu , interface menu , and computer port . the alarm settings report may list the alarm settings for each indicator . the feed usage report may list daily feed usage sorted by date and the total feed delivered for a selected date range . the bin summary report may list the current bin weights and any alarm conditions for the feed bins . now also referring to fig4 a - c , the bin monitoring system 10 additionally includes a channel bracket 60 used to connect the bin monitoring system 10 to a leg l of the bin b . the channel bracket 60 may be generally u - shaped , being deeper at the top than at the bottom , to correspond to the shape of the bin leg l . in some embodiments , the bin monitoring system 10 includes a limiting mechanism 66 to restrict the upward movement of the channel bracket 60 . the limiting mechanism 66 prevents the bin b from lifting and blowing over when , for example , there is a gust of wind and the bin b is empty . as shown , the limiting mechanism 66 may be a stop strap having bolt apertures 68 for use with a bolt 69 to secure the strap to the frame 12 as shown in fig1 a - 1c . the channel bracket 60 further includes a slot 62 for supporting a load block 70 and is deep enough such that when the channel bracket 60 is bolted to the bin leg l and the frame 12 is secured to the concrete slab c , the channel bracket 60 extends beyond the stop strap 66 , allowing it to contact and be restricted by the stop strap 66 when the bin b is lifted too high . this configuration is also illustrated in fig2 a . in alternative embodiments , the channel bracket 60 may be replaced with a chain link suspension 80 attached to a clevis 82 , as shown in fig7 , or another similar system . now further referring to fig5 a - 5b , as previously mentioned , the bin monitoring system 10 further includes the load block 70 , which is received within the slot 62 of the channel bracket 60 and is supported by the channel bracket 60 . the load block 70 is illustrated in fig5 a - 5b as having a bolt aperture 72 . the load block 70 is placed in the slot 62 of the channel bracket 60 . a bolt 64 is then placed through a bolt aperture 72 of the load block 70 and threaded into the load cell 50 . the load block 70 can move within the slot 62 . this configuration allows for some misalignment of the channel bracket 60 . a typical feed bin has 4 , 6 , or 8 generally u - shaped legs . the bin monitoring system 10 may be placed alongside each leg l and bolted to the concrete slab c with an anchor bolt 30 through two of the flange apertures 28 a and 28 b . two more bolts 65 may be pressed through the bolt holes 64 of the channel bracket 60 to connect the bin monitoring system 10 to the bin leg l . as described above , the bin monitoring system 10 includes the bolt 18 , which secures the load cell 50 to the frame 12 . according to various embodiments , the bolt 18 also serves as a jack to lift and support the load cell 50 when the load cell 50 is suspended off of the concrete slab c . in some embodiments , the bin monitoring system 10 jacks up the bin b no higher than about 0 . 75 inches , preferably no higher than about 0 . 5 inches above the concrete slab c . because installing the bin monitoring system 10 does not require the bin b to be significantly lifted , existing bins may be retrofitted without having to empty the bin or disconnect flex augers and associated piping . to install the bin monitoring system 10 according to one example method , the load cell 50 , frame 12 , and limiting mechanism 66 are operatively connected to one another . the footpads are then disconnected from the bin legs l . next , two 0 . 5 inch holes are drilled into the bin legs l for the channel bracket 60 . in the next step , the channel bracket 60 is first mounted to the leg l such that any space in between the channel bracket 60 and the leg l is reduced . once the channel bracket 60 is attached to the leg l , the frame 12 is aligned to the bin leg l and is secured with concrete anchor bolts 30 . the channel bracket 60 further includes a threaded load cell 50 and a bolt 40 that is received in the channel bracket 60 and that functions as a jack . as the bolt 40 is rotated , e . g ., seven times , the load cell 50 is moved upwards and correspondingly moves the bin leg l upwards . in the next step , a summing box or the transmitter ( not shown ) is mounted to the bin b and is operatively connected to the load cells 50 . next , the summing box can be wired to the bin monitoring system 10 . next , wiring to the bin support frame is secured to the load cell 50 , e . g ., using one or more cable ties . the bin monitoring system 10 is then connected to the on - site network to enable communication with a remote monitoring system . next , three of the bin legs l are electrically grounded above each frame using the anchor bolts 18 . as described above , the bin monitoring system 10 can be used to determine how much feed enters and exits a feed bin . in this way , the bin monitoring system 10 facilitates the determination of when more feed should be ordered . in addition , the bin monitoring system 10 facilitates verifying how much feed is actually delivered when the bins are refilled and how much is being consumed . as a result , potential out - of - feed events can be monitored , animal performance based on feed consumption can be correlated , and future bin levels can be predicted accurately . as demonstrated by the foregoing discussion , various embodiments may provide certain benefits . for instance , the bin monitoring system 10 can greatly reduce monitoring costs . the required labor can be reduced because multiple bin feed levels can be quickly , simultaneously , and accurately monitored at a central location , as compared with the conventional approach of visually inspecting each bin individually . safety hazards can also be reduced because workers do not need to climb feed bins to inspect them . additionally , logistical savings can be realized by the bin monitoring system 10 . typically , feed mills have large demands on mondays and fridays . on these days , the mills run over capacity and often need to pay overtime to drivers and milling employees to fill tanks for the weekend or to catch up on empty tanks on mondays . on tuesdays , wednesdays , and thursdays , the mills run under capacity . the bin monitoring system 10 allows the feed mill to level its production flow out over the week by delivering feed early to some bins and just - in - time to others . accurate monitoring of feed bins allows producers to better predict and schedule when they will need to replenish the feed bins , which in turn will reduce the amount of expedited orders and allow the feed mill to plan their production . by allowing the feed mill to better plan its production , the feed mill can schedule the bottlenecks to the maximum increasing throughput . overtime is saved in both the feed mill and the trucking , and the incidence of empty compartments or “ air tons ” can be reduced . rush orders can be eliminated by better planning , thus greatly reducing the frequency of expedited orders and the associated expense . it will be understood by those who practice the embodiments described herein and those skilled in the art that various modifications and improvements may be made without departing from the spirit and scope of the disclosed embodiments . the scope of protection afforded is to be determined solely by the claims and by the breadth of interpretation allowed by law . | 8 |
fig1 shows a portion of an exemplary network for enabling protected unidirectional communication between a source node ( s ) 10 and a destination node ( d ) 12 . the primary or working communication path includes a number of intermediate nodes designated “ primary ” nodes ( p ) 14 interconnected by working segments ( ws ) 16 . also shown are a set of backup nodes ( b ) 18 , each being associated with a corresponding one of the primary nodes 14 . the backup nodes 18 are interconnected between the source node 10 and the destination node 12 by a number of protection segments ( ps ) 20 . also , each backup node 18 is interconnected with the associated primary node 14 by a corresponding pair of shunt segments ( ss ) 22 . each pair 22 includes a first shunt segment 21 for carrying traffic from a primary node 14 to the associated backup node 18 , and a second shunt segment 23 for carrying traffic from a backup node 18 to the associated primary node 14 . the various segments 16 , 20 and 22 are established at the time of connection setup , in advance of carrying any user data traffic from the source node 10 to the destination node 12 . the path consisting of the working segments 16 through the primary nodes 14 is a unidirectional path for carrying working traffic from the source node 10 to the destination node 12 , and the protection segments 20 are designated to carry protection traffic in the same direction . it will be appreciated that the nodes 10 and 12 may exchange data traffic in the other direction as well ( i . e . from node 12 to node 10 ), for which a separate set of working and protection segments ( not shown ) must be established . in general , the segments utilized for traffic in the other direction may flow through a different set of primary nodes , although in practice it is generally advantageous for traffic in both directions to traverse the same set of nodes . also , a given shunt segment 22 may serve to protect traffic flowing in both directions . in one embodiment , the segments 16 , 20 , and 22 can be realized as label - switched paths ( lsps ) as known in the multiprotocol label switching ( mpls ) architecture . they may also be realized as virtual connections ( vcs ) such as defined in the asynchronous transfer mode ( atm ) architecture , or similar pre - established connections . fig2 shows circuitry used for protection switching within the primary nodes 14 . first selection circuit 24 selects the source for traffic sent from the primary node 14 on its downstream or output working segment 16 , shown as “ ws - out ”, and second selection circuit 26 selects the source for traffic sent from the primary node 14 on its output shunt segment 21 , shown as “ ss - out ”. the inputs to the first selection circuit 24 are ( 1 ) the upstream or input working segment 16 (“ ws - in ”), ( 2 ) the as “ nc ”) when no connection 28 is selected , the output working segment 16 is not being utilized to carry traffic . this case corresponds to the presence of a failure downstream of the primary node 14 , as explained below . the inputs to the second selection circuit 26 are ( 1 ) “ no connection ” 30 and ( 2 ) the upstream or input working segment 16 (“ ws - in ”). when no connection 30 is selected , the output shunt segment 21 is not being utilized to carry traffic . this case corresponds to the normal working condition , as explained below . fig3 shows circuitry used for protection switching within the backup nodes 18 . first selection circuit 32 selects the source for traffic sent from the backup node 18 on its downstream or output protection segment 20 , shown as “ ps - out ”, and second selection circuit 34 selects the source for traffic sent from the backup node 18 on its output shunt segment 23 , shown as “ ss - out ”. the inputs to the first selection circuit 32 are ( 1 ) “ no connection ” 36 , ( 2 ) the input shunt segment 21 (“ ss - in ”), and ( 3 ) the input protection segment 20 (“ ps - in ”). when no connection 36 is selected , the output protection segment 20 is not being utilized to carry traffic . this case corresponds to the normal working condition , as explained below . the inputs to the second selection circuit 34 are ( 1 ) “ no connection ” 38 and ( 2 ) the upstream or input protection segment 20 (“ ps - in ”). when no connection 38 is selected , the output shunt segment 23 is not being utilized to carry traffic . this case corresponds to the normal working condition , as explained below . the circuitry of fig2 and 3 is used for protection switching when necessitated by failures within the network . in general , a given backup node 18 and associated protection segments 20 and shunt segments 22 are utilized to route traffic around a failure at or near the primary node 14 with which the given backup node 18 is associated . specific examples of such failures are given below . from the perspective of a given primary node 14 , failures can be categorized as having occurred at the primary node 14 itself , “ upstream ” of the primary node 14 , i . e . toward the source node 10 , or “ downstream ” of the primary node 14 , i . e ., toward the destination node 12 . a failure of a primary node 14 itself is considered to be downstream of a working upstream primary node 14 , and upstream of a working downstream primary node 14 . this specific scenario is also described below . tables 1 and 2 summarize the operation of the switch circuits 24 , 26 , 32 and 34 at a primary node 14 and associated backup node 18 based on the existence of and relative location of a failure . the contents of these tables are explained below . tables 1 and 2 are explained as follows . at a primary node 14 , in the absence of a failure , the traffic from ws - in is passed along to ws - out , and no traffic is sent on ss - out , because protection is not active due to the absence of a failure . when a failure occurs upstream of the primary node 14 , traffic is still sent on ws - out , but the source is the associated backup node 18 via ss - in . when a failure occurs downstream of the primary node 14 , traffic is still received from ws - in , but is sent to the associated backup node 18 via ss - out rather than being forwarded along the working path via ws - out . recall that from the perspective of a given primary node 14 , the failure of another primary node 14 is either an upstream or downstream failure , depending on its relative location . at a backup node 18 ( table 2 ), in the absence of a failure , no traffic is sent on either ps - out or ss - out . this is an idle or standby condition . when a failure occurs upstream of the associated primary node 14 , the backup node 18 accepts traffic from ps - in and directs it to the associated primary node 14 via ss - out . when a failure occurs downstream of the associated primary node 14 , the backup node 18 accepts traffic from ss - in and directs it along the protection path via ps - out . when the primary node 14 associated with the backup node 18 fails , then traffic is accepted from ps - in and directed along the protection path via ps - out . fig4 depicts the operation of the network in the presence of a failure on the working segment 16 - 2 extending between two primary nodes 14 - 1 and 14 - 2 . at the primary node 14 - 1 , the traffic is directed from the input working segment 16 - 1 toward the backup node 18 - 1 along the shunt segment 21 - 1 . the backup node 18 - 1 accepts the traffic from the shunt segment 21 - 1 and directs the traffic toward the downstream backup node 18 - 2 along the protection segment 20 - 2 . from the perspective of the backup node 18 - 2 and the primary node 14 - 2 , the failure is an “ upstream ” failure . therefore , the backup node 18 - 2 directs traffic from the protection segment 20 - 2 toward the primary node 14 - 2 via the shunt segment 23 - 2 , and the primary node 14 - 2 accepts the traffic from the shunt segment 23 - 2 and directs it to primary node 14 - 3 via the working segment 16 - 3 . fig5 shows operation when a primary node such as primary node 14 - 2 fails . in this case , operation of nodes 14 - 1 and 18 - 1 is the same as for the situation of fig4 , and nodes 14 - 3 and 18 - 3 operate in the same fashion as do nodes 14 - 2 and 18 - 2 in the situation of fig4 . additionally , backup node 18 - 2 forwards traffic from its input protection segment 20 - 2 toward the downstream backup node 18 - 3 via output protection segment 20 - 3 . as a result , traffic is routed around failed primary node 14 - 2 . the preceding description has focused on point - to - point connections having one source node 10 and one destination node 12 . the disclosed protection technique can also be utilized in connection with point - to - multipoint connections having a single source and multiple destinations . fig6 shows an example of a point - to - multipoint connection on which the source node 10 sends data to two different destinations 12 a and 12 b . in this simple two - destination connection , the primary node 14 - 2 is responsible for replicating the traffic on two output working segments 16 - 3 a and 16 - 3 b , and likewise the backup node 18 - 2 is responsible for replicating the traffic on two output protection segments 20 - 3 a and 20 - 3 b . the nodes 14 - 2 and 18 - 2 are referred to herein as a “ branching primary node ” and “ branching backup node ” respectively . the nodes 14 - 2 and 18 - 2 operate as shown in fig2 and 3 with respect to both the traffic stream for destination 16 a and the traffic stream for destination 16 b . generally , it is preferred that the protection switching for these different streams be carried out independently , so that for example a failure of primary node 14 - 3 b would result in protection switching occurring for the traffic for destination 12 b but no protection switching occurring for the traffic for destination 12 a . fig7 shows the existence of a failure on the working segment 16 - 3 a of the “ a ” branch of the point - to - multipoint connection . in this case , the traffic destined for destination node 12 a is directed along shunt segment 21 - 2 to backup node 18 - 2 , then along protection segment 20 - 3 a to backup node 18 - 3 a , and then along shunt segment 23 - 3 a to primary node 14 - 3 a , which forwards the traffic to destination node 12 a along working segment 14 - 4 . the traffic destined for destination node 12 b is not affected by this failure , and continues to flow along working segments 16 - 3 b and 16 - 4 b . while in the illustrated embodiments , there is a different backup node 18 associated with each primary node 14 , in alternative embodiments a node may serve as a backup node 18 for two or more primary nodes 14 , as long as the necessary working segments , protection segments , and shunt segments can be established . it is generally preferred for reliability reasons that a primary node be directly connected to its associated backup node , although it is not strictly required . by “ directly connected ”, it is meant that there are no intervening nodes that terminate network segments such as lsps . a lower - level device such as an electrical repeater or hub would generally not qualify as an intervening node . as already mentioned , there may be additional nodes within one or more of the protection segments 20 that do not participate in the protection operation as a backup node 18 . additionally , it is possible that such additional nodes are also included within the working segments 16 , although such configurations are preferably avoided . generally , it is preferred that each node along the working path from source 10 to destination 12 be protected . it will be apparent to those skilled in the art that modifications to and variations of the disclosed methods and apparatus are possible without departing from the inventive concepts disclosed herein , and therefore the invention should not be viewed as limited except to the full scope and spirit of the appended claims . | 7 |
queuing systems are found everywhere , from computing systems to networking systems to checkout lines at the supermarket . one place where queues are extensively used are inside of switches or routers . if there are more packets that want to use a resource than that resource can handle , some systems will queue those packets until the resource is able to handle them or until the packets need to be dropped for some reason . to avoid one slow or blocked resource blocking packets that do not depend on it , queuing systems will often have separate queues that can be individually enabled or blocked . by mapping independent resource sets to different queues , blocking one resource set and thus its set of queues will not block the other queues destined to other resource sets . even within a single resource set , there may be multiple queues representing different priorities . thus , in a standard queuing system , there may be many tens of thousands of queues or more . high performance queuing systems found in high performance systems such as routers are often implemented in special - purpose hardware to meet their performance requirements . in such systems , it is often the case that a single logical block that contains all of the queue state performs the entire enqueue and dequeue operations . the queue state needed by both enqueue operations and dequeue operations is the same and thus keeping a single copy of that state and implementing both operations around that single copy of the state is the obvious implementation . in these dedicated hardware cases , a sufficient number of resources are provided to support any combination of queuing operations . the required resources could include fast memories for queue state , additional contexts to tolerate long latencies to memory , combining buffers and bypasses that ensure multiple requests to the same queue are processed using the same access to the queue state and so on . such hardware systems , however , are difficult and expensive to develop . in addition , those that are hard - wired into an asic are inflexible . recently , there has been a trend towards programmable devices , such as the intel ixp network processors , that support such queuing systems in software , potentially with some hardware assist . in such devices , microcode runs on a set of small microprocessors to support almost arbitrary functionality ranging from packet classification and forwarding to queuing . such microcode is extremely difficult to write , since it must carefully manage a very restricted set of resources across several simultaneously executing threads . in addition , since such programmable devices must be general , they may not always have sufficient resources to support full - performance queuing within a single logical block . more hardware - based implementations may have similar constraints for a variety of reasons . thus , having the ability to split a queuing system into two parts has potential application in any queuing system . rather than implementing the queuing operations within a single logical block , this invention describes how to split the implementation across multiple logical blocks . this split reduces the amount of work in each logical block , thus potentially making the amount of work mappable to a physical resource , such as a micro - engine , that was not capable of supporting the entire queuing operation at the desired performance . note that it may be the case that the split duplicates some work and thus it may actually be less efficient than implementing the entire functionality in a single logical block . even in such cases , however , it is still worthwhile to perform the split if the desired functionality and performance cannot otherwise be achieved . enqueue and dequeue operations both generally require access to queue state to determine if the operation is correct and should be performed before the operation can be completed . in some systems , it is necessary or convenient to complete the check before the actual enqueue or dequeue is performed to ensure correctness . in addition , there may be additional work required that logically fits between performing the check and performing the enqueue or dequeue . in such cases , being able to split the total enqueue / dequeue operations into multiple parts can be very useful . thus , this invention is particularly useful for such systems . an example of this invention breaks the original single logical block into two blocks , block a and block b , that implement the queuing functionality . block a qualifies the operation , ensuring that the operation has the resources available to complete and is allowed to complete before passing the operation to block b that performs the operation . both blocks have their own copies of the queue information , though they may not be precisely coherent at all times . for example , on an enqueue operation , block a might read its own copy of the queue information , such as the head index , tail index and queue size , and determine whether the operation can complete . in addition , block a might also ensure that the appropriate information and resources ( perhaps that the queue state is already read into a queue state cache ) are available so that block b can complete its operation without performing any additional checks or work . if the operation can complete , block a updates its own state and passes the operation to block b for processing . the appropriate queue information ( such as the tail index to be used as the offset to write the data ) could also be passed from block a to block b . block b only needs to complete the operation and update its state . a dequeue operation might be performed in a similar fashion . block a reads its own copy of the queue information and determines whether the operation can complete . if the operation can legally complete , block a updates its own state and passes the dequeue operation to block b . block b performs the dequeue operation , reading and returning the appropriate value , and updates its queue state . block a can implement part of the enqueue operation and part of the dequeue operation , while block b can also implement part of the enqueue operation and part of the dequeue operation . another possibility is that only the enqueue operation needs to be sped up . in that case , block a may only have a count of the number of enqueue operations that can be legally completed . then , as enqueues arrive , block a uses the count to determine if the enqueue can complete , and decrements the count to ensure his information is up - to - date . as dequeues arrive , the count is checked and incremented . assuming a circular buffer to store the data , the count can also be used as an index into the circular buffer . by splitting the queuing operations into two logical blocks , each logical block has less work to do and thus potentially has more time and resources to perform other tasks . for example , red might be necessary between reading the queue state and the actual enqueue . splitting the queuing operation between two logical blocks may reduce the work one of the logical blocks needs sufficiently to allow it to perform the red operation . this invention is not limited to splitting the queuing operations into only two logical blocks . in some cases , queuing operations can be split across more than two logical blocks . for example , one logical block may perform the queue fetch into the queue state cache , the next stage may perform the correctness and any other checks , such as red , that need to be performed , and the following stage performs the actual enqueue . an example of this invention within a network processor is shown in fig5 . the queuing operations take four micro - engines : one 44 to determine if the queue state is in the queue cache , fetch the queue state into the queue cache if it is not , and perform correctness and red functions . once the enqueue has been allowed , it is passed to the enqueue micro - engine 46 that actually performs the enqueue . the next stage 48 decides which queue gets serviced and ensures that the appropriate queue state is available in the hardware queue engine cache before passing a trigger to the following stage 50 that actually performs the dequeue operation . such a structure to implement split queuing functionality is mappable to the intel ixp2400 and ixp2800 network processors . those network processors provide hardware - assisted queue engines that support a limited number of queues . when using those queue engines with a larger number of queues , the software must maintain knowledge of which queues reside in which queue resources . in addition , the software must use the interfaces provided by the queue engines that separate the correctness check from the actual operation . in such systems or similar systems it may be impossible or inconvenient to check and enqueue / dequeue in the same operation ; two operations in accordance with the present invention enable the full queuing process . in addition , other work such as determining quality of service ( qos ) operations , may need to take place between the queue state check operation ( using a “ check ” operation to the queuing engine ) and the actual enqueue / dequeue operation . such operations , for example , may block the enqueue operation , even though there is sufficient space in the queue for the value being enqueued , due to some condition such as that queue using too much bandwidth recently . such work can potentially be so expensive that it and the entire queuing operation cannot be completed by a single logical block while maintaining full performance , thus making a splitting of the queuing functionality necessary . it is also possible that some sub - operations of queuing are better implemented in different logical blocks . for example , one logical block may have easy access to a larger amount of local state but does not have fast access to the queuing engine . in such cases , the appropriate partitioning of functionality may improve performance on some metric . thus , implementing one part of a queuing operation in one logical block and another part of the queuing operation in another logical block ( and potentially further splitting the queuing operation across more logical blocks ) reduces the amount of work per block and thus potentially enables the functionality and / or enables higher performance and / or makes better use of resources by implementing the specific sub - operation in a more resource - logical place . this invention is useful in a variety of devices from pure hardware implementations such as in an asic or fpga , network processors , simultaneous multi - threaded ( smt ) processors and chip - based multi - processors ( cmp ). logical blocks are essentially separate threads of control that can be mapped to different hardware engines , micro - engines , threads or processors . while this invention has been particularly shown and described with references to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims . | 6 |
an optical receiver monitors and outputs a voltage that represents the oma of a received optical signal at the optical receiver . the voltage is a diagnostic measure of the quality of the optical communication link defined by an upstream transmitter , an optical medium and the optical receiver . the voltage provides a direct measure of signal strength , rather than an indirect calculation that uses one or more measures of a point of reference and the er of the upstream transmitter to characterize the quality of the communication link . a direct measure of communication link quality provides the ability to track vertical eye closure due to inter - symbol interference ( isi ) caused by increased transmitter rise / fall times , reduced transmitter er and increased dispersion effects in a fiber medium , etc . as described above , diagnostic monitoring based on oma is better correlated to ber performance of an optical communication link than monitors that use a measure of average optical input power . this is especially the case for optical communication links that use bandwidth - limited transmitters , bandwidth limited and / or relatively high - loss fiber media like polymer optical fiber ( pof ) and hard - cladded silica ( hcs ) fiber . an optical receiver uses automatic gain control to support the dynamic range of pof and hcs communication media ( 1 mw to 1 μw or 0 dbm to − 30 dbm ) and provides a diagnostic measurement of oma at other than a signal output . two embodiments are presented . in a first embodiment , oma , based on signal swing at an input to a signal - limiting amplifier ( or post amplifier ) in combination with an actual transimpedance gain setting is provided at a dedicated receiver output . a low - speed circuit ( i . e ., a circuit operating at a rate in the khz range or slower ) records an average of the high signal peaks and an average of the low signal peaks . thus , the low - speed circuit provides a measure of the peak - to - peak signal swing at the input to the signal - limiting amplifier . the low - speed circuit combines the measure of the peak - to - peak signal swing with the gain of the transimpedance amplifier to generate an absolute measure of oma at the receiver . for example , if the light intensity at the optical detector is very low , the transimpedance gain setting will be at a maximum gain setting . under these operating conditions , the signal swing at the output of the transimpedance amplifier will be a representation of the optical signal swing at the optical detector . when the light intensity increases to a point where the automatic gain control of the transimpedance amplifier starts to attenuate the signal to ensure that the output of the transimpedance amplifier is not limited ( i . e ., the transimpedance amplifier is not saturated ), the output of the low - speed circuit is adjusted by the gain applied at the transimpedance amplifier to accurately track the optical signal swing at the optical detector . a driver provides an analog voltage at a non - data output of the receiver . the analog voltage can be related to a measure of link quality . thus , for a particular receiver , a relationship between the analog voltage and oma swing at the receiver can be established . in addition , once a measure of the receiver noise floor is recorded or characterized , a relationship between the oma swing and ber for the communication link can be provided . in a second embodiment , oma , based on signal swing at an input to a transimpedance amplifier is provided at a dedicated receiver output . a signal or current mirror is inserted between the optical detector and a transimpedance amplifier that applies automatic gain control to ensure that the output of the transimpedance amplifier is not limited . a first output of the signal mirror is coupled to the transimpedance amplifier . a second output of the signal mirror is coupled to a fixed gain amplifier having a gain such that the output of the fixed gain amplifier will not saturate over the dynamic range of the receiver and a low - speed circuit that generates an average peak - to - peak signal swing . an optical receiver in accordance with this second embodiment will be preferably constructed with the signal mirror , transimpedance amplifier , fixed - gain amplifier , the low - speed circuit and the buffer being formed on a single substrate . the low - speed circuit provides a measure of the peak - to - peak signal swing at the output of the fixed gain amplifier . a driver coupled to an output of the low - speed circuit provides an analog voltage at a non - data output of the receiver . the analog voltage can be related to a measure of link quality . turning now to the drawings , wherein like reference numerals designate corresponding parts throughout the drawings , reference is made to fig3 , which includes a schematic diagram of an embodiment of an improved optical receiver 300 . the optical receiver 300 includes a series arrangement of an optical detector 310 , a pre - amplifier 320 and a post - amplifier 330 . the optical receiver 300 receives an optical signal at a second or output end 24 of an optical medium 20 and generates a first electrical signal labeled data on connection 333 that is an amplified version of the optical data signal received at input 302 . the first electrical signal on connection 333 and the complement signal on connection 335 are limited or clamped between the logic high voltage and the logic low voltage . in addition to the first and second electrical signals , the optical receiver 300 generates a voltage on connection 339 ( labeled oma ) that is a measure of the optical modulation amplitude at the input 302 . the optical detector 310 is coupled to the input 302 via an optical coupling mechanism 305 . the optical coupling 305 can be a butt coupling , a refractive coupling , a fiber stub , etc . the optical detector 310 is further coupled to the pre - amplifier 320 via connection 315 . the optical detector 310 is an optical - to - electrical signal converter . that is , the current on connection 315 is responsive to the time - varying light signal received via the input 302 and the optical coupling mechanism 305 . the transimpedance amplifier 322 receives the current on connection 315 and converts the same to a time - varying voltage on pre - amplifier output connection 325 , which is coupled to a signal input of the post - amplifier 330 . an indication of the gain is provided on connection 323 to the post - amplifier 330 . the pre - amplifier 320 comprises a transimpedance amplifier 322 with automatic gain control . the pre - amplifier 320 is configured to dynamically apply the automatic gain control to ensure that the amplified voltage on connection 325 at the output of the pre - amplifier accurately reflects the time - varying optical signal swing at the input 302 without saturating the transimpedance amplifier 322 . the signal limiting post - amplifier 332 receives the amplified voltage on connection 325 and generates the first electrical signal labeled data on connection 333 and its complement ( i . e ., the second electrical signal ) on connection 335 . a relatively low - speed circuit 336 receives the amplified voltage on connection 325 and the indication of the gain applied by the transimpedance amplifier 322 on connection 323 . the low - speed circuit 336 generates the difference of a first signal level and a second signal level . the difference of the first signal level and the second signal level is forwarded via connection 337 to a driver or buffer 338 , which is coupled to the connection 339 . the low - speed circuit 336 operates in the khz range or slower . the low - speed circuit 336 determines the average high signal level at the output of the pre - amplifier 320 and the average low signal level at the output of the pre - amplifier 320 and forwards the difference of these average signal levels at its output . to provide an accurate representation of the optical signal swing at the input 302 of the optical receiver 300 , the output of the low - speed circuit 336 is adjusted by the gain applied at the transimpedance amplifier 322 . for example , if a gain factor of 0 . 1 is applied at the transimpedance amplifier 322 to ensure that the output voltage is not limited and the average peak - to - peak voltage swing measured by the circuit 336 is 40 mv , the circuit 336 multiplies the inverse of the gain by the peak - to - peak voltage swing and generates an output signal on connection 337 of 400 mv . the buffer 338 is provided to ensure that external monitoring equipment does not adversely affect the diagnostic measure of oma on connection 339 . fig4 is a circuit diagram of an alternative embodiment of an improved optical receiver . the optical receiver 400 includes an arrangement of an optical detector 310 , a signal mirror 410 , a pre - amplifier 420 and a post - amplifier 430 . the optical receiver 400 receives an optical signal at a second or output end 24 of an optical medium 20 and generates a first electrical signal labeled data on connection 433 that is an amplified version of the optical data signal received at the input 302 . the first electrical signal on connection 433 and the complement signal on connection 435 are limited or clamped between the logic high voltage and the logic low voltage . in addition to the first and second electrical signals , the optical receiver 400 generates a voltage on connection 429 ( labeled oma ) that is a measure of the optical modulation amplitude at the input 302 . the optical detector 310 is coupled to the input 302 via an optical coupling mechanism 305 . the optical detector 310 is further coupled to the signal mirror 410 via connection 315 . the optical detector 310 is an optical - to - electrical signal converter . that is , the current on connection 315 is responsive to the time - varying light signal received via the input 302 and the optical coupling mechanism 305 . the signal or current mirror 410 provides a first pre - amplifier input on connection 413 and a second pre - amplifier input on connection 415 . the signal mirror 410 is a circuit designed to copy a current through one active device by controlling the current in another active device of the circuit . the signal mirror 410 keeps the output current on connection 413 and the output current on connection 415 constant regardless of pre - amplifier and post - amplifier loading ( if any ). the signal mirror 410 provides a representation of the current provided by the optical detector 310 on the connection 413 and the connection 415 . the first pre - amplifier input on connection 413 is coupled to a transimpedance amplifier 422 that receives the current on connection 413 and converts the same to a time - varying voltage on pre - amplifier output connection 423 , which is coupled to a signal input of the post - amplifier 430 . the transimpedance amplifier 422 dynamically applies automatic gain control to ensure that the amplified voltage on connection 423 at the output of the pre - amplifier 420 accurately reflects the time - varying optical signal swing at the input 302 without saturating the transimpedance amplifier 422 . an optical signal monitoring path within the pre - amplifier 420 includes an arrangement of a fixed gain amplifier 424 , a low - speed circuit 426 , and a driver or buffer 428 . the fixed gain amplifier 424 receives the second pre - amplifier input on connection 415 and forwards a time - varying amplified voltage on connection 425 . the fixed gain amplifier 424 is configured to provide a time - varying amplified voltage that is not limited over the dynamic range of the optical receiver 400 . the low - speed circuit receives the amplified voltage on connection 425 and generates the difference of an average high signal level and an average low signal level . the difference of the average high signal level and the average low signal level is forwarded via connection 427 to the buffer 428 , which is coupled to the connection 427 . the low - speed circuit 426 operates in the khz range or slower . the buffer 428 provides a measure of the oma at other than a signal output of the optical receiver 400 . the buffer 428 further ensures that any external monitoring equipment does not adversely affect the diagnostic measure of oma on connection 429 . the signal limiting post - amplifier 432 receives the amplified voltage on connection 423 and generates the first electrical signal labeled data on connection 433 and its complement ( i . e ., the second electrical signal ) on connection 435 . in this way , the post amplifier 430 generates a limited or clamped version of the optical signal received at the input 302 . the first and second electrical signals on connection 433 and connection 435 are limited or clamped to the voltage levels corresponding to a logic high and a logic low , respectively . fig5 is a flow chart illustrating a method 500 for providing a diagnostic measure of oma in an optical receiver that uses automatic gain control . the method 500 begins with block 502 where a representation of an output of an optical detector is applied to a circuit that determines a difference between a first signal level and a second signal level . thereafter , as indicated in block 504 , the difference of the first signal level and the second signal level provided by the circuit is buffered . the buffered difference of the first signal level and the second signal level is a diagnostic measure of oma . fig6 is a flow chart illustrating an embodiment of a method 600 for providing a diagnostic measure of oma in an optical receiver that uses automatic gain control . the method 600 begins with block 602 where an output of an optical detector is applied to a transimpedance amplifier that uses automatic gain control . in block 604 , the optical receiver generates a measure of oma by applying the output of the transimpedance amplifier to a circuit that determines a difference between a first signal level and a second signal level . in addition , the circuit generates a measure of oma as a function of the gain applied at the transimpedance amplifier and the difference between the first signal level and the second signal level . as explained above , the product of a gain factor and the difference is a measure of oma at the optical detector of the receiver . thereafter , as indicated by block 606 , the oma as represented by an analog voltage , is buffered . in block 608 , the buffered oma signal is coupled to an external apparatus that compares the buffered oma signal to one or more thresholds . in block 610 calibration information that associates a voltage level with an absolute oma is provided . fig7 is a flow chart of an alternative embodiment of a method 700 for providing a diagnostic measure of oma in an optical receiver that uses automatic gain control . the method 700 begins as shown in block 702 , where an electrical signal responsive to the received light at an optical receiver is provided to a signal mirror that generates first and second signal mirror output signals . in block 704 , a first representation of the first signal mirror output signal is generated using a fixed gain amplifier that does not become saturated over the dynamic range of the optical receiver . in block 706 , a difference of an average high signal level and an average low signal level in the first representation of the first signal mirror is determined . thereafter , as indicated in block 708 , a measure of oma is generated by buffering the difference of the average high signal level and the average low signal level . in block 710 , a second representation of the second signal mirror output signal is generated using a transimpedance amplifier that applies automatic gain control . in block 712 , differential output signals , responsive to the electrical signal are generated by applying the second representation to a signal limiting amplifier . in block 714 , the measure of oma is coupled to an external device ( i . e ., an apparatus other than the optical receiver ) that applies one or more thresholds to generate a measure of optical communication link quality . in block 716 , calibration information that associates the measure of oma with an absolute oma at the optical receiver is provided . the particular sequence of the steps or functions in blocks 702 through 712 is presented for illustration . it should be understood that the order of the steps or functions in blocks 702 through 712 can be performed in any other suitable order . the steps or functions in block 714 and block 716 are optional . while various embodiments of the optical receiver systems and methods for providing a measure of oma at an optical receiver that uses automatic gain control have been described , it will be apparent to those of ordinary skill in the art that many more embodiments and implementations are possible that are within the scope of this disclosure . accordingly , the described optical receiver systems and methods for providing a diagnostic measure of oma at an optical receiver that uses automatic gain control are not to be restricted or otherwise limited except in light of the attached claims and their equivalents . | 7 |
referring to fig1 and 2 , the boring tool 1 is provided at its free end with two interchangeable hard metal cutting plates 2 . the shank 3 of the boring tool 1 has a central bore 4 for the passage of a cooling medium , which bore terminates , at the leading end of the boring tool , in two openings 5 . cooling medium is supplied through the bore 4 and the openings 5 directly to the region of the cutting plates 2 . instead of a liquid cooling medium , it may in some cases , be necessary to supply compressed air through the bore 4 and openings 5 . on the cylindrical shank 3 of the boring tool 1 is rotatably mounted a cooling medium supply ring 6 which is formed with an annular duct 27 connected to the cooling medium bore 4 by a transverse bore 8 . by providing an accurate fit between the cooling medium supply ring 6 and the shank 3 of the tool , these two parts are sealed with respect to each other . the cooling medium ring 6 is provided with a radially projecting coupling piece 7 . this coupling piece 7 is slidable radially in the direction r over a nipple 12 screwed into the cooling medium ring 6 and can be secured by means of a clamping screw 9 ( fig2 ). the coupling piece 7 has in addition a flat sealing surface 10 into which a substantially radially extending inlet bore 11 extends . this inlet bore 11 is connected with a bore through the nipple 12 and , via the latter , with the transverse bore 8 . rotatably mounted in a housing 13 of a working center is a drive spindle 14 . a supporting ring 15 may be subsequently fixed to the housing coaxially with the spindle 14 . this supporting ring 15 has an axially extending bore 16 in which the shaft 17a of a coupling head 17 is slidable in the direction a parallel to the axis a -- a of the shank 3 and can be secured by means of a screw 18 . the axis a -- a of the shank 3 is coaxially aligned with the central axis of the drive spindle 14 as soon as the boring tool 1 is inserted in the drive spindle 14 . on the shaft 17a of the coupling head 17 there is additionally rotatably mounted a coupling ring 19 to which is connected a supply pipe 20 for the cooling medium . the rotatable arrangement of the coupling ring 19 has been chosen in order to provide an arrangement which is as adaptable as possible . if desired , the supply pipe 20 could instead be fixedly connected to the shaft 17a . the coupling head 17 projects into the region radially outside the cooling medium supply ring 6 and in this region is provided with a substantially radially inwardly extending cooling medium outlet bore 21 . this cooling medium outlet bore 21 is either located in the same radial plane as the cooling medium inlet bore 11 or may be brought into the same radial plane as the latter by axial adjustment of the coupling head 17 . the coupling head 17 is also provided with a flat sealing surface 22 . the outlet bore 21 extends into this sealing surface 22 . the sealing surface 22 is inclined , circumferentially of the cooling medium supply ring 6 , with respect to a tangent line t ( fig2 ) extending through the outlet bore 21 approximately perpendicular thereto . in this case , it is a line question of a tangent to a circle k which is concentric with the axis a -- a of the tool shank 3 . the inclination of the sealing surface 22 circumferentially with respect to the tangent line t is at an acute angle α of about 2 ° to 10 °, preferably 6 ° to 8 °. the circumferential inclination of the sealing surface 22 is moreover such that the distance m thereof from the axis a -- a of the spindle 3 becomes progressively less in the rotational direction d of the boring tool . the sealing surface 22 , in the example shown , extends , in the direction of the axis a -- a of the tool shank 3 , parallel to the axis . if desired , however , the sealing surface could instead be inclined , as shown by the chain - dotted line 22a , toward the free end of the boring tool and away from the axis of the tool shank at an acute angle β , which angle may be as large as 10 °. the sealing surface 10 of the coupling piece 7 is inclined in the same directions and at the same angle as the sealing surface 22 , so that the two sealing surfaces 10 , 22 can , in the coupled condition , lie parallel to and in contact with each other in a good sealing relationship . the boring tool is inserted in the drive spindle 14 , together with the cooling medium supply ring which is arranged thereon so as to be freely rotatable , by means of a tool changer , the coupling piece 7 being disposed at any desired angle with respect to the coupling head 17 . when rotation is imparted to the boring tool 1 by the drive spindle 14 , the cooling medium supply ring 6 will also be caused to rotate by the friction between the tool shank 3 and the said ring 6 until the sealing surface 10 of the coupling piece 7 comes into engagement with the sealing surface 22 of the coupling head 17 . in connection with the choice of the angle α , it is important that this angle should be neither too great not too small , so that a predetermined contact pressure between the two sealing surfaces 10 , 22 will be attained . on the one hand , this contact pressure must be small enough to ensure that the stream of cooling medium discharged from the outlet bore 21 will not force the two coupling parts 7 , 17 apart from each other . on the other hand , the angle α must not be too small to ensure that the sealing surfaces 10 , 22 will also assume the correct relative position in which the two bores 11 , 21 are in alignment with each other . also , that edge of the coupling piece 7 which is the leading edge in relation to the direction of rotation should not be prematurely jammed against the coupling head 17 . an angle of from 6 ° to 8 ° has thus proved to be the most suitable in this connection . a positive adjustment of the relative position of the sealing surfaces 10 , 22 can also be effected by radially adjusting the coupling piece 7 after loosening the screw 9 . if the angle β is made greater than 0 °, a locking of the coupling piece 7 and the coupling head on the withdrawal of the boring tool 1 from the drive spindle 14 , should the boring tool not be withdrawn exactly in the axial direction , will be avoided . further , it is advantageous if the free end 17b of the coupling head 17 is made conical or wedge - shaped . due to this wedge - shaped construction , the coupling piece 7 , on insertion of the boring tool 1 into the drive spindle 14 , will be displaced in the direction of rotation or in the direction opposite to the direction of rotation if it should by chance strike directly against the coupling head 17 . for boring tools , the axis a -- a of the shank of which extends horizontally in operation , it is furthermore advantageous to mount a counter - weight 23 on the cooling medium supply ring 6 diametrically opposite the coupling piece 7 , which counter - weight should advantageously be radially adjustable . the radial adjustability may for example result from the counterweight 23 having a female screw - thread and being capable of being screwed on a screw - threaded stud 24 . a securing screw 25 prevents undesired rotation of both of these parts . by means of the counterweight 23 , the weight of the coupling piece 7 is balanced , so that even a small amount of friction between the tool shank 3 and the cooling medium supply ring 6 is sufficient to cause the latter to be rotationally entrained when the boring tool 1 is rotating . if no counter - weight 23 is provided , the coupling piece 7 may in certain circumstances be too heavy to be entrained for rotation in the direction d from a downwardly hanging position . in the case of vertically arranged boring tools , a counter - weight may be dispensed with . a second advantageous embodiment is illustrated in fig3 and 4 . in so far as the parts thereof have the same function as in the first constructional embodiment , they are indicated by the same references . the above description is correspondingly applicable . in the embodiment illustrated in fig3 and 4 , the coupling piece 7 &# 39 ; is secured by screws directly onto the outer circumference of the cooling medium supply ring . the coupling head 17 &# 39 ; advantageously consists of a holder 30 , which is adjustable axially with respect to the axis a -- a of the tool shank 3 and a tube 32 which is slidable in a transverse bore 31 in the holder 30 . the tube 32 can be clamped tight in the transverse bore 31 by means of a clamping screw 33 . the tube 32 can thus be adjusted approximately in the radial direction r1 , exactly at right angles to the two sealing surfaces 10 &# 39 ; and 22 &# 39 ;. for the axial adjustment of the coupling head 17 &# 39 ;, the holder 30 may have a screw - threaded stud 34 extending parallel to the axis a -- a of the tool shank 3 , which stud can be screwed into a female screw - threaded bore 35 provided in the supporting ring 15 &# 39 ; and can be fixed in position by means of a lock nut 36 . after loosening the lock nut 36 , the holder 30 can be adjusted by rotating it about its own central axis , whereby the indication of the sealing surface 22 &# 39 ; of the tube 32 can at the same time be adjusted to suit that of the sealing surface 10 &# 39 ; of the coupling piece 7 &# 39 ;. as regards the positions of the sealing surfaces 10 &# 39 ; and 22 &# 39 ; relatively to the central axis a -- a of the tool shank 3 , the information given in connection with the embodiment according to fig1 and 2 applies correspondingly . in the embodiment illustrated in fig3 and 4 , the two sealing surfaces 7 &# 39 ; and 22 &# 39 ; are inclined towards the free end of the boring tool and away from the axis a -- a of the tool shank 3 at an acute angle β of about 2 °. the central axis of the tube 22 is also correspondingly inclined at the angle β with respect to a radial plane at right angles to the said axis a -- a . the manner in which this embodiment operates when changing tools is the same as in the embodiment described previously . the flat end surface of the tube 32 at the same time constitutes the first sealing surface 22 &# 39 ;. in order to improve the sealing action between the two sealing surfaces 10 &# 39 ; and 22 &# 39 ; still further , an o - ring 37 may be arranged in a seating or annular recess in the flat sealing surface 22 &# 39 ; of the coupling head 17 &# 39 ;- which surface in this case is the lower end surface of the tube 32 -- the o - ring surrounding the outlet bore 21 of the said tube 32 and projecting only slightly from the flat sealing surface 22 &# 39 ;. the device according to the invention for supplying cooling medium is suitable for every kind of rotary cutting tool which operate with a cooling medium , and hence not only for boring tools but also , for example , for milling cutters , boring bars and inside turning tools . | 8 |
