text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
fig1 is a side view of the apparatus of the instant invention . the apparatus employs a large volume settling tank 103 , a flow direction means 108 , an oil outlet means 105 , and a water outlet means 107 . ( an oil - water inlet pipe 122 is connected to the flow direction means and is not shown in fig1 ). the tank employed can be of a standard cone bottom design to facilitate settling of sediments contained in the fluids to be separated . fig1 also shows a tank fluid level 102 which indicates the oil level of the fluids in the tank . level 104 is the oil - water interface of the separated fluids in the tank . volume 106 is the water volume portion of the fluids in the tank . in the method of the instant invention an oil - water emulsion mixture is continually introduced into the tank through the flow direction means 108 so that the mixture enters the tank substantially tangential to the tank wall 120 . then , simultaneously with the introduction of additional fluid into the tank through the flow direction means , separated oil is continuously withdrawn through oil outlet means 105 and water is continuously withdrawn through the bottom - center located water outlet means 107 . in an alternate embodiment it is possible to introduce the fluid mixture into the tank substantially tangential to the tank wall through a plurality of flow direction means the tangential entry of the fluids creates a slow vortex - like flow pattern of fluid in the tank which interferes with adverse fluid channeling . the induced flow pattern establishes long circular - like flow paths in the tank which interfere with the direct channeling of the unseparated fluids from the mixture inlet to the water outlet . this in effect increases the reaction time of the fluid mixture in the settling tank . in addition , the desired gravity separation of oil and water in the settling tank requires a period of time . this required time period can be obtained by the induced slow vortex - like flow pattern thus allowing the desired gravitational separation . thus , this tangential entry of fluids into the tank , by avoiding fluid channeling and permitting the gravity separation to take place prevents formation plugging and the loss of saleable oil by subsequent reinjection of oil contained in the separated water and eliminates the need for additional separation treatment . the actual location of the flow direction means 108 can be at any height on the tank wall . it is preferable , however , that it is located so that it is approximately two - thirds to three - quarters of the distance between the top of the water outlet means 107 and the oil - water interface 104 . this interface level 104 is dictated in practice by the volume input of fluid to be separated , but is readily predicted . the height above the tank bottom of the water outlet 107 is dictated by the amount of sediment in the produced fluids . this sediment amount depends on the producing field , but , in general the top of the water outlet should be above the sediment level expected . the water outlet should also be located in approximately the center of the tank to ensure that the input emulsion while flowing in an induced vortex pattern will not prematurely reach the water outlet . the location of the oil outlet 105 depends on the height of the oil volume desired in the tank , and is located at the desired distance above the oil - water interface 106 . the oil outlet , however , is preferably located at least one foot below the top of the tank to prevent oil contamination of a well - known vapor recovery system which may be installed . fig2 shows a detail top view of the flow direction means 108 of the apparatus of the instant invention . through the use of this flow direction means , the oil - water emulsion mixture &# 39 ; s entry into the settling tank is substantially tangential to the tank wall 120 . fluid is shown entering an oil - water inlet means 122 . it then enters a diffuser means 124 for insuring the tangential to the tank wall entry of the fluids . the centerline 128 of the diffuser means , the centerline 126 of the oil water inlet means , the angle between the two center lines 130 and the angle between the two walls of diffuser means 124 are all indicated on fig2 . the angle 130 which the flow direction means 108 bends the flow of the introduced fluid is approximately 60 degrees to bring the flow tangential to the tank wall . the angle 132 between the inner walls of the diffuser means is approximately 15 degrees . fig3 shows a top view at a level below the oil outlet pipe 105 of the apparatus of the instant invention . the oil - water inlet 122 and the flow direction means 108 and indicated . the bottom - center located water outlet means 107 insures that water is withdrawn from the bottom center portion of the tank . fig4 shows a detailed drawing of the flow direction means 108 of the apparatus of the instant invention . the oil - water inlet means 122 runs through the tank wall 120 and is connected to a flow bending means 162 by a victaulic coupling clamp 158 ( victaulic is a trademark of victaulic company of america ). the parts of the flow direction means can also be connected by other suitable well - known connective methods such as threaded connections . the flow bending means 162 is a curved section of pipe wich bends the flow of the input fluids approximately 60 degrees and is connected by another victaulic clamp 158 to a flow straightening means 164 . the flow straightening means is then connected by victaulic clamp 158 to a diffuser means 124 for the actual entry of the fluids into the tank . the walls 180 of the diffuser means have an angle 157 between them of approximately 15 degrees . the flow diffuser means also contains a narrow throat 169 . the narrow throat is to improve the dynamic flow characteristics of the oil - water mixture through the diffuser means . the angle 159 between a centerline 171 of the diffuser means and the inner wall 180 of the diffuser is approximately 7 . 5 degrees . the flow straightening section 164 is to lessen the turbulence created by flow through the flow bending means 162 . it prevents the fluids &# 39 ; tendency to rotate in a circular manner as is customary after liquids are flowed through any type of curved pipe . this lessens the mixing effect caused by the forced flow through the curved pipe . the flow straightening section can be one of several well - known designs to eliminate the rotational flow tendency , and a preferred version utilizes lengths of smaller diameter pipe placed inside the larger pipe 160 of the flow straightening means . the length of the flow straightening section may be of any desired length , but it is preferred to make the length double that of the diameter of the input pipe 122 . the diameter of the flow straightening means is preferably the same as that of the input pipe 122 . the use of flow direction means as described also results in an overall reduction in the input fluid &# 39 ; s velocity . the actual reduction achieved is the ratio of the area of the diffuser means 124 outlet to the area of the oil - water input means 122 exit . it is preferable that this reduction be 3 : 1 , but other reductions will still permit the functioning of the instant invention . the purpose behind the velocity reduction is to lessen the mixing effects of the fluid entry into the tank but it is not believed necessary for the functioning of the method of the instant invention that any velocity reduction occurs . the materials used in the apparatus of the instant invention are well - known in the oil field fluid handling industry . it is important that the material be able to withstand a corrosive environment as the input fluids will contain brine and often h 2 s . suitable materials for use are stainless steels , plastics , and fiberglass . to decrease the cost of the apparatus of the instant invention , the diffuser means 124 is preferrably constructed of fiberglass with its inner wall 180 coated with gel - kote ( a trademark of the glidden - durkee div . of scm corp . ), a polyester resin coating , or other similar coatings such as an epoxy coating to give a smooth surface . the apparatus and method of the instant invention have been tested in several amoco production company oil field settling tanks . the apparatus has been installed in settling tanks of varying sizes from 1000 barrels up to 10 , 000 barrels . the size of the inlet pipe 122 has varied from 4 inches ( 10 . 16 centimeters ) up to 14 inches ( 35 . 56 centimeters ). the actual size of the tank 110 , inlet pipe 122 , the flow direction means 108 , the water outlet pipe 107 , and the oil outlet pipe 105 will depend on the quantity of production fluids that must be handled . tests of the apparatus and method of the instant invention were performed in a 6 , 000 barrel standard a . p . i . cone bottom tank with total throughput of 10 , 500 barrels of fluid per day and an input line diameter 122 of 10 inches ( 25 . 4 centimeters ). the tank has a diameter of 38 feet and 8 inches ( 11 . 78 meters ), and a height of 30 feet ( 9 . 14 meters ) above ground level . the oil - water inlet 122 is located 20 feet ( 6 . 1 meters ) above the ground level and the water outlet 107 extends 4 feet ( 1 . 22 meters ) above ground level . the oil outlet 105 is 2 feet ( 0 . 61 meters ) down from the top of the tank and has a diameter of 10 inches ( 25 . 4 centimeters ). the flow straightening section 164 was built by cei plastics of odessa , tx and is 20 inches ( 0 . 51 meters ) long . the diffuser means 124 was built as depicted in fig4 and is made from fiberglass . it is coated on the inside with gel - kote to give a smooth surface . the overall length of the diffuser is 45 . 5 inches ( 1 . 16 meters ). the throat 169 width is 7 . 18 inches ( 18 . 2 centimeters ) and the inside diameter of the input section of the diffuser is 10 . 15 inches ( 25 . 78 centimeters ) the inside diameter of the end of the diffuser is 17 . 58 inches ( 0 . 45 meters ) resulting in an overall velocity reduction of approximately 3 : 1 . the angles 157 and 159 are approximately 15 and 7 . 5 degrees , respectively . the flow bending means 162 is a standard 10 inch ( 25 . 4 centimeters ) pipe with a 60 degree bend in it . the apparatus was tested by using a radioactive tracer of iodine - 131 and then monitoring the separated water for iodine - 131 concentration . it was found that the actual retention time of this holding tank equipped with the apparatus and employing the method of the instant invention was 4 hours and 52 minutes . the test results are plotted in fig5 . the shape of the breakthrough curve ( fig5 ) also shows that the tracer breakthrough was quite steep . this indicates that channeling of the tracer directly from the inlet to the outlet was eliminated , as there was no increase in the tracer concentration at the outlet until 4 hours and 52 minutes after injecting the tracer . no input fluid velocity measurements were made during the tests . the method and apparatus of the instant invention were also tested in laboratory scale bench tests . the tests performed were to determine the input fluid velocity required to allow the tangential entry method and apparatus to work . in all tests the model tank was allowed to operate for a minimum seven hours to stabilize the flow patterns before velocity measurements were taken . the apparatus tested was as depicted in fig4 with a fluid velocity reduction ratio of 3 : 1 . the input fluids contained a water soluble dye to annouce the arrival of input fluids at the tank exit . the model tank had a radius of 15 inches ( 38 . 1 centimeters ) and a height of 24 inches ( 0 . 61 meters ). velocity measurements were taken 12 inches ( 30 . 48 centimeters ) from the center of the tank . these tests revealed that any fluid velocity as measured at the end of the oil - water inlet pipe 122 above 3 . 3 in / sec ( 8 . 38 cm / sec ) resulted in satisfactory functioning i . e ., elimination of fluid channeling , of the method and apparatus . this indicates that for an apparatus employing the tangential fluid entry technique it is preferable that the fluid input be above this velocity . however , these model velocities have not been confirmed in field side apparatus tests . it is thus possible that in a full size installation , a lower velocity rate will allow the method to function satisfactorily . it should be noted that the scope of the apparatus and method disclosed herein should be determined by the specification but rather its scope is determined by the extent of the appended claims . | 1 |
referring first in detail to fig1 a motorcycle having an exhaust system constructed in accordance with an embodiment of the invention is identified generally by the reference numeral 21 . it is to be understood that a motorcycle is only a typical environment in which the invention may be employed and that the invention has utility in a wide variety of engine applications . however , the invention has particularly utility in connection with a motorcycle since such vehicles are extremely compact and readily illustrate the way in which the invention is adapted to such compact vehicles . because the motorcycle 21 is depicted for illustrative purposes only , its major components have been shown in phantom and will be described only generally . the motorcycle 21 includes a frame assembly 22 that mounts a fuel tank 23 and seat 24 . a handlebar assembly 25 is journaled at the front part of the frame assembly 22 for steering a front wheel 26 that is supported in any known manner . in addition , the frame assembly 22 supports a rear wheel 27 for suspension movement in any known manner . an internal combustion engine , indicated generally by the reference numeral 28 , is supported within the frame assembly 22 beneath the fuel tank 23 . the engine 28 includes a cylinder block assembly 29 and a combined crankcase transmission assembly 31 . the crankcase transmission assembly 31 affords a means for driving the rear wheel 27 , as by means of a driving chain 32 . the engine 28 is provided with an exhaust system , indicated generally by the reference numeral 33 and which embodies the invention . the exhaust system 33 may comprise either the exhaust system shown in the embodiments of fig2 through 4 , the exhaust system of fig6 through 11 , the exhaust system of fig1 , or the exhaust system of fig1 and 14 . in fig1 the exhaust system of fig2 through 5 is specifically illustrated . referring now to those figures ( 2 through 5 ), the engine 28 has its cylinder block 29 formed with four cylinder bores that are aligned transversely relative to the motorcycle 21 . it is to be understood that the invention may be employed in connection with engines of other cylinder number of configurations . however , the invention has particularly utility with engines that have at least two cylinders . because of its transverse disposition , the cylinder block 29 has four forwardly facing exhaust ports ( not shown ). inlet flanges 34 , 35 , 36 and 37 of respective exhaust pipes 38 , 39 , 41 and 42 cooperate with these exhaust ports for receiving the exhaust gases and carrying them downwardly and rearwardly . the exhaust pipes 38 and 39 and 41 and 42 are paired for tuning purposes and merge into respective collector sections 43 and 44 which also serve as expansion chambers . a reflective control valve arrangement , indicated generally by the reference numeral 45 , is interposed between the exhaust pipes 38 , 39 , 41 and 42 and the expansion chambers 43 and 44 for a purpose to be described . tail pipes 46 and 47 extend rearwardly from the expansion chambers 43 and 44 and deliver the exhaust gases to a pair of mufflers 48 and 49 that lie on opposite sides of the rear wheel 27 for discharge of the exhaust gases to the atmosphere . the tail pipes 46 and 47 are interconnected by a crossover pipe 50 . it should be noted that the exhaust pipes 39 and 41 lie at a slightly lower level than the exhaust pipes 38 and 42 so as to clear the transmission crankcase assembly 31 and to afford a compact nature . this arrangement also permits the rider to lean the motorcycle 21 through a greater bank angle than if the pipes 39 and 42 were at this lower position . this is significant in connection with the construction of the valve assembly 45 which will now be described by primary reference to fig4 and 5 . the valve assembly 45 includes a first valve body 51 that has a pair of exhaust passages 52 and 53 that extend horizontally and which are aligned with and connected to the trailing ends of the exhaust pipes 39 and 41 , respectively . a pair of reflective valve members 54 and 55 are supported within the passages 52 and 53 , respectively , and are affixed to a common valve shaft 56 that is journaled within the valve body 51 and which extends outwardly beyond its side edges . the valve elements 54 and 55 are of a butterfly type and it will be noted that in their fully closed position as shown in fig5 that they do not fully close off the exhaust passages 52 and 53 . they occupy , in an embodiment , approximately 50 % of the effective cross sectional area in this position . however , it is to be understood that the specific ratio may be varied depending upon engine parameters and in accordance with the principles set forth in aforenoted copending application ser . nos . 935 , 340 and 935 , 342 . a second valve body 57 lies on one side of the valve body 51 and is disposed slightly higher than it . the valve body 57 forms an exhaust gas passage 58 which is aligned with and coupled to the trailing end of the exhaust pipe 38 so as to receive exhaust gases from it . a reflective valve member 59 is rotatably supported in the exhaust passage 58 on the shaft 61 which extends through both sides of the valve body 57 , for a purpose to be described . in a similar manner , a third valve body 62 lies on the other side of the first valve body 51 and defines an exhaust passage 63 that is aligned with the connected to the tailing end of the exhaust pipe 42 so as to receive exhaust gases from it . it should be noted that the valve bodies 57 and 62 lie on substantially the same horizontal plane and that the axes of the exhaust passages 52 and 58 and 53 and 63 are aligned with each other and describe a v angle b - b due to the placement of the exhaust pipes . this places the valve in a protected location and permits a greater bank or leaning angle for the rider when maneuvering , as already noted . a reflective valve element 64 of the butterfly type is rotatably journaled in the valve housing 62 by means of a shaft 65 . the shaft 65 only extends through one end of the valve body 62 , this being the end adjacent to the valve body 51 . an arrangement is provided for rotating the valve members 59 , 54 , 55 and 64 simultaneously between a fully closed position wherein they present the maximum reflective area , as shown in fig4 and 5 , and a fully opoened position wherein they present the minimum reflective area . this mechanism includes a control that is responsive to an engine running condition , such as engine speed , and which is shown schematically in fig2 . this includes an engine speed sensor 66 that outputs a speed signal to a control device 67 . the control device 67 , in turn , positions an actuator such an electric motor 68 or the like which is coupled by means of a flexible cable 69 to a pulley 71 that is affixed to the extending end of the shaft 61 of the valve 59 . the actual timing or operating sequence for the valve 59 , as has been noted , depends upon a variety of factors and the logic may be understood by reference to aforenoted copending application ser . nos . 935 , 340 and 935 , 342 . the valve shaft 61 is coupled to the valve shaft 56 and the valve shaft 56 is coupled to the valve shaft 65 by respective motion transmitting mechanisms , indicated generally by the reference numeral 72 . each motion transmitting mechanism 72 includes a first lever 73 that is affixed to the respective shaft 61 or 65 and a second lever 74 that is affixed to the respective end of the shaft 56 . the levers 73 and 74 are coupled for simultaneous rotation by means of a link 75 that is pivotally connected at its opposite ends to the levers 73 and 74 . as a result of this interconnection , rotation of the shaft 61 will be accompanied by simultaneous rotation of the shaft 56 and shaft 65 so that the valve elements 54 , 55 , 59 and 64 will all operate in unison . it should also be noted that the valve bodies 57 and 62 are positioned slightly aft or rearwardly of the valve body 51 so that the valves 59 and 64 may be positioned slightly rearwardly of the valve elements 54 and 55 and so that all of the valve elements may be positioned at the appropriate axial location along the length of their respective pipes . in this way , maximum effect can be obtained for the valve system . also , it should be noted that the arrangement is such that no one long valve shaft is employed so that the likelihood of binding due to thermal expansion will be substantially minimized if not totally eliminated . in the embodiment of fig2 through 5 , the valve assembly 45 consists of three separate valve bodies . fig6 through 11 show another embodiment of the invention which differs from the embodiment of fig2 through 5 in the construction of the control valve , which is indicated generally by the reference numeral 101 . in all substantial regards , except for the relative locations of the exhaust pipes 38 , 39 , 41 and 42 where they merge into the valve assembly 101 and of the shape of the expansion chambers 43 and 44 , the construction of the exhaust system is the same as the previously described embodiment and , for that reason , components which are substantially the same or the same as those of the previously described embodiment have been identified by the same reference numerals and will be described again only in detail in this embodiment as is necessary to understand the embodiment . referring primarily to fig8 through 11 , the control valve assembly 101 includes a valve body 102 in which horizontally extending parallel exhaust passages 103 , 104 , 105 and 106 are formed . because these passages 103 through 106 are all horizontally disposed and have their axes lying in the same plane , it is necessary for the corresponding mating ends of the exhaust pipes 38 , 39 , 41 and 42 to be also so disposed at their point of attachment to the valve body 102 . reflective control valve elements 107 , 108 , 109 and 111 are positioned within the exhaust passages 103 through 106 , respectively . the valve elements 107 , 108 , 109 and 111 are of the butterfly type but unlike prior art constructions are not all affixed to a common valve shaft that is horizontally disposed . rather , each of the valves is affixed to a respective vertically extending valve shaft 112 , 113 , 114 and 115 each of which is journaled in the valve body 102 for rotation about parallel vertically extending axes . each of the shafts 112 , 113 , and 114 has affixed to it a respective lever 116 . the levers 116 are all interconnected for simultaneous rotation of their associated shaft by means of a common link 117 . the link 117 is disposed externally of the valve body 102 and hence will not be heated and subject to thermal expansion to any significant effect . as with the previously described embodiment , the shaft 112 is directly operated by the control device by means including a flexible transmitter 69 and pulley 71 . fig1 shows another embodiment of control valve , indicated generally by the reference numeral 151 . this embodiment is substantially the same as the embodiment of fig7 through 11 and for that reason only an end elevational view is shown . in this embodiment , like the previously described embodiment , includes a single valve housing 152 in which passages 153 , 154 , 155 and 156 are formed . unlike the previously described embodiment of fig7 through 11 , however , the passages 153 and 156 lie on a horizontal plane that is vertically above those of the passages 154 and 155 . hence , the passages 153 and 154 and 155 and 156 define a v shape configuration similar to the embodiment of fig2 through 5 and thus presents greater clearance for leaning when turning . however , in this embodiment , the passages 153 through 156 are all axially aligned . butterfly type throttle valves 157 , 158 , 159 and 161 are supported in the passages 153 through 156 , respectively , on individual vertically extending shafts 162 , 163 , 164 and 165 , respectively . the shafts 162 through 165 are all interconnected at their upper ends by means of a linkage system of the type shown in fig8 and 9 and thus this system will not be described again in detail . in the embodiments of the invention thus far described , the individual shafts of the valve elements were connected to each other by means of a linkage system . fig1 and 14 show a valve construction , indicated generally by the reference numeral 201 , which is generally similar to the previously described embodiments but wherein at least certain of the shafts of the valve elements are connected by a system other than a linkage system . in this embodiment , like the previously described embodiments , those elements which are common with the other embodiments have been identified by the same reference numerals and will not be described again . in this embodiment , the valve mechanism 41 is comprised of a pair of valve bodies 202 and 203 that are disposed at an angular relation to each other and wherein they are axially aligned . as with the embodiments of fig2 through 5 and 12 , this configuration permits greater leaning for maneuvering . the valve body 202 is formed with a lower exhaust gas passage 204 and an upper exhaust gas passage 205 which passages are parallel to each other . in a similar manner , the body 203 is provided with a lower exhaust gas passge 206 and an upper exhaust gas passage 207 . the passages 206 and 207 extend horizontally and are parallel to each other and also parallel to the passages 204 and 205 of the body 202 . individual butterfly type throttle valves 208 , 209 , 211 and 212 are journaled in the passages 204 , 205 , 206 and 207 , respectively . the valves 208 and 209 are supported on a common valve shaft 213 that is journaled in the body 202 while the valve elements 211 and 212 are affixed to a valve shaft 214 that is journaled within the valve body 203 . the shafts 213 and 214 are at an angle to each other and their inner ends are drivingly connected by means of a pair of intermeshing bevel gears 215 so that all of the valve elements will be operated in unison . it should be readily apparent from the foregoing description that a number of embodiments of exhaust control valves have been illustrated each of which permits an effective operation without detrimental effects due to thermal expansion while at the same time maintaining an effective and simple operation . in addition , the construction is such that the valves may all be controlled simultaneously and there is latitude permitted in the configuration of the associated exhaust pipes . although a number of embodiemnts of the invention have been illustrated and described , various changes and modifications may be made without departing from the spirit and scope of the invention , as defined by the appended claims . | 5 |
the present invention is based on the automated composition of a raw media stream from multi media or plain still image material recorded by individuals or observation cameras , such as web cams . a typical composition method according to the present invention involves collecting media items offered in a category selected by the recording individual in a sequence according to recording time . the raw media stream is edited or refined according to actions of those individuals who view the material . a typical editing method according to the present invention involves a system that obtains information concerning the viewing actions of individual viewers . when an image or stream is displayed that is of a particular interest to an individual , the individual users can browse the multimedia stream in many ways . the viewing actions that are involved in the editing process can comprise typical implicit editing methods , and the outcome is based upon an analysis of the actions by those individuals who view the material . actions that can be used in the collaborative editing process include , but are not limited to , the use of an “ accelerated playback ” mode , viewing the stream at a normal playback speed , repeatedly viewing the same portion of content , adjusting the volume , bass , balance , fade , treble or other audio - related aspects of the content , zooming within the multimedia content , panning within the multimedia content , or viewing the content in slow motion . as used herein , “ panning ” refers to , if a picture ratio in a video is wider than a device &# 39 ; s display , adjusting the positioning of the video so that a selected portion of the video remains viewable by the user . all of the above actions can be considered as indications of interest to that portion of the media stream . information concerning all of these actions can be consolidated with a conventional data mining technique or similar method in order to refine the appears appearance of the media stream for subsequent users and / or viewers . fig4 is a representation showing a collaborative media stream editing process according to one embodiment of the present invention . as shown in fig4 , a recording device 100 is used to capture an image or a video stream , referred to herein generically as content 110 , and transmit the content 110 to a processing server 120 . the recording device 100 can take a variety of forms , including , but not limited to , a digital movie recorder , a conventional movie recorder , a digital camera , and a mobile telephone with built - in camera capabilities . the processing server 120 transmits the content 110 to at least one playback device 130 . the playback device 130 can also take a wide variety of forms , including virtually any device that includes some form of display unit . the playback device 130 can include either a built - in or an otherwise associated controller 140 that enables the viewer to manipulate the media stream . the controller 140 can include items such as a joystick , keyboard keys , touch pads , a touch - sensitive display , or a variety of other features that allow the viewer to manipulate the content 110 . in one embodiment of the invention , a mobile telephone serves as the controller 140 . the system depicted in fig4 also includes a voting engine 150 . the voting engine 150 is used to collect information concerning the activities of each individual viewer . the voting engine 150 keeps track of how many viewers perform particular actions around individual content segments , including whether viewers fast forward past a segment , whether a viewer watches a segment multiple times , etc . the voting engine 150 is incorporated into the processing server 120 in one embodiment of the invention . the voting engine 150 can also be a stand - alone device . in addition , the voting engine 150 can also be incorporated into the recording device 100 , into one or more playback devices 130 , or into one or more controllers 140 . in one embodiment of the invention , several individuals simultaneously view the media stream in a broadcast mode using respective playback devices 130 . the playback devices 130 can each include their own controller 140 or other mechanism , or a single playback device 130 can be connected to multiple controllers 140 , where individuals can view and control the content 120 through one of the controllers . each user or viewer can use a controller 140 to generate viewer actions . the viewer actions are processed by the voting engine 150 . this information can be used by the voting engine 150 to generate an altered or edited appearance of the media stream and to control the playback of the media stream . editing actions that can be implemented by a playback device 130 in order to alter the appearance of the content include , but are not limited to : adjusting the time to keep a still image on the display , selecting the part of a video clip to be exhibited at a slower speed , selecting a still image or frame to be shown from a video clip when browsing a video stream , adjusting the volume , bass , treble , balance , fade or other audio - related aspects of a content portion , zooming within the multimedia content , panning within the multimedia content , and skipping a portion of a video stream . editing actions , such as those discussed above , result in the generation of a modified appearance for the media stream for future viewing . for example , in the event that several viewers “ rewind ” a portion of a video stream in order to watch the portion more than one time , it may be determined that that particular portion should be given more prominence when exhibited to future users . as a result , the media processing server 120 may adjust the media stream for future users so that the particular portion is shown in slow motion . conversely , portions which are skipped over by users could be deemphasized for future viewers . other possibilities include the showing of a more detailed view of the content portion , an accelerated rate of exhibiting the piece of content , or other actions . in any event , the end result of this collaborative editing process is the subsequent display of the content in a modified fashion that is likely to be of more interest to the user than the content in an unmodified form . it should be noted that the media stream can include not only video and / or still images but also other media forms such as audio . in such situations , the different portions can edited independent from each other in one embodiment of the invention . for example , an audio portion of a media stream can be independently edited without editing the video or image portion of the content . in one particular implementation of the present invention , a basic mobile telephone with a built - in camera is used as a recording device 100 , which is used to post content 110 to a selected raw media channel . the media processing server 120 receives posts to the raw media channel and creates online and browsing media streams according to the actions of the individual viewers . a playback device , such as a multimedia playback - capable telephone or personal computer , is able to receive and play the stream . according to this embodiment of the invention , a number of the playback devices need to have the ability to obtain information regarding the viewer actions and to communicate information about the actions to the media processing server 120 . some playback devices may be able to react to viewer actions locally while , at the same time , consuming a media stream received from the media processing server 120 . fig5 is a flow chart showing the implementation of one embodiment of the present invention . at 200 , a recording device 100 records content 110 from a source . in a particular embodiment of the invention , this can be in the form of live - action recording of video , although it is also possible that the content 110 can take the form of a series of still images , or the content 110 can take other forms . at step 210 , the content 110 is transmitted to the media processing server 120 . it should be noted that the content 110 can be transmitted in real time to the media processing server 120 , or the content 110 can be stored in the recording device 110 and transmitted at a later time to the media processing server . at step 220 , the content 110 is transmitted to at least one playback device 130 . at step 230 , the content 110 is viewed by at least one user . at step 240 , each user uses his or her controller 140 to view the content 110 in a specific way , e . g ., by fast - forwarding through portions , playing portions in slow motion , etc . at step 250 , information concerning how the content 110 is viewed is transmitted to the voting engine 150 , which collects this information from each user that views the content 110 . at step 260 , the voting engine uses the information to generate modified content , which is transmitted to subsequent viewers at step 270 . the generation of modified content can occur according to predefined criteria . “ predefined criteria ” can be both relative and absolute and can be based upon the number of viewers of content , the number of consecutive viewers performing the same action , the frequency of performing a particular action by viewers or a wide variety of other suitable measures . for example , the predefined criteria can state that , if more than a certain percentage of viewers fast - forward through a particular segment , then the modified content should exhibit that portion of the content at an accelerated rate in the future . the content 110 then continues to be viewed and modified over time . the generation of modified content can occur through the use of an engine having an artificial intelligence . in this situation , the objective of the artificial intelligence is to generate content which would match the needs and tastes of an average consumer , or content which would match the needs of a “ key user ” of a specific target group . according to one embodiment of the invention , a particular playback device 130 may access the content 110 with an indication to view the content 110 only when it has been altered and edited such that the content has obtained a desired level of “ maturity ” quality . fig1 shows a system 10 in which the present invention can be utilized , comprising multiple communication devices that can communicate through a network . the system 10 may comprise any combination of wired or wireless networks including , but not limited to , a mobile telephone network , a wireless local area network ( lan ), a bluetooth personal area network , an ethernet lan , a token ring lan , a wide area network , the internet , etc . the system 10 may include both wired and wireless communication devices . for exemplification , the system 10 shown in fig1 includes a mobile telephone network 11 and the internet 28 . connectivity to the internet 28 may include , but is not limited to , long range wireless connections , short range wireless connections , and various wired connections including , but not limited to , telephone lines , cable lines , power lines , and the like . the exemplary communication devices of the system 10 may include , but are not limited to , a mobile telephone 12 , a combination pda and mobile telephone 14 , a pda 16 , an integrated messaging device ( imd ) 18 , a desktop computer 20 , and a notebook computer 22 . the communication devices may be stationary or mobile as when carried by an individual who is moving . the communication devices may also be located in a mode of transportation including , but not limited to , an automobile , a truck , a taxi , a bus , a boat , an airplane , a bicycle , a motorcycle , etc . some or all of the communication devices may send and receive calls and messages and communicate with service providers through a wireless connection 25 to a base station 24 . the base station 24 may be connected to a network server 26 that allows communication between the mobile telephone network 11 and the internet 28 . the system 10 may include additional communication devices and communication devices of different types . the communication devices may communicate using various transmission technologies including , but not limited to , code division multiple access ( cdma ), global system for mobile communications ( gsm ), universal mobile telecommunications system ( umts ), time division multiple access ( tdma ), frequency division multiple access ( fdma ), transmission control protocol / internet protocol ( tcp / ip ), short messaging service ( sms ), multimedia messaging service ( mms ), e - mail , instant messaging service ( ims ), bluetooth , ieee 802 . 11 , etc . a communication device may communicate using various media including , but not limited to , radio , infrared , laser , cable connection , and the like . fig2 and 3 show one representative mobile telephone 12 within which the present invention may be implemented . it should be understood , however , that the present invention is not intended to be limited to one particular type of mobile telephone 12 or other electronic device . the mobile telephone 12 of fig2 and 3 includes a housing 30 , a display 32 in the form of a liquid crystal display , a keypad 34 , a microphone 36 , an ear - piece 38 , a battery 40 , an infrared port 42 , an antenna 44 , a smart card 46 in the form of a uicc according to one embodiment of the invention , a card reader 48 , radio interface circuitry 52 , codec circuitry 54 , a controller 56 and a memory 58 . individual circuits and elements are all of a type well known in the art , for example in the nokia range of mobile telephones . the present invention is described in the general context of method steps , which may be implemented in one embodiment by a program product including computer - executable instructions , such as program code , executed by computers in networked environments . generally , program modules include routines , programs , objects , components , data structures , etc . that perform particular tasks or implement particular abstract data types . computer - executable instructions , associated data structures , and program modules represent examples of program code for executing steps of the methods disclosed herein . the particular sequence of such executable instructions or associated data structures represents examples of corresponding acts for implementing the functions described in such steps . software and web implementations of the present invention could be accomplished with standard programming techniques with rule based logic and other logic to accomplish the various database searching steps , correlation steps , comparison steps and decision steps . it should also be noted that the words “ component ” and “ module ” as used herein , and in the claims , is intended to encompass implementations using one or more lines of software code , and / or hardware implementations , and / or equipment for receiving manual inputs . the foregoing description of embodiments of the present invention have been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the present invention to the precise form disclosed , and modifications and variations are possible in light of the above teachings or may be acquired from practice of the present invention . the embodiments were chosen and described in order to explain the principles of the present invention and its practical application to enable one skilled in the art to utilize the present invention in various embodiments and with various modifications as are suited to the particular use contemplated . | 7 |
an embodiment of the present invention is a process for preparing a compound having the formula ## str1 ## wherein r is an aryl group which comprises reacting a compound having the formula ## str2 ## with ( a ) sf 4 and ( b ) bf 3 or alcl 3 , in liquid hf at temperatures ranging from about - 80 ° c . to about 20 ° c . r is an aryl group exemplified by ## str3 ## preferred r groups are ## str4 ## the compounds of formula i and ii have a chiral center and may occur in optically active forms i . e ., as optical isomers . these isomers are designated conventionally by the symbols l and d , - and +, l and d , s and r and combinations thereof . where the compound name or formula has no isomer designation , the name of formula includes the individual isomers , mixtures thereof and racemates . the present process is preferably carried out at atmospheric pressure although pressures above atmospheric may be used . the reaction temperature ranges from about - 80 ° c . to about 20 °, - 80 ° c . to 0 ° c . being preferred . the present process may conveniently be carried out by introducing the sf 4 and bf 3 or alcl 3 into the formula ii / hf reaction system initially . the process may also be carried out by first adding the sf 4 to the reaction system , allowing the reaction to proceed for a period of time and then adding the bf 3 or alcl 3 and allowing the reaction to go to completion . the use of bf 3 or alcl 3 in the sf 4 / hf reaction system substantially improves the yield of formula i product . the formula i products have decarboxylase inhibiting activity and are useful as diagnostic tools to determine the presence and importance of the corresponding decarboxylase in relation to diseases as to functioning of biological systems . the products may also have chemotherapeutic utility which is a consequence of their decarboxylase inhibiting activity . for example , α - fluoromethylhistidine inhibits the biosynthesis of histamine from histidine and thus may be useful in preventing gastric lesions or in treating allergic conditions . α - fluoromethyl - 3 - hydroxytyrosine and α - fluoromethyl tyrosine also exhibit antihypertensive activity when administered to spontaneously hypertensive ( sh ) rats ; the compounds are thus indicated to be useful for treating hypertension in humans . the following examples illustrate the process of the present invention . all temperatures are in ° centigrade . melting points are determined in open capillary and are uncorrected . 50 g of 3 -[ 3 &# 39 ;, 4 &# 39 ;- diacetoxyphenyl ]- 2 - acetamino - 2 - acetoxymethyl - propionic acid is added into 204 ml of 4 m aqueous koh with stirring . after 1 hour of stirring ( under nitrogen ), the solution contains potassium salt of 3 ( 3 &# 39 ;, 4 &# 39 ;- dihydroxyphenyl )- 2 - acetamino - 2 - hydroxymethyl - propionic acid , formed in essentially quantitative yield . without isolation , by methylation with dimethyl sulfate , this compound is transformed into 3 -( 3 &# 39 ;, 4 &# 39 ;- dimethoxyphenyl )- 2 - acetamino - 2 - hydroxymethyl - propionic acid . this operation is performed at room temperature under n 2 gas by dropwise addition with vigorous stirring of dimethyl sulfate ( about 64 ml ) and 4 m aqueous koh solution ( about 148 ml ) over a period of about 1 hour . the reaction mixture was stirred for another hour , then left standing overnight . acidification ( at 5 °- 10 ° c . with 55 ml of conc . aqueous hcl ), extraction with ethyl acetate ( 12 × 300 ml ), drying over na 2 so 4 and evaporation in vacuo gave r , s - 3 ( 3 &# 39 ;, 4 &# 39 ;- dimethoxyphenyl )- 2 - acetamino - 2 - hydroxymethyl - proionic acid . it was purified by recrystallization from 1325 ml of acetonitrile , m . p . 154 °- 6 ° c . ( dec ). twenty - nine and 1 / 10 g of strychnine was suspended in 1 . 12 l of ethanol 2ba , heated to reflux , then 26 . 1 g of r , s - 3 ) 3 &# 39 ;, 4 &# 39 ;- dimethoxyphenyl )- 2 - acetamino - 2 - hydroxymethyl - propionic acid was added . the solution thus obtained was allowed to cool down and left standing overnight at room temperature . crystals of the strychnine salt of antimer , &# 34 ; a &# 34 ; separate ; m . p . 193 °- 194 ° c . (&# 34 ; hm &# 34 ;). the mother - liquor of the above named precipitation was evaporated in vacuo to dryness and recrystallized from 270 ml of ethanol 2ba ; the hot solution is allowed to cool to room temperature and left standing at room temperature for ˜ 3 hours , then kept in the refrigerator for ˜ 4 hours . the crystals formed were collected on a filter and after drying , recrystallized from acetonitrile to give strychnine salt of antimer &# 34 ; b &# 34 ; of 3 -( 3 &# 39 ; 4 &# 39 ;- dimethoxyphenyl )- 2 - acetamino - 2 - hydroxymethyl - propionic acid m . p . 130 °- 132 ° c . ( dec .). yield 17 . 5 g . seventeen g of this strychnine salt was decomposed by dissolving it first in 160 ml of water ; 31 ml of 1 m aq . naoh solution was added . the strychnine separated was removed by filtration and the solution evaporated to small volume in vacuo and applied onto a small ion exchange resin column ( 150 ml of ag - x 2 cation exchange dowex 50 resin , 200 / 400 mesh ). elution with water , followed by evaporation in vacuo of the fractions which showed absorption , as indicated by an lkb uv absorption monitor ( uvicord ii - 8300 ). this compound , antimer &# 34 ; b &# 34 ; of 3 -( 3 &# 39 ;, 4 &# 39 ;- dimethoxyphenyl )- 2 - acetamino - 2 - hydroxymethyl - propionic - acid showed [ α ] d : 78 . 3 + 0 . 5 ° ( c , 1 . 425 in 0 . 1 m aq . naoh ). transformation of the above compound into the corresponding stereo - isomer of α - hydroxymethyl - 3 - hydroxytyrosine : four and 43 / 100 g of antimer &# 34 ; b &# 34 ; of 3 -( 3 &# 39 ;, 4 &# 39 ;- dimethoxyphenyl )- 2 - acetamino - 2 - hydroxymethylpropionic acid is dissolved in 100 ml conc . hcl and sealed and heated for 90 minutes in a fisher - porter tube immersed into an oil bath of 130 ° c . the solvent was eavporated in vacuo and the above hcl treatment repeated . the residue thus obtained represents r - α - hydroxymethyl - 3 - hydroxy tyrosine hydrochloride . 8 g of r - α - hydroxymethyl - 3 - hydroxytyrosine . hcl is charged to a 1 l . reactor . the reactor is immersed into a dry - ice acetone bath and 80 ml of liquid hf is condensed on top of the substrate . to remove the hcl present , the cooling - bath is removed and the hf solvent removed by passing in a stream of n 2 gas . the reactor is immersed into the cooling bath again a stream of hf gas is passed in until a liquid volume of ˜ 250 ml collects . 6 . 2 ml of sf 4 ( 17 . 6 mmol / ml : ˜ 109 mmol ) is then bubbled in , the solution aged for 1 hour , the cooling bath exchanged for an ethylene - glycol bath kept at - 16 ° c . and the solution aged for ˜ 22 hours . boron trifluoride gas is passed in until saturation and the solution aged again at - 16 ° c . for 46 hours . the cooling bath is removed and the solvent evaporated by passing through it a vagorous steam of n 2 gas . the residue is quenched in ˜ 100 ml of ice - cold aqueous hcl ( 2 . 5 m ), evaporated in vacuo , the residue dissolved in water and added onto a column of cation - exchange resin . 2 . 2 l of ag - 50 - x - 8 resin ( 200 / 400 mesh ) was employed . elution with 0 . 25 m aq . hcl , containing 5 % methanol ; in ˜ 8 . 5 hours , 7 . 2 l of this solvent is pumped through the column . this is followed by 7 . 2 l of 0 . 4 m aq . hcl with 7 . 5 % methanol in 8 . 5 hours , then concluding with 0 . 6 m aq . hcl with 10 % methanol . 22 ml fractions are collected , 10 tubes per rack . tubes in racks nos . 45 - 66 contained the desired compound . evaporation in vacuo gave hcl salt of s isomer of α - fluoromethyl - 3 - hydroxytyrosine . for liberation of the free amino acid , 4 . 826 g of this compound was dissolved in 90 ml of isopropanol , filtered through celite . 6 . 2 ml of propylene oxide was added to the filtrate and the suspension kept at room temperature for 3 . 5 hours , then at ˜ 5 ° c . for another 2 . 5 hours . the s α - fluoromethyl - 2 - hydroxy - tyrosine thus formed was collected by filtration , washed with isopropanol and dried overnight in vacuo at 76 °. [ α ] d : + 9 . 3 °± 0 . 5 , c , 1 . 82 in 1 : 1 mixture of trifluoroacetic acid and water . for preparation of the above named compound the strychnine salt of the antimer of 3 ( 3 &# 39 ;, 4 &# 39 ;- dimethoxyphenyl )- 2 - acetamino - 2 - hydroxymethyl - propionic acid ( example 1 &# 34 ; hm &# 34 ;) was carried through steps analogous to those in example 1 . the final product of the sequential steps was r - α - fluoromethyl - 3 - hydroxy - tyrosine , with [ α ] d : - 9 ° ( c , 2 . 5 in a 1 : 1 mixture of h 2 o - trifluoroacetic acid ). one and 5 / 100 g ( 0 . 005 mol ) of r , s - α - hydroxymethyl - tyrosine is charged into a reactor . the reactor is immersed into a dry - ice - acetone bath and ˜ 50 ml of liquid hf is collected by passing in a stream of hf gas . under continuing cooling , sf 4 gas ( 4 ml , measured in liquid state at - 78 ° c .) is passed in , then bf 3 gas until saturation at - 78 ° c . ( stirring with magnetic stirrer ). the deep - red solution thus obtained is aged overnight at - 78 ° c . ; the cooling bath is removed then , and the solvent evaporated to dryness in vacuo . the residue is dissolved in water and applied to a strong acid cation - exchange resin column , prepared with 100 ml of ag50 - x - 8 resin ( 200 / 400 mesh ). the column is first washed with water ( 1 . 8 l ), followed by 0 . 5 m aq . hcl . 20 ml fractions of the effluent are collected and the course of the elution is followed by uv monitor of lkb , model uvicord ii . the fractions corresponding to the main peak in the uv curve are combined and evaporated to dryness in vacuo , to yield hydrochloride salt of r , s - fluoromethyltyrosine . 400 mg of this salt is dissolved in 6 ml of water ; after a few minutes , crystallization of r , s - fluoromethyl - tyrosine begins . after standing overnight at 5 ° c ., the product is filtered , washed with water , ethanol and diethyl - ether and dried in vacuo at 76 ° c ., to give r , s - α - fluoromethyl tyrosine . thirty g of n ( im ) benzyl - l - histidine is dissolved in 600 ml h 2 o and the solution heated in a high - pressure autoclave at 200 ° c . for 8 hours with shaking . the autoclave is cooled to room temperature , the clear supernatant solution evaporated in vacuo to dryness to give the r , s - α - fluoromethyl - histidine as a colorless crystal . twenty g of rac . n ( im ) benzyl - histidine is dissolved in 1 l of hot water , then 40 g of basic cupric carbonate is added in portions and the mixture refluxed with stirring for 1 hour . the mixture is filtered while hot and the filtrate is evaporated in vacuo to give cu chelate of racemic n ( im ) benzyl - histidine as a blue solid . a mixture of 31 ml of formalin ( 38 % h 2 co ), 3 . 1 ml of pyridine and 2 . 13 g of na 2 co 3 is heated with stirring to 70 ° c . then 20 g of the above named cu - chelate is added and the system heated and stirred at 75 ° for 90 minutes . evaporation in vacuo gives a blue solid residue . this is dissolved in a mixture of 50 ml of h 2 o with 50 ml of conc . nh 4 oh and charged onto a cation - exchange resin column ( dowex 50 - x - 8 , 300 ml resin in the nh 4 - form ) and eluted with 2 m aq . nh 4 oh solution . the effluent is monitored with lkb uvicord ii uv absorption monitor and the 1 . 1 l . portion of the effluent with uv absorption is combined , evaporated in vacuo to a solid . the residue is dissolved in a mixture of 60 ml of h 2 o with 5 ml of conc . aq . nh 4 oh and charged onto an anion exchange resin column ( 300 ml of dowex 1 - x - 2 resin in the oh - form ). the column is washed with water ( 2 l .) and eluted with 2 m aq . hcl , monitored with a uvicord ii for uv absorption . the effluent fractions with ultraviolet absorption were combined and evaporated to dryness , to give substantially pure hcl salt of n ( im ) benzyl - α - hydroxymethylhistidine ( ii ) ( new compound ). this compound is transformed into α - hydroxymethyl - histidine ( iii ) in the following way : 12 . 5 g of ii is dissolved in 200 ml of liquid nh 3 ( 3 - neck flask , equipped with &# 34 ; cold - finger &# 34 ; condenser filled with dry - ice - acetone ), then sodium is added ( 5 . 5 g , cut in small pieces ) until the blue color persists for ˜ 10 minutes . nh 4 cl is added then to consume the excess the excess na ( indicated by decolorization ) and the nh 3 solvent is allowed to evaporate under a stream of n 2 . the product iii thus obtained is purified by chromatography on a cation - exchange resin column ( 2 . 2 l . of dowex - 50 - x - 8 , 200 / 400 mesh ). crude iii is dissolved in 100 ml of h 2 o and applied onto the resin column . the column is washed first with water ( 4 l .) then developed with aq . hcl ( 1 . 5 m , then 2 m ). 20 ml fractions are collected , flow rate 600 ml / h . ______________________________________fraction no . pauly reaction______________________________________ 1 - 400 1 . 5m hcl - 401 - 670 2m hcl - 671 & amp ; later + ______________________________________ fractions 671 - 760 are combined and evaporated in vacuo to dryness , to give iii : r , s - α - hydroxymethylhistidine 2 hcl ( new compound ). two and 73 / 100 g of r , s - α - hydroxymethylhistidine . 2 hcl ( iii ) is dissolved in 70 ml of liq . hf , then evaporated to dryness by passing in a stream of n 2 . the residue thus obtained represents the hydrofluoride salt of α - hydroxymethylhistidine . it is redissolved in 200 ml of liq . hf ( dry - ice - acetone cooling bath ), then 9 ml sf 4 is passed in ( measured as liquid at - 78 ° c .). the solution is stored overnight , while being kept in a cooling bath of - 12 ° c . the solution is saturated then with bf 3 gas , left standing for 5 hours , saturated then with bf 3 gas , left standing for 5 hours , saturated again at - 12 ° c . and left aging at the same temperature for 66 hours . the cooling - bath is then removed and the solvent evaporated by passing in a stream of n 2 . the residue represents mainly hbf 4 salt of α - fluoromethyl - histidine . this is dissolved in 100 ml of 2 . 5 m aq . hcl , evaporated to dryness and transformed into the hcl salt as follows : it is redissolved in h 2 o and applied onto a cation - exchange resin column ( 100 ml of ag50 - x - 2 , 200 / 400 mesh ), eluted with h 2 o until effluent is neutral and free of f - . the product is released then from the column by 3 m aq . hcl , evaporated to dryness in vacuo , to result in a residue , consisting mainly of dihydrochloride of iv . for final purification , this is rechromatographed on another ag - 50 - x - 2 column ( 900 ml resin ). elution with : the desired product iv was located by pauly test . fractions 390 - 470 are combined , evaporated to dryness in vacuo , to give pure dihydrochloride of iv . recrystallization from water - isopropanol ( 1 : 9 v / v ) gives the crystalline monohydrochloride salt of α - fluoromethyl - histidine , m . p . 226 °- 7 ° ( dec .). copper chelate of r , s - δ - n - benzoylornithine ( 7 . 995 g ) is added in small portions onto a mixture made of formalin ( 38 % h 2 co ; 12 . 45 ml ), pyridine ( 1 . 25 ml ), and sodium carbonate ( 0 . 81 g ) at ˜ 70 ° c ., under mechanical stirring . after further 90 minutes stirring at 75 ° c ., it is evaporated to dryness in vacuo , the dark blue residue dissolved in a mixture of 30 ml of h 2 o and 30 ml of conc . aq . nh 3 solution and charged to a cation - exchange resin column ( 130 ml of dowex 50 - x - 8 in the nh 4 + form ) to remove cu 2 + . the column is eluted with 250 ml of 2 m aq . nh 3 and the effluent evaporated to dryness in vacuo . the residue is redissolved in h 2 o and applied onto an anion exchange resin column ( dowex 1 - x - 2 , oh - form , 130 ml resin ). the column is washed with h 2 o ( 250 ml ) and eluted with 3 m aq . hcl . the hcl effluent is concentrated in vacuo to give r , s - α - hydroxymethyl - δ - n - benzoyl - ornithine . three and 5 / 10 g of the product obtained in ( a ) is dissolved in 40 ml of 6 m aq . hcl and refluxed for 21 hours . the solution is extracted with toluene ( 2 × 40 ml ) and the aqueous phase evaporated in vacuo to dryness , to give r , s - α - hydroxymethyl - ornithing dihydrochloride ( new compound ). one and 1 / 10 g of the product obtained under ( b ) is placed into a reactor , the reactor immersed into a dry - ice - acetone bath and hf gas passed in until hf solution of ˜ 25 ml volume is formed in the reactor . the cooling bath is removed and the solvent evaporated by passing in a stream of n 2 . the residue thus obtained represents the hf salt of r , s - α - hydroxymethyl - ornithine . this residue is redissolved in hf , by cooling the reactor in the dry - ice - acetone bath and passing in hf gas until 50 ml volume is reached . sf 4 gas is passed in ( 4 ml as measured in liquid state at - 78 ° c . ), the dry - ice - acetone cooling bath removed and replaced by a bath kept at - 15 ° c . after aging for 16 hours at - 15 ° c ., bf 3 gas is passed in for saturation . after 5 hours further aging , the cooling bath is removed and the solvent evaporated by passing in a stream of n 2 . the residue is dissolved in 6 m aq . hcl , evaporated to dryness in vacuo and redissolved in h 2 o ( 10 ml ). this solution is applied onto a dowex 50 - x - 8 cation - exchange resin column ( 400 ml resin , 200 / 400 mesh , h + form ). the column is first washed with h 2 o ( 800 ml ); elution with 2 m aq . hcl , 15 ml fractions are collected . flow rate 600 ml / h . every 5th fraction is spotted on tlc plate and developed with ninhydrin spray . fractions no . 171 - 220 are combined and evaporated to dryness in vacuo , to deliver a mixture of amino acids , the main component being r , s - α - fluoromethyl - ornithine 2 hcl . for further purification , this product is rechromatographed on another column , made of dowex 50 - x - 8 cation exchange resin ( 200 / 400 mesh ). for development , the dolumn is first washed with water , then eluted with 1 . 5 aq . hcl , flow rate 0 . 6 l ./ h . 20 - ml fractions are collected . the residue obtained on evaporation of fractions no . 521 - 540 represents pure r , s - α - fluoromethyl - ornithine dihydrochloride . | 2 |
fig1 depicts a closed circuit system consisting of a compressor 1 with casting 1 a , suction line 8 , condenser 2 , evaporator 3 , suction accumulator 7 with inlet 5 connected to said evaporator 3 by line 4 , two outlets 6 and 9 , said outlet 6 connected to said compressor 1 by said suction line 8 , said outlet 9 connected to said casting 1 a by oil return line 10 , and controller 11 placed on said oil return line 10 to adjust the oil - refrigerant mixture flow . regulator 13 with set - point adjustment 14 is connected to said compressor 1 by line 15 and electrically connected to said controller 11 by line 12 . refrigerant vapor compressed in the compressor 1 enters the condenser 2 where it becomes a liquid and enters the evaporator 3 where it is boiled . the refrigerant vapor containing oil enters the suction accumulator 7 through line 4 and then through inlet 5 . the mixture is separated in said suction accumulator 7 into a vapor and a liquid part containing mainly oil and some liquid refrigerant . the mixture containing oil and liquid refrigerant is drawn to the compressor 1 from the suction accumulator 7 through outlet 9 by return line 10 . when the initial part of this mixture , containing an excess of liquid refrigerant , enters said casting 1 a of said compressor 1 , the oil pressure in said compressor 1 immediately decreases to a level that is still above the minimum level allowed for the bearings ( not shown ) of said compressor 1 to work safely . regulator 13 monitors the oil pressure value of the compressor 1 and compares this pressure value to that installed on set - point adjustment 14 . when this first reduction of oil pressure occurs , the controller 11 closes the line 10 and prevents the entrance of liquid oil - refrigerant mixture into the compressor 1 . in a short period of time liquid refrigerant in the compressor 1 evaporates , the oil pressure increases , the regulator 13 opens the controller 11 , and the oil continues to return to the compressor 1 . this system provides an uninterrupted safe operation of the compressor . fig2 depicts a closed circuit system consisting of compressor 1 with casting 1 a , suction line 16 , condenser 2 , evaporator 3 connected by said suction line 16 to said compressor 1 and to said condenser 2 , and controller 11 which is placed on said suction line 16 . regulator 13 with set - point adjustment 14 is connected to said compressor 1 by line 15 and electrically connected to said controller 11 by line 12 . refrigerant vapor becomes compressed in the compressor 1 and enters the condenser 2 where it becomes a liquid and enters the evaporator 3 where it is boiled . the refrigerant vapor containing oil is drawn to the compressor 1 by suction line 16 . when the initial part of this mixture containing an excess of liquid refrigerant enters the casting 1 a of said compressor 1 , and the oil pressure in said compressor 1 immediately decreases to a level that is still above the minimum level allowed for the bearings ( not shown ) of said compressor 1 to work safely . the regulator 13 monitors the oil pressure value of the compressor 1 , comparing this pressure value to the one established on set point adjuster 14 . controller 11 closes the line 16 when the target pressure is reached . this prevents the entrance of liquid oil - refrigerant mixture into the compressor 1 . in a short period of time liquid refrigerant in the compressor 1 evaporates , the oil pressure increases , the regulator 13 opens the controller 11 and the oil continues to return to the compressor 1 . this system provides uninterrupted safe operation of the compressor . fig3 depicts a closed circuit system consisting of compressor 1 with casting 1 a , suction line 16 , condenser 2 , evaporator 3 connected by said suction line 16 to said compressor 1 and connected to said condenser 2 by line 17 , and controller 11 which is placed on said line 17 . regulator 13 connected to said compressor 1 by line 15 , and electrically connected to said controller 11 by line 12 . refrigerant vapor compresses in the compressor 1 and enters the condenser 2 where it becomes a liquid and enters the evaporator 3 where it is boiled . the refrigerant vapor containing oil is drawn to the compressor 1 by suction line 16 . when the initial part of this mixture containing an excess of liquid refrigerant enters the casting 1 a of said compressor 1 , the oil pressure in said compressor 1 immediately decreases to a level that is still above the minimum level allowed for the bearings ( not shown ) of said compressor 1 to work safely . the regulator 13 monitors the oil pressure value of the compressor 1 , comparing this pressure value to the one installed on the set - point adjuster 14 , and closes the line 17 by means of controller 11 . controller 11 closes the line 16 when the target pressure is reached . this prevents the entrance of liquid oil - refrigerant mixture into the compressor 1 . in a short period of time liquid refrigerant in the compressor 1 evaporates , the oil pressure increases , the regulator 13 opens the controller 11 , and the oil continue to return to the compressor 1 . this system provides an uninterrupted safe operation of the compressor . while this invention has been illustrated and described in accordance with the preferred embodiments , it is recognized that variations and changes may be made therein without departing from the invention as set forth in the claims . | 5 |
the present invention provides an acetabular cup for canine hip replacements . the acetabular cup comes in a range of sizes comprising 24 mm , 26 mm , 28 mm , 30 mm and 32 mm , which are adapted for association with a common femoral head having a diameter of 17 mm . the surgeon may choose the size of the acetabular cup based on the bone size of the dog . if for any reason , a sized acetabular cup will not fit properly into an existing reamed cavity the next size of acetabular cup may be used by selecting the next reamer size , creating a hip implant that matches the femoral head and femoral prosthesis . in this manner , the canine acetabular cup system provides a variety of acetabular cup sizes that match precisely with a 17 mm femoral head , enabling reliable hip replacement procedures . in addition , each of the acetabular cups has a 45 degree cutout truncated section in one side thereof . advantageously , the truncated cutout section enables extended hip motion in the cutout direction , allowing the dog to sit on its stomach while extending the hind legs . the present canine acetabular cup is especially suited for use in cementless hip replacement procedures wherein an acetabular cup composed of an outer ti — al — v shell with a porous coating and an inner polyethylene liner is interference press fitted into a bone cavity using a cementless fixation procedure . the interference is carefully controlled so that the porous coating of the implanted acetabular cup makes intimate contact with the bone encouraging long term bone ingrowth . due in part to the carefully controlled interference between the reamed bone cavity and the acetabular cup , and the reduced body weight of a dog , the implanted device is available for use immediately after surgery . based on clinical and research results , it has been established that during this initial stability phase there must be less than 150 μm of motion between the acetabular cup and the bone to allow the bone an opportunity to grow into the pores of the outer surface of the shell . motion exceeding this threshold during the initial stability phase of the procedure has been shown to result in fibrous tissue ingrowth in the porous outer surface . this , in turn , can result in loosening of the joint components and revision surgery . the motion of the acetabular cup in the acetabular cup system is limited to well below the 150 μm limit due to the carefully controlled interference fit and the friction provided by the porous coating of sintered chemically pure titanium beads on the outer surface of the ti — al — v acetabular cup shell . long term stability is thus assured by intimate contact between the porous surface of the implanted device and the underlying bone . the convex outer surface of the ti — al — v shell is coated with titanium beads , typically 250 μm ± 50 μm ( 0 . 01 ± 0 . 0025 inches ), which are sintered to the ti — al — v cup shell , maintaining porosity between the beads . the coating typically has a thickness of 0 . 8 mm ( 0 . 030 inches ). the ti — al — v shell is typically 2 mm thick with the sintered titanium beads attached . the outer dimensions of the ti — al — v shell is chosen so that it produces an interference fit with a specially milled cavity in the bone where the ti — al — v shell will be placed , with an interference of 0 . 75 to 1 . 2 mm across the diameter . the outer convex surface of the ti — al — v shell is multiply curved to bring the above interference from zero at an angular location of 50 degrees from the apex to 0 . 75 to 1 . 2 mm at 90 degrees from the apex . this increasing interference along the distance from the apex allows intimate contact between the bonded chemically pure sintered ti beads and the bone , resulting in rapid bone ingrowth development . this interference as well as the rough outer surface of the ti — al — v shell increases the friction between the bone and the ti — al — v shell , preventing the movement of the implant within the bone cavity , and permits use of canine legs immediately after surgery . the articular inner surface of the acetabular cup comprises an uhmw polyethylene astm f - 648 insert that is permanently pre - assembled at the factory and is held in place within the acetabular cup without any possibility of rotational , lateral or vertical displacement . the uhmw polyethylene insert also provides for long - term success by providing sufficient thickness for wear and an assembly , which resists disassociation . if insert assembly is inadequate , it can lead to excessive motion between the insert and shell , producing wear debris and eventual loosening through wear debris - induced osteolysis . the mechanical lock between the insert and shell must resist torsional fatigue and offset loading , which could be induced through neck impingement with the femoral stem in extreme ranges of motion . the uhmw polyethylene insert has a typical thickness of 2 . 4 mm to 6 . 4 mm ( 0 . 1 to 0 . 25 inches ) based on the size of the acetabular cup . insert thickness is sufficient to withstand wear during normal operation of the acetabular cup over the dog &# 39 ; s lifetime . the uhmw polyethylene insert is locked into the ti — al — v shell by use of an elongated post , which is not circular in cross section . the elongated post , which is 0 . 24 inches long and 0 . 155 inches wide having full radius in the uhmw polyethylene insert , mates with a corresponding elongated opening located in the dome of the ti — al — v cup shell , thus preventing relative rotational movement of the uhmw polyethylene insert within the ti — al — v cup shell . in addition , a retaining groove milled into the uhmw polyethylene insert , mates with a corresponding interior projection in the ti — al — v shell preventing lateral or vertical movement of the uhmw polyethylene insert with respect to the ti — al — v shell , even when high loads are applied during the lifetime use of the canine acetabular cup . insertion of the uhmw polyethene insert into the ti — al — v cup shell is possible due to the elastic compliance of the uhmw polyethylene insert which can be pressed into the ti — al — v cup shell . also , the dimensions of the uhmw polyethylene insert are chosen so that a general interference fit exists between the outer surface of the uhmw polyethylene insert and the concave inner surface of the ti — al — v cup shell . the uhmw polyethylene insert essentially has a lip that completely surrounds the outer edge of the ti — al — v cup shell , preventing metal to metal contact between the ti — al — v cup shell rim and a femoral head that is placed within the uhmw polyethylene insert . the lip also adds to the stability of retention of the uhmw polyethylene insert against the ti — al — v cup shell . the face of the ti — al — v shell and the uhmw polyethylene insert are chamfered at 51 °. this avoids point contact between the acetabular cup and the femoral stem in extreme ranges of motion as demanded by certain motions such as when a dog spreads his hind legs while lying on his stomach . the manufactured canine acetabular cup , which has the uhmw polyethylene insert permanently attached to the ti — al — v cup shell at the factory , is produced in various sizes that match the requirements of dogs . typically , the outer diameter of the canine acetabular cup is 24 , 26 , 28 , 30 , or 32 mm . the inner diameter of the uhmw polyethylene insert is always maintained at 17 mm to allow mating with a 17 mm femoral head . since the thickness of the ti — al — v shell is always 1 . 2 mm , the thickness of the uhmw polyethylene insert is a function of the diameter of the canine acetabular cup and varies from 2 . 4 to 6 . 4 mm , the larger thickness corresponding to a larger diameter canine acetabular cup . bone drilling cutters are provided for each size of the canine acetabular cup , and result in interference of 0 . 75 mm to 1 . 2 mm across the diameter . larger interference is used for a larger diameter bone cavity . the cutting tool for creating the cavity in the bone has four tool inserts , which cut out the spherical bone cavity to the required dimensions ., fig1 a is a schematic view depicting the side view and fig1 b is a schematic view depicting the top view of the canine acetabular cup in an assembled condition , illustrating the basic features of the cup . the ti — al — v shell 1 is shown with chemically pure sintered titanium beads 3 on the surface of the ti — al — v shell . a uhmw polyethylene insert 4 is placed within the ti — al — v shell , pre - assembled at the factory . fig2 is a schematic diagram depicting the canine acetabular cup in an assembled condition . a truncated section 5 of the canine acetabular cup is created for increased abduction of the hip joint , a feature that provides enhanced movement of the hip joint which is necessary to accommodate the movement requirements of a dog . a groove 6 on the uhmw polyethylene insert 4 mates with a interior projection 9 on the ti — al — v shell preventing lateral or vertical movement of the uhmw polyethylene insert with respect to the ti — al — v shell . a non - circular post 10 in the uhmw polyethylene insert mates with an elongated opening 7 in the t — al — v shell preventing rotational movement of the insert within the shell . the uhmw polyethylene insert has a lip 8 on the basal plane surface of the polyethylene insert preventing contact between femoral components and the ti — al — v shell . fig3 a is an engineering drawing detailing the dimensions and construction of a typical ti — al — v shell 1 . fig3 b is the frontal view of the canine acetabular cup of fig3 a taken along line xx , detailing the non - circular cylindrical opening at the apex of the ti — al — v shell . the shell is manufactured with an outer dimension to mate with a reamed bone cavity having a diameter of approximately 24 , 26 , 28 , 30 and 32 mm , with an interference of 0 . 75 to 1 . 2 mm ( 0 . 03 inches to 0 . 05 inches ) measured at the basal plane of the canine acetabular cup , with larger interference associated with larger diameter canine acetabular cups . the interference is zero at 50 degrees from the apex of the ti — al — v shell and increases to full value at 90 degrees from the apex . thus , the outer surface of the shell has multiple curvatures with the maximum interference occurring closer to the basal plane of the canine acetabular cup . the shell is made from ti — al — v or cobalt chrome , tantalum alloy with typical wall thickness of 1 . 2 mm ( 0 . 05 inches ). the chemically pure titanium beads , sintered on the outer surface of the shell and held in between the circumferential ribs has a dimension of 250 ± 50 μm ( 0 . 01 ± 0 . 0025 inches ). the apex of the ti — al — v shell comprises an elongated cylindrical opening , which is 6 by 3 . 8 mm ( 0 . 240 inches by 0 . 152 inches ). this opening is adapted to receive a cylindrical post in the polyethylene insert to prevent the rotational movement of the polyethylene insert with respect to the ti — al — v shell . in addition , the inner surface of the shell has an interior projection at a distance of 4 mm ( 0 . 159 inches ) from the base surface of the ti — al — v shell that mates with a groove in the polyethylene insert and locks it , preventing horizontal or vertical movement . the edge of the shell at the bottom surface is tapered to accept the polyethylene insert . the right side of the cup is cut out to produce a truncated section at the 45 degree angle , as shown , to provide increased movement of the hip joint in the plane of the drawing . fig4 a is an engineering drawing detailing the dimensions and construction of a typical uhmw polyethylene insert 4 . fig4 b is a frontal view of fig4 a taken along line zz , depicting the design and dimensions of the uhmw polyethylene insert and the details of the non - circular cylindrical post at the apex . the polymeric insert has a cylindrical post at the apex which is 6 mm by 3 . 8 mm ( 0 . 236 inches by 0 . 155 inches ) and is designed to mate with the elongated opening in the ti — al — v shell . the external surface of the polyethylene insert has a groove which mates with the circumferential rib or projection on the interior surface of the shell . the inner surface of the polyethylene insert has a dimension of 17 mm ( 0 . 68 inches ) regardless of its outer dimension or shell size and is designed to engage with a 17 mm femoral head . the polyethylene insert has a wear thickness of 2 . 4 to 6 . 4 mm ( 0 . 1 to 0 . 2 inches ) depending on the overall size of the canine acetabular cup . a larger size canine acetabular cup has a larger polyethylene insert wear thickness , since it mates with a common diameter femoral head of 17 mm ( 0 . 68 inches ). the bottom edge of the polyethylene insert has a lip which mates with the taper in the ti — al — v shell , thus covering the entire surface of the shell and preventing metal to metal contact between the femur hardware and the ti — al — v shell . the right side of the polyethylene insert is cut out to create a truncated section at 45 degrees as shown in fig4 . there is a corresponding truncated section at 45 degrees cut out of the ti — al — v shell . the truncated section provides extended movement of the canine femur . fig5 diagrammatically depicts parameters required to achieve an interference fit . the figure shows a cross section perpendicular to the sheet of the drawing of fig3 a , 3 b , 4 a and 4 b , taken along the lines x — x and z — z . the reamed bone cavity precisely matches the 26 mm ti — al — v shell for 50 degrees from apex with no interference . the interference increases from this zero value to 1 mm interference as the angle is increased from 50 to 90 degrees from the apex , 1 mm being the interference value for a 26 mm ti — al — v shell . the ti — al — v shell has a 3 mm cylindrical section where the interference is fully maintained . fig6 is a diagram illustrating the head of an acetabular spherical reamer . reamers are provided for each size of the canine acetabular cup , and are especially shaped to precisely machine out spherical cavities of 24 , 26 , 28 , 30 and 32 mm . these cutters overlap and ream out a spherical bone cavity . 1 . a canine acetabular cup having a cutout truncated section at 45 degrees , for increased abduction to provide enhanced movement of the canine hip joint that meets the movement requirements of a dog ; 2 . a spherical dome of the t - al — v shell encompassing a 50 ° arc to either side of centerline ; which mates with a line - to - line fit with the bone preparing spherical reamer ; 3 . a section below the dome , which is composed of multi - conical sections adapted to provide a gradually increasing interference fit with the spherically prepared bone ; each of the sections beginning at 50 ° and continuing through 90 °, and the interference beginning at zero and increasing to 0 . 75 mm to 1 . 2 mm depending on the tolerances between the implant and instruments ; 4 . a section below the conical sections , which is a cylinder and has a designed interference with the bone preparation of 0 . 75 mm to 1 . 2 mm , depending on the tolerances between the implant and instruments ; 5 . a truncated section of the conical and cylindrical sections , which provides for increased abduction ( i . e . increased range of motion when the dog spreads his hind legs and lies on its stomach ); and 6 . a circumferential groove disposed within the cylindrical section , that assists the insert to lock onto the cup and provides for a stable and controllable insertion of the polyethylene insert . having thus described the invention in rather full detail , it will be understood that such detail need not be strictly adhered to , but that additional changes and modifications may suggest themselves to one skilled in the art , all falling within the scope of the invention as defined by the subjoined claims . | 0 |
the claimed subject matter is now described with reference to the drawings . in the following description , for purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of the claimed subject matter . it may be evident , however , that the claimed subject matter may be practiced with or without any combination of these specific details , without departing from the spirit and scope of this invention and the claims . the inventive method is a segment of an overall systems approach to health care . this systems approach to health care can be envisioned as a pyramid with the systems approach as the tip of the pyramid . underneath this systems approach to health care is systems integration diagnostics and treatment . systems integration diagnostics and treatment is the concept that all human systems are connected ( i . e . the endocrine system is connected to the nervous system is connected to the circulatory system ). the diagnosis and treatment of one system cannot be performed in isolation of other systems . a physician should consider information and readings of all distinct systems when diagnosing and treating an issue presented by a patient . under the systems integration diagnostics and treatment are brain and organ remapping neuroplasticity treatments . these treatments are separate treatments which are utilized to effect brain remapping and neuroplasticity in a patient . under the brain and organ remapping neuroplasticity treatments are organ remapping and brain remapping . the procedures falling under organ remapping are neurovisceral applications which are a specific set of applications which affect remapping and neuroplasticity related to the patient &# 39 ; s organs . the procedures falling under brain remapping are brain based applications which are a specific set of applications which affect remapping and neuroplasticity in the patient &# 39 ; s brain . the procedures of neurovisceral applications and brain based applications produce restoration of function through neurogenesis . underlying this restoration of process is the concept that the end product of these procedures is functional neurology . this is the concept that many problems and issues presented in a patient can be fixed through restoring the proper function of the nervous system . underneath all of these is the concept of modern neuroscience treatment procedures and protocol . this concept is a shift in paradigm from the method of treating a patient &# 39 ; s health problems in distinct and isolated segments . under current medical philosophy a physician treats only the current issue presented by the patient at the moment of treatment . sidt procedures and protocols in modern neuroscience treatment changes this to the philosophy that the patient cannot be treated in increments but instead that the physician must treat the entire patient , considering all systems of a patient when diagnosing and treating the health issue presented . the inventive method is easiest to understand when viewed in light of knowledge of the anatomy and physiology of the human nervous system . the human nervous system comprises the central nervous system and peripheral nervous system . the brain and the spinal cord make up the central nervous system . the largest mass of the brain is the cerebrum . the cerebrum comprises the outer gray matter that is the cortex and several deep nuclei that are split into functional groups . within the cerebrum is the limbic cortex which is part of the limbic system . the hypothalamus , a part of the limbic system , is involved in regulating homeostasis . the hypothalamus is the region of the brain in charge of the autonomic nervous system and the endocrine system . the peripheral nervous system is everything that is not the central nervous system . the nerves of the peripheral nervous system can have structures called ganglia . a ganglion is a group of neuron cell bodies in the periphery . ganglia can be categorized as either sensory ganglia or autonomic ganglia . the most common type of sensory ganglion is a dorsal ( posterior ) root ganglion . these ganglia are the cell bodies of neurons with axons that are sensory endings in the periphery , such as in the skin , and that extend into the cns through the dorsal nerve root . the other major category of ganglia are those of the autonomic nervous system , which is divided into the sympathetic and parasympathetic nervous systems . the sympathetic chain ganglia are a row of ganglia along the vertebral column that receive input from the lateral horn of the thoracic and upper lumbar spinal cord . superior to the chain ganglia are three paravertebral ganglia in the cervical region . three other autonomic ganglia that are related to the sympathetic chain are the prevertebral ganglia , which are located outside of the chain but have similar functions . they are referred to as prevertebral because they are anterior to the vertebral column . the neurons of these autonomic ganglia are multipolar in shape , with dendrites radiating out around the cell body where synapses from the spinal cord neurons are made . the neurons of the chain , paravertebral , and prevertebral ganglia then project to organs in the head and neck , thoracic , abdominal , and pelvic cavities to regulate the sympathetic aspect of homeostatic mechanisms . in addition , there are a group of terminal ganglia that receive input from cranial nerves or sacral spinal nerves and are responsible for regulating the parasympathetic aspect of homeostatic mechanisms . these two sets of ganglia , sympathetic and parasympathetic , often project to the same organs — one input from the chain ganglia and one input from a terminal ganglion — to regulate the overall function of an organ . for example , the heart receives two inputs such as these ; one increases heart rate , and the other decreases it . the terminal ganglia that receive input from cranial nerves are found in the head and neck , as well as the thoracic and upper abdominal cavities , whereas the terminal ganglia that receive sacral input are in the lower abdominal and pelvic cavities . nerves are fibers of nerve cells extending from the central nervous system and are categorized as either cranial nerves extending from the brain or spinal nerves connected to the spinal cord . cranial nerves are primarily responsible for the sensory and motor functions of the head and neck . of the cranial nerves , the vagus nerve is responsible for contributing to homeostatic control of the organs of the thoracic and upper abdominal cavities . the vagus nerve primarily targets autonomic ganglia in the thoracic and upper abdominal cavities . the nerves connected to the spinal cord are the spinal nerves . all of the spinal nerves are combined sensory and motor axons that separate into two nerve roots . the sensory axons enter the spinal cord as the dorsal nerve root . the motor fibers , both somatic and autonomic , emerge as the ventral nerve root . the dorsal root ganglion for each nerve is an enlargement of the spinal nerve . referring to fig1 , there are 31 spinal nerves , named for the level of the spinal cord at which each one emerges . there are eight pairs of cervical nerves designated c1 to c8 , twelve thoracic nerves designated t1 to t12 , five pairs of lumbar nerves designated l1 to l5 , five pairs of sacral nerves designated s1 to s5 , and one pair of coccygeal nerves . the nerves are numbered from the superior to inferior positions , and each emerges from the vertebral column . spinal nerves extend outward from the vertebral column to enervate the periphery . the nerves in the periphery are not straight continuations of the spinal nerves , but rather the reorganization of the axons in those nerves to follow different courses . axons from different spinal nerves will come together into a systemic nerve . this occurs at four places along the length of the vertebral column , each identified as a nerve plexus . of the four nerve plexuses , two are found at the cervical level , one at the lumbar level , and one at the sacral level . the cervical plexus is composed of axons from spinal nerves c1 through c5 and branches into nerves in the posterior neck and head , as well as the phrenic nerve , which connects to the diaphragm at the base of the thoracic cavity . spinal nerves c4 through t1 reorganize through the brachial plexus to give rise to the nerves of the arms . the lumbar plexus arises from all the lumbar spinal nerves and gives rise to nerves enervating the pelvic region and the anterior leg . the sacral plexus comes from the lower lumbar nerves l4 and l5 and the sacral nerves s1 to s4 . spinal nerves of the thoracic region , t2 through t11 , are not part of the plexuses . these plexuses contain fibers that serve sensory functions or fibers that serve motor functions . some fibers extend from cutaneous or other peripheral sensory surfaces and send action potentials into the central nervous system . those are axons of sensory neurons in the dorsal root ganglia that enter the spinal cord through the dorsal nerve root . other fibers are the axons of motor neurons of the anterior horn of the spinal cord , which emerge in the ventral nerve root and send action potentials to cause skeletal muscles to contract in their target regions . sensory receptors help us learn about the environment around us , or about the state of our internal environment . stimuli are received and changed into the electrochemical signals of the nervous system . this occurs when a stimulus changes the cell membrane potential of a sensory neuron . the stimulus causes the sensory cell to produce an action potential that is relayed into the central nervous system , where it is integrated with other sensory information to become a conscious perception of that stimulus . stimuli in the environment activate specialized receptor cells in the peripheral nervous system . different types of stimuli are sensed by different types of receptor cells . physical stimuli , such as pressure and vibration , as well as the sensation of sound and body position ( balance ), are interpreted through a mechanoreceptor . another physical stimulus that has its own type of receptor is temperature , which is sensed through a thermoreceptor that is either sensitive to temperatures above ( heat ) or below ( cold ) normal body temperature . physical touch on the skin can be subdivided into pressure , vibration , stretch , and hair - follicle position , on the basis of the type of mechanoreceptors that perceive these touch sensations . other overlooked senses include temperature perception by thermoreceptors and pain perception by nociceptors . somatosensation is the group of sensory modalities that are associated with touch , proprioception , and interoception . these modalities include pressure , vibration , light touch , tickle , itch , temperature , pain , proprioception , and kinesthesia . many of the somatosensory receptors are located in the skin , but receptors are also found in muscles , tendons , joint capsules , ligaments , and in the walls of visceral organs . two types of somatosensory signals that are transduced by free nerve endings are pain and temperature . these two modalities use thermoreceptors and nociceptors to transduce temperature and pain stimuli , respectively . temperature receptors are stimulated when local temperatures differ from body temperature . some thermoreceptors are sensitive to just cold and others to just heat . nociception is the sensation of potentially damaging stimuli . mechanical , chemical , or thermal stimuli beyond a set threshold will elicit painful sensations . stressed or damaged tissues release chemicals that activate receptor proteins in the nociceptors . low frequency vibrations are sensed by mechanoreceptors called merkel cells , also known as type i cutaneous mechanoreceptors . merkel cells are located in the stratum basale of the epidermis . deep pressure and vibration is transduced by lamellated ( pacinian ) corpuscles , which are receptors with encapsulated endings found deep in the dermis , or subcutaneous tissue . light touch is transduced by the encapsulated endings known as tactile ( meissner ) corpuscles . follicles are also wrapped in a plexus of nerve endings known as the hair follicle plexus , which detect the movement of hair at the surface of the skin . stretching of the skin is transduced by stretch receptors known as bulbous corpuscles . bulbous corpuscles are also known as ruffini corpuscles , or type ii cutaneous mechanoreceptors . in summary : free nerve endings in the dermis respond to the stimuli of pain , temperature , and mechanical deformation ; mechanoreceptors in the dermis respond to the stimulus of vibration ; bulbous corpuscles in the dermis respond to the stimulus of stretch ; tactile corpuscles in the dermis respond to the stimuli of light touch and vibration ; lamellated corpuscles in the dermis respond to the stimuli of pressure and vibration ; hair follicle plexi in the dermis respond to the stimulus of movement of hair . a sensory pathway that carries peripheral sensations to the brain is referred to as an ascending pathway , or ascending tract . the various sensory modalities each follow specific pathways through the central nervous system . tactile and other somatosensory stimuli activate receptors in the skin , muscles , tendons , and joints throughout the entire body . however , the somatosensory pathways are divided into two separate systems on the basis of the location of the receptor neurons . somatosensory stimuli from below the neck pass along the sensory pathways of the spinal cord , whereas somatosensory stimuli from the head and neck travel through the cranial nerves — specifically , the trigeminal system . the dorsal column system and the spinothalamic tract are two major pathways that bring sensory information to the brain . the axons in the dorsal column terminate in the nuclei of the medulla , where each synapses with the second neuron in their respective pathway . the second neuron in the system crosses the midline of the medulla and continues to ascend the brain stem . these axons terminate in the thalamus , where each synapses with the third neuron . the third neuron in the system projects its axons to the postcentral gyms of the cerebral cortex , where somatosensory stimuli are initially processed and the conscious perception of the stimulus occurs . the spinothalamic tract also begins with neurons in a dorsal root ganglion . these neurons extend their axons to the dorsal horn , where they synapse with the second neuron in their respective pathway . axons from these second neurons then ascend to the brain and enter the thalamus , where each synapses with the third neuron in its respective pathway . the neurons in the thalamus then project their axons to the spinothalamic tract , which synapses in the cerebral cortex . the dorsal column system is primarily responsible for touch sensations and proprioception , whereas the spinothalamic tract pathway is primarily responsible for pain and temperature sensations . the sensory pathways of the trigeminal pathway each involve three successive neurons . these nuclei receive information like that carried by the dorsal column system , such as touch , pressure , vibration , and proprioception . in the thalamus , each axon synapses with the third neuron in its respective pathway . axons from the third neuron then project from the thalamus to the primary somatosensory cortex of the cerebrum . the nervous system can be divided into two parts : the somatic nervous system and the autonomic nervous system . the somatic nervous system is associated with voluntary responses , and the autonomic nervous system is associated with involuntary responses , such as those related to homeostasis . the autonomic nervous system regulates many of the internal organs through a balance of two aspects , or divisions . the autonomic nervous system is instrumental in homeostatic mechanisms in the body . the two divisions of the autonomic nervous system are the sympathetic division and the parasympathetic division . the sympathetic system is associated with the fight - or - flight response , and parasympathetic activity is referred to by the epithet of rest and digest . homeostasis is the balance between the two systems . at each target effector , dual innervation determines activity . for example , the heart receives connections from both the sympathetic and parasympathetic divisions . the sympathetic system increases the heart rate and the parasympathetic system decreases the heart rate . to respond to a threat — to fight or to run away — the sympathetic system causes divergent effects as many different effector organs are activated together for a common purpose . more oxygen needs to be inhaled and delivered to skeletal muscle . the respiratory , cardiovascular , and musculoskeletal systems are all activated together . the digestive system shuts down so that blood is not absorbing nutrients when it should be delivering oxygen to skeletal muscles . to coordinate all these responses , the connections in the sympathetic system diverge from a limited region of the central nervous system to a wide array of ganglia that project to the many effector organs simultaneously . the complex set of structures that compose the output of the sympathetic system make it possible for these disparate effectors to come together in a coordinated , systemic change . the sympathetic division of the autonomic nervous system influences the various organ systems of the body through connections emerging from the thoracic and upper lumbar spinal cord . the majority of ganglia of the sympathetic system belong to a network of sympathetic chain ganglia that runs alongside the vertebral column . the ganglia appear as a series of clusters of neurons linked by axonal bridges . the sympathetic nerve projects to the chain ganglion at the same level as the target effector ( the organ , tissue , or gland to be innervated ). collateral ganglia , also called prevertebral ganglia , are situated anterior to the vertebral column and receive inputs from splanchnic nerves as well as central sympathetic neurons . they are associated with controlling organs in the abdominal cavity , and are also considered part of the enteric nervous system . an axon from the central neuron that projects to a sympathetic ganglion is referred to as a preganglionic fiber or neuron , and represents the output from the central nervous system to the ganglion . a postganglionic fiber — the axon from a ganglionic neuron that projects to the target effector — represents the output of a ganglion that directly influences the organ . as a response to a threat , the sympathetic system would increase heart rate and breathing rate and cause blood flow to the skeletal muscle to increase and blood flow to the digestive system to decrease . sweat gland secretion should also increase as part of an integrated response . all of those physiological changes are going to be required to occur together to run away from a threat . the neurons involved in the sympathetic system branch off in different pathways . a single preganglionic sympathetic neuron may have upwards of twenty targets that it innervates . for instance , when a fiber exits the spinal cord , one branch will synapse on a neuron in the adjacent chain ganglion . other branches will innervate collateral ganglion . all of these branches means that one preganglionic neuron can influence different regions of the sympathetic system very broadly , by acting on widely distributed organs . the sympathetic system causes changes in the body in preparation for fight or flight mechanisms of the body . the sympathetic system stimulates secretion of the sweat glands , constricts the blood vessels , dilates the pupils , decreases salivation , accelerates the heartbeat , relaxes the airways , inhibits digestion , stimulates secretion of epinephrine and norepinephrine , inhibits gut motility and secretions , and relaxes the urinary bladder . referring fig2 , the connections of the human sympathetic nervous system is illustrated . the main part of the sympathetic nervous system is the spinal cord 102 . at the higher end of the spinal cord 102 is the pons 104 and the medulla 106 . emanating from the spinal cord 102 are a plurality of spinal nerves . the spinal nerves connect into a right chain ganglia 108 and a left chain ganglia 110 . nerves emanating from the right chain ganglia 108 innervate separate sections of their respective dermatomes 100 . nerves emanating from the left chain ganglia 110 innervate separate organs . nerves emanating from the superior cervical ganglia innervate the eye 200 , lacrinal gland 202 , mucous membrane — nose and palate 204 , submaxillary gland 206 , sublingual gland 208 , mucous membrane — mouth 210 , and parotid gland 210 . the t1 through t4 spinal nerves innervate the heart 214 or larynx , trachea , or bronchi 216 . the t5 through t11 spinal nerves combine into the celiac ganglion 242 . nerves emanating from the celiac ganglion 242 innervate the esophagus / stomach 216 , the abdominal blood vessels 220 , the liver and bile duct 222 , the pancreas 224 , the adrenal gland 226 , and the small intestine 228 . a nerve from the celiac ganglion 242 innervates the superior mesenteric ganglion 244 , which then innervates the large intestine 230 . the t12 through l3 spinal nerves combine into the inferior mesenteric ganglion 246 . nerves from the inferior mesenteric ganglion 246 innervate the rectum 232 , kidney 234 , bladder 236 , gonads 238 , and external genitalia 240 . the connections of the parasympathetic division are similar to the general layout of the sympathetic division . parasympathetic preganglionic fibers primarily influence the heart , bronchi , and esophagus in the thoracic cavity and the stomach , liver , pancreas , gall bladder , and small intestine of the abdominal cavity . the postganglionic fibers from the ganglia activated by the vagus nerve are often incorporated into the structure of the organ , such as the mesenteric plexus of the digestive tract organs and the intramural ganglia . the autonomic nervous system is important for homeostasis because its two divisions compete at the target effector . the balance of homeostasis is attributable to the competing inputs from the sympathetic and parasympathetic divisions . organ systems are balanced between the input from the sympathetic and parasympathetic divisions . when something upsets that balance , the homeostatic mechanisms strive to return it to its regular state . for each organ system , there may be more of a sympathetic or parasympathetic tendency to the resting state , which is known as the autonomic tone of the system . the parasympathetic system causes changes in the human body to calm the fight or flight mechanism . the parasympathetic system slows the heartbeat , constricts the airways , stimulates digestion , stimulates intestine activity , stimulates exocrine secretions , stimulates the gallbladder to excrete bile , stimulates gut motility , stimulates urinary bladder contraction , constricts the pupil , stimulates secretion from the lachrymal gland , stimulates salivation , and stimulates sexual arousal . referring to fig3 , the human parasympathetic system is illustrated . cranial nerve iii emanates from the eddinger - westphal nucleus in the pons 104 , passes through the ciliary ganglion , and innervates the eye 200 . cranial nerve vii emanates from the super salivatory nucleus in the medulla 106 and innervates the pterygopalatine ganglion and submandibular ganglion . nerves from the pterygopalatine ganglion innervate the lacrinal gland 202 and mucous membrane — nose and palate 204 . nerves from the submandibular ganglion innervate the submaxillary gland 206 and sublingual gland 208 . cranial nerve ix emanates from the inferior salivatory nucleus in the medulla 106 and innvervates the octic ganglion . nerves from the octic ganglion innervate the mucous membrane — mouth 210 and parotid gland 212 . cranial nerve x emanates from the dorsal nucleus of the vagus nucleus ambigus in the medulla 106 and innervates the heart 214 , the larynx , trachea , and bronchi 216 , the esophagus / stomach 218 , the abdominal blood vessels 220 , the liver and bile duct 222 , the pancreas 224 , the adrenal gland 226 , the small intestine 228 , and the large intestine 230 . a nerve from the s4 level innervates the large intestine 230 , rectum 232 , kidney 234 , bladder 236 , gonads 238 , and external genitalia 240 . the nervous system comprises the brain and nerves that extend throughout the body outward from the brain . the main nerves travel down the spinal cord . nerves branch off from the spinal cord . the spinal cord has several vertebra segmenting the spinal cord , as shown by fig1 . from the top of the spinal cord are the cervical vertebrae which are designated as c1 , c2 , c3 , c4 , c5 , c6 , c7 , and c8 . connected to these are the thoracic vertebrae which are designated as t1 , t2 , t3 , t4 , t5 , t6 , t7 , t8 , t9 , t10 , t11 , and t12 . connected to these are the lumbar vertebrae which are designated as l1 , l2 , l3 , l4 , and l5 . connected to these are the sacral vertebrae which are designated as s1 , s2 , s3 , s4 , and s5 . the nerves which branch out from the spine at each vertebra innervate separate organs within the body . additionally , the nerves branching out from the spine at each vertebra also innervate a separate sections or areas of the skin , known as dermatomes . this is known as dermatomal segmentation . the location of dermatomes 100 is illustrated in fig4 a and fig4 b . nerves from c2 vertebra innervate the face and top of the back of the head . nerves from the c3 vertebra innervate the neck and portions of the arm . nerves from the c4 vertebra innervate the collar bone area and back of the neck . nerves from the c5 vertebra innervate the upper chest and base of the back of the neck . nerves from the c6 vertebra innervate the upper back and portions of the arm . nerves from the c7 vertebra innervate the back , portions of the arm , and fingers . nerves from the c8 vertebra innervate the back , portions of the arm , and fingers . nerves from the t1 vertebra innervate the back , the chest , and portions of the arm . nerves from the t2 vertebra innervate the back , the chest , and portions of the arm . nerves from the t3 vertebra innervate the back and the chest . nerves from the t4 vertebra innervate the back and the chest . nerves from the t5 vertebra innervate the mid - back and the mid - chest . nerves from the t6 vertebra innervate the mid - back and the upper abdomen . nerves from the t7 vertebra innervate the mid - back and the upper abdomen . nerves from the t8 vertebra innervate the mid - back and the mid - abdomen . nerves from the t9 vertebra innervate the mid - back and the mid - abdomen . nerves from the t10 vertebra innervate the mid - back and the mid - abdomen . nerves from the t11 vertebra innervate the lower - back and the lower - abdomen . nerves from the t12 vertebra innervate the lower - back and the lower - abdomen . nerves from the l1 vertebra innervate the upper pelvis and lower back . nerves from the l2 vertebra innervate the upper legs and lower back . nerves from the l3 vertebra innervate the upper legs and lower back . nerves from the l4 vertebra innervate the legs and lower back . nerves from the l5 vertebra innervate the legs and lower back . nerves from the s1 vertebra innervate the buttocks and legs . nerves from the s2 vertebra innervate the buttocks , genitals , and legs . nerves from the s3 vertebra innervate the buttocks and genitals . nerves from the s4 innervate the buttocks . nerves from the s5 vertebra innervate the buttocks . neuroplasticity , also known as brain plasticity , is the change of the central nervous system . neuroplastic change can occur at small scales , such as physical changes to individual neurons , or at whole - brain scales , such as cortical remapping in response to injury . behavior , environmental stimuli , thought , and emotions may also cause neuroplastic change . one component of neuroplasticity is synaptogenesis . synaptogenesis is the formation of synapses between neurons in the nervous system . activation of n - methyl - d - aspartate ( nmda ) receptor in neurons of the central nervous system initiates synaptogenesis through activation of downstream products . the heightened level of nmda receptor activity during development allows for increased influx of calcium , which acts as a secondary signal . synaptic signaling during synaptogenesis is not only activity - dependent , but is also dependent on the environment in which the neurons are located . the special structure found in the central nervous system that allows for multiple inputs is the dendritic spine , the site of excitatory synapses . this morphological dynamism is due to the specific regulation of the actin cytoskeleton , which in turn allows for regulation of synapse formation . dendritic spines exhibit three main morphologies : filopodia , thin spines , and mushroom spines . the filopodia play a role in synaptogenesis through initiation of contact with axons of other neurons . filopodia of new neurons tend to associate with multiple synapsed axons , while the filopodia of mature neurons tend to sites devoid of other partners . the dynamism of spines allows for the conversion of filopodia into the mushroom spines that are the primary sites of glutamate receptors and synaptic transmission . through a comprehensive neurological examination ( after an extensive case history and patient / doctor consultation ), regions of the nervous system that have become dysfunctional are identified . also targeted are neurological pathways that are well intact ( viable ), which connect with dysfunctional regions . these viable pathways are then manipulated ( non - surgically and non - pharmaceutically ) through various modalities that utilize various myotomal and dermatomal regions to strengthen connections with faulty regions , causing neuroplasticity and regulation and normalization of function . using these methods , the organ systems , neurological pathways that have become dysfunctional , and brain regions that have become dysfunctional are targeted and through various non - invasive procedures , electrochemical signaling between brain regions and between regions of the brain and the body is regulated and normalized . by regulating and normalizing the function of the brain and neural pathways and regulating and normalizing organ function and metabolism , symptoms and conditions are resolved in an overwhelming number of patients with a wide variety of conditions , including breathing disorders , regardless of the underlying mechanism ( however , the underlying mechanisms must be first targeted through extensive and comprehensive testing and case history analysis ). the process begins when a patient is examined by a physician . first , the patient provides information to the physician . the physician can obtain information from the patient through a number of means , such as by presenting a questionnaire to the patient . the physician determines the location of the anatomical lesion in the nervous system of the patient . the physician gets the history of the patient , including the onset of the symptoms complained of , the chronology of the symptoms presented , the quality of the patient &# 39 ; s health the severity and effect of the symptoms on the activities of the patient &# 39 ; s life , any previous treatment that the patient has undergone , medical records and imaging records , and the overall health goals of the patient . the physician also obtains the past health history of the patient , including information related to serious illnesses , hospitalizations and surgeries , any general trauma or injury , whether the patient is in menopause or is pregnant , if the patient is taking medication , whether the patient has allergies , any past diagnostic imaging such as x - ray , mri , cat - scan , doppler , or mra , prior physician care , and the results of past physical or neurological exams . the physician also obtains family and personal health history including family health problems , the patient &# 39 ; s living and environment situation , the patient &# 39 ; s amount of regular exercise , the patient &# 39 ; s interests , diet , sleep pattern , bowel habits , urinary habits , stress factors , and emotional support system . the physician also performs a general review of the systems of the patient . the physician reviews the general status of the patient &# 39 ; s systems , including weight , and any weakness , fatigue , fever , sweats , chills , anorexia , or insomnia experienced by the patient . the physician also reviews other systems of the patient including the patient &# 39 ; s skin , head , eyes , ears , nose , sinuses , throat and mouth , neck , and breasts . the physician also reviews the respiratory , cardiovascular , gastrointestinal , and genitourinary systems . the physician also reviews the female / male sexual organs and endocrine , musculoskeletal , neurological , hematologic , and psychiatric systems of the patient . after obtaining all of the prior information from the patient the physician performs a comprehensive neurological examination of the patient . the neurological examination includes reviewing the emotional attitude , orientation , attention span , speech , memory , and cognition of the patient . the physician next reviews the patient &# 39 ; s vitals and reflexes , such as deep tendon reflexes and pathological reflexes . the physician next performs a sensory exam of the patient , determines muscle strength of the patient , performs orthopedic examinations of the patient , and performs a palpation examination of the patient . the physician also performs a head and neck examination of the patient . this includes an otoscopic exam , opthalamascopic exam , chest exam , abdominal exam , and vascular exam . the physician performs a cranial nerve exam of the patient , including reviewing : blepherospasticity / clonus ; olfactory perception ; rapid eye movement ; optic alignment ; hyper / hypo ; lidlag / ptosis ; pupil size ; corectasia ; cormiosis ; pupillary reflex ; optokinetic tape ; parietal pursuit ; refixation saccade ; cerebellar termination ; cardinal gazes ; hypometria ; hypermetria ; convergence ; exophoria / esophoria ; cover / uncover ; facial paresis ; voluntary motion ; lacrimal function ( eyes / mouth ); weber &# 39 ; s ; rhinne &# 39 ; s ( mastoid ); air cond ; palatal paresis ; gag reflex ; swallowing ; head rotation ; shoulder shrug ; hypoglossal ; and corneal reflex . the physician performs celebellar and cortical testing of the patient , including reviewing : titubation ; romberg &# 39 ; s ; direction of sway ; piano ; supination / pronation ; finger to nose ; heel to toe walk ; direction of sway ; past pointing ; heel down shin ; heel tap ; rapid movement of hands ; rapid movement of thumb / index ; rapid movement of feet ; alternating sup pro ; two point disc . ; graphesthesia ; joint position sense ; heel walk ; and toe walk . the physician performs orthopedic examination of the patient , including reviewing : lower left leg ; lower right leg ; straight leg raise ; bilateral leg raise ; soto hall , leg drop ; braggard &# 39 ; s ; bilateral leg lowering ; goldthwait &# 39 ; s ; lasegue &# 39 ; s sign ; well leg raising ; kemp &# 39 ; s ; ely &# 39 ; s ; and fabere patrick &# 39 ; s . the physician performs posture analysis of the patient including reviewing : head tilt ( roll ); head rotation ( yaw ); head flexion ( positive pitch ); head extension ( negative pitch ); high shoulder ; high hip ; wt . bearing ( center of pressure ); deviation ; ellipse ( r anterior - l posterior / l anterior - r posterior ); gait ; and arm swing . the physician then performs a somatosensory evoked potential ( sep ) test . an sep test studies the relay of body sensations to the brain and how the brain receives those sensations . a stimulating electrode is placed on the patient &# 39 ; s arm or leg . the stimulating electrode then generates an electrical signal . recording electrodes are placed on the patient &# 39 ; s head and / or spine . the information received from these electrodes can be utilized to diagnose the patient &# 39 ; s issue . the sep test evaluates the health of a patient &# 39 ; s peripheral nerves and spinal cord . the sep test also tests how the patient &# 39 ; s spinal cord and / or brain transmits information about body sensations through the patient &# 39 ; s peripheral nerves . the sep test can localize a “ signal blockage ” in the patient &# 39 ; s peripheral nerves , brain , or spinal cord . when recording seps , the physician may seek to study peripheral , spinal , brainstem , and early cortical seps during the same run . recording electrodes placed on the scalp pick up both seps generated in the cortex and thalamocortical fibers ( which are picked up as near - field responses located in restricted areas ) and far - field positivities reflecting the evoked activity generated in peripheral , spinal and brainstem somatosensory fibers . the results of the sep test can be used to determine and define an anatomical level of impairment along a neural pathway or otherwise determine the existence of silent lesions . in the inventive method the physician may begin by performing a series of sep tests on the patient . in each instance , the physician may place the stimulating electrodes on a separate dermatome of the patient . the physician then causes the stimulating electrodes to generate an electrical signal which is recorded by the recording electrodes on the patient &# 39 ; s scalp . after ensuring that sufficient information is received for the first dermatome , the physician then places the stimulating electrodes on another dermatome and repeats the process . the physician repeats this testing process for all dermatomes to ensure that all neural lesions are located . through the results obtained in the testing and medical history , the physician diagnoses the cause of the symptoms . the physician is able to determine the location of the lesion in the nervous system of the patient . the method of the invention provides for treating neurological lesions by instructing the neurological pathways to bypass lesions in the neurological pathway and strengthen connections through synaptogenesis of collateral branches of the neurological pathway . these connections are strengthened by applying a physical application to a chosen dermatome . the process may be utilized in the following ways : the dermatome for c1 can be used to strengthen connections to the coronary , myocardial , and intestinal systems . in this instance the location of the neurological lesion is primarily in the brainstem or enteric nervous system . a physician applies a chosen modality to activate the c1 dermatome in this instance . the dermatome for c2 can be used to strengthen connections to the respiratory system and the kidneys . in this instance the location of the neurological lesion is primarily in the brainstem or enteric nervous system . a physician applies a chosen modality to activate the c2 dermatome in this instance . the dermatome for c3 can be used to strengthen connections to the gallbladder , gastric , and ileocecal systems . in this instance the location of the neurological lesion is primarily in the celiac ganglion , enteric nervous system or brainstem . a physician applies a chosen modality to activate the c3 dermatome in this instance . the dermatome for c4 can be used to strengthen connections to the pancreas or cecum . in this instance the location of the neurological lesion is primarily in the celiac ganglion , superior mesenteric ganglion , or enteric nervous system . a physician applies a chosen modality to activate the c4 dermatome in this instance . the dermatome for c5 can be used to strengthen connections to the spleen and glandular system . in this instance the location of the neurological lesion is primarily in the hemispheric microglia or celiac ganglion . a physician applies a chosen modality to activate the c5 dermatome in this instance . the dermatome for c6 can be used to strengthen connections to the liver and colon . in this instance the location of the neurological lesion is primarily in the nucleus solitarius brainstem or liver ganglion . a physician applies a chosen modality to activate the c6 dermatome in this instance . the dermatome for c7 can be used to strengthen connections to the adrenals and gonads . in this instance the location of the neurological lesion is primarily in the hypothalamus or pituitary axis . a physician applies a chosen modality to activate the c7 dermatome in this instance . the dermatome for c8 can be used to strengthen connections to the pinkie finger . in this instance the location of the neurological lesion is primarily in the c8 nerve root . a physician applies a chosen modality to activate the c8 dermatome in this instance . the dermatome for t1 can be used to strengthen connections to the coronary system . in this instance the location of the neurological lesion is primarily in the brainstem or enteric nervous system . a physician applies a chosen modality to activate the t1 dermatome in this instance . the dermatome for t2 can be used to strengthen connections to the myocardial system . in this instance the location of the neurological lesion is primarily in the brainstem or enteric nervous system . a physician applies a chosen modality to activate the t2 dermatome in this instance . the dermatome for t3 can be used to strengthen connections to the respiratory system . in this instance the location of the neurological lesion is primarily in the brainstem or enteric nervous system . a physician applies a chosen modality to activate the t3 dermatome in this instance . the dermatome for t4 can be used to strengthen connections to the gallbladder . in this instance the location of the neurological lesion is primarily in the celiac ganglion , enteric nervous system , or brainstem . a physician applies a chosen modality to activate the t4 dermatome in this instance . the dermatome for t5 can be used to strengthen connections to the gastric system . in this instance the location of the neurological lesion is primarily in the celiac ganglion , enteric nervous system , or brainstem . a physician applies a chosen modality to activate the t5 dermatome in this instance . the dermatome for t6 can be used to strengthen connections to the pancreas . in this instance the location of the neurological lesion is primarily in the celiac ganglion , superior mesenteric ganglion , or enteric nervous system . a physician applies a chosen modality to activate the t6 dermatome in this instance . the dermatome for t7 can be used to strengthen connections to the spleen . in this instance the location of the neurological lesion is primarily in the hemispheric microglia or celiac ganglion . a physician applies a chosen modality to activate the t7 dermatome in this instance . the dermatome for t8 can be used to strengthen connections to the liver . in this instance the location of the neurological lesion is primarily in the nucleus solitarius brainstem or liver ganglia . a physician applies a chosen modality to activate the t8 dermatome in this instance . the dermatome for t9 can be used to strengthen connections to the adrenal system . in this instance the location of the neurological lesion is primarily in the hypothalamus or pituitary axis . a physician applies a chosen modality to activate the t9 dermatome in this instance . the dermatome for t10 can be used to strengthen connections to the intestinal system . in this instance the location of the neurological lesion is primarily in the brainstem or enteric nervous system . a physician applies a chosen modality to activate the t10 dermatome in this instance . the dermatome for t11 can be used to strengthen connections to the kidneys . in this instance the location of the neurological lesion is primarily in the brain and enteric nervous system . a physician applies a chosen modality to activate the t11 dermatome in this instance . the dermatome for t12 can be used to strengthen connections to the kidneys . in this instance the location of the neurological lesion is primarily in the brainstem and enteric nervous system . a physician applies a chosen modality to activate the t12 dermatome in this instance . the dermatome for l1 can be used to strengthen connections to the ileocecal valve . in this instance the location of the neurological lesion is primarily in the celiac ganglion , enteric nervous system , or brainstem . a physician applies a chosen modality to activate the l1 dermatome in this instance . the dermatome for l2 can be used to strengthen connections to the celiac ganglion , superior mesenteric ganglion , and enteric nervous system . in this instance the location of the neurological lesion is primarily in the . a physician applies a chosen modality to activate the l2 dermatome in this instance . the dermatome for l3 can be used to strengthen connections to the glandular system . in this instance the location of the neurological lesion is primarily in the hemispheric microglia or celiac ganglion . a physician applies a chosen modality to activate the l3 dermatome in this instance . the dermatome for l4 can be used to strengthen connections to the colon . in this instance the location of the neurological lesion is primarily in the nucleus solitarius brainstem or liver ganglia . a physician applies a chosen modality to activate the l4 dermatome in this instance . the dermatome for l5 can be used to strengthen connections to the gonads . in this instance the location of the neurological lesion is primarily in the hypothalamus or pituitary axis . a physician applies a chosen modality to activate the l5 dermatome in this instance . the dermatome for s1 can be used to strengthen connections to the gallbladder and gastric system . in this instance the location of the neurological lesion is primarily in the celiac ganglion , enteric nervous system , or brainstem . a physician applies a chosen modality to activate the s1 dermatome in this instance . the dermatome for s2 can be used to strengthen connections to the pancreas and cecum . in this instance the location of the neurological lesion is primarily in the celiac ganglion , superior mesenteric ganglion , or the enteric nervous system . a physician applies a chosen modality to activate the s2 dermatome in this instance . the dermatome for s3 can be used to strengthen connections to the rectal sphincter . in this instance the location of the neurological lesion is primarily in the frontal lobe or pelvic plexus . a physician applies a chosen modality to activate the s3 dermatome in this instance . the dermatome for s4 can be used to strengthen connections to the liver or colon . in this instance the location of the neurological lesion is primarily in the nucleus solitarius brainstem or the liver ganglia . a physician applies a chosen modality to activate the s4 dermatome in this instance . the dermatome for s5 can be used to strengthen connections to the perianal area . in this instance the location of the neurological lesion is primarily in the frontal lobe or pelvic plexus . a physician applies a chosen modality to activate the s5 dermatome in this instance . the physician can choose a selected modality to activate each dermatome . the chosen modality may be any type of stimuli applied to the surface of a dermatome . the chosen modality may activate mechanoreceptors , thermoreceptors , nocireceptors , or otherwise activate the firing of nerves from the chosen dermatome . in one modality , the physician may choose to activate mechanoreceptors in the dermatome by applying physical pressure , vibration , or stretch stimuli . for instance , a physician can use a reflex hammer , such as that disclosed in u . s . pat . no . 3 , 515 , 125 ( ruskin ), u . s . pat . no . 4 , 324 , 261 ( mark et al . ), or u . s . pat . no . 5 , 657 , 763 ( schneider ) each of which is hereby fully incorporated by reference , to apply pressure to the chosen dermatome . the physician may also use the reflex hammer to stretch the patient &# 39 ; s skin at the chosen dermatome . the physician may use the reflex hammer to manually apply vibrations to the chosen dermatome . alternatively , the physician may use a tuning fork , such as that disclosed in u . s . pat . no . 1 , 880 , 923 ( eisenhour ), which is hereby fully incorporated by reference , to apply pressure or vibrations to the selected dermatome . alternatively , the physician may perform these actions utilizing a stylus of a chiropractic adjusting instrument , also known as a chiropractic activator , such as that disclosed in u . s . d269 , 812 ( lancellotti ) or u . s . pat . no . 6 , 379 , 375 ( fuhr ) each of which is hereby fully incorporated by reference . alternatively , the physician may utilize an electrical vibration device , known as an arthrostim device , such as that disclosed in u . s . pat . no . 4 , 841 , 955 ( evans et al .) or u . s . pat . no . 6 , 228 , 042 ( dungan ) each of which is hereby full incorporated by reference , to apply vibration stimuli to the chosen dermatome . the electrical vibration device has a pressure sensitive stylus which vibrates longitudinally . the electrical vibration device produces a rapid recoiling of the stylus . the electrical vibration device activates the patients &# 39 ; proprioceptors and mechanoreceptors without recruiting the nocioceptors . in another modality , the physician may choose to activate thermoreceptors in the dermatome by applying heat or a cold press to the patient &# 39 ; s skin surface . for instance , the physician could activate the thermoreceptors of a chosen dermatome with heat by applying a heating pad to the patient &# 39 ; s skin . a physician may also use cold to activate the thermoreceptors by applying ice or a cold press to the patient &# 39 ; s skin . in another modality , the physician may choose to activate nociceptors in the dermatome by presenting pain inducing stimuli to the patient &# 39 ; s skin surface . the physician may do this by applying a sharp point of a needle to the patient &# 39 ; s skin . in addition , the physician may apply a pinwheel , such as that disclosed in u . s . pat . no . 5 , 433 , 212 ( greenfield ) which is hereby fully incorporated by reference , to the patient &# 39 ; s skin at the chosen dermatome . in another modality , the physician may apply an electrical microcurrent to the dermatome . the electrical microcurrent activates the firing of nerves from the dermatome . the physician may utilize a transcutaneous electrical nerve stimulation unit ( tens unit ), such as that disclosed in u . s . pat . no . 4 , 989 , 605 ( rossen ) which is hereby fully incorporated by reference , to activate the neurons in a chosen dermatome . in this modality the physician would apply two or more electrodes to the patient &# 39 ; s skin at the chosen dermatome . the tens unit applies a high frequency series of electrical stimuli ( greater than 50 hz ) at an intensity lower than that required to initiate motor contraction . alternatively , the physician may choose to utilize a somatosensory evoked potential ( sep ) unit and method , such as that disclosed in u . s . 20060276720 ( mcginnis et al .) which is hereby fully incorporated by reference . in this modality the physician applies one or more stimulating electrodes on the chosen dermatome . the physician places one or more recording electrodes on the patient &# 39 ; s head or spine . the physician then causes the stimulating electrodes to generate an electrical signal which travels from the stimulating electrodes through a patient &# 39 ; s neural pathway and is captured by the recording electrodes . these modalities target neurological pathways that are well intact ( viable ), which connect with dysfunctional regions . these viable pathways are then manipulated ( non - surgically and non - pharmaceutically ), through the various modalities applied to various myotomal and dermatomal regions , to strengthen connections with faulty regions , causing neuroplasticity and regulation and normalization of function . the modalities operate to stimulate the neural network connected to the chosen dermatome . this stimulation produces neuroplasticity via synaptogenesis in the collateral nerve branches of the activated neural network . through repeated application of the modalities to the chosen dermatome , the collateral branches of the neural pathway are strengthened , thereby bypassing any lesion blocking normal pathway processes . the physician may apply any number or type of these modalities of treatment to the chosen dermatome ( s ). to ensure improvement of the neural network and that the modality has caused a bypass of the neural lesion , the physician repeats the initial testing . this repeated testing may include full testing or solely a repeated sep test procedure . the repeated testing allows a physician to determine an improvement in the patient &# 39 ; s position and ensure that the chosen modality is clinically effective . referring to fig5 , an example of an application of the invention is illustrated . in this example a neural lesion 300 exists in a spinal nerve emanating from t1 and innervating the a - v node 306 of the heart 304 . the neural lesion 300 may make itself known through a number of symptoms , such as arrhythmia . to compensate for this neural lesion 300 , the physician applies a chosen modality to the t2 dermatome . applying the modality to the t2 dermatome activates neuroplasticity via synaptogenesis between the t2 nerve and t1 nerve along collateral branches at a synaptogenesis point 302 . signals traveling along the t1 nerve can thus bypass the lesion 300 by traveling along the t2 nerve and crossing over at the synaptogenesis point 302 . this bypass can resolve any symptoms presented by the patient . the example is further illustrated in fig6 at the systems level . as shown in fig6 , the heart 304 has a neural lesion 300 at the connection of the spinal nerve . the spinal nerve carries somatosensory information from the heart 304 , through the spinal cord 102 , and into the brain 308 . based on information received by the brain 308 , the brain 308 will send a motor signal to the heart 304 , controlling the actions of the heart . if the brain 308 is not receiving correct information about the status of the heat 304 due to the neural lesion 300 , then the brain 308 is sending a motor signal to control the heart 304 that is incorrect . for instance , due to the neural lesion 300 the brain may believe that the heart 304 is beating slower than it is in reality and therefore send a motor signal to increase heart rate when an increase is not needed . such a motor signal would therefore lead to arrhythmia in the patient . the inventive method seeks to cause integration in the brain 308 by changing the sensory signals received by the brain 308 . in this instance , a physician applies a chosen modality to a selected dermatome 100 . the modality causes a somatosensory signal to be sent from the dermatome 100 , through the spinal cord 102 , and to the brain 308 . because the somatosensory signal from the dermatome 100 is received by the brain 308 in the same manner as that from the heart 304 , the brain bases its motor signal response based on the combination of signals - essentially interpreting the somatosensory signal from the dermatome 100 as having come from the heart 308 . by applying the chosen modality to the dermatome 100 , the brain 308 is now integrating all sensory input and resetting the motor signal it generates , thereby correcting for deficiencies created by the neural lesion 300 . the method of the invention is illustrated by fig7 . first the physician performs neurological diagnostic testing of the subject 400 . then the physician determines the existence and the location of a neural lesion in the subject 402 . the physician selects a dermatome on the subject that is innervated by a nerve that is connected to a neural pathway containing the neural lesion 404 . the physician then applies a therapeutic modality to the selected dermatome 406 . the physician may then perform diagnostic testing of the subject to ensure efficacy of the therapeutic modality 408 . the inventive methodology can be used to treat the causes of addiction . standard models treat addiction in a number of ways but primarily target the symptoms of addition rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of addition . the inventive methodology can be used to treat the causes of adhd . standard models treat adhd in a number of ways but primarily target the symptoms of adhd rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of adhd . the inventive methodology can be used to treat the causes of alzheimer &# 39 ; s . standard models treat alzheimer &# 39 ; s in a number of ways but primarily target the symptoms of alzheimer &# 39 ; s rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of alzheimer &# 39 ; s . the inventive methodology can be used to treat the causes of als . standard models treat als in a number of ways but primarily target the symptoms of als rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of als . the inventive methodology can be used to treat the causes of anxiety . standard models treat anxiety in a number of ways but primarily target the symptoms of anxiety rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of anxiety . the inventive methodology can be used to treat the causes of autism . standard models treat autism in a number of ways but primarily target the symptoms of autism rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of autism . the inventive methodology can be used to treat the causes of balance disorders . standard models treat balance disorders in a number of ways but primarily target the symptoms of balance disorders rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of balance disorders . the inventive methodology can be used to treat the causes of breathing disorders . standard models treat breathing disorders in a number of ways but primarily target the symptoms of breathing disorders rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of breathing disorders . the inventive methodology can be used to treat the causes of carpal tunnel . standard models treat carpal tunnel in a number of ways but primarily target the symptoms of carpal tunnel rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of carpal tunnel . the inventive methodology can be used to treat the causes of celiac disease . standard models treat celiac disease in a number of ways but primarily target the symptoms of celiac disease rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of celiac disease . the inventive methodology can be used to treat the causes of cerebral palsy . standard models treat cerebral palsy in a number of ways but primarily target the symptoms of cerebral palsy rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of cerebral palsy . the inventive methodology can be used to treat the causes of chronic fatigue . standard models treat chronic fatigue in a number of ways but primarily target the symptoms of chronic fatigue rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of chronic fatigue . the inventive methodology can be used to treat the causes of chronic neck and back pain . standard models treat chronic neck and back pain in a number of ways but primarily target the symptoms of chronic neck and back pain rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of chronic neck and back pain . the inventive methodology can be used to treat the causes of dangerous diet . standard models treat dangerous diet in a number of ways but primarily target the symptoms of dangerous diet rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of dangerous diet . the inventive methodology can be used to treat the causes of diabetes . standard models treat diabetes in a number of ways but primarily target the symptoms of diabetes rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of diabetes . the inventive methodology can be used to treat the causes of dysauntonomia . standard models treat dysauntonomia in a number of ways but primarily target the symptoms of dysauntonomia rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of dysautonomia . the inventive methodology can be used to treat the causes of dystonia . standard models treat dystonia in a number of ways but primarily target the symptoms of dystonia rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of dystonia . the inventive methodology can be used to treat the causes of esophageal disorders . standard models treat esophageal disorders in a number of ways but primarily target the symptoms of esophageal disorders rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of esophageal disorders . the inventive methodology can be used to treat the causes of fibromyalgia . standard models treat fibromyalgia in a number of ways but primarily target the symptoms of fibromyalgia rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of fibromyalgia . the inventive methodology can be used to treat the causes of headaches . standard models treat headaches in a number of ways but primarily target the symptoms of headaches rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of headaches . the inventive methodology can be used to treat the causes of homeostasis . standard models treat homeostasis in a number of ways but primarily target the symptoms of homeostasis rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of homeostasis . the inventive methodology can be used to treat the causes of hypertension . standard models treat hypertension in a number of ways but primarily target the symptoms of hypertension rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of hypertension . the inventive methodology can be used to treat the causes of hyperthyroidism . standard models treat hyperthyroidism in a number of ways but primarily target the symptoms of hyperthyroidism rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of hyperthyroidism . the inventive methodology can be used to treat the causes of hypothyroidism . standard models treat hypothyroidism in a number of ways but primarily target the symptoms of hypothyroidism rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of hypothyroidism . the inventive methodology can be used to treat the causes of inflammatory bowel disease . standard models treat inflammatory bowel disease in a number of ways but primarily target the symptoms of inflammatory bowel disease rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of inflammatory bowel disease . the inventive methodology can be used to treat the causes of kidney disease . standard models treat kidney disease in a number of ways but primarily target the symptoms of kidney disease rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of kidney disease . the inventive methodology can be used to treat the causes of liver disease . standard models treat liver disease in a number of ways but primarily target the symptoms of liver disease rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of liver disease . the inventive methodology can be used to treat the causes of multiple sclerosis . standard models treat multiple sclerosis in a number of ways but primarily target the symptoms of multiple sclerosis rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of multiple sclerosis . the inventive methodology can be used to treat the causes of parkinson &# 39 ; s disease . standard models treat parkinson &# 39 ; s disease in a number of ways but primarily target the symptoms of parkinson &# 39 ; s disease rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of parkinson &# 39 ; s disease . the inventive methodology can be used to treat the causes of peripheral . standard models treat peripheral in a number of ways but primarily target the symptoms of peripheral rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of peripheral . the inventive methodology can be used to treat the causes of psoriasis . standard models treat psoriasis in a number of ways but primarily target the symptoms of psoriasis rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of psoriasis . the inventive methodology can be used to treat the causes of restless leg syndrome . standard models treat restless leg syndrome in a number of ways but primarily target the symptoms of restless leg syndrome rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of restless leg syndrome . the inventive methodology can be used to treat the causes of stoke . standard models treat stroke in a number of ways but primarily target the symptoms of stroke rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of stroke . the inventive methodology can be used to treat the causes of tremor . standard models treat tremor in a number of ways but primarily target the symptoms of tremor rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of tremor . the inventive methodology can be used to treat the causes of vascular disease . standard models treat vascular disease in a number of ways but primarily target the symptoms of vascular disease rather than the underlying cause . prolonged drug use can lead to systemic inflammation or hepatic encephalopathy . the use leads to an accumulation of symptoms , each of which is treated separately under the standard model of health care . the incentive method treats the underlying neurological , psychological , and chemical processes of the body that are not addressed by these standard methods of treatment . the inventive method normalizes the nervous system , restoring brain and nerve function to normal , thereby eliminating the underlying cause of vascular disease . what has been described above includes examples of the claimed subject matter . it is , of course , not possible to describe every conceivable combination of components or methodologies for purposes of describing the claimed subject matter , but one of ordinary skill in the art can recognize that many further combinations and permutations of such matter are possible . accordingly , the claimed subject matter is intended to embrace all such alterations , modifications and variations that fall within the spirit and scope of the appended claims . furthermore , to the extent that the term “ includes ” is used in either the detailed description or the claims , such term is intended to be inclusive in a manner similar to the term “ comprising ” as “ comprising ” is interpreted when employed as a transitional word in a claim . the foregoing method descriptions and the process flow diagrams are provided merely as illustrative examples and are not intended to require or imply that the steps of the various embodiments must be performed in the order presented . as will be appreciated by one of skill in the art the order of steps in the foregoing embodiments may be performed in any order . words such as “ thereafter ,” “ then ,” “ next ,” etc . are not intended to limit the order of the steps ; these words are simply used to guide the reader through the description of the methods . further , any reference to claim elements in the singular , for example , using the articles “ a ,” “ an ” or “ the ” is not to be construed as limiting the element to the singular . the preceding description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention . various modifications to these embodiments will be readily apparent to those skilled in the art , and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention . thus , the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the following claims and the principles and novel features disclosed herein . | 0 |