fig2 shows the overall flow of the path abstraction based floorplanning in the context of an overall physical design methodology , according to the present invention . for clarity sake , the inventive steps are placed within the context of a conventional physical design flow ( fig1 ). the main steps are highlighted within a dashed box shown on the top right hand side of fig2 . from the input design netlist , an abstract / virtual model of the netlist is constructed . the floorplanning step uses the virtual model of the netlist ( instead of the detailed design netlist ) and constraints computed by the floorplan constraint generation step in order to determine locations for the floorplan objects of interest . the coordinates of the floorplan objects as determined by the floorplanner make use of the virtual model to update locations of the objects in the original design netlist . the remaining physical design steps , i . e ., placement and routing , utilize floorplan information from the updated design netlist . the virtual model of the design netlist will be referred to hereinafter as “ annotated abstract netlist ”, “ annotated abstract hypergraph ” or , simply , “ abstract netlist ”. objects are referred to as nodes or vertices , and the connections , hyper - edges . nodes of the “ annotated abstract hypergraph ” ( representing a virtual model of the design netlist ) are designated “ floorplan objects of interest ” and hyper - edges are referred to as connections between floorplan objects of interest . ( note : a hypergraph is a data structure that represents a set of objects and connections linking them ). the hyper - edge is also provided with annotations ( or attributes ) associated with it , with the annotations representing attraction and repulsion constraints ( which are used by the floorplan optimization algorithm ) between objects that are connected by the hyper - edge . ( the terms abstract netlist and abstract hypergraph may be used interchangeably ). referring to fig3 a that illustrates a sample design netlist , boxes referenced by l 1 , l 2 , l 3 and l 4 denote the “ floorplan objects of interest ”, whose locations on the chip are to be determined by floorplanning . circles identified as d 1 , d 2 , d 3 , d 4 , d 5 and d 6 denote the dust logic or leaf cells in the netlist . lines referenced by n 1 , n 2 , n 3 , n 4 , n 5 , n 6 , n 7 , n 8 and n 9 represent nets or connections between design objects in the netlist . referring back to the dashed box on the top right hand corner of fig2 the process of creating the virtual model of the detailed design netlist , consists of an abstract netlist generation step followed by net bundling . construction of the virtual model is initiated when the abstract netlist generation step is applied to the illustrative example design netlist . floorplan objects of interest are identified in the original design netlist , a process referred to as “ marking ”. for the example of fig3 a , the marked floorplan objects of interest are design objects l 1 , l 2 , l 3 , and l 4 . the abstract netlist generation step consists of a tracing algorithm that is executed on the original netlist . the tracing algorithm starts from a floorplan object of interest searching for a path leading to another object of interest . a path ( i . e ., a sequence of design objects , such as leaf cells or dust logic — cells other than the marked floorplan objects of interest ) and real interconnections ( or nets ) in the original netlist ) begins at a floorplan object of interest and ends on a second floorplan object of interest . in the present example , the path shown is a sequence starting in floorplan object of interest l 1 , proceeding through n 1 , d 1 , n 3 , d 2 , and n 5 , ending in the floorplan object of interest l 2 . the abstract netlist generation step identifies all the paths in the design netlist between marked floorplan objects of interest . all the paths that are identified as a result of the abstract netlist generation step for the example netlist in fig3 a are : path 1 : l 1 , n 1 , d 1 , n 3 , d 2 , n 5 , l 2 : path 2 : l 1 , n 1 , d 1 , n 3 , d 3 , n 6 , l 2 : path 3 : l 1 , n 2 , d 4 , n 4 , d 5 , n 7 , l 2 : path 4 : l 1 , n 2 , d 4 , n 4 , d 5 , n 7 , l 3 : path 5 : l 1 , n 2 , d 4 , n 4 , d 6 , n 8 , l 3 : path 6 : l 4 , n 9 , d 6 , n 8 , l 3 . the result of applying the abstract netlist generation step on the design netlist is shown in fig3 b . the step of identifying all the paths between floorplan objects of interest may result in multiple paths between the same two floorplan objects of interest . hereinafter , paths having the same starting and ending floorplan objects of interest will be referred to as “ parallel ” paths or connections . parallel paths can be advantageously grouped by way of net bundling to reduce the total number of connections in the abstract netlist that is generated . the task of net bundling is performed immediately following the execution of the tracing algorithm in the abstract netlist generation step . applying net bundling to the result of the abstract netlist generation step generates the final “ annotated abstract hypergraph ” or “ annotated abstract netlist ” as shown in fig3 c . multiple parallel connections ( paths ) existing between floorplan objects of interest ( fig3 b ) are collapsed into a single connection or abstract hyper - edge , having a width that corresponds to the number of individual paths that were merged . by way of example , in fig3 b , the three connections between l 1 and l 2 are merged into a single annotated abstract hyper - edge ( connection — with the corresponding path count and unique cell count annotations ). annotations on abstract hyper - edges consist of two parts and provide the following information : 1 ) the total number of paths between the two objects of interest , and 2 ) the number of cells on the longest path between objects of interest . the latter may contain information such as the total number of unique cells among all the paths between two objects of interest . still referring to fig3 c , the first abstract hyper - edge , denoted by an 1 connects cell l 1 and l 2 . the annotation (# paths = 3 , # cells = 5 ) on abstract net an 1 is formed by the previously described merging of paths 1 , 2 , and 3 . the second part of the annotation denoted by # cells = 5 denotes the list of cells d 1 , d 2 , d 3 , d 4 , and d 5 , resulting from merging paths 1 , 2 , and 3 . in an alternate representation , the second part of the abstract hyper - edge annotation , may also be expressed in terms of the total area of the cells instead of the count , without any loss of generality . the next step generates floorplan constraints using the abstract netlist created in earlier steps . as previously described , the goal of floorplanning is to find locations for all the floorplan objects of interest identified in the abstract netlist . connectivity between floorplan objects of interest serves as one aspect of the constraints for the floorplanner . these constraints dictate how close the floorplan objects of interest should be , i . e ., the “ attraction ” constraints between them . another aspect of the constraints is to model the space needed for the design objects not present in the abstract netlist . these space requirements are modeled as “ repulsion ” constraints between floorplan objects of interest . as mentioned earlier , the simulated annealing engine serves as a basis for the floorplanner . practitioners of the art will readily realize that other optimization techniques may be used for this purpose as well as for placing objects of interest . the objects are floorplanned such that the attraction constraints draws them in close proximity to each other when placed on the chip layout . each attraction constraint is modeled as a connection with a weight proportional to the number of paths between the objects of interest ( determined during the abstract netlist generation step ). the floorplanner then minimizes the length of the connections representing the attraction constraints . repulsion constraints are modeled by the artificial area expansion of the floorplan objects of interest . with reference to the abstract netlist shown in fig3 c , the area of the floorplan objects of interest l 1 and l 2 are expanded to account for the design objects : d 1 , d 2 , d 3 , d 4 , and d 5 , that were removed during the netlist abstraction step . information related to connections between floorplan objects of interest is provided to the floorplanner by the abstract netlist . this is illustrated in fig2 where the arrow leaving the oval represents the abstract netlist to the floorplanner . annotations on the abstract hyper - edges of the abstract netlist are used in the floorplan constraints generation step , to obtain the aforementioned attraction and repulsion constraints that are directly used by the floorplanner . in fig2 this is shown by the arrow between the output of the floorplan constraint generation step to the floorplanner . the output of the floorplanner are locations of the floorplan objects of interest on the chip layout . for the example illustrated in fig3 a , the floorplan is shown in fig3 d . therein , floorplan objects of interest l 1 , l 2 , l 3 and l 4 are assigned locations ( x 1 , y 1 ), ( x 2 , y 2 ), ( x 3 , y 3 ), and ( x 4 , y 4 ) on the two - dimensional layout of the chip . hereinafter , details pertaining the main objectives of the invention , such as abstract netlist generation , net bundling , floorplan constraint generation and floorplanning steps will be described . in this section , the main algorithm that creates an abstract netlist from a given design netlist will be explained with reference to the dashed box in the top right hand corner of fig2 . the abstract netlist generation step starts following a description of the algorithm . shown in fig4 is a top level view of the abstract netlist generation algorithm . there are two distinct phases in the abstract netlist creation process , namely : marking phase , where floorplan objects of interest are identified in the design netlist , and abstract network generation or tracing phase , wherein paths between floorplan objects of interest are identified as abstract or virtual interconnections between objects . the result of the marking phase is a list of design objects : the marked object of interest list . the network generation phase accepts the list of floorplan objects of interest and computes the set of paths among the floorplan objects of interest . the output of the abstract network generation phase is a list of abstract hyper - edges ( or abstract nets representing the paths ). the abstract hyper - edge is a data structure consisting of the following information : list of unmarked objects ( design objects in the netlist that are not floorplan objects of interest ), existing in the path between the source and destination floorplan objects of interest ; the abstract network generation phase performs a path enumeration starting from each of the marked floorplan objects of interest . path enumeration is known to be a problem that increases exponentially . in order to limit the complexity of the problem , the abstract network generation algorithm is provided with parameters to control the execution of the algorithm . these will be discussed hereinafter along with the abstract network generation algorithm . the marking phase refers to the process of identifying floorplan objects of interest in the original design netlist . classes of objects / individual objects are identified and marked on the original netlist . the classes of objects most commonly supported are : latches , ios , macros , large objects , and fixed objects . individual objects of interest may also be marked in a given design netlist ( i . e , an abstract netlist includes marked objects of interest falling into more than one of the categories ). the marking process can be static or dynamic . for the static case , objects of interest are predetermined and the subsequent network generation algorithm does not have any control over which objects of interest are to be marked ( i . e ., start / stop points for the abstract network tracing algorithm ). for the illustrative netlist shown in fig3 ( a ), the design objects l 1 , l 2 , l 3 , l 4 are identified as floorplan objects of interest . the output of the marking phase for this example is the list of floorplan objects of interest (& lt ; l 1 , l 2 , l 3 , l 4 & gt ;) which is used by the next phase of abstract network generation . this illustrates static marking , where the list of floorplan objects of interest are not changed , remaining the same throughout the process of floorplan object of interest identification ( marking ), abstract network generation ( tracing ), and the like . static marking is the most commonly used mode of performing the marking process . this function marks all the cells that fall within a particular type of cell . the function identifies a large object based on the number of circuit rows occupied by it ; a macro , by the presence of any child elements within ; io and latches based on their cell property . once identified , these cells are tagged in the design netlist to be objects of interest . the result of the marking process is shown on the top right hand side of fig4 b . therein is shown the illustrative design netlist introduced in fig3 a following the marking process . in fig4 b , the marked floorplan objects of interest , i . e ., l 1 , l 2 , l 3 , l 4 , are depicted by dashed boxes . cells are also individually marked . typically , for the floorplanning , i / os , macros and large objects are marked to be of interest . ( these are the objects whose location on the layout needs to be determined by the floorplanner ). in the case of static marking , the list of identified floorplan objects of interest are not modified during the marking process . in addition to the floorplan objects of interest , one may also determine that some design objects ( not identified to be a floorplan object of interest ) need to be marked as additional floorplan objects of interest in order to improve the abstract netlist being generated . the identification of these additional floorplan objects of interest based on properties of the design netlist is referred to as “ dynamic marking ”. the basic property used for identifying additional floorplan objects of interest requires that the total number of inputs and outputs from a single design object exceed a pre - defined threshold . ( if certain design objects in the netlist have a high number of pins associated with them ). if this property is satisfied and the design object satisfying this property has not already been marked , then the additional design object becomes a primary candidate for marking . this phase refers to the task of generating the abstract network between objects of interest that were marked in the previous phase . the basic network generation algorithm is a modified depth first search on the design netlist . the algorithmic process , generateabstractnetwork , addresses the main abstract netlist ( hypergraph ) generation as follows : i . hyper - edgevector = tracenets ( n , foi ) the algorithm ‘ generateabstractnetwork ’ accepts the design netlist and a vector of marked floorplan objects of interest . the vector is a standard data structure that contains a list of elements of a given type . it provides random access to elements , allows for a constant time insertion , removes elements at the end of the vector , and provides linear time insertion and removal of elements at the beginning or in the middle of the vector . a vector can , generally , be viewed as having the same meaning as a linked list . more information regarding vectors can be found in a c ++ text , like “ the c ++ programming language ” by bjarne stroustrup . steps 2 - 6 of the algorithm are initialization steps . each design object has a flag referred to as “ visited ” associated with it . the flag is set during the recursive tracing algorithm tracenet , if the particular design object was visited during the process . the nodevector is a vector of design objects ( which are not floorplan objects of interest ) that were abstracted in the process of searching for a path to other floorplan objects of interest from the starting floorplan object of interest ( foi ). this nodevector is constructed as a result of executing tracenet on each of the floorplan objects of interest belonging to the vector containing the objects of interest . step 7 addresses the main loop that encompasses the list of floorplan objects of interest , executing the tracenet for each net connected to the floorplan object of interest . the result of executing tracenet is the creation of a vector of abstract hyper - edges representing alternate paths from certain floorplan objects of interest to other floorplan objects of interest . the list of hyper - edges obtained from a single call to tracenets is merged into the global list of abstract hyper - edges , represented by the variable abstracthyper - edge vector . step 7 ii illustrates the merging step . for the example illustrated with reference to fig3 ( a ), following completion of the marking process , the input to generateabstractnetwork is a vector containing the four floorplan objects of interest l 1 , l 2 , l 3 , l 4 . tracenet is executed for each of the objects . for instance , for object l 1 ( fig3 a ), in step 7 of generateabstractnetwork , there are two calls made to tracenet , one to net n 1 , and the other to net n 2 . the first call tracenet ( l 1 , n 2 ) results in a vector of abstract hyper - edges . referring to fig3 b , the vector of abstract hyper - edges contains two paths : path 1 and path 2 . the second call to tracenet with floorplan object of interest l 1 , tracenet ( l 1 , n 2 ) ( i . e ., with net n 2 ) results in a vector of abstract hyper - edge containing path 3 . 6 . for each design object d belonging to net n do a . if d is a floorplan object of interest then c . else /* d is an unmarked design object in the the above process tracenet recursively traces the nets for each marked floorplan object of interest , with the intent of finding paths between objects of interest . certain controls exist with which the user controls the overall recursive tracing process . the user can opt to ignore tracing from special nets . clocks or scan nets having a very large fan - out are examples which the user may ignore while creating the abstract netlist . other commands may be used to control the tracing that imposes a limit on the logic depth . if this constraint is set by the user , then the tracing algorithm identifies only those paths ( between the floorplan objects of interest ) having the total number of unmarked design objects thereon to be less than the constraint specified by the user . steps 2 , 4 of tracenet implement these controls in the tracing process . the variable logicdepthconstraint in step 4 reflects the user defined logic depth constraint . if the current number of logic levels ( kept track of in the variable logiclevels by the tracing process in algorithm tracenet ) exceeds this constraint , then the tracing process is brought to a stop . the for loop in step 6 addresses each design object connected to the net . the if statement in step 6 a checks whether the design object is a floorplan object of interest . if the answer is yes , then an abstract hyper - edge ( path ) is established between startfoi ( the floorplan object of interest with which the tracing process started ) and d ( the current design object ). referring to fig3 b , this step of the algorithm creates an abstract hyper - edge ( path 1 in fig3 b ) between l 1 and l 2 , and sets the list of unmarked design objects ( that have been abstracted away ) on this abstract hyper - edge to be equal to d 1 and d 2 . the variable activepathvector denotes the set of unmarked design objects that are currently in the path ( abstract hyper - edge ) being constructed by the tracing process . each design object has a “ visited ” boolean attribute associated with it . this attribute indicates whether the design object was already reached and identifies that a loop was detected , which would then be ignored . the way of breaking loops among design objects is shown by the else if statement in step 6 ( b ) of tracenet . step 6 c shows the step of recursive stepping through unmarked design objects ( non - floorplan objects of interest ) of the netlist . the algorithm at step 6 c implies that the current design object d is not a floorplan object of interest , and that it is not a loop . in the sub - steps following step 6 c , the design object d is marked as visited , saved into activepathvector and nodevector , and a recursive call is made from each net connected to the design object d , thereby seeing through or ignoring the non - floorplan objects of interest during the tracing process . fig6 a shows an input hypergraph with marked vertices { a , b , c , d }. the top - level abstract network generation algorithm accepts such a hypergraph with marked vertices , invoking the recursive net tracing algorithm for each of the vertices a , b , c , d . each vertex has the attribute visited . if it is set , it is an indication that the particular design object was visited during the recursive tracing . saving design objects being recursively stepped through into a “ node vector ” and resetting their visited attribute before calling tracenet for the next marked floorplan object of interest in the top - level function ensures that all the paths between the floorplan objects of interest are represented in the final abstracted hypergraph . in the example of fig6 a , during the creation of abstract hyper - edges ( a , c ) and ( a , d ) in the first call of tracenet ( a , e 1 ), intermediate nodes 1 , 2 , 3 are marked visited . had the node vector color resetting not been used , then the path ( a , d ) through nets e 4 , e 6 and intermediate design object 4 , would not have be found . this is because the net tracing algorithm starting from node b stops at node 3 , as this node would already have been marked as visited . this example illustrates why a conventional depth first traversal is inadequate for the abstract hypergraph generation problem being solved by the abstract network generation algorithm presented herein . the result of the abstract network generation algorithm is a vector of abstract hyper - edges that are represented as path 1 , . . . , path 6 , in fig3 b . the annotations on these abstract hyper - edges are used by the floorplan constraint generation phase to generate the constraints that drive the floorplanner . thus , making the floorplanner aware of the intermediate logic that was abstracted allows the floorplanner to account for the real estate required to place the abstracted intermediate cells . the next section describes the net bundling technique . net bundling step identifies parallel connections and reduces the number of abstract hyper - edges in the network generated by the netlist abstraction process . furthermore , during this process it generates the final annotations on the abstract hyper - edges . once the abstract netlist is generated , other abstract nets or connections between the same sets of floorplan objects of interest may be put in place . for example , in fig3 b , the abstract netlist generation step created three abstract nets or interconnections between the floorplan objects of interest l 1 and l 2 . a widely used metric to drive / evaluate a floorplanner is provided by the total interconnect wirelength ( twl ). during the process of annealing , objects are moved around on the chip layout and the wirelengths are recomputed after each move to evaluate the quality of the floorplan . when a floorplan object is moved from its original position to a new position , the length of the nets connected to that object is no longer valid . in order to evaluate the goodness of this move , the length of the nets belonging to that object is recomputed . if the object contains a large number of terminals , then the process of recomputing the nets significantly increases the run - time . in order to reduce the run - time of the wirelength estimation and of the annealing algorithm , the concept of net - bundling is introduced . net - bundling identifies “ parallel edges ” ( connections ) in the abstract netlist ( or hypergraph ) of the given design and bundles them as a single edge . parallel connections are defined as connections in the netlist that link the same set of floorplan objects of interest . referring to fig3 b , paths p 1 , p 2 and p 3 span between floorplan objects l 1 and l 2 . thus , these paths are parallel edges . the three paths can be merged into one ( represented by abstractnet an 1 in fig3 c ). the formation of a single annotated hyper - edge : an 1 from three separate abstract nets denoted by path 1 , path 2 , and path 3 is shown in fig5 b and 5 c . assuming that each path pi is associated with a weight w pi . the weight reflects the criticality of the path . then , the total weighted wirelength for all the paths between the floorplan objects l 1 and l 2 is : where l p1 , l p2 and l p3 represent the length of the paths p 1 , p 2 and p 3 , respectively . in order to compute wl ( l1 , l2 ) without using net ( or path ) bundling , three multiplications and two additions are required . however , with net bundling , the three paths are represented as a single path bundle pb with a weight w pb such that the wirelength of path pb is the same as that of paths p 1 , p 2 and p 3 . thus , the total weighted wirelength using path bundling is calculated as : resulting in a only one multiplication . it can be seen that this result is the same as the one obtained by resorting to net bundling , except for certain redundant computations that were removed and which , in turn , reduced the time required for computing the wirelengths . output : list of abstract hyper - edges with updated annotations after bundling : olist the above algorithm provides an overview of net bundling . the input to this process is a vector of abstract hyper - edges that was created by the abstract netlist generation process . this is denoted by the variable ilist . the function isparallel accepts two abstract hyper - edges ( e . g ., path 1 , path 2 in fig5 b ) and checks whether the source and destination of both abstract hyper - edges is the same . if they are , it returns true ; otherwise , it returns false . the mergehyper - edges function in step 4 . i . 1 of the net bundling procedure accepts two abstract hyper - edges that are parallel , and increments the path count annotation between the source and destination floorplan objects of interest , merging the two lists of unmarked objects that occur on the hyper - edges being combined . merging is achieved by removing duplicate design objects between the hyper - edges being merged . the cell count is correspondingly set by the size of the merged list of abstracted design objects . referring to fig5 b and 5 c , net bundling results in generating the bundled abstract nets an 1 , an 2 , and an 3 along with the annotations from the list of paths : path 1 , path 2 , . . . , path 6 , that were generated by the abstract network generation step . the abstraction model modifies the original netlist in two ways . firstly , it reduces the number of objects seen by the floorplanner , i . e ., the number of objects requiring to be floorplanned are fewer than the number of placeable objects in the design . secondly , the abstraction model removes nets from the original netlist and adds new nets in the abstract netlist seen by the floorplanner . following is described a method of modeling changes so that the floorplanner can be driven effectively . the attraction between two floorplan objects depends on : 1 ) the number of paths between two objects , and 2 ) the number of objects abstracted out between them . the larger the number of paths , the higher the attractive force between the floorplan objects . however , if a large number of objects is abstracted between objects , then the attraction force loses some of its effectiveness . thus , the attractive force f a ( i , j ) between two objects i and j is directly proportional to the number of paths ( np ), and inversely proportional to the number of objects ( na ) abstracted between them . thus , if k a is a proportionality constant , then the force equation becomes : assuming k a = 1 , the attraction constraints for the example shown in fig3 c become objects that are abstracted are real design objects that share the placement area with the floorplan objects of interest when the chip is completed . ( an object in the design that is not a floorplan object of interest is referred to as an abstracted object ) thus , it is important to keep this factor in mind when floorplanning with an abstract netlist . if these objects were not considered , it is possible to generate a floorplan purely based on attraction constraints , and the floorplan objects may end being placed abutting with each other . this is an unsatisfactory solution and , thus , space must be allocated for the placement of objects that are abstracted out . allocation of space for abstracted logic is achieved by considering the area of design objects abstracted out . the total area of all the design objects that were abstracted in a path p is added , and proportionally distributed among the floorplan objects on that path . alternatively , one may temporarily increase the size of the floorplan objects to account for the area of the abstracted objects . the area increase of the floorplan objects is proportional to the respective original areas . since the abstracted objects appear in multiple paths , only a fraction of their areas for each path in which they appear will be distributed . otherwise , more space is allocated than needed for the objects abstracted out . thus , for e . g ., if an abstracted object ai having an area aai appears in three paths , then , an area is allocated equaling aai / 3 for each path where it appears . let a ( i , j ) be the sum total of the fractional area of all the objects abstracted out between floorplan objects i and j contained in path p . let ai and aj be the original areas of the objects i and j , respectively . the area of objects i and j increases as follows : the increased areas for the objects l1 and l2 from path 1 in fig3 b becomes where a is the fractional area of the two objects d1 and d2 abstracted out in the path 1 between objects l 1 and l 2 . each floorplan object thus get its area increased based on the objects abstracted out in each path which starts or ends with it . during floorplanning , the optimizer sees the increased size of the floorplan objects and generates a floorplan with spaces between them . a subsequent placement program can then place the abstracted out objects in the spaces created by the floorplanner . a solution to the floorplanning problem is positioning all the floorplan objects of interest on the chip layout . a multi - constrained floorplan optimization technique refers to a method of finding a placement solution for the floorplan objects of interest that optimizes a number of cost objectives . an important cost objective for a floorplanner is to minimize the total interconnection length . in the present case , attraction constraints introduced by the abstraction model are represented by weighted interconnection lengths . also , for a given solution , the arrangement of the floorplan objects can be such that two or more of them may overlap . it is typical for any floorplanner to model the overlap score into the set of cost functions that are minimized . overlaps are minimized as well . thus , the cost function has two objectives to be minimized , which are : 1 ) attraction constraints represented as weighted interconnection lengths , and 2 ) the total overlaps . the cost function c s is represented for a given floorplan solution s as where k l and k o are constants , l is the total weighted interconnection length ( of the abstraction constraints ) and o , the total overlap score . note that in this framework other constraints ( such as timing , displacement , and the like ) may be added to the cost function as well . simulated annealing can be advantageously used for the underlying floorplanner . its randomized optimization allows modeling multiple constraints to drive the solution process . the annealing process begins with a random initial solution . the solution is then perturbed a large number of times to converge on a better solution that minimizes the cost objective . the final converged solution is shown to be for many instances near - optimal . the annealer accepts all the solutions that improve their quality , although it may also accept with some probability solutions that degrade the quality . this is the main reason for the annealing process to succeed . during early stages of annealing , larger perturbations are made to the solution and larger degradations are accepted . as the technique progresses , the perturbations become smaller and the accepted degradations become more stringent as well . the resulting solution provides location information of all the objects of interest having a high quality for a given cost objective ( i . e ., the total weighted interconnection length and overlaps are minimal ). a subsequent verification step certifies the position ( remove any remaining overlaps ) of the floorplan objects . thus , simulated annealing achieves an optimal arrangement of the floorplan objects of interest obtained with an awareness of the intervening objects that were abstracted out . the floorplan objects are then fixed in the chip layout and the placement tool is invoked to place other design objects on the chip layout . the result of floorplanning for the example shown in fig3 a is the arrangement of the floorplan objects of interest on the layout illustrated in fig3 d . while the presented invention has been described in terms of a preferred embodiment , those skilled in the art will readily recognize that many changes and modifications are possible , all of which remain within the spirit and the scope of the present invention , as defined by the accompanying claims . | 6 |
embodying examples of this invention will now be explained with reference to the accompanying drawings : referring to fig1 - 5 showing one embodying example thereof , numeral 1 denotes a letter paper for a bill , for instance , formed by printing out necessary descriptive matters such as an address 2 , amounts of money 3 , and others filled in the predetermined blank portions thereof by a thermal printer arranged to be operated in conjunction with a computer , and the printed letter paper 1 in an unfolded condition shown in fig3 is so folded in three that the address 2 may appear on its front side and the amounts of money 3 may be on its rear side , as shown in fig4 . this folded letter paper 1 is inserted , as shown in fig5 between a pair of long front and rear sheets 4a , 4b drawn out from respective rolls ( not illustrated ) for being covered therewith at its front and rear surfaces , and is heated by a pair of heating rolls 5 , 5 . in this case , the front sheet 4a is made of transparent paper 9 such as glassine paper which is laminated , at its rear surface , with a transparent and thermal adhering synthetic resin film 10 such as of hot melt type resin , thermoplastic resin , etc ., and the rear sheet 4b is made of transparent paper 11 which is laminated , at its front surface , with a transparent and thermal adhering synthetic resin film 12 . thus , by the foregoing heating operation , the synthetic resin films 10 , 12 at such peripheral portions of the front and rear sheets 4a , 4b that surround the folded letter paper 1 are adhered together by heat to form an enclosed sealed portion 6 , and thus there can be produced a sealed letter 8 as shown in fig1 . if , as shown in fig8 the printed letter paper 1 is interposed between the front sheet 4a and the rear sheet 4b which are formed by folding a single long sheet in two , there is produced the sealed letter 8 of such a type that out of the peripheral four sides thereof one side is lacking in the sealed portion 6 as clearly shown in fig6 and that the front sheet 4a and the rear sheet 4b are made of the same materials 9 and 10 . in any of the above embodying examples , a printed matter or the like can be enclosed together with the printed letter paper 1 in the enclosed sealed sheets 4a , 4b . the transparent paper 9 constituting the front sheet 4a is preferably made of glassine paper , so that characters or the like can be written thereon in water - color ink . the front sheet 4a may be modified so that the front surface of the transparent paper 9 thereof is also laminated with a transparent synthetic resin film 13 , as shown in fig9 so that a waterproof property thereof is improved and also the rigidity thereof is increased . further , in this case , if the front synthetic resin film 13 is thicker than the rear synthetic resin film 10 , breaking the sealed letter is facilitated . numeral 14 is a stamp mark affixed onto the front surface of the letter paper 1 . instead thereof , the front sheet 4a itself may be previously affixed , by printing , with a stamp mark 14 or the like , as shown in fig1 . in another embodying example shown in fig1 , the rear sheet 4b is made of opaque ordinary paper 11a such as kraft paper , roll paper or the like , and in a further another embodying example shown in fig1 , the rear sheet 4b is formed of a lamination of an opaque paper 11a and a thermal adhering synthetic resin film 12a applied to a front surface of the paper 11a . in the latter case , the paper 11a may be applied also on its rear surface with a synthetic resin film 12b , as shown by a chain line in the same figure . if the rear sheet 4b is opaque as shown in these examples , even when the printed letter paper 1 is folded so that the last section thereof including the correspondence contents may appear on its rear surface , as shown in fig1 , the rear surface thereof is covered with the rear sheet 4b and cannot be seen from outside and therefore the last section of the printed letter paper can be utilized effectively for correspondence description . referring to the drawings , numeral 15 denotes a folding line , and the folding line may be provided with perforations so that the letter paper may be formed of plural separable sections . thus , according to this invention , letter paper on which an address and any other necessary matters are printed by a printer of a computer is covered , at its front surface , with front sheet made of transparent paper applied with a transparent and thermal adhering synthetic resin film , and is covered , at its rear surface , with a rear sheet made of any paper material , and the front sheet and the rear sheet are adhered together by heat at their peripheral portions so as to form a sealed letter , so that any coating of an adhesive agent on the letter paper can be eliminated , and consequently there can be removed such a trouble as disorder of a thermal printer caused by the adhesive agent . additionally , the manner of folding the letter paper can be carried out in any manner provided that the printed address thereof should appear on the front surface . additionally , for the front sheet and the rear sheet are made chiefly of paper material , the sealed letter can be easily broken for opening the same , and for the front sheet has the synthetic resin film , it can prevent the sealed letter from getting wet with rain or the like . | 1 |
a camshaft adjuster of an internal combustion engine according to the present invention , including a stator 1 and a rotor 2 , is apparent in fig1 . stator 1 has a cup - shaped design and is provided with a toothing 3 on its outside for the purpose of being driven by a crankshaft via a chain or toothed belt . rotor 2 is connectable to a camshaft in the known manner , e . g ., via a central screw , and is driven to a rotary motion with the aid of stator 1 . stator 1 furthermore includes a plurality of stator webs 20 , 21 , 22 , and 23 , including threaded bores 4 situated therein , which divide an annular space provided between stator 1 and rotor 2 into multiple pressure chambers i . rotor 2 includes a plurality of vanes 14 , 15 , 16 and 17 , which extend radially outwardly to the inner wall of stator 1 and divide each pressure chamber i into two working chambers a and b . a translucently represented sealing cover 5 is furthermore provided , which is screwed into threaded bores 4 of stator 1 with the aid of fastening screws and which includes four locking gates 6 , 7 , 8 and 9 . four locking pins 10 , 11 , 12 , 13 are also provided in rotor 2 , which are spring - loaded in the engagement direction of locking gates 6 , 7 , 8 and 9 and to which pressure medium may be applied via a common pressure medium channel 26 for the purpose of unlocking from locking gates 6 , 7 , 8 and 9 . during operation of the internal combustion engine , pressure chambers i are filled with pressure medium at least after a certain start phase , whereby the rotary motion of stator 1 is transmitted to rotor 2 . locking gates 6 , 7 , 8 and 9 are ring segment - like or circular arc - shaped recesses or indentations in sealing cover 5 , which are oriented and dimensioned in such a way that their center lines run on a common diameter . upper left vane 14 in the illustration is designed to be wider than remaining vanes 15 , 16 and 17 and is used as a stop for rotor 2 for the purpose of limiting the rotary motion of rotor 2 with respect to stator 1 in the “ advance ” and “ retard ” stop positions . in order for rotor 2 to rotate into the provided stop positions in a preferably controlled manner without it being blocked in its rotary motion , e . g ., by existing production radii , recesses 18 and 19 are provided on vane 14 on its outer edge sides extending into the illustration plane . for the same reasons , recesses 24 and 25 are provided on the two stator webs 20 and 21 , which delimit pressure chamber i in which vane 14 is situated , on the radially inner edge sides extending into the illustration plane . in the illustration in fig1 , rotor 2 is in the “ retard ” stop position , i . e ., rotor 2 rests with vane 14 against the right side of stator web 20 delimiting pressure chamber i . in this position of rotor 2 , working chamber a has the smallest volume and working chamber b to the right of vane 14 has the largest volume . in the event that the internal combustion engine is suddenly turned off in this position of rotor 2 or , e . g ., if it suddenly shuts down due to stalling , problems may arise when the internal combustion engine is restarted , which are to be eliminated by the automatic reverse rotation of rotor 2 , which is described below , into central locking position mvp apparent in fig7 . the alternating torques which act upon the camshaft when the camshaft adjuster is not yet completely filled with pressure medium , in connection with the design of locking gates 6 , 7 , 8 and 9 , locking pins 10 , 11 , 12 and 13 proposed according to the present invention , are used for the automatic reverse rotation of rotor 2 into central locking position mvp as described below . in the “ retard ” stop position illustrated in fig1 , first locking pin 10 already engages with locking gate 6 , while the other locking pins 11 , 12 and 13 still rest against the side wall of sealing cover 5 outside locking gates 7 , 8 and 9 . it is important that first locking pin 10 engages with locking gate 6 in such a way that rotor 2 is able to rotate relative to stator 1 at least clockwise in the direction of central locking position mvp . in the event that a torque acts upon rotor 2 in the clockwise direction in this position of rotor 2 , rotor 2 is rotated clockwise with respect to stator 1 into the position in fig2 , in which second locking pin 13 locks into adjacent locking gate 9 . if a subsequent torque occurs in the opposite direction , rotor 2 can no longer rotate back into the “ retard ” stop position . the next time a torque oriented in the clockwise direction acts upon the camshaft and thus on rotor 2 , the latter continues to be rotated in the clockwise direction into the position illustrated in fig3 , in which second locking pin 13 locks into locking gate 9 . locking pin 10 is also moved into locking gate 6 , so that it no longer rests against the radially oriented edge section of locking gate 6 . the reverse rotation of rotor 2 back to the “ retard ” stop position is blocked in this position of rotor 2 by locking pin 13 , which rests against the radial edge section of locking gate 9 . during another rotation of rotor 2 , locking pin 12 finally locks into locking gate 8 ( see fig3 ) in a next step , and last locking pin 11 finally locks into locking gate 7 in the central locking position mvp illustrated in fig7 . in central locking position mvp illustrated in fig7 , locking pins 10 and 11 rest against the radial edge sections of locking gates 6 and 7 , so that rotor 2 is locked with respect to stator 1 in both directions of rotation . the same camshaft adjuster having rotor 2 situated in the “ advance ” stop position is apparent in fig4 , in which rotor 2 rests with vane 14 against stator web 21 , which delimits pressure chamber i on the other side . locking pin 11 is already locked into locking gate 7 . if the internal combustion engine is started with the aid of a rotor 2 in this position , rotor 2 is gradually rotated counterclockwise into the position shown in fig5 and fig6 , based on the same principle of the active alternating torques , locking pins 12 and 13 consecutively locking until last locking pin 10 finally locks into locking gate 6 , and rotor 2 is blocked with respect to stator 1 in central locking position mvp illustrated in fig7 . the automatic reverse rotation of rotor 2 from the “ advance ” and “ retard ” stop positions is based on the same principle , with the difference that , during a rotation of rotor 2 from the “ advance ” stop position , locking pins 10 , 11 , 12 and 13 lock into locking gates 6 , 7 , 8 and 9 in the reverse order and from different directions than during a reverse rotation of rotor 2 from the “ retard ” stop position . the automatic reverse rotation of rotor 2 is thus implemented using the same locking pins 10 , 11 , 12 , 13 and locking gates 6 , 7 , 8 and 9 , so that no additional costs arise compared to the approach known from the prior art . fig8 shows two locking gates 6 , 7 , 8 , 9 in which the first and second locking pins 10 , 11 , 12 , 13 lock during a rotation of the rotor 2 from the “ advance ” or “ retard ” stop position are situated axisymmetrically to a middle axis x . sealing cover 5 , including locking gates 6 , 7 , 8 and 9 , is apparent in fig8 . a sectional representation along section line f - f of locking gate 8 is shown in the illustration on the right . locking gates 8 and 9 , in which second or third locking pin 12 or 13 locks during a rotation of rotor 2 from the “ advance ” and “ retard ” stop positions , are each provided with steps 27 on their edge sections of the base surface oriented in the circumferential direction , while locking gates 6 and 7 , into which first or last locking pin 10 or 11 locks , are provided with steps 27 only on their edge sections of the base surfaces facing each other . this is due to the fact that locking pins 10 and 11 always lock into locking gates 6 and 7 only from one side during the automatic reverse rotary motion , since one of locking pins 10 and 11 already engages with locking gate 6 or 7 in the “ advance ” and “ retard ” stop positions . steps 27 each form stop surfaces in the manner of a grid pattern , against which locking pins 10 , 11 , 12 and 13 rest in the circumferential direction in the intermediate positions between the “ advance ” and “ retard ” stop positions and central locking position mvp . as a result , the reverse rotation of rotor 2 is blocked in the direction of the “ advance ” and “ retard ” stop positions , and a continued rotation of rotor 2 in the direction of central locking position mvp is simultaneously facilitated . | 5 |
fig1 illustrates a portion of an integrated circuit being fabricated showing a substrate 10 that will contain underlying layers , e . g . source / drain areas of planar transistors , other lower interconnect structures , the bulk silicon , etc , not shown in this figure . dielectric 20 is illustratively an interlayer dielectric such as silicon dioxide , a fluorinated silicon dioxide , a silicon oxycarbide material ( such as black diamond ™ from applied materials ), an organic material such as silk ™ or polyimide . the thickness of this material is typically in the range of 500 - 1000 nm , with preferred values of 600 - 800 nm . this material will be referred to as the pattern layer , since the result of the process is the formation of a pattern of apertures in this layer . a hard mask 30 such as nitride ( si3n4 ) or polysilicon will be patterned with a hole that is larger than the desired final size and , after processing according to the invention , serve as the mask to etch an aperture through dielectric 20 . preferably , the initial hole will be formed by conventional lithographic techniques . if the desired final size is so much smaller than the smallest conventional aperture , the initial hole may be formed by a sublithographic technique such as sidewall image transfer . a layer 40 containing si — oh bonds ( or having a fraction of oxide , sio2 ) has been deposited over the hardmask layer 30 . this layer 40 will serve as a seed layer for the selective deposition of silicon oxide from an aqueous solution . this oxide - containing material can be a conventional layer of cvd oxide such as teos , or a spin - on glass material , or a silsesquioxane material . layer 40 could also be a siloxane resist material that is photo sensitive and may be directly imaged with a contact hole pattern . layer 40 could also be an anti - reflective layer ordinarily used for a photoresist layer , e . g . hosp , available from honeywell . the seed layer 40 can range in thickness from 20 - 200 nm , with a range of 20 - 50 nm preferred for an oxide or antireflective layer and 100 - 200 preferred for a resist layer . typically , resist layer 50 is spun - on over seed layer 40 , exposed and developed to form the structure in fig1 , having aperture 52 with dimension 55 . dimension 55 may be sublithographic using a standard technique or it may be formed by a conventional lithographic process . a directional oxide etch ( illustratively with chf3 / o2 mixtures at 10 - 100 mtorr , with the wafer biased to create an ion - driven etch process at the wafer surface ), stopping on nitride 30 , is used to remove the oxide - containing seed layer 40 at the bottom of the aperture 52 to produce the result shown in fig2 . with the vertical sides of the oxide - containing seed layer 40 exposed ( and the top surface covered by the resist ) the wafer is immersed in a saturated hydrofluoro - silicic acid h2sif6 solution , as described in the us patents listed in the background section of the specification , and a film of oxide is grown on the exposed vertical surface through lpd . the thickness of the lpd - grown film can range from 5 - 50 nm or so , for high - density cmos applications , in which case the width 55 of the contact hole pattern in aperture 52 ′ is reduced by a corresponding 10 - 100 nm . the amount of oxide that is permitted to grow will depend on the desired width reduction and may preferentially be 20 - 30 nm for many applications . fig3 shows the result of the lpd step , in which an oxide film 45 has been formed on the vertical surfaces of seed layer 40 . the diameter of the aperture has been reduced to a value 47 , equivalent to the value 55 minus twice the thickness of film 45 . several options are available to achieve a selective oxide deposition process . if a high quality silicon nitride layer is used as the hardmask 30 , then it will not react with the hydrosilicic acid , in the case of ldp , or with trimethyl aluminum , in the case of the ald growth of silicon oxide . alternatively , if layer 30 is composed of polysilicon , it can be passivated with fluorine by exposing it to hf vapor prior to ldp or ald oxide growth . in another option , one can use a siloxane resist over nitride layer 30 , or over polysilicon layer 30 , or over an unreactive organic underlayer such as diamond - like carbon annealed in hydrogen , parylene , or bottom antireflective coating . these undercoat films may also be treated with hexamethyidisilazane prior to resist apply , as a means of masking any reactive chemical species on their surface . the siloxane resist is exposed and developed down to the unreactive organic underlayer , followed by growth of the lpd or ald oxide film directly onto the siloxane resist . in an alternative to the growth of the oxide film by lpd , one might also use an atomic layer deposition process , such as that disclosed in us 2004 / 0043149 ( incorporated by reference ). in this process , a vapor of trimethylaluminum reacts with active hydroxyl groups on the surface of silicon oxide or siloxane films to create a surface - bound aluminum catalyst species . then , a vapor of tris ( t - butoxy ) silanol is introduced to the substrate to grow films of 5 - 12 nm , depending on reaction time and temperature , at 200 - 300 c . the catalyst treatment can be repeated , followed by exposure to fresh silanol reagent , to grow films of the desired thickness . this process is highly uniform and conformal , due to its nature as a surface - limited reaction . fig4 shows the result of stripping resist 50 and etching through hardmask 30 and then through ild 20 . the lpd film 45 serves to define the dimension of the aperture formed in hardmask 30 . after the aperture in hardmask 30 is formed , the hardmask defines the width of aperture 100 . it does not matter , therefore , if the etch process used for ild 20 attacks the film 45 . fig5 illustrates in a partially pictorial , partially schematic view of an integrated circuit , in which substrate 10 represents a bulk or soi substrate , and a transistor 100 having source / drain 102 has been formed by conventional deposition , lithography and implantation techniques . a first level dielectric 20 has apertures formed according to the invention filled with a conductor 104 to form vias , one of which connects to block 400 that represents schematically the remainder of the integrated circuit . the preliminary steps of blanket implants , forming the various transistors will be referred to for purposes of the claims as preparing the substrate and the later steps after the sublithographic vias have been formed ; i . e . forming the interconnects and the remainder of the back end processing will be referred to as completing the circuit . the etching techniques and etch chemistry will depend on the material being etched and the underlying layer below that material . in an illustrative example , the material of layer 40 is oxide , the material of layer 30 is nitride , and the material of layer 20 is oxide . the etch process to form aperture 52 ′ is a conventional oxide etch that stops on nitride 30 . the etch process to form aperture 100 is also a conventional oxide etch that is resisted by hardmask 30 . advantageously , the thickness of layers 40 and 50 are set such that resist layer 50 and seed layer 40 are both consumed during the etch process that opens aperture 100 , so that a removal step for these layers is not required . if that is not practical in a particular example , then any remainder of layer 40 will be stripped . in a particular example in which layer 40 is a siloxane photoresist , layer 50 will not be used and aperture 52 ′ will be formed directly in layer 40 . while the invention has been described in terms of a single preferred embodiment , those skilled in the art will recognize that the invention can be practiced in various versions within the spirit and scope of the following claims . | 7 |
referring to fig1 , model classes 14 implement or extend a duplicatable interface 11 which defines method required by a duplicatable model . the interface also ensures there are bi - directional references 12 , 13 between the duplicated and the duplicate instances so that updates may be sent from a duplicated instance to all duplicates , and changes may be synchronized from a duplicate to the duplicated instance . this architecture allows for the duplicate object to use the same class source as the duplicated object . duplicates of models may be created within a single process from a non duplicate model , or from a duplicate model as shown in fig2 . this object interaction diagram shows that a duplicate context object 23 is used to create and maintain a model object 21 which is a duplicate of a model object 20 . the arrows 25 , 26 show that changes flow from the duplicate object to the duplicated object and updates to the duplicated object flow back to the duplicate objects . this diagram also shows that a duplicate object 22 can be created from a duplicate object 21 using a different duplicate context instance 24 , allowing a tree of duplicate objects to be created . in fig3 , we are demonstrating a more complex and concrete object interaction diagram for a contact object which contains addresses and a name , and references a spouse contact . the contact duplicate 30 references a duplicate of a collection of address duplicates 31 , a duplicate of the referenced spouse contact 32 , and it references a copy of the name 33 since strings do not implement the duplicatable interface and therefor are assumed to be immutable . fig4 builds on this same scenario by showing how a duplicate of the contact and related objects can be created across process boundaries using proxies to the duplicated objects . here the contact duplicate 40 references a proxy 41 of the duplicated contact 42 which may exist on a remote process . fig5 shows the sequence of events that create a duplicate object . the user code first makes a call 50 to its duplicate context to create a duplicate instance , passing either a local reference or proxy to an object or collection that can be duplicated . the context first makes a call 51 to the duplicated object to register a new reflection . the register method fig1 , 11 is called resulting in a serializable package of duplication data used to setup the duplicate object . the context then creates a new instance of the same type as the duplicated object and then calls the initialize method fig1 , 11 passing the package of duplication data . the duplicate object then unpacks the duplication data , sets up the duplicate , and notifies the context of any additional duplicates that must be created to complete the process . the context then creates any additional duplicates 53 by repeating this process from 51 for each addition duplicate required . duplicate objects can be altered without affecting the duplicated object or other duplicate objects of the duplicated object until the user code synchronizes the changes as depicted in fig6 . the user can make any changes desired to the duplicate object 60 which will send updates 61 to any duplicates of the duplicate object . when the changes are complete , the user code can request that the duplicate context synchronize 62 the changes to the duplicate object or to any set of duplicate objects created by the context . the duplicate context identifies the altered duplicates within the requested set and requests 63 that they package those changes for delivery to the duplicated objects . the packages of changes are then delivered to the duplicated objects via a call 64 to their synchronize fig1 , 11 method . one at a time , each logical ( an individual or tree of part - of objects where one object may be part - of another object and thus share a lock ) duplicated object is locked , applies the changes , then sends updates 65 to any other duplicates other than the one requesting the changes . finally , if the duplicated object is not its self a reflection , it will be given an opportunity 66 to update optional repositories within the context of the lock . when the user code is done with its duplicate objects as in fig7 , it will release the duplicate context 70 . the duplicate context will call 71 destroy fig1 , 11 on each duplicate created by the context to mark the duplicate as no longer being active . the context will then notify each duplicated object that the duplicate is no longer active with a call 72 to unregister fig1 , 11 . the duplicated object will remove the meta - data for the duplicate and will stop sending updates . | 6 |
referring to fig1 , a target tracking system 22 included within a platform 20 , such as without limitation a ground based facility , an aircraft , or a satellite , provides near continuous updating of inertial reference unit ( iru ) information while performing uninterrupted optical target tracking . in addition , the platform 20 includes platform information sources 26 , such as a flight data computer , and an inertial reference system ( irs ) that are coupled to the target tracking system 22 . in one embodiment , the target tracking system 22 includes a tracking processor 30 , a high signal light source component 32 , a first camera 34 , a second camera 36 , a first fast steering mirror ( fsm ) 38 , a second fsm 40 , a beam splitter 42 , and various reflecting mirrors 44 . the tracking processor 30 is operatively coupled to the high signal light source component 32 , the first and second cameras 34 and 36 , the first and second fsms 38 and 40 , and a database 46 . the database 46 stores starfield reference information for use by the processor 30 . the tracking processor 30 includes an inertial reference unit ( iru ) 50 . the iru 50 determines and adjusts inertial reference information received from the irs based on an optical output of an optical beam source 58 of the high signal light source component 32 and an image received by the second camera 36 . in addition , the tracking processor 30 includes a target tracking component 54 that tracks a target displayed within an image generated by the first camera 34 and determines inertial reference information of the tracked target based on the inertial reference information determined by the iru 50 and any information from the sources 26 . the target tracking component 54 generates an instruction to the second fsm 40 for stabilizing the tracked image , thereby allowing the second camera 36 to record a stabilized image of the starfield . the iru 50 may be located remote from the processor 30 or the target tracking system 22 . referring now to fig2 , a process 100 performed by the target tracking system 22 ( fig1 ) provides nearly continuous inertial reference information updating using starfield information stored in the database 46 without loss of contact of an optically tracked target . the process 100 begins after the target tracking system 22 has acquired a target in its view . in other words , the first camera 34 has acquired a target within its field of view and the target tracking component 54 has analyzed images generated by the first camera 34 and instructed the first fsm 38 to track the identified target . the process 100 begins at a block 102 where the target tracking component 54 determines the inertial angular rate of the target scan . the target scan inertial angular rate is the speed at which the first fsm 38 moves in order to track the target . at a block 106 , the starfield image received by the second camera 36 is stabilized based on the determined target scan rate . the determined target scan rate is sent to the second fsm 40 for de - scanning the starfield image received from the first fsm 38 . referring back to fig2 , at a block 108 the second camera 36 records the stabilized image over a predetermined period of time . at a block 112 , during the period of time that the second camera 36 records the starfield image , the iru optical beam generator 58 generates an optical beam that is pulsed over a finite period of time . at a block 114 , the tracking processor 30 or components thereof identifies the location within the stabilized image of when the iru optical beam was turned on and off during each optical beam pulse . referring to fig3 , time t 1 identifies the location within a stabilized image 300 where an optical beam pulse was initiated and time t 2 is the location within the image 300 that identifies when the iru optical beam pulse was turned off . referring back to fig2 , at a block 118 , centroids of each optical beam pulse are determined based on respective times t 1 and t 2 . at a block 120 , the processor 30 compares the centroids to one or more stars located within the stabilized image based on starfield information stored in the database 46 and adjusts inertial reference information received from the iru 50 based on the comparison . at a block 122 , the processor 30 determines inertial reference information for the target based on present target tracking information produced by the target tracking component 54 , the adjusted inertial reference information , and any information relating to the platform 20 , such as without limitation gps location information , pitch , roll , yaw , or other orientation information received from the other sources 26 . platform information may include position , velocity , and attitude from separate inertial navigation system for transforming target position into a platform body - fixed coordinate system . in one embodiment , the optical beam direction is referenced to the target based on target tracking information generated by the target tracking component 54 and sent to the light source component 32 . because the optical beam is referenced to the tracked target , the pulses track across a stabilized image . referring now to fig3 , a stabilized image 300 includes a plurality of stars 302 that are identified by a starfield analysis component included within the tracking processor 30 . the stabilized image 300 includes a plurality of optical beam pulses recorded by the second camera 36 . centroids 306 of each optical beam pulse 304 are identified based on identified t 1 and t 2 of the respective pulse 304 . the centroids 306 are simply the center location of each pulse 304 . the processor 30 determines the location of the centroids 306 relative to the starfield pattern 302 within the stabilized image 300 in order to generate highly accurate inertial reference update information of the target . fig4 illustrates an exemplary de - scanned ( stabilized ) image that is recorded by the second camera 36 . satellite 1 is a tracked target . the resulting series of pulses from the beam combined with the knowledge of the precise time of each pulse allows accurate measurement of the optical beam pointing direction relative to the starfield . this measurement is input to a kalman filter which estimates the iru errors , thereby allowing accurate reporting of the track object position in inertial frame coordinates . the kalman filter algorithm is a standard , recognized estimation algorithm for estimating iru errors . the kalman filter would be applied in the same manner as if the track were interrupted and the star measurements taken independent of the track process . the errors in the inertial system which would be estimated are the three components of inertial attitude , the three components of gyro bias , and the 3 components of gyro scalefactor . the kalman filter would therefore be at least a 9 state estimation algorithm . the equations for the kalman filter are given in the literature but are shown here for completeness : k n = p n h n t ( h n p n h n t + r ) - 1 kalman gain x n + 1 = x n + k n ( z n - h n x n ) state update p n + 1 = p n - k n h n p n co variance update k n = 9 × 9 initial co variance matrix ( identity ), h n = 2 × 9 measurement matrix , p 0 = 9 × 9 initial co variance matrix ( identity ), r = 2 × 2 measurement noise matrix x o = 9 × 1 state vector ( zero vector ) z n = 2 × 1 measurement vector ( inertial angles to each star observed ) the kalman filter equations are iterated over each exposure time of the streak camera 36 with a star measurement comprising the z n vector at each exposure time . the optical beam has a signal - to - noise ratio of approximately 100 . the beam can be very intense relative to the signal returned from the target , thereby allowing centroid measurement of the optical beam streaks to approximately 1 / 100 of the camera 36 pixel angular extent . referring to fig5 , a time graph 350 illustrates example on / off times of an optical beam . the following are exemplary system values associated with the graph 350 : aperture size : 50 cm ( mirror # 44 ) optical magnification = 10 x 1 ( mirror # 44 ) slew rate ( ω ): 1 degree / second 917 . 4 mrad / sec ) ( system # 22 ) second camera 36 optical beam pulse repetition frequency : 300 hz angular length of each streak ( pulse ): 10 pixels ( 42 . 5 μrads ) time length of each pulse : 42 . 5 × 10 − 6 / 17 . 4 × 10 − 3 = 2 . 4 msec de - scan time = 7 . 8 msec ( assuming two complete pulses in scan time ) required de - scan fsm 40 angle range = 7 . 8 × 10 − 3 × 17 . 4 × 10 − 3 ˜ 136 μrads ( output space ) while the preferred embodiment of the invention has been illustrated and described , as noted above , many changes can be made without departing from the spirit and scope of the invention . also , the steps in the process 100 may be performed in various order . accordingly , the scope of the invention is not limited by the disclosure of the preferred embodiment . instead , the invention should be determined entirely by reference to the claims that follow . | 6 |
to supply nutrients to farm animals , high concentration nutrient granules are formed and combined with the bulk feed of the animals . these nutrient granules will generally include a high concentration of nutrients , a carrier and if necessary a lubricant and / or binder . the nutrients can be a variety of different compositions . generally these will include minerals and vitamins . these nutrients along with the range of concentration that would be incorporated in the pellets of the present invention in order to provide the total nutritional requirements for the animal are listed below according to nutrient concentration ( as compared to ingredient or actual mineral concentration ). these ranges are listed by nutrient concentration . the actual ingredient inclusion rate will depend upon the concentration of that nutrient that the ingredient contains . these will then be combined with a carrier . a carrier can be any of a large number of digestible or nondigestible edible and gras ( generally recognized as safe ) ingredients . these would , for example , include animal protein products , and forage products , grain products , plant protein products , processed grain by - products , roughage products . these are more fully listed below : possible products include dried blood meal , animal by - product meal , fish meal , dried fish solubles , hydrolyzed poultry feathers , hydrolyzed poultry by - products , meat and bone meal , meat meal , poultry by - product meal , dried whey , alfalfa meal , corn , oats , wheat , wheat bran , wheat middlings , soybean hulls , cottonseed meal , linseed meal , soybean meal , sunflower meal , yeast , brewers dried grains , corn flour , corn gluten feed , corn gluten meal , corn distillers dried grains , corn distillers dried grains with solubles , oat groats , feeding oat meal , wheat flour , wheat red dog , soybean mill feed and mixtures . clay or other fillers could be added if desired , but are not necessary . a lubricant may also be required . generally these will be a fat or oil source such as animal fat , vegetable oil or blended animal or vegetable fat , oilseed processing byproducts , soapstock , etc . in certain formulations , a binder may be required . suitable binders include lignin sulfate , bentonite , and gums as well as others . these are all combined in desired proportions and pelletized . generally the nutrient ingredients will form from about 1 to about 70 % of the product and more typically 4 to 40 %. if the supplement is primarily a vitamin and trace mineral supplement , it would form a relatively minor portion of the product if macro minerals are added these would form a relatively and substantially greater portion of the product . the upper limit , i . e ., about 70 %, is due to the inability to effectively bind a high mineral content pellet together . further , if the mineral content is too high , it may not be palletible or pellitable . generally , the product will include from , about 0 to about 5 % fat or oil as a lubricant . if the supplement does not include a significant amount of minerals , i . e ., greater than 20 %, the carrier itself will effectively lubricate and bind itself to form the pellet under the influence of steam used in the pelletizer . on the other hand , if the concentration of minerals exceeds 20 %, about 0 . 5 - 1 % fat per 10 % mineral above 20 % should be added . accordingly , if the product includes 40 % mineral ingredients ( as opposed to nutrient ), 1 to 2 % fat should be included . in producing the pellets of the present invention , the components are blended in any blending apparatus . the product is pelletized by running it through a pellet mill . pellet mills are , of course , very well known . several suitable pellet mills are those made by sproutwaldron and california pellet mill . the pellets can be formed of a variety of different sizes . generally , the dye size will be from { fraction ( 6 / 64 )} up to { fraction ( 32 / 64 )} of an inch . typically they will be from { fraction ( 8 / 64 )} to { fraction ( 12 / 64 )}. the formed pellets are cooled through coolers which are generally used with the pellet mill and manufactured by the same companies and ground with a roller mill or crumbler to form granules . these are all screened and separated for size . the coolers and roller mills and crumblers are likewise well known . generally the size of granules will depend upon the ultimate use but will generally be in the neighborhood of { fraction ( 1 / 64 )} up to { fraction ( 12 / 64 )} of an inch in diameter . these sizes , of course , are average sizes . the density of the formed granules should be equal to the density of the bulk feed to which they are expected to be added + 30 %. density can be controlled by increasing the carrier concentration , modification of the carrier concentration as well as adjusting parameters within the pelletizer itself such as pressure , steam and temperature as well as ultimate granule size . the formulated product will generally have 1 - 30 % crude protein , 1 - 15 % crude fat , and 1 - 15 % crude fiber . these can be formulated into pellets using an operating temperature of about 130 to 200 , preferably 160 to about 170 ° f ., with a steam pressure of 5 to 100 psi preferably , 30 to 60 psi . when the mineral concentration exceeds 20 % of the formulation higher steam pressure is usually used , i . e ., 40 to 80 psi . this improves the manufacturing process . depending on the size of the pellet mill , 1 - 30 tons can be processed per hour . of course , these are preferred parameters for this formulation and other formulations would be modified which is well within the skill of the art . finally , the end product is combined with the feed mix . generally , the appropriate nutrient granule may be modified to meet the needs of the particular bulk feed that it is combined with . the granule should have a size which is approximately equal to the average particle size of the bulk feed . further , it will have a density equal to (± 30 %) of the density of the bulk feed product ( about 30 to 55 pounds per cubic foot ). preferably , the nutrient composition will be added to the bulk feed composition , i . e ., starch source and protein source , at a rate of 0 . 25 to 7 . 5 % based on the weight of the combined nutrient and bulk feed . lesser amounts can be employed , again , depending on the nutrients in the nutrient granule as well as the concentration of the nutrient in the granule . generally the overall amount of nutrient supplement , of course , will be added in an amount designed to meet the dietary needs of the animal consuming the bulk feed . thus , by forming the nutrients into a nutrient pellet and preparing these in a size which will remain suspended in feed , one can supply these to an animal in a manner designed to reliably supply the nutrient needs of the animal without either overfeeding the animal or undersupplying the needs of the animal . further , due to the fact that this is a granular feed nutrient premix , a variety of different formulas can be prepared which are uniquely designed for the needs of particular animals based on both species and characteristics of the species such as lactation , pregnancy , age and size . these can then be added to the bulk feed by the farmer to ensure that all of his animals are properly supplied nutrients . further , and equally important , the nutrients themselves do not separate and remain evenly distributed in the granule . | 0 |
in greater detail , fig1 and 3 show a common embodiment , and also the pivot member and cutting portion or blade thereof of fig4 being the same as that shown mounted pivotally in the structure of the outer side wall of the cylindrical corer of fig1 . in the discussion of the disclosed embodiments , of the different figures , for common parts identical or similar indicia will be utilized and the description not repeated for such elements for each figure . for the common embodiment of fig1 through 4 , there is disclosed the partial - coring device 1 having its cylindrically shaped outer side wall 2 , capped by a cap 3 at its upper end and the cap 3 fitting around the upper outer rim of the cylindrical outer side wall 2 and having inner cap plug 3a fitted supportingly and snugly within the upper end channel space formed within the cylindrically shaped outer side wall 2 . handle 4 is mounted on a neck shaft 5 that is mounted on the upper end of an elongated slide member 6 slidably mounted retainably within an elongated groove 6b shaped - into the outer surface of the cylindrically shaped outer side wall 2 , with the elongated groove extending axially along the longitudinal axis of the cylindrically shaped outer side wall 2 . the pivot member 7 has pivot arms 7d and 7d &# 39 ;, with the pivot arms 7d and 7d &# 39 ; respectively mounted in the apertures 7a and 7a &# 39 ; in the outer side wall 2 . mounted within the channel space 8 &# 39 ; at the upper end and slidable through the channel space to the lower open end of the cylindrically shaped outer side wall 2 , is the core ejection plug or core ejecter 8 having a shaft 9a mounted on and attached thereto and extending through slit - groove 10 to handle 9 . the shaft 9a is slidable within the axially extending longitudinally extending slit - groove 10 . by moving the handle 9 toward the open end at the lower end of the channel space 8 &# 39 ;, the core ejecter 8 moves to the open end to eject an core contained in the channel space 8 &# 39 ;; thereafter , movement of the handle toward the upper end of the corer causes the core ejector to move also to the upper end of the channel space as shown in fig3 and fig1 . by movement of the handle 4 , and thereby the slide member 6 , toward the lower and open end of the cylindrically shaped outer side wall 2 , the lower end of the elongated slide member 6 being pivotally attached to the ring structure 12 of the pivot member 7 , causes the cutting blade portion 7a to move outwardly along the movement path 7c to an ejected or extended position and state . return of the hande 4 to the position shown in fig1 causes the cutting blade portion 7a to return to the retracted position and state shown in fig3 . thus , for fig1 through 4 , the lower end of the elongated slide member 6 is pivotally linked to the link structure 12 . in fig4 a there is shown an additional link - member 6 &# 34 ; b that is an extension , in effect , of the slidable elongated slide member 6 , pivotally linked thereto at 11 , as link member 6 &# 34 ; b and elongated slide member 6 &# 34 ; a . in the fig1 through 4 embodiment , the lower end of the elongated slide member 6 flexibly and resiliently bends or flexes inwardly as the elongated slide member 6 is moved toward the pivot member at the open end location of the corer . it resiliently returns to its substantially straight form when moved upwardly toward the upper end of the corer 1 cylindrically shaped outer wall 2 . in fig4 b , an alternate arrangement and embodiment for the pivot member 7 &# 34 ; and the elongated slide member 6 &# 39 ; are shown in which the lower end of the elongated slide member 6 &# 39 ; is welded or otherwise fused to the upper end portion of the blade 7 &# 39 ;; in this embodiment also , the pivot member 7 &# 34 ; is rigidly and immovably fastened through hole 13 to the outer side wall 2 in juxtaposition to the through - aperture 12 &# 34 ;. thus , in this embodiment , when the handle mounted on the slide member 6 &# 39 ;, in the same manner as for the embodiment of fig1 moves toward the lower end of the corer 1 , the lower end of the elongated slide member flexes downwardly while simultaneously the cutting blade portion 7 &# 39 ; becomes also flexed inwardly , both resiliently . upon return of the handle ( not shown ) but the same as for the embodiment of fig1 through 4 to the upper end of the corer 1 , the lower end of the elongated slide member and the cutting blade portion both return to the retracted positions and states as shown in fig4 b . normally a person would grasp the upper capped end of the corer 1 and press downwardly thereon with the lower serrated end thereof pressed - against the surface of the fruit to be cored , and twist back and forth revolvably , until the serrated end reaches the desired depth within the fruit being partially cored . at that point , the handle 4 is moved toward the serrated end of the corer in a downward direction along the path 6a shown in fig3 thereby causing the cutting blade portion to move to the position 7b shown in phantom ; thereafter , the corer is revolved a full effective 360 degrees in order to fully sever the cored - portion of the fruit from the body of the fruit . thereupon the corer should be withdrawn from the fruit and the handle 4 moved to the upward end of the corer 1 . over an appropriate container for garbage , the handle 9 is moved downwardly toward the serrated end to eject the contained core portion of the fruit , and thereafter the handle 9 is returned to it upper position shown in fig1 and 3 . while this corer 1 has a special and easy use for merely partially coring a fruit , it may be obviously used also to fully core a fruit , by pressing and rotation thereof back and forth until it cores through the entire depth of the fruit . thereafter the procedure is the same as noted - above for ejecting the core . it is within the scope and spirit of the invention to make such variations and substitution of equivalents as would be apparent to a person of ordinary skill . it should be additionally noted that the squared - off or blunt open - end of the cylindrically shaped wall 2 of the corer 1 , prevents the serated end from slipping - off - of the fruit and from possibly gouging the worker or house wife with what in the prior art designs usually is a pointed and thus dangerous sharp end . this feature , in combination with other noted inventive aspects , is also a novel combination . | 0 |
the present invention comprises an improved feedback limited amplifier circuit for use in conjunction with a sensor for detecting infrared energy radiating from a celestial body . the following description is presented to enable any person skilled in the art to make and use the invention , and is provided in the context of a particular application and its requirements . various modifications to the preferred embodiment will be readily apparent to those skilled in the art , and the generic principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the invention . thus , the present invention is not intended to be limited to the embodiment shown , but is to be accorded the widest scope consistent with the principles and features disclosed herein . referring to fig1 a schematic diagram of a presently preferred embodiment of an improved feedback limited electronic amplifier circuit 10 of the present invention is shown . the electronic amplifier circuit 10 receives on line 12 electronic signals generated in response to infrared radiant energy detected and preamplified by an infrared detector system 14 . the improved amplifier circuit 10 comprises a two - stage amplifier circuit including first and second amplifiers , 18 and 20 , respectively , which amplify the input signals and provide amplified versions of the input signals as output electronic signals at output node 16 . the improved amplifier circuit 10 includes a thresholding common base amplifier , shown substantially within the dashed lines labelled 22 , for detecting when the output signal reaches a prescribed threshold level . it also includes an analog signal inverter , shown substantially within the dashed lines labelled 24 , for providing a feedback signal on line 26 when the output signal reaches the prescribed threshold . finally , the improved amplifier 10 includes a summing resistor 28 for summing an opposing feedback signal with the input electronic signal on line 12 in response to the feedback signal on line 26 . more particularly , the infrared detector system 14 is electrically connected by line 12 to one terminal of the summing resistor 28 . the infrared detector system 14 forms no part of the present invention , and a description thereof is not essential to support the claims or to provide an adequate disclosure of the present invention . however , in the interest of completeness , the disclosure of u . s . pat . no . 3 , 920 , 994 , issued to donald r . cargille on nov . 18 , 1975 , which discloses an exemplary infrared detector system , is incorporated herein by this reference . the other terminal of the summing resistor 28 is connected to one terminal of a first coupling capacitor 30 which is connected in series with the summing resistor 28 . the other terminal of the first coupling capacitor 30 is electrically connected to the noninverting terminal of the first operational amplifier 18 . a first dc return resistor 32 has one terminal electrically connected between the first coupling capacitor 30 and the noninverting terminal of the first operational amplifier 18 , and has another terminal connected to electrical ground . the output of the first operational amplifier 18 is electrically connected to one terminal of a second coupling capacitor 36 . the other terminal of the second coupling capacitor 36 is connected to the noninverting terminal of the second operational amplifier 20 . a second dc return resistor 38 has one terminal electrically connected between the second coupling capacitor 36 and the noninverting terminal of the second operational amplified 20 , and has another terminal connected to electrical ground . first feedback resistor 42 and first feedback capacitor 44 are electrically connected in parallel with one another between the inverting terminal and the output terminal of the first operational amplifier 18 . a first stage gain set resistor 46 is electrically connected between the inverting terminal of the first operational amplifier 18 and electrical ground . second feedback resistor 48 and second feedback capacitor 50 are electrically connected in parallel with one another between the inverting terminal and the output terminal of the second operational amplifier 20 . a second stage gain set resistor 52 is electrically connected between the inverting terminal of the second operational amplifier 20 and electrical ground . power supply voltages + v and - v are provided to each of the operational amplifiers 18 and 20 to provide dc power to the amplifiers . the thresholding common base amplifier and the analog signal inverter , shown substantially enclosed within the dashed lines labelled 22 and 24 respectively , comprise an electronic feedback circuit electrically connected between the output node 16 and an input node 54 interposed between the series connected summing resistor 28 and the first coupling capacitor 30 . emitter resistor 56 has one terminal connected to output node 16 . its other terminal is connected to one terminal of threshold setting resistor 58 . node 61 is interposed between emitter resistor 56 and threshold setting resistor 58 which are connected in series . the other terminal of the threshold setting resistor 58 is electrically connected to a voltage source v s . the cathode of a protection diode 60 is electrically connected to a node 61 , and the anode of protection diode 60 is electrically connected to the emitter of an npn - type thresholding first transistor 62 . the base of the first transistor is electrically connected to ground , and its collector is connected to one terminal of turn - on transient limiting resistor 64 . the other terminal of the turn - on transient limiting resistor 64 is electrically connected to one terminal of collector resistor 66 . the other terminal of collector resistor 66 is electrically connected to the voltage source v s . node 67 is interposed between turn - on transient limiting resistor 64 and collector resistor 66 . components 56 - 66 substantially comprise the thresholding common base amplifier shown substantially enclosed within dashed lines 22 . the base of a pnp - type feedback second transistor 68 is electrically connected to a node 67 . the emitter of the feedback second transistor 68 is electrically connected to one terminal of emitter resistor 70 . the other terminal of emitter resistor 70 is electrically connected to voltage source v s . the collector of the feedback second transistor 68 is connected by line 26 to the input node 54 . components 26 , 28 , 68 and 70 substantially comprise the analog signal inverter shown substantially enclosed within dashed lines 24 . component values and supply voltages for the improved feedback limited amplifier circuit of the presently preferred embodiment are tabulated below . ______________________________________components values______________________________________resistors : 28 1k32 392k38 392k42 71k46 1k48 71k52 1k56 10k64 10k66 5k70 1k58 * capacitors : 30 6 μ f36 6 μ f44 10 nf50 10 nfoperational amplifiers : 18 op - 0220 op - 02transistors : 62 2n248468 2n2907adiode : 60 1n3600______________________________________ * the value is selected to achieve the desired limit level . the voltage source v s has a value of + 18 volts . the power supply voltages + v and - v are + 18 volts and - 18 volts , respectively . in operation , the infrared detector system 14 detects energy in the infrared spectrum radiating from celestial bodies and generates on line 12 a corresponding negative polarity input electronic voltage signal which is substantially proportional in magnitude to the intensity of the detected infrared energy . the graph of fig2 illustrates typical exemplary input signal waveforms generated by the infrared detector system 14 when the radiating bodies are the sun and the earth . the magnitude of the input signal generated as a result of relatively high intensity infrared radiation from the sun is approximately 100 mv ; while the magnitude of the input signal generated as a result of the relatively lower intensity infrared radiation from the earth is approximately 1 mv . the amplification applied to input signal on line 12 by the two stage amplifier circuit comprising the respective first and second amplifier circuits 18 and 20 will be appreciated from fig3 which illustrates an exemplary open loop bode plot of the two stage amplifier circuit . the midband gain is approximately 74 db . the upper frequency break point f u substantially is 1 / 2π ( 71 × 10 3 )( 10 × 10 - 9 ) or 224 hz , and the lower frequency break point f 1 substantially is 1 / 2π ( 392 × 10 3 )( 6 × 10 - 6 ) or 0 . 067 hz . the upper and lower frequency break points are selected to be consistent with the spin rate of a spinning satellite on which the improved amplifier circuit 10 is mounted , although the improved amplifier circuit 10 is not limited to use on spinning satellites . the upper and lower frequency rolloffs both are approximately 40 db / decade ; the first and second operational amplifiers 18 and 20 , respectively , contribute approximately 20 db / decade each to the respective high and the low frequency rolloffs . the operational amplifier break frequency f a is approximately 200 khz for the two - stage circuit . the flat horizontal portion of the bode plot between the upper break frequency f u and the op - amp break frequency f a shows a gain of substantially 0 db . this flat portion and the value of f a have negligible effect on signal amplification , but they are important to the closed loop limiter stability as will be discussed below . the thresholding common base amplifier shown in fig1 substantially within dashed lines 22 detects when the output signal reaches a prescribed threshold level at which feedback limiting is to begin . more specifically , the prescribed threshold output voltage measured at output node 16 at which limiting of the two stage amplifier circuit occurs is set by appropriate adjustment of the adjustable resistor 58 . for example , with the threshold setting resistor 58 set at 37k ohms the prescribed threshold voltage is approximately - 7 volts . when the output voltage is still less negative than the prescribed threshold level ( the two - stage amplifier circuit of the presently preferred embodiment is a negative polarity circuit ), the voltage source v s and the voltage divider action of the threshold setting resistor 58 and the emitter resistor 56 provide a reverse bias voltage to node 61 and to the cathode of the protection diode 60 . the protection diode 60 protects the emitter junction of the thresholding first transistor 62 from breakdown due to excessive reverse bias voltages when the output voltage is less negative than the threshold level . the reverse bias voltage applied at node 61 reverse biases the emitter - base junction of the thresholding first transistor 62 and substantially prevents current flow from the collector to the emitter of the thresholding first transistor 62 . furthermore , the reverse bias causes the emitter - base junction of the second transistor 68 to be zero biased ; so substantially no current flows from the collector to the emitter in the feedback second transistor 68 . therefore , substantially no feedback current flows on line 26 to the summing resistor 28 , and the improved feedback limited amplifier circuit 10 of the preferred embodiment operates as a two - stage amplifier circuit providing 74 db gain in the midband region . when the output voltage at output node 16 becomes more negative than the prescribed threshold level , the voltage applied at node 61 also falls . when the threshold setting resistor 58 is set substantially at 37k ohms , and the voltage at node 61 becomes more negative than approximately - 7 volts , the protection diode 60 and the emitter base junction of the first transistor 62 becomes forward biased . consequently , current begins to flow through collector resistor 66 and turn - on - transient limiting resistor 64 to the collector junction of the first transistor 62 . as a result , the emitter - base junction of the feedback second transistor 68 will move into the active region , and the feedback second transistor 68 will begin to conduct current from its emitter to its collector . current flowing from the collector of the feedback second transistor 68 on line 26 to the summing resistor 28 comprises a feedback signal which will cause a voltage drop across the summing resistor 28 opposite from the voltage drop due to the signal voltage received on line 12 from the infrared detector 14 . thus , the input signals at input node 54 will be limited as a result of the feedback signal on line 26 . the first transistor 62 is connected as a common base amplifier . the resistance ratio of emitter resistor 56 to collector resistor 66 is substantially 10k : 5k . therefore , the ratio of the voltage drop across the emitter resistor 56 to the voltage drop across the collector resistor 66 is approximately 2 : 1 . turn - on transient limiting resistor 64 is provided to limit potentially damaging current transients during turn - on of the respective first or second transistors 62 and 68 and has substantially no impact on the relative voltage drops across emitter resistor 56 and collector resistor 66 . the feedback second transistor 68 is connected as an analog signal inverter . since the resistance ratio of emitter resistor 70 to the summing resistor 28 substantially is 1 : 1 , the voltage drop across the summing resistor 28 due to the feedback signal on line 26 will be substantially one - half of the voltage drop across the emitter resistor 56 . therefore , the feedback ratio of the circuit comprising the thresholding common base amplifier within dashed lines 22 and the analog signal inverter within dashed lines 24 is substantially 1 / 2 or - 6 db . the feedback limiting applied by the thresholding common base amplifier within dashed lines 22 and the analog signal inverter within dashed lines 24 , will be appreciated from the drawings of fig4 which represent an exemplary bode plot of the closed loop circuit comprising the respective first and second amplifers 18 and 20 , the thresholding common base amplifier , and the analog signal inverter . the midband gain is approximately 68 db , reflecting the - 6 db gain contribution from the feedback limiting circuit . the upper frequency breakpoint f u substantially is 224 hz , and the lower frequency breakpoint f 1 is substantially 0 . 067 hz . the upper and lower frequency rolloffs each are approximately 40 db / decade . the op - amp break frequency f a for the two stage operational amplifier is approximately 200 khz . the flat substantially horizontal portion of the bode plot between the upper frequency breakpoint f u and the op - amp break , frequency shows a gain of - 6 db . the curve of fig5 illustrates exemplary feedback limited output signals generated in response to relatively high intensity infrared radiation from the sun and relatively lower intensity infrared radiation from the earth . comparing the graphs of fig2 and 5 , one will appreciate that times labelled t 1 , t 2 and t 3 on fig2 correspond in time to similarly labelled times in fig5 . the portion of the output signal curve generated in response to infrared energy radiated by the sun is substantially limited , for example , at - 7 volts to prevent saturation of the two - stage amplifier circuit . although the output voltage resulting from the sun extends to a peak approximately 200 mv below the - 7 volt limit level due to amplification of the 100 mv input signal by a factor of two due to the feedback ratio of 1 / 2 or - 6 db , the 200 mv peak is negligible . the portion of the curve which illustrates the output signal generated in response to infrared energy radiated from the earth is not limited because the output signal has a voltage level which is not negative enough to cause saturation of the negative polarity two - stage amplifier circuit comprising the respective first and second operational amplifiers 18 and 20 . the output voltage resulting from the earth is approximately - 5 volts . the advantage realized by the improved feedback limited electronic circuit 10 of the present invention will be understood from the drawings of fig6 and 7 and the following discussion . fig6 illustrates exemplary gain versus frequency and phase versus frequency curves for the open loop two - stage forward amplifier portion of the improved circuit 10 ; thus , it illustrates circuit performance absent the feedback limiting provided by the circuit components enclosed within dashed lines 22 and 24 . fig7 illustrates exemplary gain versus frequency and phase versus frequency curves for the entire improved circuit ; thus , it illustrates circuit performance with the limiting provided by the circuit components enclosed within dashed lines 22 and 24 . the curves of fig6 and 7 illustrate performance in the region of high frequency gain crossover ( where the gain curve crosses through 0 db ). the relatively steep slope of the gain versus frequency curve between 100 khz and 1 mhz is due to the finite bandwidth f a , of the operational amplifiers 18 and 20 . two well - known and generally accepted measures of stability for closed loop amplifier circuits of the general type disclosed in the present invention are the phase margin and the gain margin . any negative feedback loop , including the loop embodied in the present invention , will be unstable and experience unwanted oscillations if the phase at the gain crossover frequency is more negative then - 180 degrees . the gain crossover frequency is the frequency at which the gain is 0 db . the phase margin is defined as the actual phase at the gain crossover frequency plus 180 degrees . the gain margin is defined as the negative of the actual loop gain at a frequency at which the phase is - 180 degrees . in typical closed amplifier circuits of the type disclosed in the present invention , a phase margin of substantially 45 degrees or more and a gain margin of substantially 6 db or more represent satisfactory stability . referring to fig6 the phase at the high frequency gain crossover is approximately - 70 degrees . therefore , the phase margin is approximately (- 70 + 180 ) degrees or 110 degrees which is satisfactory . the gain margin , however , is approximately 1 . 5 db , indicating only marginal stability . thus , the open loop two - stage forward amplifier portion of the improved circuit 10 is not satisfactorily stable and may experience unwanted oscillations . referring now to fig7 the phase at the high frequency gain crossover is approximately - 105 degrees . therefore , the phase margin is approximately (- 105 + 180 ) degrees or 75 degrees which is satisfactory . furthermore , the gain margin is approximately 7 . 5 db which also is satisfactory . thus , the improved feedback limited amplifier circuit 10 exhibits satisfactory stability . one skilled in the art will appreciate that the feedback ratio of the components within dashed lines 22 and 24 of the circuit 10 illustrated in fig1 is selected such that the phase margin and the gain margin fall within acceptable limits within which the circuit 10 exhibits satisfactory stability . although the feedback ratio of - 6 db was selected for the circuit 10 of the preferred embodiment described above , one will appreciate that a deviation from the - 6 db feedback ratio of up to approximately ± 3 db will still provide a substantially stable circuit 10 . furthermore , the circuit components enclosed within dashed lines 22 and 24 in fig1 do not include reactive elements which could introduce phase shifts . therefore , for example , the values of the respective first and second feedback capacitors 44 and 50 and the values of the respective first and second feedback resistors 42 and 48 can be changed without adversely affecting the stability of the circuit 10 . thus , the circuit 10 may be modified , for example , to change the upper and lower frequency break points f u and f 1 , respectively , and / or the gain in the mid - band region , substantially without suffering reduced stability . it will be understood that the embodiment described above is merely illustrative of many possible specific embodiments which can represent the principles of the invention . numerous and varied other arrangements can readily be devised in accordance with these principles without departing from the spirit and scope of the invention . for example , although the presently preferred embodiment represents a negative polarity circuit , those skilled in the art will appreciate that the same principles will apply to a positive polarity circuit . thus , the foregoing description is not intended to limit the invention which is defined by the appended claims in which : | 7 |