in the following detailed description , numerous specific details are set forth to provide a full understanding of the present invention . it will be apparent , however , to one ordinarily skilled in the art that the present invention may be practiced without some of these specific details . in other instances , well - known structures and techniques have not been shown in detail to avoid unnecessarily obscuring the present invention . the word “ exemplary ” is used herein to mean “ serving as an example , instance , or illustration .” any embodiment or design described herein as “ exemplary ” is not necessarily to be construed as preferred or advantageous over other embodiments or designs . fig1 is a schematic diagram illustrating an exemplary eamr head 100 comprising a slider 101 and a near field transducer 158 according to one aspect of the subject technology . the slider 101 comprises a substrate 110 , a recorder / reader layer 120 disposed over the substrate 110 , and an overcoat layer 130 disposed over the recorder / reader layer 120 . in the illustrated example , the substrate 110 comprises altic and the overcoat layer 130 comprises alumina . the slider 101 has a leading edge 107 and a trailing edge 109 , and an air - bearing surface ( abs ) 105 facing a magnetic recording medium 103 . the recorder / reader layer 120 of the slider 101 includes a writer 122 for recording or erasing information on the medium 103 by focusing a magnetic field on a spot on the medium 103 , a coil 124 for generating the magnetic field , a reader 126 for reading a magnetic bit recorded on the medium 103 , and a waveguide structure 150 . the waveguide structure 150 is configured to couple incident laser beam 171 from a laser diode 102 into a waveguide core layer 154 disposed in the coupler 150 . the waveguide structure 150 includes a first clad layer 152 and a second clad layer 156 surrounding the waveguide core layer 154 . disposed at an interface between the second clad layer 156 and the waveguide core layer 154 is a grating 128 having a period and a depth selected to couple incident laser beam 171 into waveguide core layer 154 . the waveguide structure 150 further includes a near field transducer ( nft ) 158 formed at a distal end of the waveguide structure 150 proximate the abs 109 . the nft 158 is configured to concentrate energy from the laser beam to a nano - sized spot on the recording medium 103 well below the so - called “ diffraction limit ” imposed on standard focusing lenses . the nft 158 is typically formed of a metal such as gold ( au ), silver ( ag ), aluminum ( al ), copper ( cu ), or a combination ( alloy ) thereof . the eamr head 100 can also includes a laser diode 102 configured to generate a laser beam in response to an electrical power applied thereto . in certain embodiments , the laser diode is affixed to the slider 101 . in some embodiments , the laser diode can be a vertical - cavity - surface - emitting laser ( vcsel ). in other embodiments , the laser diode 102 can be a separate structure disposed at a certain distance from the slider 101 and transmitting light to the waveguide structure 150 via an airgap . during the operation of a hard disk drive comprising the eamr head 100 , the magnetic recording medium 103 rotates at high speed , and air flowing at high speed between the abs 105 and the magnetic recording medium 103 provides an upward force to the slider 101 such that the slider 101 is maintained at a certain height from the magnetic recording medium 103 . a portion of the incident laser beam 171 emitted by the laser diode 102 and arrived at the waveguide structure 150 is coupled into the waveguide core layer 154 by means of the grating 128 to form a coupled laser beam 172 traveling down the waveguide core layer 154 toward the abs 105 . the coupled laser beam 172 is concentrated onto a nano - sized spot on recording medium 103 by means of the nft 158 . the nano - sized heated spot on the magnetic medium 103 is subsequently subjected to a pulse of write magnetic field from the writer 122 . viewed from the perspective of a power flow , a portion of an electrical energy provided to the laser diode 102 is converted into an incident optical power by the laser diode 102 in the form of the incident laser beam 171 . a portion of the incident optical power is coupled into the waveguide core layer 154 as a coupled optical power in the form of the coupled laser beam 172 . a portion of the coupled optical power is transmitted to the magnetic recording medium 103 as near field radiation 173 , which is absorbed by a nano - sized spot on the magnetic recording medium 103 to generate heat therein . typically , an optical conversion efficiency of the nft 158 — the percentage of the coupled optical power converted into the focused optical power using the above - defined terminologies — is in the range of 1 - 10 %. a portion of the coupled optical power not converted into the focused optical power generates heat at the nft and a surrounding region . the heat at nft 158 and the surrounding portion of the slider may cause the region to protrude above the abs 105 . fig2 is a graph showing a simulated trace 201 of such a heat - induced protrusion as a function of a distance measured from the left edge of the substrate 110 ( fig1 ), with the + direction being towards the trailing edge 109 of the slider 101 . the trace 201 shows a sharp protrusion at a region comprising the nft and a portion of the slider surrounding the nft , with its peak occurring at the center of the nft . this simulation is performed with the assumption that 20 mw of optical power is applied to a volume of 273 nm × 180 nm × 100 nm at the write gap ( wg ). it can be seen that the protrusion is very localized due to the small size of the heat source . in the simulation embodiment , the maximum protrusion beyond the abs is seen to be 50 nm at 20 mw . even if the optical power is reduced by half , e . g ., to 10 mw , the nft protrusion above the abs is still in the range of 20 - 30 nm . considering that the slider can float at a height in the range of few nanometers above the magnetic recording medium , such a heat - induced nft protrusion may result in the chipping or cracking of the nft and damage to the recording media . to reduce or eliminate such a heat - induced nft protrusion , a fabrication process of the eamr head can be configured to modify a shape of a region of the abs surrounding the nft to compensate for the heat - induced nft protrusion , according to one aspect of the subject technology . in particular , the process can involve iteratively applying increasingly larger levels of optical power to the nft , thereby generating heat in the nft and the surrounding region , and removing a corresponding heat - induced protrusion at the nft and the surrounding slider portion . fig3 is a flowchart illustrating an exemplary iterative heat - and - remove process 300 for producing an eamr head . the iterative heat - and - remove process 300 begins at state 310 and proceeds to a state 320 , in which a first level of optical power ( p opt ) is applied to the nft . as explained above , the optical power is delivered to the nft in the form of a laser light ( e . g ., the coupled laser beam 172 of fig1 ), and the optical power generates heat in the nft and a surrounding portion of the slider . the laser light and its associated optical power can be coupled from a laser source ( either affixed to the slider or separate ) into a waveguide ( e . g ., the waveguide structure 150 of fig1 ) formed in the eamr head and directed to the nft . alternatively , the laser light can be applied directly to the nft from an external laser source during the fabrication process . regardless of the chosen channel , the first level of optical power carried by the laser light generates heat at the nft , which heat , in turn , induces a first localized protrusion in a region comprising the nft and the surrounding slider portion as described above . the process 300 proceeds to a state 330 , in which the first localized protrusion is removed by , e . g ., a bar lapping process . in one embodiment , the bar lapping process is a chemical - mechanical polishing ( cmp ) process . in certain embodiments , the removal process is performed while a constant optical power is applied to the nft . in other embodiments , the optical power is increasing while the removal process is in progress . in yet other embodiments , the optical power is temporarily turned off during the removal process . the process 300 proceeds to a decision state 340 , in which a query is made as to whether p opt has reached a preset final optical power . in certain embodiments , the preset final optical power corresponds to an operational level of optical power for use during a recording operation of the eamr head . in other embodiments , the preset final optical power can be a level of optical power different from the operational level due to the need to compensate for a thermal variation caused by the removal process or due to the fact that the optical power is being delivered by an external laser source during the fabrication process in which case the optical power required to produce the same amount of heat at the nft may be different from the operational optical power delivered via the waveguide structure . if the answer to the query at the decision state 340 is yes , the process 300 ends at state 390 . on the other hand , if the answer is no , the process 300 continues at a state 350 , in which the optical power is increased to a next level , and then proceeds to the state 320 , in which the next level of optical power is applied to the nft . the next level of optical power generates a next level of heat at the nft , which heat , in turn , induces a next localized protrusion in the region comprising the nft and the surrounding slider portion . the next localized protrusion is removed at the state 330 . the heat - and - remove process of the states 320 , 330 , 340 , and 350 is repeated until the optical power has reached a preset final optical power . it shall be appreciated that many variations to the iterative heat - and - remove process 300 described above are possible without departing from the scope of the present disclosure . for example , in those embodiments in which a constant or increasing optical power is applied during the removal process , the states 320 and 330 may be combined into a single state , in which the localized protrusion is removed while the constant or increasing optical power is applied to the nft . in the latter case in which the optical power is increased during the removal process , the state 350 may not be performed as a separate step . the iterative heat - and - remove process 300 described above is terminated when the optical power reaches a preset final optical power . for example , according to one aspect of the subject technology , the process may complete after a preset number of steps ( e . g ., 10 of 2 mw increments for an exemplary final optical power of 20 mw ). alternatively , the process may be terminated after a certain other condition is satisfied . for example , the temperature of the abs near the nft can be measured by a contact or remote measurement method , and the process can be terminated when the measured temperature reaches a preset final temperature . an iterative heat - and - remove process such as the one described above with respect to fig3 is superior to a single ( non - iterative ) heat - and - remove process in which a preset maximum optical power is applied to the nft and the corresponding heat - induced protrusion is removed in a single step , because such a single heat - and - remove process can lead to an abrupt breakage in the nft protrusion and cause an attendant damage to the nft during the removal process . by iteratively applying increased levels of heat to the nft and removing corresponding incremental protrusions , the iterative heat - and - remove method described herein can prevent breakage of the nft and also produces a smooth surrounding concave surface in the slider at the end of the removal process . fig4 a and 4b are cross - sectional views of a slider 401 having a near field transducer ( nft ) 410 modified by an iterative heat - and - remove process such as the one described above . fig4 a corresponds to a case in which no optical power is applied to the nft 410 , and fig4 b corresponds to a case in which an operational optical power ( e . g ., the optical power to be used during a recording operation ) is applied to the nft 410 . the shown section of the slider 401 has an abs 405 . the nft 410 has a distal end 412 proximate the abs 405 . the distal end 412 of the nft 410 is recessed from the abs 405 when no optical power is applied to the nft 410 as shown in fig4 a , and is co - planar with the abs 405 when a predetermined amount of optical power ( e . g ., an operational optical power ) is applied to the nft 410 as shown in fig4 b . a portion of the slider 401 surrounding the distal end 412 of the nft 410 forms a concave surface 430 a having a continuously varying slope when no optical power is applied to the nft 410 as shown in fig4 a , and a substantially flat surface 430 b coplanar with the abs 405 and the distal end 412 of the nft 410 when the predetermined optical power is applied to the nft 410 . as shown in fig4 a , for example , there is a smooth transition from the abs 405 to the concave surface 430 a without a sharp edge such as a 90 - degree bend . similarly , there is a smooth transition from the concave side surface to the bottom of the recess without a sharp edge such as a 90 - degree bend . put another way , a region 407 comprising the concave surface 430 a and its surrounding abs portion has a continuously - varying slope ( e . g ., continuously differentiable without a discontinuity ). a recess having such a smooth surface with a continuously - varying slope caused by the iterative heat - and - remove process described herein has several advantages over a recess having sharp 90 - degree edges at the top and bottom of the recess . for example , the smooth surface reduces the risk of having debris particles stuck in the recess after the fabrication and causing aberrations ( e . g ., absorption , attenuation , diffraction , divergence ) in the focused laser beam pattern . in addition , as fig4 b illustrates , the smoothed - surface recess turns into a flat surface co - planar with the abs 405 and the distal end 412 of the nft 410 when an operational optical power is applied to the nft 410 . in contrast , a recess having 90 - degree edges at the top and bottom when no optical power is applied turns into an irregular surface not coplanar with the abs and the nft when an operational optical power is applied to the nft . such a non - coplanar surface can produce a portion of the slider slightly protruding beyond the abs or the distal end of the nft slightly below the abs with the attendant degradation in the focusing ability of the nft . the description of the invention is provided to enable any person skilled in the art to practice the various embodiments described herein . while the present invention has been particularly described with reference to the various figures and embodiments , it should be understood that these are for illustration purposes only and should not be taken as limiting the scope of the invention . there may be many other ways to implement the invention . various functions and elements described herein may be partitioned differently from those shown without departing from the spirit and scope of the invention . various modifications to these embodiments will be readily apparent to those skilled in the art , and generic principles defined herein may be applied to other embodiments . thus , many changes and modifications may be made to the invention , by one having ordinary skill in the art , without departing from the spirit and scope of the invention . a reference to an element in the singular is not intended to mean “ one and only one ” unless specifically stated , but rather “ one or more .” the term “ some ” refers to one or more . underlined and / or italicized headings and subheadings are used for convenience only , do not limit the invention , and are not referred to in connection with the interpretation of the description of the invention . all structural and functional equivalents to the elements of the various embodiments of the invention described throughout this disclosure that are known or later come to be known to those of ordinary skill in the art are expressly incorporated herein by reference and intended to be encompassed by the invention . moreover , nothing disclosed herein is intended to be dedicated to the public regardless of whether such disclosure is explicitly recited in the above description . | 8 |
in accordance with an exemplary embodiment , conductive ink based circuits , which are embedded as part of an electronic smoking article are disclosed . the conductive ink based circuits permit the operation of the electronic smoking article only when used with genuine or approved parts . in accordance with an exemplary embodiment , a conductive ink circuit can be embedded across a two - piece design or among a three - piece design such that the circuit , that activates the power supply and the aerosol generation unit , can be activated only when genuine parts are connected together . in accordance with an exemplary embodiment , a conductive ink based circuit can be placed between the flavor unit ( or cartridge ) and aerosol generation unit or power supply unit , to activate the article when a genuine or approved flavor unit or cartridge is connected to the electronic smoking article . in accordance with an exemplary embodiment , the conductive ink based circuit can be used to initiate pre - heating of the heater of the electronic smoking article when the user picks up the smoking article for smoking . the preheating of the heater can help to reduce the latency and improve quantity of aerosol delivered during the initial puffs . in addition , control measures can be incorporated to cut off the power supply to the heater , if a puff is not detected , using a puff detector , within a set time period after the initial handling of the smoking article . fig1 shows an electronic smoking article 100 in accordance with an exemplary embodiment . as shown in fig1 , the electronic smoking article 100 includes a housing 110 having a mouth end 112 and an upstream end 114 . in the upstream end 114 , there is provided an electric power supply in the form of power supply 120 and electric circuitry in the form of circuitry 122 . in the mouth end 112 , the smoking article 100 includes a cartridge 140 , a heater 144 , and a capillary wick ( or capillary tube ) 146 . the cartridge 140 , the heater 144 , and the capillary wick ( or capillary tube ) 146 can form the aerosol generation unit 148 . in operation , the cartridge 140 delivers a liquid material 152 from a liquid supply reservoir ( or fluid reservoir ) 150 to the capillary wick 146 , which is surrounded by the heater 144 . in accordance with an exemplary embodiment , one end of the capillary wick 146 extends to the cartridge 140 and the other end of the capillary wick 146 is surrounded by the heater 144 . the heater 144 is connected to the electric circuitry 122 via connections ( not shown ). the housing 110 also includes an air inlet 160 , an outlet 162 at the mouth end 112 , and an aerosol forming chamber 170 . in use , the liquid material 152 is supplied from the fluid reservoir 150 to the capillary wick 146 , which as shown in fig1 is surrounded by the heater 144 . when a user draws on the electronic smoking article 100 at the air outlet 162 , ambient air can be drawn through air inlet 160 . in accordance with an exemplary embodiment , the electronic smoking article 100 can include a puff detection system ( not shown ), which is part of the circuitry 122 on the upstream end 114 of the smoking article 100 . the puff detection system can sense the puff and can activate the heater 144 and supply the liquid material to the capillary wick 146 . the power supply 120 supplies pulses of energy to the heater 144 to heat the end of the capillary wick 146 surrounded by the heater 144 . the liquid material 152 in the outlet end 147 of the capillary wick 146 is vaporized by the heater 144 to create a supersaturated vapor . at the same time , the liquid material 152 being vaporized is replaced by addition liquid material 152 moving along the capillary wick 146 . in accordance with an exemplary embodiment , the supersaturated vapor created is mixed with and carried in the air flow from the air inlet 160 . in the aerosol forming chamber 170 , the vapor condenses to form an inhalable aerosol , which is carried towards the outlet 162 and into the mouth of the user . the circuitry 122 and the puff detection system ( not shown ) are preferably programmable . in accordance with an exemplary embodiment , the circuitry 122 and puff detection system can be used to manage the operation of the electronic smoking article 100 . in use , once the capillary wick 146 is heated , the liquid material contained within a heated portion of the capillary wick 146 is volatilized and ejected out of the outlet 147 where it expands and mixes with air and forms an aerosol in a mixing chamber 170 . the electronic smoking article 100 also includes at least one air inlet 160 operable to deliver air to the mixing chamber 170 . preferably , the air inlets 160 to the mixing chamber 170 can be arranged downstream of the capillary wick 146 so as to minimize drawing air along the capillary and thereby avoid cooling of the capillary wick 146 during heating cycles . in use , the volatilized material expands out of the wick 146 and into the mixing chamber 170 where the volatized material can mix with air to form an aerosol which is then drawn through the outlet 162 . in an exemplary embodiment , the at least one air inlet 160 includes one or two air inlets 160 . alternatively , the air inlets 160 can be three , four , or five or more . in accordance with an exemplary embodiment , the size and number of air inlets 160 can also aid in establishing the resistance to draw of the electronic smoking article 100 . the power supply 120 can be a lithium - ion battery or one of its variants , for example a lithium - ion polymer battery . alternatively , the power supply 120 may be a nickel - metal hydride battery , a nickel cadmium battery , a lithium - manganese battery , a lithium - cobalt battery or a fuel cell . in accordance with an exemplary embodiment , the electronic smoking article 100 is usable by a smoker until the energy in the power supply is depleted . alternatively , the power supply 120 may be rechargeable and can include circuitry ( not shown ) allowing the battery to be chargeable by an external charging device . for example , the circuitry , when charged , can provide power for a pre - determined number of puffs , after which the circuitry must be re - connected to an external charging device . the electronic smoking article 100 can also include control circuitry 122 , which can be on a printed circuit board having a processor . in accordance with an exemplary embodiment , the liquid material 152 includes a tobacco - containing material including volatile tobacco flavor compounds which are released from the liquid upon heating . the liquid material 152 may also be a tobacco flavor containing material or a nicotine - containing material . alternatively , or in addition , the liquid material 152 may include a non - tobacco material . for example , the liquid material 152 may include water , solvents , ethanol , plant extracts and natural or artificial flavors . preferably , the liquid material further includes an aerosol former . examples of suitable aerosol formers are glycerine and propylene glycol . in accordance with an exemplary embodiment , the aerosol generation unit includes the liquid supply reservoir 150 and a capillary wick 146 for holding liquid received from the liquid reservoir . in accordance with an exemplary embodiment , rather than a capillary wick 146 , the aerosol generation unit 148 can include a capillary tube ( not shown ) having an inlet and an outlet , the inlet being in communication with the outlet of the liquid supply reservoir , and the at least one heater 144 is operable to heat the capillary tube to a temperature sufficient to at least initially volatilize the liquid material contained within the capillary tube . the control circuitry 122 can also include a heater activation light ( not shown ) at an upstream end of the smoking article 100 , which is operable to glow when the heater 144 is activated . the control circuitry 122 can also include a timer operable to limit the time for which power is supplied to the heater 144 . the time - period of the electric current supply to the heater 144 may be pre - set depending on the amount of liquid material 152 desired to be vaporized . for example , the control circuitry 122 can be programmable for this purpose . in accordance with an exemplary embodiment , when activated , the heater 144 heats a portion of the wick 146 for less than about 10 seconds , more preferably less than about 7 seconds . thus , the power cycle ( or maximum puff length ) can range in period from about 1 second to about 10 seconds . fig2 is a side view of an electronic smoking article 100 in accordance with an exemplary embodiment having a first section 210 and a second section 220 , which forms a conductive ink circuit upon assembly thereof . as shown , the electronic smoking article 100 includes a first section 210 , which includes an aerosol generation unit 211 and a second section 220 , which includes a power supply portion 221 , which can be coupled together at a threaded joint ( not shown ) or by other convenience such as a snug - fit , snap - fit , detent , clamp and / or clasp . in accordance with an exemplary embodiment , the aerosol generation unit 211 can include the at least one heater 144 , a liquid reservoir 150 having a liquid material 152 therein , and a capillary wick ( or capillary tube ) 146 . the power supply section 221 includes a power supply 120 and circuitry 122 , which is operable to apply voltage to the at least one heater 144 for heating the liquid material 152 in at least a portion of the aerosol generation unit 148 to form an aerosol . in accordance with an exemplary embodiment , a portion 212 , 222 of the conductive ink circuit is embedded within the first and second sections 210 , 220 , respectively , and the power supply and the aerosol generation unit 148 can be activated upon formation of a circuit formed by connecting or coupling the first and second sections 210 , 220 to one another . the portions 212 , 222 of the conductive ink circuit can be embedded within the outer housing 216 , 226 as shown in fig2 . alternatively , the portions 212 , 222 can form part of the electrical circuit within the smoking article 100 . for example , in accordance with an exemplary embodiment , the conductive ink circuit can be formed by the connection of the first and second sections 210 , 220 to form the electrical circuit , which provides power from the power supply 120 to the at least one heater 144 within the aerosol generation unit . alternatively , the conductive ink circuit formed by the connection of the first and second portions 212 , 222 can form a circuit in communication with the circuitry 122 of the smoking article 100 , and upon establishing the conductive ink circuit , the circuitry 122 enables the power supply 122 to provide power to the at least one heater 144 . in accordance with an exemplary embodiment , the conductive circuit can be formed by bringing into contact , an end portion 214 , 224 of each of the first and second sections 210 , 220 to complete the conductive ink circuit . in accordance with an exemplary embodiment , upon forming the circuit , a pre - heating process of the at least one heater 144 of the smoking article 100 can be initiated . in addition , the pre - heating of the smoking article 100 can also be configured based on detection of a user picking up the smoking article 100 . for example , a smoking article 100 having a conductive ink circuit on an outer portion thereof upon detection of being handled by a user , the smoking article 100 can begin a pre - heating process , which can reduce the latency and improve quantity of the aerosol delivered during the initial puffs . in accordance with an exemplary embodiment , the first section 210 and the second section 220 each comprise an outer cylindrical housing 216 , 226 extending in a longitudinal direction , and wherein each of the outer cylindrical housings has a portion 212 , 222 of the conductive ink circuit embedded therein . fig3 is a side view of an electronic smoking article 100 in accordance with an exemplary embodiment having a two - piece first section 210 , which includes an aerosol generation portion 240 and a liquid supply portion 230 , and a second portion 220 , which forms a conductive ink circuit upon assembly thereof . in accordance with an exemplary embodiment , the first section 210 includes an aerosol generation portion 240 and a liquid supply portion 230 , and wherein the conductive ink circuit 242 , 232 is embedded within an outer cylindrical housing 241 , 231 of the aerosol generation portion 240 and the liquid supply portion 230 . the at least one heater 144 housed within the aerosol generation portion 240 is activated only when the conductive ink circuit is formed by connecting the aerosol generation portion 240 , the liquid supply portion 230 and the second portion 220 , and wherein the aerosol generation portion 240 , the liquid supply portion 230 and the second section 210 each has a portion 242 , 232 , 222 . 224 , 234 , 236 , and 244 of the conductive ink circuit and upon assembly thereof forms the circuit . in accordance with an exemplary embodiment , for example , the conductive ink circuit can be embedded in parts manufactured by an authorized manufacturer of the first and second sections 210 , 220 for a two - piece electronic smoking article 100 , or an authorized manufacturer of the aerosol generation portion 240 , the liquid supply portion 230 , and the second portion , for a three - piece electronic smoking article 100 . for example , if a user attempts to place a non - authorized part within the smoking article 100 , the smoking article 100 will not function . for example , in the absence of the conductive ink circuit , the power supply 120 will not provide power to the heater 144 . fig4 is an end view of the first portion 210 and the second portion 220 of an electronic smoking article in with an exemplary embodiment , wherein each of the first and second portions 210 , 220 includes a portion of a complete conductive ink circuit therein . as shown in fig4 , the conductive ink circuits 212 , 222 can be embedded within the end portions 213 , 223 , and upon connecting the first and second portions 210 , 220 of the smoking article 100 , the conductive ink portions 212 , 222 complete the circuit . in accordance with an exemplary embodiment , the conductive ink circuits 212 , 222 can be elongated line , pattern or completely covered area forming a contact and / or contact pads . the electronic smoking article 100 is preferably about the same size as a conventional cigarette . in some embodiments , the electronic smoking article 100 can be about 80 mm to about 88 mm long and about 7 mm to about 8 mm in diameter . the outer cylindrical housing 110 of the electronic smoking article 100 may be formed of any suitable material or combination of materials . examples of suitable materials include metals , alloys , plastics or composite materials containing one or more of those materials , or thermoplastics that are suitable for food or pharmaceutical applications , for example polypropylene , polyetheretherketone ( peek ), ceramic , and polyethylene . in an exemplary embodiment , the heater 144 includes a coil of wire at least partially surrounding the capillary wick 146 . in an exemplary embodiment , the heater 144 is a metal wire and / or a metal alloy wire . the heater 144 can be a coil , which can extend fully or partially along the length of the capillary wick 146 . the electronic smoking article 100 can include a puff indicator ( not shown ) for indicating when the heater 144 is activated . in the embodiment in which the electric circuitry includes a sensor to detect air flow indicative of a user taking a puff , the indicator , such as an led , may be activated when the sensor senses air flow indicative of the user taking a puff . in the embodiment in which the electric circuitry includes a manually operable switch , the indicator may be activated by the switch . in addition , control measures can be incorporated to cut off the power supply to the heater if a puff is not detected by a puff detector , within a set time period after the initial handling of the smoking article . when the word “ about ” is used in this specification in connection with a numerical value , it is intended that the associated numerical value include a tolerance of ± 10 % around the stated numerical value . moreover , when reference is made to percentages in this specification , it is intended that those percentages are based on weight , for example , weight percentages . moreover , when the words “ generally ” and “ substantially ” are used in connection with geometric shapes , it is intended that precision of the geometric shape is not required but that latitude for the shape is within the scope of the disclosure . when used with geometric terms , the words “ generally ” and “ substantially ” are intended to encompass not only features , which meet the strict definitions , but also features , which fairly approximate the strict definitions . it will now be apparent that a new , improved , and nonobvious electronic smoking article has been described in this specification with sufficient particularity as to be understood by one of ordinary skill in the art . moreover , it will be apparent to those skilled in the art that numerous modifications , variations , substitutions , and equivalents exist for features of the electronic smoking article , which do not materially depart from the spirit , and scope of the invention . accordingly , it is expressly intended that all such modifications , variations , substitutions , and equivalents , which fall within the spirit and scope of the invention as defined by the appended claims , shall be embraced by the appended claims . | 2 |
as illustrated in fig1 the armature attachment end 1 of a printing needle 1 is prestamped into a wave like configuration providing variations in the radial positioning of the surface of the needle from the axial center line along the axial length of the portion of the needle end which is received in the armature . the wave shape formation of the needle end preferably occurs before insertion of the needle end into a bore hole in the armature of a plunger type armature magnet system such as used in mosaic needle printing heads . the bore hole of the armature 2 is originally cylindrical having a constant diameter as indicated by the broken line of fig1 . in the course of calibration of the external dimensions of the armature , it is placed into a mold having the desired dimensions and is thereafter axially cold forged . during this cold press operation , the material of the plunger type armature 2 will flow not only to the exterior of the armature into contact with the mold walls , but also to the interior into mating surface contact with the needle . thus upon completion of the cold press forging operation , the external surfaces of the armature will properly correspond to the inner surfaces of the mold or die and the inner bore wall will mate with the deformed surface of the printing needle 1 . in this manner a positive lock connection will be created between the end of the printing needle and the armature without the necessity of any heat treatment . as illustrated in fig2 a cylindrical tube member 4 can be inserted over the end of the needle which is to be inserted into the armature . the insertion of a cylindrical tube over the cylindrical needle is carried out as a first work step and as a second work step the insertion end of the needle and tube can be stamped or coined into the desired wave shaped configuration such that the end of the printing needle 3 and the end of the tube 4 will assume a complimentary shape . thereafter the tube - needle end can be inserted into the cylindrical bore of the armature . the cylindrical bore , indicated by the broken line of fig2 can be formed with a larger diameter than would otherwise be the case if the diameter reducing tube 4 were not utilized . thereafter the material of the armature 5 can be formed in to configuration with the external surface of the tube by means of the cold shaping described above during the step of external dimension calibration of the armature . a third embodiment is illustrated in fig3 . in that figure , the printing needle 6 has an end portion 7 formed with a diameter increase . the diameter increase can be created by bending the needle end back upon itself as illustrated to create a bulbous ended needle . this needle is received , preferably , into a blind hole bore in the armature . the original relatively large diameter of the blind hole bore , as illustrated by the broken line of fig3 is thereafter reduced to a diameter in conformity with the diameter of the needle 6 by means of the aforementioned cold shaping processes . it can therefore be seen from the above that our invention provides an armature - printing needle connection for use in the construction of mosaic printing needle writing head subassemblies wherein the needle has an external varying radius shaped end received in a bore hole in an armature with the bore hole thereafter reduced into mating surface contact with the needle end by means of a cold pressing operation . this effectively locks the needle in the armature at the same time the armature is being properly calibrated for external size dimensions . the resultant joint between the armature and the needle is sufficiently strong to withstand working conditions of the mosaic needle print head while at the same time being relatively inexpensive to achieve due to the production method involved . although the teachings of our invention have herein been discussed with reference to specific theories and embodiments , it is to be understood that these are by way of illustration only and that others may wish to utilize our invention in different designs or applications . | 1 |
fig1 and fig2 shows a child &# 39 ; s safety seat with a five point web harness as found in conventional safety seats fitted within a motor vehicle . the upper shoulder straps 1 and 1 a are enclosed within a pair of sleeves 2 and 3 , fitted such as frictional contact between the interior of the sleeve and the web hold the sleeve in a pre selected position . positioned on the lower portion of sleeves 2 and 3 , are two magnets 4 and 5 , ( fig3 / fig6 ) facing topside , are set within plinths 6 and 7 . these magnets may be covered by a thin membrane ( not shown ) to prevent access by a child . two metallic strips 8 and 9 are embedded within each side of the seat proper 10 , proximate the chest / shoulder area of a child , and enclosed by a material isolating contact with a child , yet allowing magnetic attraction when coupled to aforementioned sleeve magnets 4 and 5 ( this connection explained fully later ) these longitudinally placed metallic strips are sized to accommodate a range of adjustments of the sleeves made over time . it will be noted that magnetic strips may be substituted for metallic strips 8 and 9 . fig4 . the lower portions of the web harness are connected at a buckle 11 , achieved through inserting a pair of tangs 12 and 13 into buckle 11 . each tang is free to move along its web 1 , and 1 a and falls into the depression within the seat as stated previously . to counteract this , tang 12 is attached to a web clamp 14 by narrow strip 15 , similarly tang 13 is attached to web clamp 16 by narrow strip 17 , securing the tangs to a desired position along the web . to position web clamp 14 along web 1 , an attached clip 14 a , is lifted slightly , relieving compression on web 1 , allowing web clamp 14 to slide along web 1 . the same adjustment applies to web clamp 16 . narrow strips 15 and 17 enable some freedom of movement to insert the tangs 12 and 13 , into buckle 11 without adjusting the positions of web clamps 14 and 16 . fig8 , fig9 , fig1 . the upper portions of both webs 1 and web 1 a are required to be connected laterally to offer protection against separation of the webs in the event of a sudden deceleration . two portions of a connecting mechanism are therefore provided , both positioned on the topside of sleeves 2 and 3 . attached to sleeve 2 a circular wall 18 , is provided with an open area 18 a , positioned adjacent to a similarly positioned connector 20 located and connected on sleeve 3 . the distal end of connector 20 has a circular member 21 with a descending encasing flange 22 , sized to fit closely within circular wall 18 . contained on circular member 21 , having an outer facing area , and an inner facing area , a slide 23 is fitted to the outer facing area , having on one end a finger grip 24 , the distal end having a protruding planer member 25 and a descending elongated connector 26 a , engaged within slot 27 , terminating in an elongated flange 26 , ( now within the inner facing area ) with one end having a tapered opening 26 b . at the end of its travel , elongated flange 26 , and tapered opening 26 b springs apart and snaps back engaging descending protrusion 26 c , requiring additional finger force to fully engage these members . ( the resulting pressure required to secure or retract slide 23 would therefore be greater than a child could produce to eliminate accidental opening ) slide 23 is used to alternate positions between a first retracted position , and a second extended position , whereby planer member 25 is engaged within circular wall 18 . fig1 illustrates circular member 21 fitted within circular wall 18 , having opening 18 a providing a slot 29 one end and slot 30 the opposing end , cooperating to engage planer member 25 when positioned in the extended position , thereby securing circular member 21 within circular wall 18 . in this configuration , lateral force applied to sleeves 2 and 3 will be resisted by the interaction between circular member 21 , captured within circular wall 18 . as previously stated buckle 11 will fall into a position underneath a child in a conventional safety seat . therefore this invention provides an attached handle 31 providing a grasping opportunity to locate and manipulate buckle 11 to a desired storage position . fig5 illustrates such a handle 31 having on one end a yoke 31 a , terminating in pivotal connectors 31 a - 1 , and 31 a - 2 , with the distal end having two metallic discs , 31 b and 31 c , surrounded by an ascending flange 31 d . handle 31 is rotoratably connected to buckle 11 through interaction with pivot points 11 a and 11 b , inserted into connectors 31 a - 1 , and 31 a - 2 . it may be beneficial to describe the actions required to position the elements of the present invention in a first , closed , fastened position , to secure a child within a safety seat . and to further describe a second , open , unfastened and stored position required to remove a child from a safety seat , and prepare the elements of this present invention positioned such as to more easily replace a child within the seat . after placing a child within a safety seat , web 1 and 1 a , being overlaid with sleeves 2 and 3 are placed over a child &# 39 ; s shoulders , with sleeves 2 and 3 positioned at a child &# 39 ; s chest area . connector 20 , attached to sleeve 3 , positions circular member 21 proximate circular wall 18 , on sleeve 2 , whereupon circular member 21 is inserted into circular wall 18 . at this point slide 23 , set upon circular member 21 , is in a retraced position , and offers no interference to the insertion process . ( fig9 ) placing a finger on finger member 24 , and applying a small force in the direction of sleeve 3 , move slide 23 , together with planer member 25 , toward the open area of circular wall 18 a . planer member 25 ( fig1 ) is inserted into slot 29 on one side of open area 18 a , and into slot 30 on the opposite side . this action also moves elongated flange 26 and tapered connector 26 b toward descending protrusion 26 c . applying additional force , protrusion 26 c is captured within tapered connector 26 b . circular member 21 is now secured within circular wall 18 thereby securing sleeves 2 and 3 together . at a lower point , buckle 11 is positioned and tangs 12 and 13 are inserted and secured within buckle 11 . handle 31 ( fig1 ) is located and rotated upwards toward the lower portion of sleeves 2 and 3 , whereupon metallic disc 31 b is attracted to magnet 4 , and metallic disc 31 c is attracted to magnet 5 , connecting and attaching in a releasable yet secured connection . ascending flange 31 d is covering portions of magnet plinths 6 and 7 in close proximity , restricting lateral movement , thereby providing secondary protection against lateral forces separating sleeves 2 and 3 . at this point a child is securely seated within the five point safety harness seat utilizing the components of this present invention , the procedure for removing a child from the safety seat is as follows . handle 31 is lifted , breaking the magnetic connection between magnet 4 and metallic disc 31 b and magnet 5 , and metallic disc 31 c . the handle 31 is rotated through approximately 180 degrees , giving access to a push button 11 c , whereby tangs 12 and 13 are removed from buckle 11 . fig8 . using slide 23 to retract planer member 25 breaking a connection from within circular wall slots 29 and 30 , frees circular member 21 from within circular wall 18 , wherein circular member 21 is lifted out and removed , thereby separating sleeve 2 from sleeve 3 . sleeve 2 ( fig2 ) is inverted as it is lifted free of a child and moved toward the outside edge of seat 10 . sleeve 2 , together with magnet 4 , now being inverted or turned over is positioned over metallic strip 8 . magnet 4 is attracted to , and makes contact thereby attaching sleeve 2 to the side of the seat 10 . web 1 is now in a stored position along an upper outer aspect of seat side 10 , prevented from falling into the seat depression as described previously through the interaction of metallic strip 8 , and magnet 4 . web clamp 14 connected to tang 12 , through narrow strip 15 is also secured to the side of the seat 10 , connected by web 1 through interaction with sleeve 2 and the magnetic connection so formed . the same method is used to reposition sleeve 3 , connecting magnet 5 with metallic strip 9 , therefore securing web 1 a , with web clamp 16 and tang 13 also captured in a stored position . fig6 . the underside of both sleeves 2 and 3 are visible , revealing a foam or gel like material 2 a and 3 a attached to sleeves 2 and 3 , offering additional protection in the event of a sudden deceleration of a vehicle , to enhance the safety and comfort of a child . fig2 . handle 31 being rotated to a lower point , attached to buckle 11 , is grasped and pulled further in a downward direction , such that buckle 11 is pulled away from the previously described seat depression , toward an outer lower edge of seat 10 . buckle 11 , with handle 31 ( fig7 ) acting as a cantilever , is positioned and stored at a seat edge , away from interference with extracting the child , yet available for grasping when next required . at this point , all the elements provided for by this present invention are captured and positioned on seat 10 as illustrated in fig2 , giving a unobstructed space in which to place and more easily secure a child within seat 10 . fig1 in a second embodiment of the present invention , providing a similar operating function to the preferred embodiment , accordingly provides a child safety seat installed within a motor vehicle , including both upper portions of a harness web designated by the numerals 1 , and 1 a in the aforementioned preferred embodiment , threaded through a pair of sleeves 32 and 33 surrounding that portion of the web proximate a child &# 39 ; s chest area , manufactured from a suitable pliable , soft plastic . sleeves 32 and 33 are sized to fit over webs 1 and 1 a so that frictional contact between the interior of the sleeve , and the mating surface of the web , is sufficient to hold a sleeve in a preset position . sleeve 32 terminates at an approximate midpoint along the length and transitions into an open web guide member 38 , sleeve 33 similarly transitions to open guide member 39 . fig1 guide member 38 is enclosed on each side by a narrow curled flange , with projections 38 a and 38 b providing additional web securing . the distal end terminating in an integral strip 40 attached to a web tang 41 . guide member 39 , with projections 39 a and 39 b , are likewise attached to integral strip 43 , together with web tang 44 . on the underside of sleeves 32 and 33 continuing through the underside of guide member 38 and 39 a backing member 38 c , is attached , manufactured from a foam or gel like material , along the total length , providing some additional comfort and protection to a child secured within the seat . after placing a child within a safety seat , designated in the preferred embodiment by the numeral 10 web 1 and 1 a , being overlaid with sleeves 32 and 33 are placed over a child &# 39 ; s shoulders , proximate a child &# 39 ; s chest area . fig1 a depicts the previous description of fig1 with the addition of a handle 46 , attached to a buckle 47 , overlaying a portion of the sleeves 32 and 33 , and web guides 38 and 39 . the operation of handle 46 , with buckle 47 may be better explained by reference to fig1 . provided on buckle 47 , are two protuberances 47 a and 47 b set near an edge , spaced apart to accommodate a stem portion 46 f of handle 46 . an upper end of handle 46 terminates in a tee type member , the distal end terminating in a round shaft like member 46 e , extending beyond the width of handle stem 46 f , interacting within pivot points 46 c and 46 d , attached to buckle 47 near an opposite edge . positioned at a point along its length handle 46 has two elongated holes 46 a and 46 b , having narrow wall strips 46 a - 1 , and 46 b - 1 protruding from the nominal width of handle stem 46 f placed adjacent to protuberances 47 a and 47 b . with handle 46 in a first closed position handle stem 46 f , cooperating with the two protuberances 47 a and 47 b causes inward compression of the narrow wall strips sides 46 a - 1 and 46 b - 1 , in cooperation with elongated holes 46 a and 46 b , thereby securing the handle within the aforementioned protuberances . at a lower point , buckle 47 is positioned and tangs 41 and 44 are inserted and secured within buckle 47 . handle 46 is rotated upward to connect with buckle protuberances 47 a and 47 b , so that handle 46 is in a stored position overlaying a portion of web guides 38 and 39 . fig1 . the upper portions of both webs are required to be connected laterally to offer protection against separation in the event of a sudden deceleration . connecting members are therefore provided on both sleeves topside . set on an upper portion of sleeve 32 connector 34 having an open end 34 c , mounted such that open end 34 c is opposite and facing an attached insert member 35 , attached to sleeve 33 . insert member 35 is inserted into connector 34 , causing a spring like action to occur at two protruding members 35 a and 35 b , having a separated extension 35 e , terminating in finger grips 35 c and 35 d , being forced inward through interaction with contoured edge members 34 a and 34 b , and spring back to their normal position once inserted , engaging within a recessed portion of 34 a and 34 b locking insert member 35 in place within connection 34 . sleeves 32 and 33 , and by extension web guides 38 and 39 are now connected together . with both upper and lower connections made , web 1 and la are in a closed secured position around a child strapped within a safety seat . to remove a child from within the safety seat the upper connection 34 and 35 are disconnected by removing insert member 35 from connector 34 . finger grips 35 c and 35 d are squeezed together to separate protrusions 35 a and 35 b from within the recessed areas 34 a and 34 b . insert member 35 is now withdrawn from connector 34 , thereby separating sleeves 32 and 33 , together with web guides 38 and 39 . at a lower connection handle 46 is rotated away from an overlaying position over sleeves 32 and 33 , and web guides 38 and 39 , allowing tangs 41 and 44 to be extracted from buckle 47 by pressing in a push button as provided by a conventional seat harness . it will be noted that the push button set within the buckle cannot be accessed and operated with the handle in a closed position offering a further advantage by resisting opening by a child . handle 46 being rotated to a lower point , attached to buckle 47 , is grasped and pulled further in a downward direction , such that buckle 47 is pulled away from the previously described seat depression , toward an outer lower edge of a seat . buckle 47 , with handle 46 acting as a cantilever , is positioned and stored at a seat edge , away from interference with the child , yet available for grasping when next required . with connection 34 and 35 separated , and a lower connection separated at buckle 47 the actions remaining to remove a child from within a seat are exactly as described and set out within the aforementioned preferred embodiment narrative . reference is hereby made to fig2 containing numerals 8 and 9 , to describe metallic strips , and numeral 10 , to describe a safety seat . a combined sleeve 32 , and web guide 38 is inverted as it is lifted free of a child and moved toward the outside edge of seat 10 . sleeve 32 , with attached magnet 36 , now being inverted or turned over is positioned over metallic strip 8 , magnet 36 is attracted to , and makes contact thereby attaching sleeve 32 and web guide 38 to the side of seat 10 . similarly sleeve 33 and combined web guide 39 , is inverted and is positioned over metallic strip 9 magnet 37 is attracted to , and makes contact thereby attaching sleeve 33 and web guide 39 to the side of seat 10 . fig1 , included for reference , is provided to illustrate a sleeve , for example , 32 , may be separated longitudinally , and by means of a natural hinge to open into two connected parts , and to close around a web , secured by a flange extension 32 w and 32 w - 1 by spaced apart bulbous members 32 x passing through spaced apart holes 32 y in a tight fitting relationship , so as to reestablish the continuity of the sleeve 32 . thus a sleeve may be opened along its length to be fitted to a web and not require threading through . the particular embodiments of the invention described above for the purpose of disclosing and illustrating the principals involved , are not intended to put limitations on this invention . it may be apparent to those skilled in the art that various changes may be made without departing from the spirit and principles of the invention . | 1 |
referring now to the drawings wherein like reference characters designate like parts throughout the several views , an identity card 1 is shown in fig1 . the front shows the photograph of the cardholder , his surname and christian name , and an identification number . furthermore , the front of the card 1 can be provided with the signature ( not shown ) of the cardholder . the identity card 1 includes a card core 2 which is at least one layer . in the card core 2 , there is a window 5 in which one or more grid images 3 appear . the card core 2 is covered or laminated , respectively , on the front and on the rear with films 4 &# 39 ; and 4 &# 34 ;. these films serve to protect the identity card 1 in use and to secure it against forgeries or unauthorized alterations of the data . these films 4 &# 39 ;, 4 &# 34 ; are transparent and in general are of the same fusible polymers , for example polyolefines , polyamides , polyvinyl chloride or the like , as the card core 2 . compared with the total area of the front of the identity card 1 , the grid images 3 include only a small area . as a rule , they contain the information therefore on a reduced scale , in a similar manner as does conventional microfilm . microfilm images could be used in the identity card 1 as one of the security markings if , for example , they store the identity card 1 as a reduced image or store additional information or data about the cardholder . but , compared with the conventional microfilm images , the use of grid images provides better security against forgery , since the production of grid images is more difficult than that of microfilm images . holograms recorded on a holographic film could also be used by inserting an appropriately sized portion into the window . in this situation , an image of the front of the identity card 1 might be holographically produced on the piece of holographic film by appropriately controlling the path of a laser beam for recording a hologram . the hologram obtained in this manner would then be thermally developed and fixed by cooling and inserted into the card . however , the characteristic distinguishing holograms from grid images is that a hologram stores the information of the entire recorded area on each image dot . therefore , all information of the recorded area could be reproduced from a small portion of the holographic film in the card window . the grid image recordings would be safer because they cannot be divided in the same manner as hologram recordings , because only a part of the original information would be present in the corresponding portion of the grid image recording . the grid images 3 for an identity card can be produced by forming an optical image of grid structures on top of an image present on a recording material , that is to say by superposing a grid structure on an image . this technique of image recording is known as carrier frequency photography and is described , for example , in the journal &# 34 ; optik &# 34 ;, volume 28 , 1968 / 69 , pages 263 - 287 . photographic layers based on silver halides , and also other light - sensitive layers , such as photolacquers or photoconductive , thermoplastic layers , are suitable for recording the image . the following discussion is not complete and is only exemplary of this method of image recording . there is a distinction between absorption grids and phase grids or absorption images and phase images . in carrier frequency photography , recording is effected by modulation with a spatial frequency , that is to say the periodic fluctuation of density or light path length within the photographic layer due to the grid structure reproduced in the image . the spatial frequency would have a local density distribution or optical path length distribution representing the image signal . the image - modulated spatial frequency results in density differences in the silver grains in the photographic layer or density differences due to the toner in the development of the photoconducting layer . these density differences yield an absorption grid which is reconstructed by diffraction on the spatial carrier frequency . better results in reconstruction are obtained with rehalogenated , for example rechlorinated , silver images as phase images . here the information - carrying structure provides an optical path length image which is composed of an external relief in the gelatine and an internal relief in the differences in refractive index , which are caused by the different levels of silver halide concentrations . in the case of bleached silver film , the gelatine produces both periodic differences in the refractive index and periodic changes of the layer thickness . unbleached silver film is accordingly a mixed form of absorption grids and phase grids . grids produced in thermoplastic photoconducting layers or grids in photolacquer layers are largely pure phase grids having relief structures . the relatively light - sensitive silver halide layers and the likewise light - sensitive photoconducting and , if appropriate , thermoplastic layers , which are electrostatically charged , exposed and either developed with toner or heated until a relief image has formed , are suitable for recording individual grid images of , for example , the entire identity card with all the data including a photograph of the cardholder . the less light - sensitive layers from photolacquers , especially from positive - working photolacquers with o - quinone - diazide as the light - sensitive substance , are particularly suitable for the recording of very high - grade grid structures which have a high line density per millimeter and are thus relief images which are difficult to imitate and which contain general security markings , such as , for example , emblems , code numbers , code words and the like . this relief grid image technology has reached a very high technical state which makes it possible to produce relief grids having up to 600 lines per millimeter with a sine - shaped or oblong - shaped grid profile which can be determined beforehand . from these relief grid images , nickel masters are produced by means of which duplicates are prepared by embossing thermoplastic films , for example polyvinyl chloride films . these grids are particularly suitable for producing general security markings , such as emblems , coats of arms and the like , which sometimes are complemented by an item allocated to a relatively large number of cards , such as a series main number . grids of this type are described in the journal &# 34 ; optics communications &# 34 ;, volume 18 , 1976 , no . 3 , pages 292 - 303 . in principle , the line spacings in the production of grid images are not limited on the side of either large or small dimensions . however , an image can be called a grid image only if at least one grid period extends over the recording area . in the case of grid images which are read out by light reflection , this is the entire card and , in the case of grid images which are read out by light transmission , this is the diameter of the window opening . preferably , grid periods are selected which are substantially smaller than the diameter of the card or of the window opening , in order to obtain a clear diffraction effect on the grid . for example , the grid images can contain from ten lines per millimeter to several hundred lines per millimeter . typical effects , based on the diffraction , then occur , as in the case of colored grid images which have an oblong - shaped cross section of the relief structures . viewing with the naked eye is possible at about one hundred lines per millimeter of the grid image , and these effects are particularly clear above about four hundred lines per millimeter . such line structures are produced on the photographic layer by contact exposure , projection of an image or by interference of laser light . the reconstruction of the absorption image or phase image , modulated with a carrier frequency , is effected as a diffraction process on the spatial carrier frequency , as shown in fig2 by the arrangement in principle . a part of the incident light l e is deflected on the grid structure a as diffracted light l g , since the grid structure acts as a diffraction grating even in imagewise distribution . by means of a lens system 18 indicated diagrammatically , the reconstructed image 7 can be reproduced in the direction of the axis of the incident light l e . moreover , reconstructions 8 &# 39 ;, 8 &# 34 ; in the direction of the diffracted light beam l g are possible . since the line spacing will be known and the line orientation relative to the image will be known , it is possible to set a multiplicity of deflection angles . superposed grid images can be read out separately with diffracted light if each image is superposed by a characteristic line structure . this leads to a large number of possible combinations of angle settings and image superpositions so that the selection and fixing to one or several angle settings , possibly superposed by blank settings , that is to say grid images without any information content , will constitute a security marking . the reconstruction must then be carried out accurately under the fixed angles so that exact readout is possible by means of the corresponding diffraction on the particular grid . in &# 34 ; optics communications &# 34 ;, volume 18 , 1976 , no . 3 , pages 292 - 303 , sine - shaped relief grids for black and white projection images and oblong relief grids for colored projection images are described . as a result of the color and the combination possibilities thus provided , a further security stage is reached , since it is evident that the relief grid depths for particular colors must be accurate to a few hundredths μm and cannot be duplicated without a knowledge of the technique required for producing them . colored projection images can also be produced by the superposition of the grid images , corresponding to color separation images , under different grid structures and by projection through appropriate filters which are arranged in the paths of the rays concerned , as can be seen from the journal &# 34 ; optik &# 34 ;, volume 28 , 1968 / 69 , page 278 . special schlieren projectors are required for projection . in the case of oblong - shaped relief grids of a defined relief depth , colored projection images can be reproduced with normal projection lens systems (&# 34 ; optics communications &# 34 ;, volume 18 , 1976 , no . 3 , pages 292 - 303 ) or the colored images can be visually observed , which enhances the practicability . the build - up of an identity card 1 , the reconstruction of which gives a multi - colored image from oblong - shaped relief grids , is described by reference to fig3 . although the application of grid structures to identity cards is unknown , the superposition of three layers of grid structures ( where each layer has a constant grid depth ) is well known . three color separation images are mutually superposed on three grid layers in the window 5 of the card core 2 . these composite grid layers consist of part images 9 , 10 , 11 for yellow , magenta and cyan respectively . the front and rear of the card core 2 are each laminated with a transparent film 4 &# 39 ; and 4 &# 34 ; respectively . it is obvious that the insertion in a true fit of three grid layers or grid images into the opening of the window 5 is difficult . instead , it is possible to use a technique in which oblong relief grid structures of different depths are produced in such a way that they are intercalated in one plane , as is described , for example , in west german patent applications nos . p 26 57 246 . 3 , p 27 34 581 . 9 and p 27 34 580 . 8 corresponding to copending u . s . application ser . nos . 861 , 491 , 928 , 700 , and 928 , 701 , filed dec . 16 , 1979 , july 27 , 1978 and july 27 , 1978 , respectively . these relief grid structures in one plane are advantageously complemented by irregular relief structures for representing black , as is explained in west german patent application no . p 25 51 741 . 5 which corresponds to copending u . s . application ser . no . 961 , 440 filed nov . 16 , 1978 . the identity card 1 shown in fig4 has a grid image 3 with oblong relief grid structures of different depths in the opening of the window 5 , which grid image is complemented by irregular relief grid structures 12 . the space above the grid image 3 can be occupied by one or more transparent film inserts 13 which are not capable of lamination . in fig4 two such film inserts 13 are drawn , but it is also possible that only one film insert 13 or more than two film inserts fill up the window zone above the grid image 3 . as an experiment , a single - layer grid image was integrated in an identity card 1 built up in this way , which grid image is multi - colored in reconstruction and , when reproduced , shows the black west german federal eagle on a black / red / golden - yellow background . the reconstructed image could be viewed using a conventional slide projector or a microfilm reader , but it was also possible to discern the image even with visual observation in approximately vertically transmitted light . in reflected light , however , neither a black and white image nor a colored image was visible . it is therefore impossible , solely on the basis of the optical impression , to carry out a forgery of a relief grid image of this type in such a way that the latter is replaced by a color photograph . a security mark , such as a colored relief grid image , should be incorporated , as much as possible , in the particular identity card in such a manner that it cannot readily be taken out of the card and inserted into another card . one step in this direction consists of inserting the grid image not in the form of a platelet into the opening of the window of the card core , but in producing it integrally in the identity card on a continuous card layer which functions as a grid image carrier . for this purpose , the card core can partially be coated with a photo - emulsion , in particular in the window zone . similarly , it is possible to apply a photoconductor layer for the production of toner images or to apply a thermoplastic , photoconducting recording layer for the production of relief images . it is also possible directly to form a toner image , on a core film or on the inside of one of the cover films , by transfer or electrographically via a charge image produced by means of recorder electrodes . a further possibility consists in embossing a grid image into the window zone of a transparent continuous film . fig5 shows a further embodiment of an identity card 1 in which the card core consists of two matt films 2 which enclose a continuous grid image carrier 14 of transparent film . the grid image 3 was embossed onto the grid image carrier 14 beforehand . experiments have shown that it is virtually impossible to cut the grid image 3 out of a continuous grid image carrier 14 of this type without damage and to insert this grid image into another card in such a way that no cut edges are visible . fig6 a and 6b show an embodiment which has a card construction which is particularly stable in use . the manufacture of this identity card takes place in two stages . initially , the two - ply card core 2 which already contains the personal data of the cardholder and encloses the continuous grid image carrier 14 , that is to say a transparent interposed film , is laminated with the film 4 &# 34 ;. in the window zone , the lower core film 2 receives a transparent film insert 15 capable of lamination . the window zone in the upper core film 2 is initially left open , for example using a laminating press of corresponding shape or an inserted disc 16 which is not capable of lamination and is shown in fig6 a . the disc 16 can , for example , consist of a polyester film of appropriate thickness . in the case of an identity card consisting of polyvinyl chloride films , lamination is effected at temperatures of 130 ° c . to 160 ° c . and under pressures of about 10 to 30 bars ( approximately 10 to 30 kp / m 2 ) with press times of 5 to 10 minutes . subsequently , the disc 16 is removed and one or more grid images 3 are impressed into the exposed grid image carrier 14 by means of a forming punch heated to about 140 ° c . finally , a transparent film insert 13 , not capable of lamination , is inserted as a thickness compensation disc in place of the disc 16 and the upper film 4 &# 39 ; ( fig6 b ) is laminated on , while the grid image 3 located in the interior is protected . although the invention has been described relative to a specific embodiment thereof , it is not so limited and many modifications and variations thereof will be readily apparent to those skilled in the art in light of the above teachings . it is , therefore , to be understood that , within the scope of the appended claims , the invention may be practiced otherwise than as specifically described . | 1 |
fig4 , 5 and 12 show a linking member 10 having two opposing arm members 11 that are interconnected by two opposing , intermediate , looped end portions 12 , said linking member being substantially symmetrical about both its longitudinal and transverse axes . the arm members 11 diverge outwardly and away from the looped end portions 12 and whereby the enclosed angle between opposing arm members is approximately 20 degrees . consequently the distance separating the opposing arm members is greatest in the mid portion of the linking member and smallest adjacent the looped end portions . each looped end portion 12 includes an inner or wear surface 13 that in use is to be protected against wear resulting from engagement with another linking member by a wear crutch 14 that is adapted to cover said inner surface . on either side of the looped end portion 12 there is provided a crescent shaped recess 15 ( see shaded areas of fig4 and 5 ) that is formed in the inner surface 13 . each looped end portion 12 also includes two opposing , somewhat elongate , recesses or key seats 16 , each having a rectangular shaped opening . the key seats 16 are formed in the inner surface 13 , midway between opposing sides of the linking member 10 and partway along the length of the arm members 11 . each looped end portion 12 also includes a centrally located slot 17 formed in the inner surface 13 that extends from one side of the linking member 10 to an opposing side of the linking member . the slot 17 has a substantially square shaped transverse cross - section . the looped end portions 12 each also include two elongate grooves 18 that are each formed in a respective side face of the linking member 10 . the grooves 18 each have a longitudinal axis and whereby these axes lie in the same plane containing the both the longitudinal axis of the linking member 10 and a longitudinal axis of the slot 17 . fig7 to 11 show a wear crutch 14 having two substantially parallel , somewhat plate like , guides 19 having an arcuate edge portion 20 . the guides 19 are connected by an intermediate wear body 21 . the wear body 21 includes a first or outer , curved , surface 22 and a second or inner , curved , surface 23 . the outer and inner curved surfaces 22 and 23 are located on opposite sides of the body 21 and whereby the two curved surfaces intersect one another at opposite ends of said body along common edge portions 24 . the common edge portions 24 and the outer surface 22 are located between the guides 19 , said guides being substantially perpendicular to a plane containing said edge portions . the outer and inner surfaces 22 and 23 define a wear thickness there between that is thickest midway between the common end portions 19 . the wear crutch 14 also includes two , somewhat rectangular shaped , keys 25 that protrude out from the outer surface 22 , said keys being located on opposite ends of the wear body 21 adjacent a common edge portion 24 . the wear crutch 14 also includes a square shaped peg 26 that protrudes out from the outer surface 22 . the peg 26 is located midway between the common edge portions 24 . fig6 and 12 show the linking member 10 two which there has been attached two opposing wear crutches 14 . the outer surface 22 , of each wear crutch 14 , in use abuts against a respective inner surface 13 of the linking member 10 . each wear crutch 14 is retained on a respective looped end portion 12 of the linking member 10 by a rolled steel pin 27 that is frictionally threaded through aligned guide apertures 28 formed in respective guides 19 and an aperture 29 formed in the looped end portion . the guides 19 , receivable within respective recesses 15 , and the keys 25 , receivable within respective key seats 16 , aid in the correct location of the wear crutch 14 on the looped end portion 12 during the bedding process . further , when the wear crutch 14 is correctly bedded on the looped end portion 12 , the common edge portions 18 shall engage a respective one of the adjacent arm members 11 in a manner whereby said edge portions and abutting inner surfaces of the arm members are substantially flush , as illustrated in fig6 . it will be appreciated that the location of the guides 19 within respective recesses 15 ; the location of the keys within respective key seats 16 , and the location of the peg 26 within the slot 17 all assist in preventing movement of the wear crutch 14 relative to the looped end portion 12 arising from engagement of the linking member 10 with another linking member , or such like , during use . it is also believed that these multiple locating means will not only spread the load applied on the locating means but also prevent accidental movement of the wear crutch 10 during its removal . in use , the inner surface 23 , of the wear crutches 14 shall provide a sacrificial wear surface and whereby the inner surfaces 13 of the looped end portions 12 will be protected from wear . further , it is envisaged that worn wear crutches 14 will be replaced by fresh wear crutches and that the replacement of worn wear crutches could be undertaken on a regular basis as part of a maintenance program that is intended to prolong the working life of the linking members 10 and thereby a chain , or such like comprising a plurality of interconnected linking members . when the wear crutch 10 is properly located on the linking member , the respective common edge portions 15 of the wear crutch 10 are flush with an inner surface of the respective side arms of the linking member as illustrated in fig6 and 14 in the region indicated as “ y ”. the linking member used with the wear crutch 10 of the present invention is preferably specifically configured in order to ensure this flush fit . an alternative linking member 30 , in the form of a shackle , is illustrated in fig1 and 14 . the shackle 30 includes two opposing arm members 11 and a single looped end portion 12 that is located between and is connected to adjacent ends of said arm members , while the opposing ends of the arm members are adapted to receive a pawl ( not shown ) to open and close the shackle . like the linking member 10 , the arm members 11 of the shackle 30 diverge outwardly from the looped end portion 12 and whereby the enclosed angle between the opposing arm members is approximately 20 degrees . fig1 and 16 show a combination wear crutch displacement apparatus 100 and a wear crutch bedding apparatus 101 located side by side one another . the wear crutch displacement apparatus 100 includes displacement support means 102 , that is capable of providing support for one or more linking members 10 ; linking member restraining means 103 for preventing relative movement of a selected one of the linking members 10 during the process of displacing a wear crutch 14 that is mounted on said linking member , and a wear crutch displacing tool 104 . the displacement support means 102 includes a rectangular shaped , plate like , support 105 having a substantially flat support surface 106 . the support 105 is mounted on a plurality of wheels 107 that are each capable of rotational movement about an axle , not shown , within a channel 108 of a base 109 . the linking member restraining means 103 includes two opposing flanges 110 , each having a free end portion 111 . the flanges 110 are interconnected by an intermediate mounting portion 112 that is itself affixed to an elongate side rail 113 that is rigidly attached to the base 109 . the wear crutch displacing tool 104 includes a bifurcated head portion 114 consisting of two opposing terminal members 115 each having a free end portion 116 . the opposing ends of the two members 115 are interconnected by an intermediate bridging member 121 that is itself mounted on one end of a hydraulic ram consisting of a stem 117 that is capable of reciprocal movement in the direction of arrow 118 and whereby the stem is powered by a power source 119 that is rigidly mounted on a second elongate rail 120 that is substantially parallel and spaced from the first side rail 113 . the side rail is also rigidly attached to the base 120 . the support 105 is located between the opposing side rails 113 and 120 and is capable of reciprocal movement along the length of the channel 108 . the wear crutch bedding apparatus 101 includes bedding support means 130 for supporting a linking member 10 or a plurality of interconnected linking members 10 , such as a chain 200 , during a wear crutch bedding process , a first linking member engagement means 131 and a second linking member engagement means 132 that is spaced from said first linking member engagement means . the bedding support means 130 includes a plurality of cylindrically shaped rollers 133 , each capable of rotational movement about a longitudinal axis . the rollers 133 are located between two opposing , substantially parallel side rails 134 and whereby each roller is connected to both side rails by an axle 135 about which said roller rotates . the first linking member engagement means 131 includes a body 136 that is slidably mounted on both of the side rails 134 and whereby the body includes an aperture 137 formed therein that in use may be selectively aligned with one of a plurality of apertures 138 formed in a plate like member 139 that is located at a first end of the bedding apparatus , said plate like member being also located between and attached to the side rails 134 . the first linking member engagement means 131 also includes a post 140 having a lower end that is capable of being received in aligned apertures 137 and 138 so as to thereby fix the location of said first linking member engagement means relative to the bedding support means 130 . the upper end of the post 140 extends above the body 136 . the second linking member engagement means 132 also includes a body 141 that is slidably mounted on both of the side rails 134 and is located at an opposite end of the bedding apparatus to that of the first linking member engagement means 131 . further , the body 141 includes a centrally located post 142 that stands proud of the body . the body 141 is connected to two hydraulically operated ram assemblies 143 that when actuated shall move the second linking member engagement means 132 along the rails 134 and away from the first linking member engagement means . in use , a chain 200 , constructed in accordance with the present invention , consisting of a plurality of interconnected linking members 10 , each having two opposing wear crutches 14 fitted to respective , adjacent , looped end portions 12 , may be placed lengthwise on the support 205 such that adjacent linking members are substantially orthogonal , as illustrated in fig1 and 17 . beginning with say the first linking member 10 ′ of the chain 200 , a first looped end portion 12 ′ is positioned between the opposing flanges 110 such that each flange is at least partially received within a respective groove 18 and whereby the distal or free end of each flange 121 abuts against an arcuate edge portion 20 of a guide 19 . the opposing end portion 12 ″ of the same linking member 10 ′ is positioned between terminal members 115 such that each member is at least partially received within a respective groove 18 and whereby the distal end 116 of each member abuts against an arcuate edge portion 20 of a guide 19 . actuation of the power source 119 shall cause the stem 117 to advance towards the restraining means 103 whereby the resulting force applied by the members 115 directly to the edge portions 20 of the wear crutch 14 ″ shall be sufficient to displace said wear crutch relative to the looped end portion 12 ″. once this has occurred , subsequent engagement of the bridging member 121 with the looped end portion 12 ″ shall result in a force applied by the flanges 110 to the wear crutch 14 ′ sufficient to displace said wear crutch from the looped end portion 12 ′. having disengaged the linking member 10 ′ from the restraining means 103 and the displacing tool 204 , the displaced wear crutches 14 ′ and 14 ″ of the first linking member 10 ′ may be removed and replaced with fresh wear crutches . this process may be repeated for every second one of the linking members in the chain by moving the displacement support means along the channel 108 such that the said linking members in turn are aligned with the retraining means 103 and the displacement tool 104 . once the wear crutches on every second linking member have been displaced and subsequently replaced , the chain 200 may be repositioned on the displacement support such that the linking members that were previously lying substantially parallel to the rails 113 and 120 are now substantially orthogonal thereto and visa versa . once all of the worn wear crutches have been replaced by fresh wear crutches , said fresh wear crutches being only partially located on the linking members , the adjacent bedding apparatus may be used to bed said fresh wear crutches . the chain 200 is therefore moved across and placed on the bedding support means 130 , such that it is generally supported lengthwise on the rollers 133 , as shown in fig1 . the first linking member 20 ′″ is placed over the upstanding end of the post 140 such that it is retained on said post . the last linking member 10 ″″ of the chain 200 is placed over the upstanding post 142 such that it is retained on said post . the operator then actuates the ram assemblies 143 such that the distance separating the first and second linking member engagement means 131 and 132 is increased whereby as a consequence of the forces applied to the linking members by said engagement means the linking members are generally aligned with one another and the wear crutches are pulled into their bedded position . it is believed that by providing wear crutches 14 that are made of a material that is harder than the material from which the linking members are made from , the resulting chain will last longer than prior art chains and that the use of the replaceable wear crutches will significantly reduce the time and labour previously required to rebuild a worn chain . | 5 |
in accordance with one embodiment of the present invention , one or more cmut patches are adhered to the mother &# 39 ; s abdomen . each cmut patch comprises a two - dimensional ultrasound transducer array that is steerable in three - dimensional space . the cmut patches are electrically connected to a bedside instrument . when the instrument is powered on , a search is performed to acquire the doppler signal of the fetal heart . an initial coarse search , using wide beams and long range gates , will be followed by higher - resolution searches that will successively locate the fetal heart to a greater precision . once the fetal heart has been located precisely , its position will be tracked using multiple sample volumes surrounding the heart &# 39 ; s location . the sample volume that is directly over the heart &# 39 ; s location will produce a doppler waveform that can be processed to extract the fetal heart rate . based on acoustic data from the cmut patch probes , a processor incorporated in the bedside instrument autonomously computes various parameters , including the estimated fetal heart rate . in addition , the processor forms and steers ultrasound beams over the volume of space in front of each cmut patch probe . the cmut patch probes can be electrically coupled to the processor ( or processors ) by means of cables . alternatively , a wireless electrical coupling could be provided . the foregoing concepts can be easily extended to monitor multiple - birth patients using multiple cmut patches . even for a single birth , the use of multiple cmut patches will produce redundant fetal heart signatures , allowing for enhanced reliability . note that multiple cmut patches can be employed in a multiple - birth situation in a mode where each cmut patch is tracking multiple fetal hearts . this is possible because electronic beam steering allows the ultrasound “ look directions ” to be changed without any delay . in accordance with one embodiment of the invention shown in fig1 , the dsp 34 controls two cmut patch probes 30 and 32 . the reason for having two probes is to have some redundancy in measuring the fetal heart signal . if the mother moves , it is hoped that one or the other probe will remain locked onto the fetal heart . more than two cmut patch probes can be used . however , it should be understood that the broad concept of the invention also encompasses the use of a single cmut patch probe . referring to the embodiment shown in fig1 , the cmut patch probes 30 and 32 will each operate in a pulsed - wave ( pw ) doppler mode . when acquiring the fetal heart , the range gates will be long ; this is the standard mode of operation of known ultrasound fetal heart rate monitors . however , the use of cmut patch probes in conjunction with an instrument operating in the pw doppler mode provides a beam steering capability that is absent from known fetal heart rate monitoring systems . the fetal heart signature will be obtained by scanning the beams laterally until the fetal heart is detected . this detection occurs because the valves of the fetal heart cause a doppler shift in the reflected ultrasound . the fetal heart rate is much higher than the maternal heart rate , which makes it easy to recognize . in accordance with one embodiment of the invention , the dsp 34 is programmed to perform an automatic recognition algorithm for the fetal heart signature . for example , the dsp can be programmed to detect an oscillating mean frequency of the doppler shift in a certain frequency range . lateral scanning could be accomplished by translating the transmit aperture or by changing the beam direction from a stationary transmit aperture or a combination of both . however , the use of translation but not beam steering would require the cmut patch be large enough for a translated aperture to cover a sufficient range of positions . once both cmut patch probes 30 and 32 have acquired the fetal heart , the dsp 34 will begin to decrease the length of the pw range gates . the basic mode of operation will be to decrease the length on one probe until that probe starts to lose signal . a smaller range gate encompassing the heart will give a better signal - to - noise ratio ( snr ). it is possible to use the beam steering angles from the multiple patch probes to guide the process of decreasing the range gate length . for example , if two cmut patch probes are properly positioned on the mother &# 39 ; s abdomen so that two ultrasound beams originate from two points , with the beams at an angle relative to each another and with both beams producing a respective fetal heart signal , then the fetal heart will be located within the spatial intersection of the beams . ( the two probes do not have to be transmitting simultaneously in order for this to happen .) if the dsp ( or other processor ) knew their respective beam steering angles and their relative positions , then the distance of the fetal heart from either probe could be computed , at least approximately , from the geometry of the data collection set - up . the estimated range to the fetal heart could then be used to define a shorter range gate centered around the newly estimated range . however , using the beam steering angles from multiple patch probes to guide the process of decreasing the range gate length is not necessary to practice of the broad concept of the present invention . the process of adjusting the range gate to optimize the snr will be in continuous operation as a method of tracking fetal heart range . the method would be a search algorithm based on the doppler signal power . the range gate would be modified in both size and depth , and changes that resulted in a higher doppler signal power would be retained . the instrument can identify doppler signal power because it is the power of that part of the input signal that gets past the high - pass filter used for stationary clutter rejection . lateral tracking will occur on one probe at a time . the beam will be steered away from the initial beam steering angle in eight directions , i . e ., the eight range gates will surround the range gate of the initial beam in a 3 × 3 spatial relationship . that direction and range giving the best signal ( i . e ., highest snr ) will be the new beam steering angle and range gate depth . extrapolating this principle , one could steer 27 successive beams to acquire data from a cube of range gate positions surrounding the nominal range rate position in three - dimensional space . the implementation of this scheme would require formation of three range gates for each of nine ( eight plus the nominal ) beam steering angles . more specifically , the cmut patch probes can be used to track the location of a fetal heart using a method comprising the following steps : ( a ) scanning a volume inside the abdomen with beams of pulsed ultrasonic wave energy ; ( b ) acquiring acoustic data by transducing ultrasound wave energy returned from the abdomen after each transmission in step ( a ), the acoustic data being acquired using range gates centered in different sample volumes ; ( c ) determining the signal - to - noise ratio of the acquired acoustic data for each different range gate ; and ( d ) determining which one of the different range gates had the acoustic data which produced a maximum signal - to - noise ratio . this determined range gate will then be used to acquire additional acoustic data from which the fetal heart rate will be calculated . typical frequencies for existing fetal heart rate monitoring probes lie in the range of 1 to 2 mhz . in accordance with one embodiment of the present invention , higher frequencies in the range of about 3 to 5 mhz could be used . in some known monitors , a speaker is provided and the probe is manually manipulated until the operator hears the fetal heart . the cmut patch probes disclosed herein can used in conjunction with an instrument operating in such an audio mode . this feature can be utilized to locate the patch probes more accurately at the time of their attachment to the patient &# 39 ; s abdomen . for example , the processor may be programmed with a mode whereby the cmut patch probe is controlled to transmit a series of beams of ultrasonic wave energy in a direction normal to the face of the probe . acoustic data is acquired by transducing the ultrasound wave energy returned from the abdomen of the patient after each beam transmission . the acquired acoustic data is then converted into audible signals using a speaker 38 ( see fig1 ) connected to the processor 34 . the clinician or attending nurse can then attach each cmut patch probe to the abdomen of the patient at a respective location where the respective audible signals produced using each probe sound like or mimic the fetal heart beat . in accordance with a further embodiment of the invention , multiple cmut patch probes can be used to monitor more than one fetus , e . g ., twins , inside a patient . the system will monitor twins by assigning a subset of the probes to one fetus and the rest of the probes to the other fetus . if only two cmut patch probes are used , then each probe will be placed as nearly as possible in positions overlying the respective fetal hearts . when two probes have acquired the same fetal heart , their doppler mean - frequency traces will be in phase . in general , a second fetal heart will result in a mean - frequency trace that is out of phase . the disclosed embodiment will operate on complex baseband signals , and will thus be able to track the fetal heart valve motion through a complete cardiac cycle . for example , the dsp will be programmed to compute the mean doppler frequency on a continuous ( every pulse ) basis , as is done in color m - mode and using the same computations as those used by a color flow mapper ( imaging system ). this will produce a simple signed function of time representing the motion that is being sensed within the range gate . as seen in fig1 , the instrument further comprises a display screen 36 for displaying the fetal heart rate and an image of a pw doppler flow signal taken from the fetus . the spectrogram is similar to that acquired from an adult heart , except that the signal will evidence a higher heart rate . the pw doppler spectrogram shows frequency versus time , in which the mean frequency and bandwidth of the signal vary in a periodic manner . the dsp 34 is programmed to locate the fetal heart signal in space by steering the successively transmitted beams until a doppler signal is acquired that is sufficiently close to being a match of the “ signature ” signal . there is some ambiguity because the shape of the spectral doppler output will change with the angle at which the beam intersects the heart , but the rate will always be higher than that of the mother and accordingly it is believed that an automated search would be feasible . because the cmut patches will be adhered to the mother &# 39 ; s body , and because the fetal heart is tracked in three - dimensional space as it moves relative to the cmut patches , the fetal heart rate should be continuously available without any operator intervention . this arrangement has the following advantages . first , operator intervention is eliminated for operation of the fetal heart rate monitor . second , the mother is allowed free motion while being monitored . third , the heart rate measurement should be more reliable because the relatively smaller ( as compared to current systems ) doppler sample volume will allow a higher doppler signal - to - noise ratio in the measured ultrasound data . although similar capabilities will also be available with standard ( non - cmut ) two - dimensional arrays and real - time three - dimensional imaging , the cost of these devices is likely to be so high as to rule them out for this application . additionally , such transducers are too bulky and heavy to be made to adhere to the skin . furthermore , the use of cmuts permits a relatively easy and low - cost implementation of concepts such as the mosaic annular array . the use of ultrasound measurements in the continuous fetal heart rate monitoring application is enabled by micromachined ultrasonic transducer patch probe technology , which allows ultrasound data to be taken using a thin , lightweight probe that adheres to the patient &# 39 ; s skin . recently semiconductor processes have been used to manufacture ultrasonic transducers of a type known as micromachined ultrasonic transducers ( muts ), which may be of the capacitive ( cmut ) or piezoelectric ( pmut ) variety . cmuts are tiny diaphragm - like devices with electrodes that convert the sound vibration of a received ultrasound signal into a modulated capacitance . for transmission the capacitive charge is modulated to vibrate the diaphragm of the device and thereby transmit a sound wave . one advantage of muts is that they can be made using semiconductor fabrication processes , such as microfabrication processes grouped under the heading “ micromachining ”. as explained in u . s . pat . no . 6 , 359 , 367 : micromachining is the formation of microscopic structures using a combination or set of ( a ) patterning tools ( generally lithography such as projection - aligners or wafer - steppers ), and ( b ) deposition tools such as pvd ( physical vapor deposition ), cvd ( chemical vapor deposition ), lpcvd ( low - pressure chemical vapor deposition ), pecvd ( plasma chemical vapor deposition ), and ( c ) etching tools such as wet - chemical etching , plasma - etching , ion - milling , sputter - etching or laser - etching . micromachining is typically performed on substrates or wafers made of silicon , glass , sapphire or ceramic . such substrates or wafers are generally very flat and smooth and have lateral dimensions in inches . they are usually processed as groups in cassettes as they travel from process tool to process tool . each substrate can advantageously ( but not necessarily ) incorporate numerous copies of the product . there are two generic types of micromachining . . . 1 ) bulk micromachining wherein the wafer or substrate has large portions of its thickness sculptured , and 2 ) surface micromachining wherein the sculpturing is generally limited to the surface , and particularly to thin deposited films on the surface . the micromachining definition used herein includes the use of conventional or known micromachinable materials including silicon , sapphire , glass materials of all types , polymers ( such as polyimide ), polysilicon , silicon nitride , silicon oxynitride , thin film metals such as aluminum alloys , copper alloys and tungsten , spin - on - glasses ( sogs ), implantable or diffused dopants and grown films such as silicon oxides and nitrides . the same definition of micromachining is adopted herein . the systems resulting from such micromachining processes are typically referred to as “ micromachined electromechanical systems ” ( mems ). the use of a mut patch allows the obstetrician to stick the transducer to the mother &# 39 ; s skin . the mut patch is lightweight and flat . in accordance with one embodiment of the invention , the cmut patch probes can be attached to the patient &# 39 ; s skin with an acoustically transparent layer of adhesive . for the purpose of illustration , a transducer patch will be described that is made up of capacitive micromachined ultrasonic transducers ( cmuts ). however , it should be understood that the patch could instead employ pmuts . the concept of the invention can be extended to cover piezoceramics as well as piezoelectric materials . an embodiment will now be described that incorporates a mut patch . however , it should be understood that the present invention encompasses not only a device , but also methods for continuous non - invasive fetal heart rate monitoring . referring to fig2 , a typical cmut transducer cell 2 is shown in cross section . an array of such cmut transducer cells is typically fabricated on a substrate 4 , such as a heavily doped silicon ( hence , semiconductive ) wafer . for each cmut transducer cell , a thin membrane or diaphragm 8 , which may be made of silicon nitride , is suspended above the substrate 4 . the membrane 8 is supported on its periphery by an insulating support 6 , which may be made of silicon oxide or silicon nitride . the cavity 16 between the membrane 8 and the substrate 4 may be air - or gas - filled or wholly or partially evacuated . typically , cmuts are evacuated as completely as the processes allow . a film or layer of conductive material , such as aluminum alloy or other suitable conductive material , forms an electrode 12 on the membrane 8 , and another film or layer made of conductive material forms an electrode 10 on the substrate 4 . alternatively , the bottom electrode can be formed by appropriate doping of the semiconductive substrate 4 . the two electrodes 10 and 12 , separated by the cavity 16 , form a capacitance . when an impinging acoustic signal causes the membrane 8 to vibrate , the variation in the capacitance can be detected using associated electronics ( not shown in fig2 ), thereby transducing the acoustic signal into an electrical signal . conversely , an ac signal applied to one of the electrodes will modulate the charge on the electrode , which in turn causes a modulation in the capacitive force between the electrodes , the latter causing the diaphragm to move and thereby transmit an acoustic signal . the individual cells can have round , rectangular , hexagonal , or other peripheral shapes . a cmut cell having a hexagonal shape is shown in fig3 . hexagonal shapes provide dense packing of the cmut cells of a transducer subelement . the cmut cells can have different dimensions so that the transducer subelement will have composite characteristics of the different cell sizes , giving the transducer a broadband characteristic . unfortunately , it is difficult to produce electronics that would allow individual control over such small cells . while in terms of the acoustical performance of the array as whole , the small cell size is excellent and leads to great flexibility , control is limited to larger structures . grouping together multiple cells and connecting them electrically allows one to create a larger subelement , which can have the individual control while maintaining the desired acoustical response . so a subelement is a group of electrically connected cells that cannot be reconfigured . for the purpose of this disclosure , the subelement is the smallest independently controlled acoustical unit . one can form rings or elements by connecting subelements together using a switching network . the elements can be reconfigured by changing the state of the switching network . however , individual subelements cannot be reconfigured to form different subelements . for the purpose of illustration , fig4 shows a “ daisy ” transducer subelement 24 made up of seven hexagonal cmut cells 2 : a central cell surrounded by a ring of six cells , each cell in the ring being contiguous with a respective side of the central cell and the adjoining cells in the ring . the top electrodes 12 of each cell 2 are electrically coupled together by connections that are not switchably disconnectable . in the case of a hexagonal array , six conductors 14 ( shown in both fig3 and 4 ) radiate outward from the top electrode 12 and are respectively connected to the top electrodes of the neighboring cmut cells ( except in the case of cells on the periphery , which connect to three , not six , other cells ). similarly , the bottom electrodes 10 of each cell 2 are electrically coupled together by connections that are not switchably disconnectable , forming a seven - times - larger capacitive transducer subelement 24 . subelements of the type seen in fig4 can be arranged to form a two - dimensional array on a semiconductive ( e . g ., silicon ) substrate . these sub - elements can be reconfigured to form elements , such as annular rings , using a switching network . fig5 is a drawing showing a mosaic array 40 comprising eight annular elements . the drawing has been simplified by representing each subelement as a square , the squares being aligned in mutually orthogonal rows and columns . however , it should be understood that the subelements could be of the type shown in fig4 , in which case the subelements would be aligned along three axes separated by 60 - degree angles . reconfigurability using silicon - based ultrasound transducer sub - elements was described in u . s . patent application ser . no . 10 / 383 , 990 . one form of reconfigurability is the mosaic annular array , also described in that patent application . the mosaic annular array concept involves building annular elements by grouping subelements together using a reconfigurable electronic switching network . the goal is to reduce the number of beamforming channels , while maintaining image quality and improving slice thickness . to reduce system channels , the mosaic annular array makes use of the fact that for an unsteered beam , the delay contours on the surface of the underlying two - dimensional transducer array are circular . in other words , the iso - delay curves are annuli about the center of the beam . the circular symmetry of the delays leads to the obvious grouping of those subelements with common delays and thus the annular array is born . the reconfigurability can be used to step the beam along the larger underlying two - dimensional transducer array in order to form a scan or image . in accordance with one embodiment of the present invention shown in fig6 , an array of cmut subelements is built on one silicon wafer and conventional complementary metal oxide semiconductor ( cmos ) switches and preamplifier / buffer circuits are formed on a second silicon wafer to provide a cmut patch having reconfigurable beamforming elements . an acoustic backing layer 18 is preferably sandwiched between the cmut wafer 2 / 4 and the cmos wafer 20 with vias 22 for passage of electrical connections between the wafers . the acoustic backing material 18 should have a composition that is acoustically matched to the cmut substrate 4 , to prevent reflection of the acoustic energy back into the device . in the case where the substrate is made of silicon , one example of a suitable backing material comprises a mixture of 96 . 3 % ( by mass ) tungsten ( of which 85 % was 10 micron and 15 % was 1 micron particle size ) and 3 . 67 % polyvinyl chloride ( pvc ) powders , as disclosed in u . s . patent application ser . no . 10 / 248 , 022 entitled “ backing material for micromachined ultrasonic transducer devices ”. the person skilled in the art will recognize that the composition of the acoustic backing material can be varied from the example given above , however , the acoustic impedance of the resulting backing material should be matched to that of the substrate material . for example , if the substrate is silicon , the acoustic impedance should be approximately 19 . 8 mrayls ± 5 %. the cmos electronics preferably includes the transmit and receive circuits ( including a respective transmit / receive switch for each cmut subelement ) and at least a portion of the beamforming circuits . the cmos electronics also include switches that enable reconfiguration of the subelements , allowing an aperture to be translated over the two - dimensional active area of the transducer . the shape of the apertures is determined by the desired steering angle for the ultrasound beam . the beams can be translated across the cmut patch by translating the annular array of activated subelements ( seen in fig5 ) across the patch as shown in fig7 . a uniform translation of the beamforming coefficients produces a new beam at a different location . repeated frequently , this generates a rectilinear two - dimensional image . an additional bilinear term in the beamforming coefficients produces a beam directed away from the normal , as seen in fig8 . while the invention has been described with reference to preferred embodiments , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation to the teachings of the invention without departing from the essential scope thereof . therefore it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this invention , but that the invention will include all embodiments falling within the scope of the appended claims . as used in the claims , the term “ data processing means ” means one or more digital signal processors , one or more microprocessors , one or more computers , one or more computer or processor chips , any combination thereof , and any functionally equivalent circuitry , as well as any associated memory device or memory chip for storing executable instructions or data . as used in the claims , the term “ different sample volumes ” means sample volumes that either overlap only partially or do not overlap ( i . e ., occupy the same space ) at all . while only certain features of the invention have been illustrated and described herein , many modifications and changes will occur to those skilled in the art . it is , therefore , to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention . | 0 |
in accordance with one aspect of the invention , ion implantation can be used to improve the uniformity and controllability of a timed etch . as described below , this ion implantation can advantageously enhance the etch rate within a depth range that reaches down to a desired etch depth . fig2 illustrates exemplary steps for improving the uniformity and controllability of a timed etch . in step 201 , a wafer having patterned silicon and dielectric areas can be positioned for an etching process . this wafer could have a simplified cross - section similar to that shown in fig1 a . in step 202 , an ion implantation process can be performed . the implantation effectively “ damages ” the upper portions of the silicon and dielectric areas . in other words , much like spraying a plaster wall with bullets can facilitate the subsequent removal of the plaster , ion implantation can accelerate the subsequent removal of the implanted material during a subsequent timed etch . as shown in fig3 , damaged region 301 ( shown by the dotted , semi - transparent area ) has a depth 302 within the dielectric areas . note that the depth of the damaged region 301 within the silicon areas may be different than depth 302 . depth 302 is determined by the implant species ( e . g . argon ), the dose of the implant ( e . g . 1e14 per square centimeter ), and the energy of the implant . notably , ion implantation is an extremely uniform process ( e . g . dose and energy of an implant species can be controlled within 1 % across a wafer and from wafer to wafer ). as a result , depth 302 can be controlled to a precise depth range . therefore , referring back to fig2 , when a timed etch ( e . g . a wet etch such as a diluted hydrofluoric acid solution or a dry etch such as a plasma etch including fluorine radicals ) is performed in step 203 , the etch depth of the dielectric areas can be precisely controlled . specifically , as shown in fig4 , the etched dielectric areas 401 have an etch depth 402 that is substantially identical to the depth 302 ( fig3 ) of damaged region 301 within the dielectric areas . this is because the etch rate of the damaged dielectric is significantly enhanced as compared with the etch rate of the underlying undamaged dielectric . thus , once the timed etch reaches the undamaged dielectric , i . e . the dielectric areas below depth 302 , the etching rate dramatically slows . advantageously , by accelerating the etch rate by a factor of x ( greater than 1 ), the amount of time needed to etch the damaged dielectric areas can be reduced by a factor of 1 / x . therefore , the over - etch time needed to ensure that all dielectric areas on the wafer are etched to at least the desired etch depth can also be reduced by a factor of 1 / x . reducing the over - etch time can significantly minimize etch depth variations across the wafer . thus , by enhancing the etch rate within a precise depth range that reaches down to the desired etch depth , the uniformity and controllability of a timed dielectric etch process can be significantly improved . note that damaged region 301 also includes portions of patterned silicon layer 101 . the damage within the silicon can be easily repaired by thermal annealing at a temperature greater than approximately 500 degrees celsius to re - crystallize the silicon epitaxially from the underlying undamaged portions . such a thermal annealing process , which is called solid phase epitaxial re - crystallization ( sper ), is well known to those in the integrated - circuit manufacturing industry . it can be performed either before or after the timed dielectric etch , preferably the latter to avoid partial healing of the intentional damage in the dielectric areas . the sper temperature and duration should ideally be sufficiently low so as to minimize diffusion of any dopant atoms ( e . g . boron , indium , phosphorus , arsenic , antimony ) within the silicon . by forming metal - oxide - semiconductor field effect transistors ( mosfets ) over a substrate having precisely - formed and regularly - spaced stripes ( ridges of semiconductor material ( s )), both high performance ( i . e . high on - current ) and low static power consumption ( i . e . low source - to - drain leakage current ) can be achieved with good uniformity . the stripes , which can be formed with the aid of an ion implantation process as described below , enable the formation of segmented channel regions that accommodate a wide range of gate - electrode configuration options and also provide greater performance consistency between devices . fig5 a shows a top view of an exemplary transistor 500 that includes a segmented channel region . transistor 500 is formed on a substrate 590 and is surrounded by device isolation material 593 ( e . g . shallow trench isolation ), and includes a source 510 , a drain 530 , a gate 550 , sidewall spacers 561 and 562 , a source contact region 571 , and a drain contact region 572 . gate 550 ( with a gate length lg ) is located between source 510 and drain 530 and is formed over a channel region 520 in substrate 590 . sidewall spacers 561 and 562 lie over at least a portion of source 510 and drain 530 , respectively , and serve to offset the gate 550 from source contact region 571 and drain contact region 572 , respectively . as indicated by the dotted lines , channel region 520 includes multiple ridges 591 that run between source 510 and drain 530 . ridges 591 are formed from at least one semiconductor material and may be homogenous structures ( e . g . silicon ). ridges 591 are formed on an elevated base region 595 that rises from substrate 590 , as shown in fig1 b . fig1 b is a cross - sectional view of transistor 500 through view location a - a ( rotated 90 ° for clarity ). each ridge 591 has a width w , and is spaced from adjacent ridges by a spacing sp . furthermore , each ridge 591 extends a height hr above elevated base region 595 , which itself rises a height hb from the adjacent surfaces 590 - s of substrate 590 . note that because ridges 591 are identified relative to substrate 590 , ridges 591 continue to exist as “ ridges ” even covered with other materials ( e . g . even though ridge isolation material 592 , device isolation material 593 , gate dielectrics 540 , and gate 550 completely cover ridges 591 , ridges 591 are still considered to be ridges .) as described in greater detail below , each of ridges 191 is a highly precise structure that therefore provides highly quantifiable performance measures . transistor 500 is isolated from adjacent devices by device isolation material 593 ( e . g . silicon dioxide ), which extends down to surfaces 590 - s of substrate 590 ( i . e . down to the bottom of elevated base region 595 ). ridge isolation material 592 ( which can be formed from the same material ( s ) or different material ( s ) than device isolation material 593 ) fills the inter - ridge regions to a distance hg below the top of ridges 591 . gate 550 is formed over the top portions of ridges 591 , separated from those top portions by gate dielectric 540 ( which can be formed from any dielectric material ( s )). thus , when appropriate voltages are applied to gate 550 and between source 510 and drain 530 , each of ridges 591 conducts a portion of the total on - current that flows through transistor 500 . note that gate dielectric 540 and gate 550 “ wrap ” around the top portions of ridges 591 ( i . e . gate dielectric 540 and gate 550 extend down the sides of ridges 591 ). this wrapping configuration allows gate 550 to more effectively control the electric potential distribution within channel region 520 , and can therefore enhance on - current while minimizing source - to - drain leakage current . fig5 c shows a cross - sectional view of transistor 500 through view location b - b indicated in fig5 a . view location b - b provides a cross - sectional view running parallel to the direction of current flow between source 510 and drain 530 and through one of ridges 591 , and therefore indicates the full doping profiles in and around channel region 520 . as indicated in fig5 c , source 510 and drain 530 are doped regions within ridge 591 . note that while depicted as extending below the bottom of ridges 591 for exemplary purposes , the depth d of source 510 and drain 530 below the surface of ridge 591 can alternatively be less than the overall height hr of ridge 591 ( i . e . depth d is less than ridge height hr ), so that ridge isolation material 592 ( shown in fig5 b ), which starts from the base of ridge 591 , can effectively reduce the area of the junction between the source 510 and substrate 590 , and the area of the junction between the drain 530 and substrate 590 , thereby reducing junction leakage and capacitance . fig5 d shows a cross - sectional view of transistor 500 through view location c - c indicated in fig5 a . view location c - c runs between two ridges 591 , parallel to the direction of current flow between source 510 and drain 530 . therefore , fig5 d depicts gate 550 ( and sidewall spacers 561 and 562 ) extending down below the top surface of ridge 591 . specifically , gate 550 extends down to the level of ridge isolation material 592 . note that because view location c - c runs between ridges 591 , the portions of source 510 and drain 530 on either side of gate 550 ( and sidewall spacers 561 and 562 , if present ) are actually fill regions 591 - f ( i . e . regions formed by filling the space between the exposed portions of adjacent ridges 591 ). u . s . patent application ser . no . 11 / 173 , 237 , entitled “ segmented channel mos transistor ” and filed on jul . 1 , 2005 by synopsys , inc ., describes transistor 500 in greater detail and is incorporated by reference herein . table 1 shows sample data for comparing the performance ( on - state drive current and off - state source - to - drain leakage current , each normalized to the transistor layout width ) of various n - channel implementations of transistor 500 ( rows 1 , 2 , 3 , and 4 ) against the performance specifications with no carrier mobility enhancement as published in the international technology roadmap for semiconductors ( itrs ), 2003 edition ( rows 7 and 8 ). each of the implementations of transistor 500 is based on a fundamental set of implementation values , including a single ridge 591 in the channel region , a 20 nm spacing between ridges 591 ( i . e . the total layout width of the simulated transistor 500 is the ridge width w plus 20 nm ), a thickness for gate dielectric 540 equivalent to 1 . 2 nm of sio 2 , an undoped channel , a heavily p - type doped ( 2 × 10 19 cm − 3 boron ) pulse doped region starting precisely at the end of the gate overlap ( i . e . at a distance x recess below the surface of the ridge ), no stress - based mobility enhancement , and singly doped source / drain regions . as indicated in table 1 , design number 1 , which incorporates a ridge width of 20 nm , a gate length of 20 nm , and a recess distance x recess of 5 nm ( a “ slight recess ”), provides an on - state drive current i on of 0 . 5 ma / μm and an off - state source - to - drain leakage current i off of 3 × 10 − 6 na / μm . note that i on and i off are listed in terms of current per micron layout width ( in the direction transverse to the direction of current flow ) to normalize the current values . increasing the recess distance x recess to 10 nm in design number 2 provides an increase in i on to 0 . 6 ma / μm , at the trade - off of increasing i off to 0 . 4 na / μm . further increasing recess distance x recess to 15 nm in design number 3 provides a significant jump in ion to 0 . 98 ma / μm , but increases i off to 500 na / μm . thus , implementing transistors using values similar to design number 3 would generally be best for high performance circuits , whereas implementing transistors using values similar to design number 1 would be best for ultra - low power circuits . as indicated by the performance values provided for design numbers 1 - 3 , the relationship between on - current i on and off - current i off can be adjusted via recess distance x recess , i . e . the depth of the heavily p - type doped region . in contrast , the i n / i off relationship in conventional transistors is typically modified by adjusting the doping concentration within the channel region to achieve a particular threshold voltage . because dimensional control ( i . e . control over recess distance x recess and depth of the heavy channel doping profile ) can be more precise than dopant concentration control ( i . e . control over the number of dopant atoms in the channel region ), transistors having a corrugated channel made using the above - described ion implantation process and a subsequent timed etch can significantly ease the difficulties associated with achieving a particular combination of on - current i on and off - current i off . advantageously , ion implantation can be used to control etching depth in materials other than oxide . for example , fig6 illustrates a cross - sectional view of an inverted t - channel field - effect transistor ( itfet ) 600 . itfets are described in “ inverted t channel fet ( itfet )— fabrication and characteristics of vertical - horizontal , thin body , multi - gate , multi - orientation devices , itfet sram bit - cell operation . a novel technology for 45 nm and beyond cmos ”, which was authored by l . mathew et al . and published by ieee in 2005 . in itfet 600 , fin channel 602 a and planar channel 602 b , which are formed on a buried oxide ( box ) layer 604 , provide both vertical and horizontal channel regions ( hence the “ inverted t ” designation ). after formation of fin channel 602 a and planar channel 602 b , a thin gate dielectric 603 can be formed on fin channel 602 a and planar channel 602 b . then , a polycrystalline - silicon layer can be deposited and patterned to form a gate 601 for itfet 600 . notably , the thickness of planar channel 602 b ( i . e . the horizontal portions of the channel ) determines the threshold voltage of itfet 600 . therefore , the etching of the silicon layer to form fin channel 602 a and planar channel 602 b is critical to the performance of itfet 600 . advantageously , the above - described ion implantation process can precede the timed etch of the silicon to provide a precise silicon etch depth 605 . in one embodiment , the dopant species used in this ion implantation can include germanium at a dose greater than or equal to 1e14 per square centimeter . the depth to which a threshold level of damage can be precisely controlled by adjusting the dose and energy of the implanted species . by enhancing the silicon etch rate within a precise depth range , the uniformity and controllability of the silicon etch process can be substantially improved , thereby minimizing itfet performance variations across a wafer . the use of an ion implantation process to improve etch depth uniformity can be applied to various types of devices having vertical surfaces . for example , fig7 illustrates an exemplary dynamic random access memory ( dpam ) cell 700 including an access transistor 701 and a capacitor 702 fabricated in a semiconductor substrate 703 . capacitor 702 is partially formed in a cavity of a shallow trench isolation ( sti ) region 704 , which is adjacent to a sidewall region of substrate 703 . a patterned polycrystalline - silicon layer 706 can be used to form the electrodes of access transistor 701 and capacitor 702 . the portion of capacitor 702 formed in the sidewall region can increase its capacitance with a minimum of layout area . notably , the junction of this sidewall portion with the horizontal portion of capacitor 702 may result in some undesirable leakage . however , the depth of the sidewall portion can compensate for such leakage . a recess depth 707 of sti region 704 in which this sidewall portion of capacitor 702 is formed can significantly affect the final capacitance of capacitor 702 . therefore , the etching of sti region 704 ( e . g . a field oxide ) to form capacitor 702 is critical to its performance . advantageously , the above - described ion implantation process can precede the timed etch of sti region 704 to accurately and uniformly provide recess depth 707 . by enhancing the etch rate of sti region 704 within a precise depth range , the uniformity and controllability of the sti region etch process can be substantially improved , thereby minimizing variations of capacitances across a wafer . although illustrative embodiments of the invention have been described in detail herein with reference to the accompanying figures , it is to be understood that the invention is not limited to those precise embodiments . they are not intended to be exhaustive or to limit the invention to the precise forms disclosed . as such , many modifications and variations will be apparent . for example , in one application , the fin height of finfets ( transistor structures with fin - like channel regions ) made on bulk silicon wafers can be determined by using the above - describe ion implantation and timed etch to provide precise control of etch depth , thereby minimizing finfet performance variations . accordingly , it is intended that the scope of the invention be defined by the following claims and their equivalents . | 7 |