shown in fig1 a is a side view of the dense fluid centrifuge used to perform the various processes of the present invention generally designated ( 1 ). the dense fluid centrifuge ( 1 ) has a high pressure vessel ( 2 ) with high pressure centrifuge lid ( 4 ) which is operated using a hydraulic lift cylinder ( 6 ). the centrifuge lid ( 4 ), when closed as shown , is secured to and seals the high pressure vessel ( 2 ) using a rotating locking ring ( 8 ) which is rotated using a hydraulic ring closure cylinder ( 10 ). the high pressure vessel ( 2 ) contains several ports for filling and draining the dense fluid centrifuge under isobaric and isothermic conditions . a fill port ( 12 ) is located in the lower half of the pressure vessel ( 2 ). a first drain port ( 14 ) used during draining in the vertical orientation of the dense fluid centrifuge is located in the lower half of the pressure vessel ( 2 ). a second drain port ( 16 ) used during draining in the horizontal orientation is located in the lower half of the pressure vessel ( 2 ). a vent port ( 18 ) is located in the upper half of the pressure vessel ( 2 ) and is used to transfer gas saturated vapor during isobaric filling and draining operations of the present invention . when the pressure vessel ( 2 ) is optionally rotated between vertical and horizontal orientations , the vent port ( 18 ) remains above the liquid phase contained within the pressure vessel . within the pressure vessel ( 2 ) is housed a dense fluid centrifuge ( 1 ). forming the dense fluid centrifuge ( 1 ) is a magnetic or other suitable drive system ( 20 ) attached to the center of the bottom half of the pressure vessel ( 2 ) which contains a rotating shaft ( 20 a ) which feeds through a drive shaft seal ( 22 ) which is located and centered within and at the bottom of the pressure vessel ( 2 ) and into a slot ( not shown ) within the center of a specialized lower drum bearing ( 24 ). also connected to the magnetic drive system is a drive belt ( 20 b ) which is affixed to a drive motor ( 20 c ) and the drive motor system has both variable rotational speed and direction . the lower drum bearing ( 24 ) is formed in two sections — an upper bearing plate ( 24 a ) and a lower bearing plate ( 24 b ) sandwiching a self - lubricating bearing ( not shown ). the lower drum bearing design is necessary to carry and distribute eccentric and heavy loads which may be present in the dense fluid centrifuge drum ( 26 ) under high rotational velocities or during optional gimbal rotations ( fig2 a - 2 c ). the upper bearing plate ( 24 a ) rotates freely about the central axis — being directly connected to the rotating shaft ( 20 a ). the lower bearing plate is immobile and is affixed to the lower half of the pressure vessel ( 2 ). optionally , drum load springs ( 28 ) may be affixed to the top of the upper bearing plate parts which are used to interface with the dense fluid centrifuge drum ( 26 ). the dense fluid centrifuge drum ( 26 ), which may have various shapes and sizes ( fig1 a - 11 e ), is affixed to the upper bearing plate ( 24 a ), which then rotates freely , and at variable velocities , in a clockwise or counterclockwise direction as determined by the rotation of the rotating shaft ( 20 a ) powered by an external magnetic or other suitable drive motor system ( 20 ). a upper bearing assembly ( 30 ), similar in design and function to the lower drum bearing 24 , may be affixed to the upper half of the centrifuge drum ( 26 ) to support the centrifuge drum during high speed and eccentric load rotations and during optional gimbal rotations of the dense fluid centrifuge . within the interior of the dense fluid centrifuge ( 1 ) is a central centrifuge compartment ( 32 ) defined by a cylindrically shaped , but porous , stationary barrier , the centrifuge shield ( 34 , which circumscribes the centrifuge drum ( 26 ) segregating off the centrifuge compartment ( 32 ) which is thereby separate from the pressure vessel &# 39 ; s ( 2 ) interior walls and extends from the centrifuge lid ( 4 ) to the lower half of the pressure vessel ( 2 ) and contains the rotating centrifuge drum ( 26 ), lower drum bearing ( 24 ) and shaft seal ( 22 ). a second circumferential compartment is defined between the centrifuge shield ( 34 ) and inner wall of the pressure vessel ( 2 ) which defines a separation compartment or zone ( 36 ) which is baffled ( not shown ) to retard flow within this region . the centrifuge shield ( 34 ) both protects the pressure vessel ( 2 ) inner walls from potential impact by the rotating centrifuge and / or contents contained therein and provides zones of turbulent cleaning action ( centrifuge compartment ) and non - turbulent separation action ( separation compartment ). shown in fig1 a - 1 c is a multi - ported spray manifold ( 38 ) which is affixed to the centrifuge shield ( 34 ), and is connected to the fill port ( 12 ). the multi - ported spray manifold ( 38 ) is used to uniformly deliver dense fluid , admixtures , prewash agents and heating gas to the interior of the centrifuge compartment during the cleaning process . control of the phases of the carbon dioxide during the processes discussed herein using the dense fluid centrifuge is accomplished via optical sensors . shown in fig1 a are optical sensors which are used to detect the presence or substantial absence of a liquid carbon dioxide phase . a high level optical sensor ( 40 ) is located substantially in the uppermost region of the pressure vessel ( 2 ) and is used to detect when the centrifuge compartment is full of liquid carbon dioxide and / or prewash agent . a lower level optical sensor ( 42 ) is located substantially in the lowermost region of the pressure vessel ( 2 ) and is used to detect when the centrifuge compartment is substantially empty of liquid carbon dioxide or prewash agent . control of the pressure and temperature during the cleaning process is accomplished using a pressure and temperature sensor . a pressure transducer ( 44 ) is connected located to the pressure vessel and is used to measure pressure conditions within the dense fluid centrifuge ( 1 ). a temperature thermocouple ( 46 ) is connected to the pressure vessel and is used to measure temperature conditions within the dense fluid centrifuge ( 1 ) and / or the separation compartment ( 36 ). it should be apparent to those skilled in the art that a variety of pressure and temperature sensing and measuring devices may be interchangeably used to accomplish the pressure and temperature measurements within the dense fluid centrifuge ( 1 ) and such modifications are within the intended scope of this invention . although not essential to the device or process an optional vibration sensor ( 48 ) may be used to detect translated vibrations caused by eccentrically rotating loads contained within the centrifuge drum ( 26 ). the dense centrifuge drum ( 26 ) is shown in fig1 a contained within the interior of the centrifuge compartment ( 32 ) defined by the centrifuge shield ( 34 ). the centrifuge shield ( 34 ) has affixed to it baffles ( 34 a ), which may be solid or perforated and which retard fluid flow within a separation compartment ( 36 ) created between said centrifuge shield ( 34 ) and the inner wall of the pressure vessel ( 2 ). the multi - ported spray manifold ( 38 ), shown affixed to the centrifuge shield ( 34 ), sprays dense fluid , admixtures , prewash agents and hot air into the interior of the centrifuge compartment ( 32 ). the vent port ( 18 ) is located within the separation zone ( 36 ) as are first drain port ( 14 ) and the second drain port ( 16 ). [ 0059 ] fig1 c is a flow diagram of the cleaning and separation phenomenon associated with rotation of the centrifuge drum ( 26 ) in either direction and at various rotational velocities which imparts a centrifugal force ( 50 ) upon the substrates , dense fluid and / or admixtures contained therein ( all not shown ). moreover , rapid rotational velocity in either direction produces a fluid shearing force ( 52 ) which imparts scouring vortices to the substrates being cleaned . delivering dense fluid through the multi - ported spray manifold ( 38 ) during centrifugation also delivers additional cleaning and separation energy via the spray flow ( 54 ) from the multi - ported spray manifold ( 38 ) directed towards the substrates ( not shown ) which opposes the centrifugal and fluid shearing forces . the physicochemistry within the centrifuge compartment ( 32 ) is modified during centrifugation which determines the cleaning and / or separation phenomenon therein . the dense fluid centrifuge produces two simultaneous processes cleaning and separation . the cleaning action occurs within a cleaning zone which is very turbulent as indicated by a reynolds number ( nr ) of at least 1000 and more preferably in a range of 1000 to 10000 and most preferably above 10 , 000 and separation action within a separation zone which is highly non - turbulent with a nr & lt ; 1 , 000 and more preferably between 1000 and 0 . within the device during its contaminated fluids and solids are concentrated and segregated under centrifugal force , isolated from the processed substrates contained within the centrifuge compartment ( 32 ). contaminates are withdrawn from the separation compartment ( 36 ) and clean dense fluids are introduced into the centrifuge compartment via the multi - ported spray manifold ( 38 ). after placing a substrate for cleaning into the dense fluid centrifuge compartment ( 32 ) the centrifuge lid ( 4 ) is rotated down to the closed position using a hydraulic lid cylinder ( 6 ). following this , the locking ring ( 8 ) is rotated about the centrifuge lid ( 4 ) using a locking ring hydraulic cylinder ( 10 ). the high pressure lid , when in the closed position , defines and seals the uppermost half of the centrifuge compartment ( 32 ). an alternate embodiment of the dense fluid centrifuge ( 1 ) combined with a gimbal device ( 56 ), shown in fig2 a - c . a gimbal pivot assembly ( 58 ) is affixed to the dense fluid centrifuge ( 1 ) at two central but opposite connection points and movably anchored a gimbal base ( 62 ) a hydraulic cylinder ( 64 ) is used to rotate the gimbal pivot assembly ( 58 ) and connected dense fluid centrifuge ( 1 ). the gimbal device ( 56 ) provides a stable platform from which the dense fluid centrifuge ( 1 ) can be rotated to any orientation from vertical ( as shown ) to horizontal orientation . the dense fluid centrifuge may be used in an upright orientation ( fig2 a ), a barreling orientation ( fig2 b ), a tumbling orientation ( fig2 c ), or any combination thereof . a flow diagram of the integrated dense fluid cleaning and management system is provided in fig3 . the dense fluid cleaning and management system provides automatic isobaric filling and draining operations during dense fluid phase shift cleaning processes , carbon dioxide recovery and prewash agent delivery and recovery operations of the present invention . vapor and liquid phase fluid transfers are accomplished using a vapor transfer module ( 66 ) and liquid phase transfer module ( 68 ) located at the upper and lower halves , respectively , of a dense fluid clean liquid carbon dioxide storage module ( 70 ) and carbon dioxide recovery module ( 72 ) in relation to the upper and lower halves of the dense fluid centrifuge ( 60 ). also contained in the integrated dense fluid cleaning and management system is a pretreatment agent recovery module ( 74 ) and a separated waste management module ( 76 ). the dense fluid centrifuge module ( 60 ) contains the dense fluid centrifuge ( 1 ) and may also contain the optional gimbal device ( 56 ). vapor and liquid - phase dense fluid is exchanged , via ports , under isobaric and isothermal conditions between this module and the clean liquid c0 2 storage module ( 70 ) and c0 2 vapor recovery module ( 72 ) through a vapor port connect to a vapor zone within the upper half of the dense fluid centrifuge ( 1 ) and from the lower half of the dense fluid centrifuge ( 1 ) through a liquid port . pretreatment agent ( 74 ) and waste management modules ( 76 ) may also be added . the clean liquid c0 2 storage module ( 70 ) contains and maintains condensed - phase carbon dioxide under vapor - liquid equilibrium conditions . makeup carbon dioxide from an external supply source is delivered to this module as needed . an additive injection unit may also be connected to this module . the c0 2 recovery module ( 72 ) fractionates dirty dense fluid received from dense fluid centrifuge ( or clean liquid c0 2 storage module ) into liquid - and gas - phase constituents . a c0 2 vapor recovery pipe connects the vapor zone of this module to the vapor transfer module . a liquid recovery pipe connects the liquid zone to the pretreatment agent or waste management systems . the c0 2 vapor transfer module ( 66 ) houses the vapor transfer bridge , vapor pump , aerosol stripper and optional vapor treatment device . this module is located in the vapor zone of the fluid management system . a pipe connects the separated aerosols from the aerosol separator to the liquid zone of the c0 2 recovery module . this module connects to the vapor zones of the c0 2 recovery module ( 72 ) and dense fluid centrifuge module ( 60 ) via the vapor transfer bridge . this module maintains relatively constant pressure between all connected modules . optional catalytic and metal oxide treatment unit and supercritical ozonation unit ( both not shown ) can be used in - line on the vapor transfer bridge to increase the purity level of the resulting clean liquid c0 2 and provide additive chemistry to the dense fluid centrifuge module , respectively . the c0 2 liquid transfer module ( 68 ) houses the liquid transfer bridge , liquid pump and in - line filter . this module is located in the liquid zone of the fluid management system . this module connects to the liquid zone of the dense fluid centrifuge module and the liquid zone of the c0 2 recovery module via the liquid transfer bridge . the pretreatment agent management module ( 74 ) is an optional subsystem which houses the prewash agent , agent pretreatment devices , delivery and return pump , valves and level control devices for delivery of prewash agent to and from dense fluid centrifuge or return of additives back to the optional additive injection unit . a c0 2 vapor recovery line connects this module to the vapor transfer module . the waste management module ( 76 ) is another optional subsystem collects and stores the separated pre - spin waste , contaminants and spent prewash agent and residues . a pipe connects the liquid zone of this module to the liquid zones of the c0 2 recovery module and pretreatment agent recovery module . finally , an optional recirculation pump and filter element may be placed located in the liquid to perform a continuous centrifugal spray wash or centrifugal spray - under - immersion enhancement for the pretreatment and phase - shift extraction operations . high pressure high level optical sensors ( hlos ), located in the vapor zones , and low level optical sensors ( llos ), located in the liquid zones , are employed herein to measure dense fluid phase levels in the dense fluid centrifuge , clean liquid c0 2 storage and c0 2 recovery modules during phase - shifting , pre - wash , vapor recovery and recharge operations . a heat pump is used to remove heat from the clean liquid c0 2 storage module and input heat into the c0 2 recovery module . vapor and liquid are maintained under relatively equilibrium conditions and dense fluid transfers between modules are performed with less energy input . under these conditions , vapor and liquid transfers can be made without a mechanical pump , using only differences in density and vapor - liquid boundary elevations between modules to perform the transfer operations — as in during centrifugal phase - shift separation operations . for example , saturated liquid flows from the clean liquid c0 2 storage module into the dense fluid centrifuge module via the liquid transfer bridge as saturated vapor is returned from the vapor zone of the dense fluid centrifuge module back to the vapor zone of the clean liquid c0 2 storage module via the vapor transfer bridge . following which , saturated dirty liquid will flow from the dense fluid centrifuge module to the c0 2 recovery module ( provided that the liquid zone level therein has been distilled to a level that is lower than the dense fluid centrifuge module ) during which saturated vapor flows through the vapor transfer bridge into the vapor zone of the dense fluid centrifuge module . an overview of the dense fluid centrifugal cleaning and management process is illustrated in fig4 a which shows the five major sequences of the process . sequence i , is the load sequence ( 78 ) wherein substrates are placed into a basket ( fig1 c ) or other suitable centrifuging fixture and placed into the high pressure vessel and specifically into the centrifuge drum . the door or lid is closed and the process is ready to start . sequence ii , the “ centrifuge dense fluid sequence ” ( 80 ) is separated into four cycles a - d , some of which are optional . during cycle a ( 80 a ) the centrifuge begins to oscillate in a bi - directional rotation at a preset ramp rate between a maximum and minimum rotational speed and acceleration rate . this sequence continues throughout the rest of the sequence . alternatively , tumble and barrel cycles can be set at this point for subsequent and optional gimbal operations ( fig2 b and 2 c ). cycle b ( 80 b ) is an equalization step which may include an optional a pre - spin cycle to remove gross contaminants which are now being spun from the substrates following which an optional prewash cycle which can precondition , react with or otherwise modify the contaminants contained on the substrate may be added . these optional steps involve centrifugal froth flotation and multiphase cleaning ( liquid - gas , liquid - liquid and liquid - scf extractions ) to assist in scouring and scrubbing tough contaminants from substrates . after , or in the absence of , the above optional steps the equalization step is performed to equalize the vapor zone pressures between the vapor transfer module and dense fluid centrifuge module . cycle c ( 80 c ) is an optional cycle the phase shift extraction cycle which may contain an centrifugal froth flotation step . this step is similar to the cycle b optional prewash frothing step , although it uses only c0 2 pressure adjustments , to create scrubbing bubbles to assist with scouring and centrifuging fine particles from substrates . cycle d ( 80 d ) is another optional cycle wherein dense fluid is recovered . optional centrifugal gas heat up or thermal vacuum extraction processes are performed at this point . following these optional post - treatment operations , the centrifuge cycle is stopped ( no motion ). sequence iii , is the unload sequence ( 82 ) at this point the lid is opened . the substrates contained in the basket or fixture are removed from the centrifuge drum and the cleaning process is ended . sequence iv , the dense fluid management sequence ( 84 ) occurs in parallel with the three sequences described above , dense fluid , prewash agent and waste are managed in the background . using the modules previously described , dense fluids are distilled , filtered , transferred , chemicals added to , and vapor is purified and condensed . prewash agents and wastes are managed in separate operations . sequence v is the automation and control sequence ( 86 ) it occurs in parallel with the four sequences described above , electronic measurements are made continuously within each module and include phase determination , level determination , pressure , temperature , rotational speed , vibration , centrifuge orientation angle and lid closure state , among many others . electronic sensors , a plc or pc and software are required to perform the measurements and tasks described herein . a detailed illustration of the dense fluid centrifugal cleaning and management process is shown in fig4 b which further distills the five general sequence illustrated in fig4 a in to a sequence of steps . sequence i , ( also step 1 ) is the “ load sequence ” ( 78 ): during the “ load sequence ” the substrates are loaded into a suitable basket of fixture and placed into dense fluid centrifuge drum ( 26 ) and the centrifuge lid is closed and locked using hydraulic closure control and locking ring mechanisms ( fig1 a - d ). the system is now ready for prewash , extraction and recovery sequences . sequence ii , the “ centrifuge dense fluid sequence ” ( 80 ) is separated into four cycles a - d , some of which are optional . step 2 begins by rotating the centrifuge drum ( fig1 a , 26 ) containing substrates in the dense fluid centrifuge in a clockwise or counterclockwise direction at between about 50 and about 500 rpm , ramping up to between a pre - selected upper and lower centrifuge speed and acceleration rates that are as fast as permissible by the magnetic coupling of the drive ( i . e ., about 250 inch pounds torque ) and motor drive capabilities ( fig1 a ) after a predetermined period of time , stopping the dense fluid centrifuge completely , reverse direction , and begin speed ramp again . this is called the “ centrifuge cycle ”. the centrifuge cycle is operated continuously throughout the remainder of sequence ii . the action of the centrifuge cycle produces variable fluid shear in the centrifuge — does not allow the prewash agent or dense fluid within the chamber to reach an equilibrium velocity with the rotating substrates . during cycle a ( 80 a ) the centrifuge oscillates in a bi - directional rotation at a preset ramp rate between a maximum and minimum rotational speed and acceleration rate . this sequence continues throughout the rest of the sequence . alternatively , tumble and barrel cycles can be set at this point for subsequent and optional gimbal operations ( fig2 b and 2 c ). if the gimbal device ( 56 ) shown in fig2 a is used , the centrifuge drum ( 26 ) may be oriented to any angle from vertical to horizontal to allow for barrel finishing and tumble finishing . separate barrel - fuge and tumble - fuge cycles can be selected at this point , but are optional . barrel - fuge and tumble - fuge cycle operations have similar oscillation changes but always have a much lower and constant ( no ramping ) rotational velocity of between about 1 and about 20 rpm . prior to rotating from a vertical ( centrifuge ) to barrel ( about 45 degrees ) or tumble ( about 90 degrees ) orientation , the centrifuge automatically changes to the predetermined barrel - fuge or tumble - fuge cycle settings . step 3 is an optional step which may occur prior to vapor equalization , during which waste is recovered . the inclusion of this step in the process is dependant on the nature of substrate being cleaned . during this step excess oils and solid contaminants ( if present ) are wrung from the substrates located within the centrifuge drum ( 26 ) and transferred under centripetal force into the separation zone ( 36 ). a liquid transfer valve ( 88 ) is opened and a waste evacuation pump ( 90 ) is turned on to transfer separated contaminants from the dense fluid centrifuge module ( 60 ) through drain ports ( b or d , depending upon orientation of centrifuge ) through filter element ( 92 ) via liquid transfer pipe ( 94 ) through opened waste transfer valve ( 96 ) to the waste management module ( 76 ). step 4 is another optional step . during this step a pre - wash may be accomplished by using one or more of the following processes ( a ) centrifuge spray cleaning , ( b ) spray - under - immersion and ( c ) multiphase froth flotation with liquid - gas , liquid - liquid or liquid - scf multiphase extraction . generally , to begin , a prewash agent from a pretreatment agent management module ( 74 ) at a predetermined temperature of between about 20 and about 150 c . is transferred by opening a liquid transfer valve ( 100 ), using a liquid transfer pump ( 102 ), and liquid transfer pipe ( 104 ) into fill port ( a ) and delivered via the multi - ported spray manifold ( 38 ) to the substrates contained in the centrifuge drum ( 26 ). the substrates are then effectively centrifugally spray washed , scoured and thoroughly coated with prewash agent during the entire filling operation ( spray wash / wring operation ) with loosened and separated contaminants transferred under centripetal force from the centrifugal cleaning zone ( 32 ) to the separation zone ( 36 ). more particularly , a centrifugal spray cleaning operation may be used during which the pressure vessel ( 2 ) and perforated centrifuge drum ( 26 ) within are filled partially as determined by the low level optical sensor ( 42 ), whereupon a recirculation pump ( 106 ) with filter element ( 108 ) continuously sprays filtered prewash agent over centrifuged substrates via multi - ported spray manifold ( 38 ). this is performed by opening liquid transfer valve ( 110 ) and pumping filtered prewash agent from drain port ( d or b depending upon centrifuge orientation ) through recirculation pipe ( 112 ) into fill port ( a ) and through the multi - ported spray manifold ( 38 ) and the liquid transfer valve ( 100 ) is closed and the transfer pump ( 102 ) from the pretreatment agent management module ( 74 ) is turned off . or a centrifugal spray - under - immersion cleaning operation may be used during which the pressure vessel ( 2 ) and perforated centrifuge drum ( 26 ) within are filled completely as determined by high level optical sensor ( 40 ), whereupon a recirculation pump ( 106 ) with filter element ( 108 ) continuously sprays - under - immersion filtered prewash agent over centrifuged substrates via internal spray manifold . this is done by opening liquid transfer valve ( 110 ) and pumping filtered prewash agent from drain port ( d or b depending upon centrifuge orientation ) through recirculation pipe ( 112 ) into fill port ( a ) and through multi - ported spray manifold ( 38 ). in either case ( operation 4 a or 4 b ), and when prewash fill operation is completed and the liquid transfer valve ( 100 ) is closed and the transfer pump ( 102 ) from the pretreatment agent management module ( 74 ) is turned off . or a centrifugal froth flotation and multiphase cleaning operations may be used to increase pressure ( fluidize ) within dense fluid centrifuge by transferring clean liquid carbon dioxide stored in a storage tank ( 114 ) located in the clean liquid c0 2 storage module ( 70 ) via the liquid transfer pipe ( 116 ) located in the liquid transfer module ( 68 ) through opened liquid transfer valve ( 118 ) and through fill port ( a ) located in the liquid zone of the dense fluid centrifuge module ( 60 ) and through multi - ported spray manifold ( 38 ) to a pressure of between about 650 and about 2000 psi . a liquid booster pump ( 120 ) is used to fluidize the chamber to pressures greater than the equilibrium pressure within the clean c0 2 storage module ( 70 ) pressure ( typically & gt ; 900 psi ). following this , the booster pump ( 120 ) is turned off and the transfer valve ( 118 ) is closed . next a vent valve ( 121 ) located on vent return pipe ( 122 ) is opened which connects the vent port ( c ) to the c0 2 recovery module ( 72 ). this operation may be used to controllably reduce the pressure ( defluidizes ) within the dense fluid centrifuge by transferring vapor from the dense fluid centrifuge module ( 60 ) to dense fluid recovery tank ( 124 ), next the vent valve ( 121 ) is closed . the whole process to defluidize may be repeated as required . at the end of this step , ( step a ) the dense fluid centrifuge internal pressure should be returned to near ambient pressure conditions . this may be accomplished by first recovering dense fluid vapor through vent port ( a ), recovery pipe ( 122 ), opened vent valve ( 121 ) and into the c0 2 recovery tank ( 124 ) until pressure is equalized between the two modules . following this , the vent valve ( 121 ) is closed . this optional step produces several advantageous cleaning actions including co - solvency , emulsion cleaning and centrifugal shear , frothing or foaming , bubble shearing and scouring action and gas - solid flotation mechanisms and may be performed in the barrel - fuge and tumble - fuge operations . other advantages to using this optional step depending upon the temperature , as measured by temperature thermocouple ( 46 ), of prewash agent and fluidization pressure exerted , as measured by the pressure transducer ( 44 ) or other similarly functioning measurement or sensing devices , the dense fluid phase ( s ) present within the dense fluid centrifuge module ( 60 ) using liquid carbon dioxide and prewash agent may be controlled to be a combination of vapor , liquid or supercritical fluid — producing a range of prewash agent - dense fluid physical and chemical combinations . these include liquid - gas extraction , liquid - liquid extraction and liquid - supercritical fluid extraction . a non exhaustive list of pre - wash additive include oxidants such as ozone gas , supercritical ozone , sulfur dioxide gas , sulfur dioxide liquid , sulfur trioxide gas and hydrogen peroxide liquid , or reducing agents such as dimethyldithiocarbamate liquid , or liquid alcohols and glycols such as methanol , isopropanol , polyalcohols ( some solids may be dissolved in soy methyl esters as additives ), polyethylene glycol and tetrahydrofurfuryl alcohol ( thfa ), or esters such as soy methyl esters , or oils such as napthenic , paraffinic and aromatic oils , or alkanes such as propane , butane or hydrochlorofluorocarbons , or alkenes such as propylene carbonate , or liquefied gases such as liquid nitrogen , liquid ammonia , sulfur dioxide , butane , propane , sulfur hexafluoride or hydrofluorocarbons . in addition , prewash agents can be complexing agents , chelating agents , surfactants , detergents , dispersants , foaming agents , brighteners , softeners and bactericidal agents and combinations thereof . step 5 is another optional step . following the completion of any one or combination of the options detailed in step 4 the bulk of the prewash agent is removed from the dense fluid centrifuge module ( 60 ) and returned to the pretreatment agent management module ( 74 ) via drain port ( d or b depending upon orientation of centrifuge ) through opened liquid transfer valve ( 88 ) with liquid transfer pump ( 90 ) turned on and through liquid transfer pipe ( 94 ) and through opened valve ( 126 ). valve ( 88 ), valve ( 126 ) and transfer pump ( 90 ) remain on for a time period from 30 seconds to 3 minutes while the centrifuge cycle continues to separate residual prewash agent from pretreated substrates . following this , valve ( 88 ) and valve ( 126 ) are closed and pump ( 90 ) is turned off . step 6 follows the completion of steps 2 - 5 or any combination thereof , the vapor pressures between dense fluid centrifuge module ( 60 ) and clean liquid c0 2 storage module ( 70 ) are equalized through the vapor zones of each system using the vapor transfer bridge ( 128 ) located in the vapor transfer module ( 66 ). vent valve ( 130 ) located on vent line ( 122 ) is opened to the vent port ( c ) until the pressures between the two modules are approximately equal , determined by comparing a clean tank pressure sensor ( 132 ) with the dense fluid centrifuge module through the pressure transducer ( 44 ) cycle c is the “ phase shift extraction cycle ” wherein extraction and recovery of trace prewash agents , contaminants , particles or residues and dense fluid from substrates under isobaric and isothermal conditions occurs . step 7 is the initial phase change . it is a “ solvent phase ” during which the vapor bridge , connected to the vent valve ( 130 ), is opened . clean dense fluid ( liquid ) is transferred from storage tank ( 114 ) located in the clean liquid c0 2 storage module ( 70 ) via the liquid transfer bridge ( 116 ) located in the vapor transfer module ( 68 ) through opened liquid transfer valve ( 118 ) and through fill port ( a ) located in the liquid zone of the dense fluid centrifuge module ( 60 ) and through multi - ported spray manifold ( 38 ) and to a pressure of between about 650 and about 2000 psi . displaced dense fluid vapor returns through vent port ( c ) via vent line ( 122 ) through vent valve ( 130 ) and into vapor transfer module ( 66 ). during this operation , the substrates are being centrifugally scoured and spray washed . a liquid booster pump ( 120 ) is used to fluidize the chamber to pressures greater than the equilibrium pressure within the clean c0 2 storage module ( 70 ) pressure ( typically & gt ; 900 psi . ), to perform this , a booster pump ( 120 ) is turned on and the valve ( 118 ) is closed . step 8 is the second phase change . it is a “ non - solvent phase ” during which contaminated dense fluid is transferred through one of the two drain ports ( d or b depending upon centrifuge orientation ) from dense fluid centrifuge under isobaric and isothermal conditions ( vapor phase exchange ) through valve ( 134 ) and transfer pipe ( 136 ) and into the liquid zone of the recovery tank ( 124 ) while vapor from the clean storage tank ( 114 ) replaces evacuated contaminated dense fluid liquid within cleaning vessel under constant temperature and pressure through valve ( 130 ) and transfer pipe ( 122 ) and through vent port ( c ). alternatively , dirty dense may be returned back to the clean tank ( 114 ) if not grossly contaminated or if it contains special additives using liquid transfer pump ( 106 ) through transfer line ( 138 ) through transfer valve ( 140 ) and into clean storage tank ( 114 ). during this process , the liquid phase is receding within the dense fluid centrifuge causing the liquid - phase ( high density ) dense fluid containing contaminants to be wrung out of internal cavities as the vapor phase ( lower density ) dense fluid increases in volume — flushing particles and oily contaminants from internal cavities . using isobaric transfer greatly limits temperature drop during liquid carbon dioxide phase exchange , typical of conventional processes . step 9 is a cleaning operation which may take one or more of three forms ( a ) centrifugal spray , ( b ) centrifugal spray - under - immersion and ( c ) centrigal froth flotation . additionally , the cleaning operation ( s ) may occur during a variety of orientations of the centrifuge drum ( 26 ) via the gimbal device ( fig2 a - 2 c ) to tumble and / or barrel orientations and all orientations in - between . a centrifugal spray operation may be used during which the pressure vessel ( 2 ) and perforated centrifuge drum ( 26 ) within are filled partially as determined by the low level optical sensor ( 42 ), whereupon an optional recirculation pump ( 106 ) with filter element ( 108 ) continuously sprays filtered liquid carbon dioxide over centrifuged substrates via multi - ported spray manifold ( 38 ). this is done by opening liquid transfer valve ( 110 ) and pumping liquid carbon dioxide obtained from drain port ( d or b depending upon centrifuge orientation ) through recirculation pipe ( 112 ) into fill port ( a ) and through the multi - ported spray manifold ( 38 ). or a centrifugal spray - under - immersion cleaning operation may be used during which the pressure vessel ( 2 ) and perforated centrifuge drum ( 26 ) within are filled completely as determined by high level optical sensor ( 40 ), whereupon optional recirculation pump ( 106 ) with filter element ( 108 ) continuously sprays - under - immersion filtered liquid carbon dioxide over centrifuged substrates via internal spray manifold . this is done by opening liquid transfer valve ( 106 ) and pumping filtered liquid carbon dioxide obtained from drain port ( d or b depending upon centrifuge orientation ) through recirculation pipe ( 112 ) into fill port ( a ) and through the multi - ported spray manifold ( 38 ). or centrifugal froth flotation cleaning operation may be used . the pressure within the dense fluid centrifuge module ( 60 ) is increased pressure to between about 650 and about 2000 psi by transferring clean liquid carbon dioxide stored in a storage tank ( 114 ) located in the clean liquid c0 2 storage module ( 70 ) via the liquid transfer bridge located in the vapor transfer module ( 68 ) through opened liquid transfer valve ( 118 ) and through fill port ( a ) located in the liquid zone of the dense fluid centrifuge module ( 60 ) and through the multi - ported spray manifold ( 38 ). a liquid booster pump ( 120 ) is used to fluidize the chamber to pressures greater than the equilibrium pressure within the clean c0 2 storage module ( 70 ) ( typically & gt ; 900 psi ). following this , the booster pump ( 120 ) is turned off and the transfer valve ( 118 ) is closed . following this , vent valve ( 121 ) located on vent return pipe ( 122 ) is opened which connects the vent port ( c ) to the c0 2 recovery module ( 72 ). this operation reduces the pressure ( defluidizes ) within the dense fluid centrifuge by transferring back vapor to dense fluid recovery tank ( 124 ). following this , the vent valve ( 50 ) is closed . if required , the dense fluid centrifuge may be re - fluidized to the predetermined fluidization pressure and defluidized repeatedly as described above . at the end of this operation , equalize dense fluid centrifuge internal pressure with clean tank storage tank pressure by opening vapor transfer valve ( 130 ) connected to vent port ( c ) with vapor transfer pipe ( 122 ) and through vapor transfer bridge ( 128 ) into the vapor zone of a clean storage tank ( 114 ). finally , the centrifugal phase shift process can be using the gimbal device ( 56 ) ( fig2 a - c ) to the barrel orientation and / or to the tumble orientation and back to the vertical orientation , with the centrifuge cycle altered to a predetermined tumble - fuge or barrel - fuge cycle , respectively . dense fluid will separate from substrates during rotation into saturated vapor phase at top of rotation and saturated liquid phase at bottom of rotation . the phase shift extraction cycle concludes following the last isothermal - isobaric transfer from dense fluid centrifuge into either the clean tank or recovery tank — with only dense fluid vapor phase present within dense fluid centrifuge . steps 8 and 9 my be repeated sequentially as required to produce “ solvent ” and “ non - solvent ” phase conditions sequentially and instantly under isothermal and isobaric conditions while the substrates are continuously operating under the centrifugal cycle producing vigorous scouring , void filling and draining , frothing and variable solvency . step 10 , represents the recovery of the residual dense fluid vapor contained within dense fluid centrifuge . residual dense fluid is recovered through vent port ( c ), vapor transfer pipe ( 122 ), opened vapor transfer valve ( 130 ) through vapor transfer bridge ( 142 ) through vapor aerosol condenser ( 144 ) and using a gas booster pump ( 146 ), whereupon the vapor is compressed and condensed using a heat exchanger ( 148 ), is transferred into the clean storage tank ( 114 ). the dense fluid recovery operation is typically performed until internal dense fluid centrifuge pressure is lowered to about 300 psi as measured by pressure transducer ( 44 ). step 11 is an optional step . should heating and ionization of the substrates be necessary whether because the optional dense fluid froth flotation cycles are performed or the substrates must be outgassed to remove residual vapor and electrostatic charges . hot ionized gas is produced under pressure by heating and ionizing a gas from an external source ( i . e ., air ) or vapor from the clean c0 2 liquid storage tank ( 114 ), if c0 2 vapor is used , it is recycled into the vapor recovery module . using clean dry air , air is fed through a vapor transfer valve ( 150 ), using a heater - ionizer unit ( 152 ) and through transfer pipe ( 116 ) and into fill port ( a ) and through internal spray manifold ( 38 ) during which the dense fluid centrifuge cleaning vessel is continuously vented to the atmosphere through vent port ( c ) and through either vent valve ( 154 ) via vent pipe ( 156 ) and into the atmosphere or , if c0 2 is used , through vent valve ( 120 ) and into vapor zone of contaminated dense fluid storage tank ( 124 ). centrifugal hot ionized gas spraying continues until the internal temperature is greater than 20 c . the heated ionization cycle may also be performed using an internal infrared heating - ionization element ( not shown ) which traverses the vertical axis of the internal spray manifold ( 38 )— which uniformly exposes substrates to said internal heating - ionization element using the centrifuge with or without a negative pressure to expose all of the substrates . a combination of negative pressure with the infrared heater - ionization embodiment heats and neutralizes charges contained on the substrates more quickly . following this operation , the heater - ionizer unit ( 152 ) is turned off . step 12 is when the lowering of the residual gas pressure , within the dense fluid centrifuge , to ambient pressure conditions by leaving vent valve ( 154 ) open until internal pressure is less than about 20 psi as measured by pressure transducer ( 44 ). step 13 is an optional step . following the release of residual pressure , the dense fluid centrifuge may be placed under vacuum conditions with internal infrared heating to outgas and residual and trace vaporous contaminants . step 14 marks is the end of the “ dense fluid recovery cycle ” is stopped the centrifuge activity ceases and the motor is slowed to zero rotational velocity . sequence iii is the unload sequence which has one step . step 15 is when the centrifuge lid ( 4 ) is unlocked using hydraulic unlock and opened and the clean and finished , heated and ionized , substrates within the centrifuge drum ( 26 ) are removed . the system is now ready for another dense fluid cleaning and finishing process . sequence iv is the dense fluid management sequence . this sequence occurs in parallel and in combination with sequences i - iii . step 16 is when the vapor transfer and equalization operations occur . contaminated dense fluid contained in the recovery tank ( 124 ) is continuously separated by distillation into two phases : a saturated vapor phase comprising carbon dioxide and a liquid phase comprising prewash agent ( s ), carbon dioxide additive ( s ) and contaminant ( s ). heat required for constant pressure and temperature distillation is supplied preferably withdrawn from the clean storage tank ( 114 ) using a heat pump ( 158 ). the saturated vapor phase contained in the vapor zone of the recovery tank ( 124 ) is transferred through the vapor transfer bridge ( 142 ) using a gas pump ( 146 ) and through an aerosol vapor separator ( 144 ) and through a heat exchanger ( 148 ) and into the temperature - controlled clean storage tank ( 114 ). a combination of vapor transfer pump ( 146 ) and heat pump ( 158 ) maintain the pressure and temperature within the clean storage tank under vapor - liquid equilibrium conditions from about − 40 to about 70 f . and about 650 to about 850 psi , respectively . a vapor transfer bridge ( 142 ) maintains vapor pressure equilibrium between clean storage tank and - recovery tank to prevent supersaturation ( non - equilibrium ) conditions . aerosol contaminants scrubbed from the vapor using a high pressure aerosol separator ( 144 ) are returned to recovery tank liquid zone via aerosol transfer pipe ( 160 ). step 17 is an optional step . if prewash step 17 occurs this step allows for the recovery of prewash agent and contaminants . during this step , the liquid phase constituents separated and concentrated within the liquid zone of the recovery tank ( 124 ) are periodically transferred , under pressure , to the pretreatment agent management module ( 74 ) via a transfer pipe ( 162 ) and through an opened transfer valve ( 164 ) as required for treatment , reuse or disposal under the vapor pressure supplied in recovery tank ( blowdown recovery operation ). following this operation , prewash agent valve ( 164 ) is closed . the mixture of carbon dioxide gas and optionally heated prewash agent stored in the prewash agent storage tank ( 198 ) may be maintained under carbon dioxide gas pressure for subsequent operations within the dense fluid centrifuge module ( 60 ). a closed - loop filtration system ( 200 ) is used to maintain the quality of the prewash agent . an optional vacuum distillation system ( 202 ) may be used to further purify the prewash agent . prewash agent makeup is provided through valve ( 204 ) and wasting or controlled drag - out of prewash agent is provided via valve ( 206 ). collected wastes in the form of spent or residual prewash agents and contaminants stored within the waste storage tank ( 98 ) are transferred to a suitable waste facility via valve ( 208 ). step 18 , is the carbon dioxide ( co 2 ) supply recharge procedure . to re - supply c0 2 vapor lost during venting and blowdown operations are performed periodically using an external source of liquid carbon dioxide ( not shown ) transferred via a transfer pipe ( 166 ), opened valve ( 168 ) and transfer pump ( 170 ) into the liquid zone of the clean storage tank ( 114 ). step 19 , is the fluids management procedure . during this step the high level optical sensors ( 178 and 172 ) and low level optical sensors ( 176 and 174 ) located in the lower and upper halves the clean storage and recovery tanks , respectively , as well as pressure sensors ( 132 and 180 ) and temperature sensors ( 184 and 182 ) are used with a plc or pc and software to monitor and control distillation , liquids concentration , vapor recovery and carbon dioxide recharge operations in the dense fluid management systems as well as insure adequate availability of saturated dense fluid and maintenance of vapor - liquid equilibrium conditions for dense fluid phase shifting , fluidization , flotation and pre - washing cycles herein . step 20 , is an optional step for injecting additives into the clean dense fluid or for recharging the clean dense fluid with additives . if additives are injected into the clean dense fluid storage tank using the optional additive injection system ( fig3 ), using opened valve ( 186 ), injection pump ( 188 ) and in - line mixer ( 190 ) or if the clean dense fluid is used and returned several times during phase shift cycles described above for lightly contaminated loads , the clean storage tank contents must be periodically cleaned and recharged ( with additives if required ). this is accomplished as follows : clean storage tank dense fluid is transferred on a batch basis through the liquid transfer bridge ( 116 ) into the recovery tank ( 124 ) through opened valve ( 192 ), whereupon operations 16 through 19 above are performed . this may be performed during non - production periods in two ( 2 ) or three ( 3 ) large volume transfers or during production operations in multiple small volume transfer operations . this process maintains the “ quality ” desired for the cleaning storage tank dense fluid in terms of cleanliness or additive concentration . step 21 is an optional step and dependant on the cleaning parameters and the nature of substrate being if the quality requirement for the clean storage tank dense fluid is very stringent ( contaminant levels & lt ;& lt ; 1 ppm (& gt ; 99 % purity )), for example as with wafer cleaning applications ( fig1 ), an add - in treatment unit for the vapor phase is provided . the present invention provides both single stage distillation ( sequence steps 16 - 17 above ) for general industrial quality cleaning solvent ( 99 % pure ), multiple - distillation treatment capability ( step 20 above ) and an enhanced vapor treatment process for producing “ ultrapure ” dense fluid as follows : vapor may be transferred from recovery tank through vapor transfer bridge ( 142 ), using a vapor transfer pump ( 146 ) and into an optional vapor treatment unit ( 194 ) which contains a device to preheat the vapor to a temperature of approximately 200 c ., contacted with a catalytic bed and transferred through a regenerative metal oxide dryer . following this , the ultrapure vapor is transferred through a heat exchanger ( 148 ) and compressed as a saturated ultraclean liquid in clean storage tank ( 114 ). in these applications , special attention is observed with respect to the quality of construction materials for the dense fluid centrifuge and integrated fluid management system specifically , non - reactive materials should be used to avoid interaction with the cleaning . materials such as stainless steel , peek , fluorocarbons , and nylon . sequence v is also the “ automation and control of dense fluid cleaning and fluids management system ”. the dense fluid cleaning and dense fluid management apparatus and processes are preferably automated and electronically controlled using software , process logic controller ( plc ) or a personal computer ( pc ), pressure sensors or switches , temperature sensors or switches , position sensors , vibration sensors ( out - of - round centrifuge conditions ) and optical level sensors , among other electronic devices . electronic control devices which efficiently perform the phase shifting , centrifugation , recycling and recovery processes of the present invention six vapor zone and liquid zone optical liquid level sensors ( 40 , 42 , 176 , 178 , 172 , 174 ) which provide an electrooptical “ go ” and a “ no - go ” indicator of saturated c0 2 vapor and liquid phase levels present within the upper and lower halves of the three high pressure vessel of the dense fluid centrifuge module ( 60 ), clean storage tank ( 114 ) and within the vapor recovery tank ( 124 ). pressure transducers / sensors ( 44 , 132 , 180 ) and temperature thermocouple / sensors ( 46 , 182 , 184 ) located in all three pressure vessels described above ensure reliable vapor - liquid equilibrium control between systems . an overview and application of the within process is shown cleaning a substrate which is a contaminated machined ball point pen tip ( 300 ) in fig5 . the contaminated substrate contains a deep narrow void wherein at the bottom is a small ( 1 mm diameter ) stainless steel ball ( 310 ) which is swaged into the tip . this substrate body is machined from solid brass or stainless steel rod stock using precision swiss screw machine technology employing tiny drills and swaging devices and cutting fluids . substrates produced with this machining technology are soaked in oil and laden with metallic fines and chips ( contaminants ) ( 320 ) within the voids and cavities and the surface is coated with thin films of waxes ( not shown ) and extreme pressure agents ( machining oil additives ). moreover , because of their small size ( about 3 mm diameter by about 25 mm length ), virtually millions of ball point tips will pack a centrifuge drum having a 12 × 12 inch diameter . cleaning with the within method and apparatus has removed nearly 250 milliliters of oils , wax and chips in such a mass of pen tips . this ball point tip ( 300 ) application presents several problems that require innovative device and process adaptations not found in conventional dense fluid cleaning technology . unlike conventional dense fluid cleaning technology , the present invention addresses the above problems by providing five unique features . the ability to separate excess contaminants from heavy and densely packed loads excess contaminants prior to cleaning . the ability to provide a prewash step to emulsify wax films and remove metal chips (& gt ; 100 microns ) trapped in voids . the ability to precision clean the heavy and dense mass of parts to remove trace oils and small metal particles (& lt ; 100 microns ) trapped in deep voids and narrow interstitial spaces ( i . e ., ball - body interface ). the ability to perform the previous operations without causing the substrates to rust or corrode . finally , the ability to have the parts clean and dry ( warm ) following processing . one additional feature is to also prepare metallic ball point tips , subject to oxidation , for extended shelf - life . this is accomplished by using a rust inhibitor in the optional prewash step which binds to the active metal sites of the metallic parts ( complex formation ) and is not subsequently appreciably removed in the extraction step . the centrifugal froth flotation process is also illustrated in fig5 with respect to the ball pen tip ( 300 ). first voids filled with contaminants , prewash agent or dense fluid are pressurized ( 400 ) with dense fluid until it gas saturation or super - saturation conditions are created within cavities , voids and interstitial spaces of the pen tip , contaminants , prewash agent ( s ) and dense fluid , during which the substrate is subjected to a continuous bi - directional centripetal force . next the pressure is reduced which causes millions of microscopic scrubbing and scouring carbon dioxide vapor bubbles ( 410 ) to form in the cavities , voids and interstitial spaces therein forming a foam or froth ( 420 )— gas - liquid interfaces . finally , the froth under the influence of centripetal force creates various cleaning actions — shear , cavitation and flotation causes the contaminants ( 320 ) to separate from internal cavities , voids and interstitial spaces whereupon centripetal shear further separates contaminants from substrate and transfers them to the separation zone of the dense fluid centrifuge ( fig1 c ). [ 0132 ] fig6 a is a chart showing the dense fluid and gives physicochemical data that includes critical point , triple point , solubility , density and viscosity data . the phase - shift process described herein uniquely contributes both “ chemical ” and “ physical ” cleaning and separation energies . the entire process is performed under the constant physical influence of a centripetal force . therefore changes in physical state of the dense fluid can used to rapidly separate trapped or entrained contaminants dissolved or dispersed in solution or captured in gas - liquid or gas - solid interfaces . exchanging the two phases present at the vapor - liquid equilibrium boundary under isothermal and isobaric change accomplishes this . the centrifugal phase shifting pressure - temperature range is from about 50 to about 70 atm and about 10 to about 80 c ., respectively . the apparatus and procedures to perform this exchange have been previously described in detail above . under equilibrium conditions , the vapor phase exhibits under the same temperature and pressure a much lower density than the liquid phase . fluidization is illustrated in fig6 b and defludization is illustrated in fig6 c , at about 60 atm and about 20 c ., the instant the saturated liquid phase is present in the substrate being acted upon by a centripetal force several cleaning actions can be observed including fluid shear , vortexing and solvency because the density as risen more than 8 - fold , whereupon the very instant that the saturated liquid phase is withdrawn from the dense fluid centrifuge , replaced by saturated vapor , the voids are evacuated of saturated liquid phase which expels entrained , dissolved or otherwise captured contaminants from cavities , voids and interstitial spaces producing a non - solvent state the density has decreased by more than 8 - fold . the exchange process , whether fluidizing or defluidizing , creates significant frothing , vortexing and shearing action at the receding or rising phase boundary within the dense fluid centrifuge cavity . the present invention produces a much more rapid phase shifting process that occurs at constant temperature and pressure performed along the liquid - vapor phase boundary . this process produces a 2 - phase “ solvent spectrum ” that is altered between “ solvent phase ” ( solubility parameter — 22 mpa 1 / 2 ) and “ non - solvent phase ” ( solubility parameter —& lt ; 10 pa 1 / 2 ), respectively . [ 0136 ] fig7 provides a diagram of a conventional cleaning line for a substrate such as the ball point pen tips ( 300 ). the conventional cleaning line requires up to five ( 5 ) separate machines , five ( 5 ) independent substrate load and unload steps and a process time of over 100 minutes . fig8 provides a diagram of a conventional cleaning process for a substrate such as the ball point ( 300 ). the conventional cleaning process for the substrate requires up to nine ( 9 ) independent cleaning and finishing operations which cannot be combined because of solvent and equipment operational and process incompatibilities that cannot be resolved with conventional cleaning technology . the within apparatus and process invention ( fig9 ) can reduce the cleaning requirement for the substrate to one ( 1 ) machine , one ( 1 ) load and unload step , ( 1 ) cleaning process and a reduced processing time . shown in fig1 is a flow chart of a cleaning process for a wafer coated with photoresist ( a hard polymer coating ). for this wafer substrate a prewash agent , a soy methyl ester with other additives including amines and operating at a temperature of about 100 c . is sued . the resulting prewash process is a liquid - supercritical fluid extraction and the fluidization pressure and temperature ( imparted by prewash agent ) is greater than the critical parameters for carbon dioxide . following emulsification of the polymeric coating , the wafers may be extracted with liquid carbon dioxide . the examples of uses of this invention and the substrates listed within are not intended to provide an exhaustive list . the process and apparatus herein , may be useful for dry cleaning textiles , removing oily wastes from shop rags , treating hazardous waste , removing oil from spent oil filters , cleaning tube bundles or elongated substrates , removing organic coatings — removing mold varnish and stripping . shown in fig1 a - 11 e are a variety of centrifuge drum ( 26 ) alternate embodiments . a barreling drum ( 600 ) is a conical - shaped drum having an opening that has a larger diameter than its base and which attaches to the centrifuge bearing via the load springs ( 28 ) ( fig1 a ). the barreling drum ( 600 ) may have perforated walls in which case dense fluid flow is directed in a straight line from center point to the circumference of the centrifuge cavity ( vertical operation only ). alternatively the drum may have solid walls whereby the dense fluid flow is in a semicircle , flowing downward through the center point and upward along the walls of the drum . this design in useful for processing substrates which may be “ poured ” from the dense fluid centrifuge following processing . this design is a fill and pour design without using drum separate drum inserts such as baskets and trays . a vortexing drum ( 610 ) is a polygonal - shaped drum having a constant diameter and which attaches to the centrifuge bearing via the load springs ( 28 ) ( fig1 a ). the vortexing drum ( 610 ) has perforated walls and has various geometric and concentric shapes . fluid flow is highly turbulent due to the vortexing created by the irregular shape rotating at high velocity and is directed in a straight line from center point to the circumference of the centrifuge cavity . this design can accept a similarly shaped basket or tray filled with substrates . a cylindrical centrifuge drum ( 620 ) is a drum having a constant diameter and which attaches to the centrifuge bearing via the load springs ( 28 ) ( fig1 a ). the cylindrical centrifuge drum ( 620 ) has perforated walls . fluid flow is turbulent due to substrate - dense fluid interactions only and is directed in a straight line from center point to the circumference of the centrifuge cavity . in this design , substrates fill the entire drum cavity or , more efficiently , can accept a similarly shaped and sized basket ( 622 ) or several trays ( 624 ) filled with substrates . alternatively and as shown in fig1 c , the centrifuge may be compartmentalized about the center point ( shown ) or in horizontal segmented layers such as using several stacked trays . substrates fill individual compartments in relatively equal weight distribution that maintains balance during horizontal centrifugal processes about the central axis . a tumble drum ( 630 ) is a cylindrical - shaped drum having a constant diameter and which attaches to the centrifuge bearing via the load springs ( 28 ) ( fig1 a ). the tumble drum ( 630 ) has perforated walls and has triangularly - shaped baffles ( 635 ) affixed to the interior drum walls in a concentric manner . this design will thoroughly mix and blend substrates during extraction processes and is useful for cleaning textiles and granulated substrates subject to nesting or agglomerating . this design is for manual load and unload operations and may use a sliding inverter drum . an inverter drum ( 640 ) is a cylindrical - shaped drum having a constant diameter and which attaches to the attaches to the centrifuge bearing via the load springs ( 28 ) ( fig1 a ). the inverter drum ( 640 ) design will insert substrates into the center of a secondary centrifuge , tumble , vortex drum which then allows the substrates to be processed under turbulent mixing conditions . the substrates do not experience a centripetal force . this design is for manual load and unload operations and may be a basket ( 642 ) or a sliding tray ( 644 ) design . tests were conducted to determine how the new centrifugal phase shifting process performed in comparison to ( 1 ) standard dense fluid extractions with flow - through and fluidization operations and ( 2 ) conventional ultrasonic perchloroethylene cleaning ( boiling ). these results are shown graphically in fig1 a and 12 b . the results show that the present process produces cleaning and separation phenomenon , and equivalent cleaning results , analogous to those found in multi - stepped solvent cleaning processes in less time . | 1 |
fig1 - 3 depict an intramedullary pin 1 in three views . the intramedullary pin 1 has a proximal end 14 and a distal end 15 . the shaft of the pin 1 is generally cylindrical in shape . the proximal end 14 may be curved in a lateral - posterior direction , while the distal end 15 may be straight or at least partly straight . proximal and distal end planes of the pin may be rotated about 60 °- 110 °, preferably 70 °- 90 ° and in particular 80 ° relative to one another . in one embodiment , the radius is between about 300 - 1300 mm , preferably about 900 - 1200 mm and in particular about 1100 mm . the length of the proximal radius corresponds to the lateral contact surface with the cortex which is about 300 - 1000 mm , preferably about 600 - 800 mm , and in particular 700 mm . the length of the distal straight section may correspond to the depth to which the distal pin end penetrates into the distal spongiosa structure . the length may be about 35 - 70 mm , preferably about 40 - 60 mm , and in particular about 52 mm . the pin 1 , at the proximal end 14 , may be designed with a 120 ° antegrade bore 2 compatible with a locking screw having a thickness between about 3 . 9 - 6 . 0 mm , a cranial 130 ° recon bore 3 compatible with a headless screw that is about 6 . 5 mm thick . the 130 ° recon bore 3 may coincide medially with the 120 ° antegrade bore 2 . the pin 1 may further be designed with a caudal recon bore 4 which is approximately 130 ° and compatible with a headless screw that is about 6 . 5 mm thick , and an oval bore 5 for static and dynamic positioning of a locking screw that is about 3 . 9 - 6 . 0 mm thick . furthermore , a lateral bevel 9 is recognizable at the proximal end 14 . the orientation of the three bores 3 , 4 , 5 allows for a combination of possibilities for locking the intramedullary pin , where antegrade locking has particular importance . a lateral opening 2 for the intramedullary pin approximately coincides with the insertion direction of the antegrade screw . if only one screw is set proximally , no further skin incision is therefore necessary . at the distal end 15 , two bores 6 and 7 extend transverse to the pin &# 39 ; s axis 18 and parallel to one another . an anterolateral bore 8 which is rotated through about 25 ° relative to the parallel bores 6 and 7 is shown at the distal end 15 . the angle formed between the anterolateral bore 8 and the parallel bores is preferably between about 45 ° and 10 °, where 0 ° corresponds to the frontal plane or the plane of two standard locking screws . a feature of the configuration of the three bores lies in the combination of the possibilities for locking . in addition to the generally known standard locking , the third bore 8 is present between the two standard bores . by locking the pin with three screws , axial stability is achieved . this ensures that the position of the distal pin end is fixed and the pin cannot be displaced on the screws . the 25 ° angle of the axial blocking screw may prevent the screw from injuring important soft tissues during insertion . this can occur , for example , if the screw is inserted in the sagittal direction ( 90 °). the locking screws may be present at a distance of about 30 mm away from one another . special formations at the tip 16 of the pin 1 allows the pin 1 to be tapped without rotation into the spongiosa in the distal femur region so as to be secured , preventing rotation even without locking by means of a screw . the tip 16 of the pin 1 may have , in a radial section , differing from the circular shape ( cylindrical ) of the body of the pin 1 , special tip surfaces , in particular concave notches or planar surfaces . in these embodiments , subsequent , arbitrary or involuntary rotation is not possible . fig4 a and 4 b depict an embodiment of the tip 16 at the distal end 15 of the pin 1 in two views . the tip 16 may have , in a radial section , differing from the circular shape , special tip surfaces 13 , in particular three planar surfaces , having a length of about 10 - 40 mm , preferably about 15 - 25 mm and in particular about 20 mm . the total length of the tip 16 may be about 20 - 50 mm , preferably about 25 - 35 mm and in particular 30 mm . bore 7 is shown near the tip 16 of the distal end 15 . fig5 a and 5 b depict another embodiment of the tip 16 at the distal end 15 of the pin 1 in two views . the tip 16 may have , in a radial section , differing from the circular shape , special tip surfaces 13 , in particular three concave notches , having a length of about 10 - 40 mm , preferably about 15 - 25 mm and in particular about 20 mm , and a radius 17 of about 4 - 10 mm , preferably about 5 - 8 mm and in particular about 6 mm . the total length of the tip 16 is about 20 - 50 mm , preferably about 25 - 35 mm and in particular about 30 mm . fig6 a and 6 b depict another embodiment of the tip 16 at the distal end 15 of the pin 1 in two views . the tip 16 may have , in a radial section , differing from the circular shape , special tip surfaces 13 , in particular four concave notches , which have a length of about 10 - 40 mm , preferably about 15 - 25 mm and in particular about 20 mm , and a radius 17 of about 4 - 10 mm , preferably about 5 - 8 mm and in particular about 6 mm . the total length of the tip 16 is about 20 - 50 mm , preferably about 25 - 35 mm and in particular about 30 mm . fig7 shows the proximal end 14 of the pin 1 viewed in a proximal to distal direction . a lateral bevel 9 , discussed previously , may form an angle at the lateral - proximal end relative to the axial pin axis 18 of between about 10 ° to 60 °, preferably about 40 °. a cylindrical recess 12 may have a thread 11 , and a positioning groove 10 on the medial side of the proximal end 14 , are shown . the bevel 9 which interrupts the transition and the contour matching between the target bow and pin 1 is preferably formed laterally at the proximal end 14 of the pin 1 . in the case of an anterior - posterior x - ray photograph , the end of the pin 1 can be easily and clearly detectable . this simplifies the surgery and leads to safer use and a shorter operation time . the pin &# 39 ; s entry point is on the lateral surface of the trochanter major . this lateral surface can be palpated particularly in slim patients . this means that the surface is covered only by a thin layer of skin . through the lateral entry point of the pin 1 , it is necessary to prevent the soft tissue from being irritated by the proximal end 14 of the pin 1 . an advantage of the bevel 9 is that the bevel 9 may ensure that the proximal end 14 fits the lateral cortex wall with a matching contour . this may prevent irritation of the soft tissue . while the distal pin section has , at least partly , no curvature at all , the proximal pin section may run in the lateral posterior direction when it is inserted into the medullary space through the lateral compacta of a trochanter major . the groove 10 which fixes the rotation of the pin 1 on the target bow is preferably present on the medial side of the proximal end 14 . the cylindrical recess 12 into which the diametrically opposite shaft of a connecting screw can penetrate between target bow and pin 1 is present at the proximal end 14 . consequently , the pin axis 18 is aligned coaxially with the target bow , and the thread 11 exerts only contact pressure . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , composition of matter , means , methods and steps described in the specification . as one of ordinary skill in the art will readily appreciate from the disclosure of the present invention , processes , machines , manufacture , compositions of matter , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention . accordingly , the appended claims are intended to include within their scope such processes , machines , manufacture , compositions of matter , means , methods , or steps . | 0 |
referring to fig1 a mercury - arc lamp 1 of a low pressure type is fixedly mounted on a base plate 3 constituting a part of a fluid - tight chamber by means of a lamp supporting member or socket 2 . light beams 5 and 6 assumed as emitted from a light extracting portion 4 located at a middle portion of the mercury - arc lamp 1 are collimated by a collimator lens 7 and subsequently pass through a flow cell composed of a cell body 9 and a cell window 8 . the light beams which have passed through the flow cell will then impinge on detector elements 12 and 13 after having passed through an optical filter 11 . the lens 7 is tightly in a light path cylinder 14 which is made of a material having a high thermal conductivity such as aluminium , copper or the like and which provides a light path . the cylinder 14 is closely fitted onto a glass bulb surface of the mercury - arc lamp 1 through a sealing member 15 provided at the abutting end of the cylinder . the cell window 8 is made of a quartz glass and welded to the opaque cell body 9 which in turn is formed with flow passages 16 and 17 through which a fluid or liquid to be measured is caused to flow . the flow cell is coupled to a cell holder 19 and the light path cylinder 14 through a packing 18 . the filter 11 destined to take out the monochromatic light is secured to a detector block 21 . a pair of detector elements 12 and 13 are secured to the detector block 21 by means of a fitting plate 22 and electrically connected to a lead wire cable 23 . a chamber 24 is formed in the detector block and maintained in a fluid - tight state by means of an o - ring 25 and a cover 26 secured by set screws 27 . the detector block 21 as well as the cell holder 19 are enclosed by a cover 29 which also serves to define a chamber 28 . a spiral metal pipe 32 having several turns is securedly held by a stationary plate 31 and functions to balance the temperature of liquid flowing into the flow cell with that of the cell body 9 . a partition plate 34 located in a chamber defined by the base plate 3 and a cover 33 shields the light extracting portion 4 of the source lamp from a heat generating portion 35 located in the vicinity of the lamp filament . in the structure described above , it will be understood that the portion of the mercury - arc lamp at which the highest temperature prevails is the heat generating portion 35 where the filament is located and the enclosing chamber 36 is subjected to the highest temperture . the partition plate 34 serves to reduce or suppress the heat transfer from the chamber 36 to the chamber 37 . the chamber 37 is located so as to enclose exteriorly the light extracting portion 4 and subjected to a high temperature next to that of the chamber 36 . the chamber 38 formed by the light path cylinder 14 and a lens 7 is tightly or closely fitted to the bulb glass surface of the mercury - arc lamp 1 by means of the sealing member 15 which may be formed of left or like material . the light path cylinder 14 is tightly fitted to the lamp surface to such degree that no gas flow may occur relative to the ambient exterior or atmosphere when the chamber 38 is at a normal pressure . in this connection , it is to be noted that the tight or close fitting of the chambers to the lamp surface which are inhibited from fluid communication with the exterior may be accomplished by directly closs - fitting the abutting ends of such chambers to the lamp surface or by closely fitting the end portions of such chamber to a supporting base portion formed integrally with the mercury - arc lamp . the chamber 39 located adjacent to the chamber 38 is maintained in a fluid - tight state at a normal pressure by means of the lens 7 , cell window 8 and the light path cylinder 14 . both chambers 41 and 42 are also fluid - tight closed so that fluid flow from or to the exterior is inhibited . in the above described embodiment , all the portions which constitute the light path extending from the light extracting portion of the source lamp to the detector elements are shielded from the ambient atmosphere . however , it will be appreciated that the portions which have negligible temperature difference relative to the ambient temperature such as the chambers 41 and 42 may be opened to the exterior because of their not incurring any appreciable increase of noise . in the case of the above described embodiment , each of the chambers 38 , 39 , 41 and 42 is placed in a tightly closed box so that these chambers are immune to the influence of the ambient temperature . in more particular , the chambers 38 and 39 are surrounded by the chamber 37 , while the chambers 41 and 42 are housed in the chamber 28 . this arrangement is effective to decrease the temperature difference relative to the ambient temperature , whereby the drift is especially reduced . since each of the chambers 38 , 39 , 41 and 42 is of a relatively small volume , a uniform temperature distribution will be likely to occur in the respective chambers . as a result , gas flow or movements will scarcely take place in these chambers . by virtue of the fact that the light path cylinder 14 is formed of a material having a high thermal conductivity , the chambers 38 and 39 are brought to a balnanced state in respect of the temperature in a short time , involving additionally an excellent heat radiation effect . fig2 a and 2b illustrate magnitude of noise produced in the apparatus according to the invention in comparison with the noise produced in a prior art apparatus . more specifically , fig2 a graphically illustrates the results of measurement performed by the prior art apparatus in which the light path cylinder 14 , the partition plate 34 and the cover 33 are not provided . it can be seen that the light absorbance change of the base line amounts to about 0 . 0005 absorbance units . on the contrary , the absorbance change of the base line is decreased to 0 . 000025 absorbance units in the case of the measurement carried out by the apparatus shown in fig1 as will be seen from fig2 b . in reality , the magnitude of noise shown in fig2 b is decreased to 1 / 20 of the noise shown in fig2 a . in either case , the measurement has been carried out by flowing methyl alcohol through a sample cell at a flow rate of 1 . 0 ml / min by means of a reciprocating piston pump . fig3 shows another embodiment of the invention in which a tungsten lamp 44 is employed as a light source . the tungsten lamp 44 is secured to a lamp base 46 by means of a lamp socket 45 . the light emitted from the lamp 44 passes through a heat shielding plate 48 which is provided in a light path cylinder 47 and constituted by an infrared ray absorbing filter of phosphate glass and a lens 7 and the light reaches a flow cell body 9 . the lamp chamber 49 is formed by a cover 51 and the base 46 and has a vent hole 52 through which either natural ventilation or enforced heat - radiating ventilation through a fan 52 is effected , as occasion requires . the partition wall 54 in combination with the light path cylinder 47 and the base plate 55 defines a chamber 58 which serves to decrease the temperature difference between the chambers 56 ; 57 and the ambient atmosphere . the flow cell is accommodated within a chamber 59 . in fig3 other components or parts similar to those of fig1 are indicated by the same reference numerals . in the case of the above described embodiment , each of the chambers 61 , 56 and 57 through which the light beams are transmitted is constructed in a tightly closed manner independently from one another . since the temperatures in the individual chambers are in a balanced state , the air flows in the chambers can be suppressed at a minimum . the light path cylinder 47 which also forms an exteriorly shielded chamber 61 in cooperation with the heat - shielding plate 48 is closely attached to the glass surface of the tungsten lamp 44 through a resilient seal 15 . in general , the tungsten lamp has the heat generating portion at the same location as the light extracting portion and generates a relatively large quantity of heat . accordingly , ambient air of the lamp will tend to more most easily under the influence of heat . in order to evade such phenomenon , the chamber 61 is maintained in a substantially tightly closed state with the aid of a seal made of a heat - resisting glass wool . the interior of the lamp 44 should preferably be evacuated thereby to prevent gas movement within the lamp 44 . in the above described embodiment , since the light path is constituted by a plurality of the tightly closed and partitioned chambers , the temperatures in the individual chambers are independently balanced thereby to prevent any fluid movement in the chambers . this structure is also effective to reduce the noise and drift remarkably . fig4 shows still another embodiment of the invention . lamp 63 is supported on a supporting mount 64 . a cover 65 is located so as to enclose the lamp 63 with the space between the cover 65 and the surface of the lamp 63 which is selected to be very narrow . the end portion of the cover 65 is tightly fitted to the supporting mount 64 through a sealing member 66 . a first closed chamber 67 tightly closed from the exterior is formed by a cover 65 and a shield plate 68 . it should be noted that the lamp 63 as well as the cover 65 are positioned in contact with a cooling block 69 which is adapted to be cooled by an appropriate coolant . a second closed chamber 71 is formed by a shield plate 68 , lens 72 and the cover 65 . further , a third closed chamber 73 is formed by the lens 72 , the cell body 74 and the cell window 75 . the embodiment shown in fig4 provides similar advantages as those of the preceding embodiments . gas flow into the first closed chamber 67 from the exterior is positively prevented . additionally , since the chamber 67 is so formed that the interior space thereof is made extremely small , movement of gas within the chamber 67 is essentially suppressed . fig5 shows a further embodiment of the invention . a light source lamp 77 is closely attached with an optical fiber 78 at the balb surface thereof by means of an end face fitting device 79 . the optical fiber 78 is divided at a branching point 81 and each of the divided branches of the optical fiber is secured to the cell window 8 of the cell body 9 by means of respective end face fitting devices 82 and 83 . since the light emitted from the light source is directly guided to the cell window 8 through a solid state optical conductor or the optical fiber without passing through chambers in which air is present , influence of air movements as caused by the heat generated from the light source is completely eliminated , whereby noise and drift are sharply decreased . it is also possible within the scope of the invention to connect optically the end face of the optical fiber to the light source through a chamber which is inhibited from fluid communication with the exterior . finally , referring to fig6 description will be made on a liquid chromatography in which a high sensitivity absorptiometer according to the invention is utilized as a detector for the chromatography . an eluting solution contained in an eluent reservoir 85 is caused to flow through a sample flow path and a reference flow path . the sample flow path is composed of a pump 86 , a sample injection device 87 , a separation column 88 and a sample flow cell 89 . on the other hand , the reference flow path includes a liquid feeding pump 91 , a reference column 92 and a reference flow cell 93 . the detector apparatus 94 includes a sample flow cell 89 through which effluent from the separation column 88 is caused to pass , a reference flow cell 93 through which elute from the reference column 92 is caused to pass , a light source 95 for illuminating both of the flow cells 89 and 93 and a photodetector 96 for sensing the light beams transmitted through the flow cells 89 and 93 . it will be appreciated that the flow cells 89 and 93 correspond , respectively , to the flow passages 16 and 17 composed of the cell body 9 and the cell window 8 as shown in fig1 . output signals from the photodetector 96 are processed by a suitable signal processor 97 . it has been ascertained that the liquid chromatographic system of the structure described above and incorporating an absorptiometer according to the invention allows analysis with an extremely high accuracy . | 6 |
fig3 illustrates a perspective view of a jaw set 110 for demolition equipment having a bottom jaw 115 pivotally connected to a top jaw 125 . a bottom blade 120 is secured to the bottom jaw 115 . the bottom blade 120 has a first radial axis r 1 therethrough , wherein the first radial axis r 1 is within a rotational plane rp of the jaws 115 , 125 . the bottom blade 120 has two raised support rails 140 , 145 . each raised support rail 140 , 145 , as explained with respect to support rail 140 , includes planar surface segments 160 ( see also fig4 ), wherein the planar surface segments 160 are generally perpendicular to the rotational plane rp and extend along the bottom blade 120 parallel to the first radial axis r 1 ( fig3 ). each support rail 140 , 145 , as illustrated in support rail 140 , has recesses 165 between the planar surface segments 160 . the recesses 165 extend across the width w 1 of the raised support rail 145 . the recesses 165 of one support rail 140 are aligned with the corresponding recesses 170 of the other raised support rail 145 . a cavity 175 extends between and adjacent to the raised support rails 140 , 145 . relative pivotal motion between the bottom jaw 115 and the top jaw 125 is achieved when both jaws 115 , 125 rotatably move or when one jaw is stationary and the other jaw rotates relative to the stationary jaw . as an example , bottom jaw 115 may be stationary and top jaw 125 may rotate . a top blade 130 is secured to the top jaw 125 . the top blade 130 has a second radial axis r 2 running therethrough and within the rotational plane rp . the top blade 130 additionally includes a raised knife rail 155 having planar surface segments 180 ( fig3 a ) generally perpendicular to the rotational plane rp ( fig3 ) and extending parallel to the second radial axis r 2 . the raised knife rail 155 further includes recesses 185 between the planar surface segments 180 , wherein the recesses 185 extend across the width w 2 of the knife rail 155 . directing attention to fig5 , the width w 2 of the knife rail at the planar surface segment 160 is less than the overall width w 3 of the cavity 175 . the top blade 130 and the bottom blade 120 are symmetric about the rotational plane rp ( fig5 ). as illustrated in fig3 and 5 , the bottom blade 120 and the top blade 130 are u - shaped to provide overlapping matching surfaces on the respective bottom jaw 115 and top jaw 125 , such that the bottom blade and the top blade are supported by the jaws 115 , 125 on three sides . for example , directing attention to fig5 , the bottom blade 120 is supported by the bottom jaw 115 along support surfaces 122 a , 122 b , and 122 c . additionally , the top blade 130 is supported by the top jaw 125 along three support surfaces 132 a , 132 b , and 132 c . directing attention to fig6 , the width w 2 of the knife rail 155 at the planar surface 180 is between 10 - 40 % of the width w 3 of the cavity 175 and preferably , the width w 2 at the planar surface 180 of the knife rail 155 is approximately 20 % of the width w 3 of the cavity 175 . in addition to effectively breaking railroad rails , the subject jaw set 110 may also be used to hold one side of a railroad rail after it has been severed . in particular , fig7 a - 7d show the progression of severing a railroad rail 112 into two parts 112 a , 112 b . in fig7 a , the rail 112 is placed between the bottom jaw 115 and the top jaw 125 . as illustrated in fig7 b , the bottom jaw 115 and the top jaw 125 are urged toward each other at which time the rail 112 begins to deflect . as previously mentioned , the material used for the rail is relatively brittle and , as a result , the rail 112 will deflect only a small degree before the rail breaks as illustrated in fig7 c . briefly returning to fig5 and 6 , the rail 112 is supported by raised rail support 140 and raised rail support 145 and is unsupported along the width w 3 of the cavity 175 . the top jaw 125 applies a load to the rail 112 approximately midway between the width w 3 of the cavity 175 to produce maximum stresses on the rail 112 . it should be appreciated that the width w 3 of the cavity 175 is made possible because the bottom blade 120 is wider than the bottom jaw 115 supporting it . this is achieved by the u - shaped connections between the bottom blade 120 and the bottom jaw 115 . returning to fig7 c , with a sufficient force supplied by the top jaw 125 against the rail 112 , the rail breaks into two parts 112 a , 112 b , as illustrated in fig7 d . however , in the instances where the rail 112 is relatively long , then it is possible to configure the top blade 130 and the cavity 175 , such that after the rail 112 is severed , the longer remaining half 112 a may essentially be clamped between the top blade 130 and the bottom blade 120 so that the remaining rail section 112 a may be positioned for an additional cut , or in the alternative , may be transported to a different location . in particular and directing attention to fig6 , the width w 2 of the knife rail 155 extending away from the planar surface 180 remains generally constant in the region 187 , however , thereafter , the width increases , as illustrated by the width in region 189 adjacent to region 187 . furthermore , the width in the region 189 may increase linearly and may increase to the width w 4 equal to the width w 3 of the cavity 175 . the knife rail 155 in the region 189 as it increases linearly forms an angle a with a line perpendicular to the rotational plane rp of between 30 - 60 degrees and preferably 45 degrees . additionally , the cavity 175 may have a depth d 1 of approximately 50 - 150 % of the width w 2 of the knife rail 155 at the planar surface segment 180 . the cavity 175 may have a shape that is generally oval , however , regardless of the shape , it is important that the surfaces of the cavity 175 are continuous and do not intersect with sharp corners that produce high stress concentrations . directing attention to fig4 , each recess 165 associated with the bottom blade 120 has a depth d 2 that is approximately 20 - 70 % of the width w 1 ( fig5 ) of the rail support 145 . additionally , the length l 2 of the recess 165 is approximately 20 - 70 % of the width w 1 of the support rail 140 . it is important to note that the length l 4 of the planar recess segments 160 may be greater than the length l 2 of the recesses 165 . the purpose of this is to maximize the wear capacity of the bottom blade 120 . in a similar fashion , with respect to the top blade 130 , each recess 185 has a depth d 3 and the depth d 3 is approximately 20 - 70 % of the width w 3 ( fig5 ) of the planar surface segment 160 of the knife rail 155 . furthermore , the length l 3 of each recess is approximately 20 - 70 % of the width w 3 at the planar surface segment 160 of the knife rail 155 . finally , the length l 5 of the planar surface segments 180 of the top blade 130 may be greater than the length l 3 of the recesses 185 of the top blade 130 . once again , the purpose of this is to increase the longevity of the wear surfaces . again directing attention to fig4 , although in each instance the recesses 165 , 185 of the bottom rail 120 and the top rail 135 are radiused , they may have different shapes , however , any intersection of surfaces should have radiused corners to minimize stress concentration factors . as illustrated in fig4 , both the bottom rail and the top rail have recesses 165 , 185 that are generally arcuate in shape . fig8 illustrates a jaw set 110 with a bottom jaw 115 and a top jaw 125 in a closed position , such that the cavity 175 of the bottom blade 120 receives the radial knife rail 155 . it should be noted , however , that the recesses 165 of the bottom blade 120 are , for the most part , shifted along the radial axis r 1 relative to the recesses 185 of the top blade 130 with respect to the radial axis r 2 . under certain circumstances , this off - set feature may enhance the ability of the bottom blade 120 and top blade 130 to hold and secure railroad rails . fig4 and fig8 also illustrate the relative position of the bottom blade 120 and the top blade 130 in the partially opened position ( fig4 ) and in the completely closed position ( fig8 ). although the rail to be broken is brittle , depending upon the size of the rail 112 , the range of travel of the blades 120 , 130 toward one another may be more or less . to break the rail 112 , it must be sufficiently deflected to produce the stresses which cause failure and breakage . in certain instances , the rail 112 may be small and oriented such that the blades 120 , 130 are nearly closed when the rail 112 is initially grabbed by the blades 120 , 130 . under these circumstances , the travel of the blades 120 , 130 is such that they overlap , as shown in fig8 . in particular , the travel of the blades 120 , 130 may be so great in the closed position that the raised knife rail 155 enters the cavity 175 of the bottom blade 120 . with this arrangement , the raised knife rail 155 may compress a rail 112 within the cavity 175 . directing attention to fig3 and 9 , the bottom blade 120 is removably secured to the bottom jaw 115 and the top blade 130 is removably attached to the top jaw 125 . the arrangement for attaching each of these blades to its respective jaw is similar and , for that reason , the attachment of the bottom blade 120 to the bottom jaw 115 will be discussed with attention directed to fig6 and 9 . the bottom blade 120 includes holding lugs 190 and a stabilizer 195 protruding from the bottom blade 120 . extending through the holding lugs 190 are bores 192 adapted to accept bolts 230 . the bottom jaw 115 has receivers 200 to accept the holding lugs 190 and a cradle 205 to accept the stabilizer 195 . the holding lugs 190 extend on both sides of stiffening bars 210 extending along the lower jaw 115 . the stiffening bars also have bores 212 aligned with bores 192 to accept bolts 230 . additionally , as illustrated in fig6 , below the holding lugs 190 are stabilizer wings 215 having surfaces 220 which abut the lower jaw surfaces 225 ( fig9 ) to provide additional stiffness and to resist twisting between the bottom blade 120 and the bottom jaw 115 when forces are applied to the bottom blade 120 . as illustrated in fig6 , bolts 230 pass through the holding lugs 190 and the stiffening bars 210 to secure the bottom blade 120 to the bottom jaw 115 . it is possible to include sleeves around the bolts 230 for additional strength . it should be appreciated that this arrangement just discussed , with respect to the bottom blade 120 and its attachment to the bottom jaw 115 , is also applicable to the attachment of the top blade 130 to the top jaw 125 . as illustrated in fig7 c and 7d , when the railroad rail 112 is sufficiently stressed , due to the brittle nature of the rail 112 , it will bend only slightly before breaking . the energy released when the rail 112 breaks , typically manifests itself in energy transmitted to the severed parts . as shown in fig7 d , while segment 112 a is retained by the jaws 115 , 125 , segment 112 b becomes an airborne projectile moving in a direction away from the bottom jaw 115 . for that reason , during this cutting operation , for safety , the bottom jaw 115 of the jaw set 110 must be closest to the operator , while the top jaw 125 must be furthest from the operator . to insure this , the exterior surface 235 of the top jaw 125 is marked with indicia 240 to assist the operator in the proper orientation of the jaw set 110 during operation . in one embodiment , the indicia 240 may be a highly visible paint covering a substantial portion of the top jaw 125 , such that the highly visible paint and , therefore , the top jaw 125 should not be visible to the operator during a cutting operation . preferably , the highly visible paint is red paint . as a result , so long as during the cutting operation the operator does not see the indicia on the top jaw 125 , then there is assurance that the path of segment 112 b , as it becomes a projectile , will be directed away from the operator . a method of processing a railroad rail 112 using a rail breaker demolition tool having a jaw set 110 with a bottom jaw 115 having a bottom blade 120 , and a top jaw 125 having a top blade 130 , involves the steps as illustrated in fig7 a - 7d of holding the rail 112 between the bottom jaw 115 and the top jaw 125 , such that the bottom blade 120 of the bottom jaw 115 provides spaced - apart support using the raised support rail 140 and raised support rail 145 . as illustrated in fig7 b , the top jaw 125 and the bottom jaw 115 are advanced together , such that the top jaw 125 applies a load on the rail 112 midway between the spaced - apart support of the bottom blade 120 until the rail 112 breaks ( fig7 c ) and a severed portion 112 b ( fig7 d ) is ejected from the jaws 115 , 125 . the jaws 115 , 125 are further advanced together until the wider portion 189 of the top blade 130 compresses the remaining portion of the rail 112 a against the walls of the cavity 175 to retain the remaining portion 112 a within the clamped jaw set 110 . additionally , when the exterior surface 235 of the top jaw 125 is marked with indicia 240 , the method of processing may further include the step of orienting the jaw set 110 such that the indicia 240 of the top jaw 125 is furthermost away from the machine operator , such that any severed part 112 b may be expelled in a direction away from the operator . what has so far been described is the application of the jaw set 110 to break railroad rails . while this is the primary application for this jaw set 110 , it should be appreciated that the jaw set 110 may have other applications including , for example , compressing hollow pipe either before or after it is cut with a shear to minimize the volume the pipe occupies , thereby increasing the efficiency of stockpiling and transporting such parts . furthermore , it should be appreciated that while the bottom blade 120 has been described as removably attached to the bottom jaw 115 and the top blade 130 has been described as removably attached to the top jaw 125 , each blade and its respective jaw may be formed as a unified integral part , such that the jaw and blade would be integral with one another . while specific embodiments of the invention have been described in detail , it will be appreciated by those skilled in the art that various modifications and alternatives to those details could be developed in light of the overall teachings of the disclosure . the presently preferred embodiments described herein are meant to be illustrative only and not limiting as to the scope of the invention which is to be given the full breadth of the appended claims and any and all equivalents thereof . | 4 |
referring now to fig1 the fume hood there shown is generally identified by the numeral 10 . as is the practice , the fume hood is provided with an air intake plenum chamber 12 that fits across the front of the fume hood . this chamber 12 is illustrated in fig1 in exploded relationship to the fume hood cabinet 14 that comprises a top 14a , sides 14b , supported on a bottom or base 16 . in the assembled configuration , the air intake plenum 12 is connected to the cabinet 14 as shown in fig2 to become an integral part thereof . mounted on the front of the fume hood 10 is a plurality of sliding sashes 18 . in the present configuration , four such sashes are shown and they are numbered 18a , 18b , 18c and 18d respectively . as the description of the invention proceeds , it will be apparent that any number of tracks with rows of such sashes may be utilized . in the present configuration , the sashes 18 are shown hung in two rows in a sliding bypass relationship . each sash is supported by two respective hangers 20 and , therefore , the hangers shown are numbered 20a , 20b , 20c and 20d with only 20a and 20b shown in fig2 connected with their respective sashes 18a and 18b . the hangers 20 are slidably carried by overhead channels 22 and 24 that are supported by a lintel 26 . a dust collar 28 is positioned above the plenum chamber 12 to provide a coupling to any conventional duct work ( not shown ) whereby the plenum chamber 12 is adapted to receive a supply of supplemental air from any external source such as atmospheric air . the plenum chamber immediately receives the air supply and directs the flow of air along the face of the cabinet 14 of the fume hood where the air enters the interior of the fume hood substantially under equal pressure throughout . each sash 18 is provided with an air guide diverter or panel 30 . thus , each sash 18 will have a respectively numbered diverter panel 30a , 30b , 30c and 30d . the diverter panel for each respective sash moves with the sash across the face of the fume hood cabinet 14 to open or close the same . from what has been described , the sash and its respective diverter move in a normally horizontal direction . by reason of the arrangement of the sashes 18 , they may be closed alongside each other so as to fully close the face of the cabinet 14 and fume hood 10 to prevent access to the interior of the cabinet by anyone standing in front of the same . in like manner , anyone or more of the sashes 18 may be moved horizontally with respect to any other sash to open a vertically disposed entrance to the fume hood interior . when the sashes are in their closed relationship across the front of the fume hood cabinet 14 , they essentially close off the flow of air from the room into the fume hood interior . the diverters or panels overly each other in the same manner as the sashes 18 overlying each other and , thus , only supplemental air will enter the fume hood by way of the collar 28 and the plenum chamber 12 in the direction depicted by the arrows a - 1 . this supplemental air flows into the cabinet through a louvered air by - pass 32 that is mounted directly behind the plenum chamber in an air intake opening . the air by - pass louvers 33 guide the flow of air into the hood so as to divert it downward along the inside face of the cabinet 14 behind the panels 30 and the sashes 18 and then along the bottom of the cabinet and finally upward along the back of the cabinet 14 . some air flows upward in the direction of arrows a - 4 to flow outward from the cabinet by way of an exhaust collar 36 extending through ceiling portion 37 . as is the practice in fume hoods , there is provided a baffle 34 the details of which are only diagrammatically illustrated . the air flowing in the direction a - 2 flows downward beneath the lower edge of the baffle 34 and then upward behind it to be exhausted from the cabinet through the air exhaust 36 which may be connected with an exhaust fan and a conventional exhaust duct work , not shown . in this way , there is a complete changeover and flow of air through the fume hood creating an air barrier behind the sashes 18 to prevent noxious fumes that are within the cabinet 14 from flowing outward into the room in which the fume hood is located . an additional precaution against the entry of such noxious fumes into the surrounding room is to provide a flow of air beneath the sashes into the cabinet 14 . this is accomplished by providing an air foil 38 at the bottom of the fume hood beneath the sashes 18 . in the same manner as the air guide louvers 32 are supported from a supporting means such as lintel 40 , the air foil 38 is supported above a working countertop 42 of the cabinet 14 on a suitably shaped brackets 44 that permit the flow of air into the lower portion of the cabinet beneath the air foil 38 as illustrated by the arrows a - 5 . in practice , the room and its contents including the technicians working therein are always protected from the seepage of noxious fumes that may be within the fume hood 10 by reason of the air barrier and air flow that is created within the fume hood as previously described . however , when a technician desires to use the fume hood 10 , it is merely necessary for him to slide one of the sashes 18 open in the area wherein he wishes to work within the fume hood . this is illustrated in fig1 wherein the sash 18b has been moved ajar behind the sash 18a thereby providing the worker an opportunity to manipulate within the fume hood . at such time , by reason of the connection of the air exhaust with the interior of the fume hood at 36 , conditioned air within the surrounding room will be drawn into the fume hood cabinet 14 at a minimum constant rate so as not to affect the balance of the building air handling system irrespective of the opening created by the sash 18b . the amount of air taken from the room remains constant and is totally irrelevant to the position of the sashes 18a , 18b , 18c and 18d . as the air is drawn into the cabinet 14 from about the worker , air is also forced downward from the plenum chamber 12 through the opening created by the diverter 30b exposing that portion of the plenum chamber 12 to the front of the fume hood cabinet . hence , a further air barrier illustrated by the air flow lines a - 3 is created in the front of the fume hood to bathe the front of the technician and thereby prevent the outward flow of noxious fumes into the room so that the technician is left unaffected by the fumes of the fume hood interior . shield 39 acts as an air guide . it will be recognized that by reason of the overlapping relationship of the diverter panels 30 , the plenum chamber 12 is isolated from the front of the fume hood when all of the sashes 18 close the fume hood entrance . however , when any one or more of the sashes 18 are moved to open the fume hood entrance , only that diverter panel which moves with its sash will permit the flow of air downward from the plenum chamber 12 across the front of the fume hood . as a consequence , the front of the fume hood is bathed with outside air which then flows into the fume hood so as to protect the room and its contents from that of the fume hood . thus there has been providing a fume hood utilizing horizontal sashes which enables the operator to open only so much of the fume hood as is needed for a particular operation . air guide panels prevent outside air from entering the room and then flowing into the fume hood . the panels direct the outside air directly into the fume hood in the area where the sashes are in the closed position , thus preventing outside air from mixing with and contaminating the room air . however , where the sash is open , its associated panel permits outside air to flow into the zone outside the hood face and then into the opening of the fume hood to assure that no gases back up into the room from the fume hood . this arrangement assures that outside air will not enter the room when the sash is closed , thus preventing disturbances to the air handling system of the room . the air guide panels , louvered air by - pass and sashes are compatibly designed to limit the flow of air through the fume hood and , in particular , near the working counter to reasonable velocity values to prevent interference with delicate chemical operations . while there have been shown and described and pointed out the fundamental novel features of the invention as applied to a preferred embodiment thereof , it will be understood that various omissions and substitutions and changes in the form and details of the device illustrated and in its operation may be made by those skilled in the art without departing from the spirit of the invention . it is the intention , therefore , to be limited only as indicated by the scope of the claims appended hereto . | 1 |