the pressure gas engine 10 of the embodiment illustrated has a casing 11 including a portion 12 in which are located vent openings 13 that communicate between an exhaust chamber 14 of large cross sectional dimensions for essentially unrestricted gas flow and an auxiliary chamber 15 defined by a peripheral wall 16 containing gas flow openings 17 leading to a space 20 defined on the outer side by a wall 21 similar to the wall 16 and also containing gas flow openings 22 . these openings lead to a further chamber 23 defined by an outermost wall 24 in which are located in circular series large exhaust openings 25 to the atmosphere . the engine 10 includes an interior rotor 26 mounted for rotation with an axle 27 that is supported on spaced ball bearing structures 30 and 53 . the rotor 26 is surrounded by a wall 31 that operates as a stator nozzle plate 32 and contains an arcuate series of converging - diverging nozzles 33 each having ( fig3 ) a converging entrance 34 , a throat 35 and a diverging exhaust end 36 for creating sonic or supersonic gas flow 134 through the nozzles . as shown in fig3 each nozzle 33 is located in an opening 38 that is aligned on the chord of the circle defining the inner periphery 40 of the plate 32 . as shown in fig4 the rotor 26 contains a peripheral series of outwardly opening buckets 41 that have arcuate impulse surfaces 42 extending substantially between the opposite sides 28 and 29 of the rotor 26 . each adjacent pair of buckets is separated by a knife edge 43 so that the high velocity gas will be divided by the knife edges without substantial restraint into the buckets as the buckets pass each nozzle . the relationship of the exhaust end 36 of each nozzle to the bucket surface 42 is shown at the top of fig4 . as is shown there , the nozzle exhaust enters the bucket at one side 44 thereof and then sweeps around in a smooth unobstructed arc to exhaust at the opposite side 45 . this provides a smooth wiping action on the impulse surfaces 42 that converts pressure energy of the sonic or supersonic gas flow to rotational energy of the rotor . thus the nozzles 33 comprise first energy conversion means for converting gas pressure to gas velocity while the series of buckets 41 comprise second energy conversion means for converting gas velocity to power . the stator plate 32 containing the nozzles 33 also includes a peripheral portion 46 for directing the gas flow into the nozzles in the fixed stator plate 32 . the casing 11 has extending therefrom a tube 47 that is hollow as shown at 50 to serve as a handle and a conduit for pressurized gas flow 51 which can conveniently be compressed air . the one end 52 of the axle 27 is provided with a second ball bearing structure 53 similar to the first structure 30 . opposite this end 52 of the axle 27 is a positioning lock nut 54 . mounted on the axle 27 between the bearings 30 and 53 is a small circular gear 55 which meshes with a large circular gear 56 mounted on , for rotation with , a stub shaft 57 so that the combination is rotatable within the casing portion 60 on a pair of spaced ball bearing structures 61 . the shaft 57 is provided with a projecting end portion 62 that is sealed to the casing portion by a seal plate 63 and gasket 58 . this end 62 of the shaft 57 has mounted thereon in the illustrated embodiment a grinding disc 64 that is partially enclosed in the customary manner by a guard 65 mounted on the end of the casing portion 60 through which the shaft 62 extends . leading from the hollow chamber 50 in the conduit and handle 47 for flow 51 of the pressurized gas such a compressed air is a passage 66 that is normally closed by a valve piston 67 usually held in closed position by a compression spring 70 . this spring is retained in a chamber 71 in a threaded closure 72 . the piston 67 may be moved from its normally closed position as shown in fig1 to an open position as shown in fig2 by a hinged lever 73 including a handle position 74 . gas in the passage or chamber 66 presses against the end 75 of a slidable piston 76 . this piston 76 is normally urged to its closed position which is the extreme left position in the illustrated embodiment of fig1 by a helical compression spring 77 ( fig2 ). this spring together with gas pressure in a manner to be explained hereinafter holds the piston 76 in the left or closed position of fig1 until the forces in the chamber 66 acting on the end 75 are sufficient to move the piston as to the partially open or right position of fig2 . the piston end 75 operates as a gas valve blocking flow of gas from the chamber 66 when the end 75 bears against an annular valve seat 80 as shown in fig1 . surrounding the valve seat 80 and the corresponding annular valve edge portion of the end 75 is a second gas chamber 81 . when compressed air , for example , is admitted to this chamber 81 from the chamber 66 by the open piston valve 76 , as illustrated by the air flow arrow 82 , this air immediately is free to flow through the series of nozzles 33 ( of which only one is shown in fig1 and 2 ) to sweep through the impeller buckets 41 , as indicated by the arrow 83 , to impart rotational forces to the rotor 26 and thereby to the axle 27 to rotate the grinding disc 64 by way of the gears 55 and 56 and the stub shaft 62 . the exhaust gas 83 from the buckets passes unhindered from the exhaust sides 45 ( fig4 ) of the buckets directly into the relatively large chamber 14 in a direction that is generally radial to the rotor 26 as shown at 83 in fig2 and from there through the openings 13 , chamber 15 , openings 17 , chamber 20 , openings 22 , chamber 23 and openings 25 into the ambient atmosphere . the piston 76 , its end surface 75 and the annular valve seat 80 are all parts of the governor system for controlling the speed of rotation . this speed control is accomplished by metering the incoming gas between the end surface 75 and the valve seat 80 by increasing and decreasing the pressure of the gas in the piston area . in order to minimize the change in force exerted on the bellows 93 by the variation in gas pressure surrounding the outside of the bellows , the bellows is surrounded by a chamber 85 which is pressurized by gas bled through a passage 84 from the main gas supply chamber 66 . chamber 66 has much less pressure variation than chamber 81 during normal governed turbine operation . an o - ring gasket 86 seals one end of the chamber 85 from outside pressure effects . the piston 76 at the end adjacent to the valve seat 80 is provided with a gas passage 87 that extends inwardly through a small chamber 90 and an inner passage 91 to an interior chamber 92 within the extensible bellows 93 . the chamber 90 is provided with a filter 94 for intercepting foreign material carried by the incoming gas whose flow is indicated by the arrow 95 . the interior 92 of the bellows 93 communicates with a passageway 96 in a guide pin retainer 97 which retains an axial guide pin 98 that is slidably attached to the guide post 115 for guiding the longitudinal movement thereof . the passageway 96 communicates with a passageway 101 which joins with a continuous passageway 102 and 103 ( indicated by the broken line in fig2 ) to a trigger adjuster insert 122 and into chamber 105 which is sealed at each end by sealing gasket o - rings 106 . the chamber 105 is provided with exit openings 107 that lead through the trigger adjuster screw 110 and into the internal chamber 111 . from this chamber 111 the gas exits by way of a small axial passage 112 as indicated by the flow arrows 113 . flow through this passage 112 is metered by the movable trigger pin 114 . a guide post 115 at the piston 76 is press fitted into the piston at the end 75 thereby holding the filter 90 in position . the bellows 93 is attached in gas tight relationship to the movable piston 76 in an annular section 116 into which the guide post 115 is press fitted . a larger o - ring 117 is provided at the fixed retainer 97 adjacent to the end o - ring 86 ( that seals the retainer 97 and housing 11 ) to form a gas tight seal at this fixed end of the bellows 93 and thereby seal the interior 92 of the bellows from the exterior chamber 85 . the guide pin 98 is provided with a bushing 120 that provides a bearing surface for a slip fit to the guide pin 98 thereby preventing the assembly of guide post 115 and annular section 166 of piston end 75 from angling and jamming against the cylinder wall portion 121 of the casing 11 . at the opposite end of the air flow passageways 96 and 101 - 103 the trigger adjuster insert 122 provides a convenient mounting for the trigger adjuster screw 110 . this adjuster insert 122 is press fitted into the housing 104 and an outer closure plug 123 is press fitted into screw 110 to provide a closure to the internal chamber 111 . the speed governor trigger structure is illustrated in fig1 and 2 in association with the rest of the embodiment and in fig5 - 8 in enlarged detail . this trigger mechanism comprises a main body 124 that is attached to the rotor axle 27 by means of screw threads 125 that engage a similarly shaped axle recess in the end of the drive shaft 27 . a backing ring 126 forms a part of the body 124 and this ring provides a support for a leaf spring 127 that has diametrically opposite upstanding arms 130 that are centrifugally responsive for movement outwardly away from each other . at increasing speeds of rotation 131 the arms 130 flex outwardly under increasing centrifugal forces as indicated by the arrows 132 and at maximum desired outward movement corresponding to highest governed speed these arms 130 contact and are supported by an inclined annular surface 133 located on the interior of the backing ring 126 to prevent accidental damage to the arms at extremely high speed such as those resulting from the misadjustment or failure of the governor . since the limitation of outward movement of the arms 130 by the annular surface 133 also limits the motion of trigger pin 114 toward surface 172 , contact between pin 114 and the surface 172 of the trigger adjuster screw 110 can be prevented if desired . as explained earlier , the trigger pin 114 serves as a metering device to meter and control the gas flow 113 from the chamber 111 through the metering orifice or passage 112 . the pressure gas engine 10 embodied in the illustrated air turbine includes an overspeed safety device that is illustrated most clearly in fig2 and 10 . this device provides a positive braking action in the event of a governor failure tending to produce excessive speeds . where the engine is used to power an abrasive wheel , for example , such a safety device is of very great importance as excessive centrifugal forces can of course cause a violent disintegration of the grinding wheel . in addition , the device of this invention also prevents the engine from commencing rotation after it has been stopped by the safety device until the engine has been disassembled and reactivated as when making repairs . as is shown in fig1 and 2 the rotor 26 having a series of buckets as shown in fig4 normally is rotated by pressurized gas indicated by the arrow 134 entering the buckets in the rotating rotor 26 from the nozzles 33 as previously described . the rotor is located in a chamber 135 that is considerably wider in vertical direction as shown in fig1 and 3 than is the thickness of the rotor 26 itself . the rotor 26 is longitudinally slidable on the axle 27 between the normal operating position of fig1 and 2 and the non - operating or raised position as illustrated in fig9 . when in the raised position a peripheral side surface 136 of the rotor 26 comes in contact with friction pads 137 ( or a single pad if desired ) which may be of any material exerting a friction braking action on the side surface 136 and thus may be leather , asbestos or any desired material . if less than the maximum braking effect is desired , the normal force between the friction pads 137 and surface 136 of the rotor 26 must be limited . for this purpose surrounding the end of the axle 27 that is adjacent to the trigger body 124 previously described is a helical compression spring 140 the outer end of which bears against an inverted dish - shaped mechanical stop 141 that abuts against the trigger body base 142 and the other end of which bears against a shoulder 143 . the stop 141 is provided so that as the rotor 26 moves from the operating position of fig1 and 2 to the braked position of fig9 the rotor contacts the stop 141 after contacting the yielding spring loaded pads 137 but before contacting the surface 173 of chamber 135 . in this way the spring loaded pads apply a controlled braking force to the rotor 26 . the operating portion of the overspeed safety device comprises a plurality of steel balls 144 , here shown as three , each located in a recess 145 each having an upwardly and outwardly inclined outer surface 146 . during normal rotation the balls 144 are located deep within their recesses as shown in fig2 allowing proper rotor - to - nozzle alignment so that the pressurized gas 134 from the nozzles 33 sweeps the buckets , as previously described , and rotates the rotor 26 and the parts attached thereto . the recesses 145 in which are located the balls 144 are formed in one side of a ring 147 that is attached to the drive axle 27 . this ring is keyed to the shaft 27 by a key lock 150 as illustrated in fig1 . the ring 147 also includes tapered openings 151 of a generally frustoconical shape with the taper widening toward the rotor 26 . in the embodiment illustrated there are three of these openings 151 each receiving a similarly tapered end 152 of a pin 153 . when the engine or turbine 10 is at rest as shown in fig1 the main control valve piston 76 is in closed position with the surface 75 held against the annular valve seat 80 by the spring 77 . then , to operate , the lever 73 is moved about its fulcrum 154 as to the position shown in fig2 which raises the control valve piston 67 away from its seat 155 thereby admitting compressed air or other pressurized gas flow 51 into the piston chamber 66 in a volume flow that is dependent on the positioning of the lever 73 and thus the position of the valve 67 . air from the chamber 66 is bled into the interior chamber 92 in the bellows 93 through the series of bleed lines 87 , 90 and 91 . this air then flows out through passages 96 , 101 , 102 , 103 , 105 , 107 and 111 , through orifice 112 past wide open valve 114 to atmosphere . since exit orifice 112 is much larger than air entrance orifice 91 , only a relatively low pressure is maintained in bellows chamber 92 . at the same time , air from chamber 66 flows through the bleed line 84 to the chamber 85 surrounding the bellows 93 . since the passage 84 is much larger in cross sectional area than a cylindrical gap 166 that exists between the piston 76 and the cylinder wall 121 , the pressure in the chamber 85 is nearly equal to that in chamber 66 . the air pressure in chamber 66 exerts a force on the exposed surface 75 of valve 76 . this surface 75 is made large enough for air pressure acting on it from chamber 66 to overcome the total combined forces on its opposite side generated by the helical spring 77 and air pressure in chambers 92 and 85 . therefore , the opening of valve piston 67 to introduce air pressure into the chamber 66 immediately causes this pressure acting on the surface 75 to open the control valve 76 as described . as can be seen in fig1 and 2 , the extent of movement of the valve 76 is limited between the fully closed position of fig1 where the surface 75 bears against the annular valve seat 80 and the fully open position in which an annular surface 156 on the piston bears against an annular stopping surface 157 . as can be seen in fig2 the surfaces 75 and 156 of the control valve piston 76 are on opposite sides of an annular flange 148 . when the control valve piston 76 is either partially or completely open , the air for example flows into the surrounding chamber 81 as illustrated by the arrow 82 in fig2 . this air then flows through the converging - diverging nozzles 33 in the annular wall 31 which functions as a stator plate or nozzle plate 32 . this air 134 from the nozzles 33 wipes across the surfaces 42 of the buckets 41 thereby causing rotation in the rotor 26 . this type of sonic or supersonic nozzle and bucket arrangement is disclosed and claimed generically in prior u . s . pat . no . 3 , 930 , 744 also assigned to the same assignee . the air exiting from the buckets 41 during rotation of the rotor 26 then enters the large chamber 14 under low back pressure . from there the air flows through the large openings 13 into the correspondingly large chamber 15 and from there to ambient through the successive plurality of holes 17 , 22 and 25 . in order to maintain the speed of the turbine 10 the flow of air 82 to the nozzles 33 striking the turbine bucket surfaces 42 must be varied so that the torque applied to the turbine rotor 26 will substantially balance the opposite load torque exerted on the rotor shaft 27 through the gears 55 and 56 by varying external loads applied to the shaft 62 . this is done by moving the piston 76 ( the surface 75 ) relative to the valve seat 80 . the movement of piston 76 is caused by changes of the gas pressure in chamber 92 . for example , as the pressure in chamber 92 decreases , the force of air pressure acting on the surface 75 of the piston 76 overcomes the forces acting on the bellows side of the piston 76 causing the surface 75 to move away from the seat 80 allowing more air 82 from passage 66 to flow through nozzles 33 . this increases the torque developed by the turbine 26 on the shaft 27 . conversely , if the pressure in chamber 92 increases , the valve 76 closes reducing the air flow 82 to the nozzles 33 and consequently the turbine torque . the governing of the turbine torque is controlled by the speed sensitive bleed control valve 112 . this valve 112 varies the back pressure in the bellows chamber 92 and thus changes the turbine torque to match the load torque allowing the turbine to reach quickly a predetermined no load speed . the valve 112 also decreases the back pressure in the bellows chamber 92 as the speed of the turbine drops due to increased loads . the decrease in the bellows chamber pressure allows greater torque to be developed by the turbine 26 to counterbalance the increased load torque . this prevents excessive speed drop and efficiency losses of the turbine motor . to allow the speed sensitive bleed control valve 112 to vary the back pressure in the bellows chamber 92 , there is provided a passage 91 of piston 76 to allow a metered flow of air 84 to pass into bellows chamber 92 and from there flow through passages 96 , 101 , 102 , 103 , annular chamber 105 , central chamber 111 , through the series of openings 107 to the axial orifice passage 112 opposite the speed control valve piston 114 of the speed responsive device 158 . as shown in greater detail in fig5 - 8 , this speed responsive device 158 comprises a trigger body 124 that is mounted on the end of the drive shaft or axle 27 on which the rotor 26 is mounted so that the two rotate as a unit under the force developed in the nozzle and bucket combination as described . this trigger body 124 in general comprises a hexagonal plate 159 from which projects the annular backing ring 126 . this trigger body 124 has mounted on it the flat spring 127 having projecting arms 130 arranged substantially parallel to the axis of rotation 160 . the spring 127 ( of which the centrifugally responsive arms 130 are a part ) is mounted on a circular insert 162 within a recess in the trigger body 124 by a pair of screws 163 . actually , in the illustrated embodiment , these arms 130 are not exactly parallel but are bowed outwardly to a small extent . these arms when subjected to the centrifugal forces of rotation 131 tend to move outwardly as shown at fig6 by the arm movement arrows 132 . the spring arms 130 are always returned to their normal position shown in fig5 when the turbine stops . simultaneously a helical spring 164 retained in a recess 165 returns the piston 114 . the outward movement of the arms under increasing speeds of rotation bows the central portion 161 of the centrifugally responsive spring 127 to move the trigger pin 114 closer to the axial bleed orifice passage 112 as can be seen by a comparison of fig5 and 6 . this partially blocks the orifice and reduces the flow of the bleed air 113 thereby increasing the pressure in the chamber 92 . this increase in back pressure moves the piston 76 closer to the seat 80 reducing the torque of the turbine 26 as previously described until equilibrium of the turbine torque and load torque results in a constant steady speed . an increase in the load torque will result in a corresponding loss in turbine speed . this speed drop reduces the centrifugal force 132 acting on the arms 130 of the speed responsive device 158 . this drop in force 132 on the arms 130 allows the arms to move together reducing the amount of bow in the central portion 161 of the centrifugally responsive spring 127 and allows the helical spring 164 to withdraw the trigger pin 114 to a position further from the orifice 112 . this movement of the pin 114 reduces the restriction of the bleed air 113 flowing from the orifice 112 . the resulting increased flow of bleed air from the bellows chamber 92 causes the pressure in the chamber 92 to decrease . as previously described , this allows more air to flow to the turbine 26 thereby increasing the turbine torque . these changes continue until once again the torque developed by the turbine is substantially equal to the combined load torques . once this equilibrium exists , the turbine operates at a constant and somewhat lower speed . as the load torque varies during the operation of the turbine , the governing system responds as described to maintain the balance of air flow 82 past the control valve 76 necessary to minimize the changes in turbine speed with load . the pressure gas engine also includes an overspeed safety apparatus that not only interrupts the pressure gas flow into the turbine buckets during overspeed but also automatically moves and holds the rotor in contact with the braking means embodied in the braking pad or preferably pads 137 . this braking apparatus operates as follows . during normal operation of the turbine with the parts normally in the position of fig1 before rotation begins and then in the position of fig2 after rotation begins , the air flows to the nozzles 33 and from there through the buckets 41 on the rotor 26 . however , if the speed control or any other portion of the apparatus malfunctions tending to increase the speed to dangerous levels , the centrifugally responsive balls 144 will move outwardly and forwardly on the inclined surfaces 146 of the pockets or recesses 145 in which they are located . this upward and outward movement as indicated by the arrow 167 in fig2 causes the force of the balls to slide the rotor 26 against the force of retaining spring 140 . when the balls 144 are at their maximum outward positions they have moved the rotor 26 so that the air 134 ( fig9 ) from the nozzles 33 cannot enter the buckets . the movement of the rotor 26 in this manner not only prevents the nozzle air 134 from entering the rotor buckets 41 but also permits this pressurized gas or in this embodiment air 134 to enter the large chamber 135 behind the rotor 26 on the side thereof opposite the friction surfaces 168 of friction brake pads 137 . this then means that the full force and pressure of the gas 134 operates against the rotor to press the rotor against the pads 137 and provide an immediate stopping to the rotation of the rotor . in order that this stopping of rotation will not be too abrupt which might tend to throw the illustrated grinding disc 64 from the shaft end 62 , there is also provided the dish - shaped stop 141 which is contacted by the rotor before the rotor contacts the housing adjacent surface 173 . before the rotor contacts this stop 141 , it contacts the spring loaded friction pads 137 as described . this allows the springs 171 to apply a controlled normal force to the friction pads 137 causing a controlled frictional braking force to act on the rotor surface 136 . thus , the overspeed safety device brakes the rotor relatively gently to a complete stop so as to avoid damage . in order to permit this axial movement of the rotor 26 relative to the axle 27 , the rotor 26 is releasably connected to the axle 27 by way of the ring 147 through a plurality of connecting pins 153 of which there are three in number in the illustrated embodiment . these pins 153 each had a conical end 152 that are held in similarly conical recesses 151 in the ring 147 during normal operation as is illustrated in fig1 and 2 . however , during these excessive speeds and the axial movement of the rotor 26 to the fully braked position of fig9 these conical ends 152 are almost completely removed from the recesses 151 ( fig9 ). in order that the engine cannot again be operated until the malfunction condition is corrected , the balls 144 are then positioned between the ring 147 and the rotor body 26 as shown in fig9 so that the rotor 26 cannot be moved back to operating position until the engine has been dismantled and the condition corrected at which time the balls 144 can be moved back to their normal position within the recesses 145 and essentially out of contact with the rotor 26 . | 5 |
the device 1 according to the invention shown in the drawing serves for ventilating a fuel tank 2 of an internal combustion engine 3 which for example can be the internal combustion engine of a motor vehicle with hybrid drive or of a motor vehicle with automatic start - stop mechanism , or the device can be the internal combustion engine of a plug - in motor vehicle which is driven by an electric motor , which combustion engine serves as an auxiliary motor for charging a vehicle battery . the device 1 includes an activated carbon filter 4 , which is connected to the interior of the fuel tank 2 by a first gas 5 line which is also referred to as tank venting line , to the environment or the atmosphere by a second gas line 6 also referred to as ventilation line , and to an intake tract 9 by a third gas line 8 also referred to as regeneration line . the first and the third gas lines 5 , 8 lead into the activated carbon filter 4 at one side , while the second gas line 6 leads into the activated carbon filter at the opposite side . a tank shut - off valve 10 is inserted into the first gas line 5 , while a ventilation and aeration valve 11 is inserted into the second gas line 6 and a regeneration valve 12 into the third gas line 8 . each valve 10 , 11 and 12 is a controllable proportional valve with an actuator in the form of an electromagnet 14 , 15 , 16 . the opening cross section of the valves 10 , 11 , 12 is controlled in the opened state by an engine control unit 13 of the internal combustion engine 3 in dependence on the loading condition of the activated carbon filter 4 . the valves 10 , 11 , 12 can be active valves , whose opening cross section respectively corresponds to the amperage of the exciting current which is conducted to the electromagnet 14 , 15 , 16 of the valve 10 , 11 , 12 under the control of the engine control unit 13 , or passive valves , whose opening cross section is changed by the engine control unit 13 by changing the exciting current to the electromagnet 14 of the valve 10 , 11 , 12 , and is maintained when the current supply to the electromagnet 14 , 15 or 16 respectively is interrupted by the engine control unit 13 . the activated carbon filter 4 is equipped with two loading sensors 17 , 18 , to determine the loading of the activated carbon filter 4 with hydrocarbons . the first sensor 17 is arranged near the site of entry of the second gas line 6 in the activated carbon filter 4 , while the second sensor 18 is arranged at a defined distance to the site of entry of the first and the third gas lines 5 , 8 in the activated carbon filter 4 . both sensors 17 , 18 determine the presence of hydrocarbons and are connected to the engine control unit 13 for analyzing the sensor signals . because the activated carbon filter 4 is loaded with hydrocarbons from the junction of the first gas line 5 and unloaded or rinsed with fresh air , respectively , from the opposing junction of the second gas line 6 , the load factor of the activated carbon filter is high when the sensor 17 and the sensor 18 respond , moderate when only sensor 18 responds and low when neither of the sensors 17 , 18 responds . the tank is further equipped with a pressure sensor 19 , which measures the pressure in the fuel tank 2 and transmits it to the engine control unit 13 , where the pressure is compared with a permissible pressure range . when the pressure in the fuel tank 2 exceeds the upper limit of the permissible range , the engine control unit 13 opens the two valves 10 and 11 to conduct gas from the fuel tank 2 through the activated carbon filter 4 into the environment or the atmosphere 7 and thereby relieves the pressure in the fuel tank 2 . when the pressure in the fuel tank 2 falls below the lower limit of the permissible range , the engine control unit also opens the two valves 10 and 11 , to conduct air from the environment or atmosphere 7 through the activated carbon filter 4 into the fuel tank 2 and to thereby achieve pressure compensation . when the load factor of the activated carbon filter 4 determined by means of the sensors 17 , 18 is high , the opening pressure of the valve 10 is increased by the engine control unit 13 when the tank shut - off valve is opened as a result of overpressure in the fuel tank 2 , so that the valve 10 only opens at a higher pressure , which prevents hydrocarbons to enter the activated carbon filter 4 before the opening pressure is reached . as soon as the activated carbon filter 4 is regenerated and the load factor determined by the sensors 17 , 18 is moderate or low , the engine control unit 13 opens the valve 10 to relieve an overpressure that may still persist . when opening the valve 10 the engine control unit 13 reestablishes the lower opening pressure . to prevent that an impermissible overpressure or negative pressure builds up in the fuel tank 2 , a bypass line 20 with an overpressure protection valve 21 and a negative pressure protection valve 22 can be provided , which branches off from the first gas line between the fuel tank 2 and the valve 10 and leads into the first gas line 5 behind the valve 10 as shown in the drawing . in contrast , when the valve 10 is opened the opening pressure of the valve 10 in the first gas line 5 , as a result of a negative pressure in the fuel tank 2 , is decreased by the engine control unit 13 when the load factor of the activated carbon filter 4 determined by the sensors 17 , 18 is high . this may allow a somewhat better flushing of the activated carbon filter 4 by ambient air which flows into the fuel tank 2 and is further flushed by the inflowing ambient air rather continuously and not intermittently . in this case , the opening pressure of the ventilation and aeration valve 11 in the second gas line 6 is also decreased by the engine control unit 13 . when the load factor of the activated carbon filter 4 is high , the opening cross section of the regeneration valve 12 in the third gas line 8 is decreased when the activated carbon filter is regenerated , to prevent too much fuel from being added into the intake manifold . at the same time the opening pressure of the ventilation and aeration valve 10 in the second gas line 6 is decreased as much as possible and the regeneration valve 12 is opened as long as possible in dependence on the load condition of the internal combustion engine , to achieve a complete regeneration of the activated carbon filter 4 in spite of the smaller opening cross section . when the load factor of the activated carbon filter 4 is low , the regeneration valve 12 in the third gas line 8 is controlled according to the desired amount of fuel to be fed from the activated carbon filter 4 into the intake manifold , while the opening pressure of the tank shut - off valve 10 in the first gas line 5 and the ventilation and aeration valve 11 in the second gas line 6 are decreased as much as possible . a desired opening pressure or a desired opening cross section can be set beforehand at the valves 10 , 11 and 12 . | 1 |
in accordance with a governing principle of the invention , an improved prestressed composite laminate may be fabricated by applying a load to the fibers during cure of the matrix material . the applied load must be high enough to achieve desired stress modification in the cured composite , but not high enough to fracture the fibers . in the practice of the invention , load is applied to the fibers by a combination of mechanical prestressing during filament winding and thermal expansion of the mandrel during cure in order to stress the fibers uniformly , determinably and reproducibly . referring now to the drawings , fig1 a and 1b show respective top and edge views of a representative mandrel useful in applying mechanically or thermally induced load to fibers wound thereon . in fig1 a , 1b , mandrel 11 includes first female member 12 having lengthwise slot 13 for receiving second male member 14 . mechanical expander 16 is disposed within slot 13 between members 12 , 14 for selectively positioning member 14 within slot 13 . expander 16 may , in an exemplary configuration comprise a pair of triangular blocks 17 , 18 having a lengthwise slot 19 for receiving connecting bolt 20 . expander 16 is adjusted in width within slot 13 by tightening bolt 20 which results in movement of blocks 17 , 18 along their oblique contacting surfaces . member 14 can thereby be selectively positioned along slot 13 , and when fiber ( not shown in fig1 a , 1b ) is wound on mandrel 11 , adjustment of expander 16 as just described results in outwardly movement of member 14 and resultant tension on the wound fiber . it is noted that tension on the wound fiber may result both from mechanical adjustment of expander 16 and from thermal expansion of the component pans of mandrel 11 . particularly members 12 , 14 , during cure of the composite , in an alternative embodiment , members 12 , 14 may comprise a material having a very small coefficient of thermal expansion so that tens ion in the wound fiber is applied substantially only mechanically . in another alternative , expander 16 may be replaced with a block or bar of known ( high ) coefficient of thermal expansion for thermal - only control of fiber tension . the maximum tension which may be applied to a fiber without breakage through mechanical adjustment and thermal expansion of mandrel 11 will vary widely depending on fiber material selection and may be determined by a skilled practitioner guided by these teachings in consideration of the tens fie strength of the selected material . tensions of up to about 350 kpsi may be obtained . tension applied to the wound fiber as suggested in relation to fig1 a , 1b may be applied in two or more directions using mandrel 21 such as that suggested in fig2 wherein first member 22 is slotted on two or more sides to receive a corresponding number of male members 24a , 24b and mechanical expanders 26a , 26b . the mandrel may therefore , within the scope of these teachings , be configured to accommodate fiber winding and tensioning in two or more directions , and the mandrel configurations described herein are not considered limiting of the invention . fig3 shows a representative system 30 useful in applying resin matrix material 31 to tow 33 comprising a fiber bundle and in winding tow 33 onto mandrel 35 with preselected tension according to the invention . matrix 31 may be any suitable material as might occur to one skilled in the applicable art , such as epoxy ( such as hercules 3501 - 6 or other commercially available epoxy ), bmi , glass , ceramic , polyimide or thermoplastic . tow 33 may comprise a bundle of up to 1000 to 12000 fibers of any suitable material such as carbon ( such as that available commercially as as - 4 from hercules ), graphite , glass , silicon carbide or aramid ( kevlar ®). although the invention may be most applicable to filament winding in the fabrication of cylindrical structures , such as pressure vessels and tubes , system 30 was configured to utilize flat mandrel 35 of aluminum of known thermal expansion coefficient so that uniaxial testing of composite specimens could be performed in demonstration of the invention . it is noted that in filament winding cylindrical structures , the fibers and matrix tend to self - compact , so that pressure need not be applied during cure . but because only the wound portion at the rounded edges of a wound flat plate self - compact , external pressure was applied during cure ( e . g . conventional graphite / epoxy cure cycle at 100 psi and 350 ° f .). in the demonstration system , winding tension in tow 33 was selected to avoid fiber slack on wound mandrel 35 and was attained using tensioning mechanism 37 including dram 38 contacted by brake 39 , the inertia of drum 38 along with friction of brake 39 providing the desired tension . tow 33 from spool 41 was drawn over pulleys 42 through resin bath 43 ( for impregnation with matrix material ) and twice around drum 38 , substantially as shown in fig3 and into winding system 45 . substantial tension in tow 33 had to be maintained during winding , so it was preferable to impregnate tow 33 with resin prior to inducing tension because the tension reduces liquid resin migration toward the center of tow 33 and may result in a composite product having resin - starved areas and high fiber volume . pulleys 42 and other rollers used in system 30 for guiding tow 33 comprised teflon ® and delrin ® to avoid the contacted surfaces becoming gummed with resin . winding system 45 of the demonstration system comprised two independently controlled motors 47 , 48 for rotating mandrel 35 and controlling traverse of tow 33 across mandrel 35 in producing fiber layers having the desired respective fiber orientations . it is noted that other winding systems for tow 33 may be used as would occur to the skilled artisan guided by these teachings , the specific system shown not being considered limiting of the invention . impregnation of tow 33 with resin 31 may be performed using any suitable means as would occur to the skilled artisan , such as a hot melt procedure wherein resin 31 is melted and tow 33 is passed through pure resin , or dissolution of the resin in suitable solvent and passing tow 33 through the solution . the solution impregnation techniques are preferred because the length of travel of the hot melt impregnated tow 33 allows for resin 31 to harden which interferes with the winding process . however , the length of travel of the solution impregnated tow 33 allows for an unacceptable amount of solvent evaporation so that the pulleys and dram become sticky with resin which fractures individual fibers . this problem was resolved by using a hybrid solvent obtained by mixing two different solvents . the hybrid solvent minimized solvent evaporation and also lubricated pulleys 42 . solvents useful for the resin 31 materials listed above include methylethyl ketone , acetone or others as would occur to the skilled artisan practicing the invention ; in a ceramic or glass matrix , the solvent required may be water . in demonstration of the invention , wherein hercules 3501 - 6 epoxy resin was used as matrix 31 material , a mixture of acetone and isopropyl alcohol was used as the hybrid solvent . solvent entrapment problems which may cause high porosity in the laminate product were avoided by debulking the composite prior to cure using a vacuum and a slightly elevated temperature in an autoclave or vacuum oven at about 125 ° f . for about 4 hours or more depending on the thickness of the winding . resin / solvent solution viscosity was monitored to maintain an optimum resin content in the solution . as shown in fig4 a monitoring and solution content control system used in conjunction with system 30 included a micromet eumetric system ii microdielectrometer 51 ( micromet instruments , inc ., cambridge mass .) and an idex sensor 53 ( micromet instruments , inc ., newton centre mass . ), controlled by computer 55 , which measured the solution phase angle , and pump 57 powered by power supply 59 for circulating solvent through lines 61 to bath 43 as needed to keep the resin / solvent solution adequately mixed and at the desired preselected concentration . tests on as - 4 / 3501 - 6 ( fiber / resin ) prestressed composite specimens fabricated according to the invention and corresponding conventional composite specimens showed that , for the geometry of composite specimens tested , the prestressed specimens showed an approximate 15 % increase in tensile strength and that damage due to loading was delayed in the prestressed materials . theoretical models ( see , e . g ., rose et al . &# 34 ; effect of prestressed fibers upon the response of composite materials &# 34 ;, proc am soc for composites , 8th technical conference on composite materials ( october 1993 )) predict that for some laminate geometries , onset of damage ( first ply failure ) in prestressed materials can be substantially reduced or eliminated , which is important because cracks associated with first ply failure are believed to be initiation sites for fatigue cracking in dynamic structures . the invention therefore provides an improved composite fabrication process including fiber prestressing . it is understood that modifications to the invention may be made within the scope of the appended claims as might occur to one with skill in the field of the invention . all embodiments contemplated hereunder which achieve the objects of the invention have therefore not been shown in complete detail . other embodiments may be developed without departing from the spirit of the invention or from the scope of the appended claims . | 1 |
a first preferred embodiment of the subject invention includes a system and method for providing internet service over an existing radio - transmission network . [ 0021 ] fig1 depicts a conventional radio - transmission network . the network includes a studio 100 which is the source of all radio program transmissions . the studio is connected to an audio distribution center ( adc ) 110 by a pair of copper wires 105 . the adc is similarly connected to a plurality of base amplifier stations ( bas ) 120 . each base amplifier station 120 is connected to an adc 110 by its own pair of copper wires 115 . the adc 110 includes a plurality of amplifiers for receiving radio signals from the studio ( via copper wires 105 ) and transmitting the amplified signals to base amplifier stations 120 . each base amplifier station 120 also includes an amplifier for amplifying the received radio signals for re - transmission further downstream . more specifically , the output of each base amplifier station 120 is connected to an inter - building transformer station 130 . each inter - building transformer station ( its ) 130 includes input terminals for receiving signals from base amplifier station 120 via copper wires 125 . each its 130 includes an inlet / input filter 910 a transformer 920 , an outlet / output filter 930 and a distribution transformer 940 ( see fig9 ). each its 130 also includes output terminals connected to a plurality of single - building transformer stations ( sts ) 140 . each sts is typically associated with a single building ( such as an apartment complex or office building ). the sts 140 includes an input terminal for receiving radio transmissions from an inter - building transformer station 130 . sts 140 also includes an output terminal connected to a copper wire pair 145 . the copper wires 145 run throughout the building to a plurality of radio sockets 150 , each radio socket typically residing in a single apartment or office within the building . each radio socket is connected to a radio speaker for generating acoustic signals representative of the radio signals received via copper wires 45 . using this network , studio 100 broadcasts radio signals by transmitting the radio signals over copper wires 105 to adc 110 . the adc amplifies the received signal and re - transmits the amplified signal over each pair of copper wires 115 to a corresponding bas 120 . each bas 120 amplifies the received radio signal and re - transmits the amplified signal over each pair of copper wires 125 to an its 130 . each its 130 transforms the signal and transmits it over copper wires 135 to a plurality of sts units 140 . each receiving sts 140 transforms the signal and transmits it over copper wires 145 to a plurality of radio sockets 150 . thus , the radio signal emitted by studio 100 propagates throughout the radio network to every radio socket in the network . the radio signals are typically in the 0 - 10 khz range . for simplicity of explanation , we assume that each radio socket of the radio - transmission network is located in an apartment , although as discussed above , such sockets are also located in offices , separate homes , etc . that is , the term “ apartment ” is used herein henceforth generically to refer to any place that has a radio - socket connection to a radio - transmission grid . a preferred embodiment of the present invention uses the above - described existing radio network to provide internet - based services to apartments that have radio sockets . in a preferred system ( see fig2 ), a central switching and routing unit ( a - 1 ) 220 is installed into a structure housing adc 110 . the a - 1 unit is preferably the main operating point of the system , and is connected to the internet 210 via high - speed fibre - optic lines 205 . it monitors , controls , and supervises the quality of service and the security of the entire system . it also performs switching and routing for the system ; supports ip telephony , ip tv , high - speed access , and other internet / intranet applications ; provides system access to the internet 210 ; and provides database services for system users and administrators . preferred components for the construction of the a - 1 unit are listed below in table 1 . preferably the a - 1 unit is connected by underground fibre - optic lines 215 to a plurality of area switching and routing units ( a - 2 ) 230 , each of which is installed into a structure that houses a bas 120 . each a - 2 unit is the main operating point of an area network typically including sixty to one hundred residential or commercial buildings . the a - 2 unit performs switching and routing for the entire area network ; supports ip telephony , ip tv , high - speed access , and other internet / intranet applications ; and provides access to the remainder of the system . the number of a - 2 units 230 depends on the number of buildings in the area , since each unit typically services sixty to one hundred buildings . preferred components for the construction of the a - 2 units are listed below in table 2 . as shown in fig2 and 3 , each a - 2 unit is connected to one or more low - speed modems ( lsms ) 170 . each lsm is also connected to a copper wire pair of the radio transmission network , preferably at a point between bas 120 and an its 130 on copper wires 125 . the lsm receives internet transmissions from the a - 2 unit and re - transmits them on copper wires 125 . the term “ low - speed modem ” here merely refers to the fact that transmission is over copper lines instead of relatively high - speed fibre - optic lines — there is no requirement that the speed of transmission actually be slower than that over the high - speed optical lines . likewise , the term “ modem ” is not intended to be unduly restrictive . in fact , the lsms 240 are preferably 10base - s switches that comply with the 10base - s protocol , and not modems in the traditional “ modulator - demodulator ” sense . however , those skilled in the art will recognize that a variety of modem types ( including , for example , isdn and dsl - type “ modems ”) and transmission protocols could be used . the transmissions by lsm 240 on wires 125 are forwarded by its 130 to a plurality of sts units 140 . each sts unit then forwards the transmission throughout its associated building by transmitting the signal on copper wires 145 . as shown in fig2 some apartments may include an lsm 270 connected to the apartments &# 39 ; radio sockets 150 for receiving the internet transmissions on wires 145 . each lsm 270 is connected to a personal computer 280 . in this manner , computer 280 can receive internet transmissions . similarly , the computer 280 can also send internet transmissions via lsm 270 because the modem signal travels bi - directionally over the radio - transmission network without interfering with the existing radio signals . such transmissions propagate over the building wires 145 to sts 140 . sts 140 then forwards the transmission to its 130 via wires 135 . similarly its 130 forwards the transmission to lsm 240 via wires 125 . lsm 240 receives such internet transmissions from wires 125 and forwards them to a - 2 unit 230 , which then transmits these signals upstream to the internet via optical fiber 215 , a - 1 unit 220 , and optical fiber 205 . in a preferred embodiment , each lsm 240 is a 10base - s switch and router , and each lsm 270 is a 10base - s interface . other apartments may include a high - speed interface card hsc 260 connected between the building wires 145 and a personal computer 280 . each hsc is a network interface card that communicates between a personal computer 280 and the wires 145 of the building . to permit such hsc cards to communicate over the internet , each a - 2 unit 230 is connected by high - speed fibre - optic lines 255 to a plurality of a - 3 units 250 , each of which is located in a single building . each a - 3 unit 250 is connected to the intra - building wires 145 . the a - 3 unit 250 uses these existing wires to form a local area network for the building . in a preferred embodiment , hsc 260 and lsm 270 are network interfaces which employ the 10base - s protocol . each hsc / lsm unit is used to communicate with an lsm 240 or an a - 3 unit 250 . which type of unit an hsc / lsm unit communicates with is determined by the user &# 39 ; s subscription level : hsc / lsms of high - speed subscribers communicate with a - 3 units 250 , while hsc / lsms of low - speed subscribers communicate with lsms 240 . a - 3 units are capable of communicating with high - speed interface cards using 10base - s , 100base - t , or 1000base - t protocols . each a - 3 unit 250 is preferably the main operating point within the building of a high - speed local area network formed by the personal computers 280 connected to the building &# 39 ; s copper wires 145 by high - speed subscribers &# 39 ; hscs 260 . an a - 3 unit 250 performs switching and routing for all computers that are part of its local network . the a - 3 unit 250 is preferably connected to an a - 2 unit 230 by fibre - optic cables 255 installed in the air , with the support of feeders located on the roof of the building , although ground - based cables or cables of non - fibre - optic composition could also be used . preferred components for the construction of the a - 3 units are listed below in table 3 . the physical connections between the a - 1 , a - 2 , and a - 3 units and their components are depicted in fig3 , and 4 a . thus , for apartment units that include an hsc card 260 , a personal computer 280 can communicate over the internet via the relatively high - speed path formed by units a - 3 250 , a - 2 unit 230 , and a - 1 unit 220 and their associated optical cables 205 , 215 , and 255 . however , for apartments which merely include an lsm interface card 270 ( i . e ., the apartment is a low - speed subscriber ) the personal computer 280 communicates with the internet via the alternative path formed by sst 140 , its 130 lsm 240 , a - 2 unit 230 , a - 1 unit 220 and their associated wires and optical cables . preferably , lsm units 240 and 270 use a 10base - s ™ system ( available from olencom electronics ltd ., yokneam illit 20692 , p . o . b . 196 , israel ), or a similar system , for transmission over copper wires . similarly , a - 3 units 250 and hsc units 260 communicate with the same 10 base - s protocol . the 10base - s system provides an extension to the ieee 802 . 3 compliant 10baset ethernet standard network . it combines dsl modulation technologies with ethernet technology . the 10base - s system provides a point - to - point link that can deliver half or full duplex 10baset ethernet at the full 10 mbps data rate . for telephone applications , it supports transmission of pots or isdn or pbx signaling simultaneously with data over the standard telephone - grade wire infrastructure . the 10base - s system employs quadrature amplitude modulation ( qam ). qam modulation uses both signal amplitude and phase to define each symbol . 10base - s uses the most sophisticated qam technology with various qam modulations ( qam - 256 , qam - 128 , qam - 64 , qam - 32 , qam - 16 , qam - 8 and qam - 4 ). a specific modulation is chosen according to the line specification and the rate definition . 10base - s is designed to support multi - qam in order to achieve performance as close to the physical limit as possible , while maintaining low cost and low power . 10base - s has higher capacity than both dmt tdd and regular qam , when comparing capacity calculations ( the calculation of physical capacity limitations ). 10base - s facilitates the transport of symmetrical bi - directional data over unshielded , copper twisted - pair wires . the 10base - s system employs frequency division duplexing ( fdd ) to separate the downstream channel , the upstream channel , and pots , isdn , or pbx signaling services , in the frequency domain . this enables service providers to overlay 10base - s on existing pots , isdn , or pbx signaling services without disruption . both 10base - s and pots / isdn / fbx services may be transmitted over the same line without interfering with each other . ethernet data is encapsulated onto a continuous stream of cells in a proprietary scheme . the system applies a self - synchronizing scrambler mechanism to this continuous , non - bursty data cell stream . the scrambler is initialized to a random value providing better de - correlation of the transmitted signals , and thus better fext performance when transmitted through a multi - pair copper cable . a sophisticated reed - solomon ( rs ) error correction code is also applied to the data stream , providing strong error detection and recovery capabilities . upon reception , the ethernet data is reassembled from the error free cell stream . 10base - s technology operates at a continuous raw symmetrical bi - directional data rate of 11 . 25 mbps . this allows transport of ethernet data at the full standard line rate of 10 mbps , in full duplex . the transport overhead does not reduce the ethernet bandwidth and the system may thus be used totally transparently in a 10 mbps ethernet network . the 10base - s system may be used as an essentially point - to - point communication system . the core data pump is a blind modem , capable of supporting point - to - multi - point transmission systems . operation in the point - to - point arrangement avoids the need for the collision detection scheme by frequency separation of the downstream from the upstream and at the same time supports fall duplex operation . the physical ethernet interface is a standard rj - 45 socket . the user may connect standard 10baset equipment , such as an ethernet switch or an ethernet nic card , to the 10base - s equipment using standard ethernet cables . the 10base - s transmissions on wires 145 do not interfere with the radio transmissions on the same wires because the power and frequency of the 10base - s transmissions is substantially different from those of the radio transmissions . more specifically , the radio signals are of a much lower frequency content ( 0 - 10 k hz ) than the 10base - s transmissions . further , the radio signals have substantially more power than the 10base - s transmissions . thus , when a user activates a radio unit connected to radio socket 150 to listen to a radio program , the loudspeaker of the radio unit largely filters out the 10base - s signals due to their relatively high frequency . further , to the extent the 10base - s signals include frequency components within the bandwidth of the loudspeaker , they are not perceptibly reproduced by the speaker because of their low power content . [ 0041 ] fig4 a , and 4 b show in greater detail the components used to construct units a - 1 , a - 2 , and a - 3 and how they are connected together . [ 0042 ] fig5 illustrates , in general , the operation of the network when an individual user accesses the internet via a low speed modem 270 . in the example shown , at step 510 , an a - 1 unit 220 receives internet data directed to the individual user . the a - 1 unit 220 then at step 520 routes the received data to an a - 2 unit 230 that services an area network of which the user is a member . the a - 2 unit at step 530 receives the data and routes it to the lsm unit 240 that serves , typically with other buildings , the building in which the user resides . at step 540 , the lsm unit 240 receives the data and transmits it ( preferably , using 10base - s protocol ) over radio - transmission lines through an sts 140 to the user &# 39 ; s pc 280 via lsm 270 ( preferably , a 10base - s end - user unit ). [ 0043 ] fig6 illustrates , in general , the operation of the network when an individual user accesses the internet via an hsc 260 . in the example shown , at step 610 an a - 1 unit 220 receives internet data directed to the individual user . at step 620 the a - 1 unit 220 routes the data to the a - 2 unit 230 that serves an area network of which the user is a member . the a - 2 unit 230 at step 630 receives the data and routes it to an a - 3 unit 250 that serves user &# 39 ; s building . at step 640 the a - 3 unit receives the data and transmits it over radio - transmission lines 145 to the user &# 39 ; s pc 280 via hsc 260 , using the 10base - s protocol . in one embodiment of the network , each a - 2 unit 230 is connected to both a plurality of lsms 240 and a plurality of a - 3 units 250 . high - speed subscribers are connected to the a - 2 units 230 via a - 3 units 250 , and copper - wire - based , narrowband subscribers are connected to the a - 2 units 230 via lsms 240 . fig7 depicts , in general , the operation of such a network . at step 710 , an a - 1 unit 220 receives internet data directed to an individual user . at step 720 the a - 1 unit routes the data to an a - 2 unit 230 that serves the area network of which the user is a member . at step 730 , the a - 2 unit 230 receives the data . at step 740 , the a - 2 unit 230 determines the identity of the user to which the data is directed , and checks the user &# 39 ; s identity against a database of users . if the user is a high - speed - service subscriber , and thus located in a building that has an a - 3 unit 250 , then at step 755 the a - 2 unit routes the data via high - speed lines 255 to the a - 3 unit 250 that services the user &# 39 ; s building . at step 760 the a - 3 unit 250 receives the data , and at steps 770 and 780 the a - 3 unit 250 routes the data over the building &# 39 ; s radio - transmission lines to the user &# 39 ; s lsm 270 . returning to step 740 , if the user is not a subscriber to high - speed services , then at step 745 the a - 2 unit 230 routes the data to an lsm 240 that serves the user &# 39 ; s building , and at step 750 the lsm 240 receives the data and transmits it over radio - transmission lines to the user &# 39 ; s lsm 270 . in another embodiment , when a building ( such as building 235 ) has both high - speed and low - speed subscribers , all internet signals are sent from the a - 2 unit 230 to the building &# 39 ; s a - 3 unit 250 . this includes those signals directed to low - speed subscribers in the building . in this embodiment , the lsm units 270 are 10base - s units , so the a - 3 unit 250 transmits internet signals directed to low - speed subscribers directly to their lsm units 270 . in a further alternate embodiment , the a - 3 unit is connected to an lsm unit ( not shown ) that in turn is connected to the intra - building copper - wire network 145 . then , if a packet is to be sent to a low - speed subscriber , the a - 3 unit receives it and routes it to the attached lsm , which then sends it to the user &# 39 ; s lsm 270 . in a still further embodiment , the lsm attached to the a - 3 unit is capable of receiving signals from an lsm unit 240 and routing them to the attached a - 3 unit . this configuration has the advantage of redundancy : if the fibre - optic communication line to the a - 3 unit is broken , high - speed subscribers can still use the low - speed system , and if the copper - wires ( or lsms 240 ) are down , low - speed subscribers can still receive internet services via the a - 3 unit . while the subject invention has been particularly shown and described with reference to preferred embodiments of the systems and methods thereof , it will also be understood by those of ordinary skill in the art that various changes , variations , and modifications in form , details , and implementation may be made therein without departing from the spirit and scope of the invention as defined by the appended claims . for example , although the a - 1 , a - 2 , a - 3 , lsm , and hsc units have been described herein with great specificity regarding part numbers and configurations , those skilled in the art will recognize that the functionality of each of these units can be substantially duplicated by a wide variety of configurations of various components by various manufacturers . also , although the above embodiments have been described primarily as they apply to radio - transmission networks , those skilled in the art will recognize that the subject invention also can be applied in other contexts . for example , ordinary telephone lines also form a copper - wire network to which the invention can be applied . [ 0053 ] table 2 unit a - 2 components no catalog code description catalyst6500 - l3 ( 2xlx / lh 1gb - a1 ; 48x10 / 100 - a3 ) 1 ws - c6509 catalyst 6509 chassis 2 ws - cdc - 1300w catalyst 6000 1300w dc power supply 3 ws - cdc - 1300w / 2 catalyst 6000 second 1300w dc power supply 4 ws - x6k - sup1a - catalyst 6000 supervisor engine 1 - a , 2ge , msfc plus msfc & amp ; pfc 5 mem - msfc - catalyst 6000 msfc mem , 128mb dram 128mb option 6 mem - c6k - flc24m catalyst 6000 supervisor pcmcia flash mem card , 24mb option 7 sc6msfcc - catalyst 6000 msfc ios flash image - ip 12 . 0 . 7xe 8 ws - x6k - s1a - catalyst 6000 redundant supervisor 1a , msfc / 2 2ge , w / msfc & amp ; pfc 9 mem - msfc - catalyst 6000 msfc mem , 128mb dram 128mb option 10 mem - c6k - flc24m catalyst 6000 supervisor pcmcia flash mem card , 24mb option 11 sc6msfcc - catalyst 6000 msfc ios flash image - ip 12 . 0 . 7xe 12 ws - g5486 1000base - lx / lh “ long haul ” gbic ( singlemode or multimode ) 13 ws - x6348 - rj - 45 catalyst 6000 48 - port 10 / 100 , enhanced qos , rj - 45 14 nc316bu - 16 / dc 16 - slot chassis with internal − 48dc power supply 15 nc316 - 16rpsdc redundant power supply for nc316bu - 16 (− 48v dc ) 16 em316nm snmp management module with 1 10base - t port 17 em316f / s1 100base - tx to 100base - fx ( sm : 1310nm : 0 - 25km : dsc ) [ 0054 ] table 3 unit a - 3 components no catalog code description catalyst2924 ( 23x10 / 100 ; 1x100 - a2 ) 1 ws - c2924 - xl - en 24 - port 10 / 100 switch ( enterprise edition ) 2 em316f / s1 100base - tx to 100base - fx ( sm : 1310nm : 0 - 25km : dsc ) 3 nc316bu - 1hp / ac single - slot high power chassis with internal 90 - 240v ac power supply | 7 |
preferably in the preferred embodiment , as shown in fig1 , an anchor sheet 1 has a polyethylene layer 9 , in which there is a countersunk area 7 at ( in this case ), a corner . the sheet is made of polyethylene and is substantially covered with hooks 4 that are injection molded into the sheet . details of this are described in the corresponding applications entitled “ system and methods of manufacturing hook plates ” and “ improved anchor sheet ” by some of the same inventors filed concurrently herewith , and in earlier cases described earlier in this application , all of which are incorporated herein by reference . the anchor sheet typically has a resilient layer 5 , but this is not necessary for the operation of this invention . contained within the countersunk area , in at least one embodiment , is an aperture 15 and surrounding expansion areas 16 and 17 , which will be described more fully in detail later . shown in fig2 , is a series of anchor sheets , which in this embodiment have an overlapping area 23 and 25 , but such overlapping area is also not necessary for this invention . in fig2 , the countersunk area for the attachment device is shown at 21 . fig3 , shows an anchor sheet also having a countersunk area 7 , an aperture 15 and expansion areas in the sheet 16 and 17 . these are areas of reduced strength , so as to allow for movement of the rim 14 around the aperture 15 into the expansion areas as will be described later . fig3 also shows an attachment device 31 , which typically will contain a male protrusion 33 , projecting onto its under - surface , and which will conform to and fit into aperture 15 , as also will be described in further detail later . fig4 , shows in more detail , a male prong 33 as seen from below attachment device 31 . registration members 35 are also placed underneath attachment piece 31 . male prong 33 is a flexible protrusion , which has a normal memory position as shown in fig4 , which is slightly larger than aperture 39 . it has a cam surface 37 , which contains an edge slightly larger than the corresponding aperture 39 contained in the sheet 1 . shown in fig5 , is sheet 1 having aperture 39 . there is also a corresponding indentation 41 , which matches with the registration member 35 to help centre the snap - fit connection . in practice , male prongs 33 have sufficient flexibility that they can move slightly into aperture 39 , but are normally in a position whereby cam surface 37 fits onto the edge 43 of aperture 39 to prevent disengagement of the attachment device 31 from the anchor sheet 1 . as will be explained later , there are apertures or expansion openings 45 through the polyethylene sheet 1 , and surrounding the aperture 39 on opposite sides , so as to create effectively a structure whereby the aperture 39 is surrounded by a thin surrounding layer of plastic 47 as a rim on two sides of the aperture , thus to allow the aperture to move in a path between the two expansion openings 45 . the movement of the aperture allows for some movement of the whole connection between the attachment device 31 and anchor sheet 1 as will be described later . some movement is also available because of movement of the prongs 33 . by appropriate placement of the aperture 39 and prongs 33 in of the overlap area of an attachment piece 31 and the overlap of an anchor sheet 1 , an appropriate space can be created between the attachment piece and the anchor sheet . during atmospheric expansion and contraction , the flexibility of prong 33 and the flexibility of rim 47 and 48 around surrounding opening 39 , allow rim 47 and 48 to move into the expansion openings 45 as necessary to accommodate expansion and contraction . the prong 33 and rim 47 and 48 may be made from the same material as the anchor sheet or the attachment piece , as long as the material is sufficiently flexible . it is preferred that the material be polypropylene or polyethylene . for example , polypropylene such as that sold as stamylan ™ p112mn40 with an iso of 1873 indication of pp - h , ma - m400 is acceptable . this material has a melt - flow index of 50 ( t - 230 degrees c ., f = 2 . 16 kg ) a tensile modulus of 1900 mpa , proportional strength of 35 mpa , ultimate strain of greater than 50 %, a density of 910 kg / m 2 , and a melting point of approximately 160 degrees celsius . the attachment device 31 may include two registering pins 35 and two corresponding indentations 41 for receiving pins 35 . pins 35 and indentations 41 co - operate to align the attachment piece 31 with the anchor sheet 1 . this arrangement can encourage atmospheric expansion and contraction to occur , in a direction along a line 572 or 574 that passes approximately through the middle of expansion openings , as shown in fig6 . in fig6 , attachment piece 430 has male members 432 , 434 , 436 , and 438 on the bottom surface of its upper - disk , with corresponding registering pins 440 , 442 , 444 , and 446 . these fit into corresponding openings 448 , 450 , 452 , and 454 and corresponding pin receptacles 456 , 458 , 460 and 462 . after the prongs and registering pins are inserted into the corresponding round opening and pin receptacles , atmospheric expansion and contraction will be encouraged to take place generally through the centres of the horseshoe openings 464 , 466 , 468 and 470 , along lines 574 and 572 . it is not necessary to restrict the expansion and contraction to these lines , but it is thought in practice that this is the natural way that the sheets will expand and contract . referring to fig3 , while in the above description , the first half of the attachment device has been described as being an attachment piece 31 , and the second half has been described as being on an anchor sheet 1 , there could be a reversal of the male and female members , however because the male member projects down into the resilient layer 5 , it is preferable to have the male member on the attachment piece which is projecting into the resilient layer . as shown in fig7 , male member 61 can also be provided with expansion openings 63 and 65 , which will allow for the male member to move on the attachment device 31 . in this embodiment , male member 61 is inserted into keyhole 67 , and then twisted to move into channel 69 . the flange or cam surface 71 on male member 61 , prevents the upward movement of attachment piece 31 once it has been moved into channel 69 . in addition , there are also registration pins 73 on the underside of head 61 , which can register with small indentations 75 to locate the attachment device 33 in relation to the anchor sheet 1 . as shown in fig8 , registration pins can also be registration receptacles 77 , so co - operate with pins at locations 75 on anchor sheet 1 . fig8 also shows the expansion opening 63 in greater detail . fig9 shows the attachment device 31 and the anchor sheet 1 shown in plan view from above . because of the countersink , attachment device 31 and anchor sheet 1 are on the same plane , presenting a flat surface . not completely shown , but to be understood , is that typically the anchor sheet will be covered in hooks ( not shown ), as will the attachment device 31 . it is noted that those skilled in the art will appreciate the modifications of detail may be made from the embodiments described herein which would come within the spirit and the scope of the invention as described in the following claims . | 0 |
in embodiments of the present invention , a leaf node is informed of failure information by extending the existing notification message of mldp or by defining a new notification message . in the following embodiments , an intermediate node may be an lsr , or other network apparatus , e . g ., a switch . referring to fig1 , a method for failure notification is as follows . step 101 : it is detected whether a failure occurs in a multicast lsp that is established based on an mldp . during the establishment of the p2mp lsp by mldp , the detection for whether a failure occurs in a multicast lsp may be different from that after the establishment of the p2mp lsp by mldp . these two cases will be described below . during the establishment of the p2mp lsp by mldp , each intermediate node detects whether a failure occurs in the multicast lsp . the detection is usually performed on a status of a direct upstream node of the intermediate node , or performed on a path between the direct upstream node and the intermediate node . the failure cause may include no route , label space error , or p2mp incapable . the no route may include failure of calculating a route to a head node . the label space error may include insufficient label space , label space distribution error , inconsistency between a label space and a label , etc . for example , if the no route occurs during the establishment of the p2mp lsp by mldp , a failure may be detected when the lsp fails to be further established upon the receipt of a joining request from a leaf node . the failure cause during the establishment of the mp2mp lsp by mldp differs from that during the establishment of the p2mp lsp in that the p2mp incapable is the failure cause during the establishment of the p2mp lsp while mp2mp incapable is for the establishment of the mp2mp lsp . after the p2mp lsp is successfully established , each intermediate node detects whether a failure occurs . the failure cause may include no route , or the maintaining of the lsp at the moment . the no route may include situations of an irreparable disconnection of a path to a head node , or a disconnection of a path to a head node without an alternative path , etc . the situations may be incurred by a failure of the network or maintenance for the network at the moment . the failure notification principle of the mpls p2mp lsp is also applicable to the mpls mp2mp lsp . the intermediate node may detect whether a failure occurs during the establishment of the mp2mp lsp by mldp or after the establishment of the mp2mp lsp by mldp . step 102 : when a failure is detected , failure information is sent to a downstream node of a multicast tree where a failed point locates . the following description is made by way of illustration concerning two scenarios , i . e ., during the establishment of the p2mp lsp and after the establishment of the p2mp lsp . during the establishment of the p2mp lsp by mldp , when it is detected that the lsp fails to be further established upon the receipt of a joining request from a leaf node , a failure occurs . then , a failure notification message is generated , and is delivered to the downstream node . the failure notification message is used for carrying failure information , where the failure information may include a failure location and a failure cause . the failure location includes a location of a node where the failure occurs , or a location of a path where the failure occurs , for example , information about which node fails or which route between two nodes fails . the failure information carries an ip address and an identification of the failure node , or carries an ip address and an identification of an end node of the failure route . the failure cause may be referred to step 101 . during the establishment of the p2mp lsp by mldp , after receiving a joining request from any leaf node , an upstream node may process the request . when a failure is detected , failure information is sent or forwarded to the leaf node via a downstream node . the following description is made as an example where two leaf nodes initiate a joining request separately . referring to fig2 , leaf nodes lsr r 5 and lsr r 6 send joining requests . upstream nodes r 3 and r 2 process the requests in sequence . however , the r 2 finds out that a route fails and the lsp cannot be further established . moreover , there is no other route that may arrive at a head node r 1 . therefore , the r 2 actively notifies a downstream node r 3 via a failure notification message . the failure notification message is used for carrying failure information . upon the receipt of the failure notification message , the downstream node r 3 delivers the failure notification message along the downstream . the failure notification message finally arrives at the leaf nodes r 5 and r 6 . thus , the leaf nodes r 5 and r 6 are informed , via the failure notification message , of the failure occurring on the path between the r 2 and the r 1 as well as the failure cause . after the establishment of the p2mp lsp , due to a network failure or maintenance for the network , etc ., a failure occurs when it is detected that a path to a head node is disconnected and irreparable , or it is detected that a path to a head node is disconnected while no alternative path is available . then , a failure notification message is generated , and is delivered to the downstream node . the failure notification message is used for carrying failure information . for example , referring to fig2 , a p2mp lsp is successfully established and includes a head node r 1 , intermediate nodes r 2 , r 3 , r 8 and r 4 , leaf nodes r 5 , r 6 and r 7 . due to a failure of the intermediate node r 2 , the r 3 finds out that a path to the head node r 1 via the r 2 is disconnected while no other path to the head node r 1 is available . at this point , the r 3 generates a failure notification message and delivers it to a downstream node . after processed by one or more downstream nodes , the failure notification message finally arrives at the affected leaf nodes r 5 and r 6 , informing the leaf nodes r 5 and r 6 of the failure of the leaf node r 2 as well as the failure cause . in addition , for further improving the network management and maintenance capability , the network administrator may acquire the failure information from the leaf node , and may accordingly maintain or repair the failed point based on the failure cause . in an actual network , there may be a scenario that the leaf node does not need to acquire the failure notification message . for example , there is no need to send / receive multicast data via the multicast forward tree after the leaf node sends a joining request . the leaf node may indicate in the joining request whether a failure notification message is required . when a failure is detected , it is determined first whether the leaf node requires receiving failure information . when the leaf node requires receiving the failure information , a failure notification message is generated . the failure notification message is used for carrying the failure information . and , the failure notification message is finally sent to the leaf node via the downstream node . when the leaf node does not require receiving the failure information , a failure notification message is not generated to thereby avoid sending useless failure information . the node that detects the failure sends the failure notification message to a downstream node of the multicast tree where the failed point locates . if the downstream node is a leaf node , the leaf node may receive the failure notification message and acquire the failure information from the failure notification message . if the downstream node is an intermediate node , the intermediate node may receive the failure notification message , and forward the failure notification message to its downstream node when the intermediate node finds out that the failure notification message carries the failure information . the failure notification message is forwarded through one or more hops of intermediate nodes , and is finally sent to the leaf node . when the failure information requires to be carried , the following approaches may be adopted . a new notification message may be defined . the new notification message may carry failure information . for example , the new notification message may be in a form of an identification bit and an information bit . the identification bit indicates that the notification message carries the failure information . the first m bits of the information bit indicate the lsp where the failure occurs , while the last n bits of the information bit indicate the failure cause . m and n herein are natural numbers . since each intermediate node may probably be located at a plurality of routes , the first m bits of the information bit need to indicate on which route the failure occurs . there may also be various failure causes , so that the leaf node shall perform a different processing / operation according to a different failure cause . thus , the last n bits of the information bit may be employed to indicate the specific failure cause . alternatively , the failure notification may be realized by extending the existing notification message of mldp . a failure notification element and a failure - affected forwarding equivalence class ( optional ldp mp fec tlv ) are encapsulated in the extended notification message . the failure notification element is used to indicate a failure cause , e . g ., no route , label space error , p2mp incapable or mp2mp incapable , etc . the failure - affected forwarding equivalence class is used to indicate a failure location . since each intermediate node may probably locate at a plurality of lsps , the failure - affected forwarding equivalence class indicates which p2mp lsp the failure occurs in , or to indicate which mp2mp lsp the failure occurs in . the failure notification element may have a coding value and a form that are adjustable according to actual implements , as long as the coding value and the form may indicate a failure location and a failure cause . here is an example for one form of the failure notification element . error code : 1 indicates no route ; 2 indicates label space error , e . g ., insufficient label space ; 3 indicates p2mp incapable ( mp incapable ); 4 indicates planned maintenance . referring to fig3 , a switch apparatus for notifying a failure on a multicast label switch path established based on a multicast label distribution protocol may include the following : a detection unit 301 , configured to detect whether a failure occurs in the multicast lsp , where the multicast label switch path is established based on the multicast label distribution protocol ; and an information unit 302 , configured to send failure information to a downstream node of a multicast tree where a failed point locates when the detection unit detects a failure , where the failure information is forwarded through one or more downstream nodes and arrives at a leaf node . an information generating subunit , configured to generate a failure notification message , where the failure notification message is configured to carry the failure information ; a sending subunit , configured to send the failure notification message generated by the information generating unit to the downstream node of the multicast tree where the failed point locates ; or a forwarding subunit , configured to forward , upon the receipt of the failure notification message from an upstream node of the multicast tree where the failed point locates , the failure notification message to a downstream node . a determination unit , configured to determine whether a leaf node requires receiving the failure information , and is configured to generate a termination instruction when it is determined that a leaf node does not require receiving the failure information , where the termination instruction is used to control the information unit for terminating the work ; generate an execution instruction when it is determined that a leaf node requires receiving the failure information , where the execution instruction is used to control the work of the information unit . in the present embodiment , the switch apparatus may be a network apparatus with switch function , such as a switch , a two - layer router , etc . with the description of the foregoing embodiments , it is readily appreciated by those skilled in the art that the present invention may also be implemented with software in combination of a necessary hardware platform , or , of course , may also be entirely implemented with hardware . based on this understanding , technical solutions of the present invention , or the part which the present invention makes contribution over the background may be embodied in a software product . the computer software product may be stored in a readable storage media such as rom / ram , magnetic disc , or optical disc , etc . the software product may include a set of instructions enabling a computer ( may be a personal computer , a server , or a network device , etc .) to perform methods according to various embodiments or some parts of the embodiments of the present invention . the foregoing embodiments are merely preferred embodiments of the present invention . it should be noted that several modifications and variations can be made by those skilled in the art without departing from the principle of the present invention . these modifications and variations shall be construed as fall within the scope of the present invention . | 7 |
referring to fig1 a laser 10 is controlled by modulator 12 to provide a modulated light output indicated by the arrows 14 . the light output 14 falls upon a suitable transparent , crystalline rod 16 , for example of liyf 4 , doped with any of the rare earths as indicated by the speckling 18 . the rod or bar 16 is mounted by means of a piezoelectric crystal 20 to a suitable mounting 22 and provides an electrical output which is coupled through a coaxial cable 24 to an amplifier 26 . the amplifier 26 has an output applied to a detector and indicator 28 . the coaxial cable output conductor , the amplifier 26 , the detector and indicator 28 have a suitable common ground connection which is applied also to the crystal mounting of crystal 20 in a known fashion . a laser has been selected for the light generator which is amplitude modulated because the light from the laser is substantially monochromatic . if this incident light is at a wavelength such that the rare earth ions or the doping by the rare earth absorbs the light , then the amount of the absorption will be also modulated at the modulating frequency , for example , f 0 . the absorption is then converted into phonons insofar as the decay is nonradiative . referring to fig2 a , 2b and 2c , at least three possibilities suggest themselves . in fig2 a , if the energy from the incident light is at a level n o , so that the applied energy level is n o , then there may be one or more nonradiative step decays indicated at 32 of the energy absorbed by the rare earth ions to a level 34 , each step decay representing a phonon because , since it is a nonradiative decay , it is transformed into vibratory elastic energy in the crystal structure of the crystal . there may follow a radiative decay indicated by the abrupt change in energy level as indicated by the arrow 36 to a level 38 and then there may follow one or more nonradiative decays indicated by the levels 40 , again indicating a transfer by phonons of energy until the lowest energy level 42 above the so - called ground level 44 is reached . a similar situation may occur in accordance with the diagram of fig2 b , indicating that the radiation of light 14 is absorbed at an energy level n o again resulting in a multiphonon decay 46 and thereafter a radiative decay 48 to the lowest level 42 . fig2 c illustrates still another situation in which the absorbed energy of the radiation 14 at level n o decays by one or more radiative decays 56 , 52 directly to the lowest level 42 . in the case of fig2 c , there is no phonon energy and the crystal is not excited by any vibratory elastic energy . the diagrams of fig2 a , 2b and 2c , are not intended to show every possible situation completely , but merely to indicate the nature of the energy transfer from the light 14 to the rare earth ions which absorb it and then return to their original energy levels from the excited state by radiation or by phonons or by combination of radiation or phonons . the operation of the system can be explained in a qualitative manner and also in a more rigorous scientific manner . in this portion of the specification , we will adopt the former explanation and then follow it with the latter explanation which involves some mathematics . let the matrix for the rare earth ions be exemplified by a transparent bar or rod 16 as illustrated in fig1 . the dimensions of the rod 16 are chosen in such a way that the rod is susceptible to its lowest resonant frequency well separated from the nearest higher frequency of resonance . the laser 10 is modulated by the modulator 12 at this resonant frequency , which is the mechanical resonant frequency of the rod 16 . on reception of energy from the laser 10 , the rare earth ions will absorb some of the energy , especially if the radiant energy 14 is chosen to be at or near a particularly absorbent energy level for the rare earth ions . if the energy is reradiated as light , the bar 16 is not otherwise affected . nevertheless , if the absorbed energy is given up in part as phonon energy , it will be apparent that the bar is subjected to a vibratory elastic energy at a modulation rate equal to the modulation frequency of the modulator 12 . because the rod or bar 16 has a high q , the vibratory energy is transformed into mechanical oscillatory energy of the bar in effect by an action which may be explained as comparable to parametric oscillations . the mechanical oscillations of the bar in such a way will be multiplied by the mechanical q of the bar , which may be very great , so that the system will be very sensitive to energy levels whose decay is by phonons and insensitive to energy levels that decay radiatively . the laser source 10 may be tunable and therefore may serve as a highly sensitive tool to examine the method of and decay of the excited state of the rare earth ions in the crystalline matrix 16 . similarly , this provides a tool to examine the line width mechanisms of the ions . the phonon assisted energy transfer processes themselves may be thus examined . the system and method therefore affords a way of investigating many important questions . the q of the system may be further enhanced by resort to operation in a cyrogenic medium or atmosphere , if desired . in preparing the bar which is a solid containing the rare earth ions to be resonant at a selected frequency w o , where l is the length of the solid and c is the speed of sound in the bar . for a simple bar ## equ1 ## where r is young &# 39 ; s modulus and q is the density of the bar 16 . for glass ( pyrex ), c is approximately 5 , 200 meters / second , and for quartz c is about 5 , 450 meters / second . for a rod or bar of about 1 / 10 cm . in length , the resultant frequency is a few kilocycles for the lowest mode of the bar . this will be the selected frequency at which the incoming laser beam will be modulated . the bar may be attached to the piezoelectric transducer 20 in known fashion , and if desired may be calibrated after attachment so that the frequency can be known extremely accurately . the bar also is preferably shaped so that no modes of mechanical oscillation are near , that is , the length of the bar is much greater ( let us say 10 times greater ) than any of the other dimensions . a system of this kind may have a very high q factor . for example , quartz in air can have a q factor of as high as 27 , 500 , while in vacuum the q of such a bar may be as high as 10 6 . even though the bar is somewhat loaded by its attachment to the piezoelectric crystal , it is still an extremely high q system . the electric vector in the incident light can be written as : where δ m is the modulation amplitude and where ωm is the modulating frequency . also the wave e z ( where e z denotes the field strength in the direction z of the incident radiation ) can then be written as : ## equ2 ## then the wave at point x distant from the free end of the bar may be written as in which kμ = wμ / c , wμ = w + μw m , a o = e o , and a . sub .± 1 =( e o δm )/ 2 . now the intensity of the laser radiation 14 falling on the crystal bar 16 is proportional to the vector product e × h , so the intensity i may be written as a proportionality : in which the subscript μ &# 39 ; denotes a value arising from h . so by trigonometric identity : the frequency of the first term in brackets , is much greater than the frequency of the second term in brackets , in equation 9 . therefore , we may assume that the higher frequency may be filtered out by any suitable known means , and we may consider the remaining lower frequency component , so that , at low frequencies , i becomes i lf , and ## equ3 ## the various terms then arise from μ = μ &# 39 ;, which gives a constant , and the parings : μ = 1 , μ &# 39 ;= 0 , μ = 0 , μ =± 1 , μ =- 1 , μ &# 39 ;= which gives w m , as follows : ## equ4 ## the remaining terms may be ignored because they will be insignificant in view of the nature of the summation and because of the system resonance and filtering . where a 1 and a 2 are constants and k m = 2π / λm which desirably assume values of a few hundred kilocycles . we may allow k m = 0 , nearly . then the number of rare earth atoms ( or rare earth ions ) 18 in the bar 16 in the excited states as a result of the radiation 14 is proportional to the intensity of the radiation 14 . the number of phonons n p generated by a non - radiative decay is , in turn , proportional to the intensity . therefore where k is some constant . then the number of time - dependent phonons generated is this term ( 15 ) enters as a source term into the wave equation for the mechanical oscillation of the bar 16 , which is the sample , driving the bar to oscillate at frequency w m . if the bar is resonant at frequency w m , as is supposed , the amplitude of the oscillation ka , will be multiplied by the q of the mounted bar , which is very large as noted hereinbefore . thus , the system is highly sensitive to the non - radiative energy level decay by phonons , and insensitive to energy levels that decay radiatively by photons . as noted above , the q may be enhanced by operation in a cryogenic atmosphere or medium . if the laser source is tunable , as indicated by arrow 54 , being for example , a dye laser , then a sensitive tool is provided to examine the method of decay of the excited states of rare earth ions in crystals , and for examining the line - width mechanisms of such ions . phonon - assisted energy processes can also be studied . the system here described is useful in the investigation of the rare earth absorption and emission spectra in a single crystal . many of the absorption lines of the rare earth ions in solids are very sharp , e . g . approximately 1 cm . - 1 half - width at 20 , 000 cm - 1 . it is believed by some that much of this line width is caused by inhomogeneous regions in the sample , rather than by coupling of the ions to phonons . one prior way of investigating has been to test line widths as a function of temperature . the hypothesis is that if the line widths increase , these lines appear due to phonon activity ; line widths that do not change with temperature may be considered due to the inhomogeneous regions . by employing both the present system and method and prior techniques the accuracy of this hypothesis may be ascertained . it is apparent from the foregoing that the present system and method provides a valuable tool for the study of phonons and phonon decay . | 6 |
embodiments of the invention will be described below in details , and examples of the embodiments will be illustrated in the drawings throughout which identical or similar reference numerals denote identical or similar elements or elements with identical or similar functions . the embodiments to be described below with reference to the drawings are illustrative and intended to just explain the invention but can not be construed as limiting the invention . in order to attain the object of the invention , an embodiment of the invention discloses a method of mapping to a demodulation reference signal port , which includes the following steps : a base station assigns a ue with a corresponding data stream dependent upon an attribute of the ue ; the base station maps the corresponding data stream from a layer to a corresponding demodulation reference signal port ; and the base station transmits the corresponding data stream to the ue via the demodulation reference signal port . as illustrated in fig4 which is a flow chart of a method of mapping to a dmrs port according to an embodiment of the invention , which includes the following steps : s 401 : a base station determines an attribute of a ue and assigns the ue with a corresponding data stream . in the step s 401 , the base station communicates with the ue and assigns the ue with a corresponding data stream dependent upon an attribute of the ue . specifically during downlink mimo transmission , the enb assigns each scheduled ue with a specific number of parallel data streams dependent upon a channel condition , a service characteristic , a priority and other factors of each ue , where each data stream is referred to as a layer . in order to support a spatial multiplexing technology of at most 8 layers , an 8 - port dmrs will be defined in the lte - a . the mmrs is processed with the same pre - coding as data , and the ue can know an equivalent channel matrix after pre - coding and demodulate the data by measuring the dmrs . the downlink su - mimo of the lte - a can support at most 8 layers , each of which corresponds to a dmrs port . a process flow of a downlink physical channel is as illustrated in fig1 . s 402 : the base station maps the corresponding data stream from a layer to a corresponding demodulation reference signal port . s 403 : the base station transmits data to the ue via the demodulation reference signal port . in the step s 402 , the base station maps the corresponding data stream from a layer to a corresponding demodulation reference signal port . specifically for downlink transmission at the rank = 1 , the base station mapping the corresponding data stream from a layer to a corresponding demodulation reference signal port includes : the corresponding data stream can be mapped onto any port and occupy any cdm group . as illustrated in fig5 , for example , assumed multi - user multi - input multi - output ( mu - mimo ) transmission can be supported with m orthogonal dmrs ports in the lte - a , and then a data layer can be mapped onto any port in { 0 , . . . , m } and occupy any cdm group regardless of retransmission or initial transmission . fig5 illustrates a layer - to - port mapping scheme with m = 4 . for downlink transmission at the rank = 2 , the base station mapping the corresponding data stream from a layer to a corresponding demodulation reference signal port includes : when downlink transmission is double - codeword transmission at the rank = 2 , dmrs ports to which two layers correspond belong to the same cdm group . for retransmission of a codeword corresponding to the two layers , it is retransmitted in single - codeword transmission , and the ports occupied for the two layers in retransmission belong to the same cdm group . as illustrated in fig6 , for example , in double - codeword transmission at the rank = 2 . dmrs ports to which two layers correspond shall belong to the same cdm group from the perspective of saving an overhead and improving the reliability of data transmission . a specific group to be occupied is indicated from the enb side as a result of a scheduling decision . if double - codeword transmission at the ranks = 3 - 5 were adopted in previous transmission , where a codeword mapped to the layer 2 , will be retransmitted and a transport block corresponding to the other codeword will not be retransmitted , then single - codeword transmission will be adopted in this case . drms ports to which the two layers correspond shall belong to the same cdm group . a specific group to be occupied is indicated from the enb side as a result of a scheduling decision . an occupancy condition of ports in retransmission may be inconsistent with that in initial transmission . following this mapping relationship , a dmrs overhead is kept at 12 pairs of res / prbs , and this mapping scheme is compatible with the rel - 9 to facilitate joint scheduling . fig6 illustrates an example of a layer - to - port mapping relationship in transmission at the rank = 2 . for downlink transmission at the rank = 3 or the rank = 4 , the base station mapping the corresponding data stream from a layer to a corresponding demodulation reference signal port includes : when downlink transmission is double - codeword transmission , a layer to which a codeword 1 corresponds is mapped to a first demodulation reference signal cdm group , and a layer to which a codeword 2 corresponds is mapped to a second demodulation reference signal cdm group . when downlink transmission is single - codeword transmission , layer - to - demodulation reference signal port mapping is kept consistent with double - codeword transmission . when downlink transmission is double - codeword transmission at the rank = 3 , if one of the codewords has an error occurring therewith and will be retransmitted and the other codeword has no new data to be transmitted , then a mapping relationship between the layer to which the retransmitted codeword corresponds and the occupied port thereof is defined as that at the rank = 1 or the rank = 2 . a specific example thereof is as illustrated in fig7 . when downlink transmission is double - codeword transmission at the rank = 4 , if one of the codewords has an error occurring therewith and will be retransmitted and the other codeword has no new data to be transmitted , then a mapping relationship between the layer to which the retransmitted codeword corresponds and the occupied port thereof is defined as that at the rank = 2 . a specific example thereof is as illustrated in fig8 . for downlink transmission at the rank = 5 , 6 , 7 or 8 , downlink transmission is double - codeword transmission . for downlink transmission at the rank = 5 , the base station mapping the corresponding data stream from a layer to a corresponding demodulation reference signal port includes : a layer to which a codeword 1 corresponds is mapped to a first demodulation reference signal cdm group , and a layer to which a codeword 2 corresponds is mapped to a second demodulation reference signal cdm group . when downlink transmission is double - codeword transmission at the rank = 5 , if one of the codewords has an error occurring therewith and will be retransmitted and the other codeword has no new data to be transmitted , then a mapping relationship between the layer to which the retransmitted codeword corresponds and the occupied port thereof is defined as that at the rank = 2 or the rank = 3 . a specific example thereof is as illustrated in fig9 . for downlink transmission at the rank = 6 , the base station mapping the corresponding data stream from a layer to a corresponding demodulation reference signal port includes : a layer to which a codeword 1 corresponds is mapped to a first demodulation reference signal cdm group , and a layer to which a codeword 2 corresponds is mapped to a second demodulation reference signal cdm group . when downlink transmission is double - codeword transmission at the rank = 6 , if one of the codewords has an error occurring therewith and will be retransmitted and the other codeword has no new data to be transmitted , then a mapping relationship between the layer to which the retransmitted codeword corresponds and the occupied port thereof is defined as that at the rank = 3 . a specific example thereof is as illustrated in fig1 . for downlink transmission at the rank = 7 , the base station mapping the corresponding data stream from a layer to a corresponding demodulation reference signal port includes : a layer to which a codeword 1 corresponds is mapped to a first demodulation reference signal cdm group , and a layer to which a codeword 2 corresponds is mapped to a second demodulation reference signal cdm group . when downlink transmission is double - codeword transmission at the rank = 7 , if one of the codewords has an error occurring therewith and will be retransmitted and the other codeword has no new data to be transmitted , then a mapping relationship between the layer to which the retransmitted codeword corresponds and the occupied port thereof is defined as that at the rank = 3 or the rank = 4 . a specific example thereof is as illustrated in fig1 . for downlink transmission at the rank = 8 , the base station mapping the corresponding data stream from a layer to a corresponding demodulation reference signal port includes : a layer to which a codeword 1 corresponds is mapped to a first demodulation reference signal cdm group , and a layer to which a codeword 2 corresponds is mapped to a second demodulation reference signal cdm group . when downlink transmission is double - codeword transmission at the rank = 8 , if one of the codewords has an error occurring therewith and will be retransmitted and the other codeword has no new data to be transmitted , then a mapping relationship between the layer to which the retransmitted codeword corresponds and the occupied port thereof is defined as that at the rank = 4 . a specific example thereof is as illustrated in fig1 . in the step s 403 , the base station transmits the corresponding data stream to the ue via the demodulation reference signal port determined in the step s 402 . the foregoing method proposed according to the embodiment of the invention defines a method of mapping to a demodulation reference signal port at the rank = 1 to the rank = 8 , and a method of mapping to a demodulation reference signal port in retransmission , so that the methods of mapping to a demodulation reference signal port can be compatible with an existing system while keeping a lower demodulation reference signal overhead . furthermore the foregoing method proposed according to the embodiment of the invention makes minor modification to an existing system without any influence upon continual evolvement of the system and can be simple and efficient to implement . as illustrated in fig1 , an embodiment of the invention further discloses a base station 10 including a transceiver module 110 and a mapping module 120 . particularly the transceiver module 110 is configured to assign a ue with a corresponding data stream dependent upon an attribute of the ue . the mapping module 120 is configured to map the corresponding data stream from a layer to a corresponding demodulation reference signal port . specifically for downlink transmission at the rank = 1 , the mapping module 120 mapping the corresponding data stream from a layer to a corresponding demodulation reference signal port includes : the corresponding data stream can be mapped onto any port and occupy any cdm group . as illustrated in fig5 , for example , assumed mu - mimo transmission can be supported with m orthogonal dmrs ports in the lte - a and then a data layer can be mapped onto any port in { 0 , . . . , m } and occupy any cdm group regardless of retransmission or initial transmission . fig5 illustrates a layer - to - port mapping scheme with m = 4 . for downlink transmission at the rank = 2 , the mapping module 120 mapping the corresponding data stream from a layer to a corresponding demodulation reference signal port includes : when downlink transmission is double - codeword transmission at the rank = 2 , dmrs ports to which two layers correspond belong to the same cdm group . for retransmission of a codeword corresponding to the two layers , it is retransmitted in single - codeword transmission , and the ports occupied for the two layers in retransmission belong to the same cdm group . as illustrated in fig6 , for example , in double - codeword transmission at the rank = 2 , dmrs ports to which two layers correspond shall belong to the same cdm group from the perspective of saving an overhead and improving the reliability of data transmission . a specific group to be occupied is indicated from the enb side as a result of a scheduling decision . if double - codeword transmission at the ranks = 3 - 5 were adopted in previous transmission , where a codeword mapped to the layer 2 will be retransmitted and a transport block corresponding to the other codeword will not be retransmitted , then single - codeword transmission will be adopted in this case . dbms ports to which the two layers correspond shall belong to the same cdm group . a specific group to be occupied is indicated from the enb side as a result of a scheduling decision . an occupancy condition of ports in retransmission may be inconsistent with that in initial transmission . following this mapping relationship , a dmrs overhead is kept at 12 pairs of res / prbs , and this mapping scheme is compatible with the rel - 9 to facilitate joint scheduling . fig6 illustrates an example of a layer - to - port mapping relationship in transmission at the rank = 2 . for downlink transmission at the rank = 3 or the rank = 4 , the mapping module 120 mapping the corresponding data stream from a layer to a corresponding demodulation reference signal port includes : when downlink transmission is double - codeword transmission , a layer to which a codeword 1 corresponds is mapped to a first demodulation reference signal cdm group , and a layer to which a codeword 2 corresponds is mapped to a second demodulation reference signal cdm group . when downlink transmission is single - codeword transmission , layer - to - demodulation reference signal port mapping is kept consistent with double - codeword transmission . when downlink transmission is double - codeword transmission at the rank = 3 , if one of the codewords has an error occurring therewith and will be retransmitted and the other codeword has no new data to be transmitted , then a mapping relationship between the layer to which the retransmitted codeword corresponds and the occupied port thereof is defined as that at the rank = 1 or the rank = 2 . a specific example thereof is as illustrated in fig7 . when downlink transmission is double - codeword transmission at the rank = 4 , if one of the codewords has an error occurring therewith and will be retransmitted and the other codeword has no new data to be transmitted , then a mapping relationship between the layer to which the retransmitted codeword corresponds and the occupied port thereof is defined as that at the rank = 2 . a specific example thereof is as illustrated in fig8 . for downlink transmission at the rank = 5 , 6 , 7 or 8 , downlink transmission is double - codeword transmission . for downlink transmission at the rank = 5 , the mapping module 120 mapping the corresponding data stream from a layer to a corresponding demodulation reference signal port includes : a layer to which a codeword 1 corresponds is mapped to a first demodulation reference signal cdm group , and a layer to which a codeword 2 corresponds is mapped to a second demodulation reference signal cdm group . when downlink transmission is double - codeword transmission at the rank = 5 , if one of the codewords has an error occurring therewith and will be retransmitted and the other codeword has no new data to be transmitted , then a mapping relationship between the layer to which the retransmitted codeword corresponds and the occupied port thereof is defined as that at the rank = 2 or the rank = 3 . a specific example thereof is as illustrated in fig9 . for downlink transmission at the rank = 6 , the mapping module 120 mapping the corresponding data stream from a layer to a corresponding demodulation reference signal port includes : a layer to which a codeword 1 corresponds is mapped to a first demodulation reference signal cdm group , and a layer to which a codeword 2 corresponds is mapped to a second demodulation reference signal cdm group . when downlink transmission is double - codeword transmission at the rank = 6 , if one of the codewords has an error occurring therewith and will be retransmitted and the other codeword has no new data to be transmitted , then a mapping relationship between the layer to which the retransmitted codeword corresponds and the occupied port thereof is defined as that at the rank = 3 . a specific example thereof is as illustrated in fig1 . for downlink transmission at the rank = 7 , the mapping module 120 mapping the corresponding data stream from a layer to a corresponding demodulation reference signal port includes : a layer to which a codeword 1 corresponds is mapped to a first demodulation reference signal cdm group , and a layer to which a codeword 2 corresponds is mapped to a second demodulation reference signal cdm group . when downlink transmission is double - codeword transmission at the rank = 7 , if one of the codewords has an error occurring therewith and will be retransmitted and the other codeword has no new data to be transmitted , then a mapping relationship between the layer to which the retransmitted codeword corresponds and the occupied port thereof is defined as that at the rank = 3 or the rank = 4 . a specific example thereof is as illustrated in fig1 . for downlink transmission at the rank = 8 , the mapping module 120 mapping the corresponding data stream from a layer to a corresponding demodulation reference signal port includes : a layer to which a codeword 1 corresponds is mapped to a first demodulation reference signal cdm group , and a layer to which a codeword 2 corresponds is mapped to a second demodulation reference signal cdm group . when downlink transmission is double - codeword transmission at the rank = 8 , if one of the codewords has an error occurring therewith and will be retransmitted and the other codeword has no new data to be transmitted , then a mapping relationship between the layer to which the retransmitted codeword corresponds and the occupied port thereof is defined as that at the rank = 4 . a specific example thereof is as illustrated in fig1 . thereafter the transceiver module 110 is further configured to transmit the corresponding data stream to the ue via the demodulation reference signal port determined by the mapping module 120 . the foregoing apparatus proposed according to the embodiment of the invention defines an apparatus for mapping to a demodulation reference signal port at the rank = 1 to the rank = 8 , and an apparatus for mapping to a demodulation reference signal port in retransmission , so that the apparatus for mapping to a demodulation reference signal port can be compatible with an existing system while keeping a lower demodulation reference signal overhead . furthermore the foregoing apparatus proposed according to the embodiment of the invention makes minor modification to an existing system without any influence upon continual evolvement of the system and can be simple and efficient to implement . those ordinarily skilled in the art can appreciate that a part or all of the steps in the method according to the embodiment described above can be perform in a program instructing relevant hardware , which can be stored in a computer readable storage medium and which upon execution includes one or a combination of the steps in the method embodiment . furthermore the respective functional units in the respective embodiments of the invention can be integrated in a processing module or the respective units can physically exist separately or two or more of the units can be integrated in a module . the integrated module can be embodied in the form of hardware or in the form of a software functional module . the integrated module can also be stored in a computer readable storage medium if it is embodied in the form of a software functional module and sold or used as a standalone product . the storage medium mentioned above can be a read only memory , a magnetic disk , an optical disk , etc . the foregoing description is illustrative of the preferred embodiments of the invention , and it shall be noted that those ordinarily skilled in the art can further make several adaptations and modifications without departing from the principal of the invention and these adaptations and modifications shall also be construed as falling into the scope of the invention . | 7 |
in the embodiment shown in fig1 , the secondary cone 6 is placed , according to the installation of the cone ring transmission , above the primary cone 4 . the gear arrangement possesses an auxiliary gear train 10 which is placed on the shaft 7 of the secondary cone 6 , whereby the auxiliary gear train 10 is in connection through a sprocket 12 and a chain 13 with a sprocket 11 on the shaft 5 of the primary cone 4 . this is an arrangement in which shifting into reverse is possible . further , on the shaft 7 of the secondary cone 6 is located a gear 14 , which , coacting with a gear 15 , engages the differential 9 . the start - up element 2 , in accord with fig1 , is a dry clutch , which is provided with a torsion damper . in the case of the embodiment as shown in fig2 , the secondary cone 6 , in accord with the installation of the cone ring transmission in the motor vehicle , is placed above the primary cone 4 and the adjustment ring 8 encircles the secondary cone 6 . the gear arrangement includes a planetary gear set 3 , which is placed on the shaft 7 of the secondary cone 6 and is provided with an arrangement 22 for the reversal of the direction of rotation . advantageously , for effecting the reversal of direction , an element of the planetary gear set 3 is affixed to the housing . in this situation , the sun gear of the planetary gear set 3 is mounted to be rotatably affixed to the shaft 7 . the planetary cage is connected to a gear 14 , which engages itself with the gear 15 of the differential 9 . the start - up element 2 is a dry clutch , which is provided with a torsion damper . the transmission in fig3 , differentiates itself from the transmission depicted in fig2 , in that the adjustment ring 8 encircles the primary cone 4 . the transmission in fig3 , differentiates itself from the transmission depicted in fig2 , in that the adjustment ring 8 encircles the secondary cone 6 . in the case of the embodiment shown in fig4 , the secondary cone 6 , in accord with the installation of the cone ring transmission in the motor vehicle , is placed above the primary cone 4 , whereby the adjustment ring 8 circumferentially encompasses the secondary cone 6 . an auxiliary gear train 10 is again provided and is placed on the shaft 7 of the secondary cone 6 . in this case , for forward travel , the auxiliary gear train 10 stands in engagement with a first gear 14 which meshes with a gear 15 of the differential 9 . for reverse travel , the auxiliary gear train 10 , which is driven by means of a shaft in gear 23 , engages itself with the gear 15 of the differential 9 . in this embodiment the start - up element 2 ′ is a wet disk clutch , which is provided with a torsion damper and connected with an electromechanical activation . the transmission illustrated in fig5 , differentiates itself from the transmission of fig4 , in that the axis a which penetrates the center point of the circle formed by the adjustment ring 8 , and which axis is perpendicular to the plane defined by the adjustment ring 8 , runs at an angle α to the axis of the shaft 7 of the cone 6 . in fig6 we are shown a transmission , wherein the secondary cone 6 , in accord with the installation in the motor vehicle , is above the primary cone 4 and offset to one side thereof , whereby the adjustment ring 8 circumferentially encircles the secondary cone 6 . in addition , the gearing has a gear 16 , which is rotatably affixed to the shaft 7 of the secondary cone 6 . the gear 16 further engages itself with an element of the planetary gear set 3 , preferably with the cage , advantageously by means of a gear 19 . an additional element of the planetary gear set 3 , advantageously the sun gear , is rotatably affixed with the shaft of the differential 9 . a reverse of the direction of rotation is accomplished advantageously by the optional coupling of an element of the planetary gear set to the housing . in accord with the invention , the adjustment ring 8 , can circumferentially encompass the primary cone instead of the secondary cone . this configuration is the object of fig7 . in the embodiment shown in fig8 , the secondary cone 6 , in accord with the installation of the cone ring transmission in the motor vehicle , is advantageously placed above the primary cone 4 and laterally offset therefrom , whereby the adjustment ring 8 circumferentially encompasses the secondary cone 6 and the axis a which penetrates the center point of the circle formed by the adjustment ring 8 , and which axis is perpendicular to the plane established by the adjustment ring 8 , runs at an angle α to the axis of the shaft 7 of the cone 6 . the arrangement of the gearing includes a planetary gear set 3 , the sun gear of which is rotatably affixed to the shaft 7 of the secondary cone 6 . on the power take - off side , advantageously , the cage of the planetary gear set 3 is connected with a gear rotatably affixed also to the shaft 7 , which engages with a gear 15 of the differential 9 . for the start - up element 2 , a dry clutch is provided , which is advantageously provided with a torsion damper . the embodiment shown in fig9 differentiates itself from the operational method of fig8 , in that , as a start - up element 2 ′, a wet disk clutch is provided . in fig1 , an invented transmission is shown , wherein the secondary cone 6 , in accord with the installation of the cone ring transmission in the motor vehicle , is to be found above the primary cone 4 and laterally offset therefrom . in this case , the adjustment ring 8 circumferentially encompasses the secondary cone 6 . the gear arrangement of this embodiment has an auxiliary gear train 10 , which is placed on the shaft 7 of the secondary cone 6 . in this case , for a forward speed shift , a first gear 14 of the auxiliary gear train 10 engages itself with the first gear 15 of the differential 9 . to achieve a reverse shift , a sprocket 20 of the auxiliary gear train 10 connects through a chain 13 with a sprocket 21 of the differential 9 . as a start - up element 2 ′, a wet disk clutch is provided , which is advantageously provided with a torsion damper and with an electromechanical activation . in fig1 is shown an embodiment example , wherein the secondary cone 6 , in accord with the installation of the cone ring transmission in the motor vehicle , is placed advantageously above and laterally offset from the primary cone 4 , whereby the adjustment ring 8 circumferentially encompasses the secondary cone 6 and for the transmission of the torque to the differential , a chain drive is provided . in this case , on the shaft 7 of the secondary cone 6 , a sprocket 16 is placed , which , by means of a chain 13 stands in communication with a sprocket 17 of an auxiliary gear train 10 . for forward movement , auxiliary gear train 10 connects , through a gear 14 with a gear 15 of the differential 9 , while for reverse motion , a gear 19 meshes with a gear 23 , which is driven by means of a gear 21 which engages the gear 15 of the differential . in the transmission as illustrated in fig1 , the secondary cone 6 , in accord with the installation of the cone ring transmission in the motor vehicle , is placed advantageously above the primary cone 4 and is laterally offset therefrom wherein the adjustment ring 8 circumferentially encompasses the secondary cone 6 . for the transmission of the torque to the differential , a sprocket 16 is provided , which is placed on the shaft 7 of the secondary cone 6 , and which connects with a sprocket 17 by means of a chain 13 . the sprocket 17 is rotatably affixed to the sun gear of a planetary gear set 3 . the planetary gear set 3 is provided with a change of direction means 22 for reversing the direction of rotation , wherein , for the reversal of direction , advantageously the internal gear can be coupled to the housing . further , the planetary gear set 3 , on the power out - take side is connected with a gear 14 , which is engaged with the gear 15 of the differential 9 . as a start - up element 2 , a dry clutch is provided , which is provided with a torsion damper . in the embodiment depicted in fig1 , it is possible that the secondary cone 6 , in accord with the installation in the motor vehicle , is placed underneath the primary cone 4 and is laterally offset therefrom , whereby the difference to the presentation in fig1 can be found in that , the adjustment ring 8 circumferentially encompasses the primary cone 4 . in the case of all illustrated examples of embodiments , which possess a planetary gear set , this can be designed as a plus or minus gear set . obviously , any designed construction , especially any spatial arrangement of the components themselves as well as to one another and to the extent the construction is advantageous , falls under the protection of the present claims , without influence on the function of the transmission , as this is given in the claims , even when these designs are not explicitly presented in the figures nor in the description . also , the invention is not limited to cones , but additional , rotationally symmetric bodies may be provided . | 1 |
the acid is preferably lactic acid , acetic acid or hydrochloric acid , and the alkali is preferably sodium hydroxide or potassium hydroxide . the concentration of quinolinecarboxylic acid derivative in the solution to be refrigerated may be within a range from 0 . 1 to 30 w / v %, preferably from 5 to 15 w / v %. if the concentration is less than 0 . 1 w / v %, the volume of the solution becomes too large and a large vessel or a large injector will be required , which is inconvenient . on the other hand , if the concentration is higher than 30 w / v %, freeze - drying becomes difficult since the solution cannot be frozen easily by refrigeration . the solution may be sterilized by filtration through a membrane filter ( pore size 0 . 22 μm ) and then be filled into vials . the solution in the vials is cooled to below - 40 ° c . as a general procedure , the vials are directly cooled by contacting with a refrigerant so as to obtain a rapid cooling . the cooling condition can be selected according to the ability of refrigerant and / or refrigerator , but no limitation is needed with respect to the cooling condition . whatever condition to refrigerate the solution to below - 40 ° c . is applicable . the freeze - drying can be performed according to conventional procedures and conditions under a vacuum using vacuum pump and mild elevation of temperature . as for the freeze - drying method , the conventional heat shock method or a method characterized by adding a solvent can also be used . after drying is completed , the vials are sealed , for example , with rubber stopper . medically usable adjuvants may be added to the freeze - dried pharmaceutical preparations of the present invention , such as excipients , adjuvants to provide isotonicity , ph adjusters , stabilizers , solubilizers , buffering agents and preservatives . the excipients or adjuvants providing isotonicity may be xylitol , d - sorbitol , d - mannitol , fructose , glucose , sucrose , lactose , gelatin , and the like . the ph adjuster may also be lactic acid , acetic acid , hydrochloric acid , sodium hydroxide or potassium hydroxide . the following examples illustrate the present invention , but are not intended to limit its scope . in the following examples , the quinolinecarboxylic acid derivatives used are 6 , 8 - difluoro - 1 -( 2 - fluoroethyl )- 1 , 4 - dihydro - 7 -( 4 - methyl - 1 - piperazinyl )- 4 - oxo - 3 - quinolinecarboxylic acid ( hereinafter referred to as am - 833 ), 1 - ethyl - 6 - fluoro - 1 , 4 - dihydro - 4 - oxo - 7 -( 1 - piperazinyl )- 3 - quinolinecarboxylic acid ( hereinafter referred to as nflx ), 9 - fluoro - 2 , 3 - dihydro - 3 - methyl - 10 -( 4 - methyl - 1 - piperazinyl )- 7 - oxo - 7h - pyrido [ 1 , 2 , 3de ][ 1 , 4 ]- benzoxazine - 6 - carboxylic acid ( hereinafter referred to as oflx ), 1 - cyclopropyl - 6 - fluoro - 1 , 4 - dihydro - 4 - oxo - 7 -( 1 - piperazinyl )- 3 - quinolinecarboxylic acid ( hereinafter referred to as cpfx ), 1 - ethyl - 6 - fluoro - 1 , 4 - dihydro - 4 - oxo - 7 -( 1 - piperazinyl )- 1 , 8 - naphthyridine - 3 - carboxylic acid ( hereinafter referred to as enx ), 7 -( 3 - amino - 1 - pyrrolidinyl )- 8 - chloro - 1 - cyclopropyl - 6 - fluoro - 1 , 4 - dihydro - 4 - oxo - 3 - quinolinecarboxylic acid ( hereinafter referred to as am - 1091 ), 1 - ethyl - 6 , 8 - difluoro - 1 , 4 - dihydro - 7 -( 3 - methyl - 1 - piperazinyl )- 4 - oxo - 3 - quinolinecarboxylic acid ( hereinafter referred to as ny - 198 ), 7 -( 3 - amino - 1 - pyrrolidinyl )- 1 -( 2 , 4 - difluorophenyl )- 6 - fluoro - 1 , 4 - dihydro - 4 - oxo - 1 , 8 - naphthyridine - 3 - carboxylic acid p - toluene - sulfonic acid hydrate ( hereinafter referred to as t - 3262 ). ten grams of powdered am - 833 were dissolved in 50 ml of 1m lactic acid , the ph was adjusted to 4 . 5 with 1n sodium hydroxide solution , and diluted with distilled water for injection to 100 ml . this solution was filtered through a membrane filter ( pore size 0 . 22 μm ) and each 2 ml of the filtrate was filled into clean and sterilized vials . these vials were cooled to - 42 ° c ., and dried under vacuum . the temperature of the shelf was kept at - 20 ° c . during the initial stage ( up to 22 hours ) of drying . under vacuum , the temperature was elevated to 20 ° c . and kept for 24 hours , and it was further elevated to 40 ° c . and kept for 6 hours to give a freeze - dried pharmaceutical preparation containing am - 833 . fifteen grams of powdered am - 833 were dissolved in 75 ml of 1m lactic acid , the ph was adjusted to 4 . 0 with 1n sodium hydroxide solution , and diluted with distilled water for injection to 100 ml . this solution was filtered through a membrane filter ( pore size 0 . 22 μm ), and each 1 . 33 ml of the filtrate was filled into clean and sterilized vials . these vials were cooled to - 40 ° c . and dried under vacuum in a manner similar to that of example 1 to give a freeze - dried pharmaceutical preparation containing am - 833 . ten grams of powdered am - 833 and 10 grams of glucose were dissolved in 50 ml of 1m lactic acid , the ph was adjusted to 4 . 5 with 1n sodium hydroxide solution , and diluted with distilled water for injection to 100 ml . this solution was filtered through a membrane filter ( pore size 0 . 22 μm ), and each 2 ml of the filtrate was filled into clean and sterilized vials . these vials were cooled to - 40 ° c . the temperature was elevated to - 10 ° c ., and kept for 5 hours . then , it was lowered again to - 40 ° c . and dried under vacuum . the temperature of the vials was kept at - 20 ° c . during the initial stage ( up to 66 hours ) of drying . under vacuum , the temperature was elevated to 20 ° c . and kept for 5 hours to give a freeze - dried pharmaceutical preparation containing am - 833 . ten grams of powdered am - 833 were dissolved in 55 ml of 1n sodium hydroxide solution , and the ph was adjusted to 10 . 1 with 1m lactic acid , and diluted with distilled water for injection to 100 ml . this solution was filtered through a membrane filter ( pore size 0 . 22 μm ), and each 2 ml of the filtrate was filled into clean and sterilized vials . these vials were cooled to - 44 ° c . and dried under vacuum . the temperature of the vials was kept at - 20 ° c . during the initial stage ( up to 22 hours ) of drying . under vacuum , the temperature was elevated to 20 ° c . and kept for 26 hours , and it was further elevated to 40 ° c . and kept for 20 hours to give a freeze - dried pharmaceutical preparation containing am - 833 . five grams of powdered nflx were dissolved in 50 ml of 1m lactic acid , and diluted with distilled water for injection to 100 ml . this solution was filtered through a membrane filter ( pore size 0 . 22 μm ), and each 2 ml of the filtrate was filled into clean and sterilized vials . these vials were cooled to - 40 ° c . and dried under vacuum in a manner similar to that of example 1 to give a freeze - dried pharmaceutical preparation containing nflx . five grams of powdered nflx were dissolved in 15 ml of 1n hydrochloric acid solution , and the ph was adjusted to 4 . 6 with 1m sodium hydroxide solution , and diluted with distilled water for injection to 100 ml . this solution was filtered through a membrane filter ( pore size 0 . 22 μm ), and each 2 ml of the filtrate was filled into clean and sterilized vials . these vials were cooled to - 40 ° c . and dried under vacuum in a similar manner as example 1 to give a freeze - dried pharmaceutical preparation containing nflx . five grams of powdered nflx and 10 grams of glucose were dissolved in 15 ml of 1n hydrochloric acid solution and the ph was adjusted to 5 . 5 with 1n sodium hydroxide solution , and diluted with distilled water for injection to 100 ml . this solution was filtered through a membrane filter ( pore size 0 . 22 μm ), and each 2 ml of the filtrate was filled into clean and sterilized vials . these vials were cooled to - 40 ° c . and dried under vacuum in a manner similar to that of example 1 to give a freeze - dried pharmaceutical preparation containing nflx . five grams of powdered oflx were dissolved in 25 ml of 1m lactic acid and diluted with distilled water for injection to 100 ml . this solution was filtered through a membrane filter ( pore size 0 . 22 μm ), and each 2 ml of the filtrate was filled into clean and sterilized vials . these vials were cooled to - 40 ° c . and dried under vacuum in a manner similar to that of example 1 to give a freeze - dried pharmaceutical preparation containing oflx . five grams of cpfx were dissolved in 15 ml of 1n sodium hydroxide solution , and diluted with distilled water for injection to 100 ml . this solution was filtered through a membrane filter ( pore size 0 . 22 μm ), and each 2 ml of the filtrate was filled into clean and sterilized vials . these vials were cooled to - 42 ° c . the temperature was elevated to - 10 ° c ., and kept for 2 hours . then , it was cooled again to - 40 ° c . and dried under vacuum . the temperature of the vials was kept at - 20 ° c . during the initial stage ( up to 21 hours ) of drying . subsequently , the temperature was elevated to 20 ° c . and kept for 65 hours under vacuum to give a freeze - dried pharmaceutical preparation containing cpfx . five grams of powdered cpfx were dissolved in 45 ml of 1n acetic acid solution , and diluted with a water for injection to 100 ml . this solution was filtered through a membrane filter ( pore size 0 . 22 μm ), and each 2 ml of the filtrate was filled into clean and sterilized vials . these vials were refrigerated by cooling to - 42 ° c . and dried under vacuum in a manner similar to that of example 9 to give a freeze - dried pharmaceutical preparation containing cpfx . five grams of powdered cpfx were dissolved in distilled water for injection and dissolved in 100 ml of distilled water . this solution was filtered through a membrane filter ( pore size 0 . 22 μm ), and each 2 ml of the filtrate was filled into clean and sterilized vials . these vials were cooled to - 40 ° c . and dried under vacuum in a manner similar to that of example 1 to give a freeze - dried pharmaceutical preparation containing cpfx . five grams of powdered enx were dissolved in 25 ml of 1m lactic acid , the ph was adjusted to 4 . 5 with 1n sodium hydroxide solution , and diluted with distilled water for injection to 100 ml . this solution was filtered through a membrane filter ( pore size 0 . 22 μm ), and each 2 ml of the filtrate was filled into clean and sterilized vials . these vials were refrigerated by cooling to - 40 ° c . and dried under vacuum in a manner similar to that of example 1 to give a freeze - dried pharmaceutical preparation containing enx . five grams of powdered am - 1091 were dissolved in distilled water for injection and diluted up to 100 ml with the distilled water . this solution was filtered through a membrane filter ( pore size 0 . 22 μm ), and each 2 ml of the filtrate was filled into clean and sterilized vials . these vials were cooled to - 40 ° c . and dried under vacuum . the temperature of the vials was kept at - 20 ° c . during the initial stage ( up to 5 hours ) of drying . subsequently , the temperature was elevated to 20 ° c . and kept for 63 hours for drying under vacuum to give a freeze - dried pharmaceutical preparation containing am - 1091 . five grams of powdered am - 1091 were dissolved in 25 ml of 1n sodium hydroxide solution , and diluted with distilled water for injection to 100 ml . this solution was filtered through a membrane filter ( pore size 0 . 22 μm ), and each 2 ml of the filtrate was filled into clean and sterilized vials . these vials were cooled to - 40 ° c . the temperature was elevated to - 10 ° c ., and kept for 5 hours . then , it was lowered again to - 40 ° c . and dried under vacuum . the temperature of the vials was kept at - 20 ° c . during the initial stage ( up to 6 hours ) of drying . subsequently , the temperature was elevated to 20 ° c . and kept for 21 hours for drying under vacuum to give a freeze - dried pharmaceutical preparation containing am - 1091 . one gram of powdered ny - 198 was dissolved in 20 ml of acetic acid and diluted with distilled water for injection to 50 ml . this solution was filtered through a membrane filter ( pore size 0 . 22 μm ), and each 2 ml of the filtrate was filled into clean and sterilized vials . these vials were cooled to - 40 ° c . and dried under vacuum in a manner similar to that of example 14 to give a freeze - dried pharmaceutical preparation containing ny - 198 . one gram of powdered t - 3262 was dissolved in 20 ml of 1m lactic acid and diluted with distilled water for injection to 50 ml . this solution was filtered through a membrane filter ( pore size 0 . 22 μm ), and each 2 ml of the filtrate was filled into clean and sterilized vials . these vials were cooled to - 40 ° c . and dried under vacuum in a manner similar to that of example 1 to give a freeze - dried pharmaceutical preparation containing t - 3262 . the freeze - dried pharmaceutical preparations obtained were evaluated by a stability test , under light ( fluorescence lamp , 1 , 200 , 000 lux - hours ) and heat ( 50 ° c ., 3 months ) as compared with the solution prepared by using the same components . the results are shown in table 1 . these freeze - dried pharmaceutical preparations of the present invention have excellent properties , particularly with respect to stability as compared with those for the solutions . table 1______________________________________result of the stability tests of thefreeze - dried pharmaceutical preparationsof this invention and solutions lightexamples ( fluorescence lamp ) heat ( 50 ° c ., 3 months ) no . freeze - dried solution freeze - dried solution______________________________________ 1 no changes yellowish no changes yellowish 6 no changes slightly no changes no changes yellowish 8 no changes slightly no changes no changes yellowish12 no changes slightly no changes no changes yellowish13 no changes precipitate no changes no changes of light brown15 no changes slightly no changes no changes brown______________________________________ | 0 |
fig2 illustrates the known building roof structure r as generally described above , comprising a corrugated metal or other roof deck d supported on plurality of parallel , spaced - apart purlins p ( only first and second purlins p 1 , p 2 are shown in fig2 ). between each successive pair of purlins p , an open bay ba is defined , and the roof deck d spans the bays ba . according to the present development , in order to insulate the roof structure r , a vapor retarder facing or other facing f ( see fig2 b and 7 ) is secured to bottom face pf of the lower flange pl of multiple ( at least two ) parallel spaced - apart purlins p so that the facing f directly spans one or more bays ba , without being draped over the upper flanges pu of the purlins p . each bay ba is then at least partially filled with fiber glass or other insulation that is supported on the facing f . as described in further detail below , the facing f is initially fixedly secured to the bottom face pf of each purlin lower flange pl using adhesive ( for example , double - sided tape or other adhesive ) and , preferably , is thereafter more permanently secured using screws and / or other mechanical fasteners that connect to the purlins p . the facing f , itself , comprises a single layer or multiple layer product , e . g ., single - layer vinyl film / sheet or other film / sheet , or a laminated composite containing various combinations of aluminum foil , polymeric film / sheet , kraft paper , reinforcing yarns and fabrics . facings f vary in strength , color , light reflectivity , and their ability to retard moisture migration therethrough . as noted , the facing f can inhibit migration of moisture into the insulation ( if the facing f is constructed as a vapor retarder ) and improves aesthetics of the interior of the building . in some applications , the facing f is perforated or otherwise constructed to allow migration of moisture therethrough . regardless of the exact structure of the facing , the terms “ sheet ” or “ web ” as used herein are intended to refer to a length of the facing f having a width sufficient to span the bay ba so as to extend directly between the lower flanges pl of the purlins p 1 , p 2 . as shown in fig2 , according to the present development , the facing f is installed using a carriage c that is temporarily secured to / suspended from and moved along at least two of the purlins p 1 , p 2 , parallel to the longitudinal axes px thereof . the carriage c is adapted to carry one or more rolls rf ( fig2 a ) of the facing f and to dispense the facing for securement to the lower flanges pl at least two of the purlins p 1 , p 2 by tape or other adhesive . more particularly , the carriage c is adapted to be movably secured to the lower flanges pl and ride along same in a direction d 1 parallel with the axes px of the purlins p 1 , p 2 and to dispense the facing f from the roll rf as it moves along the purlins . as shown in fig2 a , the facing f includes double - sided tape or other first and second adhesive zones z 1 , z 2 respectively located at least adjacent its opposite first and second lateral sides that adhere to the bottom face pf of the purlin lower flange pl to secure the facing f to the purlins ( the adhesive zones z 1 , z 2 can be separate zones or can both be part of a larger single adhesive area ). alternatively , adhesive ( e . g ., double - sided tape or other adhesive ) can first be applied to the bottom face pf of the purlin lower flanges pl through a manual process or using the carriage c to define the first and second adhesive zones z 1 , z 2 . after the facing f is dispensed from the carriage c and adhered to the purlins p , optional screws , clips and / or other mechanical fasteners can be installed using conventional methods , e . g , screws installed through the facing into the lower flange pl , for strengthening the connection between the facing f and the purlins p . unlike known system such as that shown in fig1 , the facing f extends directly between the lower flanges pl , meaning that the facing f is not draped over the purlin upper flanges pu . the carriage c is adapted to be temporarily and movably engaged with first and second parallel spaced - apart purlins p ( p 1 , p 2 ), with a base b of the carriage c suspended beneath the purlins . as shown , the carriage c is movably engaged with successive purlins p 1 , p 2 , but the carriage can be sized to by movably engaged with any two ( or more ) parallel spaced apart purlins p . in the illustrated embodiment , the carriage c is adapted to be movably engaged with the lower flanges pl of the first and second purlins p 1 , p 2 and comprises first and second feet 12 a , 12 b adapted to be received on an inner / upper surface of the lower flanges pl . the feet 12 a , 12 b are adapted to slide , roll or otherwise movably engage the flanges pl for movement in a direction d 1 or opposite direction d 2 parallel to the longitudinal axes px of the purlins , and the feet 12 a , 12 b are preferably conformed and dimensioned to minimize movement transverse to the longitudinal axes px . as shown , the feet 12 a , 12 b are adapted to slide on the flanges pl , but the feet 12 a , 12 b can include rollers , wheels or other means for moving on the flanges pl . alternatively , the feet 12 a can movably engage any other part of the purlins p 1 , p 2 without departing from the overall scope and intent of the present development . the base b of the carriage c comprises first and second base portions b 1 , b 2 connected to each other by one or more cross - members xb . the cross - members are selectively adjustable in length to allow the spacing between the first and second base portions b 1 , b 2 to be adjusted and fixed as desired so that the carriage c can be sized to engage first and second purlins p 1 , p 2 laterally spaced from each other at various distances , such as 5 feet or more or less . the adjustable - length cross - members xb are important because purlin spacing will vary from building to building or even within the same roof structure r . in one example , the cross - members xb are telescoping poles that include a lock that allows the poles to be fixed at a desired length . the first and second base portions b 1 , b 2 are adapted to be located generally beneath and in lateral alignment with the lower flanges pl of the first and second purlins p 1 , p 2 , respectively . the first base portion b 1 is connected to the first foot 12 a via one or more first struts 16 a , and the second base portion b 2 is connected to the second foot 12 b via one or more second struts 16 b . in one embodiment , the carriage c is constructed from steel alloy or other metal components welded or otherwise connected together ( e . g ., metal stampings or extrusions or other structures ), or can be constructed from metal wire and / or polymeric components , as a one - piece or multi - piece structure , and the illustrated structure for the carriage c is only one example not intended to limit the present development in any way . the feet 12 a , 12 b can be defined from a durable polymeric material with a low coefficient of friction and / or can include wheels or the like . the first and second base portions b 1 , b 2 are shown separately in fig3 and 4 , with views taken at 3 - 3 and 4 - 4 of fig2 , respectively . as seen in fig4 , the feet 12 a , 12 b are preferably conformed and dimensioned to fit closely between the vertical web pw of the purlin and the upturned lip fl to minimize lateral movement of the feet 12 a , 12 b transverse to the longitudinal axis px of the purlin p . the base b includes a roll support device or other roll support means for supporting a roll rf of the facing f and for dispensing facing from the roll rf . in the illustrated embodiment of fig2 - 5 , the bases b 1 , b 2 comprise respective roll support device 20 comprising a roll support block 22 connected to a shaft 24 . the shaft 24 is slidably connected to the respective base portion b 1 , b 2 . the roll support block 22 is adapted for vertical movement relative to its respective base b 1 , b 2 between an extended position ( closer to the purlin lower flange pl ) and a retracted position ( spaced farther away from the purlin lower flange pl ). means are provided for biasing each roll support block 22 to its extended position . in the illustrated embodiment , the above is accomplished connecting each shaft 24 slidably to its respective base b 1 , b 2 and by including a coil spring 26 that is coaxially located about each shaft 24 and operatively engaged between its respective base b 1 , b 2 and the support block 22 and / or shaft 24 . as shown in fig2 a , in one example , each facing roll rf can include first and second spindles 28 removably inserted in its opposite ends or otherwise projecting from its opposite ends such as , e . g ., the spindles 28 being connected to or defined by the opposite ends a shaft or core that extends through the roll rf . the roll support blocks 22 each include a slot 22 s ( fig5 ) or other structure for receiving and rotatably supporting one of the spindles 28 so that the roll rf extends between the roll support blocks 22 of the bases b 1 , b 2 and is rotatably supported for dispensing the facing f from the roll rf onto the purlin lower flange pl . the roll support devices 20 bias the roll rf upward as indicated by arrow a 1 into operative engagement with the bottom face pf of the purlin lower flanges pl such that when the carriage c is moved relative to the purlins p 1 , p 2 in the direction d 1 , the first and second adhesive zones z 1 , z 2 of the roll rf adhere the facing f to the purlin lower flanges pl as the facing f is dispensed from the roll . in an alternative embodiment , the roll rf , itself , is not biased into contact with the purlins p . instead , one or more idler rollers or blades , or other means are used to press the facing f into contact with the purlin flanges pl after the facing is unwound from the roll rf . it should be noted that adjacent bays ba of a roof structure r will be faced in a successive manner , by engaging the carriage c with each adjacent successive bay ba after facing a previous bay , i . e ., after a bay ba is faced , the carriage c is moved to and engaged with the next bay ba . also , those of ordinary skill in the art will recognize that the installed facing f of a previous bay ba will require that the bays ba be faced in a specified order / direction to allow unobstructed access to the purlin lower flanges pl for the carriage feet 12 a , 12 b to be seated thereon ( the bays ba will be faced staring with the most upstream bay and moving downstream from bay - to - bay in the direction that the flanges pl extend from the vertical web pw of the purlins p ). furthermore , the facing f will typically overlap on the purlin lower flange pl and define a seam between successive adjacent bays ba . this overlapped seam is highly desired when the facing f is a vapor retarder facing and the facing is sealed by an adhesive such as tape or otherwise continuously sealed along the overlapped seam so that a continuous vapor barrier / vapor retarder liner is formed by the successive overlapped strips of facing f . as used herein , the facing f is deemed to be adhered or otherwise connected to a purlin lower flange pl if the facing f is directly in contact with the purlin lower flange pl and / or if an intervening layer of tape or another layer of adhesive or facing f or other material is located between the facing f and the purlin lower flange pl . thus , the facing f is deemed to be adhered to the purlin lower flange pl when adhered directly to the purlin lower flange pl and / or if the facing f is connected to and overlapped with another piece of facing f that is connected directly or indirectly to the purlin lower flange pl . fig6 shows an alternative carriage embodiment c ′ that is identical to the carriage c , except that the first and second bases b 1 , b 2 of the carriage c ′ each include first and second roll support devices 20 a , 20 b each defined as described above for the roll support devices 20 . with the carriage c ′, the facing f must be dispensed from the roll rf behind the struts 16 a , 16 b in terms of the carriage movement direction so as not to obstruct movement of the feet 12 a , 12 b on the purlin flanges pl . as such , the respective first roll support devices 20 a are adapted to support and dispense a roll of facing rf when the carriage is moving in direction d 1 , and the respective second roll support devices 20 b are adapted to support and dispense a roll of facing rf when the carriage c is moving in the opposite direction d 2 . in one alternative embodiment , the second roll support devices 20 b are each separately adapted to support and dispense double - sided tape from respective separate , individual rolls onto the bottom faces pf of the lower flanges pl of the purlins p 1 , p 2 , with the first roll support devices 20 a dispensing facing f from a roll rf to be adhered to the purlin lower flanges pl via the tape dispensed from the device 20 b when the carriage c is moving in direction d 1 ( if the carriage is moving in direction d 2 , the first roll support devices 20 a are each separately adapted to support and dispense double - sided tape from respective separate , individual rolls onto the lower flanges pl of the purlins p 1 , p 2 , with the second roll support devices 20 b dispensing facing f from a roll rf ). as an alternative to double - sided tape , the first roll support devices 20 a ( for moving in direction d 2 ) or second roll support devices 20 b ( for moving in direction d 1 ) can be replaced by or used to support devices for dispensing a spray or bead or other layer or deposit of liquid or other adhesive onto the respective lower flanges pl of the first and second purlins p 1 , p 2 , after which facing f is adhered to the lower flanges pl as dispensed from a roll rf supported by the first roll support devices 20 a ( for moving in direction d 1 ) or second roll support devices 20 b ( for moving in the direction d 2 ). it is not intended that the carriage c , c ′ and / or roll support devices 20 ( 20 a , 20 b ) be limited to the embodiments shown . also , the roll rf of facing f can include a core or be coreless , and can include the spindles 28 or not , and can include a central shaft extending therethrough or not , and the structure of the roll support devices 20 will vary accordingly in order to rotatably support the roll rf for dispensing facing f therefrom to be adhered to the purlin lower flanges pl in response to movement of the carriage c along the purlins p 1 , p 2 in the direction d 1 or d 2 . fig7 - 10 disclose another alternative carriage 2 c for implementing the system and method of the present development . like components relative to the carriage c are identified with like reference numbers / letters . the base b comprises first and second base portions b 1 , b 2 interconnected by adjustable - length cross - members xb . a first foot 12 a is connected to the first base portion b 1 by a first strut 16 a , and a second foot 12 b is connected to the second base portion b 2 by a second strut 16 b . the first and second feet 12 a , 12 b are adapted to be slidably supported on and engaged with the lower flanges fl of the first and second purlins p 1 , p 2 , respectively , for movably supporting the carriage 2 c for movement in the first direction d 1 . the first and second feet are pivotally connected to the respective struts 16 a , 16 b by respective pivoting connections v ( see fig1 ). the base b is adapted to rotatably support a roll of facing rf for dispensing facing f from the roll for adhesive securement to the bottom surface pf of the purlin lower flanges pl . as shown , the roll rf is supported by use of spindles 28 in its ends , with the spindles 28 secured to the respective base portions b 1 , b 2 . alternatively , a rod or the like can extend between the base portions b 1 , b 2 and the roll rf is rotatably carried on the rod . fig7 shows the base b in a free state , where the roll rf is not operably engaged with the purlins p 1 , p 2 . in use , as shown in fig8 - 10 , a user grasps the outermost cross - bar xb ( farthest from facing roll rf ) as a handle and pulls downward away from the purlins p 1 , p 2 to pivot the base b such that the roll rf is moved upward into contact with the bottom faces pf of the lower flanges pl , while the user simultaneously pulls the carriage in the direction d 1 to dispense the facing f from the roll rf as described above . the facing includes first and second adhesive zones z 1 , z 2 ( fig7 ) that adhere the facing f to the purlins p 1 , p 2 as the carriage is moved in the direction d 1 . as noted above , the facing is thereafter more permanently secured using screws or other fasteners that engage the purlin lower flange pl . for the carriage 2 c and all other embodiments disclosed herein , after the carriage is operably suspended from the purlins p 1 , p 2 , the user can start the facing operation by pulling some facing from the roll rf and adhering same to the bottom face pf of the lower flanges pl . fig9 a shows the carriage 2 c with the adjustable - length cross - members xb extended in order for the base b to accommodate a roll of facing rf 1 having a width w 1 for a first purlin spacing distance . fig9 b shows the carriage 2 c with the adjustable - length cross - members xb retracted in order for the base b to accommodate a roll of facing rf 2 having a width w 2 for a second purlin spacing distance . fig1 shows an alternative carriage 2 c ′ in which the roll support devices 20 of the carriage c are replaced by a roll support device 200 that comprises a frame 202 pivotally connected to the first and second base portions b 1 , b 2 at pivot points v 1 , v 2 . the frame 202 includes at least one and preferably first and second roll supports 204 ( 204 a , 204 b as shown ) on which a roll rf of facing f is rotatably supported for dispensing onto the purlin lower flanges pl as described above . as shown , the first and second roll supports 204 a , 204 b comprise respective adjustable - length rods 205 on which the roll rf is rotatably supported . in the embodiment of fig1 , when a roll rf is carried by one of the roll supports 204 a , 204 b , the other roll support 204 a , 204 b serves as a handle for grasping by a user to move the carriage to install the facing f from the roll rf with the installed facing f trailing the carriage c . in such case , the user also manually pivots the frame 202 relative to the base b of the carriage c about pivot points v 1 , v 2 such that the roll rf is urged into contact with the purlin lower flanges pl . the present development provides a system and method and device for facing a roof structure , i . e ., for installing facing f on the underside of roof purlins p 1 , p 2 by securing the facing f to the purlin lower flanges pl . it is not intended that the present development be limited to the exact designs for the carriages c disclosed herein . in general , the present development is intended to encompass any carriage that carries and dispenses facing f for securement of the facing f to the lower flanges pl of purlins p ( p 1 , p 2 , etc .) using adhesive such as tape or other adhesive , whether the tape or other adhesive is part of the facing , dispensed from the carriage and / or applied to the purlin flanges pl in a separate process before and / or after the facing is dispensed . for all carriage embodiments , if desired or required for certain applications , the carriage can function merely as a dispenser for the roll of facing rf , meaning that the carriage can be operably suspended from the purlins p 1 , p 2 and clamped or otherwise secured in position . then the user can manually pull facing f from the roll rf and extend the facing along the length of the purlins p 1 , p 2 , navigating the facing around pipes , electrical conduits and other obstructions while adhering the facing to the bottom faces pf of the purlin lower flanges pl . the development has been described with reference to preferred embodiments . those of ordinary skill in the art will recognize that modifications and alterations to the preferred embodiments are possible . the disclosed preferred embodiments are not intended to limit the scope of the following claims , which are to be construed as broadly as possible , whether literally or according to the doctrine of equivalents . | 4 |
referring to the figures , a vehicle door substrate (“ substrate ”) is generally shown at 10 . the substrate 10 comprises of an inner , or “ a ” surface 12 visible to an occupant of the vehicle , and an outer , or “ b ” surface 14 that is not visible to the occupant . the substrate 10 includes , amongst other features , an armrest 16 and a grab handle 18 . as illustrated in fig2 , substrate 10 further includes apertures 20 , which will be discussed in greater detail below . the armrest 16 is attached to the inner surface 12 of the substrate 10 and grab handle 18 is secured to armrest 16 . it can be appreciated that armrest 16 may be integrated into substrate 10 during the manufacturing of substrate 10 . alternatively , armrest 16 may be secured to the inner surface 12 of the substrate 10 through a secondary process , such as , for example , by welding , by fasteners or by adhesives . as illustrated , armrest 16 may be formed from a top portion 22 and a bottom portion 24 for ease of manufacturing armrest 16 . top portion 22 and bottom portion 24 may be generally symmetrical with respect to each other and secured together by conventional methods . armrest 16 and grab handle 18 may be manufactured from the same material , or from different materials . for example , armrest 16 may be manufactured from a polyvinyl chloride and grab handle 18 may be manufactured from a polyurethane . further , both armrest 16 and grab handle 18 may be covered with a decorative layer of material , or scrim ( not shown ). referring to fig2 , armrest 16 includes a cavity 26 , dent , gap , pocket , or the like . cavity 26 separates armrest 16 into a front portion 28 and a rear portion 30 . as illustrated , top portion 22 of armrest 16 is disjoined into separate front and rear portions 28 , 30 by cavity 26 , while front and rear portions 28 , 30 of bottom portion 24 remain joined by an intermediate surface 32 . cavity 26 may be generally u - shaped and defined by opposing exposed surface 34 of the front portion 28 and exposed surface 36 of the rear portion 30 and by either substrate 10 or intermediate surface 32 . exposed surfaces 34 , 36 of front and rear portions 28 , 30 may include a tee lock 38 . tee lock 38 may be integrated into exposed surfaces 34 , 36 of front and rear portions 28 , 30 of armrest 16 during the manufacture of armrest 16 . it can be appreciated by those skilled in the art that exposed surfaces 34 , 36 of the front and rear portion 28 , 30 may be angled at approximately 3 degrees so as to prevent a condition , known by those skilled in the art , as “ die lock ” in the mold tool ( not shown ) from occurring during the manufacture of armrest 16 . in other words , providing an angle to exposed surfaces 34 , 36 of front and rear portions 28 , 30 allows the mold tool to properly open and close without armrest 16 during the manufacture and / or removal of armrest 16 from the mold tool . according , it can be appreciated by those skilled in the art , that exposed surfaces 34 , 36 may be angled at any degree so long as the mold tool for armrest 16 does not damage armrest 16 during the manufacture and / or removal of armrest 16 from the mold tool . tee lock 38 comprises a seat 40 and a tapered guide 42 . seat 40 may extend horizontally outwardly from exposed surfaces of front and rear portion 34 , 36 . seat 40 may have a uniform thickness , or as illustrated , may gradually increase in thickness from an end 40 a to an opposing end 40 b . tapered guide 42 may extend vertically above and below seat 40 at approximately a 90 degree angle . in the illustrated embodiment , as tapered guide extends from edge 40 a to opposing edge 40 b , tapered guide 42 may increase in thickness . further , tapered guide 42 may connect to exposed surfaces 34 , 36 of front and rear portions 28 , 30 beyond seat 40 . fig3 - 5 illustrate grab handle 18 isolated from armrest 16 . grab handle 18 may be generally u - shaped , and include two opposing side wings 44 with a handle area 46 therebetween . side wings 44 may include locating pins 50 that extend outwardly past grab handle 18 . it can be appreciated that grab handle 18 may be any desired dimensions so long as an adult hand ( not shown ) can comfortably wrap around the handle area 46 . the two opposing side wings 44 of the grab handle 18 may be generally symmetric relative to each other . fig4 and 5 illustrate enlarged views of side wing 44 . each side wing 44 includes a means for engaging tee locks 48 . the means for engaging tee locks 48 may be integrated into each side wing 44 during the manufacture of the grab handle 18 . alternatively , means for engaging tee locks 48 may be manufactured separately and inserted into each side wing 44 of grab handle 18 during a secondary process . the means for engaging tee locks 48 may be , for example , a reverse tapered guide 48 for guiding the grab handle 18 over tee locks 38 . as illustrated , reverse tapered guide 48 may be defined as a slot that extends from an edge 44 a of side wing 44 to an opposing edge 44 b of side wing 44 . reverse tapered guide 48 slightly tapers from edge 44 a of side wing 44 to a collar 52 . at collar 52 , reverse tapered guide 48 reduces in width and slightly tapers from collar 52 to opposing edge 44 b . however , it can be appreciated that the invention may be practiced without collar 52 . thus , reversed tapered guide 48 may taper uniformly from edge 44 a to opposing edge 44 b . fig4 illustrates reverse tapered guide 48 as viewed from edge 44 a of side wing 44 , while fig5 illustrates reverse tapered guide 48 as viewed from edge 44 b of side wing 44 . when grab handle 18 is aligned with arm rest 16 , tapered guide 42 of tee lock 38 may be aligned with reverse tapered guide 48 of grab handle 18 . in an installed embodiment , grab handle 18 may be inserted into cavity 26 of armrest 16 . thus , tapered guide 42 of tee lock 38 may be inserted into reverse tapered guide 48 . as a result , reverse tapered guide 48 is slightly larger than tapered guide 42 of tee lock 38 . when installed , grab handle 18 pulls tee locks 38 toward each other , and therefore , pulls front and rear portions 28 , 30 of armrest 16 towards each other . consequentially , gaps that may exist between armrest 16 and grab handle 18 are equally reduced when tapered guide 42 of tee lock 38 engages reverse tapered guide 48 of side wings 44 . grab handle 18 abuts against seat 40 of tee lock 38 , thus reducing upward and downward movement of grab handle 18 relative to armrest 16 . when grab handle 18 is inserted into armrest 16 , locating pins 50 of grab handle 18 may be inserted into apertures 20 of substrate 10 . fasteners ( not shown ) may be inserted into the remaining apertures 20 , thereby further securing the location of grab handle 18 . the embodiments disclosed herein have been discussed for the purpose of familiarizing the reader with novel aspects of the invention . although preferred embodiments of the invention have been shown and described , many changes , modifications and substitutions may be made by one having ordinary skill in the art without necessarily departing from the spirit and scope of the invention as described in the following claims . | 1 |
referring to fig1 a thin film superconductor assembly 10 according to a preferred embodiment of the invention is seen to be of a planar type , comprising a self - supporting substrate 15 having a lower surface 16 and an upper surface 17 . the assembly further comprises a dielectric layer 20 , a thin film superconductor 30 and a substantially moisture and oxygen impervious , electrically insulating coating 40 . such assembly is described now in greater detail . the substrate 15 forms at least a portion of a containment for a flow of cryogenic fluid to maintain the assembly at sufficiently low temperatures to operate as a superconductor . more specifically , lower surface 16 of substrate 15 forms at least a portion of the inside surface of a chamber , conduit , etc . carrying cryogenic fluid . thus , surface 16 would be in contact with such cryogenic fluid and heat would be extracted from the assembly through surface 16 to the cryogenic fluid acting as a heat sink . the substrate 15 can be formed of any material or combination of materials which produce a self - supporting component with sufficiently high thermal conductivity ( given the substrate thickness and other dimensions required to make the substrate self - supporting ) to evacuate sufficient heat from the assembly during operation in its expected environment to maintain the superconducting material , described below , at the necessary cryogenic temperatures . preferably , the substrate comprises metal , more preferably a very high thermally conductive metal such as aluminum and aluminum alloys comprising at least about 70 weight percent aluminum by weight . the substrate must also be of a material suitable to form an adherent bond with the dielectric layer 20 . dielectric layer 20 is laid down on surface 17 of the substrate to electrically insulate the thin film superconductor 30 from the substrate 15 . the dielectric layer 20 can be formed of any suitable dielectric material which can achieve good structural integrity with substrate 15 and with superconductor 30 and coating 40 . preferred materials include various commercially available ceramic and ceramic - like materials well known to the skilled of the art . exemplary such materials include beryllium oxide , diamond or diamond - like thin films , silicon carbide , strontium titanate , aluminum oxide and aluminum nitride . other suitable dielectric layer materials will be apparent to the skilled in the art in view of the present disclosure . it will be within the skill of the art to select particular material ( s ) for the dielectric layer and to provide same in a suitable thickness in view of the intended use and environment of use for the superconductor assembly . specifically , the dielectric layer must be provided in sufficient thickness to electrically insulate the thin film superconductor from the substrate and must not be s thick that it impedes extraction of heat through the substrate to the cryogenic fluid . in this light , it will be understood that it is not essential that the dielectric layer and thin film superconductor be carried on a surface of the substrate directly opposite that surface of the substrate which is in contact with the cryogenic fluid . it is necessary only that the two be sufficiently proximate to achieve adequate heat extraction from the superconductor to the cryogenic fluid to maintain the necessary cryogenic temperatures for superconductivity . aluminum nitride is especially preferred for the dielectric layer in view of its high dielectric constant and its superb thermal conductivity and for reasons concerning the method aspect of the invention described below . a diamond or diamond - like dielectric layer can be grown according to methods known to the skilled of the art and is a preferred material in view of its superb thermal conductivity and excellent dielectric value . achieving good integration with the substrate may , however , in some cases , be more difficult than with others of the materials mentioned . in addition , present methods of growing diamond layers on substrates require temperatures that exceed the melting point of aluminum . accordingly , a substrate other than aluminum must be chosen having a sufficiently high melting point where a diamond or diamond - like dielectric layer is to be grown on the surface of the substrate . strontium titanate , especially single crystal strontium titanate has been found to be particularly suitable for contact with the high t c ceramic superconductor materials mentioned above and will for that reason , in certain embodiments of the present invention , be a preferred material for the dielectric layer 20 of the superconductor assembly . it is generally recognized by those skilled in the art , however , that strontium titanate and like materials can be quite difficult to grow on polycrystaline metals such as aluminum . the thin film superconductor 30 is laid down on the surface of the dielectric layer according to any of various methods known to the skilled of the art . such method will depend , of course , on the superconductor material selected for use . the high t c ceramic superconductors mentioned above are preferred for use in the invention in view of their suitability for thin film applications . it presently is believed that especially good superconductivity would be achieved by growing a single crystal thin film superconductor on the dielectric layer . a single crystal thin film superconductor is not , however , essential to the invention and may not be commercially competitive with non - single crystal thin film superconductors in view of the difficulty and cost currently associated with the growing of single crystal superconductors . thin film superconductors of y - ba - cu - o and er - ba - cu - o systems of oxygen defect perovskite can be prepared for the present invention by sputtering deposition , for example , according to the techniques disclosed by kitabatake et al , superconducting y - ba - cu - o and er - ba - cu - o thin films prepared by sputtering deposition , presented at the 34th national symposium of the american vacuum society , the disclosure of which is superconductive thin film was so grown without post annealing . other methods for vapor deposition of thin film high t c superconductors suitable for the present invention are disclosed by laibowitz , vapor deposited superconducting oxide thin films , and by hong et al , thin film research of high t c superconductors , both also given at the 34th national symposium of the american vacuum society and both also incorporated herein by reference . coating 40 acts as a moisture and oxygen barrier and serves also to electrically isolate the thin film superconductor , this latter function being performed in conjunction with the dielectric layer . the coating can be formed of any of numerous materials , the identity and suitability of which will be apparent to the skilled of the art in view of the present disclosure . the material preferably is one which can be applied as a liquid and must , in any event , achieve good adhesion to the thin film superconductor and to the dielectric layer where the two are to have an interface . the coating 40 must be applied in sufficient thickness to provide the necessary protection and insulation given the environment in which the superconductor assembly is to be used , its desired life expectancy , etc . the protective coating 40 is particularly important for use with the high t c ceramic superconductors mentioned above , especially the yttrium - barrium - copper - oxygen superconductors in view of the sensitivity of such superconductor materials to contact with other materials . coating 40 can be , for example , a physically or chemically vapor deposited film or a polymeric material applied typically by various known rheological processes such as spin coating . preferred polymeric materials for the protective coating 40 include polyimides and the like . numerous additional commercially available materials suitable for use as the protective coating 40 will be apparent to those skilled in the art in view of the present disclosure . referring now to fig2 a tubular embodiment of the invention is seen to comprise a substrate 50 which is self - supporting and , as in the case of the planar embodiment discussed above , is structurally sufficient to support the entire superconductor assembly . substrate 50 is seen to be a hollow cylinder , passage 55 of which is adapted to carry a flow of cryogenic fluid for cooling the superconductor assembly . dielectric layer 60 is carried on the outside surface of substrate 50 and the thin film superconductor 70 is formed as a cylindrical layer carried on the outside of the dielectric layer 60 . finally , the protective coating 80 forms the exterior surface of the assembly . a preferred embodiment of the thin film superconductor assembly of the invention is fabricated according to the method aspect of the invention . according to such method , the self - supporting substrate is formed of a material selected from the group consisting of aluminum and aluminum alloys containing at least about 70 weight percent aluminum , more preferably at least about 85 weight percent . the dielectric layer is provided by growing an aluminum nitride dielectric layer integral with the surface of the aluminum or aluminum metal substrate . thus , the superb thermal conductivity and the high dielectric constant of aluminum nitride is achieved together with the excellent structural integrity of a dielectric layer which is integral with the substrate . the aluminum nitride layer can be grown on the substrate by any of various methods known to the skilled of the art including , for example , vapor deposition . according to preferred embodiments of this method aspect of the invention , however , the aluminum nitride dielectric layer is grown by nitriding the aluminum - bearing substrate . a critical aspect of this preferred embodiment of the invention is that the substrate is the source of the aluminum in the aluminum nitride layer . in u . s . pat . no . 4 , 522 , 660 to suzuki a process is disclosed for ion nitriding of aluminum using a glow discharge technique , which disclosure is incorporated herein by reference . the glow discharge process of suzuki is a relatively low energy process and improved adhesion of the aluminum nitride layer to the aluminum - bearing substrate has been achieved using higher energy ion beam implanting methods known generally to the skilled of the art . aluminum nitride layers produced by such higher energy processes may , however , provide a layer of somewhat lower dielectric constant . it will be within the ability of those skilled in the art to select nitriding processes and techniques providing aluminum nitride dielectric layers having both adequate adhesion and dielectric properties . teachings regarding the growing of aln by nitriding of aluminum also are disclosed in nippon kogyo shimbun ( japan daily industrial newsletter ) 12 / 85 , p . 5 , and in techno japan 19 ( 3 ), 76 ( 1986 ), which disclosures are incorporated herein by reference . while not intending to be bound by theory , it is here mentioned for completeness of explanation that an aluminum nitroxy ( aln x o y ) interfacial layer may be produced during a nitriding process between the aluminum nitride layer and the aluminum bearing substrate . such aluminum nitroxy may be formed at the outer surface of the dielectric layer and / or be dispersed in some measure throughout the layer . this does not , in any event , change the essential feature of this preferred embodiment of the invention , i . e ., that the aluminum nitride layer is integral with the substrate and that the aluminum bearing substrate is the source of the aluminum in the aluminum nitride layer . further regarding the method aspect of the invention , a thin film superconductor is provided adherent to the surface of the dielectric layer ( i . e ., adherent to the surface of the aluminum nitride opposite the substrate ). as discussed above , the dielectric layer must be sufficient to substantially electrically isolate the substrate from the thin film superconductor . this is especially important according to this aspect of the invention in view of the high electrical conductivity of aluminum and aluminum alloy materials used as the substrate . depending upon the superconductor material chosen for the thin film superconductor , it may be necessary to employ an interfacial layer between the superconductor and the dielectric layer to improve adhesion and / or to prevent interaction of the superconductor material with the dielectric layer either during the fabrication process or during use of the superconductor assembly . it will be within the ability of those skilled in the art , in view of the present disclosure , to provide such interfacial layer as needed . it will be preferred according to certain embodiments of the invention to provide surface treatment of the aluminum nitride layer to remove contaminants prior to laying down the superconductor layer . this will be especially significant where the superconductor material selected for the thin film superconductor is particularly susceptible to performance deterioration due to contamination . it also will be significant where the process of making the thin film superconductor on the surface of the dielectric layer is particular sensitive to contamination . one suitable interfacial layer for this purpose , for example , is strontium titanate . certain of the above - mentioned high t c superconductor materials , most notably y 1 ba 2 cu 3 o 7 - x ( where x is a small number ) and the like may require relatively high temperature processing . more specifically , a high temperature ( generally approximately 800 °) treatment step may be needed for post - annealing or &# 34 ; perfection &# 34 ; of the superconductor . thus , for example , the component materials can be formed initially as a slurry and then heat treated in air or in oxygen bearing atmosphere to produce the desired superconductor material . it will be apparent , therefore , that where a superconductor material of this type is employed , the aluminum or aluminum alloy must be protected against such heat . thus , for example , techniques for heating the thin film of pre - superconductor slurry , for example high speed laser heating techniques , can be used to substantially isolate the heat to the pre - superconductor slurry . high speed heat processing according to such techniques also would minimize reaction of the slurry with the dielectric layer and any other adjacent materials and contaminants . additional alternatives include the above - mentioned , recently developed techniques , such as sputtering techniques , for growing a thin film high t c superconductor which can be perfected without ( or with little ) high temperature processing , perhaps in conjunction with ion implantation of excess oxygen . it will be apparent in view of the present disclosure that such processing techniques can be used in the present invention to form the thin film superconductor on the surface of the dielectric layer . of course , it will be understood that alternative superconductor materials not requiring such high temperature processing can be employed in the invention . it also will be apparent that very complex circuitry paths can be achieved by many of the above - discussed methods , including painting the aforesaid pre - superconductor slurry onto the dielectric layer according to any desired pattern and configuration . various modifications and additions to the invention as disclosed above will be apparent to those skilled in the art in view of the present disclosure , such modifications and additions being within the scope of the claims appended hereto . | 8 |
as used in the specification and the appended claims , the singular forms “ a ,” “ an ” and “ the ” include plural referents unless the context clearly dictates otherwise . the term “ about ” as used herein , when referring to a numerical value or range , allows for a degree of variability in the value or range , for example , within 10 %, or within 5 % of a stated value or of a stated limit of a range . as used herein , “ individual ” ( as in the subject of the treatment ) means both mammals and non - mammals . mammals include , for example , humans ; non - human primates , e . g . apes and monkeys ; and non - primates , e . g . dogs , cats , cattle , horses , sheep , and goats . non - mammals include , for example , fish and birds . the term “ disease ” or “ disorder ” or “ malcondition ” are used interchangeably , and are used to refer to diseases or conditions wherein fak plays a role in the biochemical mechanisms involved in the disease or malcondition such that a therapeutically beneficial effect can be achieved by acting on the kinase . “ acting on ” fak can include binding to fak and / or inhibiting the bioactivity of fak . the expression “ effective amount ”, when used to describe therapy to an individual suffering from a disorder , refers to the amount of a compound of the invention that is effective to inhibit or otherwise act on fak in the individual &# 39 ; s tissues wherein fak involved in the disorder is active , wherein such inhibition or other action occurs to an extent sufficient to produce a beneficial therapeutic effect . “ substantially ” as the term is used herein means completely or almost completely ; for example , a composition that is “ substantially free ” of a component either has none of the component or contains such a trace amount that any relevant functional property of the composition is unaffected by the presence of the trace amount , or a compound is “ substantially pure ” is there are only negligible traces of impurities present . “ treating ” or “ treatment ” within the meaning herein refers to an alleviation of symptoms associated with a disorder or disease , or inhibition of further progression or worsening of those symptoms , or prevention or prophylaxis of the disease or disorder , or curing the disease or disorder . similarly , as used herein , an “ effective amount ” or a “ therapeutically effective amount ” of a compound of the invention refers to an amount of the compound that alleviates , in whole or in part , symptoms associated with the disorder or condition , or halts or slows further progression or worsening of those symptoms , or prevents or provides prophylaxis for the disorder or condition . in particular , a “ therapeutically effective amount ” refers to an amount effective , at dosages and for periods of time necessary , to achieve the desired therapeutic result . a therapeutically effective amount is also one in which any toxic or detrimental effects of compounds of the invention are outweighed by the therapeutically beneficial effects . a “ salt ” as is well known in the art includes an organic compound such as a carboxylic acid , a sulfonic acid , or an amine , in ionic form , in combination with a counterion . for example , acids in their anionic form can form salts with cations such as metal cations , for example sodium , potassium , and the like ; with ammonium salts such as nh 4 + or the cations of various amines , including tetraalkyl ammonium salts such as tetramethylammonium , or other cations such as trimethylsulfonium , and the like . a “ pharmaceutically acceptable ” or “ pharmacologically acceptable ” salt is a salt formed from an ion that has been approved for human consumption and is generally non - toxic , such as a chloride salt or a sodium salt . a “ zwitterion ” is an internal salt such as can be formed in a molecule that has at least two ionizable groups , one forming an anion and the other a cation , which serve to balance each other . for example , amino acids such as glycine can exist in a zwitterionic form . a “ zwitterion ” is a salt within the meaning herein . the compounds of the present invention may take the form of salts . the term “ salts ” embraces addition salts of free acids or free bases which are compounds of the invention . salts can be “ pharmaceutically - acceptable salts .” the term “ pharmaceutically - acceptable salt ” refers to salts which possess toxicity profiles within a range that affords utility in pharmaceutical applications . pharmaceutically unacceptable salts may nonetheless possess properties such as high crystallinity , which have utility in the practice of the present invention , such as for example utility in process of synthesis , purification or formulation of compounds of the invention . suitable pharmaceutically - acceptable acid addition salts may be prepared from an inorganic acid or from an organic acid . examples of inorganic acids include hydrochloric , hydrobromic , hydriodic , nitric , carbonic , sulfuric , and phosphoric acids . appropriate organic acids may be selected from aliphatic , cycloaliphatic , aromatic , araliphatic , heterocyclic , carboxylic and sulfonic classes of organic acids , examples of which include formic , acetic , propionic , succinic , glycolic , gluconic , lactic , malic , tartaric , citric , ascorbic , glucuronic , maleic , fumaric , pyruvic , aspartic , glutamic , benzoic , anthranilic , 4 - hydroxybenzoic , phenylacetic , mandelic , embonic ( pamoic ), methanesulfonic , ethanesulfonic , benzenesulfonic , pantothenic , trifluoromethanesulfonic , 2 - hydroxyethanesulfonic , p - toluenesulfonic , sulfanilic , cyclohexylaminosulfonic , stearic , alginic , β - hydroxybutyric , salicylic , galactaric and galacturonic acid . examples of pharmaceutically unacceptable acid addition salts include , for example , perchlorates and tetrafluoroborates . the synthetic pathway to sf - 1 that was selected involves two successive coupling reactions , as shown : in the method disclosed in wo 2008 / 115 , 369 both coupling steps were carried out using the palladium transition metal catalyst pd 2 ( dba ) 3 / xantphos . in various embodiments , the present invention provides an improved method for the final synthetic transformation of a compound exemplary for formula ( i ), termed sf - 1 ( compound 6 of wo 2008 / 115 , 369 ), shown in scheme 2 , below . in various embodiments , the invention provides a method of synthesizing a compound of formula ( i ) r 1 is independently at each occurrence alkyl , aryl , cycloalkyl , heterocyclyl , aryl , or heteroaryl ; r 2 , r 3 and r 4 are independently at each occurrence alkyl , aryl , cycloalkyl , heterocyclyl , aryl , heteroaryl , alkoxy , aryloxy , or fluoro ; r 5 is hydrogen , alkyl , aryl , cycloalkyl , heterocyclyl , aryl , or heteroaryl ; ( a ) a solution of compounds ( ii ) and ( iii ) in a liquid hydroxylic solvent of boiling point higher than about 115 degrees c . ; ( b ) the compound of formula ( ii ) being present at a concentration of no less than about 0 . 4 m ; ( c ) the compound of formula ( iii ) being present at a concentration about 10 % higher than the concentration of the compound of formula ( ii ); followed by precipitation of the compound of formula ( i ) by addition of a hydrocarbon to the hydroxylic solvent following cooling of the solvent to ambient temperature , then collection of the precipitated compound . for example , the hydroxylic solvent can be n - butanol , methoxyethanol , or ethoxyethanol . more specifically , the hydroxylic solvent can be n - butanol . in various embodiments , the concentration of the compound of formula ( ii ) can be about 0 . 5 m . in various embodiments , the temperature can be about 118 - 166 ° c ., i . e ., at or near the boiling point of a hydroxylic solvent such as n - butanol , methoxyethanol , or ethoxyethanol . in various embodiments the reaction can be carried out at the reflux point of the hydroxylic solvent chosen . various hydrocarbons can be used to bring about precipitation of the reaction product . for example , the hydrocarbon can be heptane . in various embodiments , the yield of the compound of formula ( i ) can be at least about 75 %. in various embodiments , the purity of the compound of formula ( i ) can be at least about 98 %. coupling of the 2 - chloropyridine derivative sf - int2a with aniline derivative sm - 3 ( in the form of a stoichiometically defined dihydrochloride salt ) yields sf - 1 hydrochloride , which is recovered as the free base form following workup . the free base was obtained in greater than 70 % yield of 99 % pure material prior to the final step of recrystallization from 1 , 4 - dioxane . recrystallization yielded material of greater than 99 . 5 % purity in greater than 85 % yield . conversion to the hcl salt was then carried out to provide the active pharmaceutical ingredient in the form of a pharmaceutically acceptable salt . optimization of various parameters for this coupling reaction was studied . the art coupling reaction used the transition metal catalyst pd 2 ( dba ) 3 / xantphos in 1 , 4 - dioxane solvent in the presence of cs 2 co 3 base . the inventors herein have unexpectedly discovered that use of an alcoholic solvent , rather than an ethereal solvent such as 1 , 4 - dioxane , can bring about the coupling reaction in good yield and purity in the complete absence of any catalyst , particularly in the absence of the expense palladium transition metal catalyst pd 2 ( dba ) 3 / xantphos . investigation of alcoholic ( hydroxylic ) solvent with a range of boiling points in excess of 100 ° c . was investigated . alcohols such as n - butanol , methoxyethanol , ethoxymethanol , n - hexanol , and cyclohexanol , and non - alcohols dmf , dmso , and diethyleneglycol dimethylether were investigated as reaction solvents . the sf - int2a and sm - 3 reagents were dissolved in the solvent at approximately 0 . 5 m concentration , with a 10 % molar excess of the sm - 3 , and the solvents were heated to reflux except in the cases of dmso and dmf , where the reactions were heated to 135 ° c . results are shown in table 1 , below . as seen in table 1 , the three most favorable solvents were found to be n - butanol , 2 - ethoxyethanol , and 2 - methoxyethanol . in another experiment using cyclohexanol , n - hexanol , and diethyleneglycol dimethyl ether , lower yields were observed . in a separate experiment , little or no product was observed to be formed in dmso or dmf . in the alcohols , there was no significant difference in product yield when the reaction was carried out under ambient atmosphere or under nitrogen gas atmosphere . the reaction in n - butanol was carried out on a 40 gm scale ; see example 1 , below . in various embodiments , the invention provides a method for further purification of the compound of formula ( i ), comprising : ( a ) first , dissolving and partitioning the compound of formula ( i ) between aqueous base and a water - immiscible organic solvent , then separating a solution of the compound of formula ( i ) free base in the water - immiscible organic solvent ; ( b ) then , adding to the solution silica gel , and optionally anhydrous magnesium sulfate , and optionally activated charcoal , then separating the solid material from the solvent to provide a purified solution of free base ; ( c ) then , adding a hydrocarbon to the purified solution to cause precipitation of the free base ; and ( d ) then , collecting the precipitated free base of the compound of formula ( i ). in various embodiments , the aqueous base comprises aqueous carbonate , for example , 10 % aqueous potassium carbonate . in various embodiments , the water immiscible solvent can be ethyl acetate , dichloromethane , or any mixture thereof . in various embodiments , separating the solid material ( silica gel , charcoal , magnesium sulfate ) can be carried out by a process comprising filtration or centrifugation , or both . in various embodiments , the purified free base can be precipitated from the solution by addition of a hydrocarbon , such as heptane . the precipitated purified free base can be collected by a process that comprises filtration or centrifugation , or both . in various embodiments , the free base of formula ( i ) is a compound of formula in various embodiments , the yield of the compound of formula ( i ) can be at least about 70 %, and the purity of the compound of formula ( i ) can be at least about 98 %. accordingly , further purification of the crude reaction product , in particular to remove color bodies , can be carried out by treatment of a solution of sf - 1 free base with solid absorbents . as shown in fig1 , a flow chart of an optimized synthetic process for decolorized sf - 1 free base , the product resulting from the above - described reaction , believed to be a hydrochloride salt of sf - 1 as existing in the reaction solvent due to the formation of an equivalent of hcl from the reaction , can be converted to free base form by partition between a water - immiscible organic solvent , e . g ., ethyl acetate , and an aqueous base such as carbonate solution . the sf - 1 free base , or the corresponding free base of a compound of formula ( i ), partitions into the organic phase . the aqueous phase can be backwashed with the same or a different water - immiscible organic solvent , e . g ., dichloromethane ( dcm ). then , the combined organic phases can be dried and decolorized by treatment with silica gel , optionally with anhydrous magnesium phosphate , optionally with activated charcoal . for example , it was found that on a 40 gm scale ( i . e ., 40 gm of sf - int2a ), addition of about 200 gm of silica to the organic extract described above , was effective in decolorizing the solution . addition of about 40 gm activated charcoal improved the effectiveness of the decolorization , and 40 gm anhydrous magnesium sulfate could be used to thoroughly dry the solution . see example 2 , below . an embodiment of an inventive method is shown in fig1 . the two reactants are stirred together in a hydroxylic solvent such as n - butanol at reflex for 2 - 3 days . the progress of the reaction can be monitored by hplc . following completion of the reaction , the reaction mixture is cooled and a hydrocarbon such as heptane is added to precipitate the reaction product . the precipitate is filtered , then is partitioned between a water - immiscible solvent such as ethyl acetate and aqueous base , such as potassium carbonate , to liberate the free base form . the aqueous phase can be further extracted with the same or different organic water - immiscible solvent , such as dichloromethane ( dcm ). the combined organic extracts are then treated with silica gel , for example with about 5 × the weight of the starting material of silica gel , which is then filtered to provide a decolorized solution of the sf - 1 free base . optionally , charcoal , and / or anhydrous magnesium sulfate , are added . then , the solution is filtered , for example through celite , and the solvent ( s ) removed from the filtrate to provide sf - 1 free base . the sf - 1 or other compound of formula ( i ) herein prepared by the inventive method can be further purified by recrystallization . in various embodiments of the invention , recrystallization is carried out in 1 , 4 - dioxane . the purification of sf - 1 free base by recrystallization from 1 , 4 - dioxane was evaluated using various ratios of compound to solvent , with respect to purity and yield of the recrystallized product . individual procedures are shown in example 3 , and table 2 , below , shows the yield and purity of the products obtained under the conditions specified in example 3 . as can be seen , variations in purity and yield were observed using variants of the 1 , 4 - dioxane recrystallization procedures , and a higher purity was obtained using somewhat lower concentrations of the crude material in the recrystallization solvent , with only a slight reduction in yield . conversion of sf - 1 to its hydrochloride salt , and additional purification , were achieved according to various embodiments of the inventive method . in various embodiments , the invention provides a method further comprising converting the free base of the compound of formula ( i ) to a hydrochloride salt thereof by a process comprising : ( a ) contacting a first alcoholic solution of the free base and a second alcoholic solution of hydrogen chloride , then ( b ) adding a hydrocarbon to precipitate the compound of formula ( i ) hydrochloride salt ; then for example , the first alcoholic solution can be in ethanol , or the second alcoholic solution can be in isopropanol , or both . in various embodiments , the hydrocarbon can be heptane . in various embodiments , the hydrochloride salt of the compound of formula ( i ) can be a mono - hydrochloride salt , i . e ., a stoichiometrically defined salt of a pharmaceutically acceptable identity . in various embodiments , the hydrochloride salt of the compound of formula ( i ) can be further purified by recrystallizing the compound , for instance , from 1 , 4 - dioxane . the compound of formula ( i ) hydrochloride salt obtained by a method of the invention can of at least 99 % purity , or of at least 99 . 5 % purity , such as measured by hplc area percentage . a recrystallization yield of at least about 85 % can be obtained . the overall yield of formula ( i ) hydrochloride salt can be at least about 70 %, with a purity of at least about 97 %. the compound of formula ( i ) can be sf - 1 hydrochloride , i . e ., a compound of formula which is obtained in at least about 99 % purity and at least about 60 % overall yield based upon sf - int2a . example 4 , below , provides experimental details for the preparation of a hydrochloride salt of a compound of formula ( i ). fig2 , is a flowchart of the embodiment of a hydrochloride salt preparative portion of a method of the invention . in various embodiments , the invention provides a method of synthesis of other compounds of formula ( i ) analogous to sf - 1 . for example , the inventive method can be applied to the synthesis of a compound of formula sf - 2 : or any pharmaceutically acceptable salt thereof . more specifically , the synthesis of this kinase inhibitor can be carried out as detailed above for compound sf - 1 , provided that for compound sm - 1 , a compound of the following formula replaces sm - 1 with sm - 1a in carrying out the first step as shown above in synthetic scheme 1 . this starting material can be converted to compound ( ii ) as shown below , then converted to a compound of formula sf - 2 using the methods disclosed and claimed herein . in various embodiments , the invention provides a method of preparing a compound of formula ( ii ) wherein r 3 and r 4 are independently at each occurrence alkyl , aryl , cycloalkyl , heterocyclyl , aryl , heteroaryl , alkoxy , aryloxy , or fluoro ; r 5 is hydrogen , alkyl , aryl , cycloalkyl , heterocyclyl , aryl , or heteroaryl ; ( c ) no more than about 1 . 1 molar equivalents of cs 2 co 3 ; ( d ) a concentration of the compound of formula ( iv ) of no less than about 0 . 5 m ; ( e ) a concentration of the compound of formula ( v ) of no less than about 0 . 5 m ; in various embodiments , the method further comprises recovering the compound of formula ( ii ) by a method comprising : ( b ) washing the filtrate with a water immiscible solvent to provide a filtered solution ; then ( e ) adding a hydrocarbon to precipitate the compound of formula ( ii ). in various embodiments , the purity of the compound of formula ( ii ) can be at least about 99 %, and the yield of the compound of formula ( ii ) can be at least about 90 %. in various embodiment , the invention provides a method of preparing a compound of formula ( ii ) of the formula : it was surprisingly discovered by the inventors herein that the selection of base used in the reaction greatly influenced the time to reaction completion . table 3 , below , shows time points in a comparison study of cs 2 co 3 and k 2 co 3 ( both solid and aqueous ) in the coupling reaction of sm - 1 and sm - 2a . as can be seen , conversion is surprisingly complete using cs 2 co 3 after only 18 hours , while solid k 2 co 3 requires 66 hours , and the reaction is only about 69 % done after 66 hours with aqueous k 2 co 3 . further studies were conducted to example the molar ratio of cs 2 co 3 base to starting material sm - 1 . tables 4a and 4b respectively show the yield and purity of product sf - int2a at time points 3 hours and 18 hours over a range of relative molar quantitites . experiments were conducted to determine the minimum molar ratio of catalyst to reactants under the reaction conditions previously examined . referring to table 5 , entries 1a - 5a , and 1b - 5b correspond with the short time and longer time points of reactions in tables 4a and 4b with varying amounts of cs 2 co 3 and the mole % of catalyst shown . time points are at 4 hours and 18 hours . the results indicate that no significant advantage in yield or purity is achieved when using in excess of 0 . 5 mol % of the pd 2 ( dba ) 3 / xantphos catalyst system in this conversion . table 6 shows a second series of experiments using 0 . 5 mol % and less of the catalyst system in this conversion , using 1 molar equivalent cs 2 co 3 in dioxane . table 7 effect of solvent selection on product yield and purity reaction yield (%) of impurities entry solvent time ( h ) product a sm - 1 (%) (%) 1a 1 , 4 - dioxane 3 94 5 . 8 0 2a n - butanol 3 79 0 21 3a ethylene glycol 3 0 0 100 b 4a dmf 3 65 35 0 5a dmso 3 58 26 14 e 1b 1 , 4 - dioxane 18 88 0 12 2b n - butanol 18 29 56 . 5 d 3b ethylene glycol 18 n / a n / a n / a 4b dmf 18 76 13 11 e 5b dmso 18 87 0 12 at a 3 hour time point , reaction in dioxane is virtually complete , and is very clean , while reactions conducted in solvents n - butanol , ethylene glycol , dmf , and dmso give lower yields and higher levels of impurities . a detailed synthetic procedure using these parameters is provided in example 5 , below . in various embodiments , the invention provides a compound of formula ( i ) of claim 1 or a pharmaceutically acceptable salt thereof prepared by a method comprising a method of the invention . for example , an embodiment provides the compound of formula or a pharmaceutically acceptable salt thereof . more specifically , the pharmaceutically acceptable salt can be a hydrochloride salt . use of sf - land analogs in treatment of inflammatory and immune disorders and of arthritis the inhibition of focal adhesion kinase ( fak ) is believed by inventors herein to be an effective therapy in the treatment of an inflammatory or immune disorder , or arthritis . accordingly , various embodiments of the invention provide the use of a compound of formula ( i ) in preparation of a medicament for treatment of an inflammatory or immune disorder , or arthritis . in various embodiments , the invention provides a method of treatment of an inflammatory or immune disorder , or arthritis , in a patient comprising administering to the patient an effective dose of a compound of formula ( i ) at a frequency and for a duration of time to provide a beneficial effect to the patent . for example , the compound of formula ( i ) can be op step # material name lot # mw equiv mmol w ( g ) v ( ml ) 1 sf - int2a 1779 - 56 - 15 329 . 7 1 121 . 32 40 . 00 1 sm - 3 lb - 008 - 125c 281 . 18 1 . 1 133 . 45 37 . 52 1 n - butanol 240 4 heptane 480 5 etoac 100 5 heptane 100 5 heptane 100 6 etoac 1200 6 k 2 co 3 138 . 21 5 606 . 61 84 6 water 18 . 01 800 8 k 2 co 3 138 . 21 20 8 dcm 800 10 charcoal 40 10 mgso 4 40 10 silica gel 200 12 celite 50 12 etoac 1200 12 dcm 800 14 heptane 600 16 heptane 300 charge sf - int2a ( 40 g , 121 mmol ), sm - 3 ( 37 . 52 g , 133 mmol ) and n - butanol ( 240 ml ). heat the mixture to gentle reflux for 2 - 3 days under nitrogen atmosphere . check the reaction by hplc . after 18 h , there was 13 . 81 % sf - int2a left . cool down to 15 - 25 ° c . stir the mixture overnight . charge heptane ( 480 ml ). stir the mixture filter the precipitate formed . wash the cake with etoac / heptane ( 1 : 1 , 200 ml ) and then charge the cake with 1200 ml of etoac and 10 % aq . k 2 co 3 ( 800 ml ) to the reactor . charge 20 g of k 2 co 3 powder to the reactor . stir until clear . charge 800 ml of dcm to the charge 40 g of charcoal and 40 g of mgso 4 and 200 g of silica gel to the organic layer . stir the organic layer at gentle reflux point for about 30 min . cool the mixture down to room temperature and filter through celite pad ( 50 g ). wash the cake cool the mixture to room temperature with stirring . stir the mixture at rt overnight . filter the precipitate formed and wash the cake with heptane ( 300 ml ). dry the cake to give rise to 44 g ( 72 . 5 %) of yellow powder . op # operation note 1 charge sf - 1 hcl ( 2 g ), etoac ( 60 ml ). sample from 1779 - 58 - 5 2 charge 30 ml of 10 % k 2 co 3 aqueous solution to the reactor with stirring . continue to stir the mixture for 1 to 2 hours . 3 separate the layers . keep the organic layer in the reactor . 4 charge 2 g of mgso 4 and 20 g of silica gel to the reactor . 5 charge dichloromethane ( 40 ml ) to the reactor . 6 heat the mixture to 50 ° c . for 30 min . 7 cool the mixture to 15 - 25 ° c . 8 filter through celite ( 5 g ). wash the cake with 50 ml of mixture dcm / etoac ( 2 : 3 ). 9 distill the solvent to 5 - 7 . 5 ml . add heptane ( 25 - 32 . 5 ml ) to the reactor . 10 cool the mixture to 15 - 25 ° c . stir the mixture for 2 - 3 hours . 11 filter the precipitate formed . wash the cake with heptane ( 20 ml ). 12 dry the cake under vacuum to give 1 . 0 g of yellow solid , yield 57 %, purity 98 . 7 %. op # operation note 1 charge sf - 1 hcl ( 2 g ), etoac ( 60 ml ). sample from 1779 - 58 - 5 2 charge 30 ml of 10 % k 2 co 3 aqueous solution to the reactor with stirring . continue to stir the mixture for 1 to 2 hours . 3 separate the layers . keep the organic layer in the reactor . 4 charge 2 g of mgso 4 and 2 g of charcoal to the reactor . 5 heat the mixture to 50 ° c . for 30 min . 6 cool the mixture to 15 - 25 ° c . 7 filter through celite ( 5 g ). wash the cake with etoac ( 60 ml ). 8 distill the solvent to 5 - 7 . 5 ml . add heptane ( 25 - 32 . 5 ml ) to the reactor . 9 cool the mixture to 15 - 25 ° c . stir the mixture for 2 - 3 hours . 10 filter the precipitate formed . wash the cake with heptane ( 20 ml ). 11 dry the cake under vacuum to give 1 . 2 g of yield solid , yield 69 %, purity 98 . 6 %. charge 30 ml of 10 % k 2 co 3 aqueous solution to the reactor with stirring . continue to stir the mixture for 30 min to 1 hour . charge 2 g of mgso 4 and 1 g of charcoal and silica gel ( 10 g ) to filter through celite ( 5 g ). wash the cake with 50 ml of dry the cake under vacuum to give 1 . 29 g of gray solid , yield as procedure c was found to be the most effective , it was scaled up for further study . purity was determined by hplc ( fig4 ). charge 150 ml of 10 % k 2 co 3 aqueous solution to the reactor with charge 5 g of k 2 co 3 to the aqueous layer . charge dichloromethane ( 200 ml ) to the reactor . stir the mixture for 15 to 30 minutes . charge 10 g of mgso 4 and 5 g of charcoal and silica gel ( 25 g ) to filter through celite ( 20 g ). wash the cake with 500 ml of mixture dry the cake under vacuum to give 7 . 1 g of gray solid , yield 81 %, procedure 1 . ratio of 1 : 2 ( w / v ) sf - 1 free base to 1 , 4 - dioxane 1 . charge sf - 1 free base ( 1 g , 1779 - 76 - 17 ) and 1 , 4 - dioxane ( 2 ml ). 2 . heat the mixture to 80 ° c . to give a clear solution . 3 . cool the mixture to 15 - 25 ° c . and stir at this temperature for 2 - 3 hours . 5 . dry the compound to give a yellow solid ( 0 . 98 g , 98 %). purity . 98 . 32 a %. procedure 2 ratio of 1 : 3 ( w / v ) sf - 1 free base to 1 , 4 - dioxane 1 charge sf - 1 free base ( 2 g , 1779 - 76 - 17 ) and 1 , 4 - dioxane ( 6 ml ). 2 . heat the mixture to 80 ° c . to give a clear solution . 3 . cool the mixture to 15 - 25 ° c . and stir at this temperature for 2 - 3 hours . 4 . filter the precipitate formed . wash the cake with 1 , 4 - dioxane ( 6 ml ). 5 . dry the compound to give an off - white solid ( 1 . 94 g , 97 %). purity , 99 . 12 a %. procedure 3 . ratio of 1 : 5 ( w / v ) sf - 1 free base to 1 , 4 - dioxane 1 . charge sf - 1 free base ( 2 g , 1779 - 76 - 17 ) and 1 , 4 - dioxane ( 10 ml ). 2 . heat the mixture to 80 ° c . to give a clear solution . 3 cool the mixture to 15 - 25 ° c . and stir at this temperature for 2 - 3 hours . 4 . filter the precipitate formed . wash the cake with 1 , 4 - dioxane ( 10 ml ). 5 . dry the compound to give an off - white solid ( 1 . 86 g . 93 %). purity . 99 . 47 a % procedure 4 . ratio of 1 : 8 ( w / v ) sf - 1 free base to 1 , 4 - dioxane 1 . charge sf - 1 free base ( 1 g , 1779 - 76 - 17 ) and 1 , 4 - dioxane ( 8 ml ). 2 . heat the mixture to 80 ° c . to give a clear solution . 3 . cool the mixture to 15 - 25 ° c . and stir at this temperature for 2 - 3 hours . 4 . filter the precipitate formed . wash the cake with 1 , 4 - dioxane ( 10 ml ). 5 . dry the compound to give a white solid ( 0 . 89 g , 89 %). purity . 99 . 76 a %. procedure 5 . ratio of 1 : 10 ( w / v ) sf - 1 free base to 1 , 4 - dioxane 1 . charge sf - 1 free base ( 1 g , 1779 - 76 - 17 ) and 1 , 4 - dioxane ( 10 ml ). 2 . heat the mixture to 80 ° c . to give a clear solution . 3 . cool the mixture to 15 - 25 ° c . and stir at this temperature for 2 - 3 hours . 4 . filter the precipitate formed . wash the cake with 1 , 4 - dioxane ( 10 ml ). 5 . dry the compound to give a white solid ( 0 . 87 g , 87 %). purity . 99 . 76 a %. a 20 gm scale synthesis was conduct by acidification of sf - 1 free base dissolved in ethanol with hcl dissolved in isopropanol , followed by precipitation with heptane . the sf - 1 hcl salt product was obtained in 84 . 8 % yield and 99 . 5 a % purity as determined by hplc ( fig5 ). op material step # name lot # mw equiv mmol w ( g ) v ( ml ) 1 sf - 1 free 1779 - 97 - 205 501 . 5 1 39 . 88 20 . 00 base 1 hcl in ipa 1 . 0 39 . 88 1 etoh 290 3 heptane 600 5 etoh 40 5 heptane 160 charge etoh ( 290 ml ) and hcl in ipa ( 3 . 4n , 11 . 8 ml , stir the mixture for 15 - 30 min at this point . charge heptane cool down to 15 - 25 ° c . stir the mixture for 2 - 3 hours . sf - int2a was synthesized on a 200 g scale . the materials used are listed below . the product was obtained in 91 % yield with 99 a % purity . op # material name mw eq mmol w ( g ) v ( ml ) 1 sm - 1 307 . 44 1 0 . 65 200 . 00 1 sm - 2a 150 . 18 1 0 . 65 97 . 70 1 cs 2 co 3 325 . 82 1 0 . 65 211 . 96 1 1 , 4 - dioxane 88 . 11 1200 2 pd 2 ( dba ) 3 915 . 7 0 . 005 0 . 003253 2 . 98 2 xantphos 578 . 63 0 . 015 0 . 0098 5 . 65 5 celite 50 . 00 5 etoac 2400 6 , 6 10 % nacl 1200 7 , 7 7 % nahco 3 1200 8 10 % nacl 600 10 heptane 3000 12 heptane 600 211 . 96 g ( 0 . 65 mmol ) of cs 2 co 3 , and 1 , 4 - dioxane ( 1200 ml ). charge pd 2 ( dba ) 3 ( 2 . 98 g ) and xantphos ( 5 . 65 g ). monitor the reaction with hplc . after 45 hours , there was 0 . 52 % cool the mixture down to room temperature . filter through a pad of celite ( 50 g ). wash the cake with etoac ( 2400 ml ). wash the organic layer with 10 % nacl ( 2 × 600 ml ). wash the organic layer with 7 % nahco 3 ( 2 × 600 ml ). distill the solvent to around a volume of 350 - 400 ml left . dry the compound under vacuum to give 195 g , yield 91 %. purity all patents and publications referred to herein are incorporated by reference herein to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference in its entirety . the terms and expressions which have been employed are used as terms of description and not of limitation , and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof , but it is recognized that various modifications are possible within the scope of the invention claimed . thus , it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features , modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art , and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims . | 2 |
in fig1 there is shown a schematic illustration of a transistor or diode integrated circuit matrix formed of a plurality of substantially parallel electrically conducting rows x 1 - x n and a second plurality of spaced apart parallel electrically conducting columns y 1 - y n which are disposed normal to the rows but out of contact therewith . the rows and columns are disposed in separate levels with transistor or back - to - back diode 10 located at the intersection or cross - over points of columns and rows . conventionally , information is stored in the matrix in a binary state , typically a fused or shorted junction of the transistor or back - to - back diode 10 represents one of the two binary states which represent information such as a computer program to be stored in memory ; one such shorted junction shown by the dotted connection 12 between the emitter and base of the transistor or one junction of a back - to - back diode 10 located at the crossover point between conductors x 1 and y 2 . the fused junction between one row and one column is information permanently stored in the matrix and thus , the matrix is commonly termed a read - only memory or rom as stated above . turning now to fig2 and 3 , it can be seen that a single transistor or back - to - back diode of an integrated circuit matrix in accordance with the present invention is illustrated schematically . the illustrated single transistor or back - to - back diode 10 , as shown in fig3 includes an n - type epitaxial region 12 on a p - type substrate 14 at the top of which there is formed a p - type base region 16 within which are formed an n + type collector region 18 and an n + type emitter region 20 . an oxide . coating 22 insulates the upper surface and overlays the pn junctions thereat . openings 24 and 26 are provided through the oxide layer 22 for a contact 28 , contact 30 , and an optional base contact ( not shown ). the transistor or back - to - back diode illustrated is similar to a normal high frequency npn transistor formed utilizing the washed emitter process , such as disclosed in the patent to sanders u . s . pat . no . 3 , 783 , 048 , supra . this process comprises generally the functions of forming the base region 16 by diffusing p - type impurities through a window ( not shown but essentially of a size generally defined by the periphery 32 of the base layer 16 ) in the oxide layer 22 and during this high temperature diffusion process of a thinner layer of oxide ( not shown ) over the surface exposed by the window and thereafter the formation of phosphorous doped silicon dioxide over the entire exposed surface by thermal growth in an atmosphere containing phosphorous atoms or by the deposition of sio2 together with the phosphorus atoms . the collector window 24 and the emitter diffusion window 26 are opened by selectively etching such as by photoresist and standard photolithographic techniques but the oxide layer 22 is left substantially intact . during the n + emitter and collector diffusion step with phosphorus typically used as a donor impurity , the n + type collector region 18 and emitter region 20 are formed beneath the windows 24 and 26 . since diffusion occurs in every direction within the base region 16 , the collector and emitter regions ultimately extend beyond the sides of the windows beneath the oxide layer 22 . as a consequence of the high temperature phosphorus diffusion process , a phosphorus doped silicon dioxide layer ( not shown ) is grown over windows 24 and 26 and over the remaining exposed surface including the previously applied oxide layers . by virtue of the high phosphorus concentration and the thinness of the aforementioned oxide layer over windows 24 and 26 , a brief hf etch is sufficient to reopen the windows to permit the application of the collector and emitter contacts 26 and 28 , while leaving the oxide layer over other areas substantially unetched . moreover , this washed emitter window is smaller than the surface of emitter region because of the aforementioned lateral diffusion and is therefore an ideal size through which to deposit the emitter and collector contacts 28 and 30 therethrough together with a relatively small piece of metal 34 . this metal 34 is introduced into the same window 26 as the emitter contact material to overlie the pn junction between the base and the n + emitter . this piece of metal 34 is completely out of physical contact with the other metals . the foregoing description of the washed emitter process is conventional but given here in connection with the invention because it is important to the operation of this invention . the advantages of the washed emitter process in resolving mask alignment problems in the conventional diffusion process are known but it is important herein that the window used to locate the isolated metal 34 is located in close proximity to the pn junction . in a typical process , not using the washed emitter process , the distance between the edge of the window and the pn junction and therefore the edge of the metal and the junction is normally about 3 - 4 microns which is the absolute minimum because of the tolerance required for an alignment of a mask . when the washed emitter process is used , however , the distance between the edge of the window , therefore the metal , and the junction , is slightly less than the depth of the diffusion which in practice is about 6 / 10 ths of a micron deep . this means that there is only about 4 / 10 ths of a micron or so from the metal to the edge instead of the 4 - 6 microns . this is identified in fig2 by distance &# 34 ; d .&# 34 ; it can be appreciated that this is a 10 to 1 gain in distance with an approximately commensurate 10 : 1 reduction in time and energy required to fuse the junction . finally , not only is the distance &# 34 ; d &# 34 ; shortened by a 10 : 1 ratio over the distance available when a conventional process is used but the size of the metal 34 is kept to a minimum so that this small piece of metal 34 reduces the dissipation of heat by conduction . therefore , the temperature can rise higher for the same amount of applied power . the size of the piece of metal can be made as small as possible ; the size being limited only by photolithographic requirements with allowance for alignment of the masks used in the process of manufacture . presently , a piece of metal 3 microns by 3 microns is feasible and examples of materials suitable for the purpose are aluminum and gold . thus , with the distance between the metal 34 and the junction to be fused reduced , and with the size of the metal kept as small as possible , fusion takes place with an applied current of about 50 milliamperes at about 8 volts in about 1 to 10 microseconds or about 1 / 20 the energy required to fuse the junctions in the aforesaid prior art matrices with the result that current energy capabilities of interconnections can be reduced thus allowing a more compact structure . finally , from the foregoing it can be seen that the machine utilized to program the matrix according to a selected code can operate faster and with more accuracy than before . the term &# 34 ; fuse &# 34 ; or &# 34 ; fused &# 34 ; as used herein is to be interpreted in the broadest sense to describe the alteration of the pn junction so that the junctions can conduct current in both directions at a low voltage . also the terms &# 34 ; emitter &# 34 ; and &# 34 ; collector &# 34 ; are used to describe or identify conventional structure but are not intended to imply that such structure must be used in the conventional way in all modes of operation . | 7 |
referring now in detail to the drawings , the reference numeral 20 denotes generally a tamper resistant valve actuator and a special wrench 50 in accordance with this invention . the valve actuator 20 is illustrated in fig1 in a typical fire hydrant installation . it should be noted , however , that the valve actuator 20 and the special wrench 50 are adaptable for use within the purview of this invention in substitution of any operating nut found on fire hydrant nozzle caps or on other apparatus wherein it is advantageous to provide a tamper resistant nut . with regard to this exemplary embodiment , fig2 and 3 show a hydrant assembly including a seal plate 22 bolt mounted over a standpipe 24 and having a bonnet 26 enclosure . a vertically mounted valve stem 28 extends through the seal plate 22 and a yoke member 30 . the valve stem 28 has at its upper terminal an externally threaded stem extension 32 . the valve actuator 20 is coupled to the threaded stem extension 32 as will be described hereinafter . conventionally , a yoke stem nut ( not shown ) is threaded to the stem extension 32 and projects through an aperture 34 at the top of the bonnet 26 . the projecting portion of the yoke stem nut is conventionally provided with a standard pentagonal head . the improved valve actuator 20 , as shown in fig4 has a cylindrical body portion 36 and a conically tapered end forming a bullet shaped nose 38 . the distal end is provided with an internally threaded bore 40 approximately 11 / 2 &# 34 ; in depth having a 15 / 16 &# 34 ; internal diameter of 6 threads per inch of standard lefthand thread . in addition , a hollow core 42 approximately 11 / 8 &# 34 ; in diameter and 21 / 8 &# 34 ; in height is provided for receiving the threaded stem extension 32 . the overall length of the actuator 20 is approximately 4 - 1 / 16 &# 34 ; and the outside diameter is 1 - 17 / 32 &# 34 ;. a shoulder portion 44 is also provided along the cylindrical body portion 36 for positionally seating the valve actuator 20 upon a circular ledge 46 formed within the yoke 30 . a hold - down nut 47 secures the actuator 20 within the yoke member 30 . the bullet shaped nose portion 38 is substantially a conical section approximately 1 - 1 / 6 &# 34 ; in height having a rounded apex . the angular incination of the conical surface with respect to a vertical axis of the cone is within the range of 15 °- 35 ° and preferably 22 ° ( see fig6 ). it has been found that an inclination angle within this range provides a favorable nongrippable surface which cannot be clampingly engaged by conventional wrenches or other tools because this angular orientation does not present a sufficient surface area for the tool to obtain a significant bite . furthermore , the valve actuator 20 is fabricated of a case hardened steel to make same impervious to an impact blow by a cold chisel , punch , drill bit or similar instrument . a plurality of cone shaped indentations or recesses 48 have been provided in the bullet shaped nose 38 during fabrication . the recesses 48 are of uniform size and depth and are at a common level so as to lie within the same horizontal plane . in a preferred embodiment , each of the recesses 48 is teardrop shaped and at its deepest point penetrates approximately 5 / 64 &# 34 ; below the conical surface . this area of the recess has a 180 ° circumference and a diameter of about 5 / 16 &# 34 ;. the wall of the semi - circular perimeter forms an included angle of approximately 60 ° with a perpendicular passing through the circle as shown in fig6 . the remaining wall perimeter is gradually curved to coverage with the conical surface of the nose , as noted in fig6 a , to form an included angle greater than 120 ° and to provide a slip surface 49 being effective for defeating a chisel , spanner wrench , etc ., for operating the valve actuator 20 . it should be further observed that the slip surface 49 corresponds with the direction of rotation ( see broken arrow in fig6 a ) for opening the hydrant valve . it is contemplated that a companion wrench 50 will be used for operating the valve actuator 20 . the wrench 50 has an elongated handle 52 for providing leverage and terminates in an annular frame 54 . the frame member 54 defines a central opening 56 having a tapered side wall 58 corresponding to the angular inclination of the bullet shaped nose 38 . the annular frame 58 is further provided with internally threaded radial apertures for receiving threaded studs or set screws 60 , 62 , 64 . the set screws are preferably of case harden steel having a diameter of approximately 3 / 8 &# 34 ;. the set screws 60 , 62 have standard hexagonal heads for securement and a cone point 61 , 63 respectively , corresponding to the circular perimeter of the recesses 48 . the set screw 64 is similar to the aforementioned screws having a cone point 65 , however a knurled handle 66 has been provided to permit adjustable tightening when the cone points 61 , 63 , 65 are received within the deepest portion of the recesses 48 to grippingly engage the bullet shaped nose 38 as illustrated in fig8 . the valve actuator 20 can then be rotated either clockwise or counterclockwise upon application of a horizontal force to the handle 52 . it should also be noted that the distal end of the handle 52 includes a pentagon head 68 as shown in fig1 for operating the standard pentagonal nuts on the nozzle caps . an alternate embodiment of the invention will now be described with reference to fig1 -- 13 wherein the same reference numeral has been used for designating corresponding elements in the previous embodiment , however with the suffix &# 34 ; a &# 34 ; being added . an alternate valve actuator 20a has a stub cylindrical body portion 36a and an integrally formed conically shaped bullet nose 38a having a rounded apex . the base of the cylindrical body 36 has an annular shoulder 44a and further includes a rectangular recessed socket 40a . the nose portion 38a includes two shallow depth recesses or indentations 48a located at a common level or lying within the same horizontal plane . a third shallow depth recess or indentation 51 has been provided at a different elevation . furthermore , the recesses 48a are spaced 90 ° apart , whereas recess 51 is 135 ° from each of the respective recesses 48a . in all other respects the angular inclination of the conical surface of the nose portion 38a , as well as the depth and wall orientation of the recesses 48a , 51 correspond directly with those of the previously described embodiment . the variant recess pattern of the alternate actuator 20a has been found to provide a more effective deterrent in that it would be even more difficult to fabricate a tool for unauthorized operation of the actuating nut . the valve actuator 20a is shown in fig1 in a typical installation wherein the bullet shaped nose 38a projects above a cap 26a mounted above hydrant standpipe 24a . the socket 40a is coupled to a stem extension 32a and is thus adapted to actuate the valve assembly . the valve actuator 20a is adapted to be operated by a companion special wrench ( not shown ) structurally similar to wrench 50 except that the orientation of the threaded studs or set screws corresponds to the placement of recesses 48a , 51 with an adjustble set screw being adapted for engagement with recess 51 . it should further be noted that when the wrench 50 is placed upon the bullet shaped nose 38 , the cone points 61 , 63 , 65 rest upon the conical surface and that a clearance space 70 will provide a visual means for facilitating registration of the annular frame 54 so that the set screws 60 , 62 , 64 can be readily seated within the recesses 48 . a similar clearance space will be evident with regard to the modified embodiment of the actuator 20a . it should be also be observed , however , that even without this visible orientation , slight rotation of the wrench within an angular displacement of approximately 60 ° will usually be sufficient to seat the set screws within the indentations in either embodiment . it should thus be seen that there is provided a tamper resistant valve actuator which achieves the various objects of the invention and which is well adapted to meet the conditions of practical use . since various possible embodiments might be made of the present invention and various changes might be made in the exemplary embodiments as above set forth , it is to be understood that all material set forth or shown and described in the accompanying drawings is to be interpreted as illustrative and not in a limiting sense . | 8 |
referring to the figures generally , where like reference numerals denote like structure and elements , and in particular to fig1 and 2 , a collar stay perforating device 10 is depicted comprising a first lever member 12 , a second lever member 14 , a housing 16 and a guide slot 18 through which a collar stay 38 is inserted into device 10 . housing 16 further includes a releasable latch 20 . moving latch 20 in the direction of arrow a opens device 10 . movement of latch 20 in the direction of arrow b closes device 10 . housing 16 has an opening 30 which allows second lever member 14 to rise from housing 16 , when latch 20 is moved to the open position . fig1 illustrates an open configuration of device 10 whereupon second lever member 14 is raised exposing an inner surface 22 of second lever member 14 . second lever member 14 also has first and second side walls 24 a and 24 b as well as a top panel 26 . a portion of first lever member 12 contacts or bears upon a portion of inner surface 22 as will be discussed in detail later . preferably , inner surface 22 includes a plurality of protruding ridges 28 which contact the outer surface of first lever member 12 . first and second lever members 12 and 14 are pivotable or otherwise movable within housing 16 . housing 16 limits the movement of first lever member 12 . second sidewall 24 b has a notch 32 which cooperates with latch 20 to maintain device 10 in a closed position as shown in fig3 and 5 . top panel 26 conceals opening 30 when device 10 is in the closed configuration . top panel 26 also includes an extended portion 34 which extends over a portion of the upper surface of housing 16 when latch 20 and notch 32 cooperatively engage to maintain device 10 in a closed position . extended portion 34 may include a finger depression 36 to assist in finger placement during use of device 10 . device 10 further comprises a base member 40 having a discharge orifice 42 and a pad 44 as shown in fig3 - 5 . a pivot attachment 46 between base member 40 and second lever member 14 is shown in fig4 . pad 44 may be attached to the exterior surface of base member 40 as is commonly known to those skilled in the art , with adhesive attachment preferred . preferably , pad 44 is made of rubber , a soft plastic , or similar material to provide a soft , non - scratch imposing lowermost surface for device 10 . the internal components of device 10 are best seen in the exploded view provided by fig6 . first lever member 12 includes a hinge portion 48 which cooperatively fits with first hinge portions 50 a and 50 b of base member 40 . a hinge pin 52 secures hinge portion 48 to first hinge portions 50 a and 50 b thereby providing a pivot attachment 53 between base member 40 and first lever member 12 . similarly , second lever member 14 has hinge portions 54 a and 54 b that cooperate with a second hinge portion 56 of base member 40 . a hinge pin 58 secures hinge portions 54 a and 54 b to second hinge portion 56 to provide a pivot attachment 46 between base member 40 and second lever member 14 . a guide plate 60 corresponding to guide slot 18 is placed upon base member 40 and is aligned with guide slot 18 to create a guide pathway 61 . guide plate 60 further comprises a raised surface 62 having a punch hole 64 . guide plate 60 is positioned on base member 40 so as to align punch hole 64 with discharge orifice 42 . housing 16 has tracks 66 a and 66 b corresponding to the perimeter of raised surface 62 . tracks 66 a and 66 b properly align guide pathway 61 with guide slot 18 and secure guide plate 60 on base member 40 when housing 16 is secured to base member 40 . one of ordinary skill in the art will recognize that the width of guide slot 18 and guide pathway 61 may be adapted to accommodate collar stays of varying widths and depths . leaf springs 68 a and 68 a are secured in place on guideplate 60 by a spring clamp 70 . first lever member 12 pivots so that the inner surface of first lever member 12 rests upon leaf springs 68 a and 68 b . screws 72 a and 72 b insert through corresponding screw holes 74 a and 74 b and into screw seats ( not shown ) in housing 16 thereby securing base member 40 to housing 16 . a decorative inlay 76 , preferably made of a shiny metal , may be adhesively secured to the exterior surface of top panel 26 . pad 44 may be adhesively secured to the exterior surface of base member 40 . pad 44 has an opening 45 ensuring discharge orifice 42 is not obstructed . latch 20 has a protruding portion 78 which extends through a washer 80 and through a latch hole 82 in housing 16 . when device 10 is in a closed position , protruding portion 78 engages notch 32 and maintains device 10 in a closed configuration . moving latch 20 in the direction of arrow a ( see fig1 ) disengages protruding portion 78 from notch 32 . the force exerted upon first lever member 12 by leaf springs 68 a and 68 b urges the exterior surface of first lever member 12 to bear upon inner surface 22 thereby raising second lever member 14 above housing 16 . inner surface 22 of second lever member 14 includes a bearing surface 94 . bearing surface 94 preferably includes a plurality of protruding ridges 28 . ridges 28 may be made of any wear - resistant material as is commonly known in the art including such non - limiting examples as metal or plastic with glass filled nylon being preferred . preferably , base member 40 , first lever member 12 , guideplate 60 hinge pins 52 and 58 , leaf springs 68 a and 68 b , spring clamp 70 , are made of a hard , durable , wear - resistant material . suitable materials for these components may include plastic , or a metal such as steel . preferred is cold rolled steel with spring steel preferred for leaf springs 68 a and 68 b and spring clamp 70 . housing 16 is omitted from fig7 and 8 to better illustrate the operation of collar stay punch device 10 . first lever member 12 has an inner surface 84 and an outer surface 86 . a punch member 88 extends from the inner surface 84 . punch member 88 is designed and positioned on inner surface 84 to cooperate with punch hole 64 . located distally from pivot attachment 53 is a curved portion 90 of first lever member 12 . the inward curve of curved portion 90 provides a rounded or otherwise smooth contact surface between outer surface 88 and bearing surface 94 of second lever member 14 . the user of device 10 initially releases latch 20 to raise second lever member 14 from housing 16 to place device 10 in an open position . the user then inserts an end of collar stay 38 into guide slot 18 and slides collar stay 38 through guide pathway 61 until a portion of collar stay 38 extends under punch hole 64 . a user &# 39 ; s finger 92 then moves second lever member 14 toward base member 40 as indicated by arrow c in fig7 . this downward motion brings bearing surface 94 of second lever member 14 into contact with curved portion 90 of first lever member 12 . curved portion 90 preferably contacts bearing surface 94 proximate pivot attachment 46 to increase the torque potential afforded by the double lever configuration of device 10 . as user &# 39 ; s finger 92 moves second lever member 14 downward , the user initially experiences resistance from leaf springs 68 a and 68 b . as the downward motion continues , the user then experiences greater resistance as punch member 88 inserts into punch hole 64 whereupon a cutting edge 96 of punch member 88 engages collar stay 38 . collar stay 38 may be made of any material as is commonly known in the art including such non - limiting examples as plastic , paper , cardboard or a metal such as steel , stainless steel , brass , gold , silver or nickel . preferably , cutting edge 96 has a protrusion 98 for initially piercing collar stay 38 . cutting edge 96 and protrusion 98 are hard , sharpened surfaces and may or may not be made of the same material as first lever member 12 . preferred are cutting edge 96 and protrusion 98 made from cold rolled steel . protrusion 98 is preferably located on the portion of punch member 88 closest to pivot attachment 53 further increasing the torque potential of device 10 . with the downward force provided by user &# 39 ; s finger 92 , protrusion 98 pierces an initial hole in collar stay 38 with a minimal amount of force from user &# 39 ; s finger 92 . as user &# 39 ; s finger 92 continues to apply a downward force , the rest of cutting edge 96 engages collar stay 38 at the puncture point and cuts along the circumference of punch hole 64 . user &# 39 ; s finger 92 continues to move second lever member 14 downward as indicated by arrow d in fig8 until the entire cutting edge 96 cuts through collar stay 38 bringing punch member 88 into full cooperation with punch hole 64 . punch member 88 subsequently discharges a perforate 100 through discharge orifice 42 . the initial hole formed by protrusion 98 and the gradual cutting by cutting edge 96 contribute to reduce the shearing force required to fully perforate collar stay 38 by avoiding the simultaneous engagement of the entire cutting surface with collar stay 38 . removal of user &# 39 ; s finger 92 from second lever member 14 enables the resistance from leaf springs 68 a and 68 b to urge second lever member 14 to rise above housing 16 . the user may then remove collar stay 38 from guide pathway 61 . in view of the operational aspects of device 10 , it will be apparent to the skilled artisan that housing 16 also provides several safety features . housing 16 prevents the user &# 39 ; s fingers or clothing from becoming caught or pinched between the first and second lever members , as well as between the pivot attachments of each lever . in addition , the restriction of pivotal movement imposed upon first lever member 12 by housing 16 protects the user from the sharpened surfaces of cutting edge 96 and protrusion 98 . punch member 88 , cutting edge 96 and punch hole 64 may be designed as is commonly known in the art to provide any desired shape perforation in collar stay 38 . such shapes may include , but are not limited to , square , triangular , round , or elliptical . once removed from guide pathway 61 , collar stay 38 exhibits a clean - cut perforation 102 as shown in fig9 . preferably , perforation 102 is round in shape . one of ordinary skill in the art will readily realize that either end of collar stay 38 may be perforated with device 10 . fig9 shows one embodiment wherein perforation 102 is located in a round end portion 104 of collar stay 38 . however , device 10 may be used to readily apply a perforation to any portion of collar stay 38 . such portions may include a middle portion 106 as well as the pointed portion 108 of collar stay 38 . the skilled artisan will further recognize that device 10 may be employed to apply multiple perforations to collar stay 38 . in such a situation , guide pathway 61 may be adapted to have no restraint thereby enabling collar stay 38 to be inserted through guide pathway 61 so that at least the longitudinal midpoint of collar stay 38 extends under punch hole 64 . alternatively , guide slot 18 and guide pathway 61 may be situated within housing 16 to allow collar stay 38 to be inserted into one end of housing 16 and removed from an opposing end of housing 16 . such a configuration would facilitate the rapid application of multiple perforations to the collar stay . the double lever configuration of device 10 greatly reduces the force required to perforate a collar stay . device 10 is readily hand operated by placing second lever member 14 and base 40 between the thumb and forefinger , and squeezing the thumb and forefinger together in a closing motion . manual use of device 10 provides sufficient force to comfortly perforate collar stays having a thickness between 0 . 0005 inches to about 0 . 05 inches . best results are achieved when device 10 is used to perforate plastic collar stays . metal collar stays may also be perforated with the present invention . the double lever configuration of the present invention also contributes to the compactness of device 10 . device 10 has length between about 2 . 5 inches to about 3 . 5 inches , a width between about 1 . 0 inches to about 2 . 0 inches , and a height between about 1 . 0 inches to about 2 . 0 inches . this is advantageous as device 10 takes up minimal space in drawers , suitcases , garment bags and the like . the compactness of device 10 promotes portability as device 10 readily fits in purses , travel kits , toiletry or accouterment kits , and even pockets . upon perforating a collar stay with device 10 , a collar stay storage device 200 is provided to store perforated collar stays as shown in fig1 - 14 . device 200 includes first and second arcuate members 202 a and 202 b , a housing 204 , a cover member 206 and a push button 208 . a portion of each first and second arcuate member 202 a and 202 b extends into housing 204 through openings 205 a and 205 b respectively . housing 204 thereby maintains first and second arcuate members 202 a and 202 b in a pivotal relation to each other as will be described in detail below . [ 0050 ] fig1 shows device 200 in a closed configuration wherein first and second arcuate members 202 a and 202 b are engaged to form a closed loop . device 200 is particularly suited for the storage of perforated collar stays 210 a , 210 b , 210 c , and 210 d as the diameter for each of first and second arcuate members 202 a and 202 b is less than the diameter of the perforation in each collar stay . each collar stay 210 a , 210 b , 210 c and 210 d has a corresponding perforation 212 a , 212 b , 212 c , and 212 d through which either first arcuate collar stay 202 a or second arcuate collar stay 202 b is readily inserted . consequently , device 200 maintains collar stays 210 a - 210 d in an ordered , arranged and readily usable manner . a user pressing push button 208 disengages first arcuate member 202 a from second arcuate member 202 b . this provides a gap between first arcuate member 202 a and second arcuate member 202 b as shown in fig1 . in this open configuration , perforated collar stays may be placed onto storage device 200 by inserting either arcuate member through the perforation within the collar stay . fig1 shows second arcuate member 202 b being inserted through perforation 212 a of collar stay 210 a . it is preferred that the gap formed by opening arcuate members 202 a and 202 b is somewhat small , about 0 . 02 inches to about 0 . 10 inches , to reduce the chance that collar stays maintained on the arcuate members do not inadvertently slip or fall off device 200 upon addition or removal of another collar stay . after insertion of second arcuate member 202 b through perforation 210 a , the user releases pressure from button 208 and arcuate members 202 a and 202 b engage to form the closed loop , as shown in fig1 . removal of a collar stay from device 200 is similar wherein button 208 is pressed to disengage the arcuate members 202 a and 202 b , a collar stay is moved to the gap and removed from either arcuate member . device 200 may store as few as one or as many as about 30 perforated collar stays upon the closed loop formed by first and second arcuate members 202 a and 202 b . one of ordinary skill in the art will realize that the selectively releasable closed loop or ring formed by the engagement of first and second arcuate members 202 a and 202 b may result in a variety of shapes . the arcuate members may engage to form a substantially circular loop as shown in fig1 , 11 and 15 . alternatively , the shape of the arcuate members may be modified so that the shape of the closed loop may be any desired shape commonly known in the art including , but not limited to , square , rectangular , triangular , polygonal or elliptical . as shown in fig1 , device 200 also includes a spring 214 , pins 216 a and 216 b and a magnet 218 . first and second arcuate members 202 a and 202 b respectively include first and second elbows 220 a and 220 b , first and second arm segments 221 a and 221 b , first and second flat portions 222 a and 222 b and first and second holes 224 a and 224 b . pins 216 a and 216 b are disposed in respective pin seats 226 a and 226 b . arcuate members 202 a and 202 b are mounted onto the exposed portions of seated pins 216 a and 216 b through respective holes 224 a and 224 b . this provides each arcuate member with pivotal movement . first and second flat portions 222 a and 222 b , first and second arm segments 222 a and 222 b and first and second elbows 220 a and 220 b are disposed within housing 204 . the remaining portions of first and second arcuate members 202 a and 202 b extend through opening 205 a and 205 b respectively and project freely from housing 204 to form a closed loop . the ends of spring 214 are attached to elbow portions 220 a and 220 b to urge first and second arcuate members toward each other and into a closed position . button 208 comprises an exterior surface 228 and a button body 230 as shown in fig1 . button body 230 extends from exterior surface 228 inward into the interior of housing 204 with a portion of button body 230 extending between first and second arm segments 221 a and 221 b . circumferentially disposed and integral to button body 230 is a lip 232 which extends outwardly . lip 232 abuts against cover member 206 when device 200 is in a closed position . lip 232 maintains button 208 within housing 204 as shown in fig1 and 13 . cover member 206 has an opening 234 corresponding to the shape of button exterior 228 . cover member 206 attaches to the top of housing 204 thereby enclosing device 200 and maintaining button 208 , spring 214 , pins 216 a and 216 b and portions of the arcuate members within housing 204 as previously described . cover member 206 is secured to housing 204 as is commonly known in the art including , but not limited to , lip and groove attachment snap - on attachment or adhesively attached . housing 204 further includes button supports 234 a , 234 b , 234 c , and 234 d . button supports 234 a - 234 d guide the inward movement of button 208 when inward pressure is applied thereto placing device 200 in an open configuration . spring 214 extends between button support 234 c and 234 d attaching to first and second elbow portions 220 a and 220 b as previously described . the cross - sectional shape of button body 230 is a wedge shape or otherwise tapered such that the width of button body 230 is greater proximate button exterior 228 than the width of button body 230 distal button exterior 230 as depicted in fig1 . as button 208 is pressed inward into housing 204 , opposing outer surfaces of button body 230 are brought to bear upon first and second arm segments 221 a and 221 b . the inner movement of button 208 brings the widening cross - sectional configuration of button body 230 to bear upon first and second arm members 221 a and 221 b , gradually increasing the distance between the arm members . this causes at least one arcuate member to pivot about pin 216 a or 216 b thereby disengaging arcuate member 202 a from 202 b and providing a gap therebetween . housing 204 , cover member 206 and button 208 may be made of any durable material including , but not limited to plastic , rubber or metal . similarly , pins 216 a and 216 b , spring 214 and first and second arcuate members 202 a and 202 b are made of a durable material such as plastic or metal , with metal being preferred . magnet 218 is attached to the underside of device 200 as is commonly known in the art such as adhesive attachment , for example . device 200 may then be magnetically attached to base member 40 of collar stay punch device 10 as shown in fig1 . preferably , the shape of pad opening 45 conforms to the circumferential shape of housing 204 allowing magnet 218 to attach directly to the exterior surface of base 40 . this is advantageous as collar stay perforating device 10 and collar stay storage device 200 may be stored together . consequently , once a collar stay is perforated by device 10 , it may immediately be placed upon storage device 200 before being bent , broken or misplaced . device 200 may used in conjunction with collar stay perforating device 10 , or may be used separately . similar to collar stay perforating device 10 , an advantage of collar stay storage device 200 is its compactness , durability , and portability as well as its ease of operation . the length of device 200 is between about 1 . 5 inches to about 2 . 5 inches with the width being between about 0 . 5 inches to about 1 . 5 inches . the height of device 200 is about 0 . 3 inches to about 1 . 0 inch . given these dimensions , device 200 is a handy garment accessory that is readily stowed in a dresser drawer , a suitcase , a garment bag , a car glove compartment , a toiletry kit , a purse or even a pocket with or without device 10 . given its ease of operation device 200 may also be used to store such ringed objects as keys , paper clips , rubber bands , hair bands and the like . in another aspect of the present invention , device 200 may be used in conjunction with a mated attachment system . in this embodiment , an attachment component is affixed to the rear surface ( i . e ., the outer surface of housing 204 opposing button exterior 228 ) of device 200 . a mated attachment component is provided to releaseably attach to the attachment component of device 200 . the mated attachment component may then be affixed to any desired surface or structure that promotes ready access to the collar stays maintained by device 200 . for example , the mated attachment component may be affixed to a closet wall adjacent the closet area where shirts and / or blouses are stored . attaching device 200 to the mated attachment component thereby enables a person to conveniently retrieve collar stays from device 200 for use with a shirt or blouse as the shirt is retrieved for wear . the mated attachment component may be affixed to any surface or structure that is able to provide a suitable mounting platform for device 200 . such surfaces or structures may include the interior wall of a dresser , suitcase , garment bag or toiletry kit or even a bathroom wall . consequently , device 200 may be moved from one mated attachment component ( i . e ., a mated attachment component affixed to a closet wall ) to another mated attachment component ( i . e ., a mated attachment component affixed to an inner wall of a garment bag ) providing device 200 the versatility of use at home or during travel . the mated attachment system may be any releasable attachment system as is commonly known in the art wherein the attachment component and mated attachment component may include such non - limiting examples as a magnet and an iron - bearing metal or metal alloy , a hook or loop attachment system , a lip and groove attachment , and a snap and clip attachment . the attachment component may be affixed to device 200 as is commonly known in the art with adhesive attachment preferred . likewise , mated attachment component may be affixed to any suitable structure or surface as is commonly known in the art with adhesive attachment preferred . while the invention has been described with respect to certain preferred embodiments , as will be appreciated by those skilled in the art , it is to be understood that the invention is capable of numerous changes , modifications and rearrangements and such changes , modifications and rearrangements are intended to be covered by the following claims . | 8 |
hereinafter , the present invention will be described in detail with reference to examples . these examples are only for illustrating the present invention more specifically , and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples . human infectious norovirus ( genotype gii - 4 ) was heated at temperatures of 50 to 90 ° c . for 10 minutes , and then rna was obtained . rna isolation was conducted by using trizol ( invitrogen ) according to the general rna preparation protocol ( chomczynski p , mackey k . short technical report . modification of the trizol reagent procedure for isolation of rna from polysaccharide - and proteoglycan - rich sources . biotechniques 19 ( 6 ): 942 - 945 . 1995 ). 700 μl of trizol was placed in 1 . 5 ml tubes , followed by light vortexing , and then 200 μl of chloroform was dispensed in each tube , followed by vortexing , and then each tube was allowed to stand for 5 minutes . after centrifugation at 12 , 000 × g for 15 minutes at 4 ° c ., the supernatant was transferred into new 1 . 5 ml tubes , and an equal volume of isopropanol was dispensed for each tube , followed by vortexing , and then each tube was allowed to stand for 10 minutes . after centrifugation at 12 , 000 × g for 10 minutes at 4 ° c ., the supernatant was removed , and 500 μl of 75 % ethanol was dispensed , followed by light vortexing . after centrifugation at 7 , 500 × g for 5 minutes at 4 ° c ., the supernatant was removed , and rna was obtained by using 10 μl of rnase - free water . to 10 μl of the obtained rna , 1 μl of random primer , 4 μl of 5 × m_mlv rtase buffer , 2 μl of 5 × dtt , 2 μl of dntp , 0 . 5 μl of rnase inhibitor , and 1 μl of m_mlv rtase were dispensed , followed by reaction at 65 ° c . for 10 minutes , at 37 ° c . for 1 hour , and at 72 ° c . for 5 minutes . rt - pcr was conducted by reaction of pcr premix ( bioneer ), 16 μl of dnase - free water , and 2 μl of cdna , which was synthesized by adding forward and reverse primers of 1 μl for each . pcr conditions were : 95 ° c . for 5 minutes , 40 cycles of 95 ° c . for 30 seconds , 55 ° c . for 30 seconds , and 72 ° c . for 45 seconds , and 72 ° c . for 5 minutes for last extension . as can be confirmed in fig1 , the electrophoresis results obtained by conducting rt - pcr of norovirus heated at different temperatures of 50 - 90 ° c . also confirmed gene products in the heated non - infectious norovirus . therefore , it was confirmed that the infectious norovirus and non - infectious norovirus could not be distinguished by gene amplification . zebrafish ( danio rerio ) were purchased from a local aquarium , and five zebrafish were placed in each 1 l water bath using a reverse osmosis ( ro ) system water for an acclimation period of time . 400 mg of tricaine ( ethyl 3 - aminobenzoate methanesulfonate salt , sigma ) reagent used in the fish anesthesia , and 2 . 1 ml of 1 m tris were dissolved in 97 . 9 ml of distilled water , followed by adjustment to ph 7 , thereby preparing an anesthesia solution . 4 . 2 ml of the anesthesia solution was dissolved in 100 ml of ro system water , and the fish were anesthetized . the previously prepared sterile phosphate buffer saline ( pbs ) and norovirus ( genotype g ii - 4 ) diluted in sterile pbs of 20 μl for each ( titer 1 × 10 6 copy number ) were intraperitoneally administered to the zebrafish . a lysis buffer ( 10 mm tris , 2 mm edta , 150 mm nacl , 10 % triton x - 100 10 %, 10 % np40 ) was prepared , and a proteinase inhibitor and a phosphate were added to the lysis buffer at concentration ratios of 1 : 200 and 1 : 100 , respectively . the mixture was dispensed into each 1 . 5 ml tube , and the zebrafish were rapidly frozen in liquefied nitrogen and then placed in the prepared 1 . 5 ml tubes . the zebrafish were cut into small tissues using sterile dissection scissors , and then homogenized using a homogenizer . these works were conducted in ice . the homogenized zebra tissues were subjected to vortexing once for every five minutes , followed by reaction in ice for 20 minutes . thereafter , the centrifugation was conducted at 15 , 000 rpm for 13 minutes at 4 ° c ., thereby obtaining supernatant . the zebrafish were sampled by date , and proteins were extracted . the protein change was confirmed by coomassie brilliant blue . the protein change was confirmed using proteomic analysis in the zebrafish on day 3 on which there was the most significant difference . as can be confirmed in fig2 showing the protein change using the ingenuity pathway analysis ( ipa ) on the basis of the analyzed proteins , several important factors in the proteins were confirmed through protein analysis . of these , three kinds of biomarkers , heat shock protein 90α ( hsp90α ), heat shock cognate 71 ( hsc71 ), and transferrin receptor ( tfr ) were confirmed to be overexpressed by infectious norovirus . biomarkers were specified according to the results of fig2 showing the protein change analyzed by obtaining proteins of the zebrafish infected with human infectious norovirus . 30 fig of each zebrafish protein was loaded on sds - gel , and then the protein was transferred to the pvdf membrane ( immobilon - p , millipore ). each membrane was blocked with tbst ( 1 % tween20 tbs ) mixed with 5 % skim milk for 1 hour . each primary antibody of hsc71 ( anti - hsc71 antibody , rabbit , cell signaling ), hsp90α ( anti - hsp90α antibody , rabbit , anaspec ), and tfr - 1b ( anti - tfr - 1b antibody , rabbit , anaspec ) was dispensed at a concentration of 1 : 1000 in tbst mixed with 5 % skim milk , followed by reaction overnight in a refrigerator . after washing three times with tbst for 10 minutes , secondary antibody ( polyclonal goat , anti - rabbit immunoglobulins hrp , dako ) was dispensed at a concentration 1 : 2000 in tbst mixed with 5 % skim milk , followed by reaction at room temperature for 2 hours . after washing five times with tbst for 5 minutes , the protein change was confirmed through a reaction with a western blot substrate ( luminata crescendo , millipore ). fig3 a and 3 b show the results of confirming the expression of biomarkers , hsp90α and hsc71 , by date through western blot . on day 3 of the infection , the protein expression between mock ( sterile pbs inoculation group ) and norovirus infection group were greatly differentiated , and on day 4 of the infection , the expression level was significantly reduced in both of the mock group and the norovirus infection group , and thus the effect could not be confirmed . therefore , it was investigated the possibility as biomarkers of hsp90α and hsc71 by using inhibitors of hsp90α and hsc71 , which are considered to be biomarkers , in the zebrafish proteins on day 3 of the norovirus infection . fig4 a and 4 b show the results of reducing the protein expression , which was increased due to the norovirus infection , through hsp90α inhibitor ( 17aag , sigma ) and hsc71 inhibitor ( knk437 , sigma ), and thus confirmed the functions as biomarkers . in addition , when the tfr - 1 b ( transferrin receptor 1 b and anaspec ) antibody was used , the proteins were expressed in the norovirus infection group , and when using together with hsp90α inhibitor and hsc71 inhibitor , the protein expression was reduced , but the protein expression was still confirmed ( fig4 c and 4 d ). norovirus was heated at different temperatures for 10 minutes , and thus zebrafish were infected with non - infectious state norovirus . on day 3 of the infection , the proteins were extracted from the zebrafish , followed by western blot , thereby confirming the protein change . the expression levels of hsp90α and hsc71 were increased in the norovirus heated at 50 ° c . and wild type ( wt ) norovirus , but similar levels of proteins were expressed in the norovirus heated at 70 ° c . and 90 ° c . and in the zebrafish inoculated with only sterile pbs . therefore , hsp90α and hsc71 could be confirmed as biomarkers that can distinguish between human infectious and non - infectious norovirus . in addition , the expression of tfr - 1 b occurred in only groups infected with norovirus heated at 50 ° c . and wt norovirus , and thus hsp90α and hsc71 could be confirmed as more accurate biomarkers . the previously prepared sterile phosphate buffer saline ( pbs ) and norovirus diluted in sterile pbs of 20 μl for each case were intraperitoneally administered to the zebrafish anesthetized using an anesthetic solution . in addition , 100 μg / ml con a ( concanavalin a , sigma ) was allowed to react with human infectious norovirus ( genotype g ii - 4 , titer 1 × 10 6 copy number , reaction in a rotator at room temperature for 1 hour ), and 20 μl of the resultant material was intraperitoneally administered to zebrafish . zebrafish proteins were obtained 3 days after the infection , followed by western blot . the expression levels of hsp90α and hsc71 were shown to still increase by about 2 - fold in the group infected with only norovirus ( fig6 a ). however , the proteins of the zebrafish infected with norovirus plus con a were expressed at similar levels compared with the group infected with only sterile pbs . in addition , as for tfr - 1b antibody , the zebrafish infected with norovirus plus con a showed a different tendency as compared with the treatment with inhibitors . that is , the transferrin receptor was not expressed ( fig6 b ). this is thought to suppress the norovirus infection per se . the infection and culturing of hepatitis a virus ( hav ) occur in frhk - 4 cells ( rhesus monkey kidney , atcc ), and thus the frhk - 4 cells were utilized as a cell line capable of suppressing the infection mechanism . the frhk - 4 cells were cultured in a medium prepared by supplementing dulbecco modified eagle medium ( dmem , welgene ) with 10 % fetal bovine serum ( fbs , welgene ) and 1 % penicillin streptomycin ( sigma ). the frhk - 4 cells were dispensed in a 96 - well plate at 8 × 10 3 cells / well , and after 24 hours , when the the cells reached about 80 - 90 % of confluence , the virus inoculation was carried out . hav was added at 1 × 10 5 unit / well , and an equal volume of hav and 100 μg / ml con a 100 were allowed to react each other , and the reaction material was dispensed to each well . rna was obtained from the frhk - 4 cells treated with viruses by date , to investigate the copy number of hav . rna isolation was carried out by the method as in example 1 . the binding affinity according to the concentration of con a was investigated after hav was immobilized to the arg2 chip , and it was verified that the higher the con a concentration , the more the con a bound to the hav - immobilized chip ( fig7 ). in the hav infection group , the binding affinity was not largely changed until day 5 of infection , but on day 6 and day 7 of the infection , the binding affinity was increased by a value of about 2 log and the copies were 3 . 3 × 10 6 unit ( fig8 a and 8 b ). however , in the group infected with con a plus hav , the concentration of hav was 2 . 7 × 10 4 unit , which corresponded to a lower level than the inoculation concentration . in addition , from the images , the cytopathic effect ( cpe ) was observed in the group treated with hav , but the cpe was not observed in the group treated with hav plus con a . it is thought that con a obstructs the intercellular penetration of hav to suppress replication of hav . con a is bound between hav vp1 ( structure forming protein ) domain and hav vp2 domain , and the n - terminus of the hav vp2 domain binds with two molecules of con a to stabilize the structure binding ( fig9 ). it was investigated through rt - pcr and biolayer interferometry ( bli ) assay whether human infectious norovirus and con a bind to each other . rt - pcr was carried out according to the concentration of norovirus to obtain the ct value for each concentration of norovirus . each concentration of norovirus was mixed with 100 μl of con a - bound sepharose 4b resin ( 25 mg con a / ml ; c7275 , sigma ), followed by reaction for 10 minutes . after the reaction , the resin was subjected to centrifugation ( 2000 g , 3 minutes , 4 ° c .) to remove the supernatant , and then the resin was washed three times with the pbs solution , followed by rt - pcr . for the bli assay , a blitz system ( fortebio inc ., ca ) was employed , and an amine reactive biosensor ( arg2 ) chip and a protein a chip were used . after the norovirus was immobilized to the arg2 chip , the binding was investigated at con a concentrations of 0 - 10 μm . the test was carried out as follows : initial reference value , distilled water , 30 seconds : 20 mm 1 - ethyl - 3 -( 3 - dimethylaminopropyl )- carbodiimide ( edc ) and 10 mm sulfo - n - hydroxysuccinimide ( s - nhs ), 240 seconds ; loading : norovirus dissolved in naoac ( ph 4 ), 360 seconds ; blocking : 1 m ethanolamine ( ph 8 . 5 ), 240 seconds ; reference value : 10 mm pbs ( ph 7 . 4 ), 60 seconds ; association : con a dissolved in pbs , 180 seconds ; dissociation : 10 mm pbs ( ph 7 . 4 ) 240 seconds . sensorgrams are shown in fig1 and 11 using data analysis software 7 . 1 . 0 . 36 for the reference value ( 60 seconds ), association ( 180 seconds ), and dissociation ( 240 seconds ). a competitive reaction test was carried out using the protein a chip in order to investigate whether the binding portions of the antibody against norovirus and con a with respect to norovirus are the same as or different from each other . after the antibody was immobilized to the protein a chip , respective sensorgrams were investigated for samples of con a , norovirus , and norovirus mixed with con a ( 0 . 1 um and 5 um ). the test on the protein a chip was carried out as follows : initial reference value : pbs , 30 seconds ; loading : antibody dissolved in pbs , 120 seconds ; reference value : 10 mm pbs ( ph 7 . 4 ), 60 seconds ; association : sample ( fig1 ) dissolved in pbs , 120 seconds ; disassociation : 10 mm pbs ( ph 7 . 4 ) 300 seconds . sensorgrams are shown in fig1 using data analysis software 7 . 1 . 0 . 36 for the baseline ( 60 seconds ), association ( 120 seconds ), and dissociation ( 300 seconds ). fig1 shows the results of confirming the binding of con a and norovirus through rt - pcr . when ct values for 1 × 10 3 to 1 × 10 8 copies / rat of norovirus were compared with ct values for norovirus collected from con a - bound sepharose 4b resin , the ct value was reduced in a norovirus concentration - dependent manner , and when ct values of respective concentrations of norovirus were compared with ct values of norovirus collected from con a - bound sepharose 4b resin , the collection rate was confirmed to be 94 . 1 % on average . fig1 shows the binding affinity according to the concentration of con a after norovirus was immobilized to the arg2 chip , and it was verified that the higher the con a concentration , the more the norovirus bound to the norovirus - immobilized chip . after the antibody and con a were immobilized to arg2 chips , respectively , the binding of norovirus was investigated through the sensorgrams ( fig1 ). when sensorgrams of the antibody and con a were compared with each other for the same concentration of norovirus , it was verified that con a bound to the norovirus stronger than the antibody by 3 - fold . fig1 shows the results through a competition test whether the binding portion between the antibody and norovirus is the same as or different from the binding portion between con a and norovirus . after the norovirus antibody was immobilized to the protein a chip , sensorgrams for con a , norovirus , and norovirus plus con a ( 0 . 1 μm and 5 μm ) were compared with each other . as a result , it was verified that the norovirus bound to the antibody - immobilized chip by 0 . 23 nm in the norovirus sample as a positive control , and con a did not bind to the antibody - immobilized chip in the con a sample as a negative chip . through these results , the sensorgrams for the binding with antibody in the norovirus concentrations used in the test were obtained , and it could be verified that there was no binding between con a and the antibody . next , it was verified that the norovirus bound to the antibody - immobilized chip by 0 . 2 nm in the respective samples of norovirus and con a ( 0 . 1 μm and 5 μm ), which were almost similar to sensorgrams in the positive control . in addition , the fact that the norovirus was bound to the antibody - immobilized chip regardless of the binding of con a and the norovirus seems that the binding sites of con a and the antibody with respect to the norovirus were different from each other . in order to investigate whether rotavirus among the poisoning viruses binds to con a , a viral detection probe was manufactured by linking biotinylated con a to streptavidin connected to magnetic beads as a magnetic body material . for the biotinylation of con a , first , a labeling reaction was carried out by transferring 100 μl of con a ( 1 mg / ml ) into a reaction tube ( component c ). 1 / 10 of 1 m sodium bicarbonate was added , and mixed by pipetting , and then 1 μl of biotin - xx sse was added and mixed , followed by reaction at room temperature for 15 minutes . next , for the separation of con a , the gel resin was allowed to fill an upper chamber , and 800 μl of resin was allowed fill a column , followed by centrifugation at 16 , 000 g for 15 seconds . the filling of resin was carried out using a centrifuge . after the resin was washed with pbs solution , the biotin - bound con a reaction material was placed in the spin column filled with the resin , followed by centrifugation at 16 , 000 g for 1 minute , thereby obtaining a reaction material . the thus reacted biotinylated con a was linked to streptavidin - bound magnetic beads to manufacture a viral detection probe , and the manufacturing procedure thereof are as follows . rotavirus was placed in the tube with the manufactured viral detection probe , followed by reaction at room temperature for 10 minutes . after the immunological reaction , the antigen - lectin binding portion was attached to magnets of the con a - bound magnetic beads . the con a - bound magnetic beads were washed three times with 200 μl of pbs to remove non - specifically bound impurities , and then floated in 100 μl of pbs , and the suspension was transferred to a new 1 . 5 ml tube to remove the supernatant . in order to separate streptavidin - bound antigen - con a conjugate in the new tube , the conjugate was eluted with an eluent ( 50 mm glycine , ph 2 . 8 ), and neutralized to ph 7 . 5 with 100 mm tris . in addition , rt - pcr was carried out for the pure separation of rotavirus , and the virus was identified . in order to investigate whether rotavirus is detectable by immunoprecipitation using magnetic beads , rt - pcr of the eluted product was carried out to detect viruses . as rotavirus primers used in the polymerase chain reaction ( pcr ) for the use of viral identification , rov_vp4_f ( 5 ′- att tcg gac cat tta taa cc - 3 ′) and rov_vp4_r ( 5 ′- tgg ctt cgc cat ttt ata gac a - 3 ′) were used . the size of the pcr products amplified through the primers is 877 bp . the rov pcr conditions for viral identification were as follows . rov pcr conditions : 35 cycles of denaturation at 94 ° c . for 30 seconds , annealing at 55 ° c . for 30 seconds , and elongation at 72 ° c . for 30 seconds , and the final elongation at 72 ° c . for 7 minutes . after rt - pcr , the pcr products were subjected to electrophoresis to monitor bands . fig1 shows the results of electrophoresis after rt - pcr in order to investigate the binding of con a and rotavirus using the con a - bound magnetic beads . column 1 shows rt - pcr results of the solution obtained by performing elution on the magnetic beads , which were collected after the reaction with rotavirus , using an eluent , and column 2 shows rt - pcr results of the rotavirus stock solution . column 3 shows a negative control for confirming the success or not of pcr . as a result , the band corresponding to rotavirus amplification product of 877 bp was confirmed at the same position as in column 2 as a positive control . these results confirmed that con a was bound to rotavirus . the infection and culturing of rotavirus occur in ma - 104 cells ( green monkey kidney , atcc ), and thus the ma - 104 cells were utilized as a cell line capable of suppressing the infection mechanism . the ma - 104 cells were cultured in a medium prepared by supplementing dulbecco modified eagle medium ( dmem , welgene ) with 10 % fetal bovine serum ( fbs , welgene ) and 1 % penicillin streptomycin ( sigma ). the ma - 104 cells were dispensed in a 96 - well plate at 1 × 10 4 cells / well , and after 24 hours , when the the cells reached about 80 - 90 % of confluence , the virus inoculation was carried out . rotavirus was added at 1 × 10 5 unit / well , and an equal volume of rotavirus and 100 μg / ml con a 100 were allowed to react each other at room temperature for 1 hour , and the reaction material was dispensed to each well . rna was obtained from the ma - 104 cells treated with viruses by date , to investigate the copy number of rotavirus . rna isolation was carried out by the method as in example 1 . in the rotavirus infection group , the binding affinity was not largely changed until day 1 of infection , but on day 3 and day 5 of the infection , the binding affinity was increased by a value of about 1 . 5 log and the copies were 2 . 7 × 10 5 unit . however , in the group infected with con a plus rotavirus , the concentration of rotavirus was 6 . 4 × 10 4 unit , which was reduced by a value of 1 log compared with the rotavirus infection group . these results showed similar tendencies compared with the test using hav plus con a , indicating that the con a neutralized rotavirus to suppress the rotavirus infection ( fig1 ). although the present invention has been described in detail with reference to the specific features , it will be apparent to those skilled in the art that this description is only for a preferred embodiment and does not limit the scope of the present invention . thus , the substantial scope of the present invention will be defined by the appended claims and equivalents thereof . | 0 |