referring to fig1 there is illustrated an intelligent hard disk drive subsystem referred to by the general reference character 10 incorporating the present invention . the subsystem 10 includes an input connection for connection to a host system referred to as an input bus 12 which is connected to an interface 14 . interface 14 is connected to an internal bus 16 which is a composite data bus , address bus and control bus . internal bus 16 is connected to an eight - bit microprocessor 18 , to a sector buffer 20 , to a sector buffer controller 22 , to a serdes ecc 24 , to a state machine 26 , to a stepper controller 28 , and to a spindle motor controller 30 . the spindle motor controller 30 is connected to a spindle motor 32 which is connected to a spindle 34 which is connected to a pair of double - sided hard disk magnetic media 36 capable of storing digital data by means of residual magnetism . the stepper controller 28 is connected to a stepper positioner 38 which is physically connected to a set of four magnetic read / write heads 40 in a manner which allows the positioner 38 to repeatably position the heads 40 at multiple predetermined positions very near to the surface of media 36 with the multiple predetermined positions differing in their distance from the center of the media . a preamplifier / driver 42 is connected to each of heads 40 , and is also connected to a read channel 44 and a write channel 46 . a data separator 48 is connected to read channel 44 and to serdes ecc 24 . an nrz - to - mfm converter 50 is connected to the serdes ecc 24 , and to a write precompensator 52 . fig2 illustrates the functional organization of the hard disk magnetic media 36 . each recording surface of the media 36 is broken up into three regions : an outside guard band 70 which comprises a small region on the surface of media 36 near its outside diameter ; a data band 72 which comprises the surface of the media 36 extending between the outside guard band 70 and an inside diameter 74 ; and an inside guard band 76 in the region inside diameter 74 . the location of diameter 74 is a function of the effective useable area of media 36 for effective data storage . fig3 illustrates a section of media 36 , and diagramatically represents the sector formatting which is used to store data . a plurality of sectors 80 are symbolically represented as curvalinear rectangles . each of the sectors 80 include a very small area referred to as an identification field 82 ( only a few are labeled in the drawing ) and reside at the leading edge of the sectors 80 . all of the sectors 80 located at the same diameter are referred to as being located on a track ; e . g ., a track 84 . ( only one such track is labeled on the drawing , and only part of that track is illustrated in the drawing .) the identification fields 82 contain data identifying the track , the sector , and specifying whether the particular sector is in outside guard band 70 , data band 72 , or inside guard band 76 . in operation , intelligent hard disk drive subsystem 10 receives and sends data and control signals to and from a host system through the input bus 12 . the bus 12 uses a standardized protocol which is a modified version of the sasi interface and is referred to in the industry as the xebec sasi interface . the interfacing between bus 12 and bus 16 , matching the protocols of the two busses to each other , is provided by interface 14 . the processor 18 , which is a z80 with associated rom in the preferred embodiment , interprets commands from the host system and manages , accordingly , the operation of the intelligent hard disk drive subsystem 10 . the sector buffer 20 , under the control of the sector buffer controller 22 , matches data transfer rates by buffering data transfers between the disk drive subsystem 10 and the host system . the serdes ecc 24 converts parallel data from bus 16 to serial data so that it can be stored sequentially on media 36 . the serdes ecc 24 also converts serial data received from media 36 via the read channel 44 and data separator 48 to parallel data which it places on bus 16 . in addition , serdes ecc 24 calculates error codes and appends them to data being written , and also checks error codes on read data , performing corrections when necessary . state machine 26 controls and synchronizes the operation of interface 14 , serdes ecc 24 , and sector buffer 20 . data separator 48 converts mfm data received from the head 40 via preamp / driver 42 and read channel 44 to nrz data . the read channel 44 conditions the signal from preamp / driver 42 for input into data separator 48 . nrz - to - mfm converter 50 receives nrz data from the serdes ecc 24 and converts it to mfm data . converter 50 also provides a pair of signals providing information about subsequent bits when forwarding a data bit to write precompensator 52 . depending on the sequence of bits , it may be necessary to slightly advance or delay the timing of a data bit in order to store the data in the proper location on media 36 . this occurs because the presence of other bits on media 36 constitute residual magnetic fields which interact with the magnetic field generated by head 40 when writing . the small adjustments in timing required to properly locate the data on media 36 are performed by the write precompensator 52 in response to signals provided to it by converter 50 . the need for , and the required amount of , precompensation is also influenced by the structure of the media 36 . if plated media rather than oxide media is used , write precompensation can be eliminated . the write channel 46 receives a signal from precompensator 52 , conditions it for input into the driver portion of preamp / driver 42 , and provides it thereto . the driver portion of preamp 42 then provides a signal to one of the heads 40 which records the data on media 36 as a residual magnetic field . the specific head of the heads 40 used at any time is selected by the preamp / driver 42 , which amplifies read signals when data is being read from media 36 , and amplifies write signals when data is being recorded on media 36 . the stepper / positioner 38 , which is controlled by the stepper controller 28 positions the heads 40 at the desired diameter position of media 36 of the particular track to which , or from which , data is to be transferred . positioner 38 increments heads 40 in discrete steps corresponding to track locations . formatting of media 36 must be done to identify the data on media 36 so that it is possible to retrieve the data that is desired rather than some randomly selected data . fig4 sets forth a process for formatting media 36 in a manner which eliminates the need for a track 0 sensing switch . the head 40 may be positioned anywhere on media 36 when the disk drive is first turned on . since it is unknown where the heads 40 are upon energization of an unformatted disk drive , the location of the heads must be considered to be random . the process set out in fig4 begins formatting wherever the head 40 happens to be located , and follows a sequence of formatting the track , including the steps of : writing an identifying datum in the identification field 82 of each sector on the track ; attempting to index the heads 40 one track to the outside , which can be done if head movement is not prevented by a mechanical stop ( not shown ) which is provided to prevent movement of head 40 off of the media ; reading the identification fields 82 to determine if the head did not move to a new track ; and continuing the sequence of format , index the heads one track to the outside , and read , until the heads have failed to move , at which point the heads are as far to the outside as possible . formatting is then started all over , moving from this now known position , from outside to inside formatting each track , and providing track , sector and band classification identification in each sector &# 39 ; s identification field 82 . a few outside tracks are designated as the outside guard band , the data tracks are designated sequentially beginning with data track 0 on the outermost data track , and a few inside tracks are designated as an inside guard band . in an alternate embodiment , the above formatting procedure can be reversed , locating the stop on the inside first and then formatting from the inside to the outside . if that procedure is utilized , then the data track numbering begins with a number one less than the desired number of tracks , and sequentially decrements with the last data track formatted being number zero . although the present invention has been described in terms of the presently preferred embodiments , it is to be understood that such disclosure is not to be interpreted as limiting . various alterations and modifications will no doubt become apparent to those skilled in the art after having read the above disclosure . accordingly , it is intended that the appended claims be interpreted as covering all alterations and modifications as fall within the true spirit and scope of the invention . | 6 |
fig1 illustrates an embolic coil retrieval system 10 which includes a sheath 12 , an actuator wire 14 , and an embolic coil retriever 16 . the sheath 12 is approximately 60 inches in length and is preferably formed of a polymer material with a durometer in the range of about 50 d and 80 d . the outside diameter of the sheath 12 is about 0 . 038 inches while the lumen 18 of the sheath 12 has a diameter of approximately 0 . 021 inches . the actuator wire 14 is approximately 70 inches in length and is preferably made from a metallic material . the diameter of the actuator wire 14 is less than the diameter of the lumen 18 of the sheath 12 so that the actuator wire 14 may slide within the lumen 18 of the sheath 12 . the embolic coil retriever 16 is laser cut from a nickel - titanium alloy tube and is attached to the distal end 20 of the actuator wire 14 . fig2 illustrates the embolic coil retriever 16 in a normally open configuration . the embolic coil retriever 16 includes a cylindrical member 22 with a lumen 24 ( not shown ), a proximal section 26 , and distal section 28 . the cylindrical member 22 is approximately 0 . 040 inches in length and is preferably formed from a nickel - titanium alloy . the outside diameter of the cylindrical member 22 is about 0 . 018 inches while the diameter of the lumen 24 is approximately 0 . 012 inches . there are attachment holes 30 in the wall 32 of the cylindrical member 22 which allow the distal end 20 of the actuator wire 14 to be attached within the lumen 24 of the cylindrical member 22 . attached to the distal section 28 of the cylindrical member 22 is an elongated tubular member 34 which is approximately 0 . 12 inches in length and is also preferably made from a nickel - titanium alloy . the outside diameter of the elongated tubular member 34 and the diameter of the lumen 36 ( not shown ) of the tubular member 34 are generally the same as the cylindrical member 22 . a jaw member 38 is formed from the elongated tubular member 24 . preferably , the jaw member 38 is laser cut from the elongated tubular member 34 . the jaw member 38 includes a first jaw 40 , a second jaw 42 , and a third jaw 44 where each jaw 40 , 42 , and 44 takes the form of a longitudinal portion of the elongated tubular member 34 . each jaw 40 , 42 , and 44 has a distal end 48 , a proximal end 50 , a first longitudinal edge 52 , and a second longitudinal edge 54 . the distal ends 48 of the jaws 40 , 42 , and 44 are biased outwardly such that the distal ends 48 are approximately 0 . 008 inches from the longitudinal axis of the elongated tubular member 34 . the first jaw 40 , second jaw 42 , and third jaw 44 include longitudinal legs 56 having a proximal end 58 and a distal end 60 . the proximal ends 58 of the longitudinal legs 56 are attached to the distal ends 48 of the jaws 40 , 42 , and 44 . the longitudinal legs 56 are approximately 0 . 002 inches in length and may include a radiopaque marker 62 for use during fluoroscopic visualization . preferably , the longitudinal legs 56 are laser cut from the elongated tubular member 34 . attached to the first longitudinal edges 52 and second longitudinal edges 54 of the jaws 40 , 42 , and 44 are teeth 66 . these teeth 66 are described in more detail in the description of fig4 . fig3 illustrates the embolic coil retriever 16 in a closed configuration . the overall length of the embolic coil retriever 16 in the closed position is approximately 0 . 16 inches . the cylindrical member 22 includes attachment holes 30 ( one shown ) for the actuator wire 14 . the elongated tubular member 34 which takes the form of a jaw member 38 is attached to the distal section 28 of the cylindrical member 22 . the jaw member 38 includes a first jaw 40 , a second jaw 42 , and a third jaw 44 . as can be appreciated , each jaw 40 , 42 , and 44 takes the form of a longitudinal portion of the elongated tubular member 34 . at the distal ends 48 of the jaws 40 , 42 , and 44 , longitudinal legs 56 are attached which may include radiopaque markers 62 . each jaw 40 , 42 , and 44 of the jaw member 38 includes teeth 66 attached to the first longitudinal edge 52 and second longitudinal edge 54 . this configuration of the teeth 66 is described below . fig4 illustrates the teeth 66 of the embolic coil retriever 16 . the teeth 66 generally take the form of triangular members each having a base 68 attached to a longitudinal edge 52 and 54 of a jaw 40 , 42 , and 44 . preferably , the teeth 66 are laser cut from the elongated tubular member 34 . the teeth 66 may take the form of major teeth 70 which are generally obtuse triangular members having an obtuse angle 74 and a base 76 . the base 76 of each major tooth 70 has a proximal end 78 and a distal end 80 . the obtuse angle 74 of each major tooth 70 is located at the proximal end 78 of the base 76 . the teeth 66 may also take the form of minor teeth 82 which are generally acute triangular members having a base 86 . the base 86 of each minor tooth 82 is attached to a longitudinal edge 52 and 54 of a jaw 40 , 42 , and 44 . the configuration of the teeth 66 shown in fig4 includes a combination of major teeth 70 and minor teeth 82 . there is a pattern of alternating major teeth 70 and minor teeth 82 along the longitudinal edges 52 and 54 of each jaw 40 , 42 , and 44 . in addition , each major tooth 70 is generally aligned with a minor tooth 82 on an adjacent longitudinal edge 52 and 54 of an adjacent jaw 40 , 42 , and 44 , and each minor tooth 82 is generally aligned with a major tooth 70 on an adjacent longitudinal edge 52 and 54 of an adjacent jaw 40 , 42 , and 44 . this pattern forms a plurality of pockets 88 which are gaps between the major teeth 70 and the minor teeth 82 on the longitudinal edges 52 and 54 of the jaws 40 , 42 , and 44 . each pocket 88 is approximately 0 . 015 inches wide and 0 . 015 inches tall . however , the size of the pocket 88 may be varied so as to generally match the size of the pockets 88 with the size of the embolic coil 90 being retrieved . fig5 through 8 illustrate a preferred method of using the embolic coil retrieval system 10 to capture an embolic coil 90 . in fig5 , the embolic coil retrieval system 10 is inserted into the vasculature 92 of the human body . the embolic coil retriever 16 is attached to the actuator wire 14 and is disposed within the lumen 18 of the sheath 12 . the embolic coil retrieval system 10 is moved distally towards the embolic coil 90 to be retrieved . fig6 shows the actuator wire 14 being moved distally causing the embolic coil retriever 16 to exit the lumen 18 of the sheath 12 thereby causing the jaws 40 , 42 , and 44 of the jaw member 38 of the embolic coil retriever 16 to assume a normally open position . the jaw member 38 in the open position is aligned with the embolic coil 90 to be retrieved . in fig7 , the sheath 12 is moved distally causing the jaws 40 , 42 , and 44 of the embolic coil retriever 16 to assume a closed position around the embolic coil 90 . the embolic coil 90 is captured within the pockets 88 formed by the gaps between the alternating major teeth 70 and minor teeth 82 on the jaws 40 , 42 , and 44 . fig8 illustrates the embolic coil retrieval system 10 and the embolic coil 90 being removed from the vasculature of the body . as the embolic coil retrieval system 10 is moved proximally , the embolic coil 90 is held within the pockets 88 and is wedged behind major teeth 70 thereby preventing the embolic coil 90 from falling out of the jaw member 38 . a novel system has been disclosed in which an embolic coil retrieval system is introduced into the vasculature of the human body for retrieval of an embolic coil . although a preferred embodiment of the invention has been described , it is to be understood that various modifications may be made by those skilled in the art without departing from the scope of the present invention . for example , there may be variations to the jaw member of the embolic coil retriever . the jaw member may include four or more jaws formed from an elongated tubular member . each jaw may be a longitudinal portion of the elongated tubular member . in another alternative construction , the embolic coil retriever may be covered with a high density metallic coating , like gold . this coating may provide enhanced reflection during fluoroscopic visualization . in still another alternative construction , the pockets formed by the major teeth and minor teeth along the longitudinal edges of the jaws may vary in size . for example , at the distal end of the jaw member the pockets may be small for capturing small embolic coils , but pockets may gradually become larger towards the proximal end of the jaw member for capturing larger embolic coils . this construction would allow physicians to use one jaw member configuration for capturing various sized embolic coils . finally , the embolic coil retriever may be used for capturing other medical devices such as dilation balloons or stents . these and other modifications would be apparent to those having ordinary skill in the art to which this invention relates and are intended to be within the scope of the claims which follow . | 0 |
referring now to the figures , and in particular to fig1 a data processing system 10 , in which the present invention can be employed is depicted . as shown , data processing system 10 comprises a number of components , which are interconnected together . more particularly , a microprocessor 12 is coupled to a memory storage unit 14 and an input / output ( i / o ) bridge 16 . a system bus 18 provides interconnection between microprocessor 12 and memory 14 and i / o bridge 16 . i / o bridge 16 further couples to an i / o bus 20 , which provides connection to i / o adapters 22 and a real time clock 24 . further connected to microprocessor 12 is a time base generation apparatus 26 , which is further connected to the i / o bus 20 . time based generation apparatus 26 is further illustrated in fig2 . data processing system 10 may comprise multiple microprocessors . fig2 illustrates a block diagram of an implementation of the system time base generation apparatus 200 according to the present invention . time base generation apparatus 200 further includes a system clock generate circuit 202 , which serves as a master clock for the entire computer system in which apparatus 200 is located . system clock generate circuit 202 is further connected to a clock buffer driver 204 , a time base buffer / divider 206 , clock prescalar circuit 208 , and a total count latch register 210 . clock buffer divider 204 is further connected to bus interface 212 , as is time base buffer / divider circuit 206 and total count latch register 210 . clock buffer / divider 204 provides signal amplification and driving from system clock generate circuit 202 to the bus interface 212 , which is further connected to the system co - processor , micro - processor , and other resource chips connected to the bus interface . a store instruction to the address decoded by the system bus interface as the total count latch register 210 is used to set the content of total count latch register 210 . the content of total count latch register 210 is used by the clock prescalar 208 to control whether the time base enable signal is asserted during a system bus cycle . the clock prescalar 208 , using a clock generated by the system clock generate 202 , increments an internal counter . when the internal counter of clock prescalar 208 reaches a count equal to the content of the total count latch register 210 , the internal counter is reset to zero and the time base enable signal is deasserted during the next system bus cycle . the operation of the clock prescalar 208 is further described . clock prescalar 208 is a 15 - bit programmable clock prescalar circuit that deletes one clock pulse enable each time a threshold count is achieved . the threshold count is determined and limited by the precision of the clock prescalar . specifically , 15 - bit programmable circuit provides a base count of 32 , 768 , of which 95 % is used to determine the base total count or 31 , 129 . this allows a maximum range adjustment of plus or minus 5 %. the adjustment granularity of one count out of the total base total count is 116 milliseconds per hour . the maximum skew rate , or time adjustment rate , is plus or minus 190 seconds per hour . the system writes zero to the total count latch register 210 to exhibit the generation of the time base enable signal , keeping it deasserted . when the time base enable signal is deasserted , the time clocks on all processors do not change or do not increment . this system would be used in a multi - processor system to synchronize all processor time clocks when the system is initialized . the prescalar can be made longer to increase precision or shorter to reduce costs . an optional divider , which may be programmable , provides a time base that is in the range of 3 - 12 % of the system clock frequency . processors in the system count system clocks upon the assertion of the time base enable , thereby allowing the time base to be independent of the system clock frequency . the time base generation apparatus allows the time clock in the processor to be adjusted without directly altering its content . this avoids the problem of multiple updates to adjust for a large error . clock prescalar 208 is adjusted to compensate for the error over some period of time such as until the next clock synchronization computation is performed over the network . if the clock is running fast , the system reduces the time base enable rate rather than attempt to set the time back in a series of small changes normally required to avoid the appearance of time running backwards . in a multi - processor system , one processor performs the clock synchronization chores with the network and then makes a single adjustment to adjust the clocks of all the processors . the only time a complete processor synchronization is performed is at power on reset . at power on reset , the time base enable signal is inhibited by writing zeros into the total count register , and all processors initialize their time clocks . next , the lead processor sets the prescalar to a default or calibrated value , thereby starting all the clocks . fig3 depicts a flow diagram of one processor performing clock synchronization in a multiprocessor system according to the present invention . first , in block 310 , a system wide reset is performed . in block 312 , after appropriate initialization by each processor , a lead processor is chosen using whatever means ( software protocol or hardware selection ) the system chooses to use . in step 314 , each processor determines whether it is the lead processor or one of the other processors . the lead processor performs blocks 316 - 322 and the other processor perform blocks 326 - 332 . all processors join in step 324 to continue other system initialization tasks . the barriers and singles described below are normally implemented using semaphors ( a software protocol for sharing information and synchronizing processors ) which are well understood by those skilled in the art . in block 316 , the lead processor waits until all other processors have reached barrier 1 before proceeding to block 318 . in block 318 , the lead processor gets the correct time that it then stores in memory before releasing barrier 1 and proceeding to block 320 . in block 320 , the lead processor waits until all other processors have reached barrier 2 before proceeding to block 322 . in block 322 the lead processor starts the time base , causing the time clocks of all processors to begin counting , and releases barrier 2 before continuing on to block 324 . as noted previously , all processors except the lead processor perform the actions described in blocks 326 - 332 . in block 326 , each processor in this group signals the lead processor that it has reached barrier 1 . then , in block 328 , all processors in this group wait for the lead processor to release barrier 1 . when the lead processor releases barrier 1 , the processors in this group proceed to block 330 . in block 330 , each processor in this group reads the time stored in memory by the lead processor , and then sets its time clock before signaling the lead processor that it is waiting at barrier 2 . in 332 , all processors in this group wait for the lead processor to release barrier 2 , indicating that the clock initialization process is complete and all processors can continue with other system initialization process is complete and all processors can continue with other system initialization as needed ( block 324 ). this system allows for clock drift to be reduced , thereby providing the user with a more precise time standard using standard precision crystals . the accuracy of the clock is then dependent on the stability of the crystal and the precision of the synchronization granularity of the time base generation apparatus , which is independent of the precision of the crystal . further , because the time base enable pin of the processor is treated as a normal data input , meeting the normal setup and hold requirements of the processor interface , there is no need for additional complex synchronization in the processor interface . while the invention has been particularly shown and described with reference to a preferred embodiment , it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention . | 6 |
embodiments of the present invention relate to a technique for optimizing decoupling capacitance on an integrated circuit while meeting leakage power constraints . embodiments of the present invention further relate to a technique for formulating a linear optimization problem for optimizing decoupling capacitance on an integrated circuit , where the linear optimization problem is solvable using a linear solver program . [ 0017 ] fig3 a shows an integrated circuit ( 20 ) that will be used as a reference for the discussion of the present invention . the integrated circuit ( 20 ) is made up of several regions 1 . . . n , where n represents the number of regions being considered . it is desired to optimize the amount of capacitance in each of these regions while meeting leakage power budgets of either the entire integrated circuit or each of the regions shown in fig3 a . determining an optimal decoupling capacitance arrangement involves determining a maximum value of the following term ( 1 ) subject to the constraint equation ( 2 ): ∑ k = 1 n a k x k , ( 1 ) where a k represents the extra capacitance obtained by replacing thick - oxide capacitors with thin - oxide capacitors in the kth region , and where x k represents the percentage of thin - oxide decoupling capacitance in the kth region . those skilled in the art will understand that because x represents a percentage , the value of x is between 0 and 1 , inclusive . those skilled in the art will also understand that a k is normalized to the area of the kth region . further , those skilled in the art will appreciate that x can be a discrete value between 0 and 1 , inclusive . as stated above , the determination of the maximum value for term ( 1 ) is subject to the following constraint equation ( 2 ): ∑ k = 1 n w k x k ≤ c , ( 2 ) where w k represents the extra leakage current resulting from the replacement of thick - oxide capacitors by thin - oxide capacitors in the kth region , and where c represents the leakage power budget for the integrated circuit ( 20 ). in alternative embodiments , a leakage power constraint may be particular to a region instead of the entire integrated circuit ( 20 ), in which case the constraint equation for that particular region is : where w i represents the extra leakage current resulting from the replacement of thick - oxide capacitors by thin - oxide capacitors in that particular ith region , where x i represents the percentage of thin - oxide capacitors in the ith region , and where c i represents the leakage power budget for the ith region . equations / terms ( 1 ), ( 2 ), and ( 3 ) above form a linear optimization problem with linear constraints , and therefore , by solving for the maximum value of term ( 1 ) subject to equation ( 2 ) and / or possibly equation ( 3 ), a value for x may be determined , where x represents what percentage of thin - oxide capacitance that can be used in particular regions of the integrated circuit or in the integrated circuit as a whole . more particularly , the solved value of x represents an optimal amount of thin - oxide capacitance that can be used without violating leakage power constraints . those skilled in the art will appreciate that the linear optimization algorithm developed above may be solved using any number of linear problem solving techniques . for example , one or ordinary skill in the art will understand the aforementioned linear optimization problem may be solved using lagrange multipliers . in another example , linear programming software may be used to determine an optimal amount of thin - oxide capacitance given the formulation technique above . [ 0027 ] fig3 b shows a flow process describing a technique for optimizing decoupling capacitance on the integrated circuit ( 20 ) in accordance with an embodiment of the present invention . initially , a determination is made as to the percentage of thin - oxide capacitance based on the extra leakage current resulting in a region when the thick - oxide capacitance is replaced by the thin - oxide capacitance in the region ( step 22 ). this may be repeated for a desired number of regions ( step 24 ). thereafter , a determination is made as to the optimal value of capacitance based on the percentage of thin - oxide capacitance determined above and the capacitance resulting from the replacement of the thick - oxide with the thin - oxide capacitance ( step 26 ). this determination of the optimal value may be made based on a plurality of regions on the integrated circuit ( 20 ) ( step 28 ). [ 0028 ] fig4 shows an exemplary computer system ( 30 ) that determines an optimal decoupling capacitance in accordance with an embodiment of the present invention . input parameters ( 32 ) may include a circuit design or layout , an available capacitance area size for a particular area being considered , an amount of thin - oxide capacitors available for the area being considered , and leakage power budget information for the integrated circuit or particular regions thereon . one of ordinary skill in the art will understand that the input parameters ( 32 ) may include additional values , such as information relating to per unit areas of thin - oxide and thick - oxide capacitances present on the integrated circuit or particular regions thereon . the input parameters ( 32 ) serve as input data to the computer system ( 30 ) via some computer - readable medium , e . g ., network path , floppy disk , input file , etc . the computer system ( 30 ) then stores the input parameters ( 32 ) in memory ( not shown ) to subsequently determine ( via microprocessor functions ) an optimal decoupling capacitance using one of the linear problem formulation techniques discussed in the present invention . thereafter , the computer system ( 30 ) outputs the optimal decoupling capacitance information ( 34 ) via some user - readable medium , e . g ., monitor display , network path , etc ., where the optimal decoupling capacitance includes at least a percentage of the available capacitance area that can be used for thin - oxide capacitance instead of thick - oxide capacitance . the computer system ( 30 ) may additionally output the amount of leakage current resulting from the optimal decoupling capacitance determination . those skilled in the art will appreciate that in other embodiments , a software program capable of generating optimal decoupling capacitance information consistent with the linear optimization formulation techniques presented in the present invention may be used . the software program may also be capable of determining leakage current and power values corresponding to the generated optimal decoupling capacitance information . advantages of the present invention may include one or more of the following . in some embodiments , because decoupling capacitance on an integrated circuit may be optimized using a linear optimization formulation technique in accordance with the present invention , integrated circuit performance may be improved . in some embodiments , because a linear optimization formulation technique in accordance with the present invention may be used to determine an optimal assignment of thin - oxide and thick - oxide capacitance , valuable time that would otherwise be used to determine an optimal capacitance is saved . in some embodiments , because a linear optimization formulation technique in accordance with the present invention may be used to determine an optimal capacitance for an integrated circuit or regions thereon subject to leakage power constraints of the integrated circuit or regions thereon , capacitance may be maximized while meeting a leakage power budget of the integrated circuit or regions thereon . while the invention has been described with respect to a limited number of embodiments , those skilled in the art , having benefit of this disclosure , will appreciate that other embodiments can be devised which do not depart from the cope of the invention as disclosed herein . accordingly , the scope of the invention should be limited only by the attached claims . | 6 |
referring to fig1 , the general operation and structure of the system of the present invention will be described , it being understood that the operation of the system will be described in greater detail with reference to fig2 a - 2g , 3 and 4 . when a consumer calls into the telepay system 10 using a telephone 12 , the consumer is prompted by an interactive voice response unit within the system 10 to input certain necessary information , to wit , payee access code , debit card number , account number , and amount . the telepay system 10 then checks all of its internal files , including an account number velocity file 14 , a debit card velocity file 16 and a negative file 18 , to validate the access code entered , the card number presented , the validity of the account number , and if that card number and / or account number has ever processed a fraudulent transaction . if any of these internal checks into the telepay system 10 process indicate fraud , then the transaction is denied . if all of the checks are passed , then the telepay system 10 assembles the data into an authorization request message , which is electronically sent to a debit card network 20 for transmission to a financial institution 22 that issued the card for verification of balance on deposit . the debit card network 20 receives a response as to whether or not the there are sufficient funds on deposit to process the transaction requested by the consumer . the debit card network 20 prepares an appropriate deduction from the consumers account and prepares an appropriate deposit to the payee &# 39 ; s account to be processed later . in addition any fees that are due from the payor are also preprocessed at this time . the debit card network then sends a message to the telepay system 10 while the consumer is still on the telephone 12 line . the telepay system 10 will then translate the numeric data received into an audible verbal response transmitted to the consumer via the telephone 12 . settlement , as described in greater detail with reference to fig3 , is defined herein as the methodology of debiting and crediting the appropriate accounts affected by the above - described transaction . these accounts would affect the payor , the payee , and the telepay system 10 for any transaction fee . the debit card network 20 will initiate this process . the debit card network 20 , however will only deposit a total of the days transactions into the payee &# 39 ; s account . the network has no capability to discern which consumer paid how much . it then becomes the responsibility of the telepay system 10 to detail the specific account numbers and amount of payments that were made that day . this is accomplished by a computer dial - up link ( rje ) 24 from the telepay system 10 to the payee &# 39 ; s billing system 26 . the telepay system 10 will also bill the payee on a monthly basis for 800 telephone line usage ( if any ). the accounts receivable department of the payee is also provided with the capability to call into the telepay system 10 to inquire as to if and when a consumer initiated a payment . a single 800 number is used by the telepay system 10 . technology allows for a virtually unlimited number of telephone lines to terminate on the same number , limited only by the compliment of computer hardware and it &# 39 ; s capabilities that are running the system . the caller will be asked to enter the access code of the bill to be paid . this access code typically will be printed on the bottom of the statement in an obvious manner and is a requirement of all payees utilizing the service . the code will identify the payee within the telepay system 10 and will activate the telepay software to verbalize the customer &# 39 ; s selection in order to give positive re - enforcement as is the case with all customer input ( i . e . “ you have elected to pay florida power and light in miami , fla .” press 1 if this is correct an you wish to continue , or press 2 if incorrect ”). if incorrect , the customer will be asked to input another access code , or to terminate the call . assuming the proper access code is confirmed , the next step will be the entering of the account number of the bill to be paid , as this number also appears on the monthly statement . all selections will be verbally re - enforced . the next step will be the entering of the debit ( atm ) card number . various telepay system 10 checks will be done on this entry . verbal re - enforcement of the numbers entered is again given to the user (“ you have entered 5419 23485 4657 . please press 1 if correct or 2 if incorrect ”). the telepay system 10 will then instruct the user to enter the amount of the payment and verbal positive re - enforcement will be given . if all has been acknowledged positively up to this point , then the system will give a verbal summary of the transaction and give the customer a final opportunity to validate the entries (“ press 1 if correct , or press 2 if incorrect ”). when the transaction has been positively re - enforced by the user , the telepay system will then build an authorization request that will be sent out to the existing debit ( electronic funds transfer ) networks . when the transaction has been authorized , the system will once again give positive re - enforcement to the user (“ your payment to dallas gas and electric in the amount or $ 124 . 56 has been paid from your atm card account number 5419 23485 4657 . your authorization number for this transaction is xxxxxxx . please make a note of this authorization code for future reference . if you would like to hear the authorization code for this transaction again , press 1 . if you would like to pay another bill press 2 . if you are finished press 3 ”). if the user elects to pay another bill during the same session , then the system will retain the previously entered card number and ask the caller if the next bill being paid is to be paid with the same card , or allow the opportunity to enter a new card number . all of the debit ( electronic funds transfer ) networks are accustomed to the assessment , debiting and crediting of fees to the issuers and acquirers of debit ( atm ) and credit transactions . in many cases , a 75 ¢ fee for a customer to use an atm card at an atm that is not owned by the card issuing bank involves the dividing of that fee into increments as small as 5 ¢. in this manner all networks that are accessed are compensate to assist in the authorization and routing of the transaction . all of these fees are electronically credited to the entity that earned the revenue as a result of a contractual relationship with that particular network . this process happens every working day at a predetermined “ cut off ” period that separates business days and is refereed to in the industry as “ settlement ”. never before , however , has a transaction been presented to the debit networks for a real - time authorized bill payment initiated by the customer from a touch tone telephone with the - debit card used as the transaction vehicle . additionally , it has never been done without the requirement of a pin ( personal identification number ) and still maintain transaction security . in the telepay system 10 , when a transaction is entered by a consumer , and subsequently passed on to an outside debit card network for authorization , a number of things happen . assuming that the transaction is authorized , then any fee that the customer is paying , in addition to the actual bill payment , is automatically deducted from the payor &# 39 ; s account immediately and added to the amount that the debit card network will owe telepay and the payee at settlement . the amount of the bill that was paid is automatically added to the amount that will be credited to the payee at the end of the business day ( every payee is required to provide a bank account number that will be used to electronically credit the days receipts ). telepay &# 39 ; s bank account will , in a like manner , be automatically credited for the transaction fee . any network usage fees that have to be paid to process the transaction by the use of an debit card network will be electronically paid by the telepay system 10 to the appropriate service provider . once a day at telepay &# 39 ; s settlement time , each payee participating in the system will receive the electronic on - line detail summary of the days individual transactions for posting to the consumer &# 39 ; s account . a flowchart illustrating the operation of a bill payment transaction process of the telepay system 10 is shown in fig2 a - 2g . the process is initiated by a user &# 39 ; s calling into the system 10 . in step 200 , a general purpose welcome message that announces and instructs the caller in the manner with which the system can be used is transmitted to the user via the telephone 12 ( fig1 ). in step 202 , the user is prompted to enter a payee access code , which is assigned by the embodiment of the invention in the form of a service and the user is made aware of this code due to its printed presence on the monthly customer statement , statement stuffers or other printed handouts . this code is what distinguishes one payee from the other , and is the identifier that causes the system 10 ( fig1 ) to record the transaction in the appropriate payee record file . after the caller enters the access code , it is electronically checked against the list of authorized payees participating in the system 10 in step 204 . in step 206 , a determination is made whether the entered access code is valid . if the access code is invalid , in step 208 , the system 10 checks to determine whether this is the third incorrect entry of an access code . if this is not the third incorrect entry of the access code , in step 210 , the system 10 instructs the caller that the access code is invalid , and offers the caller to opportunity to re - enter the access code in step 202 . if this is the third incorrect entry of an access code , in step 212 , the system 10 instructs the caller to check the access code information and call again . if the access code is entered properly within three attempts , in step 214 , the caller is prompted to enter the account number of the bill that they are paying . in step 216 , the system 10 checks the account number for validity . the validity check is based on the methodology that the payee uses to verify account numbers and will vary according to payee . the system 10 will have all of the participating payees verification methodologies . this methodology could be a mod 10 or mod 11 check digit routine with or without a check digit in it &# 39 ; s most basic implementation . in a more sophisticated environment , the system would have in it &# 39 ; s database , a list of all the valid account numbers for that particular payee , commonly known to those skilled in the art as a “ shadow file .” in step 218 ( fig2 b ), a determination is made as to the validity of the account number entered . if the entered account number is not valid , in step 220 , a determination is made as to whether this is the third incorrect entry . if it is not the third incorrect entry , in step 221 ( fig2 a ), the caller is informed that the entry is invalid and is given an opportunity to reenter the account number . if the entry attempt is the third invalid attempt , in step 222 , the caller is instructed to check their information and call again . if a valid account number is entered within three attempts , in step 224 , the system 10 requests the caller to enter the debit card number . in step 226 , the debit card number is checked for validity . this validity check is done via the mod 10 algorithm that is the basis for debit card issuance used by financial institutions . using this method that is commonly used , and familiar to those skilled in the art , gives a great level of assurance that the number that was entered by the caller was entered properly . in step 228 , a determination is made whether the entered debit card number is valid . if the entered debit card number is not valid , in step 230 , a determination is made whether this is the third invalid entry if this is not the third invalid entry , in step 232 , the caller is instructed of the invalid entry and then , in step 224 , is requested to enter a debit card number . if this is the third invalid entry , in step 234 , the system 10 requests the caller to check their information and call again . once a valid debit card number is entered within three attempts , in step 236 ( fig2 c ), the caller is requested to enter the dollar amount ( without a decimal ) of the bill to be paid . in step 238 , the system 10 repeats the entered amount to the caller and , in step 240 , asks the caller to indicate whether the entry is correct by depressing a key on the keypad of the telephone 12 . in step 242 , a determination is made whether the caller responded that the entry is correct . if the entry is not correct , in step 244 , a determination is made whether this is the third incorrect entry . if this is not the third incorrect entry , in step 236 , the caller is requested to enter a new dollar amount . if this is the third incorrect entry , in step 246 , the caller is requested to check their information and call again . if the caller enters a correct amount within three attempts , in step 248 ( fig2 d ), the system 10 initiates a velocity file 14 check . the velocity file 14 is an internal file to this invention that restricts the number of times that a payor account number can be paid electronically using the system 10 over a 30 day period . the numerical value of the velocity file is individually selectable by each payee participating in the system 10 , and will prevent excessive payments from their customers that have the potential for fraud . in step 250 , if payments are located in the velocity file 14 that indicate to the system 10 a violation of the number of transactions permitted over a 30 day period by the payee , in step 252 , the caller is notified that their transaction cannot be processed , due to the excessive frequency of usage . if the transaction is within the number allowed by the payee over a thirty day period , in step 254 , the system 10 performs the velocity file check on the debit card number that the caller entered . the numerical value of the debit card velocity file 16 is determined by the system 10 based on , but not limited to , historical usage data of all payees and payors over a given period of time . this value is variable and is achieved generally by multiplying the total number of payees participating in the system times the total number of payments allowed by each payee over a 30 day period . if the system 10 determines that the transaction by the payor exceeds the debit card velocity file criteria , in step 256 , the caller is notified that the transaction cannot be processed due to the frequency of the number of uses of the debit card used to process transactions over a thirty day period . if the transaction by the payor does not exceed the debit card velocity file criteria , in step 258 ( fig2 e ), the system 10 determines whether either the payor account number or the debit card number is contained in the negative file 18 comprising a database of negative accounts stored on the system 10 . the purpose of the negative file 18 maintained by the system 10 is to prevent debit card numbers and account numbers that have been involved in fraudulent transactions from initiating another transaction . this file is updated by payees participating in the system by written notification to the service . an employee of the service would then update the system . if the system 10 determines that a match on either payor account number or debit card number has been found , in step 260 , the caller is informed that the transaction cannot be processed . if there is not a match found on the negative file 16 , then the details of the transaction are summarized to the caller verbally on the interactive voice response system in step 262 . in step 264 , the caller is prompted to begin the processing of the transaction by pressing one ( 1 ) on the telephone keypad , or by pressing two ( 2 ) on the telephone keypad to abort the transaction . in step 266 , the system 10 checks the caller &# 39 ; s response . if two has been depressed by the caller , in step 268 , the system 10 thanks the caller and terminates the call . if one has been depressed by the caller , in step 270 ( fig2 f ), the system 10 outdials via a normal telephone line to an appropriate debit card network , such as the network 20 for processing . a debit card network is a third party processor that will process the transaction for a fee , providing connectivity to either the financial institution that issued the debit card number , or another debit card network that has the capability to connect with the financial institution that issued the debit card number . those skilled in the art are aware that a debit card network , i . e . pulse in houston , tex ., most in washington , d . c ., honor in maitland , fla ., etc ., process primarily atm ( automated teller machine ) transactions , and do not rely on the automated clearing house ( ach ) to process individual transactions . in addition to the face value of the bill to be paid , the system adds a service charge that the caller will electronically pay for use of the convenience of the system . through the use of the debit card network , rather than the ach , the transaction is positively verified against funds on deposit prior to the processing of the transaction . in step 272 , while the system 10 is outdialing to the debit card network 20 , the system 20 plays a customized individually recorded marketing message for each payee utilizing the system 10 , that will promote a service of the payee while the caller is awaiting approval . if the debit card network and the subsequent transmission to other debit card networks ( if required ) make the determination that funds are not available in the caller &# 39 ; s account selected by the debit card number , then the transaction will be declined . in step 274 , the system 10 awaits a reply from the debit card network 20 . in step 276 , the system 10 then makes a determination on the disposition of the transaction based on the response received back form the debit card network 20 . if the response from the debit card network 20 indicates to the system 10 a declination , with which those skilled in the art are familiar , in step 278 , the system 10 informs the caller that the transaction was declined by the financial institution that issued their debit card number . if the response from the debit card network 20 indicates an approval , the caller will be verbally informed of the approval code in step 280 . in step 282 , the approved transaction is updated in a system transaction log file that will later become the basis for the transmission for payment data to each individual payee . the transaction log file contains the debit card number , payor account number of the bill paid , amount of the bill paid , time / date , and approval code . the log file is individually kept for each payee participating in the system for later electronic transmission for billing system update . in step 284 ( fig2 g ), when a transaction is successfully completed , the aforementioned debit card number velocity file that was checked as part of the pre - processing procedures is updated to reflect the transaction . in step 286 , the velocity file for the account number of the bill that was paid is updated to reflect the transaction . in step 288 , the system 10 asks the caller if he or she would like to pay another bill by requesting the caller to press one ( 1 ) to pay another bill , or two ( 2 ) to terminate the call . in step 290 , the system 10 makes a determination as to whether the caller would like to make another payment , based on the response indicated by the caller . if a one was pressed , the system 10 prompts the caller for another access code in step 202 ( fig2 a ). if a two is pressed , the system 10 terminates the call in step 292 . fig3 is a flowchart of the settlement process of the present invention . after close of the business day , by the debit card network 20 , the debit card network 20 begins to move the funds electronically ; a process with which those skilled in the art are familiar . at that point the system 10 is in a position to transmit the detail of the days transactions to the individual payees that will be receiving electronic credits from the debit card network 20 . the debit card networks transmit only the gross dollar amount of funds for crediting to each payee . the system 10 performs the actual detail of the electronic transmission of individually paid accounts . the system 10 will recognize the time of day by the internal clock common to most computer systems , and select the first payee in the aforementioned transaction log file . in step 300 , the system 10 will outdial using an ordinary telephone line into the first payee on the system in an effort to connect to the computer billing system 26 ( fig1 ). once a telephonic connection is established , in step 302 , the system 10 begins the process of transmitting the payor account numbers and amounts of the bills that were paid since the last settlement period using the system 10 . this process is known to those skilled in the art as remote job entry ( rje ). in step 314 304 , the system 10 determines whether there are other files to be transmitted . in step 306 , the system 10 outdials the appropriate telephone number established in advance to establish a telephonic rje link with the next payee in step 302 , in a manner similar to the aforementioned , the transactions that the system 10 performed in favor of that particular payee will be transmitted to that payee &# 39 ; s computer billing system 10 . once all the files have been transmitted , the settlement process is terminated in step 308 . fig4 is a flowchart of a payee inquiry process of the present invention , which provides a payee with the ability to initiate a telephone cell into the present invention operating as a third party to the transaction , in order that payment information can be discerned in conjunction with a touch tone telephone . the process is initiated by a payee calling into the system 10 . in step 400 , the system 400 will ask the caller to input a security code , which is assigned to each payee and is different for each payee . the input of a proper code will indicate to the system which payee payments are to be inquired upon . without a proper code , no inquiry access is permitted . it is important to recognize that this system capability is for the payee , and not for the actual payor of the bill . this system capability assists in past due collection activity . in step 402 , the system 10 checks its internal data files to ascertain the validity of the code entered . if an improper code is entered , in step 404 , the system 10 informs the caller that the code is invalid . if the entered code matches one that was contained in the system database , in step 406 , the system 10 requests the caller to enter the account number of the customer whose bill is being inquired upon . after the caller enters the account number , in step 408 , the system attempts to locate it on the system database . if the system 10 cannot locate the account number , in step 410 , the caller is informed that no payment exists for the entered account number and is given an opportunity to enter another account number in step 406 . if the entered account number is located , in step 412 , the system 10 informs the caller of the details of the transaction , to wit , time , date , amount , and authorization number of the payment . in step 414 , upon completion of the audio text information , the caller is asked whether he or she has another inquiry to perform . if so , in step 406 , the system 10 prompts the caller to enter the account number ; otherwise , the system 10 terminates the call in step 416 . the crux of this invention is that bill payment transactions have never been presented to the debit networks for a real - time authorization initiated by the consumer from a touch tone telephone with the debit card number used as the transaction vehicle . additionally , this process have never been done without the requirement of a pin ( personal identification number ) and still maintain an assemblage of transaction security . in the telepay system , when a transaction is entered by a consumer , and subsequently passed on to an outside debit card network for authorization , a number of things happen . assuming that the transaction is authorized , then any fee that the customer is paying , in addition to the actual bill payment , is automatically deducted from the payor &# 39 ; s account immediately and added to the amount that the debit card network will distribute between telepay and the payee at settlement . the amount of the bill that was paid is automatically added to the amount that will be credited to the payee at the end of the business day ( every payee is required to provide a back account number that will be used to electronically credit the days receipts ). telepay &# 39 ; s bank account will , in a like manner , be automatically credited for the transaction fee . any network usage fees that have to be paid to process the transaction by the use of an debit card network will be electronically paid by telepay to the appropriate service provider . once a day at telepay &# 39 ; s settlement time , each payee participating in the system will receive the electronic on - line detail summary of the days individual transactions for posting to the consumer &# 39 ; s account . the following criteria and conditions are part of the telepay method and unique process prior to the acceptance of a debit card number into the system in order to ensure a proper transaction has been presented and to add a level of usage security . first , a service address ( telephone number or residential electricity site , etc .) or payee account number can only be the recipient of a specific limited number of payments within 30 days that is selectable by the funds recipient and a velocity file by account number is kept at the telepay system tracking this limitation . in addition , a debit card number can only be used in the telepay system a specific limited number of times based on a recipient of funds selectable parameter and current recipient of funds ( payee ) negative files due to adverse experience are added to the telepay system prior to implementation . still further , any consumer chargebacks will prevent that customer &# 39 ; s telephone number / electricity service address number and that credit / debit card number to have system access . appropriate additions will be made to the negative file unless specific overrides are requested by the funds recipient . also , all transactions will be routed electronically to the card issuing entity / network by the telepay system for positive authorization as to card acceptability , credit limit guidelines , payment status , balance availability , and any and all criteria that the issuer deems appropriate . additionally , the telepay system will provide records of all declinations by card number and by telephone number , electric service account number , or payor account number , whichever is appropriate and a check will be done on all debit card numbers entered into the telepay system to ensure that the input number is an assigned number within the criteria of the issuing entities , as well as on service address account numbers to insure that the proper number and sequence of digits have been entered to add an additional level of accuracy to the numeric entry process . moreover , the customer will always be given positive audio reinforcement at critical steps during the data entry process to assist in the entry of accurate information and transaction declinations due to non - sufficient funds will be audio referred for the consumer to contact their card issuing institution . accordingly , it is clear that the telepay system is a technologically advanced and consumer convenient process . the consumer may use the telepay system to pay bills at will , spontaneously , without any personal investment in equipment , and any requirement of pre - registration . the use of the telepay system is not tied to a specific locations , as any touch tone telephone will suffice . use of this unique process will eliminate the use of stamps , envelopes , the u . s . postal service , and the necessity of going to a mailbox . personal computers and the lack of realistic portability are problems that do not exist in the present invention . receipt of payment is also assured and issues of “ lost in the mail ” or mail delays will no longer exist . debit cards will now have true utility as transaction vehicles in order to electronically present payment as opposed to paper checks . older technology of pre - registration and direct debit registration systems will become obsolete . it is understood that the present invention can take many forms and embodiments . the embodiments shown herein are intended to illustrate rather than to limit the invention , it being appreciated that variations may be made without departing from the spirit of the scope of the invention . for example , it is anticipated that the payor may be an individual or an institution , such as a corporation or association . although illustrative embodiments of the invention have been shown and described , a wide range of modification , change and substitution is intended in the foregoing disclosure and in some instances some features of the present invention may be employed without a corresponding use of the other features . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the scope of the invention . | 6 |