abstract of the invention — includes that part of a patent application that is the abstract as defined by the uspto guidelines alternate language — includes words that can be used as alternates for words in a patent application artificial intelligence — includes any computer program that uses neural nets and genetic algorithms . attorney — includes the attorney responsible for drafting and / or filing a patent application . background of the invention — includes that part of a patent application that is background as defined by the uspto guidelines claims — includes that part of a patent application that is claims as defined by the uspto guidelines date stamp — includes an electronic , unalterable stamp on an electronic file indicated the date that the file was created or received by a computer system . date of invention — includes the date a patent application has with a first time stamp degree of infringement — includes the statistically measured amount that a product or technical white paper infringes an issued patent application description of the invention — includes that part of a patent application that is description as defined by the uspto guidelines dollar value — includes a dollar amount that is defined as the value of a patent license of a patent end user — includes any user of a system including an inventor , researcher , attorney , or agent who interacts with the system , e . g ., by creating , enhancing , researching , filing , prosecuting , licensing , or invalidating , a patent application . an end user may be required to be a member of a central system . an end user may further be a group of inventors , consortium , corporation , or other entity capable of interacting with the system . electronic notification — includes an email or other means of digitally sending a message with a date and time stamp to an electronic address . filing date — shall be the time stamp of the date that a patent application was submitted to the patent office . filed patent — includes a patent application that is filed with the uspto file wrapper — includes all files associated with a patent application including but not limited to : the patent application , a certified search , notes of distinguishing language , notes of rejection , notes of additional distinguishing language , record of interview , additional prior art references , and all electronic notifications associated with a patent application . genetic algorithm — includes a computer algorithm that is capable of modifying and improving itself over time . infringement — includes that a product or technical white paper practices the invention protected by the claims of an issued patent . interview — includes an electronically recorded conversation between an end user and a patent examiner . literature prior art — shall be prior art for a patent application other than patents non - obviousness score — includes a score given to a patent application by a central system that relates the obviousness of the invention disclosed by the patent application to prior art cited by the central system . notes — includes any language added to a prior art record by an end user note of distinguishing language — includes notes provided by end users in response to the prior art cited in a certified search . these notes distinguish a patent application submitted by the end user over the prior art references contained in the certified search provided by the central system . note of additional distinguishing language — includes notes provided by end users in response to a second office action conducted by a patent examiner . note of rejection — shall be the notes contained in a second office action provided by a patent examiner novelty score — includes a score given to a patent application by a central system that related the novelty of the invention disclosed in the patent application to prior art cited by the central system online chat room — includes any electronic correspondence medium that allows for a real time , electronic conversation between a patent examiner and an end user . patent application — includes any document created to describe and invention by an end user patent application date — includes the time stamped date that a patent application was entered into a central system patent examiner — includes a person responsible for reviewing the patent application and deciding if the patent can be issued . patent examination queue — shall be the queue of patent applications that are assigned to a patent examiner that require office actions or reexaminations . patent invalidator — includes an end user who is attempting to invalidate an issued patent patent license — includes a legal right to use an invention disclosed in an issued patent patent office — includes the united state patent and trademark office ( what about the rest of the world ?) patent practitioner or practitioner — includes an attorney , agent , or inventor responsible for preparation , submission , and / or prosecution of a patent application . patent prior art — includes prior art that is filed and issued patents patent value score — includes a score assigned by an artificial intelligence system that demonstrates the strength of the claims of an issued patent in light of prior art . potential licensee — includes an end user who may want to license an issued patent prior art — includes any document with a time stamp prior to the time stamp of a patent application product — includes a created thing that can be protected by or that can infringe the claims of an issued patent published prior art — includes prior art that is available for review by the general public reexamination — includes a second examination of a patent after it has been issued . relevance score — includes a score assigned by an end user or by a central system to a particular piece of prior art as it relates to a particular patent application . research report — includes a report assemble by a researcher or a central system that contains prior art related to a patent application . researcher — includes a person who manually researches prior art databases to find prior art related to a patent application . score — includes a numerical value assigned to something as it relates to something else . status change — includes a change in status of a patent application as it moves through the patent process . changes in status can include but are not limited submitting the application for examination , receiving a certified search for the application , placing the patent application in an examiner queue , receiving an office action for the patent application , receiving a notice of allowance for the patent application , receiving a notice of missing parts for the patent application ; receiving a patent number for the patent application , and receiving an indication of interest from a potential licensee for the patent application . submitted patent application — includes a patent application that an end user submits to the central system for examination . subsequent patent application — includes an application that comes after a patent application . technical white paper — includes a text description of a product that describes the parts of the product and how they work together . time stamp — includes an unalterable recording of the time a document was created by , entered into , or received by a system . web - based application — includes an application that is accessible on the world wide web via a web browser such as microsoft &# 39 ; s internet explorer . the application will be stored on a central server and accessed via other computers . web - based form — includes an electronic form used to enter information by and end user into a web - based application unpublished prior art — includes prior art that is not available to the general public , but that can be viewed by employees of the central system . usefulness score — includes a score given to a patent application based on its usefulness as defined by the uspto guidelines . the term “ product ” means any machine , manufacture and / or composition of matter , unless expressly specified otherwise . the term “ process ” means any process , algorithm , method or the like , unless expressly specified otherwise . each process ( whether called a method , algorithm or otherwise ) inherently includes one or more steps , and therefore all references to a “ step ” or “ steps ” of a process have an inherent antecedent basis in the mere recitation of the term ‘ process ’ or a like term . accordingly , any reference in a claim to a ‘ step ’ or ‘ steps ’ of a process has sufficient antecedent basis . the terms “ an embodiment ”, “ embodiment ”, “ embodiments ”, “ the embodiment ”, “ the embodiments ”, “ one or more embodiments ”, “ some embodiments ”, “ certain embodiments ”, “ one embodiment ”, “ another embodiment ” and the like mean “ one or more ( but not all ) embodiments of the disclosed invention ( s )”, unless expressly specified otherwise . the term “ variation ” of an invention means an embodiment of the invention , unless expressly specified otherwise . a reference to “ another embodiment ” in describing an embodiment does not imply that the referenced embodiment is mutually exclusive with another embodiment ( e . g ., an embodiment described before the referenced embodiment ), unless expressly specified otherwise . the terms “ including ”, “ comprising ” and variations thereof mean “ including but not limited to ”, unless expressly specified otherwise . the term “ consisting of ” and variations thereof mean “ including and limited to ”, unless expressly specified otherwise . the terms “ a ”, “ an ” and “ the ” mean “ one or more ”, unless expressly specified otherwise . the term “ plurality ” means “ two or more ”, unless expressly specified otherwise . the term “ herein ” means “ in this patent application , including anything which may be incorporated by reference ”, unless expressly specified otherwise . the phrase “ at least one of ”, when such phrase modifies a plurality of things ( such as an enumerated list of things ) means any combination of one or more of those things , unless expressly specified otherwise . for example , the phrase “ at least one of a widget , a car and a wheel ” means either ( i ) a widget , ( ii ) a car , ( iii ) a wheel , ( iv ) a widget and a car , ( v ) a widget and a wheel , ( vi ) a car and a wheel , or ( vii ) a widget , a car and a wheel . numerical terms such as “ one ”, “ two ”, etc . when used as cardinal numbers to indicate quantity of something ( e . g ., one widget , two widgets ), mean the quantity indicated by that numerical term , but do not mean at least the quantity indicated by that numerical term . for example , the phrase “ one widget ” does not mean “ at least one widget ”, and therefore the phrase “ one widget ” does not cover , e . g ., two widgets . the phrase “ based on ” does not mean “ based only on ”, unless expressly specified otherwise . in other words , the phrase “ based on ” describes both “ based only on ” and “ based at least on ”. the term “ represent ” and like terms are not exclusive , unless expressly specified otherwise . for example , the term “ represents ” do not mean “ represents only ”, unless expressly specified otherwise . in other words , the phrase “ the data represents a credit card number ” describes both “ the data represents only a credit card number ” and “ the data represents a credit card number and the data also represents something else ”. the term “ whereby ” is used herein only to precede a clause or other set of words that express only the intended result , objective or consequence of something that is previously and explicitly recited . thus , when the term “ whereby ” is used in a claim , the clause or other words that the term “ whereby ” modifies do not establish specific further limitations of the claim or otherwise restricts the meaning or scope of the claim . the term “ e . g .” and like terms means “ for example ”, and thus does not limit the term or phrase it explains . for example , in the sentence “ the computer sends data ( e . g ., instructions , a data structure ) over the internet ”, the term “ e . g .” explains that “ instructions ” are an example of “ data ” that the computer may send over the internet , and also explains that “ a data structure ” is an example of “ data ” that the computer may send over the internet . however , both “ instructions ” and “ a data structure ” are merely examples of “ data ”, and other things besides “ instructions ” and “ a data structure ” can be “ data ”. the term “ determining ” and grammatical variants thereof ( e . g ., to determine a price , determining a value , determine an object which meets a certain criterion ) is used in an extremely broad sense . the term “ determining ” encompasses a wide variety of actions and therefore “ determining ” can include calculating , computing , processing , deriving , investigating , looking up ( e . g ., looking up in a table , a database or another data structure ), ascertaining and the like . also , “ determining ” can include receiving ( e . g ., receiving information ), accessing ( e . g ., accessing data in a memory ) and the like . also , “ determining ” can include resolving , selecting , choosing , establishing , and the like . the term “ determining ” does not imply certainty or absolute precision , and therefore “ determining ” can include estimating , predicting , guessing and the like . the term “ determining ” does not imply that mathematical processing must be performed , and does not imply that numerical methods must be used , and does not imply that an algorithm or process is used . the term “ determining ” does not imply that any particular device must be used . for example , a computer need not necessarily perform the determining . it will be readily apparent to one of ordinary skill in the art that the various processes described herein may be implemented by , e . g ., appropriately programmed general purpose computers and computing devices . typically a processor ( e . g ., one or more microprocessors , one or more microcontrollers , one or more digital signal processors ) will receive instructions ( e . g ., from a memory or like device ), and execute those instructions , thereby performing one or more processes defined by those instructions . a “ processor ” means one or more microprocessors , central processing units ( cpus ), computing devices , microcontrollers , digital signal processors , or like devices or any combination thereof . thus a description of a process is likewise a description of an apparatus for performing the process . the apparatus can include , e . g ., a processor and those input devices and output devices that are appropriate to perform the method . further , programs that implement such methods ( as well as other types of data ) may be stored and transmitted using a variety of media ( e . g ., computer readable media ) in a number of manners . in some embodiments , hard - wired circuitry or custom hardware may be used in place of , or in combination with , some or all of the software instructions that can implement the processes of various embodiments . thus , various combinations of hardware and software may be used instead of software only . the term “ computer - readable medium ” refers to any medium that participates in providing data ( e . g ., instructions , data structures ) which may be read by a computer , a processor or a like device . such a medium may take many forms , including but not limited to , non - volatile media , volatile media , and transmission media . non - volatile media include , for example , optical or magnetic disk and other persistent memory . volatile media include dynamic random access memory ( dram ), which typically constitutes the main memory . transmission media include coaxial cables , copper wire and fiber optics , including the wires that comprise a system bus coupled to the processor . transmission media may include or convey acoustic waves , light waves and electromagnetic emissions , such as those generated during radio frequency ( rf ) and infrared ( ir ) data communications . common forms of computer - readable media include , for example , a floppy disk , a flexible disk , hard disk , magnetic tape , any other magnetic medium , a cd - rom , dvd , any other optical medium , punch cards , paper tape , any other physical medium with patterns of holes , a ram , a prom , an eprom , a flash - eeprom , any other memory chip or cartridge , a carrier wave as described any other medium from which a computer can read . various forms of computer readable media may be involved in carrying data ( e . g . sequences of instructions ) to a processor . for example , data may be ( i ) delivered from ram to a processor ; ( ii ) carried over a wireless transmission medium ; ( iii ) formatted and / or transmitted according to numerous formats , standards or protocols , such as ethernet ( or ieee 802 . 3 ), sap , atp , bluetooth ™, and tcp / ip , tdma , cdma , and 3g ; and / or ( iv ) encrypted to ensure privacy or prevent fraud in any of a variety of ways well known in the art . thus a description of a process is likewise a description of a computer - readable medium storing a program for performing the process . the computer - readable medium can store ( in any appropriate format ) those program elements which are appropriate to perform the method . just as the description of various steps in a process does not indicate that all the described steps are required , embodiments of an apparatus include a computer / computing device operable to perform some ( but not necessarily all ) of the described process . likewise , just as the description of various steps in a process does not indicate that all the described steps are required , embodiments of a computer - readable medium storing a program or data structure include a computer - readable medium storing a program that , when executed , can cause a processor to perform some ( but not necessarily all ) of the described process . where databases are described , it will be understood by one of ordinary skill in the art that ( i ) alternative database structures to those described may be readily employed , and ( ii ) other memory structures besides databases may be readily employed . any illustrations or descriptions of any sample databases presented herein are illustrative arrangements for stored representations of information . any number of other arrangements may be employed besides those suggested by , e . g ., tables illustrated in drawings or elsewhere . similarly , any illustrated entries of the databases represent exemplary information only ; one of ordinary skill in the art will understand that the number and content of the entries can be different from those described herein . further , despite any depiction of the databases as tables , other formats ( including relational databases , object - based models and / or distributed databases ) are well known and could be used to store and manipulate the data types described herein . likewise , object methods or behaviors of a database can be used to implement various processes , such as the described herein . in addition , the databases may , in a known manner , be stored locally or remotely from any device ( s ) which access data in the database . various embodiments can be configured to work in a network environment including a computer that is in communication ( e . g ., via a communications network ) with one or more devices . the computer may communicate with the devices directly or indirectly , via any wired or wireless medium ( e . g . the internet , lan , wan or ethernet , token ring , a telephone line , a cable line , a radio channel , an optical communications line , commercial on - line service providers , bulletin board systems , a satellite communications link , a combination of any of the above ). each of the devices may themselves comprise computers or other computing devices , such as those based on the intelr ® pentium ® or centrinoυ processor , that are adapted to communicate with the computer . any number and type of devices may be in communication with the computer . in an embodiment , a server computer or centralized authority may not be necessary or desirable . for example , the present invention may , in an embodiment , be practiced on one or more devices without a central authority . in such an embodiment , any functions described herein as performed by the server computer or data described as stored on the server computer may instead be performed by or stored on one or more such devices . according to an embodiment , the present disclosure provides a method for scanning and altering patent applications to protect a prior art database from illegal copying . according to one aspect of this embodiment , patent applications are scanned into a database . strategic errors and additions are placed in the electronic patent documents and the result is copyrighted . the errors and additions are added either manually or by the system based on rules . 1 . check sums of each page for communications error handling 2 . indexes 3 . hyperlinks to other patents , prior art and or other sections ( cross links ) 4 . commentary an encryption system could automatically calculate how and where to make the changes to the patent application files . the system can be built utilizing three different architectural methods : 1 ) a simple , table based method 2 ) a rules based system or 3 ) an artificial intelligence ( al ) system such as neural net , or bayesian algorithm . accordingly , the presently described system may incorporate one or more programs or modules configured to perform the various functions described herein . these programs may be housed on one or more servers , including system or client servers . as a non - limiting example , the system may include the following programs housed on the following server : the system may further include one or more databases configured to collect and associate various data . non - limiting examples of databases that would be suitable in the presently described system include : moreover , the system may be configured to perform various method steps such as , but not limited to : 1 . receive patent application data 2 . generate errors and additions to patent application data 3 . store patent application data with errors and omission the invention is described with reference to several embodiments . however , the invention is not limited to the embodiments disclosed , and those of ordinary skill in the art will recognize that the invention is readily applicable to many other diverse embodiments and applications . accordingly , the subject matter of the present disclosure includes all novel and nonobvious combinations and subcombinations of the various systems , methods and configurations , and other features , functions , and / or properties disclosed herein . where a limitation of a first claim would cover one of a feature as well as more than one of a feature ( e . g ., a limitation such as “ at least one widget ” covers one widget as well as more than one widget ), and where in a second claim that depends on the first claim , the second claim uses a definite article “ the ” to refer to the limitation ( e . g ., “ the widget ”), this does not imply that the first claim covers only one of the feature , and this does not imply that the second claim covers only one of the feature ( e . g ., “ the widget ” can cover both one widget and more than one widget ). each claim in a set of claims has a different scope . therefore , for example , where a limitation is explicitly recited in a dependent claim , but not explicitly recited in any claim from which the dependent claim depends ( directly or indirectly ), that limitation is not to be read into any claim from which the dependent claim depends . when an ordinal number ( such as “ first ”, “ second ”, “ third ” and so on ) is used as an adjective before a term , that ordinal number is used ( unless expressly specified otherwise ) merely to indicate a particular feature , such as to distinguish that particular feature from another feature that is described by the same term or by a similar term . for example , a “ first widget ” may be so named merely to distinguish it from , e . g ., a “ second widget ”. thus , the mere usage of the ordinal numbers “ first ” and “ second ” before the term “ widget ” does not indicate any other relationship between the two widgets , and likewise does not indicate any other characteristics of either or both widgets . for example , the mere usage of the ordinal numbers “ first ” and “ second ” before the term “ widget ” ( 1 ) does not indicate that either widget comes before or after any other in order or location ; ( 2 ) does not indicate that either widget occurs or acts before or after any other in time ; and ( 3 ) does not indicate that either widget ranks above or below any other , as in importance or quality . in addition , the mere usage of ordinal numbers does not define a numerical limit to the features identified with the ordinal numbers . for example , the mere usage of the ordinal numbers “ first ” and “ second ” before the term “ widget ” does not indicate that there must be no more than two widgets . when a single device or article is described herein , more than one device / article ( whether or not they cooperate ) may alternatively be used in place of the single device / article that is described . accordingly , the functionality that is described as being possessed by a device may alternatively be possessed by more than one device / article ( whether or not they cooperate ). similarly , where more than one device or article is described herein ( whether or not they cooperate ), a single device / article may alternatively be used in place of the more than one device or article that is described . for example , a plurality of computer - based devices may be substituted with a single computer - based device . accordingly , the various functionality that is described as being possessed by more than one device or article may alternatively be possessed by a single device / article . the functionality and / or the features of a single device that is described may be alternatively embodied by one or more other devices which are described but are not explicitly described as having such functionality / features . thus , other embodiments need not include the described device itself , but rather can include the one or more other devices which would , in those other embodiments , have such functionality / features . numerous embodiments are described in this patent application , and are presented for illustrative purposes only . the described embodiments are not , and are not intended to be , limiting in any sense . the presently disclosed invention ( s ) are widely applicable to numerous embodiments , as is readily apparent from the disclosure . one of ordinary skill in the art will recognize that the disclosed invention ( s ) may be practiced with various modifications and alterations , such as structural , logical , software , and electrical modifications . although particular features of the disclosed invention ( s ) may be described with reference to one or more particular embodiments and / or drawings , it should be understood that such features are not limited to usage in the one or more particular embodiments or drawings with reference to which they are described , unless expressly specified otherwise . the present disclosure is neither a literal description of all embodiments of the invention nor a listing of features of the invention which must be present in all embodiments . neither the title ( set forth at the beginning of the first page of this patent application ) nor the abstract ( set forth at the end of this patent application ) is to be taken as limiting in any way as the scope of the disclosed invention ( s ). an abstract has been included in this application merely because an abstract of not more than 150 words is required under 37 c . f . r . § 1 . 72 ( b ). the title of this patent application and headings of sections provided in this patent application are for convenience only , and are not to be taken as limiting the disclosure in any way . devices that are described as in communication with each other need not be in continuous communication with each other , unless expressly specified otherwise . on the contrary , such devices need only transmit to each other as necessary or desirable , and may actually refrain from exchanging data most of the time . for example , a machine in communication with another machine via the internet may not transmit data to the other machine for long period of time ( e . g . weeks at a time ). in addition , devices that are in communication with each other may communicate directly or indirectly through one or more intermediaries . a description of an embodiment with several components or features does not imply that all or even any of such components / features are required . on the contrary , a variety of optional components are described to illustrate the wide variety of possible embodiments of the present invention ( s ). unless otherwise specified explicitly , no component / feature is essential or required . although process steps , algorithms or the like may be described in a sequential order , such processes may be configured to work in different orders . in other words , any sequence or order of steps that may be explicitly described does not necessarily indicate a requirement that the steps be performed in that order . on the contrary , the steps of processes described herein may be performed in any order practical . further , some steps may be performed simultaneously despite being described or implied as occurring non - simultaneously ( e . g ., because one step is described after the other step ). moreover , the illustration of a process by its depiction in a drawing does not imply that the illustrated process is exclusive of other variations and modifications thereto , does not imply that the illustrated process or any of its steps are necessary to the invention , and does not imply that the illustrated process is preferred . although a process may be described as including a plurality of steps , that does not imply that all or any of the steps are essential or required . various other embodiments within the scope of the described invention ( s ) include other processes that omit some or all of the described steps . unless otherwise specified explicitly , no step is essential or required . although a product may be described as including a plurality of components , aspects , qualities , characteristics and / or features , that does not indicate that all of the plurality are essential or required . various other embodiments within the scope of the described invention ( s ) include other products that omit some or all of the described plurality . unless expressly specified otherwise , an enumerated list of items ( which may or may not be numbered ) does not imply that any or all of the items are mutually exclusive . therefore it is possible , but not necessarily true , that something can be considered to be , or fit the definition of , two or more of the items in an enumerated list . also , an item in the enumerated list can be a subset ( a specific type of ) of another item in the enumerated list . for example , the enumerated list “ a computer , a laptop , a pda ” does not imply that any or all of the three items of that list are mutually exclusive — e . g ., an item can be both a laptop and a computer , and a “ laptop ” can be a subset of ( a specific type of ) a “ computer ”. likewise , unless expressly specified otherwise , an enumerated list of items ( which may or may not be numbered ) does not imply that any or all of the items are collectively exhaustive or otherwise comprehensive of any category . for example , the enumerated list “ a computer , a laptop , a pda ” does not imply that any or all of the three items of that list are comprehensive of any category . further , an enumerated listing of items does not imply that the items are ordered in any manner according to the order in which they are enumerated . in a claim , a limitation of the claim which includes the phrase “ means for ” or the phrase “ step for ” means that 35 u . s . c . § 112 , paragraph 6 , applies to that limitation . in a claim , a limitation of the claim which does not include the phrase “ means for ” or the phrase “ step for ” means that 35 u . s . c . § 112 , paragraph 6 does not apply to that limitation , regardless of whether that limitation recites a function without recitation of structure , material or acts for performing that function . for example , in a claim , the mere use of the phrase “ step of ” or the phrase “ steps of ” in referring to one or more steps of the claim or of another claim does not mean that 35 u . s . c . § 112 , paragraph 6 , applies to that step ( s ). with respect to a means or a step for performing a specified function in accordance with 35 u . s . c . § 112 , paragraph 6 , the corresponding structure , material or acts described in the specification , and equivalents thereof , may perform additional functions as well as the specified function . computers , processors , computing devices and like products are structures that can perform a wide variety of functions . such products can be operable to perform a specified function by executing one or more programs , such as a program stored in a memory device of that product or in a memory device which that product accesses . unless expressly specified otherwise , such a program need not be based on any particular algorithm , such as any particular algorithm that might be disclosed in this patent application . it is well known to one of ordinary skill in the art that a specified function may be implemented via different algorithms , and any of a number of different algorithms would be a mere design choice for carrying out the specified function . therefore , with respect to a means or a step for performing a specified function in accordance with 35 u . s . c . § 112 , paragraph 6 , structure corresponding to a specified function includes any product programmed to perform the specified function . such structure includes programmed products which perform the function , regardless of whether such product is programmed with ( i ) a disclosed algorithm for performing the function , ( ii ) an algorithm that is similar to a disclosed algorithm , or ( iii ) a different algorithm for performing the function . the present disclosure provides , to one of ordinary skill in the art , an enabling description of several embodiments and / or inventions . some of these embodiments and / or inventions may not be claimed in this patent application , but may nevertheless be claimed in one or more continuing applications that claim the benefit of priority of this patent application . applicants intend to file additional applications to pursue patents for subject matter that has been disclosed and enabled but not claimed in this patent application . | 6 |
one embodiment of an ethylbenzene production system according to the invention is depicted in fig1 . the ethylbenzene production system comprises a reactor vessel having several sections , namely an ethylation section , 10 b , a transalkylation section , 10 c , a rectifying section , 10 a , and a benzene stripping section 10 d . the reactor vessel , although depicted as a single vessel in fig1 can be in the form of several integrated vessels , so long as the integrated vapor and liquid traffic is maintained between the ethylation and the stripping section . the ethylation section , a fixed bed catalytic ethylation section , where vapor phase ethylene and mixed phase benzene feed streams react to form ethylbenzene and peb , is an isothermal reactor . because of the diluent effect of the methane and hydrogen in the ethylene feed , the ethylation reaction is carried out at a temperature that is at least 10 ° c . lower than the normal boiling temperature of benzene at a given ethylation pressure . the invention is not intentionally directed to the use of catalytic distillation in the reactor . cocurrent , mixed current and counter current flows would be formed , however , the thermodynamic effect on ethylene conversion by simultaneous separation of ethylbenzene product is insignificant . the heat of reaction and reboiler heat input to the system are recovered as 3 - 8 kg / cm 2 - g steam , to be generated in the tubes when the catalyst is placed in the shell . however , when the catalyst is placed in the tubes , the steam is generated in the shell . additional steam at 1 . 5 - 2 . 0 kg / cm2 - g would be generated at the overhead condenser . the dilute ethylene stream ( containing methane and hydrogen ) is introduced at the bottom of the catalytic ethylation section . the catalyst formulation is available at the public domain from cumene manufacturing technology . alcl 3 catalysts , which are known to be active for ethylation reactions at about 150 ° c ., could also be considered as a viable option for this system . hydrogen , methane , vapor phase benzene and cyclohexane pass to the rectifying section , and ethylbenzene , peb products , liquid phase benzene and heavy aromatics pass to the transalkylation section . fixed beds of catalyst will serve as transalkylator using a vapor liquid mixture of benzene and impurities such as cyclohexane , however no diluents of the ethylene feed the ethylbenzene and peb will be essentially in liquid phase . the catalyst formulation for the transalkylation can be identical to the one used for the ethylation section . the heat effect of this reaction is nearly zero , and the operating temperature range would be 220 - 250 ° c . depending on the pressure . the stoichiometric excess of benzene in the transalkylation section is over 1000 %, thus over 50 percent conversion of peb to ethylbenzene per pass occurs for the end of run . the remaining pebs ( after transalkylation ), along with the ethylbenzene , benzene , and heavy aromatics proceed to the benzene stripping section . the stripping section is at the bottom of the reaction vessel and is the section where benzene stripping occurs . about 25 actual trays ( 15 theoretical ) or equivalent packing can be used . stripping duty is provided by a fired heater ( or hot oil ) providing thermal duty at about 295 - 325 ° c ., depending on the pressure . the unreacted benzene along with cyclohexane is driven to the catalytic section , creating a localized excess of benzene , which improves reaction equilibrium to minimize peb formation . the stripping heat input also increases the ethylation reaction temperature , thus improving the ethylation rate of reaction and minimizing the amount of catalyst required . the upper section of the reactor vessel acts as a rectifier where reflux of benzene washes down the ethylbenzene vapors for full product recovery . vent gas , depleted of ethylene , proceeds to residual benzene recovery by refrigeration . in a preferred embodiment , a purge reactor similar to the one of the main reactor vessel described above , but without transalkylation section , could be included in the system . a purge stream from the ethylation loop with 60 to 85 wt % benzene ( 73 % in the demonstrated case ) reacts in a mixed phase with dilute ethylene . because of the low benzene to ethylene ratio , the conversion of ethylbenzene to pebs may reach 50 % or more . the bottom of the stripping section consists of ethylbenzene 35 - 65 wt % and the balance is pebs along with traces of benzene . this stream is routed to the feed of the ethylbenzene column as shown in fig1 . the off gas from the purge reactor is chilled for benzene and cyclohexane condensation . the off - gas , rich in unconverted ethylene , proceeds to the ethylene feed stream of the main ethylation reactor . the residual , non - converted liquid resulting from the ethylation of the purge contains approximately 15 - 20 wt % benzene and the balance non - aromatics , principally cyclohexane . this liquid is disposed to the pyrolysis gasoline export , or to a crude cyclohexane facility . in an alternative embodiment , as shown in fig2 the transalkylation section is contained outside of the reaction vessel . this alternative design can be used if there is a concern of catalyst plugging and deactivation by heavy aromatics , or if the reaction is being run at a pressure below 20 kg / cm 2 g . the resulting operating temperature of below 220 ° c . would deactivate the catalyst . when an impure benzene feed is used ( for example , a feed originating from pyrolysis gasoline fractionation ) the cyclohexane concentration builds in the upper rectifying section . the freezing points of pure benzene and cyclohexane are + 5 . 5 ° c . and + 6 ° c ., respectively . the eutectic effect of cyclohexane buildup results in depression of the freezing temperature of the mixture to approximately − 17 ° c . to − 10 ° c . ( depending on the ratio of benzene to cyclohexane ). thus , the benzene mixture from the rectifying section can be cooled to a temperature of − 5 ° c . or lower . the lower temperature permits a greater amount of benzene recovery from the vent gas . thus benzene recovery by refrigeration of the vent gas is a feasible approach , and the more conventional vent gas scrubber using peb liquid can be avoided . for pure benzene feed , a conventional vent scrubber is required , unless cyclohexane is added to the overhead . in u . s . patent application ser . no . 08 / 957 , 252 , the usage of impure benzene is proposed in conjunction with hydrotreating and fractionation of pyrolysis gasoline in an adjacent olefin plant . typically , this impure benzene resulting from pyrolysis gasoline includes about 2 - 6 wt % cyclohexane , depending on naphtha feed analysis and cracking severity in the olefin plant . the non - aromatic impurities also include traces of other c 6 and c 7 &# 39 ; s . these impurities would be allowed to build to a weight ratio of 0 . 3 - 0 . 70 to the benzene in the reflux drum . the eutectic effect of the impurities will allow the chilling the vent gas to − 2 ° c . to − 10 ° c ., becoming an economical way to recover residual benzene . some non - aromatic impurities will escape with the vent gas , and most of it would be purged as liquid . this methodology is described in u . s . patent application ser . no . 08 / 957 , 252 . for illustration and consistency purposes , an ethylbenzene production system for 380 , 000 tonne per year of ethylbenzene is described . the streams and apparatus designations are depicted in fig1 . the assumed production rate is based on 345 operating days per year . the dilute ethylene feed ( stream 1 ) to the facility is originated from a naphtha based olefin plant . stream no . 1 , at a pressure of 25 kg / cm 2 - g and a temperature of 30 ° c ., has the following stream no . 2 contains impure benzene from a pyrolysis gasoline source . more specifically , stream no . 2 comprises : at the end of the run , there is a total ethylene utilization 98 % and 0 . 8 % ethylene losses to heavy aromatics . thus , 97 . 2 % of the ethylene is converted to ethylbenzene , and the balance is routed to gaseous and liquid fuels . impurities build up in the liquid of the reflux drum 60 is 27 wt %. the system does not contain a purge reactor . ethylene enters the bottom of the ethylation catalyst bed and reacts with benzene in liquid phase at 180 ° c . the heat of reaction , 12 mm kcal / hr , about 975 kcal per kg of ethylene is mostly recovered by generating steam stream 16 and vaporizing benzene . the benzene is recondensed at the overhead and the vent gas chilling system 50 . about 5 . 0 % of the ethylbenzene formed in the ethylation catalyst beds further reacts with ethylene . about 3 . 8 % of the ethylbenzene ends as deb , 1 . 0 % as teb , and the balance , 0 . 2 %, as heavier aromatics . the overhead of the ethylation catalyst beds contains hydrogen , methane , benzene and small amounts of ethylbenzene and unconverted ethylene . the overhead gas from the ethylation beds proceeds to the rectifying section 10 a , about 5 to 7 trays , where ethylbenzene is recondensed . reactor vessel overhead gas stream 3 proceeds to condenser / steam generator 20 , and steam at 2 . 0 kg / cm 2 - g is generated . the gas is further cooled in heat exchange 30 to about 65 ° c . by preheating tempered water from 50 ° c . about 80 ° c . the gas is further cooled to 35 ° c . in heat exchanger 40 with 30 ° c . cooling water . the vent gas at 35 ° c . is chilled at heat exchanger 50 to − 5 ° c ., by using + 12 ° and − 8 ° c . refrigeration , for example , from the nearby olefin plant . liquid and vent gas products are separated in the reflux drum 60 and reheated to 30 ° c . by cold recovery at heat exchanger 50 . vent gas , stream 13 , at 22 kg / cm 2 - g and 30 ° c . proceeds to psa hydrogen recovery ( not shown ) or to a fuel gas system at the following composition : a purge , stream 4 , of 5 , 300kg / hr of liquid from the reflux stream 17 drum containing 73 wt % benzene is drawn from the reflux line at 30 ° c . by applying the optional purge reactor ( not shown ) the overall yield of ethylbenzene from benzene increases from 88 % to 97 %. the benzene yield losses will show as pyrolysis gasoline if no purge reactor is applied . liquid bottom product from the ethylation section 10 - b , stream 12 , contains benzene ; cyclohexane ethylbenzene and peb descend to the transalkylation section 10 - c along with recycle deb and teb . about 80 % of the peb is reconverted to ethylbenzene at the start of the run and 50 % at the end of the run . the material balance is based on end of run and transalkylation at 235 ° c . transalkylated product line , internal stream 6 , proceeds to the benzene stripping section 10 - d . reboiler 80 provides the stripping duty of about 16 mm kcal / hr . bottom product , stream 7 , results from benzene stripping and has the following composition : the bottom stripped product , stream 7 , at 310 ° c ., proceeds to the ethylbenzene column 90 . the overhead from the ethylbenzene column , stream 8 , is ethylbenzene product with 1 , 500 ppm of benzene and 250 ppm of cyclohexane . the bottom product from the ethylbenzene column stream 9 contains : this mixture , stream 9 , proceeds to peb column 100 , where heavy aromatics , stream 11 , are separated as bottom product . deb and teb overhead , stream 12 , recycle to the transalkylation section 10 - c stream 14 , by combining with benzene feed , stream 2 . in the conservative design , fig2 the conversion in the transalkylator will be 60 % at liquid phase reactor at about 270 ° c . about 3 , 500 kg / hr of deb and teb would react with about 10 , 000 kg / hr of pure benzene feed from stream 15 . the material balance at fig2 is somewhat different than fig1 and not shown . | 1 |
referring now to the figures of the drawing in detail and first , particularly , to fig1 thereof , there is shown , in the upper part , a conventional probe 10 for measuring the oxygen concentration or the air number λ in the exhaust gas of an internal combustion engine . the probe 10 comprises a measuring cell represented in the circuit diagram by a nernst voltage vs and an internal resistor of the measuring cell ris , together with a pump cell represented in the circuit diagram by a polarization voltage vp and an internal resistor of the pump cell rip . probe terminals 3 and 4 form a test electrode pair in the probe 10 for measuring the oxygen concentration in a measuring chamber of the probe 10 by determining the measuring - cell voltage vs between the terminals 3 and 4 . it will be understood that the voltage values and component values shown in the figure are intended merely as examples . when the probe 10 is operating , the oxygen concentration in the measuring chamber is adjusted to a predefined value corresponding to a predefined value of the measuring cell voltage ( measuring - cell setpoint voltage ) by appropriately controlling a pump current source 12 , thereby generating a pump voltage and accordingly a pump current which flows via the terminals 1 or 2 and the terminal 3 through the pump cell and causes a movement of oxygen ions into the measuring chamber or out of the measuring chamber ( pumping ). the pump current flows via a parallel circuit of a calibration resistor ric and an external measuring resistor rc in the probe 10 . the terminal 4 of the probe is connected to the non - inverting input of a differential amplifier 14 , to the inverting input of which a measuring - cell setpoint voltage vref is applied by a voltage source connected between the inverting input and the probe terminal 3 . this differential amplifier 14 compares the measuring cell voltage vs ( nernst voltage ) with the measuring - cell setpoint voltage vref and generates an analog deviation signal vin at its output . this deviation signal vin is fed to the inverting input of a pid controller 16 , to the non - inverting input of which a mid - range voltage vm is applied through a voltage source arranged between the said input and a ground connection of the circuit configuration . at the output of the pid - controller 16 a control signal for a subsequent pump current source 12 is formed from the deviation signal vin . for this purpose the output of the pid - controller 16 is connected via the probe terminal 1 to the calibration resistor ric of the probe 10 and a terminal of the external measuring resistor rc , the other terminal of which is connected to the probe terminal 2 as well as to the inverting input of the pump current source 12 configured as an operational amplifier . the non - inverting input of the pump current source 12 is connected to the non - inverting input of the pid - controller 16 and thus also to the mid - range voltage vm to ground . the pid - controller 16 thus forms a control circuit for the pump current source 12 , so that when the probe 10 is operating the measuring cell voltage ( vs ) is adjusted in order that it closely approximates to the measuring - cell setpoint voltage ( vref ). the block designated with 30 in the lower part of fig1 forms in summary a regulator for the pump current which is generated in a controlled manner by the pump current source 12 on the basis of a measurement of the measuring cell voltage vs . an evaluation amplifier 18 is provided for measuring the pump current flowing through the parallel circuit from ric , rc as a measure of the oxygen concentration or air number of the exhaust gas stream . this pump current measurement is performed by measuring the voltage drop in the resistor arrangement ric , rc , by connecting the input of this evaluation amplifier 18 , formed from a non - inverting input and an inverting input , to these resistors in parallel . the signal ipout provided at the output of the amplifier 18 is evaluated for mixture preparation and used by an electronic engine controller ( e . g . microcontroller — not shown ). because the pump current source 12 is configured as an inverting operational amplifier , the current flowing through the resistors ric , rc also flows as pump current through the pump cell of the probe 10 , and due to the feedback produced via the pump cell the operational amplifier 12 adjusts its output voltage in such a way that the input voltage difference closely approaches zero . the evaluation amplifier 18 then detects the voltage drop generated by the pump current on the parallel circuit of the resistors ric and rc , amplifies this voltage drop and lastly provides a measure of the pump current at its output , in the form of a voltage which is then forwarded to an adc of the engine controller for further processing . the block designated 50 in the right - hand part of fig1 represents a prior art circuit for measuring the internal resistor ris in the measuring cell of the probe 10 . since this internal resistor ris is greatly influenced by the temperature of the probe 10 and knowledge of the probe temperature is useful for various purposes , this circuit indirectly measures the probe temperature . an ac signal is generated by an oscillator osz and is modulated via a resistor rv and a decoupling capacitor cv of the probe 10 , the frequency of the oscillator signal differing sufficiently from the frequency of the useful probe signal . in response to the modulated signal and as a function of the internal resistor ris of the probe 10 , an ac signal is obtained , the amplitude of which is representative of the resistor ris and thus representative of the probe temperature . a measure of this amplitude is obtained by amplification of the ac signal with the aid of an amplifier 52 and subsequent rectification by a rectifier 54 , at the output of which a signal risout specifying the probe temperature is provided for the engine controller . fig2 shows a conventional equivalent circuit diagram of the internal resistor ( impedance ) ris of the probe 10 . in this diagram r 1 and c 1 represent the transfer impedance between the electrodes and the ceramic material , r 2 and c 2 represent the transfer impedance between grain boundaries of ceramic sinter particles and r 3 represents the inherent resistance of the sinter ceramic . fig3 shows a semi - logarithmic plot of the strongly temperature dependent internal resistor ris . from this it is clear that the resistance over the temperature range which is relevant in practice varies by many orders of magnitude . a qualitatively identical characteristic emerges for the internal resistor rip in the pump cell of the probe 10 . when the circuit shown in fig1 is operating , the following problem arises : the pump cell voltage between the probe terminals 2 and 3 is a function of the polarization voltage vp ( e . g . − 350 mv to + 450 mv ) and the product of the pump current and the pump cell resistance rip . when the probe is ready to operate , i . e ., when the probe 10 has reached its operating temperature of 750 ° c . for example , the internal resistance rip amounts to some 100 ohms , so that for a typical pump current of 6 ma the pump cell voltage is approx . 1 v , which is below the pump cell voltages at which damage to the probe 10 due to blackening typically begins . however , so that the internal combustion engine can be operated in a controlled way as soon as possible after starting , thus contributing to a reduction in emissions , there is a temptation to switch on the probe 10 earlier instead of waiting if possible until the probe 10 has safely reached its normal operating temperature . if the control loop for generating the pump current as described above is then closed during the heating phase of the probe , the differential amplifier 14 will generate a system deviation vin which the pid - controller 16 converts into a relatively large pump current demand ( voltage to rc , ric ), and the pump current source 12 then attempts to comply with this demand by raising the voltage at the pump cell until the required pump current flows . even at a probe temperature of 400 ° c . ( corresponding to an internal resistance rip of 3 . 5 kilo - ohms kω ) a pump current requirement of less than 1 ma is enough to exceed typical maximum permissible pump cell voltages . suitable measures must be taken to avoid this situation , which can permanently damage the probe 10 . the measures provided by the invention reliably limit the pump voltage and will be explained below with the aid of exemplary embodiments and by reference to fig4 to fig8 . in the description of exemplary embodiments which follows , the same reference numbers are used for like components or blocks with the addition of a lower case letter to differentiate the embodiment concerned . in the main only the differences relative to exemplary embodiments already described will be mentioned and reference will also be made expressly to the description of previous exemplary embodiments . fig4 shows a circuit configuration according to the invention for operating a linear lambda probe 10 a , from which some of the previously explained circuit components that are not important for an understanding of the novel concept have been omitted . details of their function can be obtained by referring to the explanations about the circuit shown in fig1 . the circuit according to fig4 is configured as follows : a signal source which provides the analog deviation signal vin already mentioned above is connected to ground on the one hand and to a terminal of a resistor r 1 on the other . the other terminal of the resistor r 1 leads on to first terminals of a resistor r 4 and of a capacitor c 1 as well as to the inverting input of a pid - amplifier 16 a . the non - inverting input of the pid - amplifier 16 a is connected to the first switching contacts of switching elements s 1 a and s 1 b ( e . g . switching transistors ) as well as to ground via a resistor r 3 . the output of the pid - amplifier 16 a is connected to the second terminals of r 4 and c 1 , as well as via a calibration resistor rc and a probe terminal 2 a to an internal resistor rip in a pump cell of the probe 10 a and the non - inverting input of an amplifier 12 a which forms the pump current source . the non - inverting input of the amplifier 12 a is connected to ground . the output of the amplifier 12 a leads to the other terminal of the pump - cell internal resistor rip ( probe terminal 3 a ), to the inverting input of a first comparator 22 a , to the non - inverting input of a second comparator 24 a and to second switching contacts of the switches s 1 a and s 1 b . the output of the comparator 22 a is connected to a control input of the switch s 1 a , whereas the output of the comparator 24 a is connected to a control input of the switch s 1 b . the non - inverting input of the comparator 22 a is connected to the positive pole of a first threshold voltage source vref 1 +, the negative pole of which is connected on the one hand to ground and on the other leads to the positive pole of a second threshold voltage source vref 1 −, the negative pole of which is connected to the inverting input of the comparator 24 a . the functionality of the circuit is as follows : the components shown in the upper part of fig4 , pid 16 a , r 1 , r 4 , c 1 and pump current source 12 a together with rc and rip correspond to the typical circuit configuration for adjusting the pump current on the basis of a control deviation signal vin , as shown in fig1 . the signal source shown in fig4 provides this signal vin and corresponds to the output of the differential amplifier 14 shown in fig1 . the special point to note about the circuit shown in fig4 , which is a second comparator circuit 70 a , is evident from the lower part of the circuit diagram . the voltage at the output of the pump current source 12 a ( pump voltage ) is compared by means of the two comparators 22 a , 24 a with a positive reference voltage vref 1 + and with a negative reference voltage vref 1 −. these two reference voltages define a permissible voltage range for the pump voltage to protect the pump cell from excessively high voltages . when the pump voltage is present between the positive reference voltage and the negative reference voltage , the outputs of the comparators 22 a , 24 a each provide a low - level signal ( logic level ), which is made available to the non - illustrated engine controller as an indicative signal lim + or lim −. if , on the other hand , the pump voltage of the pump current source 12 a exceeds the positive reference voltage vref 1 +, the output of the comparator 22 a changes to a high - level signal , which is indicated to the engine controller via the signal lim +. the high level of the signal lim + causes the switching element s 1 a to close , making a connection between the output of the pump current source 12 a and the non - inverting input of the pid - amplifier 16 a . on the other hand , if the pump voltage falls below the negative reference voltage vref 1 −, the output of the comparator 24 a changes to a high - level signal and the switching element s 1 b closes . this situation is also notified to the engine controller via the signal lim − and by means of the switching element s 1 b causes a connection to be made between the output of the pump current source 12 a and the pid - amplifier 16 a . during normal operation of the circuit configuration , i . e . when the pump voltage is present between the reference voltages vref 1 +, vref 1 + acting as threshold voltages , a predefined potential ( in this case a ground potential ) is applied to the non - inverting input of the pid - amplifier 16 a via the resistor r 3 , whereas if one of the threshold voltages is exceeded due to the closure of the corresponding switching element s 1 , a counter coupling path is enabled , applying a voltage to the non - inverting input of the pid - amplifier 16 a , which , with regard to pump voltage generation , counteracts the demand voltage vin , so that a stable equilibrium is established between the voltage operating via r 1 on the inverting input of the pid - amplifier 16 a and the voltage operating via the counter coupling path on the non - inverting input of the pid - amplifier 16 a , in such a way that in practice the pump voltage does not exceed the value of a threshold voltage . in summary the output voltage of the pump current source 12 a is restricted in a controlled manner to a predefined voltage range ( vref 1 +, vref 1 −). fig6 a and fig6 b show this fact with the aid of simulated signal variations for the circuit according to fig4 . fig6 a shows signals in the normal operating mode ( without limitation ) and fig6 b shows the same signals with limitation . limitation was simulated by simply increasing the internal resistance rip of the pump cell from 100 ohms to 1 kilo - ohm and leaving the input signal vin unchanged . the reference letters in fig6 a and 6b represent the following : a : the deviation signal vin , b : the signal at the output of the pid - amplifier 16 a , c : the signal at the output of the pump current source 12 a , d : the signal at the non - inverting input of the pid - amplifier 16 a . from fig6 a it is evident that starting with the deviation signal vin provided here as a sawtooth signal , the integrator behavior of the pid - controller 16 a converts this signal into a sine signal , which is moreover inverted . the pump voltage ( curve c ) then always lies within the permissible range defined by the limiting thresholds . the extremely low voltages on the non - inverting input of the pid - amplifier 16 a are generated by a finite resistance of the switching elements s 1 a , s 1 b and are virtually insignificant . for the limitation case according to fig6 b it is clear that the output signal of the pid - amplifier 16 a ( curve b ) is now drastically limited . accordingly the output signal of the pump current source 12 a ( curve c ) is exactly on the limiting threshold in the corresponding time periods . before the limiting threshold is reached the value of the signal at the non - inverting input of the pid - amplifier 16 ( curve d ) is 0 v . once the limiting threshold is reached this signal follows the same variation as vin until the value drops below the limiting threshold again . the signal then drops back to 0 v . fig5 shows a modification to the circuit configuration according to fig4 in the area of the provision of the threshold voltages . using this modification it is possible to specify both the positive reference voltage and the negative reference voltage as switch - selectable . for this purpose two positive reference voltages vref 1 +, vref 2 + and two negative reference voltages vref 1 −, vref 2 − are provided . switching can be carried out with the aid of corresponding control signals se 1 +, se 1 − using the toggle switches s 2 or s 3 . fig7 shows a further embodiment of an inventive circuit configuration , adapted to the application of the known circuit configuration shown in fig1 . since the supply to the entire circuit shown in fig7 comes from a single voltage source with a positive supply potential vcc ( 5v ), the non - inverting inputs of the pid - amplifier 16 b and of the pump current source 12 b are now referenced to a drawn off reference potential vref ( 2 . 25v ). accordingly the threshold voltages of the second comparator circuit 70 b have also been altered , namely to a positive reference voltage of 2 . 25v + 2v = 4 . 25v and a negative reference voltage of 2 . 25v − 2v = 0 . 25v . as with the embodiment shown in fig4 , here too only a pair of reference voltages is provided for defining the permissible pump voltage range . the simulated signal variations ( similar to fig6 b ) have also been determined for this circuit configuration in the limitation case and are shown in fig8 . in summary when a predefined threshold is exceeded the invention brings about a limitation of the pump voltage in that the voltage signal that needs to be limited ( pump voltage ) counteracts the causal control quantity ( vin ), or restricts its influence for limitation purposes . in the case of the exemplary embodiments shown , this voltage limitation is produced by means of comparators to which on the one hand the voltage is fed to the output of the pump current source and on the other hand a reference voltage is input , and when this is exceeded subsequent switching elements for enabling a counter coupling path are activated . | 6 |
throughout the following description , specific details are set forth in order to provide a more thorough understanding of the invention . however , the invention may be practiced without these particulars . in other instances , well known elements have not been shown or described in detail to avoid unnecessarily obscuring the invention . accordingly , the specification and drawings are to be regarded in an illustrative , rather than a restrictive , sense . fig1 is a flow chart illustrating a method 10 . fig2 illustrates schematically a system 50 that may be used in the practice of method 10 . method 10 is performed in a system , such as system 50 which includes an imaging device 12 and a host 14 coupled by a data link 16 . imaging device 12 generates image data . the image data comprises values associated with pixels in a sensing array . imaging device 12 may comprise a charge - coupled device ( ccd ), active pixel sensor ( aps ), complementary metal oxide semiconductor ( cmos ) sensor or other imaging sensor . imaging device 12 does not necessarily sense visible light but could sense other things such as infrared light , ultraviolet light , or other electromagnetic radiation outside of the visible part of the spectrum ; temperatures , vibration levels , or other measurable physical quantities ; chemical concentrations ; or the like . imaging device 12 may comprise another source of image data such as a data processor running a simulation that produces image data . imaging device 12 may optionally comprise a data processor , image processor or the like that processes raw image data from a suitable sensing array into the image data to be sent to host 14 . in some embodiments , imaging device 12 is capable of generating a large volume of image data . for example , in some embodiments , imaging device 12 is capable of generating values for 1 million or more pixels , in some cases , 6 million or more pixels . each pixel value may be represented by several bits of digital data . for example , in some imaging devices , each pixel value is represented by 8 to 24 bits of digital data . in some cases , a new set of image data is created periodically at a frame rate which may , for example , be in excess of 1 hz and in some cases is 30 hz , 60 hz , 200 hz , or more . data link 16 may comprise , for example , a serial bus such as an ieee 1394 ( also known as firewire ™) interface , cameralink ™, ethernet ( gige ), usb , another wired data communication interface , an optical data channel , a wireless data channel or the like . in some cases , data link 16 is a bottleneck that limits the performance of system 50 . this is especially the case where latency is an issue . for example , consider the case where system 50 comprises a control system for a robot such as a manipulator or the like and host 14 controls actuators that make parts of the robot move in response to image data . in such as system image data from imaging device 12 may be used to provide feedback to motion control algorithms . delays in transmitting the image data from imaging device 12 to host 14 can limit in the overall performance of the robot . host 14 may comprise a data processor , an image processor , which may be implemented in software , hardware , or a combination thereof , a programmed computer such as a personal computer or workstation , an embedded controller for an apparatus or system or a component of an apparatus or system , a collection of programmable controllers or data processors , or the like . in some embodiments , an embedded controller , which may constitute all or part of host 14 or another data processor and one or more imaging devices 12 are tightly coupled . this might be the case , for example where the embedded processor and imaging device ( s ) 12 are components of a ‘ smart camera ’. block 20 of method 10 comprises providing one or more predefined regions of interest 15 in imaging device 12 . each of the predefined regions of interest includes a subset of pixels in an array 13 of pixels 13 a of imaging device 12 ( see fig2 a ). where there are two or more predefined regions of interest , it is not mandatory that the regions of interest be equal in size , of the same shapes and / or dimensions , or non - overlapping . it is convenient to provide predefined regions of interest that are regularly - spaced , do not overlap , and are of the same sizes and shapes . in the embodiment illustrated in fig2 b , the predefined regions of interest specified in block 20 of method 10 ( see fig1 ) comprise tiles 15 a . tiles 15 a comprise rectangular groups of pixels 13 a that are non - overlapping and regularly - spaced . in the illustrated embodiment , the entire area of array 13 is covered with non - overlapping tiles 15 a . in the illustrated embodiment , each tile 15 a contains the same number of pixels . in the illustrated embodiment , each tile 15 a has the same shape and dimensions . it is not mandatory that tiles 15 a have these attributes in all embodiments . in some embodiments , tiles 15 a have widths that are an even multiple of 8 . in some embodiments there are between 25 and 256 predefined regions of interest . for example , it can be convenient to divide the image data produced by a camera into an array of tiles that is 8 × 8 or 16 × 16 . such embodiments have enough tiles that are large enough that , for many applications , image data for only a few tiles will be required and yet the image data for a few tiles is much smaller than the image data for the entire area of the imaging array . arrays of tiles having other dimensions such as 7 × 7 or 10 × 12 are also possible . the allocation of pixels 13 a to tiles 15 a does not need to be reflected in the physical structure of imaging array 13 . the pre - allocation of pixels 13 a to tiles 15 a is a logical relationship . as discussed below , that logical relationship may be embodied in any suitable manner including one or a combination of : circuitry ; a data record , data structure , data store or the like ; configurable circuitry ( such as a field - programmable gate array or the like ); the configuration of array 13 ( an array 13 may be constructed so that data from predefined regions of interest can be selectively read from the array ); etc . in block 22 imaging device 12 receives region selection information identifying one or more of the predefined regions of interest provided in block 20 . the region selection information preferably identifies selected regions by way of a compact identifier . the compact identifier may , for example , comprise a number corresponding to the selected region . in one embodiment , the compact identifier for each selected region comprises a logic flag , which may comprise one - bit , for example a position in a bit vector . enabling the flag selects a corresponding one of the regions . disabling the flag deselects the corresponding region . the region selection information may be received at imaging device 12 in various manners . for example : region selection information may be entered by way of a user interface 17 of imaging device 12 ; host 14 may transmit region selection information over data link 16 in a message addressed to or otherwise delivered to imaging device 12 ; host 14 may store region selection information in a memory location that is in or accessible to imaging device 12 ; or the like . the region selection information identifies one or more of the previously - defined regions of interest and , in preferred embodiments , does not contain sufficient information ( position , size , shape etc .) to define the regions of interest . in block 24 , imaging device 12 maintains a list or other record 18 of selected tiles 13 b . list 18 is maintained within a selected tile register 19 of imaging device 12 . as described below , imaging device 12 uses the information about what tiles are selected to assemble image data from the selected tiles ( or other regions of interest ) for transmission to host 14 . in block 26 method 10 allocates bandwidth for the delivery of image data from imaging device 12 to host 14 over data communication path 16 . block 26 is optional , especially in cases where : sufficient bandwidth is pre - allocated , data communication path 16 is dedicated solely to communication between host 14 and imaging device 12 , there is more than sufficient bandwidth for imaging device 12 and any other devices that share data communication path 16 . allocation of bandwidth may be based upon the number of selected tiles 15 a or , more generally , on a number of pixels in selected regions of interest 15 ( there is a difference when different regions of interest include different numbers of pixels ). in this way sufficient bandwidth for the transmission of image data for the selected tiles 15 a is made available while allowing any surplus bandwidth to be allocated for other purposes . in some embodiments , block 26 comprises allocating bandwidth sufficient for the image data for an expected maximum number of selected tiles 13 b . this approach can be advantageous in cases where reducing the overhead of re - allocating bandwidth each time the number of selected tiles 13 b changes is more important than minimizing the bandwidth allocated to the transmission of image data from imaging device 12 to host 14 . the mechanism for reserving or allocating bandwidth for image data , if there is such a mechanism , may be provided for in the protocol governing the operation data link 16 . various mechanisms for reserving bandwidth are available commercially and / or known to those of ordinary skill in the art of designing data communication links . in block 28 , imaging device 12 acquires image data . block 28 may involve opening mechanical or electronic shutters of a camera , acquiring a video frame or the like . block 28 need not occur at the location in method 10 indicated in fig1 . block 28 may cycle continuously or occur at any time prior to block 29 . in some embodiments it is important that image data be recent . in such embodiments , block 28 may occur immediately prior to block 29 . in block 29 imaging device 12 reads out the image data from imaging array 13 . in some embodiments , performance is improved by not reading out image data from at least some pixels that are outside of the selected tile ( s ) 13 b . block 29 may comprise storing the image data in a data buffer or other memory in or accessible to imaging device 12 . in block 30 , imaging device 12 transmits image data from the selected tile ( s ) to host 14 by way of data communication path 16 . in some applications , blocks 29 and 30 may be performed simultaneously so that image data that has been read out of imaging array 13 earlier is transmitted to host 14 while other image data is still being read out of imaging array 13 . image data may be transmitted to host 14 in any suitable format . some example formats are : in an image - aligned format , data standing for the pixels in the entire image or an entire part of the image is transmitted , only the pixels in selected tiles contain actual values . data in the image - aligned format corresponding to pixels outside of the selected tiles is set to a placeholder value ( for example , zero ). in some embodiments the protocol by which data is transmitted over data communication path 16 involves compression . in such embodiments , large contiguous areas within the image data in which the image data is set to the placeholder value can be transmitted very efficiently . fig3 a is an example of a data structure 40 holding image data in an image - aligned format . data structure 40 has data corresponding to a number of selected regions ( corresponding to corners of the imaging array in the illustrated example ) and placeholder data in other regions . in fig3 a the placeholder data is indicated by “ 0 ” s and the image data is indicated by “ x ” s . the “ x ” s represent varying image data . fig3 a is schematic . in a typical implementation data structure 40 would comprise many more values than are illustrated in fig3 a . for example , data structure 40 may have values corresponding to a few hundred , a few thousand or more pixels in each dimension . in a tile - aligned format , the output image data transmitted to host 14 is made up substantially entirely of data from selected tiles . data corresponding to non - regions selected regions of the image is not transmitted . data for different tiles is separated ( e . g . the data for different tiles may be sent sequentially ). this can introduce latency in cases where the transmission of data for one tile is not commenced until the readout of data for a previous tile is completed and the data for the previous tile has been transmitted . fig3 b is an example of a data structure 43 holding image data in an tile - aligned format . data structure 43 has sections 44 a through 44 d each containing image data corresponding to one selected region of interest ( regions of interest 15 - 1 , 15 - 2 , 15 - 3 and 15 - 4 of imaging array 13 in the illustrated example ). in a tile - interleaved format , data is transmitted in row - order but only data from selected tiles is included . where a range of rows includes pixels belonging to two or more different selected tiles , data from the selected tiles is interleaved . a tile - interleaved format has the advantage of low latency at the cost of somewhat increased complexity in processing the data . fig3 c is an example of a data structure 45 holding image data in a tile - interleaved format . in data structure 45 , data is arranged in the same order as it is read out of imaging array 13 . this results in rows of any regions of interest that have pixels from the same row of imaging array 13 being interleaved . for example , regions of interest 15 - 1 and 15 - 2 are on the same rows of imaging array 13 and so the rows of image data from regions of interest 15 - 1 and 15 - 2 are interleaved in data structure 45 . in some embodiments , a variable - sized buffer is allocated at host 14 to receive the image data . the size of the buffer may be allocated to hold the expected image data . in some embodiments , the buffer is allocated by determining the number of selected tiles in each row ; determining the maximum number of selected tiles in any row of tiles ; determining the number of rows containing any selected tiles ; allocating a buffer having a width sufficient to receive the maximum number of selected tiles times the number of columns in each active tile and a height sufficient to receive the number of rows containing selected tiles times the number of rows in each tile . incoming image data can then be directed into the buffer . this may be performed by direct memory access ( dma ) or any other suitable technology . in block 32 host 14 processes the image data to provide some result , such as control signals for apparatus controlled by host 14 , or the like . loops 34 a and / or 34 b can be repeated to transmit fresh image data from imaging device 12 to host 14 at a suitable frame rate . fig4 shows a wire - bonding machine 80 according to an example embodiment of the invention . machine 80 comprises a stage 82 that is movable in x and y directions and can also be rotated . a vlsi chip 83 is mounted on stage 82 and is imaged by a camera 85 . a wire - bonding tip 86 that is movable in the z direction by an actuator 88 controlled by controller 84 is supported over chip 83 . controller 84 controls x - y motion and rotation of stage 82 in response to image data received from camera 85 over bus 87 by suitably controlling actuators 89 . when chip 83 is first placed on stage 82 the precise location and orientation of chip 82 is not known . controller 84 first must ascertain the position and orientation of chip 82 so that it can accurately position tip 86 over specific features on chip 83 . for this purpose , controller 84 obtains from camera 85 an image of chip 83 . it is not necessary to obtain image data for the entire chip 83 since the position and orientation of chip 82 can be determined by observing registration marks 91 that are present on chip 82 ( for example on corners of chip 82 , as shown ). controller 84 sends to camera 85 region select information selecting only certain predefined regions of the image covering areas where registration marks 91 corners of chip 82 are expected to be seen ( e . g . regions of interest that include image data for the corners of chip 82 ). camera 85 acquires an image and stores image data from the selected regions of interest in a buffer . as soon as there is sufficient image data in the buffer , camera 85 begins transmitting the image data to controller 84 . only image data for the selected predefined regions of interest is transmitted to controller 84 . advantageously , the image data is transmitted in an image - aligned or tile - interleaved format so that data transmission can begin before image data for any region of interest has been read out of the imaging array of camera 85 . controller 84 receives the image data , if necessary , identifies image data corresponding to individual regions of interest , and processes the image data using any suitable image - processing techniques to identify and measure locations of registration features 91 in the image data . from the locations of the registration features , controller 84 computes the position and orientation of chip 82 . the position and orientation data can then be used to determine a sequence of motions of actuators 89 to bring tip 85 into alignment over various features on chip 82 and to actuate actuator 88 and other systems to perform wire bonding or other actions on chip 82 . for example , wires may be bonded to connect bonding pads on chip 82 to bonding pads on a chip package ( not shown ). fig5 shows apparatus 90 according to an example embodiment of the invention . apparatus 90 comprises an imaging device 92 , for example a digital camera , connected to a host 94 by a data connection 93 . imaging device 92 has an imaging array 95 having image data output lines 96 . a data selector 97 receives data from image output lines 96 and selects data corresponding to selected regions of interest . data selector 97 determines which predetermined regions of interest have been selected by reading selected region data such as a bit vector 98 in a memory 99 . the selected region data identifies selected regions . in the illustrated embodiment , one bit of bit vector 98 corresponds to each predefined region available for selection . the bit vector serves as a set of flags . a region is selected if the corresponding bit of bit vector 98 is enabled and is not selected if the corresponding bit of bit vector 98 is not selected . imaging device 92 has an optional data formatting stage 100 that , for example , collects image data for individual selected regions so that the image data can be inserted into a buffer in a tile - aligned format or inserts placeholder values where the image data is desired to be provided in an image - aligned format . a buffer 102 receives image data ( as formatted by formatting stage 100 ). an interface 104 transmits the image data from buffer 102 across data connection 93 to host 94 . at host 94 the received image data is taken in at a suitable interface 105 , stored in a buffer 106 and is available to a data processor 108 that works with the image data under the control of instructions provided by software 109 . in any of the embodiments described herein , information identifying the selected region ( s ) of interest may be transmitted with image data being sent by the imaging device to the host . for example , the selected regions of interest may be embedded in a header or trailer attached to the image data . in such embodiments , the close association of the information identifying the selected region ( s ) of interest and the image data may facilitate later processing or interpretation of the image data . information identifying the selected region ( s ) of interest may be associated with or linked to the corresponding image data in other ways such as by the provision of a pointer , data structure or the like that indicates what region ( s ) of interest were selected for a given image data . data selector 97 and data formatting stage 102 may be provided by any suitable technology including , without limitation one or more of : logic circuits ; configurable logic , such as a field - programmable gate array ( fpga ) configured to perform the functions defined above ; and a suitably programmed data processor such as a microprocessor , image processor , graphics processor , digital signal processor or the like . in the illustrated embodiment , host 94 can control the content of memory 99 either directly or indirectly . by storing different bit vectors 98 in memory 99 , host 94 can control which regions of interest are selected at imaging device 92 . this may be done in response to software instructions being executed on data processor 108 of host 94 . thus , host 94 can direct imaging device 92 to provide image data for a first group of one or more regions of interest to enable host 94 to perform a first task ( such as determining the orientation and location of a chip by visualizing reference marks on the chip , for example ) and to subsequently shift to provide image data for a second group of one or more regions of interest to enable host 94 to perform a second task ( such as positioning a wire bonding tip 85 over a specific feature on the chip , for example ). it can be appreciated that selected embodiments of the invention can be applied to advantage in various situations . for example , suitable embodiments may be applied in situations where one or more of the following conditions exist ( although the invention is by no way limited to situations in which these conditions exist ): available bandwidth for carrying image data to a host is limited — data transmission can be reduced by transmitting data for required regions of interest only . it is desired to operate an imaging array at an increased frame rate for better temporal resolution or reduced latency — some imaging devices can be operated at greater frame rates where the number of rows of image data being read out are reduced . in some embodiments , the digital imaging device may be configured to operate at an increased frame rate or rates when selected regions of interest occupy a reduced number of rows . it is desired to reduce latency — which can be done by selecting and transmitting only image data from regions of interest . it is desired to change which regions of interest are selected frequently or with low overhead . it is desired to provide an imaging device in which regions of interest may be defined easily and with low overhead . it is desired to take advantage of the increased performance of some sensors , such as certain cmos sensors , attainable by reducing the number of columns that are read . from the foregoing description and the accompanying drawings it can be seen that the invention may be embodied , without limitation , in any of : an imaging device such as a camera ; a system which includes an imaging device ; and , a method for configuring , selecting and / or using regions of interest in image data . where a component ( e . g . a software module , processor , assembly , device , circuit , etc .) is referred to above , unless otherwise indicated , reference to that component ( including a reference to a “ means ”) should be interpreted as including as equivalents of that component any component which performs the function of the described component ( i . e ., that is functionally equivalent ), including components which are not structurally equivalent to the disclosed structure which performs the function in the illustrated exemplary embodiments of the invention . as will be apparent to those skilled in the art in the light of the foregoing disclosure , many alterations and modifications are possible in the practice of this invention without departing from the spirit or scope thereof . for example : it is not mandatory that predefined regions of interest are rectangular . regions of interest could have other regular shapes such as circular or could have more complicated bound shapes designed for specific applications ; it is not mandatory that image data corresponding to every pixel of an imaging array be included in a predefined region of interest . in some embodiments , regions of interest are predefined only for some parts of an image . it is not mandatory that predefined regions of interest do not overlap . accordingly , the scope of the invention is to be construed in accordance with the substance defined by the following claims . | 6 |
referring to fig1 an adjustable windshield mount 10 is shown supporting a police radar detector 12 shown only in part in fig1 with a housing having sides 12a and 12b engaged to be supported by the mount 10 . the front end of the receiver 12 has a housing end cap 12c . the mount 10 includes a first upper planar member or panel 14 pivotally hingedly connected through a pivot pin 16 to a second lower planar member or panel 18 . the horizontal pivot pin 16 has a horizontal axis parallel to the planes of the members 14 and 18 , and connects the upper member 14 near its lower edge to the forward edge of the lower member 18 . more particularly , the forward portion of panel 18 has a pair of upstanding ears 18a and 18b between which fits a central tongue 19 extending from the forward portion of the upper panel 14 . the tongue 19 has a horizontal supporting edge 19a on the front side thereof . the hinge pin 16 extends through the ears 18a and 18b and the tongue 19 to hingedly connect the panels 14 and 18 at their respective forward margins or edge regions . for purposes of description , the terms &# 34 ; forward &# 34 ; or &# 34 ; front &# 34 ; refer to the direction toward the front of the vehicle and the terms &# 34 ; rearward &# 34 ; or &# 34 ; rear &# 34 ; or &# 34 ; back &# 34 ; refer to the direction or side toward the rear or back of the vehicle . referring now also to fig2 - 6 , rigidly attached to opposite edges of the bottom surface 18c of the bottom member 18 are a pair of downwardly extending resilient opposed receiver supporting legs 20 and 21 , each having near its lower edge a raised inwardly facing horizontal rail 22 and 23 , respectively , which clips into notches 24 formed horizontally in the sides 12a and 12b of the housing , of the receiver 12 . the horizontal rails 22 and 23 each have a notch 25 adjacent their forward ends to receive a portion of the receiver front end cap 12c to prevent the receiver 12 from sliding out of the mount 10 or against the windshield . as such , the receiver 12 can be easily snapped into and out of position between the opposed legs 20 and 21 depending from the the planar member 18 . the upper member 14 is provided with a pair of forwardly facing and laterally spaced suction cups 26 and 28 . the suction cups 26 and 28 are adapted to attach the upper member 14 to the inside of a vehicle windshield 29 . the horizontal supporting edge 19a of the forwardly extending tongue 19 of the bracket panel 14 rests against the inside of the windshield 29 and , in cooperation with the suction cups 26 and 28 , resists the bending moment exerted by the weight of the receiver 12 to provide a cantilever support for the receiver and to stabilize the angle of inclination of the upper member 14 when the mount is secured to the windshield 29 . while more or fewer suction cups than two may be used , two spaced horizontally are preferred in order to limit undesired oscillatory pivotal motion of the upper panel 14 about an axis perpendicular to the windshield 29 or in the horizontal plane . in embodiments where one cup is used , either a horizontally elongated cup or a lower edge or other such structure having more than one point of contact with the windshield will provide at least the minimum required stable cantilevered support . easy setting of the angle of inclination of the receiver 10 is accomplished by a person who is driving the vehicle by operation of a cam operating lever 32 . lever 32 has a small detent 34 thereon ( fig2 ) for setting the lever 32 in any one of a plurality of notches 36 in the lower panel member 18 near the rear edge 38 of the lower panel member . a cooperating eccentric cam 40 and cam follower 41 are provided in the mount 10 for affecting the adjustment of the angle between the members 14 and 18 . cam 40 is selectively angularly positionable through the movement of the cam operating lever 32 . the lever 32 can be better seen by reference to fig2 while the relationship of the cam 40 and cam follower 41 can be best understood by reference to fig3 - 6 . referring to fig2 the cam 40 is seen to be integrally formed with the lever 32 and eccentrically pivotally attached through pivot pin 42 to the underside of the member 18 . the cam 40 and lever 32 are thus connected to the underside of the lower panel member 18 so as to pivotally move about an axis 43 perpendicular to the lower panel member and in a plane parallel thereto to a plurality of positions defined by the coincidence of the detent 34 with one of the plurality of notches 36 near the rear edge 38 of the lower panel member . the upper panel member 14 is shown in fig2 secured by the adhesive force of the suction cups 26 and 28 to the inside of a windshield 29 shown in phantom . below the imaginary horizontal line on which the two suction cups 26 and 28 lie , the forward edge 19a of the tongue 19 bears against the inside of the inside windshield 29 . accordingly , the upper panel member 14 forms a three point contact with the suction cups 26 , 28 and the forward tongue edge 19a against the windshield 29 . at the lower edge of the panel 14 opposite the support surface 19 is the cam follower or bearing surface 41 . the cam follower 41 is in the form of a ridge or shoulder formed integrally with tongue 19 and extending downwardly therefrom parallel to edge 19a . against the bearing surface 41 rests the cam 40 , limiting the minimum distance between the axis 43 of the cam - mounting pin 42 and the cam follower surface 41 , thus defining the maximum acute angle between the panel members 14 and 18 , and approximately defining the angle at which the police radar receiver 12 will be supported under the weight of the receiver which acts downwardly through the legs 20 and 21 on the member 18 . the manner in which the receiver angle is maintained and adjustable can be better illustrated by reference to fig3 - 6 . the cam follower or bearing surface 41 preferably faces toward the cam axis 43 , and merely bears against the cam 40 under the weight of the receiver 12 limiting the angle only in one direction . this provides a simple structure , permitting the mount 10 to fold flat when removed from the windshield 29 regardless of the position of the lever , thus retaining the angle of adjustment . accordingly , while the cam follower 41 can be of a pin and groove type , holding it to the cam surface , that is a less desirable arrangement where ease in folding the mount is most desired . referring to fig3 and 5 , the cam 40 is shown bearing against the bearing surface 41 of the upper panel 14 limiting the distance x between the axis 43 of the cam pivot pin 42 and the bearing surface 41 on the upper panel 14 . the angle between panels 14 and 18 is controlled by the position of the lever arm 32 . in the lever position , shown in fig3 the arm 32 rests against stops 50 and 52 on the bracket 20 causing distance x to be at a minimum . as such , the angle of inclination of the lower member 18 with respect to that of upper panel 14 is , in fig3 and 5 , at a maximum permissible angle and accordingly , the horizontal orientation of the member 18 and the receiver 12 are thereby maintained when the windshield 29 to which the support 14 is attached is at the least inclined or most vertical expected angle of inclination . at the other extreme , shown in fig4 with lever 32 against stops 54 and 56 , the distance x &# 39 ; is maximized , the angle of the windshield 29 being at its most inclined of expected angles , and the angle between the lower lever 18 and the upper panel 14 are at a minimum , as seen in fig6 . at the maximum angle between the receiver 12 and the windshield 29 ( fig5 ), the lever 32 is moved fully to the driver &# 39 ; s right and against stops 50 and 52 on the leg 20 ( fig3 ), while when the angle between the receiver 12 and the windshield 29 is at a minimum ( fig6 ), the lever 32 is moved fully to the driver &# 39 ; s left and against stops 54 and 56 on the leg 21 ( fig4 ). the above is a description of the preferred embodiment of the present invention . those skilled in the art will readily appreciate that certain variations thereof are permissible and fall within the scope of the invention as set forth in the following claims . | 1 |
forecasting systems and methods are provided for accurate and reliable near term prediction of the product demand . the systems and methods can be advantageously used to forecast demand of a particular drug at a particular pharmacy in a particular location . the forecasts are based on data collected from reporting or “ sample ” stores or market outlets . the systems and methods involve continuous evaluation and recalibration of sample data collected from market outlets . the prediction models on which near term demand forecasts are based also may be dynamically updated or adjusted in time . fig1 a shows an exemplary forecasting system 1000 for predicting market demand . forecasting system 1000 includes a processor 1010 , a database 1030 ( e . g ., oracle database ) and a report generator or writer 1040 . processor 1010 may communicate with database 1030 and report generator 1040 via suitable electronic links , for example , a network 1020 . system 1000 generates forecasts or predictions of market conditions ( e . g ., product demand or other information ), which are then provided to clients ( e . g ., product manufacturers ). the market information may be formatted or assembled by report writer 1040 into a report for delivery to the clients . the report may be provided as a hardcopy and / or in a dataset format . system 1000 may include suitable access interfaces ( e . g ., ftp 1050 , cd 1060 , or web login 1070 ), which may be utilized by the clients for viewing the reports . fig1 b shows a block diagram of interlinked elementary business processes (“ ebp ”) 1210 - 1310 in a market projection methodology that is supported by the inventive forecasting systems and methods . interlinked ebps 1210 - 1310 may be conducted contemporaneously in parallel or in series as appropriate for monitoring and cyclically ( e . g ., weekly ) predicting market conditions . with reference to fig1 b , process 1210 involves , for example , a definition of monthly production store universes . following process 1210 , process 1220 involves creating or generating multi - channel store distance files , and process 1230 involves sizing the universe stores . processes 1220 and 1230 lead to process 1270 for calculating required projection factors . process 1240 involves updating the reporting database for a subject week and leads to process 1230 and process 1250 . the latter process 1250 involves generating imputed scripts and in combination with process 1260 (“ weekly supplier cutoff ”) leads to process 1280 for utilization of the imputed scripts . required projection factors calculated at process 1270 are appended to the imputed data in process 1290 . this data is then loaded to the reporting database ( process 1300 ). in process 1310 , the reporting database is updated with imputed weekly prescriptions ( rx ) and factors . fig2 shows an exemplary “ store sizing ” process 2000 for predicting market conditions or product demand using system 1000 of fig1 a . process 2000 utilizes historical market data gathered from any number of “ sampling ” sources , including for example , retail and software vendors to provide initial or preliminary forecasts . the historical data may be assembled in database 1030 . at step 2010 , process 2000 reads or collects the historical data from the database 1030 . the collected historical data is reassembled in , for example , an extended database segment in the database 1030 . at step 2030 , process 2000 uses a suitable financial or business model to predict or generate a preliminary forecast of the product demand based on the historical data from sampling sources ( i . e . sample pharmacy stores or outlets ). the forecast may cover any suitable time interval ( e . g ., the current or present week ). at step 2030 , process 2000 also calculates a projection factor to estimate product sales or demand for non - sample outlets . the present week &# 39 ; s predicted product sales or demand (“ weekly forecast ”) may include forecasted values for a select set of parameters ( e . g ., the number of prescriptions of a particular product , the dosage , and the number of prescriptions written by a certain doctor . at step 2020 , the weekly forecast ( including the forecasted values for the selected set of parameters ) is stored in a shadow database . the shadow database may have any convenient structure or format ( e . g ., a relational database or table , or flat files ). the weekly forecast is a work - in - progress and is continually updated by process 2000 . at step 2040 , “ live ” market data is gathered from a group of reporting sources ( i . e ., sample outlets ) during a time interval . this time interval may include or overlap with all or some of the time ( e . g ., days of the week ) that is the subject of the weekly forecast . at step 2060 , the live data may be subject to quality control routines or algorithms to screen or note any of the live data , which may be due to an unusual event , for example , a result of a catastrophe , flu outbreak , etc . then at step 2070 , process 2000 compares the live data with forecasted data in the weekly forecast for the group of reporting outlets , and accordingly calculates an adjustment factor . the adjustment factor is based on the difference between the live data and the predicted data in the weekly forecast for the group of reporting sources . the adjustment factor may be calculated on a product - level , a local geography level , a product dosage level , or prescriber level , or any other suitable or appropriate market definition category or subcategory . a product level may , for example , refer to specific products , which are identified by a corresponding “ cmf ” descriptor ( e . g ., lipitor ). process 2000 then updates the weekly forecast stored in the shadow database using the calculated adjustment factor . for example , at step 2080 , process 2000 may update data entries for non - reporting outlets stored in the shadow database using the adjustment factor obtained at step 2070 and other relevant data . process 2000 then readjusts ( e . g ., iteratively recalculates ) the weekly forecast stored in the shadow database ( step 2090 ). at step 2100 , the updated the weekly forecast is provided to clients so that they can rapidly respond to changing market conditions . fig3 show details of an exemplary store sizing procedure 3000 that may be used in process 2000 . utilizing a ddd history file , the system may extract ddd $ data at the outlet / cmf 10 level for all outlets in the universe . for example , at step 3110 in procedure 3000 , process 2000 may extract wholesale product dollar sales amounts (“ ddd $” or “ wholesale amounts ”) from a wholesale product sales history file . the wholesale amounts may be categorized by outlet and / or drug product levels for all product channels and outlets in the subject store universe ( e . g ., the entire population of outlets including retail , long term care and mail order universes , etc .). it will be understood that the wholesale amounts may be negative , for example , in the case of product returns or refunds . at step 3120 , product and outlet cross - reference data may be utilized to reflect changes to outlet and / or product information . accordingly , the wholesale amounts may be consolidated under current outlet and product numbers , for example , by combining or eliminating outlets and product not in the current or subject market universe . at step 3120 , for example , ddd $ amounts may be consolidated under current cmf outlet and cmf product numbers , split outlet ddd $ may be combined , and outlets in the current retail , long term care and mail order universes may be eliminated . at step 3130 , running six - month average wholesale amounts are computed using the consolidated wholesale amounts . the running six - month averages may be computed monthly for a number of months ( e . g ., for six months ) preceding the latest month for which sales data is available . after calculating the six - month average wholesale amounts for all outlets , procedure 3000 at step 3140 may reset any negative average wholesale amounts to zero . procedure 3000 may be configured to generate a “ wholesale dollar amounts ” data file ( e . g ., a “ ddd $” file ) listing wholesale amounts by product / therapy class level for each outlet or channel . for each outlet or channel , a product / therapy class level data record may include , for example , channel identifier , a retail outlet identifier ; a product identifier ( e . g ., a cmf7 descriptor ); a therapy class identifier ( e . g ., a usc5 descriptor ); and average wholesale product dollar sales information . a therapy class is understood to mean a type or category of drugs directed to a therapy or treatment , i . e ., cholesterol reducers , high blood pressure treatment , etc . certain stores may be excluded from store sizing procedure 3000 based , for example , on experience or traditional considerations . at step 3150 , data related to such stores are identified and isolated in the wholesale amounts file before further processing . the data related to these excluded stores may be segregated and written to a separate data file ( e . g ., excluded stores file ). the excluded stores file data may be remerged with the wholesale amounts file at the end of the procedure 3000 ( e . g . monthly ). the excluded stores file may also include data related to stores that have atypical or abnormal wholesale product sales information . a projection factor of “ 1 ” may be assigned to each sample store excluded from the sizing process ( procedure 3000 ). further , at step 3160 , the wholesale amounts file may be vetted to remove or isolate information related to all non - purchasing organizations . for convenience in data processing , a list of non - profit purchasing organizations may be stored in a file or table . the list of non - purchasing organizations may be created by using a non - wholesale product sales / non - prescription warehouse sizing process . next at step 3170 in procedure 3000 , all good and imputed total prescription data is extracted from a total prescriptions data file . the total prescriptions data for non - purchasing organizations and “ excluded ” stores may be removed from further processing in a manner similar to data excluded from the wholesale amounts file at steps 3150 and 3160 . procedure 3000 then applies adjustments the wholesale amounts at the channel , outlet , product , and / or therapy class levels ( step 3180 ). procedure 3000 may be configured to perform the adjustments at one or more of these levels . the adjustments may include retaining total prescription data ( trx ) for stores that were in the sample every week in the extracted time period , running a cross - reference to pick up the latest drug product codes ( e . g ., cmf - 10 ) and proprietary therapy classes ( usc5 ), summing the total prescription counts to the channel / outlet / product ( cmf7 )/ therapy class ( usc5 ) level for this time period ; and merging on the average wholesale product dollar amount for these records only . procedure 3000 may generate a combined total prescription and adjusted wholesale amounts file at step 3190 . the combined or adjusted prescription / wholesale amounts file ( e . g ., “ trx / ddd $” file ) may be include total prescriptions ( trx ) and wholesale amounts ( ddd $) information categorized by channel , outlet , and product / therapy class . the data in the files may be formatted or extended to include , for example , a one - byte outlier field to an adjusted wholesale product dollar amount file . procedure 3000 may generate an adjusted wholesale amounts file with adjusted wholesale product dollar amounts for each outlet with total prescriptions greater than zero . the output file may be formatted to contain the following fields : channel ; outlet ; product / therapy class ( cmf7 / usc5 ); total prescriptions ( trx ); wholesale product dollar amount ( e . g . ddd $); and estimated wholesale product dollar amount ( e . g . estimated ddd $). procedure 3000 determines if an outlet &# 39 ; s estimated wholesale product dollar amount ( estimated ddd $) should replace its actual wholesale product dollar amount , and accordingly generates the adjusted wholesale product dollar amount file (“ adjusted ddd $ file ”). this file may contain the following fields : channel ; outlet ; product / therapy class ( cmf7 / usc5 ); wholesale product dollar amount ( ddd $); adjusted wholesale product dollar amount ( adjusted ddd $); and an outlier identifier . to adjust the wholesale product dollar amounts for all outlets having total prescriptions greater than zero , procedure 3000 cycles through data records having a product dollar amount greater than zero , for each of the outlet , product and therapy classes . a “ regression factor ” is computed at the channel / product / therapy class levels by regression analysis of the total prescriptions and the wholesale product dollar amounts . an exemplary function that may be used for regression analysis is : the computed or fitted regression_factor may be merged back into the “ trx / ddd ” file by channel / product / therapy class for all outlets . procedure 300 may generate an estimated wholesale product dollar amounts file based on the regression_factors . entries in the estimated wholesale product dollar amounts may be calculated by multiplying the regression_factors with the total prescriptions . procedure 300 may also calculate the standard deviation of the estimated wholesale product dollar amount . any suitable statistical programs or routines may be used for regression analysis . a suitable statistical program , which is a commercially available , is a statistics calculations program sas 8 . 2 . procedure 3000 then evaluates if the estimated wholesale product dollar amount should replace the actual wholesale product dollar amount based on statistical criteria and rules . for example , if the estimated wholesale product dollar amount is within three standard deviations of the actual wholesale product dollar amount , then the adjusted wholesale product dollar amount may be set equal to the actual wholesale product dollar amount . conversely , if the estimated wholesale product dollar amount is not within three standard deviations of the actual wholesale product dollar amount , the adjusted wholesale product dollar amount may be set equal to the estimated wholesale product dollar amount . the outlier field in the data record may be set positive ( e . g ., “ yes ”) to indicate such replacement . if after such replacement or otherwise , the adjusted wholesale product dollar amount is less than a preset minimum wholesale product dollar amount , procedure 3000 may delete the data record . procedure 3000 may merge the total prescription / stores adjusted ddd $ file with the monthly universe with average wholesale amounts file ( step 3190 ). the merger may be indexed based upon a key for each record of each input data file . procedure 3000 may keep the wholesale product dollar amount and outlier flag record in the merged file when a key is in both input files . in the event the key is not on both input files , procedure 3000 may indicate as much by resetting the outlier field byte ( e . g ., to “ blank ” “ space ”), and adjust the wholesale product dollar amount to equal the wholesale product dollar amount . in merging the noted input files , procedure 3000 may create a final monthly universe file with average wholesale product dollar amount file . at step 3200 , procedure 3000 may add the outlet &# 39 ; s state , size and type data to the universe file having wholesale product dollar amounts information to generate a total universe file with adjusted wholesale product dollar amounts ( step 3200 ). in the event , a channel does not include the outlet &# 39 ; s type or size , this variable may be ignored in further processing . at step 3210 , procedure 3000 may sum the adjusted wholesale product dollar amount at the following levels : channel / size / type / state / product ( cmf7 )/ therapy class ( usc5 ); channel / size / type / product / therapy class ; channel / size / product / therapy class ; and channel / product / therapy class . the sequence / hierarchy of the size , type and state fields may be based on monthly parameters . these “ parameters ” may be provided by or obtained form channel data fields . for the summing procedure , it will be understood , that a parameter is a constant that can be changed in program code . by “ sum . . . at the following levels ,” it will be understood that a process of adding numeric values at all possible combinations of levels is performed indexed at one of the listed levels . at step 3210 , procedure 3000 may then sum the adjusted wholesale product dollar amount to channel level , e . g ., at the following levels : channel / size / type / state /; channel / size / type ; and channel / size ( step 3220 ). again , the sequence / hierarchy of the size , type and state fields may be based on monthly parameters . these parameters may be provided in channel data . at step 3230 , procedure 3000 may merge the total universe file having adjusted wholesale product dollar amount summed to channel with the total universe file having adjusted wholesale product dollar amount summed to product / therapy class / channel . procedure 3000 may generate a named product name ( i . e ., a named cmf7 drug ) file ( i . e ., the final monthly universe with adjusted wholesale product dollar amount file ). the named drug file may include the following fields : channel / product ( cmf7 )/ therapy class ( usc5 ); size ( may be blank ); type ( may be blank ); state ( may be blank ); product / therapy class adjusted wholesale product dollar amount ( cmf7 / usc5 adjusted ddd $); total adjusted wholesale product dollar amount ; and total outlet count . utilizing the named cmf7 file , procedure 3000 may generate product / therapy class_distribution variable for each product / therapy class ( cmf7 / usc5 ) using empirical rules at step 3240 . according to an exemplary rule , a product / therapy class_distribution variable may be created as follows for each channel / product / therapy class : if the outlet count is greater than a channel distribution outlet count , then : product / therapy class_distribution =( drug / therapy class total adjusted wholesale product dollar amount file / adjusted wholesale product dollar amount file ), however , if the outlet count is less than or equal to the channel distribution outlet count , then : the record is deleted . procedure 3000 may generate a drug / therapy class distribution file that includes the following fields : channel / product / therapy class ; size ( may be blank for higher levels ); type ( may be blank for higher levels ); state ( may be blank for higher levels ); and product / therapy class_distribution . further at step 3250 , procedure 3000 may merge the product / therapy class_distribution value with a non - purchasing organization file having store wholesale product dollar amount , using the following hierarchy ( if the select level is not available ): state / size / type ; size / type ; size ; all . the merge product / therapy class distribution values against non - purchasing organizations process may require the non - purchasing organization file with store wholesale product dollar amount . this file may be created by using the non - wholesale product sales / non - prescription warehouse sizing process . next at step 3260 , procedure 3000 may calculate adjusted wholesale product dollar amounts as follows : at step 3260 , procedure 3000 may generate a non - purchasing wholesale product dollar amount file that will include the following fields : channel , outlet , product / therapy class , wholesale product dollar amount , and adjusted wholesale product dollar amount . at step 3270 , procedure 3000 may combine the non - purchasing wholesale product dollar amount file generated at step 3260 with the final monthly universe having adjusted wholesale product dollar amount file generated at step 3230 , and the “ stores excluded from monthly sizing generated at step 3150 . procedure 300 also may set the outlier equal to “ blank ” and adjusted wholesale product dollar amount equal to wholesale product dollar amount , and further run product cross - references to pick up the latest drug products and therapy classes . the combined file may contain wholesale product sales data for all outlet / product / therapy class combinations in the universe . step 3270 completes the monthly store sizing process portion of procedure 3000 . with continued reference to fig3 , step 3280 represents the start of the weekly sizing process portion of procedure 3000 . from the updated reporting database , procedure 3000 may extract raw ( both actually reported and imputed ) total prescription data for all outlets from the predefined number (“ w ”) of weeks of data . only data from stores that had good or imputed prescription data in all extracted weeks may be kept or processed . step 3280 may also involve running product cross - references to pick up the latest drug products ( cmf10 ) and therapy classes ( usc5 ). using the total prescription data extracted at step 3280 , procedure 3000 may next at step 3290 sum the total prescriptions to the outlet / product / therapy class level and then divide the sum of the total prescriptions by the number of weeks parameter value w to obtain average total prescriptions (“ average trx ”). the field size of the average total prescriptions field in the data records may , for example , be eight ( 8 ) whole and four ( 4 ) decimal places . at step 3300 , procedure 3000 may remove stores and products that have been designated for exclusion from the weekly sizing process using the total prescriptions summed to outlet / product / therapy class file . for this purpose , procedure 3000 may further utilize “ the stores excluded from monthly sizing process ” and “ products ( cmf7s ) requiring therapy class ( usc5 ) level projections ” files . next at step 3290 , procedure 3000 may merge the weekly total prescription data summed to the outlet / drug ( cmf7 )/ therapy class ( usc5 ) level file with the monthly - adjusted wholesale product dollar amount for all outlet / product / therapy class combinations in universe file generate at step 3270 using the following rules : 1 ) if the outlet / product / therapy class is present on the wholesale product dollar amount monthly file and not on the total prescriptions weekly file , then the system may ignore the outlet ; and 2 ) if the outlet / product / therapy class is present on the total prescriptions weekly file and not on the wholesale product dollar amount monthly file , then the system may set wholesale product dollar amount equal to zero procedure 3000 may use the monthly file that matches the first day of the week when conducting the weekly sizing process , and every week of a given month will use the same monthly file . for example , if the first day of the week is november 27 , the november monthly file may be used in the weekly sizing process for that week as well as all other weeks whose first day has a november date . similarly , if the first day of the week is december 1 , the december monthly file may be used in the weekly sizing process for that week as well as all other weeks whose first day has a december date . procedure 3000 may at step 3280 generate a wholesale product dollar amount / total prescriptions file that will include the following fields : channel , outlet , product / therapy class ( cmf7 / usc5 ), wholesale product dollar amount , adjusted wholesale product dollar amount , and total prescriptions . at step 3290 , procedure 3000 may sum all product / therapy classes with total prescriptions greater than zero to identify the potentially missing population and identify all outlets with no total prescriptions . based on the wholesale product dollar amount / total prescriptions file created at step 3290 , procedure 3000 may at step 3320 estimate total prescriptions for stores not in the sample all extracted weeks . first at step 3300 , procedure 300 drops all outlets and product / therapy classes that are to be excluded from weekly sizing processes . step 3320 results in an output file of sample stores only with adjusted wholesale product dollar amounts greater than zero (“ adjusted ddd $& gt ; 0 ”). this output file may contain the following fields : channel ; product / therapy class ; size ( may be blank ); type ( may be blank ); state ( may be blank ); and ratio . step 3320 may further result in an output file of the estimated total prescriptions for non - sample stores only with the adjusted wholesale product dollar amount greater than zero . this output file may contain the following fields : channel ; outlet ; product / therapy class ; and estimated total prescriptions . step 3320 may also result in other output files . an exemplary output file for outlets in the sample all extracted weeks and adjusted wholesale product dollar amount equal to zero , may contain the following fields : channel / product / therapy class ; size ( may be blank for higher levels ); type ( may be blank for higher levels ); state ( may be blank for higher levels ); total prescriptions ; and n , where n equals the outlet count represented by total prescriptions . another exemplary output file for outlets in the sample all extracted weeks and adjusted wholesale product dollar amount equal to zero may contain the following fields : channel ; therapy class ; product ; size ( may be blank ); type ( may be blank ); state ( may be blank ); and estimated total prescriptions . yet another exemplary output file of estimated total prescriptions for non - sample stores with adjusted wholesale product dollar amount equal to zero , may contain the following fields : channel ; outlet ; product / therapy class ; and estimated total prescriptions . with continued reference to step 3320 , for all outlets in sample for all extracted weeks with adjusted wholesale product dollar amount greater than zero and outlier not set equal to “ yes ,” procedure 3000 may sum adjusted wholesale product dollar amount and total prescriptions and get a count of outlets at the following levels : channel ; size / type / state / product / therapy class ; size / type / product / therapy class ; size / product / therapy class ; sequence / hierarchy of the size , type and state fields should be based on weekly parameters . these parameters are distinct from the monthly parameters but like the monthly parameters may also be provided by channel . for processing data records , the parameters n1 and n2 are defined as follows : in cases where n1 is less than n2 , procedure 3000 may delete the data record . conversely , for cases where n1 is not less than n2 , procedure 3000 may compute a ratio equal to the : ( sum of total prescriptions )/( sum of adjusted wholesale product dollar amounts ) by channel . procedure 3000 may extract the remaining outlet data ( all outlets that were not in the sample all of the previous w weeks ). procedure 3000 may merge by the ratio from adjusted wholesale product dollar amount greater than zero file by the lowest hierarchy defined by the parameters . if there is no ratio available , then procedure 3000 may merge by the first parameter noted in parameter file / product / therapy class . procedure 3000 may continue to the next parameter in noted parameter file / product / therapy class , and then to the product / therapy class level . if there is no data to merge at product / therapy class level , then procedure 3000 may set the ratio equal to zero . procedure 3000 may calculate estimated total prescriptions using the following equation : procedure 3000 may produce files for two sets of outlet counts : one count for each channel / state / size / type (“ outlet count ”) and another count for outlets with wholesale product dollar amount greater than zero by product / channel / state / size / type (“ product outlet count ”). the first file may be merged by channel / state / size / type , and the second file may be merged by product / channel / state / size / type . for any data record for which n is less than n3 , where n =“ ddd $= 0 cell count ”=“ outlet count ”−“ product outlet count ” and n3 = ddd $= 0 cell minimum , then procedure 3000 may delete the data record . the values of n and n3 may be calculated or obtained based on research . at step 3320 , procedure 3000 may calculate estimated total prescriptions ( estimated trx at each level ) using the following equation : estimated total prescriptions =( sum of total prescriptions )/( total outlet count − outlet count with wholesale product dollar amount & gt ; 0 ), ( 3 ) where total outlet count = total number of unique outlets in file at that level , and outlet count with wholesale product dollar amount & gt ; 0 = unique outlet counts by drug ( cmf7 ) from the wholesale product dollar amount & gt ; 0 file . if estimated total prescriptions are less than the parameter ( total prescriptions size minimum ), then procedure 3000 may delete the record . next procedure 3000 may extract all outlets that were not in the sample of the previous extracted weeks and wholesale product dollar amount equal to zero from the wholesale product sales / current total prescriptions file . at step 3320 , procedure 3000 may merge on “ the estimated total prescriptions from wholesale product sales equal to zero ” file by the lowest hierarchy defined by the parameters . if there is no ratio or estimate of total prescriptions available , then procedure 3000 may merge on estimated total prescriptions by channel / size / type / product / therapy class . procedure 3000 may continue to the channel / size / product / therapy class level . if there is no data to merge at product / therapy class level i . e . cmf7 / usc5 level , then procedure 3000 may delete outlet / product / therapy class . at step 3330 , procedure 3000 may combine the estimated total prescriptions file for non - sample stores with wholesale product dollar amount greater than zero , the estimated total prescriptions file for non - sample stores with wholesale product dollar amount equal to zero , and “ the wholesale product dollar amount file / current total prescription ” file to produce the “ weekly universe size ” file for the current week . procedure 3000 may accordingly generate a “ weekly universe size ” file for the current week that may include the following fields : channel , outlet , product / therapy class , estimated total prescriptions ( only for stores not in sample for previous w weeks ), and total prescriptions ( only for stores in sample for previous w weeks ). using the universe size files from the current week and previous week , procedure 3000 at step 3340 generates a weekly universe - sizing file at the channel / outlet / product / therapy class level using the following rules : 1 ) if ( current size / previous size )& gt ; x5 and ( current size − previous size )& gt ; x7 , then current size = previous size * p1 ; and 2 ) if ( current size / previous size )& lt ; x6 and ( previous size − current size )& gt ; x8 , then current size = previous size * p2 , where x5 = week size change max . ratio , x6 = week size change min . ratio , x7 = week size change max ., x8 = week size change minimum , p1 = week size change maximum percent , p2 = week size change minimum percent , and size = total prescriptions , if a total prescriptions value is available , or size = estimated total prescriptions , if a total prescriptions value is not available . procedure 3000 at step 3350 may roll up product / therapy classes to higher levels e . g ., to summarize product / therapy class to outlet , product ( cmf7 ), therapy class 5 ( usc5 ), therapy class 4 ( usc4 ), therapy class 3 ( usc3 ), therapy class 2 ( usc2 ), therapy class 1 ( usc 1 ), and store , etc . procedure 3000 may merge the appropriate monthly cpm ( retail / long term care / mail order combined ) store universe and pick up the store type and monthly sample flag , and create the “ weekly universe sizing file for projections ” containing the following fields : channel , outlet , store type , monthly sample flag , product sizing level , size . fig4 shows an exemplary procedure 6000 for calculating factors for predicting market conditions and data using system 1000 of fig1 a . procedure 6000 is designed to generate projection factors for extrapolating market data from sample stores and outlets to non - sample stores and outlets . system 1000 may be configured , at step 6010 in procedure 6000 , to extract all sample stores from a main database file except stores having the following descriptors : a ) data imputation override , and / or b ) excluded stores from projections parameter . outlets associated with a data imputation override descriptor are listed in a data imputation override descriptor file . the sample stores in a repository for input transactions file (“ susf ” file ) may have a monthly sample use flag set equal to one . the data imputation override file may contain a list of product outlet identifiers for sample stores that are treated as non - sample stores . the excluded stores from projections parameter file may contain a list of product outlet identifiers for sample stores that are forced to have a projection factor of “ 1 ” and are not used to project onto non - sample stores . this parameter may be stored within a production parameter library . a static weekly copy of the production parameter library may be archived ( e . g ., saved for two years ). system 1000 may save the following data for all sample stores that are extracted : product outlet identifier , channel , store type ( if retail channel ), all product levels identified in the susf file for the product outlet identifier , and average total prescriptions for every product level identified in the susf file for the product outlet identifier . drugs or products for which projections will not be created are set to therapy class defaults . table a shows an example of the saved data table a sample store sizing data sample cmf outlet # channel store type product level average trx 12345678 r i store 1000 usc1 120 usc2 110 usc3 200 usc4 50 usc5 40 cmf7 10 at step 6020 , system 1000 may extract all non - sample stores data from the susf file and sample stores in the data imputation override file . the non - sample stores in the susf file may have a monthly sample use flag set equal to zero . the data imputation override file may contain a list of product outlet identifiers for sample stores that are treated as non - sample stores . system 1000 may save the following data for all non - sample stores that are extracted : product outlet identifier , channel , store type ( if retail channel ), all product levels identified in the susf file for the product outlet identifier and total prescriptions for every product level identified in the susf file for the product outlet identifier . table b shows an example of the saved data table b non - sample store sizing data non - sample cmf # channel store type product level average trx 87654321 r f store 2000 usc1 320 usc2 100 usc3 90 usc4 80 usc5 70 cmf7 10 next at step 6030 , system 1000 may extract the “ to ” product outlet ( i . e . non - sample outlets ), the “ from ” product outlet ( i . e . sample outlets ) and the distance ( miles apart ) from a multi - channel store distance file . based on the extracted data , system 1000 may create a projections store distance file . next at step 6040 , system 1000 may use “ a store distance evaluation process ” to find the closest “ usable ” sample stores in the store distance file for each store ( i . e . non - sample stores ) for which market conditions need to be projected . the number of sample stores may be restricted to be between a maximum number sample stores parameter and a minimum number sample stores parameter . the sample stores may also be required to be within a distance indicated by a “ maximum distance between stores ” parameter . a “ miles apart ” data field value in the store distance data file may determine the closest stores . if the minimum number of sample stores are not found within the distance indicated by the “ maximum distance between stores ” parameter , then stores that are over that maximum distance may be selected until the minimum number of stores are found in the projection store distance file for the store that needs to be projected . possibly the minimum number of sample stores may not be found if the number of sample stores that can be selected is limited . stores that are “ usable ” or eligible for this purpose may generally refer to stores that are not in “ the exclude from projections ” list or table , and are not listed in the data imputation override file . the usable stores also must be in an eligible channel for the subject non - sample store . the usable stores eligibility filtering may be done in the store distance process . all usable stores may be saved and used in a projection formula for calculate weights . the maximum number sample stores parameter may contain a number representing the maximum number of sample stores that can be used to project market conditions onto a non - sample store . the minimum number sample stores parameter may contain a value for a desired minimum number of sample stores that should be used to project a non - sample store . the maximum distance between stores parameter indicates the maximum distance ( e . g . number of miles ) that a sample store can be from a subject non - sample store , so that the sample store &# 39 ; s market data can be used to project the non - sample store market data or conditions . the maximum distance between stores parameter may not be enforced if a minimum number of sample stores cannot be found to project to a non - sample store . the maximum distance between stores parameter may be defined by channel and stored in a production parameter library . a static weekly copy of this library may be archived ( e . g ., saved for two years ). system 1000 may save the product outlet identifier and the miles apart value for each sample store that was found and saved to calculate weights . system 1000 may save the average total prescriptions from the sample store factor data for every product level that the sample store and non - sample store have in common . system 1000 may ignore a product level if a sample store has a product level that is not present or available in the non - sample store . system 1000 may assign total prescriptions equal to zero for a product level if a non - sample store has a product level that is not in the sample store . system 1000 may save the following data : non - sample product outlet identifier ; channel ; store type ; product level ; average total prescriptions for non - sample store for product level ; sample store product outlet identifier ; miles apart ; and average total prescriptions for sample store for product level . table c shows an example of the saved data average trx at non - sample product average sample miles sample store for cmf outlet # channel store type level trx cmf outlet # apart product level 87654321 r f store 2000 12345678 20 1000 usc1 320 20 usc2 100 0 usc3 90 10 usc4 80 10 usc5 70 10 cmf7 10 5 the channel criteria in the store distance evaluation process may be used to select stores that are added to the multi - channel store distance file for a given product outlet . the channel of the non - sample store may determine which stores will be selected as the sample stores within the store distance evaluation process . a weight of zero may be assigned for a product level within a non - sample store , if the product level is not present in the sample store that is being used to project market conditions to the non - sample store . at step 6050 , system 1000 may calculate a weight for each product level that the subject non - sample store and the sample store have in common for each non - sample store found and saved . the following exemplary equation may be used to calculate the weight for each product level : wi =(( 1 / di ** p )/( s ( i = 1 to n ) ti / di ** p ))* tu , ( 4 ) where wi = weight applied to the sample store data , di = distance from non - sample to sample store ; ( in relative distance sequence , where 1 is the closest ); ti = store size in total prescriptions volume of the sample store ; tu = store size in total prescriptions volume of the non - sample store , p = a variable parameter , n = the number of sample stores , and s = sum . a weight cap parameter may indicate the maximum weight a sample store can be assigned for a particular product level . the weight cap parameter may be defined by channel and stored in a production parameter library . as previously noted , a weekly copy of the production parameter library may regularly stored in an archive ( e . g ., saved for 2 years ). system 1000 may limit the weight assigned to a sample store when the normally computed weight ( e . g ., by equation 4 ) exceeds maximum weight cap . system 1000 may save the values of both the normally computed and limited weights assigned to a sample store . system 1000 may also save the following data : non - sample product outlet identifier ; channel ; store type ; product level ; average total prescriptions for non - sample store for product level ; sample store product outlet identifier ; miles apart ; average total prescriptions for sample store for product level ; weight assigned to sample store before capping ; and weight assigned to sample store after capping . table d shows an example of the saved data . table d non - sample sample average trx at weight assigned weigh assign cmf store product average cmf miles sample store for to sample store to sampl store outlet # channel type level trx outlet # apart product level before capping before cappin 87654321 r f store 2000 12345678 20 1000 6 5 usc1 320 20 usc2 100 0 usc3 90 10 usc4 80 10 usc5 70 10 cmf7 10 5 next at step 6060 , system 1000 may add non - sample store weights to generate sample store factors . fig5 shows further details of a process 5000 involved at step 6060 to create sample store factors . at step 6110 in process 5000 , the following factors are saved for each sample store : chain , independent , food , mass merchandise ( mm ), long term care ( ltc ) and mail order ( mo ). at step 6120 , system 1000 may add a weight for each non - sample store product level to the appropriate factor for the sample store product level . system 1000 may add the weight to a particular factor as a function , for example , of channel and store type of the non - sample store . the functions relating channel and store types to particular factors may be defined , for example , as : a ) retail channel and food store type : add weight to food factor . b ) retail channel and chain store type : add weight to chain factor . c ) retail channel and independent store type : add weight to independent factor . f ) retail channel and mm store type : add weight to mm factor . at step 6130 , system 1000 may assign or add a value of “ 1 ” to the factor corresponding to the store type for a retail store , the ltc factor for a ltc store , or to the mo factor for a mo store . a value of “ 1 ” may be added or assigned to all product levels for the product outlet . at step 6150 , system 1000 may perform a one - time factor capping process after all the factors have been computed . when capping a ltc or mo factor , system 1000 may change or reset the final computed factor to a maximum value if the final computed factor exceeds a designated value stored in a factor cap parameter file . a factor for a sample store may be set to the designated factor cap value less one . all other factors may be set to the factor cap value . for capping a retail factor , the system may add the values in the chain , mm , independent and food factors . if the sum of these values exceeds the value in the factor cap parameter , then the equation below may be used to adjust the chain , mm , independent and food factors . adjusted factor = current factor ×( a /( chain factor + mm factor + independent factor + food factor )), ( 6 ) where a =( factor cap value − 1 ) if the sample store is retail , or a = factor cap value if the sample store is mail order ( mo ) or long term care ( ltc ). a factor cap parameter may have a value for the maximum factor a sample store can be assigned for a product level . this parameter may be defined by channel and may be stored in a production parameter library . a static weekly copy of the factor cap parameter values may be saved for 6 years . at step 6160 system 1000 may populate a ltc cap flag when a ltc factor is capped , a retail cap flag when a retail factor is capped and a mo cap flag when a mo factor is capped , etc . at step 6170 , system 1000 may save the values of the computed and capped factors . however , values of the factors prior to capping may not be saved . further at step 6180 , system 1000 may save the following data : sample product outlet identifier ; channel ; store type ; product level ; average total prescriptions ; chain factor ; mm factor ; ind factor ; food factor ; ltc factor ; mo factor ; retail factor cap flag ; ltc factor cap flag ; and mo factor cap flag . table e shows an example of the saved data . table e sample retail factor cmf store product average chain mm ind food ltc mo cap factor outlet # channel type level trx factor factor factor facto factor factor etc 12345678 r i store 2000 1 5 usc1 320 1 4 usc2 100 1 6 usc3 90 1 1 . 