embodiments of the present invention will be described in detail below with reference to the drawings , and the technical solutions of the invention will be further illustrated . however , the scope of the invention is not limited to these embodiments . in this embodiment , an integrated window has front and back window frames , as shown in fig1 - 12 . the front and back window frames have the same structural principle , for which the structures of the window frames will be specifically described as follows . two front frame bodies 2 are symmetrically located on both sides of the front window frame . the front frame body 2 has a front support portion 2 a and a front guide portion 2 b . the front frame body is configured as an elongated l - shape . that is to say , the front support portion 2 a is vertically connected with the front guide portion 2 b , and an indentation 2 e is formed above the front support portion 2 a and the front guide portion 2 b , in which the upper end of the front support portion is located higher than the front guide portion . in this embodiment , the front support portion 2 a is integrated with the front guide portion 2 b . a front window cover 1 is mounted on the front frame bodies 2 . the indentation 2 e formed between the front guide portion 2 b and the front support portion 2 a has a width identical to that of the window cover . in the process of mounting , the front window cover is fixed at the said front indentation 2 e , so that the front window cover 1 will not be lonely exposed and projected to the external environment . as such , the front portion of the window , i . e . the portion exposed at the external wall , is configured as a square shape , which provides the window with an overall attractive appearance . an upper slide 9 is provided between the upper ends of the support portions of the front frame bodies on both sides , and a lower slide 10 is provided between the lower ends thereof . the upper and lower slides are provided with corresponding slide ways , which are mainly used to facilitate horizontal movement of the sliding window between left and right . the bottom surface of the lower slide 10 is covered by the outer window frame sealing plate 23 . two back frame bodies 3 are symmetrically located on both sides of the back window frame . the back frame body 3 has a back support portion 3 a and a back guide portion 3 b . the back frame body is configured as an elongated l - shape . that is to say , the back support portion 3 a is vertically connected with the back guide portion 3 b , and an indentation 3 e is formed above the front support portion 3 a and the front guide portion 23 b , in which the upper end of the back support portion is located higher than the back guide portion . in this embodiment , the back support portion 3 a is integrated with the back guide portion 3 b . a back window cover 17 is mounted on the back frame bodies 3 . the indentation 3 e formed between the back guide portion 3 b and the back support portion 3 a has a width smaller than that of the back window cover 17 . as the back frame bodies 3 are faced to the interior of the room , the back frame bodies 3 can not extend out of the wall for the purpose of attraction and harmony of the whole product . the back window cover 17 shall have a relatively large area because a tubular motor 11 has to be mounted within the back window cover 17 . therefore , the width of the indentation 3 e formed between the back guide portion 3 b and the back support portion 3 a is configured to be smaller than the width of the back window cover 17 in the back frame bodies 3 , so that the back window cover 17 could individually extend beyond the wall . an upper slide 9 is provided between the upper ends of the support portions of the back frame bodies on both sides , and a lower slide 10 is provided between the lower ends thereof . the upper and lower slides are provided with corresponding slide ways , which are mainly used to facilitate horizontal movement of the sliding window between left and right . the bottom surface of the lower slide 10 is covered by the inner window frame sealing plate 24 . in this embodiment both the front window cover 1 and the back window cover 17 are respectively fixed to the upper part of the front frame bodies and the lower part of the back frame bodies by bolts . the front support portion 2 a is fixedly connected with the back support portion 3 a by means of a plastic bar 5 . in particular , a first groove 2 c is set on one side of the front support portion 2 a and a second groove 3 c is set on one side of the back support portion 3 a corresponding to the first groove 2 c . two long lateral edges of the plastic bar are respectively inserted into and fixed to the first groove 2 c and the second groove 3 c . the plastic bar 5 has an i - shape section . in the process of mounting , the front frame body 2 is firstly aligned with the back frame body 3 , the plastic bar 5 is then aligned with and inserted into the first groove 2 c and second groove 3 c , and two long lateral edges of the plastic bar 5 are fixed within the first groove 2 c and second groove 3 c to connect the front frame body 2 with the back frame body 3 . as such , the front frame bodies 2 can be readily mounted to the back frame bodies 3 . the window frames are integrally made from aluminum alloy materials . the front support portions 2 a of the front frame bodies 2 and the back support portions 3 a of the back frame bodies 3 are made of hollow plates that are transversely and circumferentially closed and have openings at both longitudinal ends . as such , on the one hand , the reliability of the whole product could be guaranteed ; and on the other hand , not only the production cost could be saved , but also good heat insulating performance could be obtained . when the front and back window frames are connected by using the plastic bars , the corresponding upper and lower slides thereof are fixedly connected with each other as well . particularly , said two upper slides are connected via a plastic bar which is heat insulating , and said two lower slides are connected via another plastic bar which is heat insulating . a front frame body limiting element 2 d is located on the inner side of one of the front support portions 2 a for positioning the sliding window , and a back frame body limiting element 3 d is located on the inner side of the back support portion 3 a on the opposite side for positioning another sliding window . as such , the sliding windows could be conveniently mounted and positioned by using said two limiting elements . each of the front window cover 1 and the back window cover 17 has a curtain cloth rolling mechanism located therein . in this embodiment , each of the curtain cloth rolling mechanisms has a tubular motor 11 mounted within the aluminum - made reel pipe 16 . the upper edges of the said both pieces of curtain cloth 4 are respectively fixedly connected to the wall of the corresponding aluminum pipes 16 . the curtain cloth 4 is wound around the outer surface of the aluminum pipe 16 . this way , the reel pipes 16 could be driven to rotate by actuating the tubular motors 11 to automatically move the curtain cloth 4 up and down , so that the curtain cloth 4 is unwound or wound . end caps 12 are provided on both ends of the front and back window covers and are rotatably matched with the reel pipe 16 . extension elements 12 b are provided on the end caps 12 . the end caps 12 could be fixedly connected with the window frame support portions by inserting the extension elements 12 b into the window frame support portions . as such , the overall reliability of the curtain could be guaranteed . the curtain cloth 4 mounted on the front window cover 1 which is located on the exterior wall , is made from sun - shading materials , and the curtain cloth 4 mounted on the back window cover 17 which is located within the room , is made from screen window cloth . therefore , the said two pieces of curtain cloth 4 could be respectively pulled down as required , which could respectively act to prevent sunshine entering into the room and shield mosquitoes and wind . heat dissipation holes could be provided on the end caps 12 . each of the front guide portions 2 b of the front frame bodies 2 and the back guide portions 3 b of the back frame bodies 3 has a track 7 located therein . in particular , the track 7 is integrated with the corresponding guide portion to facilitate the manufacturing process . a longitudinal opening is located on the side of the guide portion 2 b facing the curtain cloth 4 . the track 7 forms an open slot in the longitudinal direction and the opening of the open slot faces to one side of the curtain cloth 4 . the upper opening of the open slot is in communication with the window cover 1 . a guide rod 6 is located within the open slot in the longitudinal direction . two symmetrically disposed seal plugs 8 are mounted within the front guide portion 2 b and the back guide portion 3 b adjacent to the end of the track 7 . a gap 8 a is formed between said two seal plugs 8 and has a diameter smaller than the outer diameter of the guide rod 6 . both lateral edges of the curtain cloth 4 respectively pass through the longitudinal opening of the guide portion 2 b and the opening of the open slot on the same side , to extend into the open slot 21 and be transversely positioned at the guide rod 6 . both lateral edges of said two pieces of window cloth 4 are fixedly connected with a hem 4 a which passes through the gap 8 a between two seal plugs 8 to be covered on the guide rod 6 and moves up and down along the guide rod 6 . the hems 4 a are cloth made from ordinary nylon composite materials or ordinary chemical fiber materials , have a tensible feature and thus tend not to be broken . the hems 4 a can be folded in two to form a circumferentially closed space into which the guide rod 6 is inserted , so that the guide rod 6 is connected with the curtain cloth 4 . while the hem 4 a is wound up with the curtain cloth 4 , the hem 4 a is flattened , has a thickness identical to that of the curtain cloth 4 and constantly remains flat to prevent the window cloth 4 from being displaced . as such , when the wind blows to the window cloth 4 , the curtain cloth 4 is caught by two guide rods 6 through the hems 4 a and is pulled straight , which ensures the guide rod 6 be always restricted within the track 7 to prevent from being removed . the curtain cloth 4 and the hems 4 a can be welded together by using a heat sealing device under the temperature of 200 - 400 ° c . or sewed to each other by using a sewing machine . a bottom plug 13 is mounted at the lower end face of the window frame guide portion and a guide plug 14 is mounted at the upper end face of the guide portion . a positioning element 15 is mounted within the bottom plug 13 . one end of the guide rod 6 is inserted into the positioning element 15 and the other end thereof passes through the guide plug 14 . the impurities , such as dust , will be prevented from entering into the window frame guide portion by the bottom plug 13 and guide plug 14 . the track 7 within the window frame guide portion will be kept tidy to prevent too many impurities blocking the track 7 to make it difficult to move the curtain cloth 4 up and down . an elliptical groove 15 a is disposed on the positioning element 15 . the guide rod . 6 is inserted into the elliptical groove 15 a . the distance between said two guide rods 6 can be varied by locating the guide rods 6 in different positions within the elliptical groove 15 a , so that curtain cloth 4 of different widths can be mounted . meanwhile , when the wind is strong , the movement of said two guide rods 6 within the corresponding elliptical grooves 15 a ensures that the curtain cloth 4 can be smoothly moved . the curtain cloth 4 can be slightly and appropriately projected to prevent itself from being torn down by wind for over - straightening reasons . the lower edge of the curtain cloth is connected with a lower rod 20 . after passing through the longitudinal opening of the guide portion and the opening of the open slot on the same side , both ends of the lower rod 20 slidably extend into the open slot . the length of the lower rod 20 coincides with the distance between the guide rods on both sides . the lower rod is hollow and both ends thereof are sealed by a rod plug 2 respectively . a rubber strip 21 is mounted on the lower surface of the lower rod 20 along its length . a concave slot is formed on the lower surface of the lower rod 20 along its length . the slot is embedded into the rubber strip 21 and the rubber strip 21 partially projects from the lower surface of the lower rod 20 . this embodiment is different from the first embodiment in that one of the window frames does not have window covers , curtain cloth or other parts . the structure of the second embodiment will be described below . as shown in fig1 - 17 , the support portion 2 a is fixedly connected with a lateral seal via a plastic bar 5 . in particular , a first groove 2 d is provided on a side of the support portion 2 a and a second groove 4 a is provided on a side of the lateral seal 4 corresponding to the first groove 2 d . both ends of the plastic bar 5 are inserted into and fixed to the first groove 2 d and the second groove 4 a respectively . the plastic bar 5 has an i - shape section . in the process of mounting , the lateral seal 4 is firstly aligned with the frame body 2 , the plastic bar 5 is then aligned with and inserted into the first groove 2 d and second groove 4 a , and two long lateral edges of the plastic bar 5 are fixed within the first groove 2 d and second groove 4 a respectively to connect the lateral seal 4 with the frame body 2 , in which case the lateral seal is conveniently mounted to the frame body . both the window frames and the lateral seals are made from aluminum alloy materials . the front support portions 2 a of the frame bodies 2 and the lateral seals are made of hollow plates that are transversely and circumferentially closed and have openings at both longitudinal ends . as such , on the one hand , the reliability of the whole product could be guaranteed ; and on the other hand , not only the production cost could be saved , but also good heat insulating performance could be obtained . a lateral seal limiting element 4 b is located on the inner side of one of the lateral seals 4 for positioning the sliding window , and a frame body limiting element 2 e is located on the inner side of the support portion 2 a of the frame body 2 on the opposite side for positioning another sliding window . as such , the sliding windows could be conveniently mounted and positioned by using said two limiting elements . an upper slide 9 is provided between the upper ends of the lateral seals on both sides , and a lower slide 10 is provided between the lower ends thereof . the upper and lower slides are provided with corresponding slide ways , which are mainly used to facilitate horizontal movement of the sliding window between left and right . when the window frames are connected with the lateral seals by using the plastic bars , the corresponding upper and lower slides thereof are fixedly connected with each others as well . particularly , said two upper slides are connected via a plastic bar which is heat insulating , and said two lower slides are connected via another plastic bar which is heat insulating . in this embodiment , the window frame having the window cover is mainly applied to outer sun - shading windows , and thus the lateral seal 4 is located within the room and the frame body 2 is located outside of the room . in other words , the window cover 1 is positioned out of the room . the curtain cloth 7 is made from sun shading materials , in which case sunshine can be effectively prevented from entering the room when the curtain cloth 7 is pulled down . the other aspects of the second embodiment could refer to those described in the first embodiment . as shown in fig1 and 19 , the structures and principles of the third embodiment are substantially the same as those of the second embodiment . the third embodiment is merely different from the second embodiment in that the indentation 3 formed between the guide portion 2 b and the support portion 2 a has a width smaller than that of the window cover 1 , because the window frame of this embodiment is mainly applied to inner sun shading windows and the frame body 2 is located within the room and the lateral seal is located outside of the room . in other words , the window cover 1 is positioned inside the room in the third embodiment . as the lateral seals 4 and the frame bodies 2 are mounted within the wall , the frame bodies 2 can not extend beyond the wall for the purpose of attraction and harmony of the whole product . meanwhile , the area of the window cover 1 can not be overly small as it is provided with a tubular motor . consequently , the width of the indentation 3 formed between the guide portion 2 b and the support portion 2 a must be smaller than the width of the window cover 1 , so that the window cover 1 individually extends beyond the wall . in the meantime , in order to prevent mosquito entering into the room when the window is opened to circulate the air , the window cloth 7 is made from screen window cloth in this embodiment . the other aspects of the third embodiment could refer to those described in the second embodiment . the fourth embodiment is different from the first , second or third embodiment in that the windproof component of the window frames employs different positioning elements . in particular , the positioning element of the fourth embodiment is implemented by a flexible tape . both lateral edges of the curtain cloth are respectively fixedly connected with the flexible tape on the same side or both lateral edges are respectively covered on the exterior of the flexible tape on the same side , and the upper end of the flexible tape is wound around the reel pipe . a hook is provided on the bottom plug at the lower end of the guide portion . when the curtain cloth is unwound , the lower end of the flexible tape is engaged with the hook of the bottom plug to keep the curtain cloth constantly in the straightened condition . when the lower end of the flexible tape is disengaged from the hook of the bottom plug , the curtain cloth could be driven by the reel pipe to wind upwards . the other aspects of the third embodiment could refer to those described in the first , second or third embodiment . the fifth embodiment is different from the first , second , third or fourth embodiment in that the reel pipe is driven in a different manner . in particular , a rope is manually pulled to drive the curtain cloth instead of the aforesaid driving components , for example the tubular motor . in this embodiment , a bead plate is externally secured to one end of the reel pipe and is driven to rotate by a pull bead , thereby driving the reel pipe to rotate synchronously . the sixth embodiment is different from the first , second , third or fourth embodiment in that the reel pipe is driven in a different manner . in particular , a rocker is manually turned to drive the curtain cloth instead of the aforesaid driving components , for example the tubular motor . the driving mode by manually turning the rocker is well known to persons having ordinary skills in the art and thus is omitted herein for brevity . the other aspects of the third embodiment could refer to those described in the first , second , third or fourth embodiment . 1 . the front and back window covers are provided with curtain cloth , which meets the demand for sun shading outside of windows and the purpose for prevention of mosquito and sun shading . as such , the curtain cloth could be of multiple uses , meet multiple demands and have cost efficiency . 2 . the present invention has a more reasonable configuration , in which the guide portion for positioning the guide rod to guide the curtain cloth to move up and down is integrated with the support portion for locating the sliding window . in addition , the front frame body and back frame body respectively provided with sliding windows are connected with each other via the plastic bars . as such , good heat insulating performance could be achieved and the window could be conveniently manufactured and mounted in the invention . 3 . the window frames are made from aluminum alloy and / or plastic steel materials and have a long use life . 4 . the position and connection of the front frame body relative to the back frame body could be modified as required by actual circumstances . as such , the window frames could be classified into inner sun shading window frames and outer sun shading window frames , for which the window frames could be widely employed . 5 . when the wind is strong , the guide rods can be located and the hems can be covered on the guide rods and move up and down along the guide rods , which ensures and strengthens the overall windproof intensity of the window frames on the one hand , and guarantees the smoothness of the movement of the curtain cloth on the other hand . 6 . a piece of cloth can be folded in two to form hems having a circumferentially closed space . when the hems are wound by the tubular motor together with the curtain cloth , the hems are pressed flat . the hems have the same thickness as the curtain cloth and always remain flat . as such , the curtain cloth is entirely and flatly wound around the aluminium tube , which overcomes the problem of the curtain cloth being displaced when the windproof curtain is wound . the specific embodiments described herein are merely illustrative of the spirit of the invention . various variations , modifications and amendments can be made to these embodiments by those of ordinary skills in the art without departing from the spirit or scope defined by the appended claims . | 4 |
the films of the invention may have incorporated therein additives which provide desired characteristics such as enhanced flexibility or strength , provided such additives do not interfere with or hinder the chiral nematic structure . such additives include plasticizers , reinforcing agents and polymer resins . in the manufacture of the film such additives would be incorporated , in an appropriate amount having regard to the desired function , in the aqueous dispersion , before , during or after formation of the chiral nematic liquid crystalline phase in the dispersion . a chiral nematic pitch of 0 . 1 μm to 1 μm in the helicoidal arrangement in the film results in the film reflecting left - circular polarized light over a spectrum from ultraviolet to near - infrared . in a preferred embodiment the chiral nematic pitch is about 0 . 4 / n μm to 0 . 8 / n μm , where n is the mean index of refraction of the material resulting in a film having a coloured iridescent appearance and reflecting left - circular polarized light without change of handedness i . e ., reflecting incident left - circular polarized light as left - circular polarized light , to provide reflected light in the visible spectrum from violet to red . the cellulose crystallites suitably bear charged groups , for example , sulfate groups or phosphate groups . the sulfate groups may be derived from the acid hydrolysis of the cellulosic materials , with sulfuric acid . groups such as phosphate groups may be incorporated by a variety of well - known methods to the surface of the crystallites produced by acid hydrolysis . these charged groups may be totally or partially removed from the resulting cellulose crystallites , for example , to alter the colour of the resulting film . the preferred hydrolyzing acid is sulfuric acid which results in sulfate groups esterified onto the crystallites . aqueous liquid - crystalline suspensions of cellulose crystallites bearing sulfate groups are produced by sulfuric acid hydrolysis of natural cellulosic materials , for example , wood pulp , cotton , bast fibres and bacterial cellulose . the acid concentration must be less than that at which dissolution of the crystals takes place and thus should generally be less than about 72 % w / w . the temperature must be high enough , usually from 30 ° to 60 ° c ., and the time of hydrolysis long enough , usually 5 minutes to 2 hours , so that a stable colloidal dispersion of crystallites can be obtained . this will be the case when the cellulose crystallites are short enough and have a high enough degree of sulfate groups that have been esterified onto their surface . the optimal conditions can vary considerably , depending on the source of cellulose . it is important for a homogeneous hydrolysis and for a good yield of colour - forming fractions that the cellulosic material be milled prior to the hydrolysis , usually to pass a 20 to 100 mesh screen . typically , bleached kraft pulp from black spruce is milled to pass a 100 mesh screen . ten grams of this pulp , with a water content of about 7 % is then added to 125 ml of 60 % sulfuric acid kept heated at 60 ° c . the fluid mixture is stirred for 25 minutes and the hydrolysis is stopped by diluting about tenfold in water . the hydrolyzed material is then centrifuged and washed until the ph is ≧ 1 and transferred to a dialysis bag . the removal of free acid is thus pursued until the dialysis water remains close to neutral . the material has then passed partly or wholly in suspension , forming a gel . this gel is treated in 10 ml aliquots with a branson model 350 micro tip sonifier and the resulting liquid is further polished by a mixed - bed ion exchange resin treatment . the final product spontaneously self - assembles to form a chiral nematic liquid - crystalline phase in a certain concentration range , from about 1 % to 20 % w / w , preferably 2 % to 10 % w / w . at lower concentrations the suspension is isotropic and at higher concentrations it is a viscous gel which prevents the formation of the chiral nematic structure . the yield is about 60 %. the product is now in its acid form so that sulfur content can be measured by titration . the sulfur content is suitably about 0 . 4 % to 1 %, and is typically found to be of the order of 0 . 7 %, by dry weight , of the solid , a measurement confirmed by elemental analysis . the salt forms of the liquid crystal can be obtained by neutralization with naoh , koh , etc . the ionic strength of the preparation can be adjusted by addition of electrolyte , but the suspension will precipitate or form a gel above a certain concentration ( a salting - out effect ), for example , at about 0 . 05m nacl . transmission electron microscopy of the colloidal suspension reveals that it is composed of rod - like crystalline fragments ranging in length from about 25 nm to 500 nm , preferably about 100 nm to 200 nm , more preferably about 100 nm ; and about 3 nm to 20 nm , preferably about 4 nm to 6 nm , more preferably about 5 nm wide . electron diffraction shows that the crystallites have retained the native cellulose i structure found in the starting material . if the colloidal suspension is allowed to dry , on a support surface , for instance in a petri dish at room temperature , it will form a solid in which the order of the liquid crystal has been preserved . this is revealed by microscopic analysis of the sample and by its optical properties , which are those of a liquid crystal . the preserved chiral nematic structure is found to be preferentially planar , i . e ., with the long axis of the crystallites preferentially parallel to the substrate on which the film was dried . when the pitch of the dried film is of the order of visible light divided by the mean index of refraction of the cellulose ( 1 . 55 ), about 0 . 25 μm to 0 . 6 μm , it appears coloured and the colours change with the angle of viewing . the reflected light is left - circular polarized as expected from a left - handed helicoid . different preparations will give different colours ; longer hydrolysis time , finer mesh , and sources of cellulose with smaller crystal width , for example , wood rather than cotton , will tend to give helicoids with shorter pitches and hence reflecting shorter wavelengths . the crystallite dimensions useful for preparing coloured films range , depending on the source , in width from 3 to 20 nm , preferably 5 nm and in length from 20 to 500 nm , preferably 100 nm . the final reflection band of a solid film obtained from a given preparation can be tuned within a spectrum spanning the near infrared to the ultraviolet . this can be done in several ways . a first is to change the ionic strength by adding an electrolyte such as nacl or kcl ; this will shift the colour towards the blue . another way of achieving the same result is to desulfate the preparation by heating it , ( de - esterification occurs more easily for the acid form ), and removing the freed acid before drying . a third approach to control the final pitch is to fractionate the preparation to obtain suspensions with shorter or longer average crystalline lengths . this can be achieved by fractional precipitation or simply by phase separation , since longer crystallite rods will tend to form the liquid - crystalline phase at lower concentrations than the small fragments . films dried from colloidal dispersions with crystallites of longer average lengths will be shifted towards the red , whereas those with shorter average lengths will be shifted towards the blue . the planar orientation of the films can be almost perfect if the drying is done in a strong magnetic field , above 2 t , which is perpendicular to the drying surface . this , however , is not necessary , as all drying substrates , be they glass , polyethylene , polystyrene , paper , etc ., yield a film with quasi - planar helicoidal texture . the adherence of the film on these substrates can be very poor , as for teflon ( trade mark for a polytetrafluoroethylene ), or very good , as for paper and glass . of course , as for other translucent reflective interference devices , the colour of the underlying substrate affects the perceived colour of the film . a black ( light - absorbing ) background gives a saturated reflection colour , whereas a white background gives a variable mixture of the transmitted ( complementary ) colour and the reflected colour . the effects that can be achieved by underlying patterns or shapes of various colours are similar to those possible with thin - layer interference devices . in addition to being optically variable , i . e ., reflecting different colours for different viewing angles , the new materials reflect left - circular polarized light of the wavelength equal to their pitch multiplied by the mean refractive index of the material without changing its handedness . this makes them easily and cheaply distinguishable from all other optically variable materials which are not helicoidal and thus reflect circular - polarized light with its handedness reversed . these non - helicoid materials will appear dull or black when illuminated and viewed through a right - circular analyzer , composed of a polarizer and of a sheet of oriented birefringent material , e . g ., polyethylene , of the proper thickness . the &# 34 ; solidified liquid crystals &# 34 ; will appear even more brightly coloured when viewed with the same simple apparatus . another exceptional feature of the films is that they can be made to swell again and redisperse in suspension , or be rendered stable and not reswellable , or be made to swell only partially while keeping the structure intact . this last possibility leads to another distinctive optical characteristic of the materials . a film which in the dry state appears blue may change to a green , yellow or red when in the wet state . this occurs because the pitch of the material is larger in the swollen state ; when the material is allowed to dry again the original colour reappears . the transition is always to longer wavelengths when the pitch is enlarged , so that transitions from an invisible ultraviolet to blue , or from yellow to red , or from red to an invisible infrared are possible . these partially reswellable films can be obtained by heating the dried helicoids in order to remove the sulfate groups to a degree such that it allows the crystallites composing them to bond to each other strongly enough that they do not allow penetration of water between layers . yet another exceptional feature of the films is that they can be composite films with better strength , flexibility and other desirable qualities than the purely cellulosic films . many materials , such as plasticizers , polymer resins , or reinforcing agents ( woven or non - woven fibers of glass , carbon , wood , etc .) can be added to the dispersion without hindering the formation of the helicoidal structures . for instance , a plasticizer such as glycerol will make the films more pliable ; a water soluble resin , such as a melamine resin will have the same effect , as well as a strengthening effect . such a resin may or may not be cross - linked to the crystallites . the invention also extends to man - made solidified liquid crystal films of rod - like particles of colloidal dimensions ( not molecules ) in a helicoidal ( chiral nematic ) arrangement exhibiting a chiral nematic pitch of about 0 . 1 μm to 1 μm ; said films reflecting circular polarized light over a spectrum from ultraviolet to near - infrared . in the examples of the invention , cellulose crystallites are the rod - like particles . the invention is , however , not limited to cellulose crystallites solely . any other rod - like particles of colloidal dimensions which are suspended in a liquid and which are colloidally stable ( non - flocculating ) will also self - assemble into ordered phases ( liquid crystals ) above a critical concentration . if a chiral interaction exists between the rods , be the said chiral interaction due to the rod geometry , to functional groups at the surface of the rods , to the liquid medium , or to the presence of any chiral agent in the liquid medium etc ., the liquid crystal will adopt a chiral nematic arrangement . if the length and the width of the rods are appropriate , a solidified liquid crystal film comprising the rod - like particles arranged in a chiral nematic fashion and exhibiting a chiral nematic pitch of about 0 . 1 μm to 1 μm could be produced ; such film will have the same optically variable properties as the films in the following examples . as long as a suspension of cellulose crystallites remains stable ( non - flocculating ) in water or another liquid vehicle , be the colloidal stability due to charged groups at the surface of the crystallites ( such as sulfates , phosphates , nitrates , etc . ), or to said chains attached to the crystallites , or to a stabilizing agent in the liquid vehicle , self - assemblies into liquid crystalline phases will be obtained above critical concentrations . if the chiral interaction between the rods is not hindered by the presence of the side chains or the stabilizing agent molecules , a chiral nematic arrangement will result in the liquid crystalline phases , and solidified liquid crystal film of cellulose with the same optically variable properties as those of the films given as examples in the present invention will be obtained . the films of the invention may be employed in articles , for example , the film may be supported on a substrate , especially a planar substrate such as paper , or may be embedded in a substrate , particularly to form a planar article ; in the latter case the article may take the form of small discs of the film embedded in the substrate , for example , paper , such embedded discs are known in the security papers industry as planchettes . data may be incorporated in the article , and for this purpose may , for example , be incorporated in or as a substrate , such as paper , on which the film is supported , or may be incorporated in a polymer sheet in which the film is embedded ; the data may also be incorporated in an additive which is incorporated in the film , such addition having been incorporated in the dispersion from which the film is formed . fig1 illustrates schematically helicoidal orientation in typical chiral nematic liquid crystals . with further reference to fig1 the short lines represent a helicoidally oriented substance . in prior art chiral nematic liquid crystals the short lines represent molecules of the substance , or fragments of such molecules . in contrast , in the chiral nematic liquid crystals of the invention the short lines are not molecules or fragments of molecules , but are crystallites of colloidal dimensions . the distance from top to bottom in the liquid crystal structure , schematically illustrated in fig1 is p / 2 , where p is the pitch of the chiral nematic structure . dissolving pulp from rauma repola , ref . 83120 ( a commercial pulp sample ), is milled in a wiley mill to pass a 40 mesh screen . 8 g of this milled pulp is added to 60 ml of h 2 so 4 at 60 % w / w . the mixture is hydrolyzed for 50 minutes in a 70 ° c . oven with stirring every 5 minutes . the reaction is stopped by diluting & gt ; 10 - fold with distilled water . the acid is removed , first by centrifuging and washing to ph ≈ 1 and then by dialysis . the product , a gel , is then sonicated in ≈ 10 ml aliquots for 2 minutes with a branson 350 cell disruptor . to the resulting liquid is added mixed - bed ion - exchange resin to remove all remaining free electrolyte . after the resin is removed , the mixture is a liquid suspension ( 4 . 09 % w / w ) of sulfated ( 0 . 73 % s w / w of solid ) cellulose microcrystals . this suspension phase - separates to give a cholesteric liquid crystal . when the anisotropic phase is placed in a glass petri dish and allowed to dry overnight in a vertical 7t magnetic field , the result is a film which is almost transparent when viewed at a 90 ° angle , but which takes on a red to bronze colour when viewed at progressively smaller angles . spectrophotometry reveals that the reflection at 90 ° is a very broad peak centered at 830 nm . the reflected light is left - circular polarized . fully bleached kraft pulp from 100 % black spruce is milled to pass a 100 mesh screen . it is hydrolyzed in 60 % h 2 so 4 at 60 ° c . for 20 minutes . it is then washed , dialyzed , sonicated and polished as in example 1 . it is then made into the salt form by adding naoh to an alkaline ph and dialyzing against neutral water . the resulting product has a ph of about 4 and is thus a mixture of the salt and acid forms . the concentration of the suspension is 3 . 85 % w / w , which is in the range in which phase separation occurs . the top , isotropic fraction is collected . when dried on a teflon surface in a vertical 7t magnetic field , this fractionated sample gives a solid film which appears deep red when viewed at 90 ° and yellow to green at sharper angles . when viewed with transmitted light it appears blue - green , which is the expected complementary colour . the reflection peak at 90 ° is a broad peak centered at 628 nm . the sample has the optical properties of liquid crystals . to 9 . 5 g of the suspension described in the previous example is added 0 . 5 g of 0 . 001m nacl . the mixture is then briefly sonicated and poured in a polystyrene petri dish which is placed in a vertical 7t magnetic field . the resulting dried film is very different from the one described above . when viewed at 90 ° it appears golden and at sharper angles it appears green and then blue . the complementary colours are seen in transmitted light viewing . the reflection peak is very broad and reaches a maximum at ≈ 580 nm . when the same sample described in example 2 is allowed to dry on the top and bottom surfaces of the disk of black paper , the result is a vividly coloured paper which is blue on top and golden on the bottom . the intensity of the colours is due to the fact that the background is black . the difference in colouration of the two sides is due to further fractionation which occurred during drying . when placed in water the colours of the film shift towards the red and then disappear . the film can then be redispersed by mechanical treatment or by ultrasounds . parts of this film - coated paper were placed in an 80 ° c . oven for 16 hours . this did not change the aspect of the film but affected its swelling properties . when wet , the colour on top changes from blue to gold and that on the bottom changes from gold to red , but the shift goes no further , even when left in water for a prolonged time . the film regains its original colours when dried . a new preparation of liquid crystals was made under the same conditions as described in example 2 , but this time the suspension is not fractionated . the preparation was then slowly desulfated to varying degrees by heating at 70 ° c . the sulfur content was then measured by titration and ≈ 3 ml of each of four preparations were allowed to dry on glass slides . the results were as follows : ______________________________________sulfur content colour of dried (% w / w solid ) film______________________________________0 . 89 none ( ir ) to red ( angled ) 0 . 74 red to gold0 . 69 orange to green0 . 61 gold to blue______________________________________ a new preparation was made , again under the same conditions as in example 2 , but the preparation was not fractionated . to four aliquots of the resulting suspension in its acid form , each containing 0 . 1 g of cellulose crystallites , are added 0 . 2 ml of a 0 . 01m nacl solution . the first of these is allowed to dry in a polystyrene petri dish and yields a brittle film with a peak absorbance at 640 nm . to the other three aliquots are added 0 . 1 , 0 . 2 and 0 . 4 ml of a 2 . 5 % w / v solution of glycerol and they are then also dried in petri dishes . they yield films with peak absorbances at 710 , 730 and 840 nm respectively , which are much more supple than the film without glycerol . glycerol does not prevent the formation of the helicoidal structure and acts as a plasticizer while increasing slightly the peak absorbance wavelength . addition of more salt can compensate this effect . thus a film prepared with 0 . 1 g of cellulose , 0 . 3 ml of 0 . 01m nacl and 0 . 5 ml of 2 . 5 % w / v glycerol has a peak absorbance of 670 nm . this is close to the 640 nm of the original film without glycerol , yet this new film is much less brittle . to each of three aliquots of the suspension described in example 6 , each containing 0 . 1 g of cellulose , are added 0 . 4 ml of 0 . 01 m nacl . a solution of 3 . 5 % nanoplast ( a registered trade mark for a water - soluble melamine resin used for embedding samples for microscopy ) is then added to the samples ; 0 . 1 ml to the first , 0 . 2 ml to the second and 0 . 3 ml to the third . they are then dried in petri dishes . the films obtained are , as for glycerol in example 6 , more supple than films to which no resin is added . a shift in peak absorbances occurs , but this time it brings them into the ultraviolet region , rather than towards the infrared as it did for glycerol . this can be compensated for by diminishing the amount of salt added . the melamine monomers seem to have polymerized , probably due to the catalytic effect of the acid groups present on the crystallite surface . this is indicated by the fact that swelling of the composite films in water is much more limited than for films without polymer . thus a composite film comprising a melamine resin and cellulose crystallites can be made without hindering the formation of the helicoidal structure . | 2 |
referring initially to fig1 a rotary engine 11 , typically of the wankel type , is shown including a plurality of trochoidal combustion chambers 13 and a plurality of eccentrically rotated rotors 15 . each of the combustion chambers 13 is connected through an inlet conduit 17 to one or more barrels of a carburetor 19 . the present invention assumes the use of plural rotors 15 operating in plural combustion chambers 13 , and assumes further that the intake conduit 17 comprises plural conduits , each conduit supplying one or more combustion chamber 13 with fuel mixed with air , and each connected to independent barrels within the carburetor 19 . it will be understood that each of the rotors 15 creates a vacuum within its respective combustion chamber 13 during the intake cycle , generating a vacuum in its respective inlet conduit 17 , causing air and fuel to be mixed within the carburetor 19 in proper proportions to support combustion . referring now to fig2 the details of construction of the carburetor 19 of the present invention will be described . in this instance , the carburetor includes at least one manually controlled barrel 21 connected to a first intake conduit 17 ( manually controlled conduit ) of a first group of rotors and a second vacuum controlled barrel 23 connected to a second intake conduit 17 ( vacuum controlled conduit ) for supplying fuel and air to a second group of rotors 13 . each of the barrels 21 and 23 is constructed to provide a venturi passage 25 for increasing the velocity and thereby decreasing the pressure of airflow at this point in the carburetor . a main fuel jet 27 communicates with the barrel 21 at the venturi 25 to supply fuel to the manually controlled barrel 21 . similarly , a main fuel jet 29 communicates with the venturi 25 of the barrel 23 . the main jet 27 communicates through a metering orifice 31 with a fuel reservoir 33 . this fuel reservoir 33 , in a typical construction , is supplied fuel from a fuel pump ( not shown ) through a needle valve 35 which includes a needle 37 opened and closed by a float 39 to maintain the reservoir 33 filled with fuel at a predetermined level at all times . a similar needle valve 41 , needle 43 and float 45 maintains the level of fuel in a fuel reservoir 47 used to supply fuel to the main jet 29 of the barrel 23 . in addition , fuel is supplied to an idling jet 49 through the metering orifice 31 from the reservoir 33 to provide fuel for idling within the carburetor barrel 21 . a similar idling jet 51 is connected to the main jet 29 to provide idling fuel for the vacuum controlled barrel 23 . a pair of throttle valves 53 and 55 control the flow of air through the respective carburetor barrels 21 and 23 to control the flow of fuel and air into the respective combustion chambers 13 . the throttle valve 53 in the manually controlled barrel 21 is directly controlled by a mechanical linkage 57 connected to the accelerator pedal in the vehicle being driven . the throttle valve 55 is controlled in accordance with the vacuum in the intake manifold connected to the manually controlled barrel 21 in a manner which will be described in detail below . while in an unmodified carburetor , fuel flow to the main jet 29 and idle jet 51 will be controlled through a metering orifice similar to the orifice 31 , a modification is made according to the present invention to replace the metering orifice with a tubular fitting 59 which is rigidly secured , as by threading , into the wall of the fuel reservoir 47 . this fitting includes a tubular extension 61 which supports a conduit 63 , preferably made of resilient material of smaller diameter of the tubular extensions 61 such that the conduit 63 fits snugly over the tubular extension 61 to provide a fuel - tight connection . the conduit 63 is similarly connected to a tubular fitting 65 which is threaded through the exterior wall 67 of the fuel reservoir 47 at a position directly opposite the fitting 59 to provide a conduit for the flow of fuel to the fitting 59 from outside the carburetor 19 . a second conduit 69 , preferably of resilient polymeric material , is connected between the fitting 65 and a vacuum actuated fuel control valve 71 . as will be described in more detail below , the fuel control valve 71 is in fluid communication with fuel within the fuel reservoir 47 and supplies fuel from the reservoir 47 to the conduit 69 and thus to the fitting 59 and jets 29 and 51 in response to the vacuum in a vacuum sensing line 73 . when a relatively high vacuum is present in the conduit 73 , the valve 71 closes to prohibit flow of fuel from the fuel reservoir 47 into the conduit 69 . when the vacuum in the conduit 73 is reduced to a predetermined level , that is , the pressure within the sensing line 73 is increased , the valve 71 will open to admit fuel from the reservoir 47 to the jets 29 and 51 . the vacuum sensing line 73 is connected to a port 75 which opens at the off - idle position into the manually controlled barrel 21 . as used in this application , the off - idle position is a position upstream of the throttle valve 53 . when the throttle valve 53 is opened a substantial distance , the vacuum at the off - idle port 75 will be substantially the same as the vacuum within the intake conduit 17 leading to the manually controlled bank of rotors 15 , so that the port 75 will monitor engine demand . as the load on the engine increases in response to increased engine demand , the vacuum in the manually controlled intake conduit 17 will decrease , leading to a vacuum decrease in the conduit 73 and a resultant opening of the valve 71 to admit fuel to the jets 29 and 51 to permit operation of the vacuum controlled rotors connected to the barrel 23 . when the vacuum within the intake conduit 17 connected to the manually controlled rotors 15 and barrel 21 increases , as would occur , for example , at cruising speeds when engine demand is relatively low , the vacuum in the conduit 73 will increase accordingly , the vacuum at the port 75 being only slightly less than the vacuum in the intake conduit 17 , so that the valve 71 will close to prohibit the passage of fuel from the reservoir 47 to the jets 29 and 51 . this eliminates combustion in the vacuum controlled bank of combustion chambers 13 connected to the vacuum controlled barrel 23 so that only a portion of the rotors 15 are used to meet this relatively low engine demand . when the engine is idling , the throttle valves 53 and 55 are closed and fuel for idling is supplied through the idle jets 49 and 51 . lack of airflow through the venturi 25 eliminates the vacuum in the main jets 27 and 29 so that no fuel flows through the main jets . a vacuum is created , however , at the idle jets 49 and 51 in direct response to rotation of the rotors 15 , so that fuel is drawn through these idle jets 49 and 51 . by placing the vacuum port 75 at the off - idle position upstream of the throttle valve 53 , a relatively low vacuum will exist within the vacuum sensing line 73 when these idle conditions exist , since the vacuum port 75 is in direct communication with atmospheric pressure through the barrel 21 . this atmospheric pressure will cause the vacuum control valve 71 to open so that fuel is supplied to the idling jet 51 through the conduit 69 . thus , whenever the throttle valve 53 is completely closed , as at idle , the vacuum control valve 71 will operate in a manner identical to its operation at peak engine demand to supply fuel to the vacuum controlled barrel 23 . it will be understood by those skilled in the art that air for idling to be mixed with the fuel from the idle jets 49 and 51 is supplied by apertures through the carburetor which are not shown in fig2 . the details of the vacuum actuated fuel control valve 71 will be explained in reference to fig3 . as previously explained , this valve 71 passes through the wall 67 of the fuel reservoir 47 to control the flow of fuel between the fuel reservoir 47 and a flexible conduit 69 . the main body of the valve 71 is formed as an externally threaded tubular member 77 which is conveniently threaded through an aperture 79 in the wall 67 . the tubular member 77 includes a flange 81 of enlarged diameter which includes a hollow cavity 83 . an annular groove 85 surrounding the recess 83 supports a perimeter of a resilient diaphragm 87 which is sealed within the annular groove 85 . the exterior of the hollow cavity 83 is sealed by a flange 89 which is attached by any suitable means to the flange 81 . the flange 89 includes an extending tubular portion 91 which provides communication to the interior of the cavity 83 and support for the resilient vacuum sensing line 73 . the resilient diaphragm 87 includes a circular central aperture 93 which mounts one end of a reciprocating valve stem 95 . the valve stem is attached and sealed to the aperture 93 by any convenient means . the opposite end of the valve stem 95 is mounted on the tubular member 77 by means of a compression spring 97 which bears against a head 99 on the valve stem 95 and an internal annular shoulder 101 at one extremity of the tubular member 77 . the spring 97 biases the valve stem 95 to the right , as viewed in fig3 . a valve seat 103 is formed within the tubular member 77 and designed to interengage with a valve surface 105 formed as a protruding annular shoulder around the valve stem 95 . the spring 97 thus biases the valve stem 95 to the right , as viewed in fig3 so that the valve 105 is biased to an open position . when a predetermined vacuum exists within the vacuum sensing line 73 , a pressure differential is generated across the flexible diaphragm 87 which is sufficient to overcome the bias of the spring 97 , such that the valve stem 95 moves to the left , as viewed in fig3 engaging the valve surface 105 and valve seat 103 . a tubular member 107 is attached , as by threading , through the wall of the tubular member 77 outside of the wall 67 of the fuel reservoir 47 . this member 107 communicates with the interior of the tubular member 77 and supports the fuel supply conduit 69 . this fuel supply conduit 69 , as previously explained , communicates with the jets 29 and 51 of the vacuum control barrel 23 within the carburetor . the control valve 71 permits fluid flow between the fuel reservoir 47 and the jets 29 and 51 through the tubular member 77 when a relatively low vacuum is present on the vacuum sensing line 73 , so that the vacuum controlled rotors within the engine will be supplied with fuel . when the vacuum within the sensing line 73 is relatively high , however , the valve 71 will close , prohibiting fuel flow through the tubular member 77 , and thus from the fuel reservoir 47 to the vacuum controlled barrel 23 . referring once again to fig2 it should be noted that , once the vacuum actuated fuel control valve 71 has closed in response to increased vacuum at the off - idle vacuum port 75 , as would occur during vehicle cruising , for example , or any low power demand engine characteristic other than idling , all fuel flow to the jets 29 and 51 is discontinued , since both the main jet 29 and the idle jet 51 are controlled . thus , when the vacuum controlled barrel 23 is deactivated , sporadic engine firing cannot occur as would be the case , for example , if the idle jet 51 were not properly controlled . this control of both jets therefore eliminates misfiring in the controlled rotor bank and thus eliminates a possible cause of undesirable exhaust emissions from the engine . in further reference to fig2 the mechanism for controlling the flow of lubricating oil to the carburetor barrels 21 and 23 and thus to the engine rotors 15 will be described . as has been previously noted and will be described in more detail below , the throttle valve 53 is manually controlled through rotation of a shaft 107 by a linkage 57 connected to the accelerator pedal in the vehicle . in order to operate the throttle valve 55 independently of the throttle valve 53 , the throttle valve 55 is mounted on an independent rotating shaft 109 . each of the shafts 107 and 109 are conveniently rotatably mounted in a throttle housing 111 mounted by any convenient means to the main carburetor housing 113 and engine 11 . in order to provide lubrication for the rotors 15 , a pair of oil inlet ports 115 and 117 communicate with carburetor barrels 21 and 23 and are in communication with an oil pressure line 119 which is connected to an oil valve 121 . the oil valve 121 , conduit 119 and ports 115 and 117 are standard on rotary engines , as is an oil pump 123 which supplies oil under pressure to the lubricating system . the oil valve 121 is designed to control the flow of oil to the ports 115 and 117 in accordance with the throttle valve opening . thus , by using the throttle valve position , the amount of lubricant supplied to the ports 115 and 117 can be made to increase in response to both the rate of rotation of the rotary engine and engine load . in a typical carburetor configuration the oil valve 121 is controlled from the rotating shaft 109 rather than the rotating shaft 107 . in the modification of the present invention , the oil control valve 121 is connected directly , as through a linkage 125 , to an eccentric member 127 connected to the rotating shaft 107 . this eccentric 127 is connected in turn to the accelerator linkage 57 so that the oil valve 101 always operates in conjunction with the accelerator linkage 57 and the throttle 53 of the barrel 21 . as will be explained in detail below , under some circumstances the throttle valve 53 will be open while the throttle valve 55 will be closed . it has been found advantageous to supply oil through both of the ports 115 and 117 under these conditions , since the rotor 13 connected to the carburetor barrel 23 must receive increased oil quantities with increased rotational rates , regardless of whether combustion occurs in this combustion chamber . the modification of attaching the linkage 125 directly to the eccentric 127 accomplishes this result . referring now to fig4 and 5 , the mechanism for operating the throttle valve 53 and 55 will be explained . as previously noted , the throttle valve 53 is rigidly connected to a rotating shaft 107 which is mounted for rotation within the throttle housing 111 . the throttle valve plate 55 is likewise rigidly connected for rotation with a rotating shaft 109 mounted in the throttle housing 111 . the shafts 107 and 109 are interconnected through respective segmented ends 129 and 131 , the operation of which will be described in detail below . as is common in many carburetor configurations , each of the pair of inlet conduits of the intake manifold 17 is connected to a pair of barrels for changing the carburetor mixture in response to engine demand . thus , the first inlet conduit 17 which is connected to the carburetor barrel 21 is additionally in communication with a secondary carburetor barrel 133 . likewise , the second intake conduit 17 which is in communication with the carburetor barrel 23 is additionally in communication with a secondary carburetor barrel 135 . the carburetor barrels 133 and 135 are controlled by a pair of throttle valves 137 and 139 , respectively , each of which is rigidly mounted on a single rotating throttle control shaft 141 supported within the throttle housing 111 . the secondary throttle valves 137 and 139 are controlled by means of an eccentric 143 rigidly connected to the rotating shaft 141 . a tension spring 145 is mounted on the engine or carburetor housing to bias the eccentric 143 to open the throttle valves 137 and 139 . a pin 147 which connects the tension spring 145 to the eccentric 143 is additionally connected by means of an actuating arm 149 to a vacuum transducer 151 . this vacuum transducer 151 operates in response to vacuum supplied by a vacuum line 153 which terminates in a vacuum sensing port 155 positioned downstream of the throttle valve 55 in the carburetor barrel 23 . as engine demand decreases , the vacuum at the sensing port 155 increases , actuating the transducer 151 to rotate the rod 141 to close the throttle valves 137 and 139 , overcoming the bias of the tension spring 145 . the carburetor barrels 133 and 135 therefore operate in response to peak engine demand as sensed by a low vacuum at the vacuum port 155 to supply additional fuel and air to the pair of intake conduits 17 . in addition to this control of the secondary throttle valves 137 and 139 which is typically included in four barrel carburetors , a vacuum control is provided for operating the throttle valve 55 in the carburetor barrel 23 independent of the throttle valve 53 . in a manner similar to the vacuum control for the rod 141 , a tension spring 157 is connected to an eccentric 159 through a pin 161 . the tension spring 157 urges the eccentric 159 and its attached rotating rod 109 in a direction which tends to open the throttle valve 55 . a vacuum transducer 163 is connected through a linkage 165 to the pin 161 and is additionally connected to a vacuum line 167 which terminates in a port 169 positioned downstream of the throttle valve 53 . the port 169 is subjected to a relatively high vacuum when the engine is operating at low demand , so that the transducer 163 holds the throttle valve 55 closed . however , as engine demand increases , the vacuum downstream of the throttle valve 53 within the carburetor barrel 21 decreases , deactuating the transducer 163 to permit the spring 157 to rotate the rod 109 and throttle valve 55 to an open configuration as shown in fig4 . the segmented ends 129 and 131 of the rotating rod 107 and 109 permit this independent rotation of the throttle valves 53 and 55 within certain limitations . referring specifically to fig5 it will be noted that the segmented portion 129 of the manually controlled rotating rod 107 is formed as a semicircle , while the segmented portion 131 of the vacuum control rod 109 is formed as a smaller segment of a circle . as the rod 107 rotates in response to depression of the accelerator pedal and motion of the accelerator linkage 57 , the segmented end 129 rotates in the direction a shown in fig5 such that a first abutting surface 171 of the segmented portion 129 rotates away from a first abutting surface 173 of the segmented portion 131 . the segmented portion 131 can thus remain stationary as the segmented portion 129 rotates , permitting the throttle valve 53 to open while the throttle valve 55 remains closed . once the throttle valve 53 has opened to a predetermined degree , a second abutting surface 175 on the segmented portion 129 will contact a second abutting surface 177 on the segmented portion 131 to assure that , when the throttle valve 53 is opened to its fullest extent , the throttle valve 55 will be manually opened by engagement of the surfaces 175 and 177 to a slight degree . this operation assures that the throttle valve 55 cannot become lodged in the carburetor barrel 23 to a sufficient extent that the spring 157 cannot rotate the throttle valve 55 , without intermittently being dislodged manually when the throttle valve 53 is opened completely . similarly , abutment of the surfaces 173 and 171 assures that , when the engine is idling , that is , when the throttle valve 53 is completely closed , engagement of the segmented portions 129 and 131 will assure that the throttle valve 55 is likewise completely closed . this latter abutment therefore overcomes the operation of the spring 157 and transducer 163 under idle conditions . operation of the rotary engine 11 and the carburetor 19 described in reference to fig1 through 5 will now be explained . when the engine 11 is operating under relatively low power demand , such that the vacuum within the carburetor barrel 21 is relatively high and the throttle valve 53 is opened to some extent by the accelerator linkage 57 , the vacuum at both of the sensing ports 75 and 169 will be relatively high . this high vacuum closes the vacuum control valve 71 to prohibit the flow of fuel from the fuel reservoir 47 to the main jet 29 and idle jet 51 of the carburetor barrel 23 . simultaneously , the relatively high vacuum at the vacuum sensing port 169 activates the vacuum transducer 163 to maintain the throttle valve 55 in the carburetor barrel 23 closed . simultaneously , a high vacuum is created in the carburetor barrel 23 downstream of the throttle valve 55 which is sensed at the vacuum sensing port 155 , activating the vacuum transducer 151 to maintain the throttle valves 139 and 137 of the barrels 135 and 133 closed . thus , under these conditions , only the throttle valve 53 is opened so that only the carburetor barrel 21 operates to supply fuel to only one of the intake conduits 17 , and only that portion of the multiple rotors 13 in communication with this inlet conduit 17 will operate to produce output power . this operation on only a portion of the engine rotors 15 efficiently produces power with reduced emissions at low engine demand . as increased engine demand is produced through further actuation of the accelerator linkage 57 , the throttle valve 53 will open to a greater degree . this greater opening of the throttle valve 53 decreases the vacuum within the carburetor barrel 21 so that a decreased vacuum is sensed at the port 169 and vacuum transducer 163 . in response to this decreasing vacuum , the vacuum transducer 163 becomes deactivated , permitting the tension spring 157 to open the throttle valve 55 to permit operation of the carburetor barrel 23 and the remaining inlet conduit 17 connected to the previously deactivated rotors 15 . simultaneously , the vacuum sensing port 75 monitors this decreasing vacuum to actuate the vacuum actuated fuel control valve 71 to open and supply fuel from the fuel reservoir 47 to the main jet 29 and idle jet 51 . fuel is thus supplied to the carburetor barrel 23 , and the throttle valve 55 is opened so that the remaining rotors are activated . in response to further increases in engine demand , the vacuum within the carburetor barrel 23 will be reduced to a greater extent such that the vacuum sensed at the port 155 will deactivate the vacuum transducer 151 permitting the tension spring 145 to open the throttle valves 137 and 139 . the carburetor barrels 135 and 133 are supplied with fuel from the fuel reservoirs 33 and 47 by conduits and jets ( not shown ) which are independent from the conduits and jets which supply the barrels 23 and 21 . thus , the remaining carburetor barrels 135 and 133 supply increased amounts of air and fuel to the pair of inlet conduits 17 to produce peak power required under these characteristics . when the accelerator linkage 57 is moved to an idle position , closing the throttle valve 53 , engagement of the segmented portions 129 and 131 of the rotating rods 107 and 109 will force the throttle valve 55 to a closed or idle position overcoming the tension spring 157 and vacuum transducer 163 . the vacuum sensing port 155 located downstream of the throttle valve 55 will monitor a relatively high vacuum under idling conditions such that the vacuum transducer 151 will maintain the throttle valves 139 and 137 in a closed position so that the barrels 135 and 133 do not operate . thus , at idle , each of the throttle valves 53 , 55 , 139 and 137 is closed . the vacuum sensing port 75 , being positioned above the throttle valve 53 , is disassociated from the vacuum within the barrel 21 below the throttle valve 53 and is thus subjected to atmospheric pressure . this causes the vacuum actuated fuel control valve 71 to open , admitting fuel to the conduit 69 . since there is no airflow through the venturi portion 25 of the carburetor barrel 23 , fuel will not flow through the main jet 29 . fuel will be drawn by the vacuum below the throttle valve 55 through the idle jet 51 to support idling combustion in the rotors 15 connected to the carburetor barrel 23 . thus , under idle conditions , all of the combustion chambers 13 will be supplied with fuel from the carburetor barrels 21 and 23 so that normal idling characteristics are achieved . it should be recognized that , through a variation in the spring constant or pretension of the springs 157 and 145 the vacuum level at which the throttle valves 55 , 139 and 137 can be operated may be varied . similarly , through a variation in the spring constant or pretension of spring 97 in the vacuum control valve 71 , the vacuum at which the control valve 71 will close to prohibit fuel flow to the barrel 23 may be varied . thus , the spring tensions may be varied to produce a gradual transition from operation on one bank of rotors to both banks of rotors at a preselected engine demand and to then undergo a second transition at even more increased engine demand through the opening of the throttle valves 137 and 139 . in addition , it has been found advantageous to adjust the relative operating vacuums of the valve 71 and throttle valve 55 such that the valve 71 operates at a lower vacuum level . thus , as the vacuum decreases in the barrel 21 , the throttle valve 55 will initially close to eliminate flow of air to the secondary bank of rotors except through the idle jet 51 . sporadic combustion will not occur under these conditions and it is possible then to interrupt the fuel altogether through a closing of the fuel control valve 71 . if this operation were reversed , such that upon decreasing vacuum in the carburetor barrel 21 the vacuum actuated fuel control valve 71 closed prior to the closure of the throttle valve 55 , fuel left in the conduit between the main jet 29 and idle jet 21 would be sucked out of the main jet 29 to cause sporadic firing of the engine which would generate high emissions and uneven engine performance . the lubrication system which has been disclosed , wherein the rotors are lubricated regardless of whether fuel is admitted by controlling the oil valve from the accelerator linkage directly pg , 20 assures that the modification to the rotary engine resulting in a splitting of the rotors does not change the engine life . in addition , it should be understood that the amounts of oil normally admitted to a rotary engine combustion chamber are so small that no substantial oil buildup will occur in the deactivated rotor during cruising . | 5 |
at the beginning of this document , i identified four attributes that were needed by an error - correcting resilience assembly , which i see as the “ missing link ” in the defenses of conventional systems , as reviewed in the preceding section . the basic error - correcting assembly , considered alone , is not the present invention ; rather , the invention here goes beyond the basic error - correcting assembly . that basic assembly , however , will be introduced first — in this section and sections 2 and 3 below . the basic error - correcting assembly should be generic , transparent to client software , compatible with defenses used by the client , and fully self - protected . it appears that an all - hardware assembly is most likely to meet those goals , since stored programs do not need to be protected . the assembly needs nonvolatile storage for record - keeping and rom microcode for sequencing operations . one way to appreciate the requirements and characteristics of my proposed error - controlling assembly is to analogize it to the immune system of the human body . to develop this reasoning , i use the following three analogies : 3 . the immune system is analogous to my novel error - controlling assembly , or resilience support architecture . 1 . it functions ( i . e ., detects and reacts to threats ) continuously and autonomously , independently of consciousness . 2 . its elements ( lymph nodes , other lymphoid organs , lymphocytes ) are distributed throughout the body , serving all its organs . 3 . it has its own communication links — the network of lymphatic vessels . 4 . its elements ( cells , organs , and vessels ) themselves are self - defended , redundant and in several cases diverse . now i can identify the properties that the error - controlling assembly must have in order to justify the immune - system analogy . they are as follows . 1b . the assembly is independent of ( requires no support from ) any software of the client platform , but can communicate with it . 1c . the assembly supports ( provides protected decision algorithms for ) multichannel computing of the client platform , including diverse hardware and software channels to provide design - fault tolerance for the client platform . 2 . the assembly is compatible with ( i . e ., protects ) a wide range of client platform components , including processors , memories , supporting chipsets , discs , power supplies , fans and various peripherals . 3 . elements of the assembly are distributed throughout the client platform and are interconnected by their own autonomous communication links . 4 . the error - controlling assembly is fully resilient itself , requiring no external support . it is not susceptible to attacks by intrusion or malicious software and is not affected by natural or design faults of the client platform . a different and independently devised analogy of the immune system is the “ artificial immune system ” ( ais ) of s . forrest and s . a . hofmeyr . its origins are in computer security research , where the motivating objective was protection against illegal intrusions . the analogy of the body is a local - area broadcast network , and the ais protects it by detecting connections that are not normally observed on the lan . immune responses are not included in the model of the ais , while they are the essence of my assembly . the unit error - correcting assembly is a system composed of four types of special - purpose controllers , modules 42 through 46 , 21 through 24 ( fig1 ). these modules are asics ( application - specific integrated circuits ) that are controlled by hard - wired sequencers or by read - only microcode . this assembly of correction modules serves and protects a primary - function module 41 that is essentially a conventional computing block such as a standard processor . the primary - function module 41 is a client system , in the sense that it this module that performs the computing work which the entire computing system exists to perform . in some of the appended claims , this protected conventional computing block 41 is treated as part of my invention itself , and in other claims it is instead treated as a part of the context or environment of my invention . redundant nodes ( not shown ) are provided for fault tolerance of the fti itself . one interface module 42 is provided for each primary - function module 41 . all error - signal outputs 32 and recovery - command inputs 33 of the primary - function module 41 are connected through its interface module 42 . within the assembly 42 - 46 , 21 - 24 , all interface modules 42 are connected to one errors / corrections cache module 44 via the errors / corrections bus 34 . each interface module also has a direct input ( the error - alert pin 45 ) to the errors / responses cache 44 . an interface module 42 conveys primary - function module error messages 32 to the errors / responses cache 44 . it also receive recovery commands 33 from the errors / responses cache 44 and issues them to the primary - function module 41 inputs . the error - alert pin 45 serves to request errors / corrections cache 44 attention for an incoming error message 32 on the errors / responses bus 34 . the cache module 44 stores in rom all error signals from every expected type of primary - function module 41 , and also all prepared responses to those known error types — as well as the sequences for its own recovery . the cache also stores system configuration and system time data , and its own activity records . as will be understood , the name “ cache ” for this module 44 is a slight simplification , since the cache 44 is not memory exclusively , but also performs associated logic functions . the cache 44 is also connected to the so - called “ hypothalamus ” module 46 . as will be seen , this module is named aptly in that it is one element of the assembly which never powers down completely , and it maintains function ( or nonfunction , as may be the case ) of all the other modules at a very fundamental level . more specifically , the functions of the hypothalamus 46 are to control power - on and power - off sequences for the entire system , to generate fault - tolerant clock signals and to provide nonvolatile , radiation - hardened storage for system time and configuration . the hypothalamus has a reserve electrical source ( a battery ) 23 and remains on at all times during the life of the error - controlling assembly 21 - 24 , 31 - 38 , 42 - 46 and the primary - function module 41 . the conflict - resolver module 43 provides resilient comparison and voting services for the other modules . if there are plural primary - function modules 41 , especially diverse processor types and perhaps operating multiversion software , then the resolver 43 includes decision algorithms for handling possibly divergent computation results from such diverse software or processors in the primary - function modules 41 . fast response of the resolver 43 is facilitated by hardware implementation of such algorithms . this same conflict - resolver module 43 also keeps a log of disagreements in the decisions . another function of the resolver 41 is to serve as a communication link between the software of the primary - function module or modules 41 and the cache 44 . primary - function modules 41 may request configuration and cache - activity data or send power - control commands , and some of these advantageously pass via the resolver 43 . the resolver 43 is linked by a built - in interface 42 to the cache 44 . another function of the resilient error - controlling assembly 21 - 24 , 31 - 38 , 42 - 46 is to provide resilient power management for the entire system , including individual command - resettable breakers ( essentially power switches ) for each primary - function module 41 . every module except the hypothalamus 46 has such a breaker . the upper - level modules of the assembly as a group have their own resilient operational electrical source 21 . the cache 44 and hypothalamus have a separate “ support ” source 22 . the partitioning of the error - correcting assembly is motivated by the need to make it resilient . the interface and resolver 42 , 43 are self - checking pairs , since high error - detection coverage is essential , while spare primary - function and resolver modules 41 , 43 can be provided for recovery under control of the error - response commands stored in the cache 44 . the cache 44 should be continuously available ; therefore the system advantageously uses triplication and voting ( tmr ), with spare cache modules added for longer life . the hypothalamus 46 manages cache replacement and also shuts the system down in case of catastrophic events ( temporary power loss , heavy radiation , etc .). the hypothalamus functions are advantageously protected by provision of two or more self - checking hypothalamus pairs ( not shown ), each with its own backup electrical source . in my development of this invention , i separated the hypothalamus from the cache to make the module that must survive catastrophic events as small as possible . the all - hardware implementation of the assembly makes it safe from software bugs and external attacks . the one exception is the power management command from the primary - function module 41 to the cache 44 ( via the resolver 43 ) which could be used to shut the system down . special protection is needed here . the adverse influence of any hardware design faults in the resilient assembly can be minimized by design diversity , both of self - checking pairs and of cache modules ; however , the logic of all the modules is very simple and their complete verification should be possible . when interconnected , the modules 42 - 46 , 21 - 24 of my assembly and the typically conventional primary - function module 41 form a computing system that is protected against most causes of system failure . this system is the first example of an implementation of the immune system paradigm . the use of the resilient support assembly is likely to be affordable for most computer systems , since the interface , cache , resolver and hypothalamus 42 , 44 , 43 46 have simple internal structure . some truly challenging missions can be justified only if their computers , together with my resilient assembly , have very high coverage as to design faults and as to catastrophic transients due to radiation . extensive sparing and efficient power management can also be provided by the resilient assembly . given that the mtbf of contemporary processor and memory chips is approaching 1000 years , missions that can be contemplated include the 1000 - day manned mission to mars with the dependability of a 10 - hour flight in a commercial airliner . another possibility is unmanned very - long - duration interstellar missions , using a fault - tolerant relay chain of modest - cost spacecraft — using my resilient assembly particularly as described in this document . one thrust of my error - controlling resilient assembly , described above , is to use hardware more extensively and more effectively than is done conventionally in providing resilience for very dependable high - performance platforms . my basic resilient - assembly invention , as set forth above , considered intel &# 39 ; s p6 family of processors and their supporting chipsets as the commercially available elements of the host platform . these elements were not designed to utilize my resilient assembly , which accordingly is introduced by a “ retrofit .” as noted earlier the basic , or unit , error - correcting assembly introduced just above — considered alone — is not itself the present invention . i shall now move on to describe preferred embodiments of the present invention . this invention is an extension of the basic resilient assembly . preferred embodiments incorporate the basic assembly into a hierarchical form , together with packaging of the entire hierarchical resilience support system into a single “ system on chip ” (“ soc ”). it is to be understood that the hierarchical configuration can be used without building the system as an soc . the two together , however , make the invention a particularly powerful combination . each primary - function module 1 a , 1 b . . . ( fig2 ) of the soc is provided with an interface 2 a , 2 b — similar to the interface 42 ( fig1 ) of the resolver 43 in the basic assembly . as mentioned earlier , use of resolver modules ( or interfaces , or both ) in my hierarchical assembly is by no means restricted to the upper - level modules that most directly protect and support primary - function computing systems . to the contrary , resolvers or interfaces , or both , provide a broad capability useful throughout preferred embodiments of my invention . for example they are advantageously used as well to compare , and make decisions about , results from any of the modules — e . g ., intermediate - or even lower - level caches — in my hierarchical system . not all protected activity begins at the first ( i . e . top ) level . for instance a monitor , or printer , or any number of other single replaceable items , may be found in a lower level — serving caches etc . in the lower tiers of either the primary apparatus hierarchy or my parallel protective hierarchical error - controlling system . cache modules 5 a , 5 b are separate blocks within the soc , and the errors / corrections bus 4 connects the cache modules , as a cluster , to each block of the soc that also has the individual error - alert pins 3 a , 3 b connected to the cache 5 a . the resolver 43 ( fig1 ) can also be replaced by a “ resolver port ” that is part of the soc block . the soc has a complete built - in basic resilient assembly , as described above . the hierarchical refinement of my resilient - assembly concept takes place as follows . the cache cluster 5 a of one soc 1 — i . e ., cache soc 4 — serves as the interface 42 ( fig1 ) of the soc , with respect to a lower - level cache cluster , cache board 8 that protects several soc packages located on the same board . this module cache board is a separate soc that serves as the interface 42 ( fig1 ) of the entire board — and is connected to every soc by the errors / corrections bus 7 for the board , as well as error - alert pins 6 a , 6 b from each soc . one chassis contains several boards and other subsystems : monitor , printer , hard disk , etc . each board has its cache board 8 serving as an interface 42 ( fig1 ) connected to a chassis - level cache cluster , cache chasis 12 . other subsystems of the chassis 9 also must be provided with interfaces 10 that are connected by error - alert pins 11 a , 11 b and the chassis errors / corrections bus 13 to the cache chassis , analogously to the boards . a further extension or refinement of the hierarchy applies to a group of chassis that yet again in turn has a cache cluster . the latter in turn is connected by an errors / corrections bus 14 of the chassis group and by individual error - alert pins 15 to all cache chassis modules 12 . a still - further refinement to a network of chassis groups is the next step . in some cases the provision of an errors / corrections bus and individual error - alert pins may be more difficult , especially if the chassis groups are widely separated physically . thus a hierarchical error - controlling system according to preferred embodiments of my invention has a nested kind of tiered structure . in this nested structure , each major element 2 a , 5 a or 8 in a given tier and of a certain type reports to and is controlled by a lower - level element 51 , 8 or 12 respectively , which is of that same certain type — but which controls a relatively large number ( i . e ., a plurality or preferably a multiplicity ) of like major elements 2 b , 5 b or 9 , respectively , in the given tier . more specifically the certain type of element is in the nature of a cache module 44 ( fig1 ). in preferred embodiments of my hierarchical system , however , that element type also performs the function of an interface 42 module for one or more elements in a higher tier . the hierarchical system of my present invention has important advantages , as compared with the unit error - controlling architecture introduced in section 2 above . these advantages particularly include very significant increases in practicality and effectiveness . it will be understood that just one single cache module 44 ( fig1 ) can serve for an entire chassis , but for best performance it would require interface 42 connections to virtually every chip and other device on the chassis . that in turn would call for many error - alert pins , and a potential excess of messages waiting for access to the error / corrections bus 34 . therefore a hierarchical structure is a more satisfactory solution . again , each board has its own cache cluster , and all of those report to a chassis - level cache group that watches for errors on all of the boards . the board cache group performs the role of the interface 12 for the entire board , and obeys commands received from the chassis cache cluster . as indicated above , the hierarchy can be extended further , based upon the same rationale . my novel hierarchical system is especially effective and advantageous if incorporated into a single “ system on chip ” or soc that itself includes several relatively large blocks — processors , memories , etc . that all fit on one package . therefore it makes sense to build in an error - controlling resilience support system for the soc . as it is built in , the overall arrangement has to be done during design — it cannot be retrofitted . every block now has an interface ( like interface 42 , fig1 ). the soc adds a cache cluster ( also designed as one soc block ) that serves as interface for the entire soc chip , and that communicates to the board - level cache group . the latter is most naturally a separate chip for the board . as a practical matter , error messages sent from the computing system to the hierarchical error - controlling system are of a sort that is very closely related to the kind of computing system in use , and its particular computing functions . likewise the corrective responses returned from the hierarchical error - control system to the computing system depend very specifically on the character and functions of the computing system . hence if the soc is intended to be generic , and to have many signal lines for connection to the computing system after manufacture of the soc , then preferably the soc includes a rom or prom section which can be filled ( or “ programmed ”, so to speak ) after manufacture of the rest of the soc . this arrangement customizes the soc to those computing functions and character — or in other words supplies the particular error messages and corrective responses required by the computing system . my new hierarchical system is suitable for future commercial processors as well as other commercial chips . they should accordingly be provided with an interface module . for present commercial chips , unfortunately no error - controlling resilience support system is available . a hierarchical overall architecture nevertheless can be made available by providing an interface module — or group of modules — as a separate chip . such a refined hierarchical error - control support system is highly resilient and provides — as further embodiments of my invention — major complexes of equipment , over a broad range of applications . these equipment complexes function based upon error - detection , - correction and - containment assemblies which are thereby made extremely dependable . these embodiments of my invention are advanced beyond any practical major equipment complexes of the present day . this is true because the computing functions of all such conventional major apparatus complexes are vulnerable to errors that are essentially undetectable , and therefore uncontrollable . such errors arise in catastrophic events ranging from natural disaster through simple malicious hacking to terrorist intervention . these forms of my invention are especially critical in cases where human lives depend on the continuous and correct operation of the incorporated computing system — with its in - turn incorporated , refined hierarchical resilience support system . thus one embodiment of the invention is a manned spacecraft 103 ( fig3 ) from earth 101 , on a long mission 102 such as exploration of the planet mars 104 . the craft 103 is a major apparatus or equipment complex . incorporated into the craft 103 of my invention is a computing system 105 which controls functioning of the craft , and which in turn includes ( or has associated ) a refined hierarchical error - controlling assembly 110 — according to my present invention — that protects the computing system 105 . another embodiment of the invention is the protected computing system 105 , with the associated or included hierarchical assembly 110 . yet another embodiment is the hierarchical assembly 110 itself . another embodiment of my invention is a human habitat 106 ( fig4 ) to be located on a planet 104 , e . g . mars , and including a computing system 107 , which in turn has associated or includes the hierarchical assembly 110 of my present invention . such a human habitat 106 is a major equipment or apparatus complex according to my invention . as will be understood , earthbound complexes such as skyscrapers , energy - generation facilities , and scientific research centers if protected by my novel hierarchical assembly 110 are likewise embodiments of my invention . still another embodiment of my invention is the included ( and protected ) computing system 107 that operates the habitat 106 or other major complex . yet another embodiment is the included or associated protective hierarchical assembly 110 . perhaps much simpler but also critical embodiments of my invention are vehicles such as an ocean liner 108 ( fig5 ) that incorporates a computing system 109 which controls the vehicle and is protected by the novel hierarchical assembly 110 of my present invention . likewise other embodiments are other kinds of vehicles for the transportation of humans on earth — such as automobiles , airplanes and railroad trains . further embodiments of my invention include the computing system 109 , as well as the hierarchical assembly 110 itself . at a smaller physical scale are other important types of hierarchical - assembly - protected apparatus including commodity computing systems such as a server or a desktop personal computer pc ( fig6 ). such a computer pc , which is an embodiment of my invention , includes or has associated a hierarchical assembly 110 . in certain of the appended apparatus claims , the term “ such ” is used ( instead of “ said ” or “ the ”) in the bodies of the claims , when reciting elements of the claimed invention , for referring back to features which are introduced in preamble as part of the context or environment of the claimed invention . the purpose of this convention is to aid in more distinctly and emphatically pointing out which features are elements of the claimed invention , and which are parts of its context — and thereby to more particularly claim the invention . the foregoing disclosures are intended to be merely exemplary , and not to control the scope of my invention — which is defined by the appended claims . | 6 |
the present disclosure relates generally to consumer products and , in particular , to shaving systems . in one embodiment , the present disclosure features a consumer product system having a handle and a blade unit mounted on the handle . the blade unit comprises a housing that contains a plurality of blades , the edges of which are exposed on the bottom surface of the blade unit ( the surface that contacts the user &# 39 ; s skin during shaving ). the opposite surface , or top , of the housing includes a plurality of measurement elements which are configured to assist the user in obtaining a precise shave , as will be discussed further below . referring to fig1 , the handle 12 provides a manner in which the shaving system 10 can be manipulated and leverage can be applied to achieve desired shaving results . measurement elements 30 are positioned on the top surface of the blade unit 20 that is visible to the user during shaving , in a measured manner to allow the user to reference them while shaving . the measurement elements 30 provide a means for the user to more precisely gauge where to utilize the shaving system 10 when sculpting facial and body hair features , e . g . mustache , side burns , etc . for example , the measurement elements 30 , as well as the evenly spaced ruled lines 36 between the measurement elements ( fig1 a ), allow the user to easily determine whether opposite side burns or opposite sides of a mustache are even or whether one side or the other requires further trimming . as shown in fig1 , during shaving the user can use the measurement elements 30 to measure the width of a facial hair feature ( e . g ., a sideburn as shown ) and then compare that measurement to the width measured on the opposite side of the user &# 39 ; s face . referring to fig1 and 1a , in one embodiment the measurement elements 30 are etched on a strip 32 that is inserted in the top edge of the rear side of the housing of blade unit 20 . in this embodiment , the strip 32 may be metal or plastic . the measurement elements may be molded , etched , painted , or applied by any suitable technique . the measurement elements may be enhanced with color to allow for easy identification . the coloration of the measurement elements 30 could be accomplished by using a coating , e . g . pvd coating , plating , decoration , or another technique . referring to fig2 - 5 , in other embodiments , the measurement elements 30 can be integrally formed with the housing of the blade unit 20 . additionally , the measurement elements 30 can protrude from the top and / or right surface of the blade unit 20 . for example , the measurement elements 30 may be in the form of a raised rim surrounding a triangular measurement element aperture 31 ,. alternatively , the measurement elements 30 may be formed in a raised arrow or pointer shape that is defined by surrounding measurement element apertures 31 , as shown in fig6 - 9 . in addition , in an embodiment not shown in the figures the measurement elements may protrude from the right surface of the blade unit 20 , e . g ., out of the plane of the page , towards the viewer , when the blade unit is seen from the viewpoint shown in fig3 . the measurement elements 30 may have many other shapes , for example raised dots as shown in fig1 - 11 . in each of these embodiments , the ruled lines 36 can be formed integrally with the housing as raised or recessed hash marks disposed at regular intervals between the measurement elements . in any of the embodiments shown in fig2 - 10 , the measurement elements or measurement element apertures may be a different color than the housing . for example , in fig2 - 3 the raised rims of measurement element apertures 31 are colored , and in fig1 - 11 the raised dots 33 are colored , in each case to enhance identification of the measurement elements and make it easier for the user to see them . coloring can be accomplished by utilizing pad printing , a technique that is well known in the art , or by other methods such as pvd coating , over - molding or multi - material molding . referring to fig2 , 4 , 6 and 8 , in some embodiments a lubricating / conditioning element 32 is positioned along the trailing edge of the opposite ( skin contacting ) surface of the blade unit 20 and can be seen through the measurement element apertures 31 . ideally , the lubricating element 32 is colored in such a manner as to highlight the measurement element apertures 31 . additionally , as is well known in the shaving art , the lubricating element 32 , when exposed to water , provides a lubricant that is evenly distributed on the skin during shaving . referring to fig1 and 13 , the measurement elements 30 and ruled lines 36 can be positioned on various aspects of the handle 12 of the shaving device 10 , for example along a surface of the handle that is generally parallel to the long axis of the blade unit ( fig1 ), or along the length of the handle ( fig1 ) if a longer row of measurement elements is desired . the measurement elements 30 and ruled lines 36 can be printed , etched , engraved , integrally molded , applied as an adhesive graphic , or other means of attachment . as previously referenced , coloring can be utilized to highlight either or both the measurement elements 30 and the ruled lines 36 thereby uniquely distinguishing them from the other aspects of the handle 12 . in the embodiments shown in the figures , blade unit 20 is removable from handle 12 so that it can be replaced when the blades become dull from use . the handle 12 can be designed to interface with the blade unit 20 in such a manner that would enable easy removal and attachment . this could be accomplished in a number of manners , such as a mechanical locking mechanism , magnetic interaction , etc . for example , the blade unit 20 and handle 12 can interface in the manner discussed in u . s . ser . no . 61 / 651 , 732 , filed may 25 , 2012 , the full disclosure of which is incorporated herein by reference . the interface between the handle and blade unit may include an interface element , e . g ., interface element 14 ( fig2 ) which provides a pivoting attachment between the blade unit and handle . pivoting of the blade unit is about an axis that is generally parallel to the long axis of the blade unit and is generally positioned to allow the blade unit to follow the contours of a user &# 39 ; s skin during shaving . pivoting shaving systems include a mechanism to provide resistance during shaving and return the blade unit to a “ rest ” position when it is not in contact with the user &# 39 ; s skin . other , more basic embodiments , ( not shown ) feature a blade unit that is pivotable , but fixedly attached to the handle , or even integrally formed with the handle in a fixed position . such embodiments would be less expensive and disposable once the blades became dull from use . the handle 12 and the housing of blade unit 20 can be made of any suitable substantially rigid material including , for example , polyethylene terephthalate ( pet or pete ), high density ( hd ) pete , thermoplastic polymer , polypropylene , oriented polypropylene , polyurethane , polyvinyl chloride ( pvc ), polytetrafluoroethylene ( ptfe ), polyester , high - gloss polyester , metal , nylon polymer , antibacterial or antimicrobial materials , or any combination thereof . a number of embodiments have been described . nevertheless , it will be understood that various modifications may be made without departing from the spirit and scope of the disclosure . for example , in other embodiments the measurement elements can be provided in a variety of colors or alternative shapes . additionally , although the measurement elements have been discussed as being raised , they could alternatively be recessed or combinations of raised and recessed features may be used . | 1 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.