5 usc4 80 1 4 usc5 70 1 2 cmf7 10 1 6 at step 6190 , system may include all sample stores in the sample store factor data . when a sample store is not used to project a non - sample store market conditions or data , all product levels for the sample store may have a factor of one ( 1 ) for the factor corresponding to the sample store &# 39 ; s channel and store type . a sample store is not be used to project non - sample stores market conditions or data when it is in the excluded stores from projections parameter file or when if it was not selected during a “ find sample stores ” process ( i . e ., an elementary business process ( ebp )). fig6 is a flow diagram of an exemplary forecasting procedure 8000 using system 1000 that may be utilized for predicting market conditions , data or statistics . at step 8110 in procedure 8000 , system 1000 may identify products that have been launched , for example , in the last 13 weeks , based on analysis of prescription information stored in database 1030 . at step 8120 , system 1000 may identify top or leading products ( e . g ., top 500 products ) based on analysis of national prescription counts information ( e . g ., based on prescription volume ). at step 8130 , system 1000 may create product groups by grouping all top 500 products by a therapy class and may treat each of the top 500 products as its own group . next at step 8140 , system 1000 may generate data files containing projected national prescription count information ( e . g ., national prescription audit or npa information ) by product for each of three channels ( namely retail , mail order , and long term care ). the files may include may include , for example , 25 weeks of information from history , and also an estimate of national current week volume from an early insight database . the files may be grouped by product groups . at step 8150 , system 1000 generates data files containing raw prescription counts at the outlet / product level for the previous 25 weeks . these files also may be grouped by product groups . at step 8160 , system 1000 may combine files generated at steps 8140 and steps 8150 for the retail , long term care , and mail order channels . outlet / product data may be separated or classified into two groups , for example , normal and low volume groups . average prescriptions per week , number of missing weeks , and maximum prescriptions per week data may be used to determine how a particular outlet / product data is classified . at step 8170 system 1000 determines outlet / product data corresponds to a normal or low volume group classifications and at step 8180 determines whether a new product is involved . at step 8190 , for low volume outlets data involving new or old products , system 1000 may forecast the current week volume by taking a four - week average of outlet / product raw prescription counts . conversely , for normal volume outlets data that does not involve a new product , at step 8180 system 1000 may use a suitable model ( e . g ., autoregressive integrated moving average ( arima ) model ) to forecast the current week volume based on outlet / product raw prescription counts for the past 25 weeks and projected national prescription counts for both the current week and the past 25 weeks . further , for normal volume outlets data that does involve a new product , at step 8200 system 1000 may forecast a new product volume based on a national ratio of product to therapy class prescription counts applied to the outlet level therapy class prescription counts . system 1000 may combine the forecasts generated at steps 8180 , 8190 and 8200 , to generate a final forecast . fig7 shows steps 8210 - 8470 that may be performed by system 1000 in an exemplary imputation procedure 8205 which may be used to allocate prescriptions , product or prescriptions data to non - reporting outlets or entities ( e . g . physicians ) in the store universe . at step 8210 , system 1000 may extract raw prescription information ( e . g ., from database 1030 ). system 1000 may then at step 8220 pull in special outlet information , and accordingly at step 8230 identify outlets with insufficient history to be imputed . the outlets with insufficient history may be excluded from further processing . next at step 8240 , system 1000 may calculate the distribution of prescriptions by day of the week for each outlet . this distribution may be adjusted for a holiday week based on a holiday proportion file . system 1000 may then at step 8250 count prescriptions by outlet / product group / sort_key ( numerator ), and separate data into various files for future processing . at step 8260 , each forecast estimate in a final forecast file ( e . g ., from process 8200 fig6 ) is converted to an integer value . at step 8270 , system 1000 may further separate the files by a product grouping method ( e . g . product / therapy class or therapy class ) system 1000 may perform subsequent processing steps 8280 , 8300 , 8320 , 8340 , 8360 , 8365 and 8380 on the separated files for each grouping ( i . e ., product / therapy class and therapy class ). at step 8280 , system 1000 may count prescriptions by outlet / product . at step 8300 , these counts may be combined with the forecast estimate . if there is a forecast estimate but no prescription counts , then the data may be placed a separate output file . at step 8320 system 1000 may calculate the needed raw prescriptions counts by imputation ( e . g . as forecast * numerator / denominator ). at step 8340 , system 1000 may sort the raw prescriptions counts by outlet / therapy class / sort key and random number . at step 8360 , system 1000 may determine whether the estimated number of applicable prescriptions from the raw prescriptions file is available . if estimated number of applicable prescriptions is available , system 1000 may at step 8365 randomly select the needed prescriptions from the raw prescriptions file . step 8365 may be repeated twice if necessary . if this is not sufficient , the remaining number of prescriptions needed may be output to a separate file . if the estimated number of applicable prescriptions from the raw prescriptions file are not available , system 1000 may at step 8380 access or generate a repository of national prescriptions by product file . where more prescriptions are needed for imputation than are available in that outlet &# 39 ; s history , the prescriptions may be selected from the pool of all national prescriptions . at step 8400 , the needed prescriptions may then be randomly selected ( e . g ., using steps 8320 and 8330 ) from the national pool of prescriptions . after a sufficient number of needed prescriptions have been generated , system 1000 at step 8410 may combine all allocation files . before the close of week , at step 8420 system 1000 may identify non - reporting outlets , which become eligible for use of imputed prescriptions . at step 8430 system 1000 may reallocate days of the week in the imputed prescriptions to match history distribution . after the close of week , system 1000 may repeat step 8430 for any non - reporting outlet that was not identified as such before the close of week ( step 8440 ). next , at step 8450 system 1000 may load imputed prescriptions data to a database ( e . g ., database 1030 ), and at step 8460 may compare imputed data estimates to actual values for outlets that did report prescriptions data . further , at step 8470 , system 1000 may generate an imputed data adjustment factor to adjust for any difference between imputed total and actual totals for reporting outlets . in the context of weekly forecasting of market conditions based on prescriptions / scripts data or other data , it will be understood that “ trailing ” data is old data received in the current week , in other words the data represents a prescription with a dispense date that is older then the current cycle week . trailing data may be received on a regular basis from stores and suppliers . the trailing data may be expected to show repeatable trends similar to the other store monitoring evaluations . a trailing data factor reflects the trend of the trailing data . back data is similar to trailing data in that the scripts are for an older week than is currently being processed . scripts data may be labeled as back data when the trailing data is unusual or exceeds some threshold parameter . to avoid breaking or disrupting trends , back data may not be used in current or future trailing data factor calculations . in the operation of system 1000 , all of the trailing data parameters are stored in the databases and processing files a manner similar to other statistical parameters . the trailing data parameters are defined at the global level ; however , supplier and store overrides of the global settings are possible . if the supplier or store level override parameters exist and are available , they are used for data processing in favor of the global parameters . a trailing data factor for a particular outlet may be calculated based on the average of the prior weeks of trailing data ( e . g ., six weeks ). the trailing data for a supplier / store is added into the daily data and trailing data of the data week for which it belongs . the trailing data does not affect any already - existing processing status code ( e . g ., the data will not be reevaluated ). if there is no data for a particular data week for the particular supplier / store , then default processing status code may be blank . fig8 illustrates an exemplary procedure 9000 for calculating a trailing data factor ( tdf ) by store ( i . e ., how much of the data is trailing ) using the system 1000 . for purposes of the trailing data factor calculation in procedure 9000 , the total prescriptions are given by the following equation : the trailing data calculations ( e . g . procedure 9000 ) may require that suitable initialization parameters and limits are defined . the initialization parameters and limits may , for example , include terms such as “ default tdf ”, “ max tdf ”, “ min week percentage ”, “ max week percentage back data max %”, “ min weeks for tdf ”, and “ tdf weeks ”, which are defined as follows : default tdf : if after preprocessing the trailing data history file a store has two or fewer weeks in the file , the system may set trailing data factor to the default . the initial value should be 1 . max tdf : if the tdf & gt ; max tdf , the system should set tdf to max tdf . the max tdf initial value should be 1 . 5 . min week percentage : during evaluation of history , if the calculated percentage between good prescription and total prescriptions for a week is less then min week percentage , the week should not be used as part of the tdf calculation . the min tdf initial value should be 1 . max week percentage back data max %: during evaluation of history , if the calculated percentage between good prescriptions and total prescriptions for a week is greater then max week percentage , the week should not be used as part of the tdf calculation . the min tdf initial value should be 1 . 5 . min weeks for tdf : the minimum number of weeks required to calculate the tdf . if less than the minimum , then the system should use the default tdf . the initial value should be 3 . tdf weeks : the number of weeks to examine for tdf calculations . the initial value should be 6 . the following data fields from the history file may be required for trailing data calculations and storing results : 1 ) store ( trailing data is calculated for each store ); 2 ) week data received ( week trailing data factor is calculated ); 3 ) total prescriptions ( current week good prescriptions ( dispense date week same as data receipt )); 4 ) trailing prescriptions ( current week trailing prescriptions ( dispense date in earlier week then receipt date )); 5 ) total good prescriptions ( calculated ) ( sum of total prescriptions and trailing prescriptions ); 6 ) trailing data factor ( trailing data factor percentage is calculated from total prescriptions and good prescriptions ); and 7 ) back data indicator ( value indicating whether or not the trailing data is really back data and not part of a normal trend ). with renewed reference to fig8 , in procedure 9000 , at step 9010 system 1000 may extract weekly data and calculate a previous week percentage for each of the last 6 weeks . the previous week percentage is equal to trailing prescriptions / total prescriptions at the same level . at step 9020 system 1000 may determine whether the previous week percentage is between a minimum week percentage and the maximum week percentage . if the previous week percentage is not within the minimum and maximum limits , system 1000 may set a back data flag , and further at step 9040 determine whether there are fewer than three weeks of acceptable previous week percentages . if there are fewer than three weeks of acceptable previous week percentages , then at step 9050 system 1000 may set the trailing data factor to default trailing data factor . conversely , when more than three weeks of acceptable previous week percentages are present system 1000 at step 9060 may set the tdf equal to the ratio of the sum over remaining store / weeks ( up to 6 ) of total prescriptions to the sum over remaining store / weeks of good prescriptions . if the tdf exceeds a maximum allowed value “ max tdf ”, then the tdf may be set to max tdf ( step 9070 ). it will be appreciated by those skilled in the art that the methods of fig1 - 8 can be implemented on various standard computer platforms operating under the control of suitable software defined by fig1 - 8 . in some cases , dedicated computer hardware , such as a peripheral card in a conventional personal computer , can enhance the operational efficiency of the above methods . fig9 and 10 show exemplary computer hardware arrangements suitable for performing the methods of the present invention . referring to fig9 , the computer arrangement includes a processing section 910 , a display 920 , a keyboard 930 , and a communications peripheral device 940 such as a modem . the computer arrangement may include a digital pointer 990 such as a “ mouse .” the computer arrangement also may include other input devices such as a card reader 950 for reading an account card 900 . in addition , the computer arrangement may include output devices such as a printer 960 . the computer hardware arrangement may include a hard disk drive 980 and one or more additional disk drives 970 that can read and write to computer readable media such as magnetic media ( e . g ., diskettes or removable hard disks ), or optical media ( e . g ., cd - roms or dvds ). disk drives 970 and 980 may be used for storing data and application software . fig1 shows an exemplary functional block diagram of processing section 910 in the computer arrangement of fig9 . processing section 910 includes a processing unit 1010 , a control logic 1020 , and a memory unit 1050 . processing section 910 may also include a timer 1030 and input / output ports 1040 . processing section 910 may further include an optional co - processor 1060 , which is suitably matched to a microprocessor deployed in processing unit 1010 . control logic 1020 provides , in conjunction with processing unit 1010 , controls necessary to handle communications between memory unit 1050 and input / output ports 1040 . timer 1030 may provide a timing reference signal for processing unit 1010 and control logic 1020 . co - processor 1060 enhances system abilities to perform complex computations in real time , such as those required by cryptographic algorithms . memory unit 1050 may include different types of memory , such as volatile and non - volatile memory and read - only and programmable memory . memory unit 1050 may , for example , include read - only memory ( rom ) 1052 , electrically erasable programmable read - only memory ( eeprom ) 1054 , and random - access memory ( ram ) 1056 . various computer processors , memory configurations , data structures and the like can be used to practice the present invention , and the invention is not limited to a specific platform . in accordance with the present invention , software ( i . e ., instructions ) for implementing the aforementioned demand forecasting systems and methods ( algorithms ) can be provided on computer - readable media . it will be appreciated that each of the steps ( described above in accordance with this invention ), and any combination of these steps , can be implemented by computer program instructions . these computer program instructions can be loaded onto a computer or other programmable apparatus to produce a machine such that the instructions , which execute on the computer or other programmable apparatus , create means for implementing the functions of the aforementioned demand forecasting systems and methods . these computer program instructions can also be stored in a computer - readable memory that can direct a computer or other programmable apparatus to function in a particular manner such that the instructions stored in the computer - readable memory produce an article of manufacture including instruction means , which implement the functions of the aforementioned demand forecasting systems and methods . the computer program instructions can also be loaded onto a computer or other programmable apparatus to cause a series of operational steps to be performed on the computer or other programmable apparatus to produce a computer implemented process such that the instructions which execute on the computer or other programmable apparatus provide steps for implementing the functions of the aforementioned demand forecasting systems and methods . it will also be understood that the computer - readable media on which instructions for implementing the aforementioned demand forecasting systems and methods are be provided include , without limitation , firmware , microcontrollers , microprocessors , integrated circuits , asics , and other available media . it will be understood , further , that the foregoing is only illustrative of the principles of the invention , and that those skilled in the art can make various modifications without departing from the scope and spirit of the invention , which is limited only by the claims that follow . | 6 |
in accordance with the invention , an alumina product which results as a by - product from the processing of aluminum salt slags and which contains aluminum tri - hydroxide , aluminum metal and aluminum nitride , is mechanically compacted to a sufficient degree to favor the exothermic reaction of residual aluminum metal and aluminum nitride with the water that is contained in the form of moisture in the alumina product , so that aluminum hydroxide is formed in the reaction and suitable hydro - thermal conditions are created by the reaction heat to allow the aluminum tri - hydroxide ( bayerite ) to transform itself into aluminum mono - hydroxide ( boehmite ) which has a smaller amount of crystal - bound water . thus , with a moisture - containing alumina product as a starting material , residual aluminum metal and aluminum nitride can be transformed into aluminum hydroxide without lowering the total al 2 o 3 content ( in contrast to the solution offered in u . s . pat . no . 6 , 238 , 633 ). as a side benefit , the process of the present invention reduces the ammonia odor that is caused by the evaporation of the ammonia - containing moisture in the aforementioned prior - art process . in sintering or fusion processes , the aluminum mono - hydroxide boehmite in comparison to the aluminum tri - hydroxide bayerite has the advantages of a lower content of crystal - bound water , a wider range of temperature for the release of the crystal - bound water , and a higher crystal density . in order to obtain the full benefit of the boehmite content , the aluminum mono - hydrate should make up at least 20 percent of the aluminum hydroxide phases , i . e ., the ratio of boehmite to bayerite should be greater than 20 : 80 = 0 . 25 . the ratio of the phases is determined by x - ray diffraction and comparison of the peak intensities of boehmite ( d = 6 . 11 å ) and bayerite ( d = 4 . 72 å ). if boehmite is in very fine - crystalline or colloidal form , a broadening of the peaks is detectable in the range of d = 6 . 11 å . the following table allows a comparison between the properties of both aluminum hydroxide phases : according to c . misra ( industrial alumina chemicals , american chemical society 1986 , page 17 ), the hydrothermal transformation from aluminum tri - hydroxide into boehmite requires a temperature above 150 ° c . to provide the hydrothermal conditions , a closed heated pressure container ( autoclave ) is normally required . the high - alumina raw material can be obtained by drying the alumina product to a residual moisture content of less than 5 percent , then compacting and grinding it in a vibratory grinder . a powder formed by this process is particularly suitable for producing porosified binding agents used in the construction trade ( for example mineral foam based on alkaline water glass ). the high - alumina raw material can further be produced by compacting the alumina product in a mixture with other suitable mineral materials with a preferably similar particle size , where at least 90 weight - percent of the material have a particle size smaller than 500 μm . these mineral materials include for example burnt lime , calcium hydroxide , cement ( portland cement , aluminate cement ), pulverized lime stone , iron oxide carriers and silicon oxide carriers ( clay , sand , burnt iron sulfide , haematite , red mud , fly ash ). mixtures formed in this manner can be used for producing ceramic and refractory materials , cement , porosified binding agents used in construction , slag formers for iron and steel , mineral wool and ceramic fibers . the alumina product used in the following examples had a muddy consistency , a noticeable odor of ammonia , a moisture content of 35 weight - percent , and a particle size smaller than 0 . 5 mm in at least 90 weight - percent of the product . its chemical composition ( in weight - percent , based on dried material ) was : al 2 o 3 61 al - metal 2 . 4 aln 1 . 1 sio 2 7 . 0 mgo 7 . 7 cao 3 . 1 fe 2 o 3 1 . 4 f 1 . 5 cl 0 . 3 loss on ignition at 600 ° c . 11 . 6 balance in total 2 . 9 bayerite al 2 o 3 . 3h 2 o 33 . 5 spinell mgal 2 o 4 27 . 5 corundum α - al 2 o 3 19 . 3 the contents of the main mineral constituents were calculated from the chemical composition as follows : bayerite content =( loss on ignition 600 ° c . )× 100 / 34 . 6 ( crystal - bound water of bayerite : 34 . 6 percent ) spinel content =( mgo content )× 100 / 28 ( mgo content of spinel : 28 percent ) corundum content =( al 2 o 3 + mgo + loss on ignition 600 ° c . )− bayerite − spinel the product has a theoretical density of 2 . 95 g / cm 3 and a bulk density of 1 . 65 g / cm 3 ( based on dried material : 1 . 07 g / cm 3 ). the alumina product according to example 1 was mixed with 10 weight - percent cao ( burnt lime ) in a forced - action mixer and compacted at the same time . conditions between a moist warm and hydrothermal state were generated in the mixed material , recognizable by the release of water vapor . after about 10 minutes , the temperature in the mixture increased to more than 70 ° c . after 60 minutes the new high - alumina raw material no longer had a noticeable odor of ammonia , its moisture content was 10 percent , its aluminum metal content was 0 . 5 percent and its aluminum nitride content was 0 . 3 percent . the ratio of aluminum mono - hydroxide to aluminum tri - hydroxide was 0 . 6 , as determined by x - ray diffraction and a comparison of the peak intensities of boehmite ( d = 6 . 11 å ) and bayerite ( d = 4 . 72 å ). this example and further investigations lead to the conclusion that the rate at which boehmite is formed can be controlled as a function of the compaction density , the aggregate size , the duration of the treatment , the ambient temperature and the exothermic reactivity of a mixing partner with the hygroscopic water in the alumina product . while , e . g ., cao produces a strong exothermic reaction with calcium hydroxide , the reaction will be weaker if cement ( portland cement , aluminate cement ) is added . dry additives , in which the hygroscopic water is only physically bound by wetting of the surface of the particles , for example dry calcium hydroxide , lime stone powder , iron oxide carriers ( such as burnt iron sulfide , haematite , red mud ) and silicon oxide carriers ( such as clay , sand , fly ash ) will at least contribute to improving the consistency of the alumina product . to produce a sintered calcium aluminate ( as slag former for the steel production ) with the main components cao ( about 40 weight - percent ) and al 2 o 3 ( about 45 weight - percent ), the alumina product according to example 1 , or high - alumina raw material according to example 2 , was mixed in the appropriate ratio with lime stone powder of the following composition ( in weight - percent ) the mixture was formed into pellets of about 10 mm diameter . the pellets were sintered in an electrically heated laboratory muffel kiln at 900 – 1300 ° c . with a holding time of 30 minutes . dependent on the sintering temperature , the content of the mineral phase 12cao . 7al 2 o 3 ( determined by x - ray diffraction , in weight - percent ) was : as demonstrated by these numbers , the formation of calcium aluminate 12cao . 7al 2 o 3 was already completed at 1100 ° c . when the high - alumina raw material according to example 2 was used , while the reaction was still incomplete at 1200 ° c . with the alumina product according to example 1 . a slag former should have the lowest possible melting point . the melting point of the calcium aluminate based on the high - alumina raw material according to example 2 and sintered at 1100 ° c . was only 1290 ° c . ( measured according to din 51070 as hemisphere temperature by means of a thermal microscope ). in contrast a melting point of 1360 ° c . was reported for the calcium aluminate slag former according to u . s . pat . no . 6 , 238 , 633 sintered at 1093 – 1193 ° c . the superior reactivity observed in the raw material according to example 2 in the production of sintered calcium aluminate leads to the conclusion , that the high - alumina raw material will also have superior sintering properties in other sintered products ( such as ceramics and refractories ) or fused products ( mineral wool , ceramic fibers ) in comparison to the alumina product according to example 1 or according to u . s . pat . no . 6 , 238 , 633 . to produce a porosified building material , an alumina product according to example 1 with 2 . 4 percent aluminum metal was dried to a moisture content of 4 weight - percent . a quantity of 30 g of the dried alumina product was ground for a time of 10 minutes in a vibratory grinder ( laboratory disk grinder ). the contents of the grinder were kept at a temperature of 85 ° c . the new raw material produced in this manner contained aluminum mono - hydroxide ( boehmite ) and aluminum tri - hydroxide ( bayerite ) in a weight - ratio of 1 . 9 . the content of metallic aluminum was 1 . 4 weight - percent . the new raw material was placed into a plastic beaker of 5 cm diameter and 10 cm height together with alkaline water glass in respective quantities of 30 g and 25 g at room temperature and mixed to a slurry by short stirring ( about 1 minute ) with a spoon . after about 5 minutes , the slurry began to release a gas , which led to a formation of foam and an increase in volume combined with a heating and hardening of the mixture . the increase in volume ( measured by the height of the foamed mixture ) and the reaction time were recorded . the resultant increase in volume was about 450 percent , and the hardening into a mechanically stable body occurred after about 10 minutes . | 8 |
fig1 shows a pump assembly 11 which generally includes a housing 13 , an inlet 15 and an outlet 17 . with reference to fig2 and 3 , the housing 13 includes a heat sink 19 and molded plastic housing sections 21 and 23 held together by a plurality ( four being illustrated ) of threaded fasteners 25 . the pump assembly 11 includes a pump 27 and a motor in the form of an actuator 29 . although the pump 27 is described in the description of the specific embodiment as pumping water , it should be understood that it can be used to pump other fluids . however , the pump 27 is particularly adapted for pumping substantially incompressible liquids . the pump 27 includes a pumping chamber 31 ( fig2 and 3 ), a diaphragm 33 sandwiched between the housing sections 21 and 23 , an inlet check valve 35 , an outlet check valve 37 , an inlet passage 39 leading from the inlet 15 to the pumping chamber 31 , an outlet passage 41 leading from the pumping chamber 31 to the outlet 17 and a positive displacement pumping member 43 . the pumping member 43 includes a central section of the diaphragm 33 and a flat , rigid disc 45 carried by the diaphragm to provide it with adequate rigidity . the disc 45 is coupled to a square shaft 47 which projects through a correspondingly configured square opening 49 of the housing section 21 to prevent rotation of the pumping member 43 relative to the housing 13 . the pumping chamber 31 is defined by annular walls 51 ( fig3 and 6 ) and 53 ( fig3 and 5 ). an annular sealing bead 55 ( fig5 ) formed integrally with the diaphragm 33 cooperates with a groove in the annular wall 51 to seal the upper portion of the pumping chamber 31 . a nearly annular sealing bead 56 ( fig6 ) which is also integral with the diaphragm 33 cooperates with a groove in the annular wall 53 to seal the lower region of the pumping chamber 31 from all adjacent regions of the pump , except for the check valves 35 and 37 . the inlet check valve 35 includes a valve seat 57 which is preferably constructed from a relatively hard material and a resilient curved valve element 59 which is constructed of a flexible resilient material , such as rubber . the valve element 59 is mounted on a central segment 61 of the valve seat 57 , and the valve seat 57 is in turn mounted on an annular mounting rib 63 of the diaphragm 33 which is insertable into an annular mating groove formed on the peripheral surface of the valve seat . the housing sections 21 and 23 have posts 64 and 65 , respectively , which engage opposite central regions of the valve element 59 . the outlet check valve 37 is identical to the inlet check valve , and portions of the outlet check valve corresponding to portions of the inlet check valve are designated by corresponding reference numerals followed by the letter &# 34 ; a &# 34 ;. one difference between the check valves 35 and 37 is that they face in different directions as viewed in fig2 and the posts 64a and 65a are provided on the housing sections 23 and 21 , respectively . the posts 65 and 65a are longer than the posts 64 and 64a and this prevents incorrect installation of the check valve by inserting either or both of the check valves upside down from the orientation shown in fig2 . to seal the housing sections 21 and 23 , the diaphragm 33 has an outer peripheral annular bead 67 ( fig2 and 6 ). as shown in fig3 the housing sections 21 and 23 cooperate to define cavities 69 , and regions of the diaphragm 33 extend across the cavities 69 to divide each of the cavities 69 into expandable chambers 71 and 73 , four sealed chambers 75 , 75a , 75b and 75c ( fig3 and 6 ), and into chambers where the check valves 35 and 37 are located . the expandable chambers 71 and 73 are sealed from each other and from the pumping chamber 31 by the beads 55 and 67 and by radial beads 77 ( fig5 ) which are also formed integrally with the diaphragm 33 . the housing section 21 has a plurality of posts 79 which are spaced apart to define channels which provide communication between the expandable chamber 71 and a region 81 ( fig2 ) of the inlet passage 39 immediately surrounding the post 64 and just upstream of the inlet check valve 35 . each of the posts 79 has a ledge 83 which engages the upper surface of the diaphragm 33 . the construction at the outlet with respect to the expandable chamber 73 is identical , and corresponding portions are designated by corresponding reference numerals followed by the letter &# 34 ; a &# 34 ;. although any suitable number of the sealed chambers can be utilized , in the embodiment illustrated , four of the separately sealed chambers 75 - 75c are employed , two for each of the expandable chambers 71 and 73 . the sealed chambers 75 - 75c are sealed by the beads 56 , 67 and 77 and by radial beads 87 adjacent the outlet . water passing through the inlet check valve 35 can travel into the pumping chamber 31 by a portion of the inlet passage 39 which comprises grooves 89 in the housing section 23 ( fig2 and 6 ). similarly , water can travel from the pumping chamber 31 to the outlet check valve 37 by a portion of the outlet passage 41 which comprises grooves 91 ( fig2 and 6 ) which are also formed in the housing section 23 . the grooves 89 and 91 extend between sealed chambers 75 , 75a , and 75b , 75c , respectively . in order to provide a pumping action , the pumping member 43 must be reciprocated axially within the pumping chamber 31 . although the function of powering the pump 27 can be carried out by many different power sources , in the embodiment illustrated , the actuator 29 is utilized . the actuator 29 may be identical to the actuator described in u . s . patent application ser . no . 06 / 076 , 344 filed on sept . 17 , 1979 entitled actuator and naming l . clark feightner and me as joint inventors . the actuator 29 is capable of driving the pumping member 43 through 60 cycles of reciprocation each second . the actuator 29 includes electromagnetic means in the form of a core 93 suitably retained within the heat sink 19 and a coil 95 wound on the core ( fig2 and 3 ). ramps 97 and 97a are mounted in a groove 99 ( fig2 ) of the housing section 21 by fasteners 25 . a leaf spring 101 is mounted on , and has its ends held in fixed position by , the fasteners 25 . an armature 103 of magnetic material is mounted on the leaf spring 101 by a screw 105 which also attaches the armature and leaf spring to the shaft 47 . the core 93 has a cavity 107 to allow the head of the screw 105 to move into close proximity to the core . the armature 103 includes a plurality of plates 109 held together by rivets 111 . the armature 103 has a concave surface 113 which faces away from the core 93 and which forms a segment of a cylinder . the screw 105 and the shaft 47 cooperate to deform a central region of the leaf spring 101 into conformity with the concave surface 113 . in the unstressed condition , the leaf spring 101 is planar and so , by deforming the leaf spring as shown in fig3 the leaf spring is preloaded . this preloading enables the armature 103 to be very close to the core 93 . the ramps 97 and 97a have inclined ramp surfaces 115 and 115a , respectively , to progressively support increasing lengths of the leaf spring 101 as the latter is deflected upwardly as viewed in fig3 toward the core 93 . as this occurs , the effective length of the leaf spring 101 is progressively shortened , and this stiffens the leaf spring or increases its spring rate . to further increase the spring rate as the leaf spring 101 deflects toward the core 93 , the area of the leaf spring as viewed in plan may progressively widen as it extends from the ends adjacent the fasteners 25 toward the armature 103 . by repeatedly energizing the coil 95 , the electromagnetic force and the force from the leaf spring 101 cooperate to rapidly reciprocate the armature 103 and hence the pumping member 43 . specifically , energization of the coil 95 pulls the armature 103 toward the core 93 against the preloaded biasing force of the leaf spring 101 . as the leaf spring 101 deflects , the ramp surfaces 115 and 115a ( fig3 ) progressively support increasing lengths of the leaf spring . consequently , the effective length of the leaf spring 101 is progressively shortened to increase its spring rate . by the time the leaf spring 101 is deflected against the full lengths of the ramp surfaces 115 and 115a , the increased spring force virtually arrests movement of the armature 103 . thus , the spring 101 brings about termination at a precisely known point of the movement of the armature 103 toward the core 93 . in this position , the ramp surfaces 115 and 115a form a smooth continuation of the concave surface 113 . when the coil 95 is de - energized , the electromagnetic force decays to allow the spring 101 to power the return stroke of the armature 103 . because the spring 101 operates above its preload range , strong forces are available to power the return stroke . in addition , when the initial position shown in fig2 is reached , the spring force tending to move the armature 103 away from the core 93 instantly terminates so that overstroking is avoided . the coil 95 can be coupled to an ac source through a diode ( not shown ) so that the coil is energized , for example , 60 times each second . when the coil 95 is energized , the pumping member 43 moves upwardly on its intake stroke and , when the coil 95 is de - energized , the leaf spring 101 pushes the pumping member 43 downwardly on its discharge stroke . on the intake stroke , the inlet check valve 35 is open and the outlet check valve 37 is closed . water flows from the expandable chamber 71 and from the inlet 15 through the region 81 of the inlet passage 39 , the inlet check valve 35 and the grooves 89 into the pumping chamber 31 . during this time , the compressible gas in the sealed chambers 75 and 75a expands to shrink the expandable chamber 71 and force the water out of the expandable chamber and into the pumping chamber 31 . on the discharge stroke of the pumping member 43 , the inlet check valve 35 closes and the outlet check valve 37 opens . during the discharge stroke , the inertia of the water column in the line or conduit ( not shown ) to which the inlet 15 is coupled supplies water to the expandable chamber 71 , compresses the compressible gas in the sealed chambers 75 and 75a , and expands the expandable chamber 71 . also on the discharge stroke , the water is forced under pressure from the pumping chamber 31 through the grooves 91 ( fig2 and 6 ), the outlet check valve 37 and the region 81a to the outlet 17 . simultaneously , water under pressure is forced into the expandable chamber 73 ( fig3 and 5 ) to expand the expandable chamber 73 and compress the compressible gas in the sealed chambers 75b and 75c . on the next intake stroke , the compressible gas in the sealed chambers 75b and 75c expands to shrink the expandable chamber 73 and force the water out of the expandable chamber 73 and into the outlet 17 . this tends to maintain a constant flow of water from the outlet 17 . it should be noted that the expandable chambers 71 and 73 are above the diaphragm 33 and that these chambers contain water . the actuator 29 is also above the diaphragm closely adjacent the expandable chambers 71 and 73 . thus , the water being pumped inherently cools the actuator 29 . fig4 shows a pump 27 &# 39 ; which is identical to the pump 27 in all respects not specifically shown or described herein . portions of the pump 27 &# 39 ; corresponding to portions of the pump 27 are designated by corresponding primed reference characters . the pump 27 &# 39 ; is substantially identical to the pump 27 , except for the construction of the check valves . the pump 27 &# 39 ; has an outlet check valve 37 &# 39 ; which comprises a spring 201 , a flexible annular section 203 , and a valve seat 205 formed integrally with the housing section 23 . the spring 201 biases the annular section 203 against the valve seat 205 . on the discharge stroke of the pumping member 43 &# 39 ;, water is forced from the pumping chamber 31 &# 39 ; through the grooves 91 &# 39 ; and against the lower face of the annular section 203 . this water pressure is sufficient to lift the flexible annular section 203 against the biasing action of the spring 201 to open the check valve 37 &# 39 ; and allow the water to flow through the outlet 17 &# 39 ;. either or both of the inlet check valve and the outlet check valve may be constructed as shown in fig4 . although exemplary embodiments of the invention have been shown and described , many changes , modifications and substitutions may be made by one having ordinary skill in the art without necessarily departing from the spirit and scope of this invention . | 5 |
the following description is presented to enable any person skilled in the art to make and use the invention , and is provided in the context of a particular application and its requirements . various modifications to the disclosed embodiments will be readily apparent to those skilled in the art , and the general principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the present invention . thus , the present invention is not intended to be limited to the embodiments shown , but is to be accorded the widest scope consistent with the principles and features disclosed herein . the data structures and code described in this detailed description are typically stored on a computer readable storage medium , which may be any device or medium that can store code and / or data for use by a computer system . this includes , but is not limited to , magnetic and optical storage devices such as disk drives , magnetic tape , cds ( compact discs ) and dvds ( digital versatile discs or digital video discs ), and computer instruction signals embodied in a transmission medium ( with or without a carrier wave upon which the signals are modulated ). for example , the transmission medium may include a communications network , such as the internet . fig1 a illustrates a computer system 102 in accordance with an embodiment of the present invention . computer system 102 includes design 104 , placement 106 , virtual routing 108 , and routing 110 . computer system 102 receives design 104 and routes design 104 to placement 106 for placement of the circuit blocks included in the design . note that the terms “ circuit blocks ”, “ cells ”, and “ circuit elements ” are used interchangeably in this document and generally refer to circuit components , which are placed on a substrate and coupled together with metal to form the completed circuit . after placement 106 places the blocks , the placement is passed to virtual routing 108 for routing the interconnections nets between the various circuit elements . finally , the virtual routing is passed to routing 110 to finish the routing based upon the virtual routing . fig1 b illustrates a router 112 in accordance with an embodiment of the present invention . router 112 includes design 104 , length determiner 116 , delay calculator 118 , repeater inserter 120 , flip - flop inserter 122 , and report generator 124 . length determiner 116 and delay calculator 118 receive input from class rules 126 , which includes resistance / capacitance ( rc ) information for each metal type , width , and spacing and layer assignments as described below in conjunction with table 1 . length determiner 116 determines the length of the nets within design 104 , which couple the cells for example by using a steiner tree or manhattan distance technique . these are well - known techniques in the art for determining net lengths and will not be discussed further herein . next , delay calculator 118 determines the delay for the various nets . if the maximum allowed delay is reached for a specific net , repeater inserter 120 inserts a repeater in the net to reduce the delay time . if the maximum allowed delay is still exceeded , the system uses higher levels of class rules . higher levels of class rules provide shorter delays because of the increased metal widths and increased spacing on these layers . details of the total path delay model are shown in fig3 . if the delay for a given net cannot be brought below the maximum allowed delay by inserting repeaters and using higher class rules , flip - flop inserter 122 inserts a flip - flop into the given net , sets the delay criterion from greater than one clock cycle to greater than two clock cycles and repeats the process of calculating net delays , inserting inverters , and using different class rules to determine a net routing , which will meet the specified maximum allowed delay . report generator 124 generates a report , which includes the net groupings according to class , the inserted repeaters , and the inserted flip - flops . this report provides the input to a subsequent routing process . fig2 is a flowchart illustrating the process of producing a virtual routing for nets in a circuit design in accordance with an embodiment of the present invention . the system first receives a circuit design 104 for routing ( step 202 ). this circuit design includes a placement for the cells , which comprise the circuit . next , length determiner 116 determines the length of the nets , which couple the cells for example by using a steiner tree or manhattan distance technique ( step 206 ). delay calculator 118 then calculates the delay for each net using the class - one rule ( step 208 ). if necessary , repeater inserter 120 inserts a virtual repeater into the net to improve timing ( step 210 ). the system then determines if the delay is greater than one clock cycle ( step 212 ). if not , the net is added to group one ( step 214 ). if the delay is greater than one clock cycle , delay calculator 118 calculates the delay for each net using the class - two rule ( step 216 ). if necessary , repeater inserter 120 inserts a virtual repeater into the net to improve timing ( step 218 ). the system then determines if the delay is greater than one clock cycle ( step 220 ). if not , the net is added to group two ( step 222 ). if the delay is greater than one clock cycle , delay calculator 118 calculates the delay for each net using the class - three rule ( step 224 ). if necessary , repeater inserter 120 inserts a virtual repeater into the net to improve timing ( step 226 ). the system then determines if the delay is greater than one clock cycle ( step 228 ). if not , the net is added to group three ( step 230 ). if the delay is still greater than one clock cycle , flip - flop inserter inserts a virtual flip - flop into the net ( step 232 ). the system then changes the delay criterion from greater than one clock cycle to greater than two clock cycles ( step 234 ) and then returns to step 208 to repeat the process . when the nets have been assigned to group one , group two , or group three , report generator 124 reports the results as a starting point for a subsequent routing step ( step 236 ). fig3 illustrates a total path delay model in accordance with an embodiment of the present invention . flip - flops 302 and 308 are coupled together by a net , which includes repeaters 304 and 306 , resistors r 1 - r 3 , and capacitors c 1 and c 2 . repeaters 304 and 306 may have been inserted by repeater inserter 120 . r 1 - r 3 and c 1 - c 2 are lumped values of resistance and capacitance representing the distributed resistance and capacitance on the metal layers that couple repeaters 304 and 306 . clock 310 is coupled to flip - flops 302 and 308 and provides timing signals to these flip - flops . the total path delay includes delays 312 , 314 , 316 , 318 , and 320 . delay 312 is the clock to output delay time of flip - flop 302 . delays 314 , 316 , and 318 are the delays for the respective portions of the net coupling flip - flops 302 and 308 . delay 320 is the setup time for flip - flop 308 . the total path delay is adjusted by inserting repeaters into the net , inserting flip - flops into the net , and / or by assigning the net to different class groups . assigning the net to different class groups effectively changes the values of r 1 - r 3 and c 1 and c 2 , thereby changing the delay value . table 1 is a table of class rules in accordance with an embodiment of the present invention . in general , class rules 126 relate metal layers , width , and spacing for the metal . specifically , class one includes metal layers 1 - 4 with width equal to one unit and spacing equal to two units ; class two includes metal layers 5 and 6 with width equal to two units and spacing equal to two units ; and class three includes metal layers 7 and 8 with width equal to three units and spacing equal to three units . other combinations are equally acceptable for a given layer . the foregoing descriptions of embodiments of the present invention have been presented for purposes of illustration and description only . they are not intended to be exhaustive or to limit the present invention to the forms disclosed . accordingly , many modifications and variations will be apparent to practitioners skilled in the art . additionally , the above disclosure is not intended to limit the present invention . the scope of the present invention is defined by the appended claims . | 6 |
the present invention discloses efficient power line routing schemes that allows both the power lines and the signal lines routable in both horizontal and vertical directions . fig1 a illustrates a conventional power ring routing scheme for an exemplary integrated circuit ( ic ) chip 100 with just two modular cells 130 and 135 . the modular cell 130 or 135 can be a memory cell array block or a functional block of a complex logic chip . the memory can be a static random access memory ( sram ), dynamic random access memory ( dram ) or a nonvolatile memory such as flash memory , magnetoresistive random access memory ( mram ) or parameter random access memory ( pram ). the logic chip can be function blocks in a system - on - chip ( soc ). such function blocks may be analog circuit blocks , digital circuit blocks or memory cell blocks in the soc chip . the power ring structure has one high supply voltage ( vdd ) ring 110 and a complementary low supply voltage ( vss ) ring 120 at the edges of the ic chip 100 . metal lines extend from the vdd ring 110 and vss ring 120 to the center of the ic chip 100 . the metal lines are then coupled to transistors . one drawback of this kind of power routing scheme is that the voltage drop at the center of the ic chip 100 is due to the resistance of metal lines . another draw back is that running a power ring around the chip 100 may increase area overhead . fig1 b illustrates a conventional power mesh routing scheme for another exemplary ic chip 150 with the two modular cells 130 and 135 . multiple parallel power lines 160 s and 170 s are routed from one side of the ic chip to the other . if the power lines 160 s represent vdd , then the power lines 170 s represent vss . the power lines 160 s and 170 s extend across a cell partition area 140 of the modular cells 130 and 135 , and blocks any vertical line in the same metal layer . a disadvantage with this kind of power routing scheme is that the power lines 160 s and 170 s are routable only in one direction ( horizontal shown in fig1 b ). signal lines in the same metal layer as the power lines 160 s and 170 s are also routable in only one direction . for signal lines that need to travel in both horizontal and vertical directions , coupling through vias and other layers of metal will be needed , which is less efficient and adds additional resistance and capacitance . fig2 a and 2b illustrate a new power mesh routing scheme where a power line from the modular cell 130 does not run through the cell partition area 140 into the juxtaposed modular cell 135 according to one embodiment of the present invention . a difference between fig2 a and fig2 b is that the ends of the power lines 210 and 220 or 215 and 225 in fig2 a are vertically aligned to each other , respectively , while the ends of the power lines 210 , 222 , 212 and 220 or 215 , 227 , 215 and 228 in fig2 b are not vertically aligned , respectively . this difference shows that the vertical alignment of the power lines are not required by the present invention , as long as they do not travel from one cell to the other . as fig2 b is only to show this difference , only descriptions of fig2 a are needed . referring to fig2 a for illustration purpose , the horizontal vdd line 210 and vss line 220 form a pair of power lines for the modular cell 130 . horizontal vdd line 215 and vss line 225 form a pair of power lines for the modular cell 135 . the cell partition area 140 is cleared of and horizontal power lines , so that signal lines can run vertically through the cell partition area 140 . referring to fig2 , a signal line 230 runs horizontally from the modular cell 130 to the modular cell 135 . another signal line 235 also runs from the modular cell 130 to the modular cell 135 , but has a vertical portion in the cell partition area 140 . here , the signal lines 230 and 235 shows feasibilities that signal lines can run in both horizontal and vertical directions across cell partition areas . fig3 a and 3b illustrate another power routing scheme according to another embodiment of the present invention . again , a difference between fig3 a and fig3 b is that the ends of the power lines 310 and 320 or 315 s in fig3 a are vertically aligned to each other , respectively , while the ends of the power lines 315 and 325 in fig3 b are not vertically aligned to each other . this difference shows that the vertical alignment of the power lines are not required by the present invention , as long as they do not travel from one cell to the other . as fig3 b is only to show this difference , only descriptions of fig3 a are needed . referring to fig3 a , the power lines 310 and 320 of the modular cell 130 do not go across to the juxtaposed modular cell 135 , and power lines 315 and 325 of the modular cell 135 do not go across to the juxtaposed modular cell 130 . further more , the power lines 310 , 320 , 315 and 325 have not only horizontal sections , but also vertical sections on a same power line . an advantage for this kind of two directional power line routing is that it can offer more uniform power line reaches to transistors across the modular cell 130 or 135 . referring to fig3 , a signal line 330 can go across from one modular cell to another horizontally , and at the same time a signal line 335 has a vertical travel addition to horizontal travels . referring to fig3 a , the modular cell 130 or 135 must have at least two power lines , one for vdd and the other for vss . fig4 and 5 show additional alternative power line routing schemes according to embodiments of the present invention . the underline principles are still the same as that applied in chips shown in fig2 and 3 . first , a power line within a modular cell does not go across the cell partition area 140 into a juxtaposed modular cell . second , both power lines and signal lines can travel in both horizontal and vertical directions . referring to fig5 , particularly , a region 530 in the modular cell 130 power lines 520 are more densely routed . because the region 530 is an area where vias can be placed to connect to other metal layers , so in order to reduce resistances of the power lines , a power line 520 is placed as a denser mesh , so that the power line 520 can make more coupling through the vias to underlying transistors . referring to fig3 ˜ 5 , the power line routing schemes do not have to be the same among two juxtaposed modular cells . the power line routing scheme follows functional requirements of a modular cell . referring to fig3 ˜ 5 , even though the power lines stop at the cell partition area 140 , but they can still be connected through vias and metal lines in other metal layers . practically , the width of a cell partition area 140 is less than about 60 um . the line width of the signal lines is less than about 0 . 3 um . the space of power lines ( vdd to vss ) is less than about 50 um . the voltage level of the 1st and 2nd modular cell will be the same or not the same voltage level . the above illustration provides many different embodiments or embodiments for implementing different features of the invention . specific embodiments of components and processes are described to help clarify the invention . these are , of course , merely embodiments and are not intended to limit the invention from that described in the claims . although the invention is illustrated and described herein as embodied in one or more specific examples , it is nevertheless not intended to be limited to the details shown , since various modifications and structural changes may be made therein without departing from the spirit of the invention and within the scope and range of equivalents of the claims . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the scope of the invention , as set forth in the following claims . | 7 |
as shown in fig1 the present invention is a dressing in the form of a wafer 10 that is generally a thin flat disc . while the diameter or the dimensions of the upper surface may vary in size depending on the intended wound size , the thickness of the wafer is preferably under about 1 / 4 &# 34 ;. as seen in fig1 the dressing may be circular or even oblong in shape . the disc is provided with at least one score line 11 or area of weakness which permits the dressing to be unwound to form a rope of the dressing material . in many instances , for example , for the treatment of irregular shaped wounds , the rope is preferably unraveled or trimmed from the disc and the desired amount of such removed - rope can be applied to , or inserted into , the wound itself . this facilitates application to the wound and improves wound coverage . cross sectionally the rope can be of any convenient configuration . preferably , the rope has a generally rectangular cross - section . as seen in fig2 the dressing of the present invention can be in the form of a rope . in fig3 this rope 12 is shown applied to an irregular shaped wound 14 . in addition , if so desired , the wafer can be used either in its entirety or with a portion of the rope removed so as to tailor the size of the dressing to the wound . in either event , the dressing unravels upon absorption of wound exudate and conforms to the aperture of the wound . when the rope is to be unraveled by the caregiver prior to application to the wound , the rope may be manually trimmed from the disc . trimming or unraveling may be accomplished by hand or by any suitable instrument . the score line is preferably spiral in its orientation . a spiral score line in the dressing permits the dressing to be unwound to form a continuous rope of dressing material which can fit the wound &# 39 ; s general dimensions facilitating wound coverage by the dressing . as shown in fig3 the dressing of fig1 has been unraveled so that the resulting rope fits within the wound 14 . unraveling may be accomplished by merely applying force at the score line to separate the section 12 from the remainder of the dressing or by use of a suitable cutting means . the dressing in the form of a rope may be trimmed to any desired length . the dressing of the present invention is formed of a material that possesses good exudate absorption , and preferably contains one or more hydrocolloids . typically , presently available materials of this sort may swell to several times their original size when in contact with a moist environment . one attribute of the dressing of the present invention is that when it swells , the dressing has the tendency to retain its original cross sectional shape . thus , if the dressing originally has a rectangular cross section when the dressing comes into contact with fluid it expands to several times its original size but still retains its rectangular cross section . it is believed that this cross - sectional shape may contribute to the wound healing improvement provided by the present invention . by providing a dressing that is swellable , more complete coverage of the wound is possible . indeed , the wound need not be completely filled at initial application , because the swellable material will increase in dimension to fill the wound upon exposure to exudate . this is especially useful when using a rope in irregularly shaped wounds . alternatively , if the hydrocolloid - containing dressing material is in the form of a foam ( rope or disc ), it can possess suitable absorption properties with little or no increase in its dimensions . in situations where it is desirable to completely fill the wound upon initial application , this embodiment will be preferred . as will be appreciated , the dressing of the present invention is trimmed along the score line to form a rope which can be applied to fit the general configuration of the wound . whatever small gaps in the dressing &# 39 ; s coverage of the wound are readily reduced or eliminated as the dressing becomes moist and expands . table______________________________________ present spiralprior art wound fillers drawbacks dressing______________________________________1 . gauze soaked in saline dries out ; tissue in - stays moist ; no in - growth growth2 . alginate fibers form gel which must stays moist ; maintains be flushed out for its integrity for removal ; may dry out complete removal3 . gels liquify , must be handles high degree flushed out ; cannot of exudate accommodate much exudate______________________________________ the dressing of the present invention may be formed of any suitable material that provides good exudate absorption and preferably contains one or more hydrocolloids . a preferred material for use as the dressing of the present invention is a wound filler comprising from about 25 % to 75 % by weight of a polymeric matrix and 25 % to 75 % by weight of absorbing powders . preferably , the wound filler contains about 35 % to 50 % matrix and about 50 % to about 65 % absorbing powders . the polymer matrix may preferably contain about 15 % to 75 % of one or more styrene random or block type copolymers , from about 5 % to 40 % by weight of one or more polyisobutylenes and from 5 % to 40 % by weight of mineral oil . the absorbing powders include , but are not limited to , sodium or calcium alginates , cross - linked sodium carboxymethyl cellulose , absorbent polyacrylates and water soluble hydrocolloids . the hydrocolloid materials useful in the present invention include any water soluble gum such as pectin , gelatin , guar gum , locust bean gum , gum karaya , carboxymethyl - cellulose ( cmc ), sodium / calcium alginate fibers , polysaccharides and the like and mixtures thereof . the absorbing powders may also contain additional materials such as antibodies , or growth factors , and silver sulfadiazine or other antibacterial products . the hydrocolloid may contain other additives and agents . suitable antibiotic or antimicrobial agents including neomycin and penicillin may be used . a suitable antiseptic agent is povidone iodine . suitable anti - inflammatory agents include hydrocortisone and triamcinolone acetonides . a skin protective agent , such as zinc oxide , may also be included in the mixture . the hydrocolloid may be present in the powder , either with or without accelerators , to promote release , such as surfactants . the hydrocolloids are present in an amount of from about 0 % to 75 % of the weight and preferably 5 % to 15 %. the styrene random or block copolymer of the matrix permits the swelling of the absorbent powders while maintaining cohesion . suitable styrene copolymers include styrene - butadiene - styrene ( s - b - s ) and styrene - isoprene - styrene ( s - i - s ) block copolymers which are available from shell chemical co . under the trademark kraton i . e . kraton d1100 , 1101 , 1102 , 1107 etc . the most preferred material is the styrene - isoprene - styrene copolymer kraton d1107 . blends of styrene - isoprene - styrene ( s - i - s ) copolymers either alone or with sbs copolymers may also be used . in addition , there may be blends of one or more sbs copolymers . the presence of polyisobutylene in the wound filler aids in binding the absorbing powders in the styrene network . preferred polyisobutylenes are lower molecular weight polyisobutylene having a viscosity average molecular weight of from about 36 , 000 to about 58 , 000 ( florey ). such polyisobutylenes are commercially available under the trademark vistanex from exxon as grades lmms and lmmh . preferably , the polyisobutylene , vistanex lmmh is used in the wound filler of this invention . if desired , 25 % to 75 % of the polyisobutylene can be substituted with butyl rubber . the mineral oil functions as a plasticizer for the styrene random or block copolymer component . it also functions to increase the stretchability of the wound filler matrix . the absorbing powders of the wound filler of the present invention constitute 25 % to 75 % by weight of the composition . in the preferred compositions , the absorbing powders are present in about 50 % to 65 % by weight . the powders for use in this invention absorb at least 300 % by weight of the wound filler and preferably 500 %. the absorbing powders useful in the invention have large water absorbing capacity , i . e ., 1000 % to 4000 % by weight and are capable of being irradiated without substantial loss of water absorbing capacity . additionally , they must not be easily leached out of the matrix when in contact with water . alginate - containing absorbent powders are known such as those available under the tradename kelset from kelco co ., or mixtures of sodium alginate and calcium alginate commercially available under the tradename sobalg na alginate and sobalg ca alginate and commercially available from grinsted of denmark or mixtures of na alginate and ca alginate available under the tradenames protanal na alginate and protanal ca alginate from protan of norway . preferably , the absorbing powders contain 10 % to 75 % by weight of sodium - calcium alginates . absorbing powders such as cross - linked sodium carboxymethyl cellulose are commercially available under the tradename acdisol from fmc and under the tradename akucell swx 177 from akzo co . of holland . the powders may also include finely divided substantially water insoluble , highly absorbent polyacrylates . representative of the highly absorbent polyacrylates are starchgraft copolymer such as that described in u . s . pat . no . 3 , 661 , 815 and commercially available from grain processing corp . under the tradename water lock a starch - graftpoly ( sodium acrylate - co - acrylamide )!, salt of cross linked polyacrylic acid / polyalcohol grafted copolymer commercially available under the tradename favor sab800 from stockhausen , inc . greensboro , n . c ., polyacrylate available under the tradename salsorb 84 from allied colloids , inc . suffolk , va ., sodium polyacrylate available under the tradename water lock j500 from grain processing corporation , cross - linked acrylic polymer under the name aridall 1078 from american colloid company , skokie , ill ., and potassium polyacrylate under the name arasorb 732 and 810 from arakawa chemical industries , ltd ., osaka , japan . water lock a140 is the preferred polyacrylate . the wound filler of this invention may be prepared by mixing the components in a heated , sigma blade , kneader mixer . the batch components are kneaded for a prescribed length of time in the temperature controlled mixer . when mixing is complete , the batch is discharged using the extrusion screw at the base of the mixer . the formulated means is fed to the hopper of a single screw extruder . the extruder heats and pumps the mass along the extruder barrel and through a sheet forming die . the mass is calendared to the desired thickness and wound on a take - up roll . rolls of extruded material are cut to the desired shape and size by passing the sheet through a rotary die cutter . the score line may be formed by any suitable means including , for example , manually such as by a blade or by means of laser scoring . no matter the method of forming the area of weakness , care must be taken to avoid creating too deep a score line that unnecessarily weakens the dressing . the dressings are then individually sealed in appropriate packaging and terminally sterilized . the vistanex lmmh was added to a sigma blade mixer preheated to 305 ° f . and mixed for ten minutes . the kraton was pre - melted and mixed for ten minutes . the mineral oil was added to the plastic mass in three separate allotments with ten minutes mixing after each allotment . the mass was mixed an additional 30 minutes to ensure full incorporation of the oil into the plastic mass . the powders were added next with four to five minutes mixing after the addition of each powder . at the completion of mixing , the mass temperature was 220 ° f . the mass was removed from the mixer as a crumb which was fed into a 21 / 2 &# 34 ; single screw extruder . extruder temperatures ranged from 225 ° f . to 250 ° f . the mass was extruded through a sheet die and calendared between silicone release paper to a thickness of 85 mils . the calendared mass was wound on a roll and then proceeded to a rotary die cutting process . spiral disks 49 to 60 mm in diameter were cut from the mass sheet . the spiral dressings were individually packaged in film / paper chevron pouches and terminally sterilized by gamma irradiation at 2 . 7 to 3 . 3 mrads . when the absorbent wound filler of this example was tested for moisture absorption ( on a saline soaked sponge ), the following results were obtained . ______________________________________absorbency of spiral shaped dressingtime ( hours ) 0 2 4 6 24 48______________________________________average gain per square inch 0 3 . 2 4 . 7 6 . 0 14 . 3 18 . 7 ( grams ) percent 0 85 145 200 539 721______________________________________ the dressing of the present invention provides an excellent degree of wound debridement and in a preferred embodiment is capable of swelling to several times its original size usually at least 2 to 4 times its original size . in addition , the dressing remains moist and is easily removed from the wound . | 0 |
referring to the drawings in particular , only part of the arm shaft 1 , part of the needle bar 2 driven via the arm shaft 1 , the needle 3 inserted in the said needle bar , as well as the hook 4 cooperating with the needle to form double thread lockstitches , are shown of the sewing machine , which is shown in a highly schematic form only . an asynchronous motor 5 , which is in drive connection with the arm shaft 1 via a belt drive 6 , is used to drive the sewing machine . a signal transmitter 7 scanning the angular position α of the arm shaft 1 is connected to the arm shaft 1 . the sewing machine contains a thread - cutting device 8 , which has a horizontally movable catch thread device 9 and a stationarily arranged cutting knife 10 . the shape of the catch thread device 9 corresponds to that of the catch thread device disclosed in the above - mentioned de - gm 19 68 920 . the catch thread device 9 correspondingly also has a tip , which is not shown in detail here , a hook , and a cutting edge , which cooperates with the cutting knife 10 . the catch thread device 9 is connected via a connecting rod 11 to a two - armed lever 12 , which is held in a starting position by means of a tension spring 13 . in the exemplary embodiment according to fig1 the tie rod 14 of an electromagnet 15 is articulated to the lever 12 . the wiper arm 16 of a displacement transducer 17 is fastened to the tie rod 14 . a regulating device operating as a cascade control is used to operate the electromagnet 15 . this cascade control comprises essentially two controllers connected to one another in a cascade structure , namely , a position controller 19 and a velocity controller 20 . the regulating device also contains a set point transducer 21 . a first input of the set point transducer 21 is connected to the signal transmitter 7 , and a second input is connected to the machine control , not shown , from which a start signal is sent for initiating a thread - cutting process . a first output of the set point transducer 21 is connected to a comparator point 23 associated with the position controller 19 , and a second output is connected to a comparator point 24 associated with the velocity controller 20 . the comparator point 23 is directly connected to the displacement transducer 17 and receives from it measured signals , which indicate the current position of the tie rod 14 . since this tie rod 14 is in positive - locking connection with the catch thread device 9 via the lever 12 and the connecting rod 11 , the displacement signals also indicate indirectly the current position of the catch thread device 9 . the comparator point 24 is indirectly connected to the displacement transducer 17 via a differentiating member 25 . the current velocity ds / dt of the tie rod 14 and of the catch thread device 9 is calculated in the differentiating member 25 and is sent to the comparator point 24 . the output signals of the velocity controller 20 are sent to an output stage 26 , where they are amplified to operate the electromagnet 15 . the current intensity in the feed line leading to the electromagnet 15 can be monitored by means of a feedback branch 27 . optimal control properties can thus be achieved , and excessively high current intensities can thus be avoided . a connecting rod 30 , which is connected to a rack 31 , is articulated to the lever 12 in the exemplary embodiment according to fig2 . a pinion 32 , which is fastened to the shaft of a stepping motor 33 , meshes with the rack 31 . a control device 34 , designed as a path plan control , is used to operate the stepping motor 33 . a memory 35 used as a program transmitter is associated with the control device 34 . the control device 34 is connected via additional inputs to the signal transmitter 7 and to the machine control , not shown , from which a start signal for initiating a thread - cutting process is sent . the output signals of the control device 34 are sent to an output stage 36 , where they are transformed into drive signals for the stepping motor 33 . the mode of operation of the thread - cutting device will be described below on the basis of the flow chart in fig5 and of the diagrams in fig3 and 4 . after the sewing machine has been started , the command is given for performing a thread - cutting process at a point in time t f set by the operator , e . g ., at the end of a seam or of a seam section , in step s1 . the sewing machine is still operating at full speed n n at this point in time . the machine or motor control now decelerates the sewing machine to a stop , while making a few more stitches , and the speed n of the sewing machine or of the arm shaft 1 is described by the curve drawn in solid line in the diagram in fig3 . the speed n of the arm shaft 1 is determined in step s2 . a check is performed at the branching in step s3 to determine whether the current speed n is lower than or equal to a limit speed n g , which essentially corresponds to the cutting speed in sewing machines with speed - controlled positioning drive . this limit speed of revolutions n g , set at , e . g ., 180 rpm , is measured so that upon reaching this speed of revolutions the machine performs at least two more complete revolutions of the hook until the machine stops . when the limit speed n g is reached , the angle of rotation α of the arm shaft 1 is measured in step s4 via the signal transmitter 7 . as soon as an angle of rotation α st , which is intended for the proper performance of a thread - cutting process and which is used as a starting point , has been determined , the movement of the catch thread device 9 is then performed in step s6 according to an instruction s ( α ) stored in the memory 22 or 35 . the instruction s ( α ) states that a movement program , whose position data , which determine the path s of the catch thread device 9 , are in a fixed relation according to fig4 to the actual angle of rotation α of the arm shaft 1 or to the angle data of the arm shaft 1 generated by the signal transmitter 7 , is stored in the memories 22 and 35 for the drive of the catch thread device 9 . while the above - described operating process according to steps s1 through s5 is equally valid for the thread - cutting device designed as a regulating device and as a control , the instruction s ( α ) is now processed in the different thread - cutting devices corresponding to their particular design . in the device according to fig1 the movement program being stored in the memory 22 is calculated by the set value transducer 21 into corresponding anticipatory control values for the positioning controller 19 and the velocity controller 20 and they are sent to the comparator points 23 , 24 . the output variable sent by the positioning controller 19 is sent to the velocity controller 20 via the comparator point 24 , as a result of which the velocity controller 20 generates a velocity - proportional control signal . this is amplified in the output stage to the extent that the electromagnet 15 acting as an adjusting member is operated according to the program . the electromagnet 15 first attracts the tie rod 14 , pivoting the lever 12 in the process , and , as a consequence of this , it displaces the catch thread device 9 from the starting position shown into the end position predetermined by the movement program , while it penetrates with its tip into the triangle ( not shown ) formed by the two legs of the needle thread loop and the hook thread . the spring 13 then pulls the catch thread device 9 back into the starting position , while the threads or thread parts to be cut are grasped by the hook in the known manner and are cut through near the end of the movement of the catch thread device in cooperation between the cutting edge and the cutting knife 10 . since the position data for the movement of the catch thread device are permanently associated with certain angles α of the arm shaft 1 in the movement program for the catch thread device 9 , the set point transducer 21 sends feed data synchronized with the current rotary movement of the arm shaft 1 for the movement of the catch thread device 9 , so that the latter is always driven exactly coordinated with the rotary movement of the arm shaft 1 and consequently of the hook 4 . the path actually traveled by the catch thread device 9 is determined by the displacement transducer 17 while the thread - cutting process is being performed and it is sent as a signal sequence to the comparator point 23 , where a possible variance between the set point and the actual value of the movement of the catch thread device is determined . if a variance is present , it is compensated by the positioning controller 19 in the known manner . furthermore , the signal values of the displacement transducer 17 are continuously calculated in the differentiating member 25 into a velocity actual value ds / dt and compared at the comparator point 24 with a position - related velocity set point . if a variance is present , it is compensated by the velocity controller 20 in the known manner . in the device according to fig2 the movement program being stored in the memory 35 is calculated by the control device 34 into corresponding control values , which are amplified in the output stage 36 into driving signals for the stepping motor 33 . the stepping motor 33 now drives the lever 12 via the pinion 32 , the rack 31 and the connecting rod 30 comparably to the electromagnet 15 of the first exemplary embodiment , and the catch thread device 9 is also moved according to the instruction s ( α ), almost exactly coordinated with the rotary movement of the arm shaft 1 and consequently of the hook 4 . since the movement of the catch thread device 9 is always coupled with the rotary movement of the arm shaft 1 according to the program in both design variants , the catch thread device 9 always performs movements coordinated with the rotary movement of the hook 4 according to the instruction s ( α ), doing so independently from the current speed of the sewing machine . this means that the thread - cutting process can be performed during the phase of deceleration of the sewing machine and consequently while the speed is continuously decreasing according to the solid line in the diagram shown in fig3 . it is therefore unnecessary in this case to provide a section with constant cutting speed according to the broken line in the diagram shown in fig3 during the phase of deceleration for carrying out the thread cutting , as it was necessary before for the operation of thread - cutting devices in sewing machines with speed - controlled positioning motors . a considerable amount of time is therefore saved in the thread - cutting device according to the present invention compared with the prior - art thread - cutting devices . while specific embodiments of the invention have been shown and described in detail to illustrate the application of the principles of the invention , it will be understood that the invention may be embodied otherwise without departing from such principles . | 3 |
the invention will now be described more fully with reference to the accompanying examples , in which certain preferred embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . surgically removing only the morbid part of an internal organ , such as a kidney , or only a selected portion of hyperplastic tissue , as in benign prostate hyperplasia , can be beneficial for the patient in that at least part of the functionality of the organ can often be spared . however , many of the organs that might benefit the patient if only part of the organ is removed are soft , and / or prone to bleed extensively , and / or have differing compartments , whose contents should not be allowed to mix ( e . g ., the kidney or liver ). for example , essentially normal kidney function can be preserved with less than one - half of the normal functionality of one of the two kidneys , and the liver can regenerate if sufficient detoxification potential is retained or provided artificially . the challenge to the surgeon is to efficiently and completely close such organs , after removal of a tumor or other abnormality , so that blood does not leak into the abdominal cavity , and so that the separation functions of the organs can rapidly regenerate . we have found , as published in patents and patent applications , that the use of a reverse - gelling polymer — i . e ., a polymer that gels as the temperature rises above a certain temperature ( tg )— can temporarily embolize the arteries ( us 2005 / 0008610 , incorporated herein by reference ) and other internal organs ( schwartz et al ., u . s . 60 / 874 , 062 , incorporated herein by reference ; raymond et al ., biomaterials 2004 vol . 25 , p . 3983 ). preliminary preclinical and clinical results appear promising . however , there are some uncertainties in the procedure and areas that can be improved . one uncertainty that one would like to reduce is the length of time needed to reperfuse the organ , after surgery and any necessary sealing or suturing is complete . this is because when the circulation is blocked , the affected region becomes anoxic . for brief periods , the anoxia is largely reversible , but damage does accrue , and the ability to reverse the damage upon reperfusion declines with the time of anoxia , at a rate that is organ dependent . hence , rapid reversal of the temporary embolization is highly desirable . application of cold solutions , such as cool or cold isotonic saline , will reverse the gelled state of the rgp , but it is not always feasible to do this quickly via the circulation itself , since the circulation is locally blocked by the reverse gelled polymer gel . hence , reperfusion is dependent on a combination of external cooling , and gradual dilution of the gel by the diffusion of molecules from the gel into the upstream or downstream circulation , or into tissue interstitial spaces and the like . another problem to be addressed is the avoidance of hemostasis of an entire organ , when what is required is hemostasis in the vicinity of a particular site . if circulation can be maintained in those parts of the organ not requiring surgery , and if the volume of tissue subjected to hemostasis can be minimized , then outcome can be improved , and in particular the likelihood of the organ remaining at least partially functional at the end of the procedure is markedly improved . another problem to be addressed is to prevent the flow of blood , in an organ being treated by heat or radiant energy , from distorting the zone of treatment by carrying heat from tissue intended to be treated , to other tissue outside the treatment zone . in response to these and other needs , a new approach to the problems of creating an embolized zone at the site of an operative procedure , and of removing an embolizing gel at the end of the procedure , and of maintaining perfusion in zones of the organ away from the operative site , has been invented . the new approach arises from the production of a reverse gelling polymer that gels over a relatively narrow range that is a few degrees above body temperature . gelation , and local embolization producing hemostasis , is then produced by replacing some or all of the blood in the organ with a reversible heat - gellable polymer solution . where possible , the gellable polymer is only instilled into regions of the organ that are to be treated . in particular , in the materials and procedures of the invention , the gelation temperature is greater than local body temperature . body temperature is about 37 ° c . internally , and so gelling temperatures of the heat - gellable polymer solution , for internal use , should be in the range of 38 ° c . or preferably at least 39 ° c ., up to about 48 ° c ., more preferably below about 45 ° c ., still more preferably in the range below about 42 ° c . if the polymer is to be used in or near the skin for a procedure , or otherwise in a body region where the overall temperature is below 37 ° c ., the preferred reverse gelling temperature of the gel may be lower , depending on the temperature to be induced in the particular tissue by the heating procedure . if the tissue is to be treated at a temperature above 37 ° c ., then perfusion with a polymer gelling above 37 ° c . is appropriate without regard to local tissue temperature . it is known that in certain concentration ranges , the gelling temperature of a reverse gelling polymer changes as the polymer concentration is varied . ( most commonly , the gelling temperature increases as the concentration is reduced , until the polymer fails to gel ). hence , it is possible to select gelling temperatures of rgp solutions by selection of a poloxamer or other rgp composition , and by adjustment of its concentration if required . poloxamers are preferred rgps in the invention . poloxamers are a well - known class of polyalkyleneoxide copolymers , typically composed of a core block of polypropylene oxide ) tipped at each terminus with a block of poly ( ethylene oxide ). most commonly , the polymer is unbranched . poloxamers having a higher proportion of propylene oxide tend to exhibit the reverse gelling phenomenon . as specific examples , the use of basf poloxamer 288 at a concentration of about 18 % in water , or of basf poloxamer 237 at a concentration of about 20 % in water , will produce a material which will gel as the temperature is raised into the range of about 39 - 42 ° c . (“ reverse ” gelation ). the poloxamer solution is preferably fractionated to narrow the gelling range . fractionation is described for example by reeve et al ., in u . s . pat . no . 5 , 800 , 711 , u . s . pat . no . 6 , 761 , 824 and u . s . pat . no . 6 , 977 , 045 ( incorporated herein by reference ). the fractionation procedure also tends to reduce the width of the temperature range over which viscosity rises rapidly with temperature , which simplifies the mechanical requirements , such as applied pressure , for administration of the polymer . other poloxamers , such as basf poloxamers 407 , 188 , 338 , 1107 and 1307 , and “ pluronic ” brand poloxamers , for example f127 and 108 , may also be suitable , after purification and selection of concentration , for use in 37 ° c . environments , or in colder environments near body surfaces . in use , the polymer is provided in a sterile solution of suitable salinity or tonicity for the task or procedure to be conducted . poloxamines , in which amine groups replace oxygens in the backbone or ends , can also be used . a preferred poloxamer is poloxamer 188 ( basf ). the poloxamer is purified as described by reeve et al ., cited above . effective concentrations of purified poloxamer 188 of about 35 % have gelling temperatures just above body temperature . using these concentrations as guidelines , gelling temperatures of the poloxamer solution can be adjusted within a reasonable range by varying the concentration of the poloxamer in the solution . ( all percentages of polymer is solvent cited herein are weight / weight ( w / w ) unless specified otherwise .) other suitable poloxamers include purified basf rtp 238 at 20 % in saline ; rtp 237 at 20 % in saline ; rtp 288 at 14 - 15 % in saline ; and rtp 288 at 15 % in tris buffered saline . the methods of the invention can be used in any organ or situation in the body where temporary but completely reversible hemostasis is desired . the salient feature of the invention , as opposed to other inventions involving temporary hemostasis with reverse gelling polymers , is that the polymers in the present invention are selected to gel at temperatures somewhat above the local tissue temperature . consequently , no gelation occurs unless an additional source of heating is provided . such heating may be provided by any source , and the heating need not have therapeutic effect . however , the methods of the invention are particularly advantageous when used in conjunction with a therapeutic effect of the localized heating . the treatment in which the reverse gelling polymer is provided may be for any purpose , including without limitation treatment for the removal or cure of a cancer , a benign tumor or growth , or a hemorrhage . any tissue may be involved , including without limitation liver , uterus , prostate , brain , spleen , pancreas , gall bladder , lung , breast , and kidney . the local embolization of tissue and organs with reverse gelling polymers has been described elsewhere , for example in other patent applications by applicants ( e . g ., us 2005 / 0008610 ), for local embolization occurring without an ancillary heat source . a system not requiring local heating will generally be simpler when it is effective , and so will be preferred . however , in some situations , the use of embolization with reverse - gelling polymers upon heating above body temperature is preferred , and has several advantages . first , a general advantage of the procedure is that it tends to minimize the amount of polymer temporarily deposited in the organ . second , it tends to minimize the volume of tissue in which hemostasis is established , minimizing anoxia in tissues of the organ of interest and in surrounding tissues . third , the re - liquefaction of the polymer at temperatures above body temperature leads to rapid cessation of hemostasis at the conclusion of the procedure . fourth , the need for additional heating allows a more precise localization of the tissue region in which hemostasis is achieved . any method of heating can be used . the heating of the organ can be provided by one or more of electromagnetic radiation , sonic energy , heated fluid , a heating pad , a heating element , and heat produced by a surgical tool or instrument . suitable methods include , without limitation , the use of microwaves , radio - frequency waves , infrared and visible light , and other non - ionizing electromagnetic radiation . electromagnetic radiation can be delivered to the exterior of a body or organ , or to interior sites via catheters , local generators , or the like . direct heating can be used by contact of a heating unit with the exterior of a body or tissue , or via catheters or other internal probes . heating of the target site can also be via electrical heating of a resistance , or by circulation of a heated fluid inside a device in contact with the tissue site . heating can be accomplished by heating a natural fluid , particularly blood or a temporary substitute for blood that is placed into the circulation , that will circulate to the site . heating can be accomplished by suspending the organ , or a region of the body , in a heated fluid , such as water , saline or the like . heating can be achieved via ultrasound and other vibratory mechanisms . the temperature rise at the site must be sufficient to cause the selected gelling solution to gel at the site . for example , if the poloxamer solution rises rapidly in viscosity above 39 ° c . and forms a firm gel at 42 ° c ., then the target temperature at the site is at least 42 ° c . if the poloxamer solution rises rapidly in viscosity above 35 ° c . and gels firmly at 38 ° c ., then a temperature of at least 38 ° c . will be sufficient . in a situation where the viscosity rises rapidly , but without gelation , in the physiological temperature range , it may be necessary to use a relatively large - bore device for injecting the polymer solution , or to cool the polymer solution below body temperature before administering it . fig1 illustrates the advantage of local gelation of polymers in the circulation that passes through a treatment site . a treatment zone 10 is created by a source of warmth 15 , which can be a probe situated below the plane of the drawing , perhaps in another artery or vein . the theoretical outer limit of the treatment zone 10 , in this example , is an essentially circular boundary 18 , at which the degree of heating drops below a therapeutic level . a blood vessel 20 flows through the treatment zone and branches into two smaller vessels 24 and 28 . natural circulation , indicated by small arrows , passes through vessel 20 and out of vessels 24 and 28 . however , the blood flow picks up heat from the treatment zone . this causes cooling in the vicinity of the blood entrance into the heating zone , shown as hatched area 32 , and causes heating at regions beyond the target zone 10 along the exiting blood vessels , shown as hatched areas 36 and 38 . it is likely that tissue in the area 32 will not be properly treated , and that tissue in areas 36 and 38 will be treated even though outside the target zone . this is undesirable . however , if heating is begun , and then followed by instillation of a reverse - gelling poloxamer solution at a location upstream of the target region , leading to vessel 20 , then a gel will form in the region being treated . the gel may begin to form in the distal vessels 26 and 28 , and once formed , will stop circulation through the treatment site . then the heat distribution in the zone 10 will more closely approximate the distribution planned for the treatment , having a treatment boundary at the circular border 18 . once heating element 15 is turned off , the tissue will rapidly drop to body temperature by heat transfer through the treated tissue to tissue outside the treatment zone 10 . the gelled polymer solution in the vessels 20 , 24 , and 28 will re - liquefy , and circulation will resume . the reperfusion of the organ may be accelerated , if desired , by circulation of isotonic fluid at a temperature of less than 37 ° c ., or even less than 30 ° c . circulation may be exterior to the organ , and / or through regions of the organ where circulation has not been blocked by gelation of polymer . if the site needs to be closed after treatment , closure may be attained with any conventional method , including without limitation one or more of sutures , staples , sealant , adhesive , and hemostatic agent , before the reduction of temperature to allow reperfusion of the organ by blood . in addition to thermotherapy , the reversible local embolization technique of the invention is applicable to surgical procedures removing tissue , particularly for removing part of a vascularized or compartmented organ , such as partial removal of liver or kidney . such highly metabolically active organs require minimization of the anoxia produced by embolization , both spatially and in terms of duration . in such tissues , a portion of the tissue is embolized by local warming , which may include local perfusion , in the normal direction or its reverse , with a warming solution , as well as local heating by other means . then , when the region adjacent to the region to be excised has been sufficiently warmed , it is perfused with an embolizing solution containing a reverse gelling polymer . the warmth causes local embolization . the tissue to be removed is quickly excised , and a sealing barrier layer is created by conventional means , for example and without limitation by one or more of local cautery , provision of tissue adhesives and barrier materials , and suturing . with proper timing , the rest of the organ can be de - embolized within a few minutes as the applied warming dissipates . the dissected and sealed organ can also be cooled immediately to accelerate reperfusion . the reverse gelling polymer solution can further comprise other medical materials . these may include , among others , a contrast - enhancing agent , which may be selected from the group consisting of radiopaque materials , paramagnetic materials , heavy atoms , transition metals , lanthanides , actinides , dyes , and radionuclide - containing materials . the solution may further comprises a biologically active agent , which , for example , may comprise one or more of anti - inflammatories , antibiotics , antimicrobials , antivirals , analgesics , antiproliferatives , and chemotherapeutics , or other biologically active agents . all of the patents and publications cited herein are hereby incorporated by reference in jurisdictions permitting the same . those skilled in the art will recognize , or be able to ascertain using no more than routine experimentation , many equivalents to the specific embodiments of the invention described herein . such equivalents are intended to be encompassed by the following claims . | 0 |
reference will now be made in detail to an illustrative embodiment of the invention , which appears in the accompanying drawings . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . in one embodiment of the present invention , as shown in fig7 , a damaged annulus 42 is repaired by use of surgical sutures 40 . one or more surgical sutures 40 are placed at about equal distances along the sides of a pathologic aperture 44 in the annulus 42 . reapproximation or closure of the aperture 44 is accomplished by tying the sutures 40 so that the sides of the aperture 44 are drawn together . the reapproximation or closure of the aperture 44 enhances the natural healing and subsequent reconstruction by the natural tissue ( e . g ., fibroblasts ) crossing the now surgically narrowed gap in the annulus 42 . preferably , the surgical sutures 40 are biodegradable , but permanent non - biodegradable may be utilized . additionally , to repair a weakened or thinned wall of a disc annulus 42 , a surgical incision can be made along the weakened or thinned region of the annulus 42 and one or more surgical sutures 40 can be placed at about equal distances laterally from the incision . reapproximation or closure of the incision is accomplished by tying the sutures 40 so that the sides of the incision are drawn together . the reapproximation or closure of the incision enhances the natural healing and subsequent reconstruction by the natural tissue crossing the now surgically narrowed gap in the annulus 42 . preferably , the surgical sutures 40 are biodegradable , but permanent non - biodegradable materials may be utilized . in an alternative embodiment , the method can be augmented by the placement of a patch of human muscle fascia or any other autograft , allograft or xenograft in and across the aperture 44 . the patch acts as a bridge in and across the aperture 44 , providing a platform for traverse of fibroblasts or other normal cells of repair existing in and around the various layers of the disc annulus 42 , prior to closure of the aperture 44 . in a further embodiment , as shown in fig8 a - b a biocompatible membrane can be employed as an annulus stent 10 , being placed in and across the aperture 44 . the annulus stent 10 acts as a bridge in and across the aperture 44 , providing a platform for a traverse of fibroblasts or other normal cells of repair existing in and around the various layers of the disc annulus 42 , prior to closure of the aperture 44 . in some embodiments the device , stent or patch can act as a scaffold to assist in tissue growth that healingly scars the annulus . in an illustrative embodiment , as shown in fig1 - 3 , the annulus stent 10 comprises a centralized vertical extension 12 , with an upper section 14 and a lower section 16 . the centralized vertical extension 12 can be trapezoid in shape through the width and may be from about 8 mm - 12 mm in length . additionally , the upper section 14 of the centralized vertical extension 12 may be any number of different shapes , as shown in fig4 a through 4c , with the sides of the upper section 14 being curved or with the upper section 14 being circular in shape . furthermore , the annulus stent 10 may contain a recess between the upper section 14 and the lower section 16 , enabling the annulus stent 10 to form a compatible fit with the edges of the aperture 44 . the upper section 14 of the centralized vertical extension 12 can comprise a slot 18 , where the slot 18 forms an orifice through the upper section 14 . the slot 18 is positioned within the upper section 14 such that it traverses the upper section &# 39 ; s 14 longitudinal axis . the slot 18 is of such a size and shape that sutures , tension bands , staples or any other type of fixation device known in the art may be passed through , to affix the annulus stent 10 to the disc annulus 42 . in an alternative embodiment , the upper section 14 of the centralized vertical extension 12 may be perforated . the perforated upper section 14 contains a plurality of holes that traverse the longitudinal axis of upper section 14 . the perforations are of such a size and shape that sutures , tension bands , staples or any other type of fixation device known in the art may be passed through , to affix the annulus stent 10 to the disc annulus 42 . the lower section 16 of the centralized vertical extension 12 can comprise a pair of lateral extensions , a left lateral extension 20 and a right lateral extension 22 . the lateral extensions 20 and 22 comprise an inside edge 24 , an outside edge 26 , an upper surface 28 , and a lower surface 30 . the lateral extensions 20 and 22 can have an essentially constant thickness throughout . the inside edge 24 is attached to and is about the same length as the lower section 16 . the outside edge 26 can be about 8 mm - 16 mm in length . the inside edge 24 and the lower section 16 meet to form a horizontal plane , essentially perpendicular to the centralized vertical extension 12 . the upper surface 28 of the lateral extensions 20 and 22 can form an angle from about 0 °- 60 ° below the horizontal plane . the width of the annulus stent 10 may be from about 3 mm - 8 mm . additionally , the upper surface 28 of the lateral extensions 20 and 22 may be barbed for fixation to the inside surface of the disc annulus 42 and to resist expulsion through the aperture 44 . in an alternative embodiment , as shown in fig4 b , the lateral extensions 20 and 22 have a greater thickness at the inside edge 24 than at the outside edge 26 . in an illustrative embodiment , the annulus stent 10 is a solid unit , formed from one or more of the flexible resilient biocompatible or bioresorbable materials well know in the art . the selection of appropriate stent materials may be partially predicated on specific stent construction and the relative properties of the material such that , after fixed placement of the stent , the repair may act to enhance the healing process at the aperture by relatively stabilizing the tissue and reducing movement of the tissue surrounding the aperture . for example , the annulus stent 10 may be made from : a porous matrix or mesh of biocompatible and bioresorbable fibers acting as a scaffold to regenerate disc tissue and replace annulus fibrosus as disclosed in , for example , u . s . pat . no . 5 , 108 , 438 ( stone ) and u . s . pat . no . 5 , 258 , 043 ( stone ), a strong network of inert fibers intermingled with a bioresorbable ( or bioabsorbable ) material which attracts tissue ingrowth as disclosed in , for example , u . s . pat . no . 4 , 904 , 260 ( ray et al .). a biodegradable substrate as disclosed in , for example , u . s . pat . no . 5 , 964 , 807 ( gan at al . ); or an expandable polytetrafluoroethylene ( eptfe ), as used for conventional vascular grafts , such as those sold by w . l . gore and associates , inc . under the trademarks gore - tex and preclude , or by impra , inc . under the trademark impra . furthermore , the annulus , stent 10 , may contain hygroscopic material for a controlled limited expansion of the annulus stent 10 to fill the evacuated disc space cavity . additionally , the annulus stent 10 may comprise materials to facilitate regeneration of disc tissue , such as bioactive silica - based materials that assist in regeneration of disc tissue as disclosed in u . s . pat . no . 5 , 849 , 331 ( ducheyne , et al . ), or other tissue growth factors well known in the art . many of the materials disclosed and described above represent embodiments where the device actively promotes the healing process . it is also possible that the selection of alternative materials or treatments may modulate the role in the healing process , and thus promote or prevent healing as may be required . it is also contemplated that these modulating factors could be applied to material substrates of the device as a coating , or similar covering , to evoke a different tissue response than the substrate without the coating . in further embodiments , as shown in fig5 ab - 6 ab , the left and right lateral extensions 20 and 22 join to form a solid pyramid or cone . additionally , the left and right lateral extensions 20 and 22 may form a solid trapezoid , wedge , or bullet shape . the solid formation may be a solid biocompatible or bioresorbable flexible material , allowing the lateral extensions 20 and 22 to be compressed for insertion into aperture 44 , then to expand conforming to the shape of the annulus &# 39 ; 42 inner wall . alternatively , a compressible core may be attached to the lower surface 30 of the lateral extensions 20 and 22 , forming a pyramid , cone , trapezoid , wedge , or bullet shape . the compressible core may be made from one of the biocompatible or bioresorbable resilient foams well known in the art . the core can also comprise a fluid - expandable membrane , e . g ., a balloon . the compressible core allows the lateral extensions 20 and 22 to be compressed for insertion into aperture 44 , then to expand conforming to the shape of the annulus &# 39 ; 42 inner wall and to the cavity created by pathologic extrusion or surgical removal of the disc fragment . in an illustrative method of use , as shown in fig1 a - d , the lateral extensions 20 and 22 are compressed together for insertion into the aperture 44 of the disc annulus 42 . the annulus stent 10 is then inserted into the aperture 44 , where the lateral extensions 20 , 22 expand . in an expanded configuration , the upper surface 28 can substantially conform to the contour of the inside surface of the disc annulus 42 . the upper section 14 is positioned within the aperture 44 so that the annulus stent 10 may be secured to the disc annulus 42 , using means well known in the art . in an alternative method , where the length of the aperture 44 is less than the length of the outside edge 26 of the annulus stent 10 , the annulus stent 10 can be inserted laterally into the aperture 44 . the lateral extensions 20 and 22 are compressed , and the annulus stent 10 can then be laterally inserted into the aperture 44 . the annulus stent 10 can then be rotated inside the disc annulus 42 , such that the upper section 14 can be held back through the aperture 44 . the lateral extensions 20 and 22 are then allowed to expand , with the upper surface 28 contouring to the inside surface of the disc annulus 42 . the upper section 14 can be positioned within , or proximate to , the aperture 44 in the subannular space such that the annulus stent 10 may be secured to the disc annulus , using means well known in the art . in an alternative method of securing the annulus stent 10 in the aperture 44 , as shown in fig9 , a first surgical screw 50 and second surgical screw 52 , with eyeholes 53 located at the top of the screws 50 and 52 , are inserted into the vertebral bodies , illustratively depicted as adjacent vertebrae 54 and 56 . after insertion of the annulus stent 10 into the aperture 44 , a suture 40 is passed down though the disc annulus 42 , adjacent to the aperture 44 , through the eye hole 53 on the first screw 50 then back up through the disc annulus 42 and through the orifice 18 on the annulus stent 10 . this is repeated for the second screw 52 , after which the suture 40 is secured . one or more surgical sutures 40 are placed at about equal distances along the sides of the aperture 44 in the disc annulus 42 . reapproximation or closure of the aperture 44 is accomplished by tying the sutures 40 in such a fashion that the sides of the aperture 44 are drawn together . the reapproximation or closure of the aperture 44 enhances the natural healing and subsequent reconstruction by the natural tissue crossing the now surgically narrowed gap in the annulus 42 . preferably , the surgical sutures 40 are biodegradable but permanent non - biodegradable forms may be utilized . this method should decrease the strain on the disc annulus 42 adjacent to the aperture 44 , precluding the tearing of the sutures through the disc annulus 42 . it is anticipated that fibroblasts will engage the fibers of the polymer or fabric of the intervertebral disc stent 10 , forming a strong wall duplicating the currently existing condition of healing seen in the normal reparative process . in an additional embodiment , as shown in fig1 a - b , a flexible bladder 60 is attached to the lower surface 30 of the annulus stent 10 . the flexible bladder 60 comprises an internal cavity 62 surrounded by a membrane 64 , where the membrane 64 is made from a thin flexible biocompatible material . the flexible bladder 60 is attached to the lower surface 30 of the annulus stent 10 in an unexpanded condition . the flexible bladder 60 is expanded by injecting a biocompatible fluid or expansive foam , as known in the art , into the internal cavity 62 . the exact size of the flexible bladder 60 can be varied for different individuals . the typical size of an adult nucleus is about 2 cm in the semi - minor axis , 4 cm in the semi - major axis , and 1 . 2 cm in thickness . in an alternative embodiment , the membrane 64 is made of a semi - permeable biocompatible material . the mechanical properties of the injectate material may influence the performance of the repair and it is contemplated that materials which are “ softer ” or more compliant as well as materials that are less soft and less compliant than healthy nucleus are contemplated within the scope of certain embodiments of the invention . it must be understood that in certain embodiments the volume added to the subannular space may be less than equal to or larger than the nucleus volume removed . the volume of the implant may vary over time as well in certain embodiments . in an illustrative embodiment , a hydrogel is injected into the internal cavity 62 of the flexible bladder 60 . a hydrogel is a substance formed when an organic polymer ( natural or synthetic ) is cross - linked via , covalent , ionic , or hydrogen bonds to create a three - dimensional open - lattice structure , which entraps water molecules to form a gel . the hydrogel may be used in either the hydrated or dehydrated form . in a method of use , where the annulus stent 10 has been inserted into the aperture 44 , as has been previously described and shown in fig1 a - b , an injection instrument , as known in the art , such as a syringe , is used to inject the biocompatible fluid or expansive foam into the internal cavity 62 of the flexible bladder 60 . the biocompatible fluid or expansive foam is injected through the annulus stent 10 into the internal cavity 62 of the flexible bladder 60 . sufficient material is injected into the internal cavity 62 to expand the flexible bladder 60 to fill the void in the intervertebral disc cavity . the use of the flexible bladder 60 is particularly useful when it is required to remove all or part of the intervertebral disc nucleus . the surgical repair of an intervertebral disc may require the removal of the entire disc nucleus , being replaced with an implant , or the removal of a portion of the disc nucleus thereby leaving a void in the intervertebral disc cavity . the flexible bladder 60 allows for the removal of only the damaged section of the disc nucleus , with the expanded flexible bladder 60 filling the resultant void in the intervertebral disc cavity . a major advantage of the annulus stent 10 with the flexible bladder 60 is that the incision area in the annulus 42 can be reduced in size , as there is no need for the insertion of an implant into the intervertebral disc cavity . in an alternative method of use , a dehydrated hydrogel is injected into the internal cavity 62 of the flexible bladder 60 . fluid , from the disc nucleus , passes through the semipermeable membrane 64 hydrating the dehydrated hydrogel . as the hydrogel absorbs the fluid the flexible bladder 60 expands , filling the void in the intervertebral disc cavity . in an alternative embodiment , as shown in fig1 , the annulus stent 10 is substantially umbrella shaped , having a central hub 66 with radially extending struts 67 . each of the struts 67 is joined to the adjacent struts 67 by a webbing material 65 , forming a radial extension 76 about the central hub 66 . the radial extension 76 has an upper surface 68 and a lower surface 70 , where the upper surface 68 contours to the shape of the disc annulus &# 39 ; 42 inner wall when inserted as shown in fig1 a - c , and where the lower surface 70 contours to the shape of the disc annulus &# 39 ; 42 inner wall when inserted as shown in fig1 a - c . the radial extension 76 may be substantially circular , elliptical , or rectangular in plan shape . additionally , as shown in fig2 , the upper surface 68 of the radial extension 76 may be barbed 82 for fixation to the disc annulus &# 39 ; 42 inner wall and to resist expulsion through the aperture 42 . as shown in fig1 and 15 , the struts 67 are formed from flexible material , allowing the radial extension 76 to be collapsed for insertion into aperture 44 , then the expand conforming to the shape of the inner wall of disc annulus 42 . in the collapsed position , the annulus stent 10 is substantially frustoconical or shuttlecock shaped , and having a first end 72 , comprising the central hub 66 , and a second end 74 . in an alternative embodiment , the radial extension 76 has a greater thickness at the central hub 66 edge than at the outside edge . in an embodiment , the annulus stent 10 is a solid unit , formed from one or more of the flexible resilient biocompatible or bioresorbable materials well known in the art . additionally , the annulus stent 10 may comprise materials to facilitate regeneration of disc tissue , such as bioactive silica based materials that assist in regeneration of disc tissue as disclosed in u . s . pat . no . 5 , 849 , 331 ( ducheyne , et al . ), or other tissue growth factors well known in the art . alternatively , as shown in fig2 , a compressible core 84 may be attached to the lower surface 70 of the radial extension 76 . the compressible core 84 may be made from one of the biocompatible or bioresorbable resilient foams well known in the art . the compressible core 84 allows the radial extension 76 to be compressed for insertion into aperture 44 then to expand conforming to the shape of the disc annulus &# 39 ; 42 inner wall and to the cavity created by pathologic extrusion or surgical removal of the disc fragment . in an additional embodiment , as shown in fig1 a and 18b , a flexible bladder 80 is attached to the lower surface 70 of the annulus stent 10 . the flexible bladder 80 comprises an internal cavity 86 surrounded by a membrane 88 , where the membrane 88 is made from a thin flexible biocompatible material . the flexible bladder 86 is attached to the lower surface 70 of the annulus stent 10 in an unexpanded condition . the flexible bladder 80 is expanded by injecting a biocompatible fluid or expansive foam , as known in the art , into the internal cavity 86 . the exact size of the flexible bladder 80 can be varied for different individuals . the typical size of an adult nucleus is 2 cm in the semi - minor axis , 4 cm in the semi - major axis and 1 . 2 cm in thickness . in an alternative embodiment , the membrane 88 is made of a semi - permeable biocompatible material . in a method of use , as shown in fig1 a - 16c , the radial extension 76 is collapsed together , for insertion into the aperture 44 of the disc annulus 42 . the radial extension 76 is folded such the upper surface 68 forms the outer surface of the cylinder . the annulus stent 10 is then inserted into the aperture 44 , inserting the leading end 72 though the aperture 44 until the entire annulus stent 10 is within the disc annulus 42 . the radial extension 76 is released , expanding within the disc 44 . the lower surface 70 of the annulus stent 10 contours to the inner wall of disc annulus 42 . the central hub 66 is positioned within the aperture 44 so that the annulus stent 10 may be secured to the disc annulus 42 using means well known in the art . it is anticipated that fibroblasts will engage the fibers of the polymer of fabric of the annulus stent 10 , forming a strong wall duplicating the currently existing condition of healing seen in the normal reparative process . in an alternative method of use , as shown in fig1 a - 17c , the radial extension 76 is collapsed together for insertion into the aperture 44 of the disc annulus 42 . the radial extension 76 is folded such that the upper surface 68 forms the outer surface of the stent , for example in a frustoconical configuration as illustrated . the annulus stent 10 is then inserted into the aperture 44 , inserting the tail end 74 through the aperture 44 until the entire annulus stent 10 is in the disc . the radial extension 76 is released , expanding within the disc . the upper surface 68 of the annulus stent 10 contours to the disc annulus &# 39 ; 42 inner wall . the central hub 66 is positioned within the aperture 44 so that the annulus stent 10 may be secured to the disc annulus 42 , using means well known in the art . in one illustrative embodiment , the barbs 82 on the upper surface 68 of one or more strut 67 or other feature of the radial extension 76 , engage the disc annulus &# 39 ; 42 inner wall , holding the annulus stent 10 in position . in a method of use , as shown in fig1 a - 12b , where the annulus stent 10 has been inserted into the aperture 44 , as has been previously described . similarly , for the stent shown in fig1 through 21 , an injection instrument , as known in the art , such as a syringe , can be used to inject the biocompatible fluid or expansive foam into the internal cavity 86 of the flexible bladder 80 . the biocompatible fluid or expansive foam is injected through the annulus stent 10 into the internal cavity 86 of the flexible bladder 80 . sufficient material is injected into the internal cavity 86 to expand the flexible bladder 80 to fill the void in the intervertebral disc cavity . the material can be curable ( i . e ., glue ). the use of the flexible bladder 80 is particularly useful when it is required to remove all or part of the intervertebral disc nucleus . it should be noted that in any of the “ bag ” embodiments described herein one wall or barrier can be made stiffer and less resilient than others . this relatively stiff wall member can then be placed proximate the annulus wall and can advantageously promote , in addition to its reparative properties , bag containment within the annulus . fig2 shows a further aspect of the present invention . according to a further illustrative embodiment , a simplified schematic cross section of a vertebral pair is depicted including an upper vertebral body 110 , a lower vertebral body 112 and an intervertebral disc 114 . an aperture or rent 116 in the annulus fibrosus ( af ) is approached by a tube 118 , which is used to deliver a device 120 according to a further aspect of the present invention . the device 120 may be captured by a delivery tool 122 through the use of a ring or other fixation feature 124 mounted on the repair device 120 . fig2 shows a delivery method similar to that depicted in fig2 , with the exception that the tube 118 a has a reduced diameter so that it may enter into the sub - annular space of the disc 114 through the aperture or rent . turning to fig2 , according to a further aspect of the present invention , the delivery of the device 120 through the delivery tube 118 or 118 a may be facilitated by folding the arms or lateral extensions 128 , 130 of the device to fit within the lumen of the tube 118 or 118 a so that the stent or device 120 is introduced in a collapsed configuration . the device 120 is moved through the lumen of the tubes 118 or 118 a through the use of delivery tool 122 . fig2 shows the arms deflected in a distal , or forward direction for insertion into the delivery tube 118 or 118 a while fig2 shows the arms 128 , 130 deflected into a proximal position . fig2 shows the device 120 curled so that one arm 128 is projecting distally , or in a forward direction , and the other arm 130 is projecting proximally , or in a rearward direction . because the lateral extent of the device is relatively flexible , whether the device is of natural or synthetic material , other collapsible configurations consistent with the intent of this invention are also possible , including twisting , balling , crushing , etc . fig2 shows the device 120 having a series of peripheral barb structures typified by barb 132 located at the edges . in operation , these barbs may be forced into the annulus fibrosus as seen in connection with fig2 . barb placement can be anywhere on the device 120 provided that at least some number of barbs are likely to find annulus fibrosus tissue to anchor in during placement . for a simple aperture or rent , placement on the periphery of the device body is a reasonable choice , but for complex tears , it may be desirable to place a plurality of barbs on the device not knowing in advance which barbs will find tissue to anchor in during placement . fig2 shows an alternative fixation strategy where a pair of barbs 134 and 136 are plunged into the annulus fibrosus from the exterior of the annulus while the device 120 is retained in the sub - annular space by means of a tether 142 . although there are a wide variety of fixation devices in this particular example , a tether 142 may be knotted 145 with the band 144 holding the barbs 134 and 136 together to fix the device in the sub - annular space . the knot is shown in an uncinched position to clarify the relationship between the tether 142 and the bands 144 . using this approach , the device can be maintained in a subannular position by the barbed bands while the tether knot is cinched , advantageously simultaneously reapproximating the annulus to close the aperture while drawing the device into sealing , bridging engagement with the subannular wall of the annulus fibrosus . fig3 shows an alternative fixation strategy where the barbs 148 and 150 are sufficiently long that they can pierce the body of the device 120 and extend all the way through the annulus fibrosus into the device 120 . in this configuration , the band 144 connecting the barbs 148 and 150 may be tightened to gently restrain and position the device 120 in the sub - annular space , or tightened with greater force to reapproximate the aperture or rent . fig3 shows a still further illustrative embodiment according to another aspect of the present invention . in this embodiment , a metal substrate 160 is incorporated into the device 120 . this piece can be machined from flat stock and includes the loop 162 as well as barbs typified by barb 164 . when formed in to the device 120 the structure shown in fig3 is used in a manner analogous to fig2 and fig2 . stents can expand to be planar , for example as shown hereinabove in fig4 , 8 , 9 , 11 and 12 , or they can expand to be three - dimensional as shown hereinabove in fig5 and 10 . fig3 - 36 depict a further three dimensional patch / stent using an autograft formed of fascial tissue . fig3 shows the superior vertebral body 202 and the inferior vertebral body 204 surrounding a disc having an annulus fibrosus 206 and nucleus pulposus 203 in the subannular space . according to this illustrative embodiment of the invention , a suture 210 is passed from outside the annulus through the wall of the annulus on one side of an aperture 208 and into the subannular space as shown . the suture is then passed back out through the annular wall on an opposing side of the aperture 208 leaving a loop or sling 212 of suture in the subannular space . as shown in the posterior view on the right side of fig3 , more than one suture can be applied . turning to fig3 , a fascial autograft 214 is then inserted through the aperture 208 into the subannular space using , for example , forceps 216 . fig3 shows the fascial stent / patch 214 fully inserted into the subannular space within the suture sling 212 . the closure of the aperture is accomplished simultaneously with pulling the autograft 214 toward the annular wall as shown in fig3 . the suture 210 can be cinched 218 or tied to maintain the closure and the fixation of the patch / stent . patches can be folded and expanded in a single plane or in three dimensions . as shown in fig2 - 25 and 41 for example , collapsing the patch can be accomplished laterally , whether the device is a single material or composite . other embodiments , such as that shown in fig1 can collapse vertically , and still others such as that shown in fig2 , longitudinally . others can collapse in three dimensions , such as those shown in fig1 - 15 and 36 . devices which expand in three dimensions can be packaged in a restraining jacket , such as a gelatine shell or “ gelcap ” for example , or a mesh of biosorbable or dissolvable material , that would allow for facile placement and subsequent expansion . patches can also be constructed of a single component , as shown for example in fig3 , made of autograft or a synthetic material such as dacron , or for example where the stent is a gelcap . they can be made of multiple components . an exemplary stent ( not shown ) can be made from a polymeric material , for example silicone rubber , which can be formed to have a natural unstressed shape , for example that of a “ bulb ”. a stylet or push - rod can , for example , be inserted on the inside of the bulb to stretch the bulb into a second shape which is thinner and elongated . the second shape is sufficient to place within the aperture in the annulus . upon placement of the device within the sub - annular space , the push - rod is removed and the bulb assumes it natural , unstressed state , assuming a larger dimension within the sub - annular space . although silicone is used in this example , other metallic constructs could also be envisioned such as a nitinol braided device that has a natural unstressed shape and assumes a second shape under tension for the delivery of the device . it is also contemplated that the opposite scenario can also accomplish the similar objective . in this alternative embodiment , the device can have a first configuration that is unstressed and elongated and assumes a second , larger configuration ( bulb ) under stress . in this embodiment , a portion of the stylet or rod that is used to mechanically activate the device would be left behind to hold the expansion element in its stressed configuration . multiple components could include a frame to help with expansion of the device and a covering to obtain biocompatibility and tissue ingrowth . examples of different frame configurations might include an expandable “ butterfly ” or “ figure - 8 ” configuration that could be constructed of wire material , such as nitinol or multiple wires . exemplary embodiments showing frame members 502 are depicted in fig4 a - e . of course , other configurations such as diamonds or other rounded or polygonal shapes can be used . the diamond frame is a construct that takes a first form that is smaller and expands to a larger frame . the diamond elements could be constructed from a single wire or from multiple wires . alternatively , the members could be constructed of elements that are moveable fixed at each of the ends to allow expansion . a tether or attachment device 504 is also depicted , which may be a suture , a wire , a screw , or other attachment means known in the art . the frame could be cut from a single material , such as flat stock nitinol to accomplish the same objective , as shown for example in fig3 . such shapes can be cut from flat stock using known methods , for example , laser cutting . a heat forming step could also be employed , as known in the art , to form barbs 132 in a shape that passes out of the flat plane of the stock material , as shown in fig2 for example . another frame configuration , also not shown , is that of a spiral or coil . the “ coil ” design can be , for example , a spring steel or other biocompatible material that is wrapped to a first “ wound ” smaller configuration and expands to a larger unwrapped , unwound configuration . depending on the size of the openings in the frames described above , each of these concepts may or may not have a covering over them in order to assure that the nucleus does not re - extrude from the intervertebral disc space after placement of the device , as well as to serve as substrate for the surrounding tissue to naturally incorporate the device . coverings might include eptfe , polyester , silicone , or other biocompatible materials . coverings could also include natural materials such as collagen , cellulose , autograft , xenograft , allograft or similar materials . the covering could also be biodegradable in nature , such as polyvinyl lactic acid . frames that are not covered may be permeable , such as a patch that is porous and allow for normal movement of fluids and nutrients through the patch into and out of the annular ring while maintaining nucleus fragments larger than the porosity of the stent / patch within the subannular space . depending on the material that the frame is constructed , a surface finish may be added to promote tissue ingrowth into the patch . for example , a titanium sputtering of the device may allow it to be more easily incorporated within the disc space . alternatively , a niti or tantalum foam could be added to the outer surface of the patch to promote tissue ingrowth . it is understood that there can be a variety of device designs of patches to accomplish the expansion of a device from a first configuration , to a second configuration to occupy the sub - annular space and reduce re - extrusion of the nucleus . the following device concepts are further discussed for additional embodiments of a device and / or system for the repair of an intervertebral disc annulus . as mentioned hereinabove , the stent / patch according to the present invention may comprise a mass of fascial autograft , and that autograft may be contained in a covering of material to form what will be referred to herein as a “ bag ”. of course , this term is used not necessarily to connote a five - sided closed container so much as to denote the notion of flexibly surrounding the volume of a patch / stent material so that it can be manipulated in space . in the most simplistic form , a prefabricated device of sutures could be used to form the “ sling ” to hold the fascial implant as discussed above . the advantage of this design over simple placement of sutures to hold the autograft is better containment and control of the autograft during and after implantation . the “ sling ” or a “ bag ” surrounds the fascial autograft to hold it in place . it is contemplated that other materials , such as a polyester mesh , could be used instead of the fascial autograft . fig3 shows an example of a pre - fabricated sling 300 . there are three sutures used in this example , 302 , 304 , and 306 , although there could be more or less sutures as would be understood by one of ordinary skill in the art . a collar member 308 has apertures or other features for attaching to the sutures . in this example , the third suture 306 passes along or within the collar 308 to form a loop extending from the lateral extent of the collar 308 . the first and second sutures 302 , 304 form loops from the superior and inferior extents of the collar 308 . intersections 310 can secure the loops to each other with small loops or knots in the sutures , small fabric attachment pieces , or by small preformed devices resembling grommets placed on the suture to aid in securement . other knot tying techniques known in the art can also be employed . turning to fig3 , the collar is depicted within the subannular space where the loops surround a fascial autograft 314 which by pulling proximally the sutures 302 , 304 , 306 the graft is collapsed into contact with the annular wall in a sealing manner . the sutures can be made of known materials , e . g ., biodegradable , bioabsorbable or bioresorbable vicryl or biocompatible nylon . the collar can be made of a fabric material , e . g ., polyester . during placement , one end of some or each suture can be passed through the inferior wall of the annulus and the other end can be passed through the superior wall surrounding the aperture . after the placement of the sling into the wall of the annulus , the fascial autograft is placed within the sling . the sutures are tightened to bring the tissues together and also to help reapproximate the aperture , as the collar size will be selected based on the surgeon &# 39 ; s judgment according to the degree of reapproximation desired . other constructions can also be used to accomplish the same objective , such as a “ bag ” 404 formed of expandable ptfe as shown in fig4 . the bag is placed through an aperture in the annulus 402 . additionally , a one way seal 406 can be positioned behind the aperture 408 . suturing techniques for introducing cardiac valves could be employed to place the seal . it is understood that there could be multiple constructs to accomplish the same objective and this is only given as an example . the are a variety of ways to affix the device to the sub - annular wall of the annulus in addition to those discussed hereinabove . the following exemplary embodiments are introduced here to provide inventive illustrations of the types of techniques that can be employed to reduce the time and skill required to affix the patch to the annulus , versus suturing and tying a knot . discussed hereinabove is the use of sutures , staples and other fixation devices , such as those passed through slot 18 to affix the patch to the annulus as shown in fig1 . fig2 also depicts the use of “ barbs ” on the surface of the stent to facilitate fixation to the annulus . in a simple example , as shown in fig2 , a patch / stent could be compressed , passed through a guide tube such as tubes 18 , 18 a shown in fig2 and 23 , and expanded within the sub - annular space . as shown in fig4 , the expanded patch 602 is shown having barbs 604 , along with detachable delivery tool 608 and guide tube 606 . once expanded , barbs 604 on the outer surface of patch 602 can be used to fix the patch into the inner wall 610 of the annulus 612 by pulling the patch back proximally , into the sub - annular wall 610 , and pushing forward distally on the guide tube 606 , thus driving the barbs 604 into the annulus and drawing the inner and outer tissues of the annulus together and reapproximating the disc on either side of the aperture , as shown in fig4 . after the placement of the patch , the delivery tool and guide tube are removed . the advantage of this design described above is that it requires very little time and skill to place and secure the patch to the annulus while also drawing the tissues together . materials of the patch could be similar to materials discussed hereinabove . anchoring barbs could be made of a biocompatible material , for example a metallic material ( e . g ., niti alloy , stainless steel , titanium ), or a polymeric material ( e . g ., polypropylene , polyethylene , polyurethane ). anchoring barbs could also be a biodegradable / bioabsorbable material , such as a polyglycolic acid ( pga ), a polylevolactic acid ( ppla ), a polydioxanone ( pda ) or for example a racemic polylactic acid ( pdlla ). if the barbs included a biodegradable / bioabsorbable material , it is anticipated that the barbs might have sufficient holding strength for a sufficient period of time to allow the patch to be incorporated into the annulus during the healing process . the advantage of having the anchoring barb of fig4 and 43 being biodegradable / bioabsorbable is that after the incorporation of the patch into the annulus there may be no need for the barbs to provide fixation . however , barbs pointing toward the outer surface of the annulus could pose a long term risk of penetration out of the annulus due to migration , and potentially impinging on the nerve root and spinal canal . biodegradable / bioabsorbable barbs address and advantageously reduce any long - term risk in this regard . it is also possible that the barbs could be made of both a biocompatible component and a biodegradable / bioabsorbable component . for example , the very tip of the barb could be made of a biodegradable material . the barb could penetrate the annulus wall with a rather sharp point , but after degradation the point of the barb would become dull . in this embodiment , the point would no longer induce continued scar formation after the patch has been incorporated , nor pose a risk of penetrating out of the annulus onto the nerve root . another fixation means includes the passing of “ anchoring bands ” into the wall of the annulus , vertebral bodies ( superior , inferior , or both ), or the sharpey &# 39 ; s fibers ( collagenous fibers between the junction of the annular fibers and vertebral bodies ). in the following example of anchors , the barbs or bands are affixed to the annulus / vertebral bodies / sharpey &# 39 ; s fibers . another element , for example a suture , cinch line , or a staple is utilized to attach the anchor bands to the patch , and thus hold the patch in proximity to the inner wall of the annulus . in addition , these bands may re - approximate the tissues at the aperture . revisiting one example of using barbs to anchor the device is shown in fig9 , described hereinabove . barbs or bone anchor screws 50 ands 52 are passed into the superior and inferior vertebral bodies 54 and 56 , respectively . superiorly , suture 40 is passed through the outer wall of the annulus , to the sub - annular space . the suture is then passed through the eyelet 53 of bone anchor 52 and then passed through the wall of the annulus from the sub - annular space to the outer wall of the annulus . the inferior end of the suture is similarly passed through the annulus , eyelet of the bone anchor , and back through the wall of the annulus . both ends of suture 40 are tightened and tied . the advantage of this concept is that it allows for fixation of the device to a surface that is known to be present in all discectomy procedures — the vertebral bodies . whereas , it is possible , depending on the location and size of a natural rent that there may not be sufficient annulus accessible to fixate the device directly to the annulus . in addition to providing a location for fixation , anchoring into the vertebral bodies may provide a more stable anchor surface . another example of fixating the device to inner wall of the annulus is shown in fig2 , and is further illustrated by fig4 - 47 . as discussed hereinabove , with reference to fig2 - 30 , a patch 120 is placed with a delivery tool 122 , through the inner lumen of a guide tube 118 , into the sub - annular space and then expanded . this step can also be seen in fig4 and 46 , where a patch 702 is folded and passed through a guide tube 706 and is held by a delivery tool 704 . also shown is a anchor band or staple 709 and an anchor band delivery device 708 . within the guide tube , or within the delivery tool , there is a suture line or cinch line 710 that is attached to the center of the patch 702 . this can be seen in fig4 a with the guide tube 706 removed . as seen in fig4 c and 46a , the guide tube 706 is retracted after the patch 702 has been expanded and deployed . next , an anchor band delivery tool 708 is used to deliver one or more “ bands ” 709 onto the outer surface of the annulus . these are intended to be anchored into the wall of the annulus with barb shapes that do not allow for the barbs to be pulled back through the annulus . the anchor bands resemble a construction of a “ staple ”. the bands could actually be constructed by connecting two barbed elements with , for example , a suture between the two barbed elements . the barbs and the connection band between the barbs could be constructed of the same material or of different materials . for example , the barbed part of the anchor band could be a biodegradable / bioabsorbable material ( such as polyglycolic acid ) or could be constructed of a metallic or polymeric biocompatible material ( e . g ., titanium , niti alloy , stainless steel , polyurethane , polypropylene ). in addition , the band that connects these barbs can be constructed of materials that are similar to the barbs , or different materials . for example , the connection band could be a biodegradable / bioabsorbable suture , such as vicryl , or a biocompatible material such as polypropylene . in addition , it is possible that these elements are constructed from multiple materials to accomplish the objective of anchoring into the annulus and providing for a fixation site to draw the patch within proximity of the sub - annular wall . fig4 b and 44c show the placement of the anchor bands 709 into the annulus 712 with the anchor band delivery tool 708 . fig4 a and 46b schematically show the placement of the anchor bands 709 into the wall of the annulus 712 and the retraction of the anchor band delivery device 708 , with the patch delivery tool 704 still in place . fig4 d depicts a representative anchor band 709 , having a pair of stainless steel barbs 709 ″ connected by a suture 709 ′. fig4 e shows the patch 702 , anchor bands 709 , and cinch line or suture 710 with the delivery tools removed , prior to drawing the patch and the tissues of the annulus together . in this embodiment there is a pre - fabricated knot 714 on the cinch line , which is described further in fig4 b , although other knots are possible . fig4 a also shows a posterior view of the patching of the annulus with this device with knot 714 . in this stent / patch 702 a pair of loops of 7 mm suture 709 are shown , which engage the cinch line and slip knot . these suture loops connect to the barbs directly , as in fig4 , or loop to surgical staples , or are placed directly into the annulus . the presence of a pre - fabricated knot on the cinch line makes the process of repairing quicker since there is no need to tie a knot . it also facilitates drawing the tissues together . the use of the cinch line and a pre - fabricated knot can be placed by , for example , an external tube such as a knot pusher . fig4 e is similar to the fig2 described hereinabove prior to “ tying ” the knot 145 . fig4 f shows the drawing of the patch and the annular tissues together by pulling on the suture in the direction “ a ” indicated by the arrow . in this case , the knot pusher has been removed from the cinch line 710 . the suture 710 is drawn proximally to draw the patch 702 into engagement with the inner wall of the annulus to seal the aperture from within , as well as draw the walls of the annulus together to reapproximate the annular aperture . fig4 c and fig4 g show the cinch line suture 710 tied and drawing the annular tissues together , after the excess suture line has been cut . it is also apparent from this device , fixation and delivery system that the outer surfaces of the aperture are also drawn together for re - approximation . the cinching of the bands and the patch also allows for taking - up the slack that allows for the accommodation of varying sizes . for example , the thickness of the annular wall surrounding the aperture can vary from 1 mm up to 10 mm . therefore , if the anchor bands have a set length , this design with an cinch line accommodates different dimensions of the thickness of the wall of the annulus by drawing the “ slack ” of the bands together within the aperture . although it has been described here as patch placement that involves two lateral anchor bands with a suture to draw the patch , bands and tissues together , one or more bands could be used and two bands is only an example . furthermore , the anchor bands were placed with the barbs in a superior - inferior fashion . one skilled in the art would recognize that these could be placed at different locations surrounding the aperture . moreover , although it was described that the bands are placed into the annulus , these anchor bands could also be placed in the vertebral bodies as shown in fig4 a generally at 800 , or the sharpey &# 39 ; s fibers 802 , as shown in fig4 b generally at 804 . although the patch depicted in the example above does not have barbs attached to the patch , it is also possible to have the barbs as described hereinabove to further promote the fixation of the patch to the inner wall of the annulus . finally , although the drawings depict an aperture that lends itself to re - approximating the tissues , it is conceivable that some apertures , whether natural or surgically made , may be relatively large and therefore might require the placement of additional material within the aperture to act as a scaffold for tissue in growth , between the patch on the inner wall of the annulus and the anchor bands located on the outer wall . an example of material to fill the aperture might include autograft para - spinal fascial tissue , xenograft , allograft , or other natural collagenous materials . the filler material could also be of a biocompatible material such as a dacron material . fig5 shows the illustrative filling of an aperture with implant material 716 prior to cinching the suture 710 . as an alternative embodiment of the present invention , the anchor bands 709 as described previously ( anchor bands into annulus ) could be sufficiently long enough to pass through the annulus and then through the patch . the barbs in this embodiment have an engaging involvement with the patch . this concept was previously discussed hereinabove in connection with fig3 . further illustration of such a system is schematically shown in fig4 and 50 . passing the barbs through the patch , in this embodiment , provides additional security and safety of reducing the possibility that the barbs may migrate after implantation . in this application of the invention , the suture cinch line may ( fig5 ) or may not ( fig3 ) be used in addition to the anchor bands to draw the tissues together and reduce tissue movement surrounding the aperture . in addition , although the bands shown in fig4 and 50 take the form of a “ barb ”, they could as easily take a form of a simple t - barb 720 , as shown in fig5 e , or a c - type element wherein the object is to have irrevocable engagement with the patch device 702 after the penetration through the patch . a t - type attachment , when aligned longitudinally with the suture , passes through the patch . the t section then rotates to prevent the suture anchor from being pulled back through the patch . in another embodiment a “ c ’ retainer made of a superelastic material may be attached to the end of the suture band . the c retainer is loaded into a needle wherein it is held straight . the needle is used to pass the c retainer and suture through the patch and deploy the retainer in a second configuration in the shape of a “ c ”. it is also foreseen within the scope of the invention that there may be patch designs which will accommodate the placement and securement of the anchor to the fabric that covers the frame of the patch . for example , a frame for a patch that is made out of metal such as nitinol can provide for “ windows ”. the device , covered with a mesh fabric , for example silicone or dacron , would therefore allow the anchoring barbs to be passed through the “ windows ” in the frame of the patch . in this case , the barb can be secured to the patch in the fabric covering the frame . alternatively , the patch can be secured by passing barbs that engage the lattice of the patch frame . these embodiments of the invention illustrate designs in which the barbs engage with the vertical , horizontal or criss - crossed structures / members of the frame . in this case , the barbs would pass through the mesh or lattice of the frame and they would be unable to pass back out of the structure . although this discussion refers to “ anchor bands ” that are shown to be two anchors connected by a suture , it is also contemplated that single barbs with sutures are placed and the sutures &# 39 ; ends , at the outer surface of the annulus , are tied after placement through the patch . one objective in the designs discussed hereinabove is to provide a way to “ pull up the slack ” in a system to adjust the length of sutures and for anchor bands . according to the present invention , a technique referred to as the “ lasso cinch knot ” was developed as a means to draw the anchor bands together with a suture cinch line that is incorporated into the patch design . fig5 gives further description of the use of the lasso embodiment . in essence , patch and frame constructs are used that incorporate the “ barbs through the patch ” design . once the barbs have passed through the patch , an internal lasso 722 is drawn tight around the sutures of the anchor bands and thus draws the extra suture material within the patch . the internal lasso gathers the sutures of the bands , and as the lasso is tightened , it cinches together the sutures of the bands and therefore tightens them and eliminates slack , bringing the patch / stent into closer or tighter engagement with the annulus wall . the patch in fig5 additionally provides for a diamond shape grid pattern , which advantageously provides a grid which will while allowing a probe or similar instrument to pass through with little resistance , provides resistance to a barb or other restraining feature on the instrument . the frame shown can be made from nitinol , and the locking and holding windows shown at the center of the figure would allow for rotation about the z - axis during placement . a slipknot technique using , for example a knot pusher , would aid in the loop pulling process by the lasso . the internal loop ( lasso ) can be tacked to the outside corners of the patch / stent , in order to hold the loop at the outer edges of the patch frame . when cinching the lasso knot , the loop can be pulled free from some or all of its tacked attachment points to the frame , to prevent deformation of the planar shape of the frame when cinching the lasso . as above , the frame can be a composite structure or sandwich formed with some type of mesh fabric . the proximal mesh fabric can be bonded fully to the patch frame , for example through the use of an adhesive , for instance a silicone . adhesive , advantageously , can fill the interstices of the grid pattern while allowing for easy probe penetration and protection of the suture lines . protection of the suture lines is advantageous when the lasso is used to pull and bunch a group of band sutures together . it is also contemplated within the scope of the present invention that sutures 710 ′ can be preattached directly to a stent / patch . as shown in fig5 a several separate barbs 709 ′″ into the annulus 712 can be directly attached to the patch 702 . each “ barb ” of fig5 a can be independently placed into the annulus after the patch is deployed . this can be seen to be similar to the embodiment including barbs 709 ″″ of fig5 . an alternative embodiment for securing a patch 902 and reapproximating a rent is providing each of the separate barbs with sutures having variable lengths as shown in fig5 . each independent suture barb 904 is placed into the annulus 906 or into the patch 902 with the barb delivery tool 908 . after the placement , all of the suture lines 910 are drawn taught , by drawing on the free ends that exit the patch delivery tool 912 . a locking element 914 that uses a gasket 916 and threading mechanism is attached to the patch 902 and is used to tighten the gasket 916 around the distal ends of the sutures 910 . the patch delivery tool 912 is removed and the extra suture length is cut . it is also possible that the gasket mechanism could be a press - fit to accommodate the tightening of the sutures to the patch . alternatively , the locking mechanism can be as shown in fig5 , although in this case the engagement of the locking element 914 ′ takes part on the patch . pulling the suture 910 in the direction of arrow b will tighten and lockingly hold in tension to aid in securement and reapproximation . the adjustable length suture band between the two anchors allows slack to be taken up between the anchors 916 . two t - type anchors are illustratively shown in this example , but multiple anchors of differing configurations could be used . the locking features can be included on the feature band , as depicted here , and allow for substantially one - way locking engagement with the anchor members . this adjustability advantageously promotes for the accommodation of varying thickness of the annulus from patient to patient . the suture slack in this embodiment may be taken up to close the defect in the annulus and / or to shorten the band between anchors for a secondary cinching of multiple tensioned suture bands as described hereinabove . the cinch line and the lasso concepts in essence try to facilitate the re - approximation and drawing of tissues together in a fast and simple way . other contemplated embodiments for “ tension ” elements include using an elastic coupler as a part of the anchor band used to fixate the device . the elastic coupler can be expanded for placement , and upon release , can draw tension to pull the tissues together . the coupler could be made of a biocompatible metal or polymer , or could be constructed of a biodegradable / bioabsorbable material . similarly , an alternative embodiment to cause tension within the device and draw the tissues together after placement of the anchor bands might include an elastic band or band with a spring which one end can be attached to the anchor bands and the other end attached to the patch . alternatively , the anchor bands might , in and of themselves may be made of an elastic band between the barbs , or may contain a spring element between the barbs . such an embodiment can be made to resemble a so - called “ bobber spring .” again , it is contemplated that the elastic or resilient element could be made from a wide variety of metals , polymeric , or biodegradable / bioabsorbable material . fig5 describes an embodiment where the patch element 1002 takes the form of a mesh seal . the securement is effected by a hook having a barb element 1004 that penetrates the inner surface of the annulus 1006 , while the inner connection of the hook ( barb ) 1004 is attached to the patch in such a fashion as to add tension between the outer surface of the annulus and the inner surface in proximity to the patch , thus drawing the annular tissues together . the patch / stent 1002 contains a spring ribbon element 1008 which can be formed from nitinol or other spring material . hooks 1010 are then deployed to “ grab ” the annulus , either through penetration or through grasping into the aperture 1012 as shown . fig5 a - f shows another embodiment of a means to draw the suture lines together to cause tension between the inner and outer tissues of the annulus . anchor bands , for example t - barbs 720 ′ are placed through the annulus and the patch , and they are secured to the patch 702 . “ slack ” in the suture of the anchor band is “ rotated ” around a detachable portion of the delivery tool 704 ′ and a locking element , for example a screw configuration 724 as shown in the drawing , is used to lock the extra suture line in place affixed to threads 726 with the patch 702 . the delivery tool 704 ′ is then removed . fig5 shows alternative embodiments for tightening “ anchoring barbs ” with different configurations of sutures and cinch lines . for example in fig5 b each independent barb has a looped suture attached to it . through each of these loops is passed a cinch line , which contains a knot . after placement of the barbs within the annulus , and possibly through the patch , the cinch line draws the loops of the barbs together . the advantage of this embodiment is that it allows for the independent placement of multiple barbs and the ability to draw all of them together . although cinch lines have been described as using a knot to “ lock ” the length of the suture , other mechanisms could also lock the length , as shown in fig5 . the locking of the suture length is accomplished through a mechanical element located on the barb which engages with three dimensional elements attached to the suture line which mechanically press fit through the engagement element on the barb , thus locking the length of the suture line into place . although the embodiments of fig5 and fig5 depict the use of a single locking mechanism ( e . g ., knot on cinch line ), it is conceivable that various designs could use more than one locking element to achieve the re - approximation and drawing together the tissue surrounding an aperture . all patents referred to or cited herein are incorporated by reference in their entirety to the extent they are not inconsistent with the explicit teachings of this specification , including ; u . s . pat . no . 5 , 108 , 438 ( stone ), u . s . pat . no . 5 , 258 , 043 ( stone ), u . s . pat . no . 4 , 904 , 260 ( ray et al . ), u . s . pat . no . 5 , 964 , 807 ( gan et al . ), u . s . pat . no . 5 , 849 , 331 ( ducheyne et al . ), u . s . pat . no . 5 , 122 , 154 ( rhodes ), u . s . pat . no . 5 , 204 , 106 ( schepers at al . ), u . s . pat . no . 5 , 888 , 220 ( felt et al .) and u . s . pat . no . 5 , 376 , 120 ( sarver et al .). various materials know to those skilled in the art can be employed in practicing the present invention . by means of example only , the body portions of the stent could be made of niti alloy , plastics including polypropylene and polyethylene , stainless steel and other biocompatible metals , chromium cobalt alloy , or collagen . webbing materials can include silicone , collagen , eptfe , dacron , polyester , polypropylene , polyethylene , and other biocompatible materials and can be woven or non - woven . membranes might be fashioned of silicone , propylene , polyester , surlyn , pebax , polyethylene , polyurethane or other biocompatible materials . inflation fluids for membranes can include gases , liquids , foams , emulsions , and can be or contain bioactive materials and can also be for mechanical , biochemical and medicinal purposes . the stent body , webbing and / or membrane can be drug eluting or bioabsorbable , as known in the medical implant arts . other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . it is intended that the specification and examples be considered as exemplary only , with a true scope and spirit of the invention being indicated by the following claims . | 8 |
referring initially to fig1 the drawing shows a dac 12 represented by a potentiometer 14 whose variable tapping is connected to an input terminal 18 of a switchable analog signal inverter 16 . the input terminal 18 is connected to fixed contacts 21 , 22 of first and second change - over switches s1 and s2 whose moving contacts are ganged together and are controlled by a polarity select signal ps applied to a terminal 24 . the other fixed contacts 20 , 23 of the switches s1 and s2 are connected to a point of reference potential which point in the illustrated embodiments comprises ground . with the switches s1 and s2 connected as described they form a double pole reversing switch . the outputs of the switches s1 and s2 are connected to respective fixed contacts 25 , 26 of a third change - over switch s3 whose moving contact is connected to one side of a capacitor c whose other side is connected to the moving contact of a fourth change - over switch s4 . the fixed contacts 27 and 28 are connected respectively to an output terminal 30 and to ground . the switches s2 and s4 are operated in synchronism on opposite half cycles of a clock signal cl applied to a terminal 32 . in fig1 it is desired to produce at the output terminal an analog voltage which can vary between ± v volts , for example ± 2 . 5 volts , using an analog input signal varying between o and v volts applied to the input terminal 18 and inverting it when required . the analog input signal in the illustrated embodiment is derived from the dac 12 , which need only be half the size or use half the components of a dac which is intended to produce an output which can vary from + v to - v volts ; in other words , by being able to invert the voltage from the dac 12 when required it is only necessary to provide a unidirectionally varying analog signal at the input terminal 18 . in order to maintain the linearity of the signal it is necessary that the overall gain of the inverter 16 be plus unity or minus unity . the required polarity of the output analog voltage on the terminal 30 is determined by the setting of the switches s1 and s2 which are controlled by a polarity select signal applied to the terminal 24 . thus the moving contacts of the switches s1 and s2 contact either the fixed contacts 20 and 22 respectively or the fixed contacts 21 and 23 respectively . in the case of the switches s3 and s4 , their moving contacts are either both up , that is connected to fixed contacts 25 and 27 , respectively , or both down , that is connected to fixed contacts 26 and 28 , respectively , on opposite half cycles of the clock signal applied to the terminal 32 . the phasing of the clock signal is not important and its frequency should be greater than twice the frequency of the signal at the input terminal 18 . fig2 a and 2b illustrate the switch positions of the switches s3 and s4 when the switches s1 and s2 are set for the invert mode , that is s1 is connected to ground and s2 is connected to the input terminal 18 . when the moving contacts of the switches s3 and s4 are down ( fig2 a ) then the capacitor c is charged by the voltage v in on the input terminal 18 and the output terminal 30 is floating . on the following half cycle of the clock signal , the moving contacts of the switches s3 and s4 are both up , so that the capacitor c is connected by the switch s1 to ground and by the switch s4 to the output terminal 30 so that a voltage - v in is developed on the output terminal ( fig2 b ). the clocking of the switches s3 , s4 enables the input voltage v in to be pumped to the output terminal 30 which gradually moves towards - v in over a number of clock cycles . in the noninvert mode of the inverter 16 , the moving contacts of the switches s1 and s2 are connected respectively to the input terminal 18 and to ground . when the switches s3 and s4 are down ( fig3 a ) then both sides of the capacitor c are connected to ground , and the output terminal 30 is floating . however , when switches s3 and s4 are both up ( fig3 b ) then the capacitor c is connected between the input and output terminals 18 and 30 , and the output voltage moves gradually to + v in due to the pumping action of the switches s3 and s4 . in a practical application of the inverter circuit , the clock frequency ( f c ) may be much higher , say 512 khz , compared with the frequency , say 3 . 4 khz , of the signal at the input terminal 18 so that the effective output resistance of the inverter 16 is 1 / f c c . this can be advantageous if the input signal has to be filtered because the inverter 16 may act as a resistor in an rc filter . consequently , the inverter 16 can act as an interface between a dac and a low pass filter . fig4 shows an implementation of the embodiment shown in fig1 in which the change - over switches s1 to s4 comprise pairs of fets , for example enhancement mode mos transistors , whose source - drain paths are connected in series . the transistors are all of the same conductivity type , either p - or n - channel . in the case of the switches s1 and s2 , these comprise , respectively , transistors 36 and 38 and transistors 40 and 42 , whose source - drain paths are connected in series between the input terminal 18 and ground . the gates of the transistors 38 and 40 are connected to a terminal 44 , to which an invert polarity signal , ips , is applied as necessary . the gates of the transistors 36 and 42 are connected to a terminal 46 to which a noninvert polarity signal , ips , is applied . the source - drain paths of the transistors 52 and 54 forming the third switch s3 are connected in series between a junction 48 of the source - drain paths of the transistors 36 , 38 and a junction 50 of the source - drain paths of the transistors 40 , 42 . the switch s4 comprises transistors 56 , 58 whose source - drain paths are connected in series between the output terminal 30 and ground . the capacitor c is connected between the junctions 53 and 57 of the source - drain paths of the transistors 52 , 54 and 56 , 58 , respectively . the gates of the transistors 52 , 56 are connected to a clock cl terminal 60 and the gates of the transistors 54 , 58 are connected to an inverted clock , cl , terminal 62 . the operation of the inverter shown in fig4 is similar to that described with reference to fig2 a , 2b , 3a and 3c . with the ips signal high and the ips signal low , transistors 38 and 40 will be conductive and the transistors 36 and 42 will be nonconductive . then when the clock cl is low , cl is high so that the capacitor c is charged to v in via the transistors 40 and 54 while the output terminal 30 is floating -- this is analogous to fig2 a . on the next half cycle of the clock signal the transistors 52 , 56 are conductive while the transistors 54 , 58 are nonconductive , thus one side of the capacitor c is connected to ground via the transistors 52 and 38 , while the other side is connected to the output terminal 30 via the nonconductive transistor 56 so that a voltage moving gradually to - v in appears on the terminal 30 -- this corresponds to fig2 b . conversely , with the ips signal high and the ips signal low , the transistors 36 and 42 are conductive and the transistors 38 , 40 will be nonconductive . when the cl signal is high and the cl signal is low then both sides of the capacitor c are connected to ground via the transistors 54 and 42 on the one hand and the transistor 58 on the other hand -- this is analogous to fig3 a . on the next half cycle of the clock signal cl is high and cl is low so that the capacitor is connected to the input signal terminal 18 via the transistors 52 and 36 and to the output terminal 30 via the transistor 56 and the voltage thereon moves towards v in -- this corresponds to the situation shown in fig3 b . fig5 is a diagram of another embodiment of an inverter made in accordance with the present invention . wherever appropriate the same reference numerals have to be used to indentify the same components as in fig1 to 4 . the selective reversing of the phasing of the switching between the input signal voltage and the reference voltage ( ground ) applied to the input side of the capacitor c is realized by change - over switches s5 , s6 , s7 and s8 connected between the input terminal 18 and ground . the moving contact of the switch s5 is connected to the input terminal . the switch s5 is operated at clock frequency . the fixed contacts of the switch s5 are connected to corresponding fixed contacts of the switch s6 whose moving contact is connected to that of the switch s7 and to the input side of the capacitor c . the fixed contacts of the switch s7 are connected to corresponding fixed contacts of the switch s8 whose moving contact is connected to ground . the moving contacts of the switches s6 and s7 are operated in response to a polarity select signal applied to the terminal 24 . the moving contact of the switch s8 is operated at clock frequency and in opposite phase to the moving contact of the switch s5 . the switch s4 is connected as shown in fig1 and accordingly will not be described again . in order to understand the operation of the inverter shown in fig5 it should be assumed that when the cl signal is high , then the moving contacts of the switches s5 and s8 are moved to the right and left respectively and that of the switch s4 is moved upwards in fig5 and when cl is high then these moving contacts adopt their opposite positions . with the moving contacts of the switches s6 and s7 deflected to the left hand positions then when cl is high , the output terminal 30 is floating and when cl is high then the output terminal 30 moves gradually to - v in . in the opposite positions of the moving contacts of the switches s6 and s7 , when cl is high , the output terminal 30 is floating and when cl is high the output terminal 30 moves gradually towards + v in . the embodiment shown in fig6 is an implementation of fig5 using field effect transistors as switches . for ease of description , the inverter shown in fig6 may be regarded as comprising three branches , the first and second branches each comprising four transistors whose source - drain paths are connected in series between the input terminal 18 and ground , and the third branch comprising the transistors 56 , 58 of the switch s4 whose source - drain paths are connected in series between the output terminal 30 and ground . the first branch comprises the transistors 64 , 66 , 68 and 70 each comprising a part of the switches s5 to s8 , respectively . the source - drain paths of these transistors are connected in series between the input terminal 18 and ground . the second branch comprises the transistors 72 , 74 , 76 and 78 , each comprising the other part of the switches s5 to s8 , respectively . the source - drain paths of these transistors are also connected between the input terminal and ground . junctions 67 and 75 of the source - drain paths of the transistors 66 , 68 and 74 , 76 respectively are connected to one side of the capacitor c while its other side is connected to the junction 57 . the gates of the transistors 66 , 68 are connected to the ips input 46 , those of the transistors 74 , 76 are connected to the ips input 44 , those of the transistors 56 and 64 and the transistor 78 to the cl inputs 60 and 60 &# 39 ; respectively and those of the transistors 58 and 70 and the transistor 72 to the cl inputs 62 and 62 &# 39 ; respectively . the operation of the circuit of fig6 can be readily understood from the description of fig5 . however , for the sake of completeness a tabular summary will be given below in which h means high , l means low and f means that the output terminal 30 is floating . ______________________________________ ## str1 ## l l h hips h h l l ## str2 ## h l h lcl l h l hterminal 30 f - v . sub . in f + v . sub . in______________________________________ one difference between the embodiments of fig4 and 6 is that the latter has two additional transistors , which means additional chip area is required if the inverter is fabricated as an integrated circuit . in a typical integrated circuit of the switchable analog signal inverter the mos transistors may be 5 microns ( μm )× 4 μm and the capacitor c may be fabricated as an oxide capacitor of 50 × 50 μm 2 and have a capacitance of 1 pf . the clock signal swings between - 5 v and + 5 at a frequency of typically 128 khz , 256 khz or 512 khz . the polarity select signal is switched between 0 and + 5 volts . the analog input voltage v in varies in the range 0 to + 2 . 5 volts at audio frequencies of say 300 hz to 3 . 4 khz . the output resistance of the inverter is of the order of 4mω . although the circuits of fig4 and 6 have been described as using enhancement fets , other fets may be used provided that the clock swing exceeds the analog voltage switch v out so that the fets can turn on and off . similarly , the voltage swing on ips and ips must exceed the analog voltage swing on v in . | 7 |
preferred embodiments of the invention and its advantages can be understood by referring to the present drawings . through all of the drawings the same reference numbers are used to refer to similar elements . fig1 is a side view of a bicycle 12 in accordance with a first embodiment of the invention . the bicycle 12 has a frame 10 comprising a head tube 20 , a top tube 30 , a down tube 40 and a seat tube 50 . the bicycle 12 , when in normal use , moves in a forward direction where the head tube 20 and down tube 40 are forward of the seat tube 50 . the top tube generally extends in forward direction . each of the head tube 20 , top tube 30 , down tube 40 and seat tube 50 is connected end - to - end to one another and form substantially a closed main frame loop 14 and a central cavity 15 as shown in fig2 . the central cavity 15 is the area enclosed by the main frame loop 14 . a fork 77 is rotatably coupled to the head tube 20 to extend through the head tube carrying at an upper end to the handlebars . the bicycle frame 10 as best seen in fig2 , the frame 10 has a head tube 20 , a top tube 30 , a down tube 40 , and a seat tube 50 . the head tube 20 has a top end 21 and a lower end 22 . the top tube 30 has a front end 31 and a rear end 32 . the down tube has a front end 41 and a rear end 42 . the seat tube 50 has a top end 51 and a lower end 57 . the front end 31 of the top tube 30 is connected to the top end 21 of the head tube 20 . the front end 41 of the down tube 40 is connected to the lower end 22 of the head tube 20 . the top tube 30 and down tube 40 diverge away from each other as they extend rearwardly from the head tube 20 . the rear end 42 of the down tube 40 is coupled to the lower end 57 of the seat tube 50 . the rear end 32 of the top tube 30 is connected to the top end 51 of the seat tube 51 . each of the head tube 20 , top tube 30 , down tube 40 and seat tube 50 are elongate members disposed about their own longitudinal axis indicated as 121 , 131 , 141 and 151 respectively . the longitudinal axis of each of the head tube 20 , top tube 30 , down tube 40 and seat tube 50 lie in the same flat central plane illustrated in fig4 to 8 and 10 as 92 . thus , mainframe loop 14 is disposed about and lies centred on the flat central plane 92 . each of the head tube 20 , top tube 30 , down tube 40 and seat tube 50 are generally symmetrical about the central plane 92 . each of these tubes have an annular tubular wall with an external surface which is symmetrical about the central plane 92 . each of these tubes 20 , 30 , 40 and 50 has inwardly directed portions of its exterior surface facing the central cavity 15 with the mainframe loop 14 . fig3 is a preferred second embodiment of the frame 10 and storage element 81 . fig3 is a side view of a bicycle frame 10 with the storage element 81 attached between the down tube 40 and seat tube 50 . as can be seen from fig3 , the storage element 81 completes the space between the down tube 40 and the seat tube 50 . this design allows the air to flow around the down tube 40 , storage element 81 & amp ; seat tube 50 , in a relatively undisturbed manner . the storage element 81 effectively creates one aerodynamic component which includes the down tube 40 , the storage element 81 and the seat tube 50 . fig4 is a cross - section along section a - a shown in fig3 . as shown in fig4 , the down tube 40 , storage element 81 and the seat tube 50 together form an aerodynamic shape . the down tube 40 is the front of the aerodynamic shape and the seat tube 50 is the back of the aerodynamic shape . the down tube 40 has a rounded front portion and the seat tube 50 has a rounded rear portion . the rounded front portion of the down tube 40 extends further away from the central plane than the rounded rear portion of the seat tube 50 . fig4 also shows both the down tube 40 and the seat tube 50 with straight portions that are symmetrical about the central plane 92 . the storage element 81 also has straight portions which are symmetrical about the central plane 92 and together with the straight portions of the down tube 40 and seat tube 50 form continuous straight portions symmetrical about the central plane 92 . the rounded front portion of the down tube 40 and the rounded rear portion of the seat tube 50 in combination with the storage element 81 show a teardrop shape . the teardrop shape is formed because the rounded portion at the front of down tube 40 extends further from the central plane 92 than the rear portion of seat tube 50 and the sides of the down tube , storage element and seat tube gradually reduces in width from the front of the down tube to the rear seat tube . when the bicycle with the storage element attached moves in the forward direction , portions of the storage element 81 and the bicycle frame 10 will be concealed from the airflow that is parallel to the central plane . fig4 shows an exterior surface of the down tube 40 with a rounded front portion that is directed away from the central cavity 15 and a concealed portion 49 which is directed inwardly towards the central cavity 15 . the concealed portion 49 is straight and intersects the central plane 92 . an exterior surface of the seat tube 50 is also shown with a rounded rear portion that is directed away from the central cavity 15 and a concealed portion 59 which is directed inwardly towards the central cavity 15 . the concealed portion 59 is straight and intersects the central plane 92 . the storage element 81 has an exterior surface with concealed portions 93 and 95 which are adjacent and conceal the inwardly directed concealed portions 49 and 59 , respectively . it is the exposed portions of the down tube 40 , storage element 81 and the seat tube 50 which form the aerodynamic shape . although not shown , the storage element 81 may be held in place on the frame 10 by a number of non - permanent fastening means . for example , the concealed portions 93 and 49 and / or 95 and 59 may have complementary mating shapes to hold the storage element 81 on the frame 10 . fig5 is a cross - section along section b - b shown in fig3 . fig5 shows the down tube 40 where the storage element is not attached as having an aerodynamic teardrop shape . fig6 is a cross - section along section c - c shown in fig3 . fig6 shows the seat tube 50 where the storage element is not attached as having an aerodynamic teardrop shape . fig7 is a cross - section along section d - d shown in fig3 . fig7 illustrates a design of the storage element showing a curved top 91 on the storage element . fig8 is a cross - section along e - e shown in fig3 . fig8 shows the top tube 30 having a circumferential wall about the longitudinal axis and the wall being symmetrical about the central plane 92 . fig9 illustrates the storage element 81 as a water bottle held between the down tube 40 and seat tube 50 as shown in fig3 but further schematically shows a drinking straw 101 routed internally through the frame of the down tube 40 as seen in cross - section in fig1 . in this instance , the down tube 40 is provided with an entrance opening 141 that allows the straw 101 to enter the down tube . drinking straw guides 103 may be provided in the entrance opening 141 . these guides 103 may be a grommet or other suitable means to assist the drinking straw 101 through the opening 141 . the straw extends internally through the down tube 40 to the head tube 20 , internally through the head tube 20 to the top tube 30 and exiting the top tube 30 at an exit opening 143 near the rider &# 39 ; s head . fig1 is a cross - section along section f - f shown in fig9 . fig1 shows the drinking straw 101 routed inside the down tube 40 . fig1 shows an alternate embodiment of the frame 10 and a storage element 82 with the storage element 82 attached to the down tube 40 only . this allows the air to flow around the down tube 40 and the storage element 82 . the storage element 82 and down tube 40 together effectively creates one aerodynamic component . as seen in fig1 , which is a is a cross - section along section a - a shown in fig1 , the down tube 40 is the front portion of an aerodynamic teardrop shape and the storage element 82 is the rear portion of the aerodynamic teardrop shape . fig1 is a cross - section along section b - b shown in fig1 . fig1 shows that the down tube 40 between the storage element 82 and the front end 41 of the down tube 40 has an aerodynamic teardrop shape . fig1 is a cross - section along section c - c shown in fig1 . fig1 shows the down tube 40 between the storage element 82 and the rear end 42 of the down tube 40 , where the storage element is not attached , has an aerodynamic teardrop shape . fig1 is an alternate embodiment of the frame 10 and a storage element 83 with the storage element 83 attached to the seat tube 50 only . this allows the air to flow around the storage element 83 and the seat tube 50 . the storage element 83 effectively creates one aerodynamic component which includes the seat tube 50 and the storage element 83 . fig1 is a cross - section along section a - a shown in fig1 . fig1 shows the storage element 83 is the front portion of an aerodynamic teardrop shape and the seat tube 50 is the rear portion of the aerodynamic teardrop shape . as can be seen in fig1 , the concealed portion 59 of the exterior surface of the seat tube 50 contacts the concealed portion 95 of the storage element 83 . fig1 is a cross - section along section b - b shown in fig1 . fig1 shows the seat tube more between the storage element 83 and the top end 51 of the seat tube 50 , where the storage element is not attached , as having an aerodynamic teardrop shape . fig1 is a cross - section along section c - c shown in fig1 . fig1 shows the seat tube between the storage element 83 and the lower end 57 of the seat tube 50 , where the storage element is not attached , as having an aerodynamic teardrop shape . fig1 illustrates the storage element 83 as a water bottle held on the seat tube 50 as shown in fig1 but further schematically a drinking straw 101 routed internally through the frame of the seat tube 50 and top tube 30 . the seat tube is schematically shown as having an entrance opening 151 that allow the straw to enter the seat tube 30 . the straw 101 travels internally through the seat tube , top tube 30 and exit the top tube near the rider &# 39 ; s head . as shown in fig1 , the drinking straw 101 may exit the top tube or the head tube 20 at exit opening 143 of the bicycle frame . fig2 is a cross - section along section d - d shown in fig1 . fig2 shows the drinking straw 101 routed inside the top tube 30 . fig2 shows an additional embodiment of the frame and storage element . fig2 is a side view of a bicycle frame with the storage element attached between the top tube 30 and seat tube 50 . as can be seen from fig2 , the storage element 84 completes the space between the top tube 30 and the seat tube 50 allowing air to flow around the storage element 84 and the seat tube 50 . the storage element 84 effectively creates one aerodynamic component which includes the seat tube 50 . fig2 is a cross - section along section a - a shown in fig2 . fig2 illustrates a design wherein the storage element 84 is the start of an aerodynamic teardrop shape and the seat tube 50 is the end of the aerodynamic teardrop shape . in this embodiment , it is the top end 51 of the seat tube 50 which completes the aerodynamic shape . as can be seen in fig2 , the concealed portion 59 of the exterior surface of the seat tube 50 contacts the concealed portion 95 of the storage element 83 . fig2 is a cross - section along section b - b shown in fig2 . fig2 illustrates a design wherein the seat tube at a lower end , where the storage element is not attached , has an aerodynamic teardrop shape . fig2 illustrates the storage element 84 as a water bottle held between the top tube 30 and seat tube 50 as shown in fig2 but further includes a drinking straw 101 which can be routed internally through the frame in the top tube 30 . in this instance , the top tube 30 is provided with an opening 131 and drinking straw guides ( not shown ) that allow the straw to enter the top tube 30 and exit the top tube in a location , which allows the rider to conveniently drink from the straw . as shown in fig2 , the drinking straw may exit the top tube 30 or the head tube 20 at exit opening 143 of the bicycle frame 10 . fig2 is an additional embodiment of the frame 10 and storage element 85 . fig2 is a side view of a bicycle frame with the storage element 85 attached between the top tube 30 , head tube 20 and down tube 40 . as can be seen from fig2 , the storage element 85 completes the space between the top tube 30 and the down tube 40 . this design allows the air to flow around the head tube 20 and the down tube 40 and then around the storage element 85 . the storage element 85 effectively creates an aerodynamic component which includes the down tube 40 and head tube 20 . fig2 is a cross - section along section a - a shown in fig2 . fig2 illustrates a design wherein the head tube 20 and / or down tube 40 is the start of an aerodynamic teardrop shape and the storage element is the end of the aerodynamic teardrop shape . as can be seen in fig2 , the concealed portion 29 of the exterior surface of the head tube 20 contacts the concealed portion 97 of the storage element 85 . fig2 is a cross - section along section b - b shown in fig2 . fig2 illustrates a design wherein the down tube at a rear end , where the storage element is not attached , has an aerodynamic teardrop shape . fig2 illustrates the storage element 85 as a water bottle held between the top tube 30 , head tube 20 and down tube 40 as shown in fig2 but further includes a drinking straw 101 which can be routed internally through the frame in the top tube 30 . in this instance , the top tube 30 is provided with an opening 131 and drinking straw guides ( not shown ) that allow the straw to enter the top tube 30 and exit the top tube at in a location , which allows the rider to conveniently drink from the straw . as shown in fig2 , the drinking straw may exit the top tube 30 at exit 143 of the bicycle frame 10 . fig2 is a cross - section along section a - a shown in fig3 illustrating an additional embodiment of the storage element 81 . in this embodiment , the storage element 81 b is extended laterally beyond the envelope 181 of the frame . even though the storage element 81 b extends outside the envelope of the frame the resulting combined profile of the tubes and storage element 81 results in a net reduction of aerodynamic drag on the bicycle frame 10 . the storage element can be designed to incorporate the means to attach itself to the bicycle frame . furthermore , the bicycle frames can be designed to incorporate a means to attach the storage element . fig3 is a cross - section along section a - a shown in fig3 illustrating an additional embodiment of the storage element 81 and the bicycle frame 10 . as shown in fig3 , the storage element 81 c and the bicycle frame are provided with complementary mating shapes 191 and 192 on the concealed portions of both the storage element and the bicycle frame . the storage element can , therefore , be easily attached to the frame while still allowing easy access and removal . fig3 is a cross - section along section a - a shown in fig3 . fig3 illustrates an additional embodiment of the storage element 81 and the bicycle frame 10 . as shown in fig3 , the concealed portion 93 d of the exterior surface of the storage element 81 d which contacts the down tube 40 is convexly shaped and the concealed portion 95 d of the exterior surface of the storage element 81 d which contacts the seat tube 50 is concavely shaped . furthermore , the concealed portions 49 of the exterior surface of the down tube 40 are concavely shaped to receive the convexly shaped portion of the storage element 81 d and the concealed portions 59 of the seat tube are convexly shaped to receive the concavely shaped portion of the storage element 81 d . fig3 is a cross - section along section a - a shown in fig3 . fig3 illustrates a still additional embodiment of the storage element 81 and the bicycle frame 10 . as shown in fig3 , the concealed portion 93 e of the exterior surface of the storage element 81 e which contacts the down tube 40 is concavely shaped and the concealed portion 95 e of the exterior surface of the storage element 81 e which contacts the seat tube 50 is also concavely shaped . furthermore , the concealed portions 49 of the exterior surface of the down tube and the concealed portions 59 of the exterior surface of the seat tube are convexly shaped to receive the concavely shaped portions 93 e , 95 e of the storage element 81 e . fig3 is a cross - section along section a - a in fig1 . fig3 shows an additional embodiment of the storage element 82 and the bicycle frame 10 . as shown in fig3 , the concealed portion 93 f of the exterior surface of the storage element 82 a which contacts the down tube 40 is concavely shaped . the concealed portion 49 at the exterior surface of the down tube is convexly shaped to receive the concavely shaped portion 93 of the storage element 82 a . the storage element 81 f also extends a longer distance from the central plane 92 than the forward portion of the down tube 40 . this allows the storage element 82 a to store a greater volume and still maintain an aerodynamic shape . fig3 is a cross - section along section a - a in fig1 . fig3 shows an additional embodiment of the storage element 83 a and the bicycle frame 10 . as shown in fig3 , the concealed portion 95 g of the exterior surface of the storage element 83 a which contacts the seat tube 50 is concavely shaped . the concealed portion 59 at the exterior surface of the down tube is convexly shaped to receive the concavely shaped portion 95 g of the storage element 83 a . the storage element 83 a also extends a longer distance from the central plane 92 than any portion of the seat tube 50 . this allows the storage element 83 a to store a greater volume and still maintain an aerodynamic shape . fig3 is a third embodiment of the bicycle frame where the front end 31 of the top tube 30 is connected directly with the front end 41 of the down tube 40 . in this embodiment the head tube 20 does not form a side of the main frame loop 14 . fig3 is a fourth embodiment of the bicycle frame showing the seat tube 50 that is non - linear which has two - parts . the seat tube 50 may be designed in a similar manner to further increase the aerodynamics of the bicycle . the seat tube has an upper tubular portion 52 which has the upper end 51 and a lower end 53 ; and a lower tubular portion 56 which has an upper end 55 and the lower end 57 . as shown there is an apex between the upper tubular portion 52 and the lower tubular portion 56 . fig3 is a perspective pictorial view of the storage element attached between the down tube 40 and the seat tube 50 and is similar to fig3 . as shown in fig3 , the storage element 81 may have separate compartments 201 and 202 . the separate compartments 201 and 202 may be separated by a flat hard surface that extends from the bottom to the top of the storage element 81 . the first compartment could hold food while the second compartment could hold rider tools . the storage element 81 may be provide with a cover 204 that allows the rider to access the storage element while continuing to ride the bicycle . the cover 204 can be designed to snap onto the top of the storage element and may be provided with an aerodynamic top to further improve the aerodynamics of the storage element 81 . the cover 204 may be attached to the storage element 81 by straps 206 . while the invention will be described in conjunction with the illustrated embodiments , it is understood that it is not intended to limit the invention to such embodiments . on the contrary , it is intended to cover all alternatives , modifications and equivalents as may be included within the spirit and scope of the invention as defined by the following claims . | 1 |
the invention herein broadly relates to liquid detergent compositions comprising a surface - active agent , a liquid carrier , an organo - functional polydi - alkylsiloxane textile treatment agent , and , if desirable , conventional detergent additives . these variables and other aspects of the invention are explained in more detail hereinafter . unless indicated to the contrary , the &# 34 ; percent &# 34 ; indications stand for &# 34 ; percent by weight &# 34 ;. a first essential component for use in the compositions of this invention is represented by a surface - active agent selected from the group of anionic , nonionic , amphoteric ( ampholytic ) and zwitterionic surface - active agents and mixtures thereof . in the context of this invention , the term nonionic surface - active agent is meant to include semi - polar nonionic surfactants . examples of suitable non - ionic surfactants are disclosed in e . p . a no . 0 . 028 . 865 page 4 , line 23 to page 5 , line 10 and page 8 line 14 to page 9 , line 4 , said disclosures being incorporated herein by reference . a disclosure of zwitterionic and ampholytic surfactants for use herein can also be found in e . p . a no . 0 . 028 . 865 page 7 , line 21 to page 8 , line 13 , this passage being also incorporated herein by reference . the anionic surfactants for use herein can be represented by known synthetic and natural anionic surface - active agents which are known to be suitable for use in detergents and frequently have found commercial application . suitable synthetic anionic surfactants are described in e . p . a no . 0 . 028 . 865 page 5 , line 12 to line 31 . examples of natural anionic surface - active agents for use in this invention can be represented by saturated and unsaturated fatty acids having from 10 to 20 carbon atoms in the alkyl chain or the alkali - metal , earth - alkali - metal and amine or alkanolamine soaps thereof . preferred fatty acids / soaps have from 12 to 18 carbon atoms in the alkyl chain . well - known examples of fatty acids / soaps suitable for use herein are natural coconut fatty acid containing a majority of c 12 and c 14 acids and tallow fatty acids containing a mixture of saturated and unsaturated c 16 and c 18 - fatty acids / soaps . the surface - active agent is used generally at levels from 5 % to 70 %. while the surface - active agent may be varied over the broad range depending upon the intended utility of the composition and the quantitative and qualitative definition of the additional ingredients and possibly optional components , two preferred executions can be formulated depending upon the presence of ( poly )- phosphate builders . in a first preferred execution of the invention liquid compositions are envisaged which are substantially unbuilt . in this embodiment , the surface active agents are frequently used in an amount from 25 % to 55 % and are represented by a mixture of anionic and nonionic surface - active agents , more preferably in a weight ratio of anionic to nonionic in the range from 4 : 1 to 1 : 4 . in a second preferred embodiment , liquid built detergent compositions are contemplated containing from 5 % to 25 %, preferably from 5 % to 15 % surface - active agent . the latter ingredient can preferably be represented by a mixture of anionic and nonionic surface - active agents whereby the anionic species represents at least 20 % of the sum of anionic and nonionic surface - active agents , and at least 3 %, calculated on the detergent composition . the like detergent compositions frequently comprise from 5 % to 30 %, preferably from 12 % to 25 % of a detergent builder which can be represented by conventional detergent builders many of which have already found commercial application . well - known examples of suitable builders include the alkali , often sodium , metal salts of ( poly ) phosphates , e . g . tripolyphosphoric acid , nitrilotriacetic acid ( nta ), citric acid and crystalline , completely hydrated , synthetically prepared zeolite builders having a particle diameter in the range from 0 . 1 to 10 , preferably from 0 . 1 to 4 micrometers . suitable zeolite builders are zeolite a , x and p . mixtures of detergent builders can also be used . the compositions herein can additionally contain , as an optional ingredient , a cationic surfactant . suitable cationic surfactant species for use herein are described in european patent application no . 0 . 028 . 865 , page 5 , line 32 to page 7 line 21 , this passage being incorporated herein by reference . the cationic surfactants can provide and / or enhance a broad range of textile treatment benefits inclusive of cleaning , feel , and bactericidal advantages . these optional cationic surface - active agents are used in additive levels , such as in levels not exceeding 10 % of the cumulative amount of anionic and nonionic surfactants defined hereinbefore , and more preferred in a range from 1 % to 5 % of the detergent composition . the compositions herein contain as a further essential component a liquid carrier , possibly a mixture of liquid carriers . the liquid carrier component can be represented by water and conventional liquid organic carriers . non - limiting examples of the like organic carriers include lower aliphatic alcohol having from 2 to about 6 carbon atoms and 1 to 3 hydroxyl groups ; ethers of diethylene glycol and lower aliphatic mono - alcohols having from 1 to 4 carbon atoms and mixtures thereof . specific examples of liquid carriers are : ethanol ; n - propanol ; isopropanol ; butanol ; 1 , 2 - propanediol ; 1 , 3 - propanediol ; n - hexanol ; monomethyl -, - ethyl -, - propyl , and mono - butyl ethers and di - ethylene glycol . other organic solvents having a relatively high boiling point and low vapor pressure can also be used , provided they do not react with any of the other ingredients present . the relative quantities of liquid carriers needed to insure the liquid state of the composition can vary depending upon the qualitative and quantitative ingredient parameters in a given composition . however , the adequate choice of the carrier is based on routine determinations well - known in the art . the essential organo - functional siloxane for use herein can be present in levels from 0 . 05 % to 5 %, preferably from 0 . 1 - 3 %, and most preferably from 0 . 15 - 1 %. using levels below 0 . 05 % will not anymore produce , to any noticeable extent , the claimed benefits whereas the incorporation of levels exceeding 5 % will not produce additional benefits commensurate with ( proportional to ) the level increase . the organo - functional - polydi - c 1 - 4 - alkyl siloxane component can stoichiometrically be defined with the aid of the following formula : ## str5 ## wherein wherein r = c 1 - 4 - alkyl ; n is an integer from 1 to 6 ; z is ## str6 ## whereby x and y are , selected independently , -- h ; -- c 1 - 30 - alkyl ; -- c 6 - aryl ; -- c 5 - 6 - cycloalkyl ; -- c 1 - 6 -- nh 2 ; -- co -- r ; with the proviso tha the nitrogen can be quaternized such as to represent ## str7 ## whereby w can be selected from x and y or z is ## str8 ## whereby p and m are -- cooh ; -- co -- nr &# 39 ; 2 ; or -- co -- or &# 39 ; and wherein r &# 39 ; is hydrogen or c 1 - 2 - alkyl ; with the proviso that the degree of substitution , i . e . the molar proportion of silicones carrying a substituent other than a c 1 - 4 alkyl group to total silicones is in the range from 0 . 01 to 0 . 7 , preferably from 0 . 02 - 0 . 3 . the siloxane component is preferably represented by amino - functional polydialkylsiloxanes which are frequently used in levels from 0 . 1 % to 3 %, more preferably from 0 . 15 - 1 . 0 %. the degree of substitution of preferred siloxanes , such as the aminosiloxanes , can be expressed as the molar ( moiety ) proportion of non - terminal silicones carrying a substituent other than a c 1 - 4 alkyl group to total non - terminal silicones . the numerical value for the degree of substitution of preferred siloxanes lies in the range from 0 . 01 to 0 . 7 ; preferably from 0 . 02 to 0 . 3 . while non - terminal substitution is preferred for enhanced through - the - wash fiber substantivity , it is understood that siloxanes with substituted terminal silicone atoms can also be used . in the preferred siloxane component herein , n is 3 or 4 , x and y are , selected independently , hydrogen ; -- c 1 - 4 - alkyl ; -- c 5 - 6 -- cycloalkyl and -- c 2 -- nh 2 . ______________________________________ abbreviated______________________________________ ( n -- cyclohexylamino - 4 amino - butyl - 1 ) sil - ipolydimethylsiloxane ( ethylene diamino - n -- butyl - 1 ) polydimethyl - sil - iisiloxane ( n -- dodecyl - 4 amino - butyl - 1 ) polydimethylsiloxane sil - iii ( 4 -( n , n -- dimethyl ammonium )- butyl - 1 ) sil - ivpolydimethylsiloxane ( 5 ( tallow amide )- 4 - carboxy - pentyl - 1 ) sil - vpolydimethylsiloxane______________________________________ the organofunctional siloxanes have generally a viscosity in the range from 40 cst to 100 . 000 cst , preferably from 250 cst to 2000 cst . the viscosity of the siloxanes is measured on the pure raw material at 25 ° c . with the aid of a brookfield ® viscometer ( lv digital ). the organofunctional polydimethyl siloxanes , in addition to the essential substituents defined hereinbefore , can contain polyalkylene oxide chains attached to unsubstituted silicone atoms ( in the meaning of this invention ). the polyalkylene , such as propylene or ethylene , oxide chains are attached to the silicone atoms instead of a c 1 - 4 alkyl group . the alkoxylation enhances the hydrophilic and antistatic ( charge - reducing ) properties of the component in relation to the textiles . in addition to the essential components , the compositions herein can contain a series of optional detergent ingredients with a view to improve the composition taking into consideration the specific utilization . these optional components can be presented by virtually all substances , which are known to suitable for use in the like composition , for their known functionality in the art established levels . the non - built or built compositions of the invention can contain , in addition to the detergent builder , other types of sequestrants , having precipitation inhibitor or anti - incrustation properties , in varying levels e . g . in an amount from 0 . 2 % to 5 %. such further sequestrants can be water - soluble copolymeric ingredients e . g . : polyacrylates , polymaleates and copolymeric carboxylates including those obtained from the copolymerization of unsaturated polyacids such a maleic or citraconic acid with suitable polymerizable reaction partners such as methacrylic acid , acrylic acid , mesaconic acid and methyl - vinyl - ether . mixture of the like watersoluble detergent sequestrant can also be used . examples of other optional components are detergent enzymes such as proteases , amylases , lipases and mixtures thereof , and stabilizing agents for the like enzymes ., soil suspending agents such as sodium carboxymethylcellulose and polyvinylpyrrolidone , suds regulants , such as c 16 - 22 fatty acids and methylated polysiloxanes , especially dimethylpolysiloxane , said silicone being used preferably at levels from 0 . 01 % to 0 . 4 %. hydrotropes can also be used and are frequently desirable in built compositions . examples of suitable hydrotropes include the water - soluble alkylaryl sulfonates having up to 3 carbon atoms in an alkyl group such as sodium , potassium , ammonium , and ethanol amine salts of xylene -, toluene -, ethylbenzene - and isopropyl benzene sulfonic acids . the subject compositions further can comprise brighteners , perfumes , dyes , bactericidal agents , antioxidants , opacifiers , photoactivators , fillers and the like . the following examples illustrate preferred executions of this invention , and facilitate its understanding . the abbreviations for the individual ingredients of the examples have the following meaning : c x - y eo n : c x - y alcohol ethoxylated with n moles of ethylene oxide . c x - y ( eo ) n s : sodium salt of c x - y alcohol ethoxylated with n moles of ethylene oxide and sulfated . tepa - eo : tetraethylene pentamine ethoxylated with about 100 moles of ethylene oxide . the following liquid detergent compositions were prepared by mixing , in a conventional manner , the following ingredients in the stated proportions ; the aminofunctional polysiloxane was admixed directly in liquid composition under agitation . ______________________________________compositions (% by weight ) comp . comp . a ex i b ex ii______________________________________las 11 . 3 11 . 3 6 . 3 6 . 3teacnas 4 . 0 4 . 0 -- -- c . sub . 13 - 15 eo7 12 . 0 12 . 0 3 . 7 3 . 7c . sub . 12 - 14 fatty acid 10 . 0 10 . 0 -- -- oleic acid 5 . 0 5 . 0 -- -- c . sub . 16 - 20 fatty acid -- -- 1 . 1 1 . 1stpp -- -- 23 . 0 23 . 0detpmp 0 . 6 0 . 6 -- -- ethanol 8 . 6 8 . 6 -- -- propanediol 3 . 0 3 . 0 -- -- glycerol -- -- 4 . 8 4 . 8sodium borate -- -- 2 2sil - i ( 1 ) -- 2 . 0 -- 2 . 0sodium hydroxyde to adjust 7 . 7 7 . 7 7 . 3 7 . 3ph ( 2 ) tomiscellaneous ( brighteners , balance to 100dyes , enzymes , perfumes , water ) ______________________________________ ( 1 ) degree of substitution of 0 . 15 ; viscosity 300 centistokes . ( 2 ) ph in composition . the composition of examples i and ii were compared for through - the - wash softness versus identical compositions a and b which did not contain the aminofunctional polydimethylsiloxane . the washed and line dried terry swatches were compared by a panel of two expert judges , working independently , by a paired comparison technique using a 9 - point scheffe scale . differences were recorded in panel score units ( psu ), positive being performancewise better and the least significant difference ( lsd ) at 95 % confidence was also calculated . ______________________________________ softness ( psu ) ______________________________________example i versus comp . a lsd + 0 . 3 - 0 . 3 0 . 5example ii versus comp . b lsd + 0 . 5 - 0 . 5 0 . 5______________________________________ these results show the significant softness through - the - wash benefits derivable from inventive compositions of examples i and ii versus identical compositions a and b which did not contain the aminofunctional polydimethylsiloxane . comparable textile benefits can be secured from liquid detergent compositions i and ii hereinabove wherein the ( n - cyclohexyl - 4 - amino - butyl - 1 ) polydimethylsiloxane ( sil - i ) is replaced by the listed organo - functional siloxanes in the stated proportions . ______________________________________ degree of examplesiloxane substitution i ii______________________________________sil - ii 0 . 18 1 . 0 -- sil - ii 0 . 45 -- 0 . 7sil - iii 0 . 08 0 . 3 1 . 3sil - iii 0 . 20 -- 0 . 5sil - iv 0 . 25 0 . 6 1 . 4sil - iv 0 . 60 0 . 9 0 . 2sil - v 0 . 05 0 . 4 -- sil - v 0 . 30 0 . 2 1 . 2______________________________________ further examples of substantially unbuilt compositions in accordance with the invention are as follows : ______________________________________ examples (% by weight ) ingredient iii iv v vi vii viii ix______________________________________hlas 10 7 7 -- -- -- -- c . sub . 14 - 15 . eo . sub . 2 . s -- 12 12 11 . 5 -- -- -- c . sub . 12 - 14 . eo . s -- -- -- -- -- 9 . 4 -- c . sub . 12 - 13 . eo . sub . 6 . 5 -- -- -- -- -- 21 . 5 -- c . sub . 14 - 15 . eo7 -- -- -- -- -- -- 18coconut alkyl -- -- -- -- -- -- 1dimethylamineoxidetea . cnas 4 -- -- -- -- -- -- c . sub . 13 - 15 . eo7 12 7 7 22 23 -- -- c . sub . 12 . tmac -- 1 . 1 -- -- -- -- -- dtmac -- -- -- -- 5 -- 3c . sub . 12 - 14 . fatty acid 10 13 15 -- -- -- -- oleic acid 5 2 -- -- -- -- -- sodium citrate 2 . 5 5 5 0 . 1 -- -- -- detpmp 0 . 6 -- -- -- -- -- -- dtpa -- 0 . 3 0 . 6 -- -- 0 . 2 -- proteolytic enzyme 0 . 7 0 . 7 0 . 7 0 . 7 -- 0 . 6 0 . 6amylase 0 . 1 0 . 2 0 . 2 -- -- 0 . 2 0 . 2ethanol 5 8 7 10 15 5 . 7 7 . 5propanediol , 1 - 2 4 7 4 -- -- -- -- tepa . eo 1 . 5 1 . 5 1 . 0 -- -- -- 1 . 5sil - i - ds . sup . (*) : 0 . 15 0 . 8 -- 0 . 4 -- 0 . 5 -- 0 . 6sil - ii - ds : 0 . 33 -- 0 . 3 -- 0 . 7 -- 0 . 7 -- miscellaneous incl . balance to 100of water , brightener , neutralizing agents , aesthetics______________________________________ . sup . (*) ds = degree of substitution . examples of built compositions in accordance with this invention are as follows : ______________________________________ examples (% by weight ) ingredient x ix xii xiii xiv xv______________________________________las 4 6 5 12 -- 6tea . cnas -- -- -- -- 4 2c . sub . 14 - 15 . eo7 2 2 3 5 8 3cn - dea 2 2 -- 3 -- -- stpp 18 16 22 -- -- 10nta 2 -- -- 18 8sodium citrate -- -- -- 15 -- -- zeolite a . sup . ( 1 ) -- 8 -- -- -- -- sodium borate 2 -- 2 -- -- 1kts 1 2 1 9 9 4fatty acid c . sub . 16 -- c . sub . 22 -- -- 1 . 5 -- -- -- ethanol -- -- -- -- -- -- glycerol 3 4 5 -- -- 3polydimethylsiloxane . sup . ( 2 ) 0 . 2 -- -- -- -- -- protease 0 . 85 0 . 5 0 . 6 -- -- 0 . 4dtpa 0 . 2 0 . 2 0 . 2 0 . 2 0 . 4 -- polyacrylate m = 100 . 000 2 -- 1 -- -- 1detpmp -- -- 0 . 6 -- -- 0 . 3sil - i : ds 0 . 40 0 . 8 -- 1 . 0 -- -- 0 . 6sil - iv : ds 0 . 15 -- 0 . 6 -- -- 0 . 7 -- sil - v : ds 0 . 55 -- -- -- 0 . 4 -- -- miscellaneous incl . of balance to 100water , aesthetics , brightener , neutralizers , etc . ______________________________________ . sup . ( 1 ) particle diameter 0 . 8 - 2 . 0 micrometer . . sup . ( 2 ) suds regulant . | 2 |
the invention applies technology used in the ink - jet printing industry and control systems for electronic dispensing of pheromones , semiochemicals and other fluids the purpose of modifying the activity or behavior of insect , viral or bacterial pests for pest control in large areas . the ink - jet printing dispensing methods could include dispensing by piezoelectric methods , thermal methods , magnetorestrictive methods or inductive methods . digital control of the dispensers permits turning them off or on , adjusting their output or operating them in a pattern in response to signals transmitted by wire or wireless devices . fig1 illustrates the dispenser using the piezoelectric method pheromones or other volatile fluids for pest control . in fig1 a schematic dispenser has a preferred piezoelectric ejection device 1 located in a case mounted on a stake support 14 suitable for driving into the soil . drops 3 are ejected from glass center tube 2 . electrical leads 8 for delivering operating pulses to dispensing device 1 are operably connected to an electronic dispenser control system 9 which has an internal battery power supply and drive electronics for generating pulses for controlling operation of jetting or ejection device 1 . included in fig1 is a radio - type radio antenna 10 which extends from a radio receiver or transceiver operably connected to circuitry in control unit 9 . control unit 9 includes a digital computing device and a means for converting signals received by the receiver or transceiver into operating commands . in this context , the term receiver refers to a radio control device that receives and converts signals from a remote source in one - way communication . the term transceiver connotes a radio device that receives and converts signals which can be used by the control system to operate the ejection device and is capable of transmitting information to a remote station in two - way communication . the communication systems themselves are conventional . the preferred communication system is offered by motorola inc .&# 39 ; s flex ™ architecture solutions division , boynton beach , fla . 33426 - 8622 . creatalink ™ ( one - way ) and creatalink2 ™ ( two - way ) receiver / transceivers use motorola &# 39 ; s flex ™ paging protocols including flex ™ one - way , reflex ™ two - way and inflexion ™ voice transmission technologies . motorola offers a robust product portfolio of pagers , components , infrastructure , test equipment , application protocols and software which are believed to be well suited to use to handle communications within this invention . piezoelectric dispensing device 1 has a glass center tube 2 that lies concentrically within a piezoelectric tube . the fluid to be dispensed is contained in a small “ sealed ” reservoir 7 which is connected by means of a fluid conduit 6 . as is conventional , the reservoir is not usually absolutely sealed , but contains a vent or valve in fluid communication with the reservoir through a tortuous path so that atmospheric pressure can be maintained on the fluid to prevent vacuum blockage from occurring . therefore the term “ sealed reservoir ” is understood to include a vent . tube 2 may comprise a channel made of piezoelectric material or is overlaid on one or more side by piezoelectric material . flexion of the piezoelectric material produced by introducing a voltage against the piezoelectric material compresses the fluid - containing compartment within tube 2 . the result is that a drop of fluid is ejected from the fluid - containing compartment through a precisely machined orifice which is typically about 60 μm in diameter or less as illustrated by microdrops 3 of fluid which are deposited onto a permeable wick 4 from which a vapor cloud 5 of pheromone or other insect behavior - controlling substance emanates . repeated droplet production maintains the cloud which plumes away downwind for a considerable effective distance . also schematically illustrated are climate - monitoring devices connected to control unit 9 including wind speed monitoring device 11 , temperature monitoring device 12 , and humidity monitoring device 13 . alternately , the environmental monitoring devices could be included in a separate environmental control station shown in fig3 and 4 . fig2 is a schematic top view showing some of the components of the dispenser of fig1 without the environmental sensors 11 , 12 , 13 or the antenna 10 . a round case is illustrated . a complete unit can be made which is not appreciably larger than a motorola pocket pager . fig2 a schematically illustrates the use of a shutter 31 which moves to the dotted position 31 “ prime ” in response to an actuator 29 operated by electrical connections 27 and a control unit 9 . a shutter schematically illustrated in fig2 a or a variation thereon is preferably used to close the orifice 2 to protect it from dust , dirt or any other foreign objects when dispensing is not underway . the shutter is open before dispensing begins and closed after dispensing ends . fig3 shows a pheromone dispensing device 15 , for example from fig1 representative of a plurality of such devices . in one embodiment , dispensing unit 15 receives dispense commands via a communication satellite 16 which in turn receives climatic data representing one or more environmental parameters from an environmental sensing agjet station 17 . satellite 16 is also in two way communication with a central computing / control station 18 that has received via satellite 16 the data on local climatic conditions from environmental sensing station 17 as well as data from other sources which control station 18 may have in its data bank . control station 18 is a master control station which processes the data received from environmental sensing station 17 and transmits back to the dispensing units 15 , signals that control pheromone dispensing by dispensers 15 . fig4 illustrates a plurality of agjet dispensing units 15 dispensed throughout many acres of a cultivated field in which climatic sensing station 17 has been placed . climatic data sensed by station 17 is relayed by communications satellite 16 to the main control station 18 from which commands are issued back via satellite 16 to control the pheromone dispensing units . dispensing unit commands are generated at main control station 18 by central control / computing computers that utilize insect - control software , information from other fields ( like fig4 ) and other / historical data , to generate optimum pheromone dispensing programs . climate - sensing equipment in the agjet system can be incorporated into one or several “ master ” dispensing units 15 , in a communication loop with many non - sensing dispensers . in effect , these “ master ” dispensing units can substitute for a separate environmental sensing station . temperature can be monitored by thermistor , humidity by a hygroscopic crystal that changes electrical resistance with ambient humidity , wind speed by a strain - gauge type instrument which changes electrical resistance when deflected by the wind , and wind direction by a series of wind - speed monitors mounted in slits oriented to the compass points . the broadcast of this information from the agjet system to the receiving station can be by conventional communication links as used in cellular telephones , two - way radios , and so forth . one skilled in the art could find many other devices capable of measuring and generating a signal representative of these parameters . in an alternate embodiment schematically illustrated in fig1 a - c , the pheromone dispensing system differs in that commands are generated and sent via wire or radio frequency or equivalent signals without the use of the satellite . the wireless control system contemplated is used in commonly known pagers utilizing paging technology mentioned above developed by motorola and other companies . u . s . pat . nos . 5 , 053 , 100 , 5 , 092 , 864 , 5 , 193 , 738 , 5 , 435 , 060 , 5 , 208 , 980 , 5 , 235 , 352 , 5 , 227 , 813 and 5 , 433 , 809 show some of the details of design and manufacturing of such a piezoelectric fluid pumping device and are incorporated herein by reference . further information about the design and manufacture of piezoelectric fluid dispensing devices can be found in the following publications : (“ application of ink - jet technology to dispensing in the electronics an semiconductor industries ”, d . b . wallace and d . j . hayes , presented at the ishm 1987 microelectronics interconnect conference , august 1987 . “ application of ink - jet technology to adhesive dispensing ”, d . b . wallace and d . j . hayes , presented at the sme adhesive &# 39 ; 87 conference , september 1987 . “ overview of small holes ,” d . j . hayes and d . b . wallace , invited paper , sme nontraditional machining conference , november 1989 . “ hot bar thermoelectric analysis ,” presented at the 2nd ishm joint technology conference , april 1991 . “ study of orifice fabrication technologies for the liquid droplet radiator ,” d . b . wallace , d . j . hayes and j . m . bush , nasa contractor report 187114 , may 1991 . “ biomedical applications of piezoelectric fluid dispensing jets ,” c . j . frederickson , d . b . wallace , r . cox , and d . j . hayes , abstracts of the tenth annual conference on biomedical engineering research in houston , 1992 . “ picoliter solder droplet dispensing ,” d . j . hayes , d . b . wallace , and m . t . boldman , proceedings , ishm &# 39 ; 92 , october 1992 .) the piezoelectric - type electronic dispenser has an electronic drive system that controls the dispenser with a circuit that generates a brief ( 20 - 100 microsecond ) monophasic pulse of 2 - 20 volts , with a rise time of 1 - 10 microseconds and a fall time of 1 - 10 microseconds . once such pulse ( amplified to 20 - 30 volts ) is delivered to a piezoelectric bending or squeezing element it generates a brief pressure transient sufficient to eject one drop in the picoliter volume range from a piezoelectric drop dispenser ejector jet . more details are given in the papers cited above and in u . s . pat . no . 5 , 436 , 648 incorporated herein by reference . drive circuitry of this sort can be designed or controlled to produce trains of pulses up to 4 , 000 per second , which in turn will produce discreet drops of fluid of rates up to 4 , 000 drops per second . one skilled in the art would understand that the number of molecules of the pheromone or other volatile fluids for pest control dispensed into the air could be obtained with different setting of various variables . these could include : concentration of pheromones or other volatile fluids for pest control in the droplets ; droplet size ; droplet rate ; number of orifices used for jetting ; and evaporation rate ; etc . optimizing these variables requires experimentation for short bursts at very high frequencies ( i . e . 25 khz ) followed by quiet times may prove to be similar to long bursts at lower frequencies ( i . e . 2 . 5 khz ). smaller droplets at high frequencies may be similar to larger drops at lower frequencies . smaller drops of concentrated fluids may be similar to larger droplets of dilute fluids . multiple orifices at lower frequencies may be similar to single orifices at high frequencies . the energy used to power the electronic drive circuitry described above can come from a battery , from a solar - charged battery , or from the electronic main supply in indoor installations . the orifice from which the drops emanate from tube 2 of ejection device or jetting device 1 is extremely small and may be located at a surface provided with a movable shutter ( not shown ) also connected to control unit 9 wherein the shutter is operated by another piezoelectric actuator . the motion required to move a shutter over the orifice to protect it from dust , moisture or debris may be provided by a piezoelectric bimorph ® actuator that may be obtained from morgan matroc inc ., electro ceramics division , 232 forbes road , bedford , ohio 44146 . these devices are discussed in a “ guide to modern piezoelectric ceramics ” by morgan matroc . the shutter actuator operates in an on / off mode to uncover the orifice when jetting of fluid from reservoir 7 is to be initiated and cover the orifice again when jetting is stopped . perhaps the simplest use of pheromone dispensers of the invention is in the wired system of fig1 a where a plurality of dispensers each having an ejection device or devices and drive electronics are dispersed over an area to be protected and wired to a remote control unit which comprises a programmable controller with a suitable power source and operating circuitry connected into the wired system . the programmable controller could be as simple as a timer that generates operating signals which are transmitted through the wires to each dispenser to turn the dispensers on at night and turn them off again during the day . fig1 a represents a simple wired system where the individual dispensers and wiring system can be permanently or semi - permanently installed which may be suitable for a greenhouse or vineyard , for example . pheromone dispensers 15 represented by “ d ” are hard wired to a control station 24 which could be a switch and a timer to turn dispensers d on or off . fig1 b and 10c represent a more complex system in which dispensers “ d ” are operated respectively in one way or two way wireless communication from master control station 18 which is in two way wireless communication with environmental sensing station 17 . the operating signals could provide intervals of on and off dispensing periods during an operating cycle . control of the electronic drive system can be via a radio - receiver that operates in the same general fashion as a radio - controlled model plane or car . a separate sending station will generate an amplitude or frequency - modulated radio signal with carrier frequency corresponding to the frequency to which the receiver is tuned . in its simplest format , the radio transmission will include a series of digital pulses , each one of which would cause the electronic ( typically ink - jet - like ) fluid dispenser to eject one drop of fluid . in more complex forms , the agjet system could contain digital programmable circuitry which could be reprogrammed or initialized by transmitted messages from the sending station . for example , the sending station could send a message to begin operating the dispensers which are pre - programmed to dispense at a selected operating rate and send a second message to discontinue dispensing when the desired dispensing time has elapsed . operation of the pheromone dispensers can be dependent upon one or a plurality of environmental condition parameters . dispensing may be futile if wind is still or wind velocity is too high . still wind does not allow a “ plume ” of pheromone vapor to trail out over the orchard to reach emerging insects . high wind simply blows the plumes away and dispenses them in the air . target insects may be inactive unless the temperature is above a certain temperature or the humidity is too high ( raining , for example ). if a wind is blowing from one side of the field , the sending station could , for example , send signals to trigger operation of the dispensers on the windward side and not operate the last row or last several rows of dispensers on the downwind side , in order to economize on the use of expensive pheromones . fig5 is an exemplary simple process which utilizes the fact that many pests do their mating in the period from dawn to dusk but not during the daytime . from start block 100 , the system moves to block 102 . block 102 determines if start time t 1 has arrived . if start time t 1 has arrived , a dispensing command is generated at block 103 and communicated to a plurality of dispensers and the process moves to block 106 and recycles until the stop time t 2 has arrived . when stop time t 2 has arrived , the process generates and communicates to the dispensers a stop dispensing command at the block 108 and returns to start block 100 . fig6 is an exemplary process which illustrates how signals from environmental sensing / monitoring station 17 can be utilized to control operation of a plurality of dispensers 15 in the system of fig3 and 10 b - c . it is understood that the absolute values of temperature , wind speed and wind direction are arbitrarily set in fig6 for illustration purposes . in actuality , these values would be determined by experimentation in relation to a specific one of the many pests . different pests may become active or inactive at different temperatures . the kind and amount of pheromone needed to be an effective amount may be greater for one pest than another . fig6 contemplates a system with operating environmental sensors as in fig1 or as is more likely for cost efficiency , in a system with an environmental sensing station 17 and a remote master / main control unit 18 . from start block 26 the system proceeds to block 28 . block 28 determines if time has reached start time t 1 . when time is t 1 , the system moves to block 30 . at block 30 station 17 , for example , checks a temperature sensor at the field where the dispensers are located . if the temperature is at or above a pre - selected limit , the process moves to block 32 . at block 32 a humidity sensor at the dispensing area is checked to determine if humidity is within a pre - defined desired range . if humidity is within a desired range , the process moves to block 34 . at block 34 a wind speed sensor in the dispensing area is checked to determine if wind speed is below a maximum desired velocity . if wind speed is below the maximum desired velocity , the process moves to block 36 . at block 36 , the wind speed sensor is checked to determine if the wind speed is near zero ( still ). if wind speed is not zero , the process moves to block 38 . at block 38 the wind speed sensor in the dispensing area is checked to determine if the wind speed is below a first control velocity , in this case 6 miles per hour . if wind speed is below the first control velocity , the process continues to block 48 . if wind speed is not below the first control velocity , the process moves to block 40 . at block 40 the wind speed sensor is checked to determine if wind speed in the dispensing area is below a second control velocity , in this case 12 miles per hour . if wind speed is below 12 miles per hour , a signal is sent to adjust the dispensers to increase the dispense rate at block 42 and the process moves to block 48 . ( the signal to increase the dispense rate may simply be stored to be sent if and when a dispensing command is generated at main control 18 .) if wind speed is not below the second control velocity , the process moves to block 44 . at block 44 the wind speed sensor is checked to determine if wind speed is below a third control velocity , in this case 18 miles per hour . if wind speed exceeds 18 miles per hour , the process returns to start block 26 . if not , the process moves to block 46 and a command to increase the dispense rate is either sent to set the dispensing units or stored to be sent later if and when a dispensing command is issued , and the process moves to block 48 . at block 48 , the environmental station 17 checks a wind direction sensor at the dispensing area and reports to the main control unit 18 . if the wind direction is from the “ north ”, the process moves to block 50 . at block 50 , a dispensing command is generated from the main control unit 18 and sent to the dispensers to dispense from all but the last two rows , for example . if the wind is not from the “ north ” the process moves to block 52 . at block 52 , the environmental station 17 checks the wind direction sensor at the dispensing area and reports to the main control unit 18 . if the wind direction is from the “ south ”, the process moves to block 54 . at block 54 a dispensing command is generated and sent from control unit 18 to the dispensers to dispense from all but the first two rows , for example . if the wind is not from the “ south ” the process moves to block 56 . at block 56 a dispensing command is generated and sent from the control unit 18 to the dispensers to dispense from all rows . next the process moves to block 58 to determine if the stop dispensing time t 2 has arrived . if the stop dispensing time t 2 has arrived , a stop dispensing command is generated at block 59 and sent by the control unit to the dispensers and the process returns to the start block . if block 58 determines time t 2 has not arrived , the process returns to block 30 and replicates the previous steps from that point . it is evident that wait blocks could be added before environmental parameters are rechecked or the process could simply wait until t 2 arrives or it could re - enter the string of steps at any point below block 28 to replicate only part of the process . for example , after block 58 the process could move to a wind speed block 34 or 36 instead of block 30 , if desired . fig7 is a schematic block diagram to illustrate components of an “ agjet ” pheromone dispenser 61 . a generic environmental parameter sensor 62 denoted “ s ” is shown in dotted outline with a companion signal conditioner 64 in electrical communication with a receiver or transceiver 66 for one - way or two - way communication as desired . a receiver is useful for receiving operating commands from a remote control station for a dispensing unit without the dotted outline components . a transceiver is useful for a “ master ” dispensing unit with environmental parameter sensors to provide feedback in the case of a limited number of such “ master ” dispensers scattered among dispensers without sensing equipment . the master dispenser can operate the other dispensers . the receiver or transceiver may have its own power supply 68 denominated battery / solar powered battery “ b ”. dispenser 61 further includes power supply 70 , control electronics 72 in electrical communication with receiver 66 and drive electronics 74 itself in electrical communication with pheromone jetting device 76 . pheromone jetting device 76 is preferably the piezoelectric ejection device 1 of fig1 . fig8 is a schematic block diagram of environmental sensing station 17 . it has a plurality of environmental parameter sensors “ s ”, in electrical communication with signal conditioner 64 . power supply 78 is in electrical communication with input / output device 80 , digital computing device 82 , interface 84 and transceiver 86 . each of these devices is in electrical communication so that signals representative of the status or condition of an environmental parameter can be converted and transmitted from environmental sensing station 17 to a master or main control station 18 in fig9 . fig9 is a schematic block diagram showing preferred components of master control station 18 . station 18 includes a digital computing device in electrical communication through a signal convertor 88 with its own transceiver 86 , all in electrical communication with a power supply 90 . power supply 90 could be battery driven or connected to a power line depending on the location of station 18 , which may be remote from a field or fields containing dispensers 61 which it is intended to operate . computing device may include database 92 and a program which can be used to generate a likely emergence date for a target pest and used to trigger a series of dispensing cycles . fig1 illustrates a rectangular prototype 110 with two ejection devices 1 each having its own coiled tube reservoir 112 for each dispenser , shown in relation to the size of a quarter coin 114 to illustrate the miniaturization that is possible with these devices . a rectangular case 111 contains two ejection devices 1 which dispense onto a “ wick ” 118 in an opening 120 . space 122 may contain circuitry and drive electronics , chips and connections 124 for power , etc . this illustrates that an electronically activated dispenser 15 , 61 may contain a plurality of ejection devices and a plurality of reservoirs 7 , 112 with each ejection device in fluid communication with one of the reservoirs . each reservoir may contain a different pest specific volatile fluid and each ejection device can operate independently in response to signals from control unit 18 so that the pest control techniques disclosed herein can be applied at different times or even at the same time to control more than one species of pest . the dispensers can have multiple orifices in a single assembly as a same or multifluid jetting device as shown in u . s . pat . no . 5 , 402 , 162 incorporated herein by reference . the special coiled tube reservoir 112 is , of course , connected in fluid communication with its jetting device . an operating advantage arises from its compactness while still holding a good quantity of pheromone fluid and from its ability to be laid flat in operation as shown in fig1 so that the maximum fluid “ head ” developed is limited to the diameter of the tiny coils . this prevents interference with efficient and continuous jetting that can arise from a variable head of fluid which might develop as pheromone level decreases in a reservoir . the coil tube reservoir reduces the chance that jetting would cease before the fluid in the reservoir is exhausted . further explanation of this device is included in u . s . patent application ser . no . 08 / 837 , 646 , filed apr . 21 , 1997 , entitle “ presenting airborne material to the nose ” which is incorporated herein by reference . although the invention has been disclosed above with regard to a particular and preferred embodiment , it is not intended to limit the scope of this invention . for instance , although the inventive method has been set forth in a prescribed sequence of steps , it is understood that the disclosed sequence of steps may be varied . it will be appreciated that various modifications , alternative , s variations , etc ., may be made without departing from the spirit and scope of the invention as defined in the appended claims . | 1 |
embodiments of the invention and the various features and advantageous details thereof are explained more fully with reference to the nonlimiting embodiments that are illustrated in the accompanying drawings and detailed in the following description . descriptions of well known processing techniques , components and equipment are omitted so as not to unnecessarily obscure the embodiments of the invention in detail . it should be understood , however , that the detailed description and the specific examples , while indicating preferred embodiments of the invention , are given by way of illustration only and not by way of limitation . various substitutions , modifications , additions and / or rearrangements within the spirit and / or scope of the underlying inventive concept will become apparent to those skilled in the art from this disclosure . the present invention discloses a system and method for using an all - to - all interconnect to generate a unique and increasing over time numerical identifier useful in determining the ordering of events across multiple computing resources . the system and method will function even if the connected entities to the fabric are processing units , storage or i / o devices even if the processing units are running different versions or vendors operating systems . in general , the context of an embodiment of the invention can include the properties provided by the lightfleet warp fabric interconnect but can include any fabric interconnect having the following properties . the context of an embodiment of the invention can include additive bandwidth — as new nodes are added to a system additional bandwidth is created . normally this would be the properties of a non - blocking switch . the context of an embodiment of the invention can also include all - to - all message delivery — all nodes on the fabric see all messages sent on the fabric . the fabric interface for a single node chooses which messages to process and which to reject . the context of an embodiment of the invention can also include fault isolation — a failure in the fabric only affects the path of the failing node . either the transmission path from a single node or the reception of a single node . but it will not be able to clog or overwhelm the fabric paths of any other node . the invention can use the above properties in order to create a reliable , self healing service that allows cooperating entities on the fabric to share a monotonically increasing number to coordinate the timing of events . a single node is initially identified as the master node . only the master node can respond to a host side request for a transaction identifier ( tid ). in a preferred embodiment , all requests for a tid are initiated by a non - fabric request . the non - fabric request can come from a node that is coupled to the interconnect fabric . for example , a processing unit , a storage unit and / or an input / output unit . in this case , the tid request is considered satisfied when the non - fabric requester has received the tid . referring to fig1 , at block 102 , a tid request is transmitted by a host 101 ( e . g ., node ) to an all - to - all interconnect fabric 100 . an exemplary tid request will be described in detail with regard to table 1 below . at block 104 the tid request is scheduled on the interconnect fabric . at block 106 , wait for a response . at block 108 , it is determined whether the new tid is higher in magnitude that the last tid . if no , at block 110 an error message is sent to the host via the interconnect fabric . if yes , at block 112 the new tid is sent to the host via the interconnect fabric . preferred embodiments of the invention include a student node in addition to the master node . when a student node receives a request from a non - fabric side it 1 ) blocks the read request until a response with the tid has occurred and 2 ) sends a packet requesting a tid . a possible version of this packet is described below in table 1 . the command in table 1 is a code that indicates that this is a request for a tid and all nodes on the fabric receive and process the request . the master node will be the only node to respond with a generated tid . the other student nodes will monitor the request and response for purposes of error detection and failure recovery . the transaction group id in table 1 allows for the fabric to support multiple tids on a single fabric . the master id in table 1 can be used to have the master and students check that the student still thinks that the master is in control of the id or be ignored . the requestor id in table 1 is used to allow the master to respond to the requester . the transaction id in table 1 does not matter during the request , but is a new tid during the response . the crc in table 1 does not matter during the request , but is protection to ensure that the packet is correct during the response . when the master node receives the request , the master will then respond with a packet formatted in the same manner as above but with a different command specifying that it is a response with a tid . referring to fig2 , at block 210 the master node is idle until the master node receives a tid request from a host node via the interconnect fabric . at block 220 , the master node generates the new tid and sends the new tid to the host ( requesting ) node via the interconnect fabric . still referring to fig2 , at block 230 the master node determines if the is another tid request outstanding ( unfulfilled ). if no , the master goes idle at block 210 . if yes , the master node gets the next request in line at block 240 and generates and sends another tid at block 220 to the requesting node via the interconnect fabric . when the student node receives a packet formatted in the same manner as above , the student node will handle the packet differently depending on whether it is a request or a new tid . referring to fig3 , at block 312 , the student node is idle until the student node receives a packet . at block 322 , the student determines whether the packet is a request . if yes , the student schedules the request in its queue at block 332 and then goes idle at block 312 . if no , the student determines whether the packet is labeled for its reception at block 342 . if yes , the student sends the packet to the appropriate host at block 352 and then goes idle at block 312 . if no , the student determines whether the student was skipped with respect to a request of its own at block 362 . if no , the student goes idle at block 312 . if yes , the student determines whether the number of times its has been skipped with respect to the request of its own exceeds a predetermined number of maximum skips at block 372 . if yes , the student raises an error to the host at block 382 and then goes idle at block 312 . if no , the student optionally sends a tid request at block 392 and then goes idle at block 312 . the invention can include two methods of processing the response which are detailed below as examples . of course , the invention is not limited to the examples . specific embodiments of the invention will now be further described by the following , nonlimiting examples which will serve to illustrate in some detail various features . the following examples are included to facilitate an understanding of ways in which an embodiment of the invention may be practiced . it should be appreciated that the examples which follow represent embodiments discovered to function well in the practice of the invention , and thus can be considered to constitute preferred mode ( s ) for the practice of the embodiments of the invention . however , it should be appreciated that many changes can be made in the exemplary embodiments which are disclosed while still obtaining like or similar result without departing from the spirit and scope of an embodiment of the invention . accordingly , the examples should not be construed as limiting the scope of the invention . a fixed master node embodiment will now be described . in a fixed master system the master node is set from the non - fabric side after agreement among the nodes . the master node only changes if there is a failure of the master node and the other nodes agree to select a new master node using an agreed upon method . in this case the master node responds with a packet as in table 1 above with the fields having the following meaning listed below in table 2 . the student response in this fixed master embodiment will now be described . when a student sees this message it response varies depending upon if it was the student being responded to with the new tid or just monitoring the fabric . if it is the student being responded to it will accept the packet . the acceptance of the packet is dependent upon the packet passing several screens . packet is successfully decoded from transmission method and passes crc verification . new transaction id is larger than the last tid processed on this node . if the above is true and the end point &# 39 ; s id matches the requestor id then the following happens . if the above is true and the end point &# 39 ; s id does not match the requestor id then the following happens . checks to see if the end point &# 39 ; s id is between the last requestor id cleared and the one just sent . if so it sends another request for a tid unless this would be a preset number times that it has been passed over for a requested tid . if you have exceeded the preset number of missed requests an error will be raised to the non - fabric interface for node to respond to the issue . a floating master embodiment will now be described . this floating master method differs in that the node that is the master is passed to the student that is receiving the tid . all tid operations result in a message being sent across the fabric even if the master is passing the token to itself . only the master can pass a tid to the non - fabric side of the interface . the master response will now be described . in this case the master node responds with a packet as in table 1 above with the fields having the following meaning listed below in table 3 . in this case the request and response packet is exactly the same as the fixed master . just the response of the master is changed . the student response will now be described . when a student sees this message its response varies depending upon if it was the student being responded to with the new tid or just monitoring the fabric . if it is the student being responded to it will accept the packet . the acceptance of the packet is dependent upon the packet passing several screens . packet is successfully decoded from transmission method and passes crc verification . new transaction id is larger than the last tid processed on this node . if the above is true and the end point &# 39 ; s id matches the requestor id then the following happens . if the above is true and the end point &# 39 ; s id does not match the requestor id then the following happens . checks to see if its id is between the last requestor id cleared and the one just sent . if so it sends another request for a tid unless this would be a preset number times that it has been passed over for a requested tid . if you have exceeded the preset number of missed requests an error will be raised to the non - fabric interface for node to respond to the issue . since a multiple nodes could request a tid before a single tid update operation could be completed , the invention can handle this by logging all requests to a table of outstanding requests . each node has a slot to indicate its status as to if it has made a request for a tid . all nodes process this table in the same order so they all expect the same node to be given the next tid . the normal operation will result in every node receiving a tid for the student it expected . however there are several conditions that could result in a node seeing a different result than it expected . this invention detects these instances and is self healing for transitory errors without intervention from the non - fabric side . however critical non - transitory errors are raised to the non - fabric side . possible errors include the following . race conditions — student request passes master response . corrupted packet — either a decoding error or crc error causes packet to be discarded by one or more end points . in the case where the student requests a tid but the master is already in the process of sending a packet to another node that is “ past ” the student requesting it would result in the request being put into the queue for the next pass through the ordered list . a missed packet that results in a master not receiving the request and skipping a node in the list because it was not logged in the table will result in the requesting node seeing that it was skipped . its normal response is to update a counter to make sure it has not been skipped multiple times ( configurable ) and send its request again . if the condition goes beyond a set maximum number of requests then an error is raised to its non - fabric interface . timing and performance calculation results are shown below in table 4 . the following are some assumptions to do the calculations : all fields are 16 bits except for the crc and the tid these assumptions result in the interconnect fabric being able to satisfy over 6 . 5 million transaction id requests per second . the term program and / or the phrase computer program are intended to mean a sequence of instructions designed for execution on a computer system ( e . g ., a program and / or computer program , may include a subroutine , a function , a procedure , an object method , an object implementation , an executable application , an applet , a servlet , a source code , an object code , a shared library / dynamic load library and / or other sequence of instructions designed for execution on a computer or computer system ). the term substantially is intended to mean largely but not necessarily wholly that which is specified . the term approximately is intended to mean at least close to a given value ( e . g ., within 10 % of ). the term generally is intended to mean at least approaching a given state . the term coupled is intended to mean connected , although not necessarily directly , and not necessarily mechanically . the term deploying is intended to mean designing , building , shipping , installing and / or operating . the terms first or one , and the phrases at least a first or at least one , are intended to mean the singular or the plural unless it is clear from the intrinsic text of this document that it is meant otherwise . the terms second or another , and the phrases at least a second or at least another , are intended to mean the singular or the plural unless it is clear from the intrinsic text of this document that it is meant otherwise . unless expressly stated to the contrary in the intrinsic text of this document , the term or is intended to mean an inclusive or and not an exclusive or . specifically , a condition a or b is satisfied by any one of the following : a is true ( or present ) and b is false ( or not present ), a is false ( or not present ) and b is true ( or present ), and both a and b are true ( or present ). the terms a and / or an are employed for grammatical style and merely for convenience . the term plurality is intended to mean two or more than two . the term any is intended to mean all applicable members of a set or at least a subset of all applicable members of the set . the term means , when followed by the term “ for ” is intended to mean hardware , firmware and / or software for achieving a result . the term step , when followed by the term “ for ” is intended to mean a ( sub ) method , ( sub ) process and / or ( sub ) routine for achieving the recited result . the terms “ comprises ,” “ comprising ,” “ includes ,” “ including ,” “ has ,” “ having ” or any other variation thereof , are intended to cover a non - exclusive inclusion . for example , a process , method , article , or apparatus that comprises a list of elements is not necessarily limited to only those elements but may include other elements not expressly listed or inherent to such process , method , article , or apparatus . the terms “ consisting ” ( consists , consisted ) and / or “ composing ” ( composes , composed ) are intended to mean closed language that does not leave the recited method , apparatus or composition to the inclusion of procedures , structure ( s ) and / or ingredient ( s ) other than those recited except for ancillaries , adjuncts and / or impurities ordinarily associated therewith . the recital of the term “ essentially ” along with the term “ consisting ” ( consists , consisted ) and / or “ composing ” ( composes , composed ), is intended to mean modified close language that leaves the recited method , apparatus and / or composition open only for the inclusion of unspecified procedure ( s ), structure ( s ) and / or ingredient ( s ) which do not materially affect the basic novel characteristics of the recited method , apparatus and / or composition . unless otherwise defined , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . in case of conflict , the present specification , including definitions , will control . the described embodiments and examples are illustrative only and not intended to be limiting . although embodiments of the invention can be implemented separately , embodiments of the invention may be integrated into the system ( s ) with which they are associated . all the embodiments of the invention disclosed herein can be made and used without undue experimentation in light of the disclosure . although the best mode of the invention contemplated by the inventor is disclosed , embodiments of the invention are not limited thereto . embodiments of the invention are not limited by theoretical statements ( if any ) recited herein . the individual steps of embodiments of the invention need not be performed in the disclosed manner , or combined in the disclosed sequences , but may be performed in any and all manner and / or combined in any and all sequences . various substitutions , modifications , additions and / or rearrangements of the features of embodiments of the invention may be made without deviating from the spirit and / or scope of the underlying inventive concept . all the disclosed elements and features of each disclosed embodiment can be combined with , or substituted for , the disclosed elements and features of every other disclosed embodiment except where such elements or features are mutually exclusive . the spirit and / or scope of the underlying inventive concept as defined by the appended claims and their equivalents cover all such substitutions , modifications , additions and / or rearrangements . the appended claims are not to be interpreted as including means - plus - function limitations , unless such a limitation is explicitly recited in a given claim using the phrase ( s ) “ means for ” and / or “ step for .” subgeneric embodiments of the invention are delineated by the appended independent claims and their equivalents . specific embodiments of the invention are differentiated by the appended dependent claims and their equivalents . | 6 |
fig1 is a side elevation , simplified view of an example of a gas turbine engine 10 . the view is partially broken away to show elements of the interior of the engine . the engine 10 includes a compression section 12 , a combustion section 14 and a turbine section 16 . an airflow path 18 for working medium gases extends axially through the engine 10 . the engine 10 includes a first , low pressure rotor assembly 22 and a second , high pressure rotor assembly 24 . the high pressure rotor assembly 24 includes a high pressure compressor 26 connected by a shaft 28 to a high pressure turbine 32 . the low pressure rotor assembly 22 includes a fan and low pressure compressor 34 connected by a shaft 36 to a low pressure turbine 38 . during operation of the engine 10 , working medium gases are flowed along the airflow path 18 through the low pressure compressor 26 and the high pressure compressor 34 . the gases are mixed with fuel in the combustion section 14 and burned to add energy to the gases . the high pressure working medium gases are discharged from the combustion section 14 to the turbine section 16 . energy from the low pressure turbine 38 and the high pressure turbine 32 is transferred through their respective shafts 36 , 28 to the low pressure compressor 34 and the high pressure compressor 26 . with reference to fig2 , a partial cross - sectional view of a turbine section is generally indicated by the reference number 40 . within the area enclosed by circle 42 , the turbine section includes a plurality of turbine blades mounted on turbine disk slots . turning to the enlarged view of fig3 , conventional turbine disk slots 44 for mounting turbine blades typically have a non - rounded or otherwise sharp - edged periphery 46 at a bottom portion 48 relative a front face 43 f of a turbine disk 43 which produces a sharp edge entrance for airflow . the sharp edge entrance causes an unfavorable airflow separation at the slot inlet , and undesirably generates an increased heat transfer rate because of airflow reattachment . turning now to fig4 , a turbine disk 50 defines a plurality of turbine disk slots 52 embodying the present invention . each turbine disk slot 52 defined by the turbine disk 50 includes an inlet 54 having a rounded periphery 56 relative a front face 50 f . the rounded periphery 56 is generally located at a bottom portion 58 of each turbine slot 52 disk . an extra machining process is employed to generate the rounded periphery 56 of the inlet 54 . a radius ( r ) of the rounded periphery 56 is based on a hydraulic diameter ( d h ) of the slot 52 , which in turn is based on a cooling airflow area between the bottom portion 58 of the slot 52 and a bottom of a turbine blade . to maximize the effectiveness of the inlet 54 having the rounded periphery 56 , an r / d h ratio of 0 . 16 is preferably used , but an r / d h ratio that is either greater or lesser than 0 . 16 can be used without departing from the scope of the present invention . because of the nature of the design , the entire edge of the inlet 54 of the slot 52 cannot be rounded . instead , the full radius of the rounded periphery 56 extends approximately 180 degrees and then tapers down to points 60 as shown in fig4 . fig5 illustrates a cross - section of a turbine disk 70 in accordance with the present invention . the turbine disk 70 defines a slot 72 including a rounded periphery 74 at a turbine disk slot entrance adjacent to an aft face 76 of a forward cover plate 78 . the turbine disk 70 further defines a plurality of blade cooling passages 80 disposed on an opposite side of the turbine disk 70 relative to the slot 72 . it has been discovered that a rounded periphery of an inlet of a turbine disk slot offers the following advantages : 1 ) reduces inlet pressure loss because of the sharp edge entrance ; 3 ) reduces the increased heat transfer rate because of flow reattachment . as will be recognized by those of ordinary skill in the pertinent art , numerous modifications and substitutions can be made to the above - described embodiment of the present invention without departing from the scope of the invention . accordingly , the preceding portion of this specification is to be taken in an illustrative , as opposed to a limiting sense . | 5 |
with reference now to the figures , and in particular with reference to fig1 , a pictorial representation of a distributed data processing system is depicted in which the present invention may be implemented . distributed data processing system 100 is a network of computers in which the present invention may be implemented . distributed data processing system 100 contains network 102 , which is the medium used to provide communications links between various devices and computers connected within distributed data processing system 100 . network 102 may include permanent connections , such as wire or fiber optic cables , or temporary connections made through telephone connections . in the depicted example , server 104 is connected to network 102 , along with storage unit 106 . in addition , clients 108 , 110 and 112 are also connected to network 102 . these clients , 108 , 110 and 112 , may be , for example , personal computers or network computers . for purposes of this application , a network computer is any computer coupled to a network that receives a program or other application from another computer coupled to the network . in the depicted example , server 104 provides data , such as boot files , operating system images and applications , to clients 108 - 112 . clients 108 , 110 and 112 are clients to server 104 . distributed data processing system 100 may include additional servers , clients , and other devices not shown . distributed data processing system 100 also includes printers 114 , 116 and 118 . a client , such as client 110 , may print directly to printer 114 . clients such as client 108 and client 112 do not have directly attached printers . these clients may print to printer 116 , which is attached to server 104 , or to printer 118 , which is a network printer that does not require connection to a computer for printing documents . client 110 , alternatively , may print to printer 116 or printer 118 , depending on the printer type and the document requirements . in the depicted example , distributed data processing system 100 is the internet , with network 102 representing a worldwide collection of networks and gateways that use the tcp / ip suite of protocols to communicate with one another . at the heart of the internet is a backbone of high - speed data communication lines between major nodes or host computers consisting of thousands of commercial , government , education , and other computer systems that route data and messages . of course , distributed data processing system 100 also may be implemented as a number of different types of networks such as , for example , an intranet or a local area network . fig1 is intended as an example and not as an architectural limitation for the processes of the present invention . with reference now to fig2 a , a block diagram of a data processing system which may be implemented as a server , such as server 104 in fig1 , is depicted in accordance with one embodiment of the present invention . data processing system 200 may be a symmetric multiprocessor ( smp ) system including a plurality of processors 202 and 204 connected to system bus 206 . alternatively , a single processor system may be employed . also connected to system bus 206 is memory controller / cache 208 , which provides an interface to local memory 209 . i / o bus bridge 210 is connected to system bus 206 and provides an interface to i / o bus 212 . memory controller / cache 208 and i / o bus bridge 210 may be integrated as depicted . peripheral component interconnect ( pci ) bus bridge 214 connected to i / o bus 212 provides an interface to pci local bus 216 . a modem 218 may be connected to pci local bus 216 . typical pci bus implementations will support four pci expansion slots or add - in connectors . communications links to network computers 108 - 112 in fig1 may be provided through modem 218 and network adapter 220 connected to pci local bus 216 through add - in boards . additional pci bus bridges 222 and 224 provide interfaces for additional pci buses 226 and 228 , from which additional modems or network adapters may be supported . in this manner , server 200 allows connections to multiple network computers . a memory mapped graphics adapter 230 and hard disk 232 may also be connected to i / o bus 212 as depicted , either directly or indirectly . those of ordinary skill in the art will appreciate that the hardware depicted in fig2 a may vary . for example , other peripheral devices , such as optical disk drive and the like also may be used in addition or in place of the hardware depicted . the depicted example is not meant to imply architectural limitations with respect to the present invention . the data processing system depicted in fig2 a may be , for example , an ibm risc / system 6000 system , a product of international business machines corporation in armonk , new york , running the advanced interactive executive ( aix ) operating system . with reference now to fig2 b , a block diagram of a data processing system in which the present invention may be implemented is illustrated . data processing system 250 is an example of a client computer . data processing system 250 employs a peripheral component interconnect ( pci ) local bus architecture . although the depicted example employs a pci bus , other bus architectures such as micro channel and isa may be used . processor 252 and main memory 254 are connected to pci local bus 256 through pci bridge 258 . pci bridge 258 also may include an integrated memory controller and cache memory for processor 252 . additional connections to pci local bus 256 may be made through direct component interconnection or through add - in boards . in the depicted example , local area network ( lan ) adapter 260 , scsi host bus adapter 262 , and expansion bus interface 264 are connected to pci local bus 256 by direct component connection . in contrast , audio adapter 266 , graphics adapter 268 , and audio / video adapter ( a / v ) 269 are connected to pci local bus 266 by add - in boards inserted into expansion slots . expansion bus interface 264 provides a connection for a keyboard and mouse adapter 270 , modem 272 , and additional memory 274 . scsi host bus adapter 262 provides a connection for hard disk drive 276 , tape drive 278 , and cd - rom 280 in the depicted example . typical pci local bus implementations will support three or four pci expansion slots or add - in connectors . an operating system runs on processor 252 and is used to coordinate and provide control of various components within data processing system 250 in fig2 b . the operating system may be a commercially available operating system such as javaos for business ™ or os / 2 ™, which are available from international business machines corporation ™. javaos is loaded from a server on a network to a network client and supports java programs and applets . a couple of characteristics of javaos that are favorable for performing traces with stack unwinds , as described below , are that javaos does not support paging or virtual memory . an object oriented programming system such as java may run in conjunction with the operating system and may provide calls to the operating system from java programs or applications executing on data processing system 250 . instructions for the operating system , the object - oriented operating system , and applications or programs are located on storage devices , such as hard disk drive 276 and may be loaded into main memory 254 for execution by processor 252 . hard disk drives are often absent and memory is constrained when data processing system 250 is used as a network client . those of ordinary skill in the art will appreciate that the hardware in fig2 b may vary depending on the implementation . for example , other peripheral devices , such as optical disk drives and the like may be used in addition to or in place of the hardware depicted in fig2 b . the depicted example is not meant to imply architectural limitations with respect to the present invention . for example , the processes of the present invention may be applied to a multiprocessor data processing system . before embarking on a more detailed description of the present invention , a brief overview of object oriented technology and programming is provided for those unfamiliar with these concepts . object oriented technology is a methodology for designing and programming information systems . object technology differs from traditional system design which separates the data from the processing . although data and processing are naturally related since software causes the computer to process data , the traditional approach has been to design the databases separate and apart from the processing routines , often using different modeling and documentation tools . in object technology , which is implemented using object - oriented programming tools , information systems are designed as building blocks that contain both the data and the processing ( the “ attributes ” and the “ methods ”). for example , a customer object would contain customer data ( name , address , etc .) and the kinds of processing that would take place for a customer ( place order , request information , etc .) would also be built into the object . object oriented programming , often abbreviated as “ oop ,” is programming that supports object technology . it is an evolutionary form of modular programming with more formal rules that allow pieces of software to be reused and interchanged between programs . major concepts are encapsulation , inheritance and polymorphism . encapsulation is the creation of self - sufficient modules that contain the data and the processing ( data structure and functions that manipulate that data ). these user - defined , or abstract , data types are called “ classes .” one instance of a class is called an “ object .” for example , in a payroll system , a class could be defined as manager , and pat and jan , the actual objects , are instances of that class . classes are created in hierarchies , and inheritance allows the knowledge in one class to be passed down the hierarchy . that means less programming is required when adding functions to complex systems . if a step is added at the bottom of a hierarchy , then only the processing and data associated with that unique step needs to be added . everything else about that step is inherited . object - oriented programming allows procedures about objects to be created whose exact type is not known until runtime . for example , a screen cursor may change its shape from an arrow to a line depending on the program mode . the routine to move the cursor on screen in response to mouse movement would be written for “ cursor ,” and polymorphism would allow that cursor to be whatever shape is required at runtime . it would also allow a new shape to be easily integrated into the program . returning now to the present invention the present invention provides a process and system for a tool to assist managers in creating and / or changing organizational structure , selecting goals , choosing personnel for projects , and motivating employees or other personnel in order to more efficiently achieve enterprise objectives and may be implemented in an object oriented programming environment , such as , for example , java . however , the present invention is not limited to implementation in an object oriented environment , but may be implemented in any number of data processing environments and as such , the present invention is not limited to object oriented systems , but is merely described in such an environment for exemplary purposes . thus , although the present invention may operate on a variety of computer platforms and operating systems , it may also operate within a java runtime environment . hence , the present invention may operate in conjunction with a java virtual machine ( jvm ) yet within the boundaries of a jvm as defined by java standard specifications . in order to provide a context for the present invention , portions of the operation of a jvm according to java specifications are herein described . with reference now to fig3 a , a block diagram illustrates the relationship of software components operating within a computer system that may implement the present invention . java - based system 300 contains platform specific operating system 302 that provides hardware and system support to software executing on a specific hardware platform . jvm 304 is one software application that may execute in conjunction with the operating system . jvm 304 provides a java run - time environment with the ability to execute java application or applet 306 , which is a program , servlet , or software component written in the java programming language . the computer system in which jvm 304 operates may be similar to data processing system 200 or computer 100 described above . however , jvm 304 may be implemented in dedicated hardware on a so - called java chip , java - on - silicon , or java processor with an embedded picojava core . at the center of a java run - time environment is the jvm , which supports all aspects of java &# 39 ; s environment , including its architecture , security features , mobility across networks , and platform independence . the jvm is a virtual computer , i . e . a computer that is specified abstractly . the specification defines certain features that every jvm must implement , with some range of design choices that may depend upon the platform on which the jvm is designed to execute . for example , all jvms must execute java bytecodes and may use a range of techniques to execute the instructions represented by the bytecodes . a jvm may be implemented completely in software or somewhat in hardware . this flexibility allows different jvms to be designed for mainframe computers and pdas . the jvm is the name of a virtual computer component that actually executes java programs . java programs are not run directly by the central processor but instead by the jvm , which is itself a piece of software running on the processor . the jvm allows java programs to be executed on a different platform as opposed to only the one platform for which the code was compiled . java programs are compiled for the jvm . in this manner , java is able to support applications for many types of data processing systems , which may contain a variety of central processing units and operating systems architectures . to enable a java application to execute on different types of data processing systems , a compiler typically generates an architecture - neutral file format — the compiled code is executable on many processors , given the presence of the java run - time system . the java compiler generates bytecode instructions that are nonspecific to a particular computer architecture . a bytecode is a machine independent code generated by the java compiler and executed by a java interpreter . a java interpreter is part of the jvm that alternately decodes and interprets a bytecode or bytecodes . these bytecode instructions are designed to be easy to interpret on any computer and easily translated on the fly into native machine code . byte codes are may be translated into native code by a just - in - time compiler or jit . a jvm must load class files and execute the bytecodes within them . the jvm contains a class loader , which loads class files from an application and the class files from the java application programming interfaces ( apis ) which are needed by the application . the execution engine that executes the bytecodes may vary across platforms and implementations . one type of software - based execution engine is a just - in - time compiler . with this type of execution , the bytecodes of a method are compiled to native machine code upon successful fulfillment of some type of criteria for jitting a method . the native machine code for the method is then cached and reused upon the next invocation of the method . the execution engine may also be implemented in hardware and embedded on a chip so that the java bytecodes are executed natively . jvms usually interpret bytecodes , but jvms may also use other techniques , such as just - in - time compiling , to execute bytecodes . interpreting code provides an additional benefit . rather than instrumenting the java source code , the interpreter may be instrumented . trace data may be generated via selected events and timers through the instrumented interpreter without modifying the source code . profile instrumentation is discussed in more detail further below . when an application is executed on a jvm that is implemented in software on a platform - specific operating system , a java application may interact with the host operating system by invoking native methods . a java method is written in the java language , compiled to bytecodes , and stored in class files . a native method is written in some other language and compiled to the native machine code of a particular processor . native methods are stored in a dynamically linked library whose exact form is platform specific . with reference now to fig3 b , a block diagram of a jvm is depicted in accordance with a preferred embodiment of the present invention . jvm 350 includes a class loader subsystem 352 , which is a mechanism for loading types , such as classes and interfaces , given fully qualified names . jvm 350 also contains runtime data areas 354 , execution engine 356 , native method interface 358 , and memory management 374 . execution engine 356 is a mechanism for executing instructions contained in the methods of classes loaded by class loader subsystem 352 . execution engine 356 may be , for example , java interpreter 362 or just - in - time compiler 360 . native method interface 358 allows access to resources in the underlying operating system . native method interface 358 may be , for example , a java native interface . runtime data areas 354 contain native method stacks 364 , java stacks 366 , pc registers 368 , method area 370 , and heap 372 . these different data areas represent the organization of memory needed by jvm 350 to execute a program . java stacks 366 are used to store the state of java method invocations . when a new thread is launched , the jvm creates a new java stack for the thread . the jvm performs only two operations directly on java stacks : it pushes and pops frames . a thread &# 39 ; s java stack stores the state of java method invocations for the thread . the state of a java method invocation includes its local variables , the parameters with which it was invoked , its return value , if any , and intermediate calculations . java stacks are composed of stack frames . a stack frame contains the state of a single java method invocation . when a thread invokes a method , the jvm pushes a new frame onto the java stack of the thread . when the method completes , the jvm pops the frame for that method and discards it . the jvm does not have any registers for holding intermediate values ; any java instruction that requires or produces an intermediate value uses the stack for holding the intermediate values . in this manner , the java instruction set is well - defined for a variety of platform architectures . pc registers 368 are used to indicate the next instruction to be executed . each instantiated thread gets its own pc register ( program counter ) and java stack . if the thread is executing a jvm method , the value of the pc register indicates the next instruction to execute . if the thread is executing a native method , then the contents of the pc register are undefined . native method stacks 364 store the state of invocations of native methods . the state of native method invocations is stored in an implementation - dependent way in native method stacks , registers , or other implementation - dependent memory areas . in some jvm implementations , native method stacks 364 and java stacks 366 are combined . method area 370 contains class data while heap 372 contains all instantiated objects . the jvm specification strictly defines data types and operations . most jvms choose to have one method area and one heap , each of which are shared by all threads running inside the jvm . when the jvm loads a class file , it parses information about a type from the binary data contained in the class file . it places this type information into the method area . each time a class instance or array is created , the memory for the new object is allocated from heap 372 . jvm 350 includes an instruction that allocates memory space within the memory for heap 372 but includes no instruction for freeing that space within the memory . memory management 374 in the depicted example manages memory space within the memory allocated to heap 370 . memory management 374 may include a garbage collector which automatically reclaims memory used by objects that are no longer referenced . additionally , a garbage collector also may move objects to reduce heap fragmentation . the processes within the following figures provide an overall perspective of the many processes employed within the present invention : processes that provide a personnel motivation model . fig4 illustrates a meta model ( a model of the modeling element objects ) for the motivation model in accordance with one embodiment of the present invention . the core model is based on goals , motivations , incentives and job roles . a person ( in a role ) responds to incentives ( which may be applicable to many roles ) according to motivations that encourage or discourage achievement of goals . the motivation may be dependent on the characteristics of persons in the role , the incentive , and the goal . this basic model is extended by incorporating the influence of other persons ( e . g ., a manger ), values associated with membership in communities , and dependence on others to achieve supporting goals . these and related elements are described in some detail , in the following paragraphs . goaltype 402 . a goal type 402 specifies a goal that may apply to a number of roles . this provides a common point of definition so that the name and description are used consistently and need not be repeated . description 432 . a description 432 that expresses the nature of the goal . goal 408 . a goal 408 is a result to be achieved by a person performing in a particular role in the organization . goals 408 are not specific to individuals , but rather for all people in a role , i . e ., doing similar kinds of work in similar circumstances . these are goals perceived by persons in the role ; and the objective of modeling is to ensure that these persons have appropriate incentives to achieve goals that are aligned with enterprise goals 408 . the goal object 408 will capture the likelihood of success ( achievement ) 438 for the people in the associated role . a different role will require a different goal object 408 . a goal incorporates the name 430 and description 432 of its associated goaltype 402 and may have the following attributes . effort 436 . an indication of the level of effort required of the individual to achieve the goal . achievement 438 . an indication of the likelihood of success given the associated motivations . skillalignment 440 . the extent to which the individuals &# 39 ; skills are consistent with the requirements of achieving the goal . motivation 412 . motivation 412 captures the relevant information for the linkage between an incentive and a goal for an individual in the associated role . motivation 412 will describe how an incentive may encourage or discourage achievement of the goal 408 . it also describes how goal success is linked to the incentive , e . g ., the person may receive a reward if the goal is achieved , and the level of reward may be linked to the level of success . the following attributes may be used to describe the nature of the motivation . contribution 444 . an indication of the significance of the motivation with respect to the goal . this may be positive or negative . this factor will be a consequence of the significance of the incentive to the individual , and the attributes of the goal ( e . g ., the individual &# 39 ; s perception of the effort and opportunity for success ). resultlinkage 446 . the manner in which the incentive is linked to the achievement of the goal . relevance 448 . an indication of the relevance of the incentive to the associated goal . for example , if incentive pay is provided for producing a specified result , then the goal associated with achieving that result is the targeted goal . other motivation for achieving other goals may also be affected as side effects . incentive 422 . an incentive 422 is a factor that influences a person &# 39 ; s behavior . an incentive 422 may be of three forms , discussed below : personal incentive 424 , community value 420 and relationship incentive 406 . the associated motivations 412 define the effects of an incentive 422 in different goals . the attributes of incentives 422 are incorporated from the associated incentivetype 414 . incentivetype 414 . the same incentivetype 414 may apply to different roles in different ways and may be used to achieve different goals . the incentivetype 414 provides characteristics that are the same across different roles . a tool might provide a list of potential incentive types and enable the user to selectively insert incentives for a particular role . an incentivetype 414 has the following attributes : name 456 . a short name for reference and identification in displays . description 458 . a textual description of the nature of the incentive . threshold 460 . specification of a threshold for the incentive indicating that the incentive must exceed the threshold to be effective . role 416 . a role 416 defines a group of people that perform a particular function in a particular context within the organization . the job role may be very specific to an organizational unit , or it may describe many people doing similar jobs in different organizational units depending on the level of detail desired in the resulting model . a role 416 object may describe a job function of individual performers , or it may describe the responsibility of a manager . for a manager , the goals may be individual or may be associated with the organization the manager manages such that they become relationship goals for the manager &# 39 ; s subordinates . name 450 . a name for reference to the role . description 452 . a description of the nature of the role such as the job function or skill set of the persons in that role . population 454 . the number of persons in the role . a tool might provide automated mechanisms to help transform a general role into multiple , more specific roles when a more detailed analysis is desired . communityvalue 420 . a community value is an incentive experienced by members of a community or group of individuals . for example , a community of physicians may be influenced by their code of ethics . a community may have several relevant values . a person may be a member of multiple communities . a project team might also be considered a community . people in a particular role may include members and non - members of several communities . the associated motivation will define how these people will be encouraged or discouraged to achieve the associated goal as a result of their community membership . a community value 420 may have an associated “ strength ” attribute 466 : strength 466 . the strength of influence of the community value on members of the community . personalincentive 424 . a personal incentive 424 is an incentive that has a direct influence on the behavior of individuals in the associated role . for example , it includes salary and incentive pay . a personal incentive may have the following attribute in addition to those incorporated from its associated incentivetype 414 : cost 464 . the cost of the incentive to the enterprise . relationshipincentive 406 . this incentive 406 is the result of a relationship 404 with another person in a different role such as a supervisor , project leader or co - worker . relationships 404 might also be based on collaboration groups , or other disciplines of a team . the relationshipincentive 406 is linked to a goal of the related person which may or may not be aligned with goals of the subject person . these incentives are of interest where they have a particular impact on the behavior of the subject person and are not the same as a goal otherwise assigned to the subject person . this incentive 406 has the following attribute : influence 434 . an indication of the level of influence the related person has on the behavior of the subject person . membership 418 . membership links a role to a community . the membership link indicates the percentage of persons in the role who are members of the associated community . it has the following attribute : percentage 462 . the percent of the persons in the defined role that are members of the community . community 426 . a group with common values where the values may have an influence on the behavior of a member in a particular role . the community value becomes an incentive for the person in the role . since different persons in a role may be members of different communities , these values may cause different persons in a role to be more or less motivated to achieve certain goals . the community will include the following attributes : description 474 . a description of the distinguishing characteristics of members of the community and the nature of the community that may influence their behavior . dependence 410 . this link defines the association between a goal and a supporting goal associated with a different role . this will typically occur where a person in one role depends on others for support or to perform related tasks . thus the goals of a process performed by a person in one role may rely on sub - processes performed by others . criticality 442 . the criticality attribute identifies how critical the supporting goal is to the subject goal . this model provides a structure for analysis of goals , incentives and motivation . as described , the analysis is based on subjective values of incentives , measures of motivation and probability of success of goals . these may be refined through experience with the model . in addition , more quantitative and more objective measures may be developed through empirical studies of values , behavior and achievement of goals . the attributes on these model elements are a starting point to provide an understanding of the model . additional attributes may be added to provide additional insights for the analyst and to document the considerations that the analyst used in drawing particular conclusions . the model may be linked to an analysis of business processes and organization where the objectives of processes and organizations become goals in this analysis . fig5 illustrates one visual presentation of an abstraction of the motivation model ( i . e ., it does not include all of the potential information ) in accordance with one embodiment of the present invention . this tabular representation shows incentives 516 and 518 , goals 506 and motivations for a particular role 502 : “ application developers 504 .” three goal types 506 are represented : ( 1 ) adopt a new development process 508 , ( 2 ) minimize time to complete tasks 510 and ( 3 ) design for reuse 512 . each motivation , the intersection of a goal row 508 , 510 , and 512 and an incentive column ( columns beneath personal incentives 516 and relationship incentives 518 ), indicates the relevance of the incentive and the influence it has on the goal . in this example , motivations have been given values from 1 to 5 where 1 is strongly opposed , 2 is somewhat opposed , 3 is neutral , 4 is somewhat supportive and 5 is strongly supportive . motivations with a value of 3 have been left blank to highlight the others . the smaller box at each intersection indicates relevance , and the form varies depending on the category of column . there are three categories of incentives : personal incentives 516 , relationship incentives 518 and community values 520 ( three of the column groups ). the fourth group of columns 522 describes dependence on other roles and is discussed later . personal incentives 516 have a direct impact on the individual . a “ t ” indicates where an incentive is targeted for the goal . presenting a list of potential incentives provides the analyst with a checklist to consider motivations . the motivation is indicated in the matrix with a value of 1 to 5 ( blank for 3 ) where an impact is expected . the goal impact column indicates the overall impact on the goal . the illustration has used integer values for simplicity , but fractional values could be used or some other scale could be used . the incentive pay column illustrates an incentive that is targeted for the second goal but has an impact on the other goals . in this case , the incentive pay to minimize time to complete tasks has a negative effect on adopting a new development process and designing for reuse . similarly , the incentive to avoid work on personal time has a positive effect on minimizing time to complete tasks , but a negative effect on the other two goals that imply additional work . relationship incentives 518 are derived from relationships - in this case , relationships with a supervisor and a project manager . the supervisor incentive is only considered relevant to the second and third goals , but it is expected to influence the behavior of developers 80 % of the time for those goals . the project manager incentive applies to all three goals but is negative with respect to the first and third goals and positive with respect to the second . the project manager has less influence than the supervisor ( 60 %). some developers are considered to be members of one or both of the two communities . these communities have values that result in company loyalty as a potential incentive and job mobility as a potential disincentive . the associated percentages in the goal rows represent the proportion of the developers who are influenced by those views . the columns under “ dependence on supporting goals ” represent goals 522 to be achieved by other roles . within this group , the percentages indicate the level of dependence on the supporting goal , and the numeric values indicate the level of achievement of the supporting goal by the other role . thus the achievement of supporting goals can be factored into the achievement of the goals of the subject role . a modeling tool might enable the user to navigate from the supporting goal in this table to the associated table for the supporting role to gain an understanding of the incentives to achieve that goal . it might also provide a linkage from a goal of a role to the other roles that depend on achievement of that goal . considerably more information can be associated with these elements as indicated in the object model , presented earlier . this information might be presented in other views or made available through other techniques such as pop - up notes that appear when the cursor is moved over the associated element . a more sophisticated and potentially automated analysis could be performed with empirical values assigned to motivations and other factors , along with a computation for goal achievement 514 . the metrics might be developed from studies of employee attitudes and actual improved achievement of goals in response to incentives . one goal of the model is to provide a framework for analysis . to aid the patent office , and any readers of any patent issued on this application in interpreting the claims appended hereto , it is noted that applicant does not intend any of the appended claims to invoke paragraph 6 of 35 u . s . c . § 112 as it exists on the date of filing unless the words “ means for ” are used in the particular claim . furthermore , none of the description in the present application should be read as implying that any particular element , step , or function is an essential element which must be included in the claim scope : the scope of the patented subject matter is defined only by the allowed claims . thus , the extent of legal protection will be determined by the limitations recited in the allowed claims and their equivalents . unless explicitly recited , other aspects of the present invention as described in this specification do not limit the scope of the claims . as used herein , the terms “ comprises ”, “ comprising ”, or any other variation thereof , are intended to cover a non - exclusive inclusion , such that a process , method , article , or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process , method , article , or apparatus . further , no element described herein is required for the practice of the invention unless expressly described as “ essential ” or “ critical ”. it is important to note that while the present invention has been described in the context of a fully functioning data processing system , those of ordinary skill in the art will appreciate that the processes of the present invention are capable of being distributed in the form of a computer readable medium of instructions and a variety of forms and that the present invention applies equally regardless of the particular type of signal bearing media actually used to carry out the distribution . examples of computer readable media include recordable - type media such a floppy disc , a hard disk drive , a ram , and cd - roms and transmission - type media such as digital and analog communications links . the description of the present invention has been presented for purposes of illustration and description , but is not intended to be exhaustive or limited to the invention in the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art . the embodiment was chosen and described in order to best explain the principles of the invention , the practical application , and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated . | 6 |
fig1 - 8 illustrate a process for forming an embodiment of the present invention . as shown in fig1 , a probe contactor substrate 100 is chosen . because of the unique way in which the probe card assembly is fashioned , the probe contactor substrate 100 is not limited to materials generally used as probe contactor substrates , namely ltcc , htcc , ceramics with vias , or multi - layer hdi substrates . because the probe contactor substrate does not require electrical vias through the substrate , the substrate may be any suitable material . in an embodiment of the present invention the probe contactor substrate 100 is an alumina ceramic substrate . when used to test semiconductors , generally the probe contactor substrate should exhibit qualities such as good thermal expansion matching that of silicon ( because the device under test is usually silicon ), good surface quality ( low pitting , excellent planarity and surface roughness ), good electrical properties for high frequency signal transmission through conductors built on its surface ( implies the need for a low - loss dielectric substrate material ), good mechanical strength and processability ( ability to form holes or slots conveniently and to build wiring traces on the surface ). alumina ceramic ( 95 %- 99 % alumina ) is a preferred material as it meets the criteria , is inexpensive , and is readily available . however , other ceramic materials ( such as alumina nitride , or silicon nitride ) may also be used , as well as glass , dielectric coated metal ( for example anodized aluminum and paryline coated materials ), silicon ( such as an oxidized or dielectric coated silicon wafer ), kapton ( polyimide ) flex material , printed circuit board ( pcb ) material . upon the contactor substrate 100 , the mems structures 110 ( also referred to as the “ probe contactors ”) are built . these mems structures are contactors which are specifically built to withstand the stresses and environment of testing semiconductors . these structures may be torsional spring contactors as described by u . s . pat . no . 6 , 771 , 084 to distefano or u . s . patent application ser . nos . 11 / 019 , 912 , 11 / 102 , 982 , 11 / 194 , 801 , and 11 / 194 , 720 , all of which are assigned to touchdown technologies , inc ., and the disclosures of which are hereby incorporated by reference . the contactors 10 may also be of the cantilever type contactor such as those produced by form factor , inc . and others . the contactors may also be inflexible type contactors ( for example see u . s . pat . no . 6 , 891 , 360 assigned to ibm ) which are often used in testing bumped wafers . the contactors 110 may be assembled to the contactor substrate 100 , or they may be built directly on the contactor substrate as described in u . s . patent application ser . nos . 11 / 019 , 912 and 11 / 102 , 982 . when contactors 110 are built directly on the contactor substrate 100 , in accordance with the above mentioned applications , they are often built using processes which involve sacrificial metal and removable photoresist . this combination of substances ( a solution ) is denoted by reference figure 120 . the base of the probe contactor 110 is usually connected via a metal trace to a terminal 320 on the probe contactor substrate 100 as can be seen in fig9 and 10 . this allows for the tips of the probe contactors to have a finer pitch , while allowing the elements to which the probe contactors are electrically connected to have a larger pitch and provides the electrical path to the vias or substrate terminals . any technique commonly know in the art may be used to form the trace and the terminal including thick film printing , thin film deposition , etching , and plating . if the probe contactor substrate 100 is polyimide flex ( or some other flex such as liquid crystal polymer ) or pcb material , then the techniques commonly used in relevant printed wiring board manufacturing may be employed , including so - called “ additive ” processes where traces and terminals are electroplated up on a thin laminated metal seed layer , and “ subtractive ” processes where a laminated metal layer is etched to produce the trace and terminal . in one embodiment , after the contactors 110 are formed on the contactor substrate 100 , the backside of the contactor substrate is then machined and planarized down to its desired thickness as shown in fig2 . for example , in the case of a contactor substrate 100 which is made from alumina , the substrate may be machined and planarized to a thickness of 6 mils - 80 mils ( approximately 0 . 15 mm - 2 . 0 mm ). after the contactor substrate 100 has been machined and planarized , troughs 130 may be etched away between the islands 140 of probe contactors 110 as shown in fig3 , usually using a process of photo patterning and then etching . ( alternately , the entire sacrificial material 120 may be etched away and replaced with a material ( such as a thermoplastic or wax potting compound ) that can be easily laser cut and later removed ( still indicated by 120 ). in still yet another embodiment , the entire sacrificial material 120 may be removed , and not replaced with another material . in both alternative forms , the troughs 130 are not formed , and the process proceeds directly to the next step of forming the slots 150 as shown in fig4 ). the process of forming the present invention , up to this point , may be alternatively accomplished by the method shown in fig1 - 16 , without departing from the spirit of the invention . in fig1 , the substrate 100 which has already been planarized to its desired thickness is bonded to a sacrificial substrate 1400 using a solder , thermoplastic or other suitable material 1410 prior to building the probe contactors on the contactor substrate . for example , a contactor substrate 100 formed of planarized 1 mm alumina may be soldered to a 5 mm thick alumina sacrificial substrate 1400 using a flux - less solder 1410 such as 90 / 10 sn — au ( 217 c ). the primary purpose in utilizing a sacrificial substrate 1400 is to add strength to the probe contactor substrate 100 during the lithographic processes of building the probe contactors 110 . the probe contactors 110 are then built onto the probe contactor substrate 100 as shown in fig1 . after the probe contactors 110 have been built onto the substrate 100 , the troughs 130 are etched away between the islands 140 of the probe contacts 110 as above ( fig1 ). the sacrificial substrate 1400 may then be removed , resulting in the same structure as fig3 . through the troughs 130 , slots 150 are formed in the contactor substrate 100 , as shown in fig4 ( these slots 150 may be vertical slots 1110 , horizontal slots 1120 , or holes 1100 as shown in fig1 ). the slots allow the probe contactor substrate 100 to remain a single substrate , as opposed to several individual substrates which will need to be individually assembled to the space transformer 300 in a manner that maintains very close tolerance alignment between the individual probe contactor substrates . these slots 150 will be used to connect the terminals 320 on the probe contactor substrate 100 to bond pads 330 on the space transformer 300 . these slots 150 are preferably laser drilled if the contactor substrate 100 is ceramic . alternatively the slots 150 may be formed by abrasive jet processing , mechanical drilling using machine tools , or green formed by punching or drilling prior to firing as known in the art . if the substrate 100 is silicon , the slots 150 maybe formed by chemical etching ( wet chemical or xenon difluoride as is commonly practiced in the art of silicon micromachining ) or plasma etching . if the substrate 100 is metal , the slots 150 may be drilled by mechanical means , by chemical etching , by electric discharge machining ( edm ) or any other suitable machining technique . once the slots 150 have been formed , the probe contactors 110 may be released from their sacrificial support 120 , as shown in fig5 . ( alternatively , the probe contactor springs could be individually attached , or bonded in groups to the probe contactor substrate ( as is done by mjc and form factor respectively ), i . e ., the probe contactor springs are not built directly on the probe contactor substrate itself as taught above . in this case , the slots 150 could be cut either before or after the springs are attached to the substrate , but the remainder of the process flow would be unchanged ). the dimensions of the slots are determined by the probe layout , and a width of approximately 0 . 5 mm to 2 mm may be optimal for many applications . the actual width of the slots will be determined by several factors including substrate thickness , bond technique employed , and dut arrangement . accordingly , the actual slot width could fall outside of the above range without falling outside the scope of the invention . in another embodiment ( not shown ), the probe contactors 110 may be built on a contactor substrate 100 which has pre - drilled slots 150 which have been filled with a sacrificial material , preferably the same sacrificial metal in the solution 120 which is used when forming the probe contactors 110 . when the probe contactors 110 are released from their solution 120 of sacrificial metal and photoresist , the sacrificial metal which has was used to fill the pre - drilled slots 150 is also removed , resulting in the structure shown in fig5 . the formation of the remainder of the probe card assembly is the same as the other embodiments . while the process of forming the probe head is ongoing ( that is , attaching the probe contactors 110 to the substrate 100 , forming the troughs 130 , the slots 150 , and releasing the probe contactors ), the space transformer 300 may also be formed , as shown in fig6 . by forming both the space transformer and the probe head at the same time ( in parallel ), the time required to form the probe head and hence the probe card assembly can be significantly decreased . for example in at least one prior art example , the space transformer is formed first , requiring approximately 21 days . once the space transformer is formed , the probes are fabricated on top of the space transformer requiring approximately another 21 days or more ( see fig1 ). however , in the present invention , by decoupling the space transformer and the probe contactor substrate , the space transformer and the probe contactor substrate may be formed at the same time ( see fig1 ). this manufacturing process can reduce the time required to manufacture the entire probe card assembly by as much as 50 %. the space transformer 300 may be a printed wiring board or an interconnect substrate . it is preferably a ceramic wiring board such as a low temperature co - fired ceramic ( ltcc ) or a high temperature co - fired ceramic ( htcc ) board as these materials are well thermally matched to ceramic and silicon in terms of thermal expansion coefficient . other options include organic wiring substrates , pcb substrates , flex substrates , etc . the space transformer material is selected primarily for multi - layer wiring capability , cost , and manufacturability without undue regard to surface finish , surface integrity or compatibility with mems processes . such a material is dupont 951 , dupont 943 , or ltcc tape . forming the space transformer often involves the production of multilayer circuits from ceramic substrate tapes or sheets . via holes are punched in the substrates , the via holes are filled with conductive paste , and conductive , dielectric , and resistive pastes are optionally applied in wiring patterns on the surface of each sheet or tape as needed , and then the sheets are laminated - together and fired ( often in a precisely controlled oven or kiln ) in one step . the resulting product is a monolithic space transformer or multi - layer wiring board structure . a typical ltcc space transformer consists of multiple dielectric layers ; screen - printed or photo - imaged low - loss conductors ; embedded inductors , resistors and capacitors ; and vias for interconnecting the multiple layers . a multi - layer wiring board ( which an ltcc space transformer is , may also have impedance control and crosstalk shielding measures such as strip lines and coplanar waveguides . additionally , multiple layers may form a wiring network within the substrate connecting one bond pad 330 to another bond pad ( or multiple bond pads ). the space transformer may also include ground planes and power planes as is known in the art . electronic components such as capacitors , active switches or integrated circuits may be attached on either surface of the space transformer or in pockets formed in the space transformer circuit ( as is commonly known in the art of electronic packaging using ceramic wiring substrates ). each layer can be inspected before lamination and firing to allow opportunity to replace damaged circuits and improve yield . since the ceramic materials used in ltcc designs are inherently very temperature stable , the need to compensate for variations in temperature is greatly reduced . as shown in fig6 , the top of the space transformer includes bond pads 330 . the bond pads may be formed directly on an electrical via 340 that conducts the electrical signal through the space transformer 300 , from the top to the bottom , or alternatively , the bond pad 330 may be formed over the space transformer &# 39 ; s surface and connected to the via 340 by a metal trace ( not shown ). the bond pads 330 are located on the space transformer in positions that align to the slots 150 formed in the contactor substrate 100 as shown in fig7 . the bond pad 330 is preferably a wire bondable pad such as a gold thick film material or electroplated gold . other options include aluminum or any other conductive bondable bond pad suitable for wire bonding or conductive adhesive bonding . after the space transformer 300 and the probe contactor substrate 100 are joined together , the bond pads 330 are electrically connected to the terminals 320 by a bond interconnect 400 as shown in fig8 . the bond interconnect 400 may be any number of interconnects that electrically connect the terminals 320 to the bond pads 330 . fig1 illustrates several bond interconnects 400 . in one embodiment , the bond interconnect 400 is a gold wire that has been attached using the thermosonic ball bonding technique in which a gold wire ball bonder 411 is used to attach a gold wire 412 from a bond pad 330 to a terminal 320 through the slot 150 . the gold ball 411 may be placed on either the terminal or the bond pad , but it is preferably placed on the bond pad 330 as this will minimize the height of the gold wire 412 above the surface of the contactor substrate 100 . the gold wire &# 39 ; s height ( often formed with a slight loop ) must be below the tip of the probe contactor 110 so as to avoid shorting to the dut during use . one end of the gold wire 412 is attached to the gold ball 410 , while the other end of the wire , often called the “ heel ”) is attached to the terminal 320 . in another embodiment , the terminal and the bond pad are attached by a wedge bonded wire . in wedge bonding , there is no ball . instead , the wire 412 ( typically aluminum but gold is also often used ) is bonded directly to the terminal 320 and the bond pad 330 . in still another embodiment , an adhesive or solder paste 431 is used to connect the terminal 320 and the bond pad 330 . in the adhesive embodiment , the adhesive is cured to fix the connection . in the solder embodiment , the entire assembly is heated to the solder reflow temperature and the solder is applied . the entire assembly is then cooled , and cleaned to remove residual flux if necessary . the bottom surface of the space transformer 300 is adapted for connection to a probe card or pcb or another interposer / space transformer depending on design requirements . accordingly , the bottom surface of the space transformer 300 has electrical terminals 350 ( as shown in fig9 ) which may be wire bondable , bumpable , adapted for contact by spring interconnects such as those manufactured by form factor , inc . known as microsprings ™ or spring pins made by everett charles corp . under the trade name pogopin ™, or adapted for connection to a lateral interposer as disclosed in u . s . patent application ser . no . 11 / 226 , 568 , assigned to touchdown technologies , inc ., the disclosure of which is incorporated by reference . some probe card architectures employ an interposer 1700 between the wiring board and the probe head ( 100 , 300 ) that imparts a very small force on the probe head ( 100 , 300 ). in this architecture , it is desirable to have a probe head with tight planarity . in such cases it is required that the attachment structure 200 is compliant to absorb any expansion differences in the probe contactor substrate 100 and the space transformer substrate 300 so that the probe head ( 100 , 300 ) planarity does not change with operating temperature . preferably , the probe contactor substrate 100 and the space transformer substrate 300 are joined together by an attachment structure 200 such as a compliant adhesive chosen with suitable modulus to account for the thermal mismatch between the space transformer 300 and probe contactor substrate 100 . some suitable options for such an attachment structure 200 may include adhesive polymers such as silicone , elastomers , polyimides , bcb ( benzo - cyclo - butene ), or hard materials such as solder . thermally compliant mechanical attachments between the space transformer 300 and the probe contactor substrate 100 , such as screws and clips , are also possible . if adhesive is used , it can be dispensed in place , screen printed , or any other means commonly known in the art . b - stage preform may also be used . if solder is used , it may be screen printed as a paste , applied as a preform , or it may be deposited ( evaporated or electroplated ) prior to reflow ( melting to attach the space transformer 300 and the probe contactor substrate 100 ). if adhesives are used , the elastic modulus of the adhesive , the dispense pattern and coverage area and the adhesive bond line thickness can be engineered to absorb any thermal expansion mismatch between the space transformer substrate 300 and the contactor substrate 100 . without such expansion absorption , the probe head ( 100 , 300 ) could have a thermally sensitive curvature . this thermal mismatch curvature effect must be considered regardless of the attachment method used . spacers ( not shown ) may be formed between the probe substrate 100 and the space transformer 300 in order to accurately control the adhesive bond line thickness if adhesive is used as the attachment structure 200 . the spacers are preferably electroplated on the top surface of the space transformer . once attached to the space transformer , the spacers can be machined so that their top surfaces lie in a plane . this machining operation guarantees that the bottom of the probe substrate has a flat planar surface to bond against , thus ensuring that the probe tips lie in a plane even when the surface of the space transformer is imperfect and not flat . alternately , the spacers can be applied to the bottom of the probe substrate . other probe card architectures employ an interposer that imparts a substantial force between the pcb and the probe head ( 100 , 300 ). this results in a planarity of the probe head ( 100 , 300 ) that is not optimal as shown in fig1 . manufactures must thus find other ways to restore the planarity of the probe head ( 100 , 300 ) when such an interposer 1700 is used . one such method is to bond support posts to the backside of probe head and pull the probe head into planarity as described by a patent publication number 20080007281 , “ method of forming a probe card assembly ,” issued to touchdown technologies , inc . another method of attaining planarity in an architecture employing a net force interposer , is to utilize a “ pre - bowed ” probe head ( 100 , 300 ) as described below as part of the present invention . using a “ pre - bowed ” probe head restores the planarity of the probe head ( 100 , 300 ) after it has been assembled to a net - force interposer 1700 . one method to induce a “ pre - bow ” on the probe head ( 100 , 300 ) is to select a probe contactor substrate 100 with a higher coefficient of thermal expansion ( c . t . e ) than the space transformer substrate 300 , and to rigidly bond the space transformer substrate 300 to the probe contactor substrate 100 using solder , epoxy , etc at a temperature higher than the probe head operating temperature , as shown in fig1 . several variables such as modulus of adhesive , bond area , bond - line thickness , bonding temperature , modulus of the probe contactor substrate 100 , the c . t . e . of probe contactor substrate 100 and the space transformer 300 , can be optimized to tune in the desired pre - bow . it is important to note that the probe head pre - bow in the un - assembled state induced by this method keeps changing with temperature . since the probe card ( 100 , 300 ) is usually specified to operate in a wide temperature range , it is necessary that the bonding conditions are chosen to balance the interposer 1700 force at the probe card &# 39 ; s highest operating temperature and then a rigid pin used on the backside of the probe head ( 100 , 300 ) provides rigidity to the assembly . this will result in a pre - bowed probe head ( 100 , 300 ) which will balance out the net force of the interposer 1700 , as shown in fig1 . another embodiment of this invention includes attaching multiple space transformer substrates 300 to a single probe contactor substrate 100 , or vice - versa , to meet the complex size and planarity requirements of advanced probe heads . fig2 illustrates a plurality of space transformer substrates 300 attached to a monolithic probe contactor substrate 100 . one of the common prior art methods to build a probe card ( 100 , 300 ) with large probing area is to tile individual probe - heads ( a plurality of single probe contactor substrates 100 attached to a plurality of single space transformer substrates 300 on 1 to 1 ratio ) by mechanical means . however this approach is complex given the probe card spec and the high number of degrees of freedom in tiling . tiling can be made simpler if one of the two , probe contactor 100 or space transformer substrates 300 is monolithic since it reduces the degrees of freedom considerably . in one embodiment where a monolithic probe contactor substrate 100 is chosen , the space transformer tiles 300 can be directly attached to the backside of the probe contactor substrate 100 in such a way that the interconnect pads on the two substrates align to each other for interconnections ( not shown ). in another embodiment , as shown in fig2 , the probe contactor substrate 100 can be mounted on a mechanically rigid frame 2000 in which the space transformer tiles 300 are assembled . in this case the frame 2000 provides the added rigidity for the probe head ( 100 , 300 ), which facilitates another way of negating the interposer 1700 forces on the probe head ( 100 , 300 ). the number of space transformer tiles 300 can be as few as two and as many as dozens . the number space transformer tiles 300 is often dictated by the electrical interconnect specifications in the space transformer to meet the probe card design requirements . in another embodiment the space transformer tiles 300 can be bonded together using adhesives such as epoxies , polyimide , etc or also by brazing or soldering if the space transformer material permits . it may be favorable to tile with polyimide if the space transformer 300 material is organic . if the space transformer 300 material is low temperature co - fired ceramic or high temperature co - fired ceramic it may be favorable to tile with the parent material slurry paste and fire again to bond them together . in such a case a monolithic space transformer substrate 300 can be realized . in yet another embodiment where a monolithic slotted probe - contactor substrate 100 ( as discussed above utilizing slots 150 ) is used , the space transformer substrates 300 or tiles can be directly assembled or flip chip bonded onto the printed circuit board and then the probe contactor substrate 100 bonded or attached on top of the tiles . mechanical frame or supports can be used to rigidize the probe contactor substrate so there is no flexing of the substrate during probe card touchdowns . in another embodiment where a monolithic space transformer substrate 300 is used , probe contactor substrates 100 or tiles that already have slots 150 in them can be assembled onto it . alignment in the x , y directions and theta can be accomplished with optical alignment tools . alignment in z direction can be accomplished by controlling the parallelism and thickness of the probe contactor tiles as described in u . s . pat . no . 7 , 180 , 316 owned by touchdown technologies , inc . in another embodiment the space transformer 300 is integrated into the pcb 2100 , using high density intercominect ( hdi ), as shown in fig2 . the hdi technology is adapted to function as both the interposer and the space transformer . a monolithic ( or tiled ) probe contactor substrate 100 is attached to the mechanical frame 2000 , and the bond interconnects 400 are formed directly to the integrated pcb / hdi space transformer 300 . while particular elements , embodiments , and applications of the present invention have been shown and described , it is understood that the invention is not limited thereto since modifications may be made by those skilled in the art ; particularly in light of the foregoing teaching . it is therefore contemplated by the appended claims to cover such modifications and incorporate those features which come within the spirit and scope of the invention . | 6 |
the following examples are given to illustrate the method and the formulations of the present invention , but are not to be construed as limiting : strawberry spread or filling made with cholestyramine to simulate the seedy character of strawberries the product is a mobile gel of the consistency of a heavy jam or the filling of a chocolate - covered candy , and its viscosity and degree of solidity can be readily controlled by varying the amount of water ( or natural or artificial fruit juice which may be substituted therefor ) employed . this strawberry composition can be used as a filling for candies , e . g ., chocolate strawberry creams , or other confections , or as a spread for crackers , breads , and the like . although presentation of the gritty drug formulation of the present invention can take many forms , one edible confectionary type of presentation is illustrated in fig1 - 3 . a thin shell of melted milk chocolate a is applied to an appropriately - shaped mold and allowed to solidify . the cavity of the milk chocolate shell in the mold is filled to capacity with the semi - solid gritty drug formulation b of the present invention . the bottom of the chocolate shell and its drug contents are sealed with a further portion of the melted milk chocolate shell a , which is also allowed to solidify . the milk chocolate shell a filled with gritty drug formulation b is then released from the mold , and said drug formulation is now presented in a readily - comestible form . this is but one example of many creative and palatable ways in which the drug formulations of this invention can be presented for pleasing and tolerable human consumption . other forms of presentation of the cholestyramine formulation of example 1 include cookies , pies , cakes , tarts , and other confections , or as a spread for crackers , bread , cookies , cakes , and the like . it can likewise be incorporated into a seedy fibrous fruit jam , preserve , or the like , and it may ultimately be packaged in bottles , jars , cans , foil or plastic pouches , cups , tubs , or other suitable containers . one particularly suitable form of packaging of the formulation of the invention is in plastic pouches in the form of a pudding or pie filling mix , which if desired can readily be incorporated into a pie crust in the usual manner now employed for the production of pies from prepared pie crust mixes or prepared pie crust &# 34 ; ready mades &# 34 ;, the ultimate product in any case being palatable , tolerable , pleasing to the taste , and totally acceptable as an innocuous and superior manner of administering the otherwise objectionable and gritty drug cholestyramine . each of the candies of the figs contains approximately 1000 to 1500 milligrams of the drug cholestyramine , so that an acceptable daily dose involves the ingestion of three ( 3 ) of the cholestyramine candies prepared as in the foregoing , three ( 3 ) times a day . higher or lower concentrations of drug may be incorporated into each unit or piece of candy or the like , so that , e . g ., even a single piece or three ( 3 ) pieces constitute a minimum daily dose or as many as , e . g ., twelve ( 12 ) pieces or units constitute a minimum daily dose of drug . this provides a totally satisfactory daily dosage of the gritty drug cholestyramine , but presented in a pleasing , palatable , and taste - acceptable form , thus making it easier for the patient to comply with the dosage regimens already well established for the effectiveness of the drug . when presented in the chocolate - coated candy form more fully described in the foregoing and in the drawings , each candy unit can if desired be designed to contain all , but preferably between one third ( 1 / 3 ) and one twelfth ( 1 / 12 ) of the daily dosage regimen for the drug , thereby enabling a patient to comply with the required or suggested daily dosage regimen by ingesting a single one or between about three and about twelve of the candy units per day , usually divided into one or more , but usually three or four , individual or unit dosages which , as the drug is now constituted , may be more properly referred to as one or three or four pleasurable taste experiences . similarly , when packaged in the form of jams , pie fillings , or the like , to name a few , it is a simple matter to calculate and designate the drug content of the formulation of the present invention , however presented in whatever form and however packaged , so that compliance of the patient with the minimum daily dosage requirements for full effectiveness of the drug is readily observed and maintained . the practice of example 1 is repeated with gritty drugs other than cholestyramine . in the case of colestipol , divistyramine , or polidexide , the product is equally useful and useful for the same purpose as the cholestyramine - containing products of example 1 . the practice of example 1 is repeated using , instead of the gritty drug cholestyramine , antacids or mineral supplements such as calcium carbonate , or a bulk laxative such as psyllium hydrocolloid . in each case , the product is found to be acceptable , palatable , and pleasing to the taste , and entirely suitable as a manner of administering the otherwise objectionable gritty drug . the practice of example 1 , 2 , or 3 is repeated using other seedy fruits of table 1 and corresponding fruit flavors with equally satisfactory results . the practice of example 1 , 2 , 3 , or 4 is repeated using other gelling agents of table 2 with equally satisfactory results . the practice of any of the previous examples is repeated using only the gritty drug plus the gritty fibrous fruit as components of the composition . although this presents a definite improvement as to taste and acceptability , inclusion of the gelling agent and the aqueous medium or a fruit juice corresponding to the fruit employed adds much to the elegance of the taste sensation and acceptability . finally , addition of a touch of sweetener and flavor corresponding to the fruit employed , or sometimes citric acid for tartness , optimizes the psychological effect and heightens the taste sensation even further . table 1______________________________________non - comprehensive , non - inclusive list ofseedy fruits for which cholestyraminecan be used to simulate seedy compositions seedy fruit______________________________________ strawberry raspberry blackberry boysenberry loganberry dewberry gooseberry cranberry mulberry elderberry blueberry fig currant kiwi______________________________________ table 2______________________________________non - comprehensive , non - inclusive list - of gelling agents useful incholestyramine seedy fruit compositions gelling agent______________________________________ pectin guar gum xanthan gum gum arabic gum acacia locust bean gum carageenan alginic acid psyllium hydrocolloid oat bran gum rice bran gum glucomannan tragacanth gum karaya gum tapioca corn starch cellulose gums agar gelatin______________________________________ it is therefore seen that the present invention provides a novel good - tasting gritty drug formulation , which may be presented in many acceptable ways , and packaged in any suitable manner , as well as a method for the preparation and use of such palatable and good - tasting drug formulations , all having the unpredictable and highly advantageous characteristics and effects as more fully set forth in the foregoing , and whereby all of the objectives of the present invention are attained . it is to be understood that the invention is not to be limited to the exact details of operation , or to the exact compositions , methods , procedures , or embodiments shown and described , as obvious modifications and equivalents will be apparent to one skilled in the art , and the invention is therefore to be limited only by the full scope which can be legally accorded to the appended claims . | 8 |
embodiments of the present invention are described in detail below with reference to the drawings . fig1 is a central sectional view of a digital single - lens reflex camera body ( hereinafter referred to as camera ) 100 according to one embodiment of the present invention and an interchangeable lens 50 as an image pickup apparatus . the interchangeable lens 50 is detachably fixed on the camera 100 with a mount section 210 in the camera 100 and a mount section 51 in the interchangeable lens 50 . when the interchangeable lens 50 is attached to the camera 100 , a contact section 220 in the camera 100 and a contact section 52 in the interchangeable lens 50 are electrically connected to each other . a light flux that has passed through focus lenses 53 in the interchangeable lens 50 enters a main mirror 130 in the camera 100 . the main mirror 130 is held on a main mirror holding frame 131 and is supported by a rotating shaft section 131 a so as to be able to pivot between a mirror upper position and a mirror lower position . the main mirror 130 is a semitransparent mirror . a light flux that has passed through the main mirror 130 is reflected downward by a sub mirror 140 and is guided to a focus detecting unit 150 . the sub mirror 140 is held on a sub mirror holding frame 141 . the sub mirror holding frame 141 is supported by a hinge shaft ( not illustrated ) so as to be able to pivot with respect to the main mirror holding frame 131 . the focus detecting unit 150 is configured to detect the amount of defocusing of the focus lenses 53 and calculate the amount of driving of the focus lenses 53 for achieving focus for the focus lenses 53 . the interchangeable lens 50 is configured to receive the calculated amount of driving through the contact sections 220 and 52 . the interchangeable lens 50 is configured to adjust the focus by controlling a motor ( not illustrated ) and driving the focus lenses 53 on the basis of the received amount of driving . a light flux reflected by the main mirror 130 is guided to an optical viewfinder 160 . the optical viewfinder 160 includes a focusing plate 170 , a pentaprism 180 , and an eyepiece 190 . the light flux guided to the optical viewfinder 160 forms an object image on the focusing plate 170 . a user can observe the object image on the focusing plate 170 through the pentaprism 180 and the eyepiece 190 . a shutter unit 20 is arranged behind the sub mirror 140 . an optical low - pass filter 21 , an image pickup element holder 22 , an image pickup element 23 , a cover member 24 , and a rubber member 25 are arranged behind the shutter unit 20 . in shooting , a light flux that has passed through the optical low - pass filter 21 enters the image pickup element 23 . the image pickup element holder 22 is fixed to the housing of the camera 100 with a screw ( not illustrated ). the image pickup element 23 is held by the image pickup element holder 22 . the cover member 24 protects the image pickup element 23 . the rubber member 25 holds the optical low - pass filter 21 and hermetically seals the gap between the optical low - pass filter 21 and the image pickup element 23 . a display monitor 26 may be a liquid crystal display monitor and is configured to display a shot image and display various setting statuses of the camera 100 . fig1 a and 1b are illustrations for describing the shutter unit 20 as a shutter according to one embodiment of the present invention . fig1 a is an exploded perspective view for describing a configuration of the shutter unit 20 . fig1 b is an exploded perspective view illustrating the shutter unit 20 further disassembled from the state illustrated in fig1 a . as illustrated in fig1 a , the shutter unit 20 is driven by a first motor ma and a second motor mb . the first motor ma is connected to a driving circuit 14 a . the second motor mb is connected to a driving circuit 14 b . the driving circuit 14 a and the driving circuit 14 b are connected to a control circuit 13 . in the present embodiment , the first motor ma and the second motor mb are the same motors . a pinion gear 101 is press - fit to the output shaft of the first motor ma . a pinion gear 111 is press - fit to the output shaft of the second motor mb . the first motor ma is mounted to a motor mounting plate 102 . the motor mounting plate 102 is fixed to a cover plate 103 . the second motor mb is mounted to a motor mounting plate 112 . the motor mounting plate 112 is fixed to a cover plate 113 . a driving mechanism accommodating section 104 accommodates a first rotor plate 107 to which a weight 106 is bonded and a second rotor plate 117 to which a weight 116 is bonded . the first rotor plate 107 includes a protruding section 107 a . when the cover plate 103 is mounted on the driving mechanism accommodating section 104 , the protruding section 107 a is exposed through the cover plate 103 . the second rotor plate 117 includes a protruding section 117 a . when the cover plate 113 is mounted on the driving mechanism accommodating section 104 , the protruding section 117 a is exposed through the cover plate 113 . a first spring 108 is mounted to the cover plate 103 . a second spring 118 is mounted to the cover plate 113 . the first rotor plate 107 includes a gear section 107 b . when the motor mounting plate 102 is fixed on the cover plate 103 , the pinion gear 101 and the gear section 107 b engage with each other . the second rotor plate 117 includes a gear section 117 b . when the motor mounting plate 112 is fixed on the cover plate 113 , the pinion gear 111 and the gear section 117 b engage each other . accordingly , when the first motor ma is driven , the first rotor plate 107 rotates ; when the second motor mb is driven , the second rotor plate 117 rotates . a blade accommodating section 105 has an aperture 105 a . the blade accommodating section 105 accommodates a first blade 110 and a second blade 120 . as illustrated in fig1 b , a driving arm 110 a is mounted to the first blade 110 . a driving arm 120 a is mounted to the second blade 120 . a first driving lever 109 and a second driving lever 119 are supported on the driving mechanism accommodating section 104 . the first driving lever 109 includes a cam pin 109 a and an engagement pin 109 b . the cam pin 109 a engages with a cam groove 107 c in the first rotor plate 107 . the engagement pin 109 b engages with the driving arm 110 a . when the first driving lever 109 pivots , the first blade 110 opens or closes the aperture 105 a . similarly , the second driving lever 119 includes a cam pin 119 a and an engagement pin 119 b . the cam pin 119 a engages with a cam groove 117 c in the second rotor plate 117 . the engagement pin 119 b engages with the driving arm 120 a . when the second driving lever 119 pivots , the second blade 120 opens or closes the aperture 105 a . in the present embodiment , the first driving lever 109 and the second driving lever 119 are the same components . the driving mechanism accommodating section 104 includes a shaft section 104 a and a shaft section 104 b . the first rotor plate 107 is supported by the shaft section 104 a . the second rotor plate 117 is supported by the shaft section 104 b . the first rotor plate 107 includes the gear section 107 b on its front surface . the weight 106 is bonded and fixed to the circumferential section of the first rotor plate 107 . the first rotor plate 107 includes the cam groove 107 c , with which the cam pin 109 a engages , in its back surface . similarly , the second rotor plate 117 includes the gear section 117 b on its front surface . the weight 116 is bonded and fixed to the circumferential section of the second rotor plate 117 . the second rotor plate 117 includes the cam groove 117 c , with which the cam pin 119 a engages , in its back surface . in the present embodiment , the first rotor plate 107 and the second rotor plate 117 are the same components . the weight 106 and the weight 116 are the same components . each of the first rotor plate 107 and the second rotor plate 117 functions as a driven member . the first blade 110 and the first driving lever 109 function as a light shielding member capable of moving between a closed state where they closes the aperture 105 a and an open state where they opens the aperture 105 a in coordination with driving the first rotor plate 107 . the second blade 120 and the second driving lever 119 function as a light shielding member capable of moving between a closed state where they closes the aperture 105 a and an open state where they opens the aperture 105 a in coordination with driving the second rotor plate 117 . each of the first spring 108 and the second spring 118 functions as an urging member . fig2 is an illustration of the first rotor plate 107 ( second rotor plate 117 ) as seen from the back surface side . the cam groove 107 c ( cam groove 117 c ), with which the cam pin 109 a ( cam pin 119 a ) engages , are disposed in the back surface of the first rotor plate 107 ( second rotor plate 117 ). as illustrated in fig2 , a first idle running driving region a , an exposure driving region b , and a second idle running driving region c are set in the cam groove 107 c ( cam groove 117 c ). in the first idle running driving region a and the second idle running driving region c in the cam groove 107 c ( cam groove 117 c ), the cam lift is substantially zero . when the cam pin 109 a ( cam pin 119 a ) follows the first idle running driving region a or the second idle running driving region c , the first driving lever 109 ( second driving lever 119 ) does not rotate and the first blade 110 ( second blade 120 ) remains in a closed state or an open state . when the cam pin 109 a ( cam pin 119 a ) follows the exposure driving region b , the first driving lever 109 ( second driving lever 119 ) rotates and the first blade 110 ( second blade 120 ) moves from the closed state to the open state or from the open state to the closed state . when the first rotor plate 107 ( second rotor plate 117 ) rotates clockwise , the cam pin 109 a ( cam pin 119 a ) follows the first idle running driving region a , the exposure driving region b , and the second idle running driving region c in this order . the details of the clockwise rotation of the first rotor plate 107 ( second rotor plate 117 ) are described below . the first idle running driving region a is a first cam region . the zone where the cam pin 109 a ( cam pin 119 a ) follows the first idle running driving region a is a first zone . the exposure driving region b is a second cam region . the zone where the cam pin 109 a ( cam pin 119 a ) follows the exposure driving region b is a second zone . the second idle running driving region c is a third cam region . the zone where the cam pin 109 a ( cam pin 119 a ) follows the second idle running driving region c is a third zone . in contrast , when the first rotor plate 107 ( second rotor plate 117 ) rotates counterclockwise , the cam pin 109 a ( cam pin 119 a ) follows the second idle running driving region c , the exposure driving region b , and the first idle running driving region a in this order . the details of the counterclockwise rotation of the first rotor plate 107 ( second rotor plate 117 ) are described below . the second idle running driving region c is the first cam region . the zone where the cam pin 109 a ( cam pin 119 a ) follows the second idle running driving region c is the first zone . the exposure driving region b is the second cam region . the zone where the cam pin 109 a ( cam pin 119 a ) follows the exposure driving region b is the second zone . the first idle running driving region a is the third cam region . the zone where the cam pin 109 a ( cam pin 119 a ) follows the first idle running driving region a is the third zone . that is , the first rotor plate 107 ( second rotor plate 117 ) is driven in one direction , and thus the first rotor plate 107 ( second rotor plate 117 ) is driven in the first zone . after the first rotor plate 107 ( second rotor plate 117 ) is driven in the first zone , the first rotor plate 107 ( second rotor plate 117 ) is driven in the second zone . as illustrated in fig1 b , the cover plate 103 is provided with a hollow shaft section 103 a . when the cover plate 103 is mounted on the driving mechanism accommodating section 104 , the protruding section 107 a in the first rotor plate 107 is exposed through the cover plate 103 and the shaft section 104 a is fit into an inner section of the hollow shaft section 103 a . the first spring 108 is mounted on an outer section of the hollow shaft section 103 a . similarly , the cover plate 113 is provided with a hollow shaft section 113 a . when the cover plate 113 is mounted on the driving mechanism accommodating section 104 , the protruding section 117 a in the second rotor plate 117 is exposed through the cover plate 113 and the shaft section 104 b is fit into an inner section of the hollow shaft section 113 a . the second spring 118 is mounted on an outer section of the hollow shaft section 113 a . when the motor mounting plate 102 with the first motor ma mounted thereon is mounted on the cover plate 103 , the output shaft of the first motor ma penetrates through an opening in the cover plate 103 , and the pinion gear 101 and the gear section 107 b engage with each other . similarly , when the motor mounting plate 112 with the second motor mb mounted thereon is mounted on the cover plate 113 , the output shaft of the second motor mb penetrates through an opening in cover plate 113 , and the pinion gear 111 and the gear section 117 b engage with each other . in the present embodiment , the first motor ma , the first rotor plate 107 , the first spring 108 , the first driving lever 109 , and the first blade 110 constitute a first shutter driving mechanism . the second motor mb , the second rotor plate 117 , the second spring 118 , the second driving lever 119 , and the second blade 120 constitute a second shutter driving mechanism . each of the first motor ma and the second motor mb is a stepping motor that can be driven in step - driving ( open - loop driving ) at which an energization state of the coil is switched at predetermined time intervals and in two types of feed - back driving with different advance angle values . to drive the first motor ma and the second motor mb in the step driving mode ( open - loop driving mode ), the energization state of the coil is switched at predetermined time intervals . to drive the first motor ma and the second motor mb in the feed - back driving mode , the energization state of the coil is switched in accordance with an output of a positional sensor . the detailed configuration of each of the first motor ma and the second motor mb is described below . fig1 is a timing chart for describing operations of the shutter unit 20 when the camera 100 is operating in continuous shooting mode . fig3 to 11 are illustrations for describing the states of the shutter unit 20 in a to i statuses illustrated in fig1 . the shutter unit 20 according to the present embodiment performs a first - frame shooting operation from the a status to h status illustrated in fig1 . in the first - frame shooting operation , the first shutter driving mechanism functions as a leading blade , and the second shutter driving mechanism functions as a trailing blade . the shutter unit 20 according to the present embodiment performs a second - frame shooting operation from the h status to i status illustrated in fig1 . in the second - frame shooting operation , the second shutter driving mechanism functions as the leading blade , and the second shutter driving mechanism functions as the trailing blade . in a third - frame shooting operation , the first shutter driving mechanism functions as the leading blade , and the second shutter driving mechanism functions as the trailing blade . when the camera 100 starts a shooting operation , it is in a status illustrated in fig1 . fig3 a and 3b are illustrations for describing a state of the shutter unit 20 in a status . fig3 a is an illustration for describing the state of the first shutter driving mechanism . fig3 b is an illustration for describing the state of the second shutter driving mechanism . as illustrated in fig3 a , in a status , the first blade 110 closes the aperture 105 a . in the state illustrated in fig3 a , the protruding section 107 a in the first rotor plate 107 is in contact with the left arm section of the first spring 108 . however , in this state , the first spring 108 is not charged and is in its natural state . as illustrated in fig3 b , in a status , the second blade 120 opens the aperture 105 a . at this time , the protruding section 117 a in the second rotor plate 117 is in contact with the right arm section of the second spring 118 . however , in this state , the second spring 118 is not charged and is in its natural state . as illustrated in fig1 , in a status , the control circuit 13 controls the driving circuit 14 a such that the first motor ma is driven clockwise in feed - back driving mode with low advance angle . in a status , the control circuit 13 controls the driving circuit 14 b such that the second motor mb is not driven in any direction . thus the shutter unit 20 moves to the b status illustrated in fig1 . fig4 a and 4b are illustrations for describing a state of the shutter unit 20 in b status . fig4 a is an illustration for describing the state of the first shutter driving mechanism . fig4 b is an illustration for describing the state of the second shutter driving mechanism . as illustrated in fig4 a , in b status , the first blade 110 closes the aperture 105 a . as illustrated in fig1 , in the period from the a status to b status , the first motor ma is driven clockwise in feed - back driving mode with low advance angle . thus the first rotor plate 107 rotates counterclockwise from the state illustrated in fig3 a . here , because the pinion gear 101 in the first motor ma and the gear section 107 b in the first rotor plate 107 engage with each other , the rotation direction of the first motor ma and that of the first rotor plate 107 are opposite . when the first rotor plate 107 rotates counterclockwise from the state illustrated in fig3 a ( a status ), the first rotor plate 107 rotates while charging the first spring 108 . in this period , the first rotor plate 107 rotates counterclockwise while charging the first spring 108 , and thus variations in load during the driving of the first motor ma are large . however , because the first motor ma is driven in feed - back driving mode with low advance angle , the first motor ma does not lose synchronization . in the state illustrated in fig4 a ( b status ), because the first spring 108 is charged , the first rotor plate 107 is urged in a clockwise direction by the first spring 108 . when the first rotor plate 107 rotates counterclockwise from the state illustrated in fig3 a ( a status ), the cam pin 109 a in the first driving lever 109 follows the first idle running driving region a in the cam groove 107 c in this period . accordingly , the position of the first driving lever 109 in the state illustrated in fig4 a ( b status ) is substantially the same as the position of the first driving lever 109 in the state illustrated in fig3 a ( a status ). the b status of the second shutter driving mechanism illustrated in fig4 b is the same as the a status of the second shutter driving mechanism illustrated in fig3 b . when the state moves from the a status to b status , the second motor mb is not driven , and thus the second rotor plate 117 remains unchanged from the state illustrated in fig3 b ( a status ). as illustrated in fig1 , in b status , the control circuit 13 controls the driving circuit 14 a such that the first motor ma is driven counterclockwise in step driving mode . in b status , the control circuit 13 controls the driving circuit 14 b such that the second motor mb is driven clockwise in feed - back driving mode with low advance angle . thus the shutter unit 20 moves to the c status illustrated in fig1 . that is , in the present embodiment , the start of driving for an approach run in the second shutter driving mechanism lags behind the start of driving for an approach run in the first shutter driving mechanism by an exposure time t1 . the first shutter driving mechanism starts driving for an approach run in step driving mode in b status . in driving for the approach run , the control circuit 13 gradually increases the rotational speed of the first motor ma by gradually reducing the width of a driving pulse . in driving for the approach run , the cam pin 109 a follows the first idle running driving region a in the cam groove 107 c , where the cum lift is substantially zero . accordingly , in this period , because the first driving lever 109 does not virtually rotate even when the first rotor plate 107 is driven , variations in load during the driving of the first motor ma are small . thus when the first motor ma is driven in step driving mode , the first motor ma does not lose synchronization . fig5 a and 5b are illustrations for describing a state of the shutter unit 20 in c status . fig5 a is an illustration for describing the state of the first shutter driving mechanism . fig5 b is an illustration for describing the state of the second shutter driving mechanism . as illustrated in fig5 a , in c status , the first blade 110 closes the aperture 105 a . because the first motor ma is driven counterclockwise in the period from the b status to c status , the first rotor plate 107 is rotated clockwise by a combined force of the driving force of the first motor ma and the urging force of the first spring 108 . the urging force of the first spring 108 is provided to the first rotor plate 107 up to the c status illustrated in fig5 a . when the first rotor plate 107 rotates clockwise from the state illustrated in fig4 a ( b status ), the cam pin 109 a in the first driving lever 109 follows the first idle running driving region a in the cam groove 107 c in this period . accordingly , the position of the first driving lever 109 in the state illustrated in fig5 a ( c status ) is substantially the same as the position of the first driving lever 109 in the state illustrated in fig4 a ( b status ). as illustrated in fig5 b , in c status , the second blade 120 opens the aperture 105 a . in the period from the b status to c status , because the second motor mb is driven clockwise in feed - back driving mode with low advance angle , the second rotor plate 117 rotates counterclockwise from the state illustrated in fig4 b . here , because the pinion gear 111 in the second motor mb and the gear section 117 b in the second rotor plate 117 engage with each other , the rotation direction of the second motor mb and that of the second rotor plate 117 are opposite . when the second rotor plate 117 rotates clockwise from the state illustrated in fig4 b ( b status ), the second rotor plate 117 rotates while charging the second spring 118 . in this period , the second rotor plate 117 rotates clockwise while charging the second spring 118 , and thus variations in load during the driving of the second motor mb are large . however , because the second motor mb is driven in feed - back driving mode with low advance angle , the second motor mb does not lose synchronization . in the state illustrated in fig5 b ( c status ), because the second spring 118 is charged , the second rotor plate 117 is urged in a clockwise direction by the second spring 118 . when the second rotor plate 117 rotates clockwise from the state illustrated in fig4 b ( b status ), the cam pin 119 a in the second driving lever 119 also follows the first idle running driving region a in the cam groove 117 c in this period . accordingly , the position of the second driving lever 119 in the state illustrated in fig5 b ( c status ) is substantially the same as the position of the second driving lever 119 in the state illustrated in fig4 b ( b status ). as illustrated in fig1 , in c status , the control circuit 13 also controls the driving circuit 14 a such that the first motor ma is driven counterclockwise in step driving mode . in c status , the control circuit 13 controls the driving circuit 14 b such that the second motor mb is driven counterclockwise in step driving mode . thus the shutter unit 20 moves to the d status illustrated in fig1 . the second shutter driving mechanism starts driving for an approach run in step driving mode in c status . in driving for the approach run , the control circuit 13 gradually increases the rotational speed of the second motor mb by gradually reducing the width of a driving pulse . in driving for the approach run , the cam pin 119 a follows the first idle running driving region a in the cam groove 117 c , where the cum lift is substantially zero . thus when the second motor mb is driven in step driving mode , the second motor mb does not lose synchronization . fig6 a and 6b are illustrations for describing a state of the shutter unit 20 in d status . fig6 a is an illustration for describing the state of the first shutter driving mechanism . fig6 b is an illustration for describing the state of the second shutter driving mechanism . as illustrated in fig6 a , the d status is a state immediately before the first blade 110 starts opening the aperture 105 a . because the first motor ma is driven counterclockwise in the period from the c status to d status , the first rotor plate 107 is rotated clockwise by the driving force of the first motor ma . when the first rotor plate 107 rotates clockwise from the state illustrated in fig5 a ( c status ), the cam pin 109 a in the first driving lever 109 follows the first idle running driving region a in the cam groove 107 c in this period . accordingly , the position of the first driving lever 109 in the state illustrated in fig6 a ( d status ) is substantially the same as the position of the first driving lever 109 in the state illustrated in fig5 a ( c status ). as illustrated in fig6 b , in d status , the second blade 120 opens the aperture 105 a . in the period from the c status to a state before the d status , because the second motor mb is driven counterclockwise , the second rotor plate 117 is rotated clockwise by a combined force of the driving force of the second motor mb and the urging force of the second spring 118 . the urging force of the second spring 118 is provided to the second rotor plate 117 up to the state before the d status illustrated in fig6 b . that is , in d status illustrated in fig6 b , the urging force of the second spring 118 is not provided to the second rotor plate 117 , and the second rotor plate 117 is rotated clockwise by only the driving force of the second motor mb . when the second rotor plate 117 rotates clockwise from the state illustrated in fig5 b ( c status ), the cam pin 119 a in the second driving lever 119 also follows the first idle running driving region a in the cam groove 117 c in this period . accordingly , the position of the second driving lever 119 in the state illustrated in fig6 b ( d status ) is substantially the same as the position of the second driving lever 119 in the state illustrated in fig5 b ( c status ). as illustrated in fig1 , in d status , the control circuit 13 controls the driving circuit 14 a such that the first motor ma is driven counterclockwise in feed - back driving mode with high advance angle . in d status , the control circuit 13 also controls the driving circuit 14 b such that the second motor mb is driven counterclockwise in step driving mode . thus the shutter unit 20 moves to the e status illustrated in fig1 . the first shutter driving mechanism starts driving for exposure in feed - back driving mode with high advance angle in d status . fig7 a and 7b are illustrations for describing a state of the shutter unit 20 in e status . fig7 a is an illustration for describing the state of the first shutter driving mechanism . fig7 b is an illustration for describing the state of the second shutter driving mechanism . as illustrated in fig7 a , in e status , the first blade 110 opens the aperture 105 a . because the first motor ma is driven counterclockwise in the period from the d status to e status , the first rotor plate 107 is rotated clockwise by the driving force of the first motor ma . when the first rotor plate 107 rotates clockwise from the state illustrated in fig6 a ( d status ), the cam pin 109 a in the first driving lever 109 follows the exposure driving region b in the cam groove 107 c in this period . this causes the first blade 110 to open the closed aperture 105 a . accordingly , in exposure driving , it is necessary to drive the first motor ma at high speeds , and this leads to large variations in load during the driving of the first motor ma . at this time , because the first motor ma is driven in feed - back driving mode with high advance angle , the high - speed driving and the load variations do not cause the first motor ma to lose synchronization . because the rotation speed of the first motor ma is sufficiently high due to the driving for the approach run , the first motor ma can be driven in feed - back driving mode with high advance angle . as illustrated in fig7 b , the e status is a state immediately before the second blade 120 starts closing the aperture 105 a . in the period from the d status to e status , because the second motor mb is driven counterclockwise , the second rotor plate 117 is rotated clockwise by the driving force of the second motor mb . when the second rotor plate 117 rotates clockwise from the state illustrated in fig6 b ( d status ), the cam pin 119 a in the second driving lever 119 follows the first idle running driving region a in the cam groove 117 c in this period . accordingly , the position of the second driving lever 119 in the state illustrated in fig7 b ( e status ) is substantially the same as the position of the second driving lever 119 in the state illustrated in fig6 b ( d status ). as illustrated in fig1 , in e status , the control circuit 13 controls the driving circuit 14 a such that the first motor ma is driven counterclockwise in feed - back driving mode with high advance angle . in e status , the control circuit 13 also controls the driving circuit 14 b such that the second motor mb is driven counterclockwise in feed - back driving mode with high advance angle . thus the shutter unit 20 moves to the f status illustrated in fig1 . the second shutter driving mechanism starts driving for exposure in feed - back driving mode with high advance angle in e status . fig8 a and 8b are illustrations for describing a state of the shutter unit 20 in f status . fig8 a is an illustration for describing the state of the first shutter driving mechanism . fig8 b is an illustration for describing the state of the second shutter driving mechanism . as illustrated in fig8 a , in f status , the first blade 110 opens the aperture 105 a . because the first motor ma is driven counterclockwise in the period from the d status to e status , the first rotor plate 107 is rotated clockwise by the driving force of the first motor ma . when the first rotor plate 107 rotates clockwise from the state illustrated in fig7 a ( e status ), the cam pin 109 a in the first driving lever 109 follows the second idle running driving region c in the cam groove 107 c in this period . accordingly , the position of the first driving lever 109 in the state illustrated in fig8 a ( f status ) is substantially the same as the position of the first driving lever 109 in the state illustrated in fig7 a ( e status ). as illustrated in fig8 b , in f status , the second blade 120 closes the aperture 105 a . in the period from the e status to f status , because the second motor mb is driven counterclockwise , the second rotor plate 117 is rotated clockwise by the driving force of the second motor mb . when the second rotor plate 117 rotates clockwise from the state illustrated in fig7 b ( e status ), the cam pin 119 a in the second driving lever 119 follows the exposure driving region b in the cam groove 117 c in this period . this causes the second blade 120 to close the opened aperture 105 a . accordingly , in exposure driving , it is necessary to drive the second motor mb at high speeds , and this leads to large variations in load during the driving of the second motor mb . at this time , because the second motor mb is driven in feed - back driving mode with high advance angle , the high - speed driving and the load variations do not cause the second motor mb to lose synchronization . because the rotation speed of the second motor mb is sufficiently high due to the driving for the approach run , the second motor mb can be driven in feed - back driving mode with high advance angle . as illustrated in fig1 , in f status , the control circuit 13 controls the driving circuit 14 a such that the first motor ma is driven counterclockwise in feed - back driving mode with high advance angle . in f status , the control circuit 13 also controls the driving circuit 14 b such that the second motor mb is driven counterclockwise in feed - back driving mode with high advance angle . thus the shutter unit 20 moves to the g status illustrated in fig1 . fig9 a and 9b are illustrations for describing a state of the shutter unit 20 in g status . fig9 a is an illustration for describing the state of the first shutter driving mechanism . fig9 b is an illustration for describing the state of the second shutter driving mechanism . as illustrated in fig9 a , in g status , the first blade 110 opens the aperture 105 a . the first motor ma is driven counterclockwise in the period from the f status to g status . in the period from the f status to g status , the protruding section 107 a in the first rotor plate 107 is in contact with the right arm section of the first spring 108 , and the first rotor plate 107 rotates clockwise while charging the first spring 108 . that is , the first spring 108 acts to apply a break to the clockwise rotation of the first rotor plate 107 . in the state illustrated in fig9 a , the first spring 108 is charged , and the first rotor plate 107 is urged in a counterclockwise direction by the first spring 108 . when the first rotor plate 107 rotates clockwise from the state illustrated in fig8 a ( f status ), the cam pin 109 a in the first driving lever 109 follows the second idle running driving region c in the cam groove 107 c in this period . accordingly , the position of the first driving lever 109 in the state illustrated in fig9 a ( g status ) is substantially the same as the position of the first driving lever 109 in the state illustrated in fig8 a ( f status ). in this period , the first rotor plate 107 rotates clockwise while charging the first spring 108 , and thus variations in load during the driving of the first motor ma are large . however , because the first motor ma is driven in feed - back driving mode with high advance angle , the first motor ma does not lose synchronization . as illustrated in fig9 b , in g status , the second blade 120 closes the aperture 105 a . in the period from the f status to g status , because the second motor mb is driven counterclockwise , the second rotor plate 117 is rotated clockwise by the driving force of the second motor mb . in the state illustrated in fig9 b , the protruding section 117 a in the second rotor plate 117 is in contact with the left arm section of the second spring 118 . however , in this state , the second spring 118 is not charged and is in its natural state . when the second rotor plate 117 rotates clockwise from the state illustrated in fig8 b ( f status ), the cam pin 119 a in the second driving lever 119 also follows the second idle running driving region c in the cam groove 117 c in this period . accordingly , the position of the second driving lever 119 in the state illustrated in fig9 b ( g status ) is substantially the same as the position of the second driving lever 119 in the state illustrated in fig8 b ( f status ). as illustrated in fig1 , in g status , the control circuit 13 controls the driving circuit 14 a such that current supply to the first motor ma is held . here , holding the current supply indicates maintaining the phase of the current supply to the coil of the first motor ma in g status . in g status , the control circuit 13 also controls the driving circuit 14 b such that the second motor mb is driven counterclockwise in feed - back driving mode with high advance angle . thus the shutter unit 20 moves to the h status illustrated in fig1 . fig1 a and 10b are illustrations for describing a state of the shutter unit 20 in h status . fig1 a is an illustration for describing the state of the first shutter driving mechanism . fig1 b is an illustration for describing the state of the second shutter driving mechanism . as illustrated in fig1 a , in h status , the first blade 110 opens the aperture 105 a . because the current supply to the first motor ma is held in g status , the first motor ma and the first rotor plate 107 remain in g status . that is , the state illustrated in fig1 a ( h status ) is the same as the state illustrated in fig9 a ( g status ). as illustrated in fig1 b , in h status , the second blade 120 closes the aperture 105 a . in the period from the g status to h status , the second motor mb is driven counterclockwise . in the period from the g status to h status , the protruding section 117 a in the second rotor plate 117 is in contact with the left arm section of the second spring 118 , and the second rotor plate 117 rotates clockwise while charging the second spring 118 . that is , the second spring 118 acts to apply a break to the clockwise rotation of the second rotor plate 117 . in the state illustrated in fig1 b , the second spring 118 is charged , and the second rotor plate 117 is urged in a counterclockwise direction by the second spring 118 . when the second rotor plate 117 rotates clockwise from the state illustrated in fig9 b ( g status ), the cam pin 119 a in the second driving lever 119 follows the second idle running driving region c in the cam groove 117 c in this period . accordingly , the position of the second driving lever 119 in the state illustrated in fig1 b ( h status ) is substantially the same as the position of the second driving lever 119 in the state illustrated in fig9 b ( g status ). in this period , the second rotor plate 117 rotates clockwise while charging the second spring 118 , and thus variations in load during the driving of the second motor mb are large . however , because the second motor mb is driven in feed - back driving mode with high advance angle , the second motor mb does not lose synchronization . as described above , the shutter unit 20 according to the present embodiment performs the first - frame shooting operation from the a status to h status illustrated in fig1 . in the first - frame shooting operation , the first shutter driving mechanism functions as the leading blade , and the second shutter driving mechanism functions as the trailing blade . in the second - frame shooting operation , the second shutter driving mechanism functions as the leading blade , and the first shutter driving mechanism functions as the trailing blade . that is , in the first - frame shooting operation , the first shutter driving mechanism performs an exposure operation ahead of the second shutter driving mechanism . in the second - frame shooting operation , the second shutter driving mechanism performs an exposure operation ahead of the first shutter driving mechanism . in the present embodiment , the start of driving for an approach run in the first shutter driving mechanism is caused to lag behind the start of driving for an approach run in the second shutter driving mechanism by an exposure time t2 for the second frame by adjustment of the period of time for which the current supply to the first motor ma is held . as illustrated in fig1 , in h status , the control circuit 13 controls the driving circuit 14 a such that the current supply to the first motor ma is held . in h status , the control circuit 13 also controls the driving circuit 14 b such that the second motor mb is driven clockwise in step driving mode . thus the second rotor plate 117 is rotated counterclockwise by the driving force of the second motor mb and the urging force of the second spring 118 . the second shutter driving mechanism starts driving for an approach run in step driving mode in h status . thus the shutter unit 20 moves to the g ′ status illustrated in fig1 . the state of the shutter unit 20 in g ′ status illustrated in fig1 is the same as the state illustrated in fig9 a and 9b . as illustrated in fig1 , in g ′ status , the control circuit 13 controls the driving circuit 14 a such that the first motor ma is driven clockwise in step driving mode . thus the first rotor plate 107 is rotated counterclockwise by the driving force of the first motor ma and the urging force of the first spring 108 . the first shutter driving mechanism starts driving for an approach run in step driving mode in g ′ status . in g ′ status , the control circuit 13 controls the driving circuit 14 b such that the second motor mb is driven clockwise in step driving mode . thus the shutter unit 20 moves to the f ′ status illustrated in fig1 . the state of the shutter unit 20 in f ′ status illustrated in fig1 is the same as the state illustrated in fig8 a and 8b . as illustrated in fig1 , in f ′ status , the control circuit 13 controls the driving circuit 14 a such that the first motor ma is driven clockwise in step driving mode . in f ′ status , the control circuit 13 controls the driving circuit 14 b such that the second motor mb is driven clockwise in feed - back driving mode with high advance angle . thus the shutter unit 20 moves to the e ′ status illustrated in fig1 . the second shutter driving mechanism starts driving for exposure in feed - back driving mode with high advance angle in f ′ status . because the rotation speed of the second motor mb is sufficiently high due to the driving for the approach run , the second motor mb can be driven in feed - back driving mode with high advance angle . the state of the shutter unit 20 in f ′ status illustrated in fig1 is the same as the state illustrated in fig8 . as illustrated in fig1 , in e ′ status , the control circuit 13 controls the driving circuit 14 a such that the first motor ma is driven clockwise in feed - back driving mode with high advance angle . in e ′ status , the control circuit 13 controls the driving circuit 14 b such that the second motor mb is driven clockwise in feed - back driving mode with high advance angle . thus the shutter unit 20 moves to the d ′ status illustrated in fig1 . the first shutter driving mechanism starts driving for exposure in feed - back driving mode with high advance angle in e ′ status . because the rotation speed of the first motor ma is sufficiently high due to the driving for the approach run , the first motor ma can be driven in feed - back driving mode with high advance angle . the state of the shutter unit 20 in e ′ status illustrated in fig1 is the same as the state illustrated in fig7 a and 7b . as illustrated in fig1 , in d ′ status , the control circuit 13 controls the driving circuit 14 a such that the first motor ma is driven clockwise in feed - back driving mode with high advance angle . in d ′ status , the control circuit 13 controls the driving circuit 14 b such that the second motor mb is driven clockwise in feed - back driving mode with high advance angle . thus the shutter unit 20 moves to the c ′ status illustrated in fig1 . the state of the shutter unit 20 in c ′ status illustrated in fig1 is the same as the state illustrated in fig6 a and 6b . as illustrated in fig1 , in c ′ status , the control circuit 13 controls the driving circuit 14 a such that the first motor ma is driven clockwise in feed - back driving mode with high advance angle . in c ′ status , the control circuit 13 controls the driving circuit 14 b such that the current supply to the second motor mb is held . here , holding the current supply indicates maintaining the phase of the current supply to the second motor mb in d status . thus the shutter unit 20 moves to the i status illustrated in fig1 . fig1 a and 11b are illustrations for describing a state of the shutter unit 20 in i status . fig1 a is an illustration for describing the state of the first shutter driving mechanism . fig1 b is an illustration for describing the state of the second shutter driving mechanism . as illustrated in fig1 a , in i status , the first blade 110 closes the aperture 105 a . as illustrated in fig1 , because the first motor ma is driven clockwise in the period from the c ′ status to i status , the first rotor plate 107 is rotated counterclockwise from the state illustrated in fig5 a . in the period from the c ′ status to i status , the protruding section 107 a in the first rotor plate 107 is in contact with the left arm section of the first spring 108 , and the first rotor plate 107 rotates counterclockwise while charging the first spring 108 . that is , the first spring 108 acts to apply a break to the counterclockwise rotation of the first rotor plate 107 . in the state illustrated in fig1 a , the first spring 108 is charged , and the first rotor plate 107 is urged in a clockwise direction by the first spring 108 . as illustrated in fig1 b , in i status , the second blade 120 opens the aperture 105 a . because the current supply to the second motor mb is held in c ′ status , the second motor mb and the second rotor plate 117 remain in c ′ status . that is , the state illustrated in fig5 b is the same as the state illustrated in fig1 b . as described above , the shutter unit 20 according to the present embodiment performs the second - frame shooting operation from the h status to i status illustrated in fig1 . in the second - frame shooting operation , the second shutter driving mechanism functions as the leading blade , and the first shutter driving mechanism functions as the trailing blade . in the third - frame shooting operation , the first shutter driving mechanism functions as the leading blade , and the second shutter driving mechanism functions as the trailing blade . in the present embodiment , the start of driving for an approach run in the second shutter driving mechanism is caused to lag behind the start of driving for an approach run in the first shutter driving mechanism by an exposure time t3 for the third frame by adjustment of the period of time for which the current supply to the second motor mb is held . as illustrated in fig1 , in i status , the control circuit 13 controls the driving circuit 14 a such that the first motor ma is driven counterclockwise in step driving mode . the control circuit 13 controls the driving circuit 14 b such that the current supply to the second motor mb is held . thus the shutter unit 20 moves to the c status illustrated in fig1 . after that , the same shooting operation as that for the first frame is performed . fig1 is a timing chart for describing operations of the shutter unit 20 when the camera 100 is operating in continuous shooting mode as a variation of the present embodiment . in the above - described embodiment , a lag between the leading blade and the trailing blade is produced by making the timing for starting the driving for the approach run in the shutter driving mechanism functioning as the leading blade and the timing for starting the driving for the approach run in the shutter driving mechanism functioning as the trailing blade different . in contrast , in the variation , a lag between the leading blade and the trailing blade is produced by making a pulse rate for the driving for the approach run in the shutter driving mechanism functioning as the leading blade and a pulse rate for the driving for the approach run in the shutter driving mechanism functioning as the trailing blade different . that is , the pulse rate for the driving for the approach run in the shutter driving mechanism functioning as the leading blade is set at a value larger than the pulse rate for the driving for the approach run in the shutter driving mechanism functioning as the trailing blade . thus even in the same approach run period , the time required for the driving for the approach run in the shutter driving mechanism functioning as the trailing blade is longer than the time required for the driving for the approach run in the shutter driving mechanism functioning as the leading blade . in the variation , in a status illustrated in fig1 , the control circuit 13 controls the driving circuit 14 a such that the first motor ma is driven clockwise in feed - back driving mode with low advance angle . in a status illustrated in fig1 , the control circuit 13 controls the driving circuit 14 b such that the second motor mb is driven clockwise in feed - back driving mode with low advance angle . thus the shutter unit 20 moves to the i status illustrated in fig1 . in i status illustrated in fig1 , the control circuit 13 controls the driving circuit 14 a such that the first motor ma is driven counterclockwise in step driving mode . in i status illustrated in fig1 , the control circuit 13 controls the driving circuit 14 b such that the second motor mb is driven counterclockwise in step driving mode . thus the shutter unit 20 moves to the d status illustrated in fig1 . the state from the d status to g status illustrated in fig1 is the same as that from the d status to g status illustrated in fig1 in the embodiment described above . in g status illustrated in fig1 , the control circuit 13 also controls the driving circuit 14 a such that the first motor ma is driven counterclockwise in feed - back driving mode with high advance angle . in d status illustrated in fig1 , the control circuit 13 also controls the driving circuit 14 b such that the second motor mb is driven counterclockwise in feed - back driving mode with high advance angle . in the above - described embodiment , in g status illustrated in fig1 , the control circuit 13 controls the driving circuit 14 a such that the current supply to the first motor ma is held . in the variation , the control circuit 13 controls the driving circuit 14 a such that the first motor ma is driven counterclockwise in feed - back driving mode with high advance angle . accordingly , although the first rotor plate 107 tries to rotate clockwise , because the protruding section 107 a in the first rotor plate 107 comes into contact with the stopper on the cover plate 103 , the clockwise rotation of the first rotor plate 107 is blocked . the characteristics in the variation are substantially the same as those in the above - described embodiment , except for the method of producing a lag between the leading blade and the trailing blade and the respect in which holding the current supply is not performed . next , the details of the first motor ma and the second motor mb are described with reference to fig1 to 16 . fig1 illustrates a motor 1 used as each of the first motor ma and the second motor mb . for the sake of the description , parts of some components are removed in the illustration . as illustrated in fig1 , a rotor 3 includes a magnet 2 and is rotatably controlled by the control circuit ( controller ) 13 and the driving circuit 14 . the magnet 2 is cylindrical , has a circumferential surface divided in its circumferential direction , and is multipole - magnetized in different poles in an alternatingly manner . in the present embodiment , the magnet 2 is divided in eight elements , that is , magnetized in eight poles . the number of divisions is not limited to eight . the magnet 2 may be magnetized in four or twelve poles . a first coil 4 is arranged on a first end of the magnet 2 in its axial direction . a first yoke 6 is made of a soft magnetic material and is opposed to the circumferential surface of the magnet 2 such that a gap is present therebetween . the first yoke 6 axially extends from an annular main body portion and includes a plurality of first magnetic pole sections 6 a arranged at predetermined intervals in its circumferential direction . the first magnetic pole sections 6 a are excited by energization of the first coil 4 . the first coil 4 , the first yoke 6 , and the magnet 2 opposed to the plurality of first magnetic pole sections 6 a constitute a first stator unit . a second coil 5 is arranged on a second end of the magnet 2 in its axial direction , and the second end is opposite to the first end on which the first coil 4 is arranged . a second yoke 7 is made of a soft magnetic material and is opposed to the circumferential surface of the magnet 2 such that a gap is present therebetween . the second yoke 7 axially extends from the annular main body portion and includes a plurality of second magnetic pole sections 7 a arranged at predetermined intervals in its circumferential direction . the second magnetic pole sections 7 a are excited by energization of the second coil 5 . the second coil 5 , the second yoke 7 , and the magnet 2 opposed to the plurality of second magnetic pole sections 7 a constitute a second stator unit . a torque provided to the rotor 3 can be changed by switching the magnetized polarity ( north pole , south pole ) of each of the first magnetic pole sections 6 a and the second magnetic pole sections 7 a . a first magnetic sensor ( first detecting element ) 8 , a second magnetic sensor ( second detecting element ) 9 , a third magnetic sensor ( third detecting element ) 10 , and a fourth magnetic sensor ( fourth detecting element ) 11 constitute detecting means . each of the magnetic sensors is a hall element configured to detect a magnetic flux of the magnet 2 and is fixed to a motor cover 12 . the motor cover 12 fixes and retains the first yoke 6 and the second yoke 7 such that the first magnetic pole sections 6 a and the second magnetic pole sections 7 a are displaced with respect to a magnetization phase of the magnet 2 by approximately 90 degrees in electrical angle . here , the electrical angle is an angle represented based on the assumption that one cycle of the magnetic force of the magnet is 360 °. the electrical angle θ can be expressed by the following equation : where m is the number of poles of the rotor , and the mechanical angle is θ0 . in the present embodiment , the magnet 2 is magnetized in eight poles , and 90 degrees in electrical angle is 22 . 5 degrees in mechanical angle . the control circuit 13 can switch the driving among the step driving and the two kinds of feed - back driving with different amounts of the advance angle . in step driving , the control circuit 13 controls the driving circuit 14 such that the energization state of the first coil 4 and the second coil 5 is switched at predetermined time intervals . that is , in step driving , none of outputs of the first magnetic sensor 8 , the second magnetic sensor 9 , the third magnetic sensor 10 , and the fourth magnetic sensor 11 are used . a case where the control circuit 13 performs the feed - back driving is described below . when the control circuit 13 performs the two kinds of feed - back driving , outputs of the first magnetic sensor 8 , the second magnetic sensor 9 , the third magnetic sensor 10 , and the fourth magnetic sensor 11 are used . in the present embodiment , even in switching the energization direction , a large rotational driving force is obtainable by arranging each magnetic sensor in a positional relationship with respect to each yoke described below . fig1 a to 15i are illustrations for describing operations of the motor 1 . actual operations of the motor 1 are described with reference to fig1 a to 15i . the state in fig1 a is described as an initial state in driving . the clockwise driving mode with low advance angle is described . the driving mode with low advance angle can achieve larger torque than that in the driving mode with high advance angle described below . in the clockwise driving mode with low advance angle , the rotor 3 is rotated clockwise by switching excitation of each of the first magnetic pole sections 6 a in response to an output signal of the first magnetic sensor 8 and switching excitation of each of the second magnetic pole sections 7 a in response to an output signal of the second magnetic sensor 9 . the direction of the clockwise rotation of the rotor 3 corresponds to a first rotation direction . in this driving mode , the energization direction of each of the first coil 4 and the second coil 5 is switched using combinations described below . when the first magnetic sensor 8 detects the south pole of the magnet 2 ( switching from the north pole to south pole ), its detection signal is input into the control circuit 13 . the control circuit 13 controls the driving circuit 14 such that the first magnetic pole section 6 a is magnetized with the north pole . when the first magnetic sensor 8 detects the north pole of the magnet 2 ( switching from the south pole to north pole ), its detection signal is input into the control circuit 13 . the control circuit 13 controls the driving circuit 14 such that the first magnetic pole section 6 a is magnetized with the south pole . when the second magnetic sensor 9 detects the south pole of the magnet 2 ( switching from the north pole to south pole ), its detection signal is input into the control circuit 13 . the control circuit 13 controls the driving circuit 14 such that the second magnetic pole section 7 a is magnetized with the south pole . when the second magnetic sensor 9 detects the north pole of the magnet 2 ( switching from the south pole to north pole ), its detection signal is input into the control circuit 13 . the control circuit 13 controls the driving circuit 14 such that the second magnetic pole section 7 a is magnetized with the north pole . in the state illustrated in fig1 a , both the first magnetic sensor 8 and the second magnetic sensor 9 detect the south pole of the magnet 2 . at this time , the control circuit 13 controls the driving circuit 14 such that the first magnetic pole section 6 a is magnetized with the north pole and the second magnetic pole section 7 a is magnetized with the south pole . this produces a clockwise rotation force in the rotor 3 and the magnet 2 . when the rotor 3 rotates clockwise from the state illustrated in fig1 a , the center q1 of each of the south poles of the magnet 2 and the center of the corresponding first magnetic pole section 6 a are opposed to each other , as illustrated in fig1 b . when the rotor 3 rotates clockwise from the state illustrated in fig1 b , the distance between the center q1 of the south pole of the magnet 2 and the first magnetic pole section 6 a is the same as the distance between the center q2 of each of the north poles of the magnet 2 and the corresponding second magnetic pole section 7 a , as illustrated in fig1 c . the first magnetic sensor 8 is arranged such that when the magnetized polarity of the first magnetic pole section 6 a is switched on the basis of the output of the first magnetic sensor 8 , the excitation switching timing for the first magnetic pole section 6 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between angle 0 degree to 45 degrees . the first magnetic sensor 8 detects the north pole of the magnet 2 ( switching from the south pole to north pole ) between the state illustrated in fig1 b and the state illustrated in fig1 c . at this time , the driving circuit 14 energizes the first coil 4 such that the first magnetic pole section 6 a is magnetized with the south pole . because the second magnetic sensor 9 detects the south pole of the magnet 2 between the state illustrated in fig1 b and the state illustrated in fig1 c , the driving circuit 14 energizes the second coil 5 such that the second magnetic pole section 7 a is magnetized with the south pole . this produces the clockwise rotation force in the rotor 3 and the magnet 2 . when the rotor 3 rotates clockwise from the state illustrated in fig1 c , the center q2 of the north pole of the magnet 2 and the center of the second magnetic pole section 7 a are opposed to each other , as illustrated in fig1 d . when the rotor 3 rotates clockwise from the state illustrated in fig1 d , the distance between the center q2 of the north pole of the magnet 2 and the first magnetic pole section 6 a is the same as the distance between the center q2 of the north pole of the magnet 2 and the second magnetic pole section 7 a , as illustrated in fig1 e . the second magnetic sensor 9 is arranged such that when the magnetized polarity of the second magnetic pole section 7 a is switched on the basis of the output of the second magnetic sensor 9 , the excitation switching timing for the second magnetic pole section 7 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between 0 degree to 45 degrees . the second magnetic sensor 9 detects the north pole of the magnet 2 ( switching from the south pole to north pole ) between the state illustrated in fig1 d and the state illustrated in fig1 e . at this time , the driving circuit 14 energizes the second coil 5 such that the second magnetic pole section 7 a is magnetized with the north pole . because the first magnetic sensor 8 detects the north pole of the magnet 2 between the state illustrated in fig1 d and the state illustrated in fig1 e , the driving circuit 14 energizes the first coil 4 such that the first magnetic pole section 6 a is magnetized with the south pole . this produces the clockwise rotation force in the rotor 3 and the magnet 2 . as described above , in the clockwise driving mode with low advance angle , the energization of the first coil 4 and the second coil 5 is sequentially switched by the outputs of the first magnetic sensor 8 and the second magnetic sensor 9 , and the rotor 3 and the magnet 2 rotate in a clockwise direction . when the rotor 3 rotates clockwise and the magnetized polarity of the first magnetic pole section 6 a is switched on the basis of the output of the first magnetic sensor 8 , the excitation switching timing for the first magnetic pole section 6 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between angle 0 degree to 45 degrees . that is , the first magnetic sensor 8 is arranged in a position where the amount of the advance angle from the position of the electrical advance angle 0 degree from the excitation switching timing at the first magnetic pole section 6 a is smaller than the amount of the lag angle from the position of the electrical advance angle 90 degrees from the excitation switching timing at the first magnetic pole section 6 a . when the rotor 3 rotates clockwise and the magnetized polarity of the second magnetic pole section 7 a is switched on the basis of the output of the second magnetic sensor 9 , the excitation switching timing for the second magnetic pole section 7 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between angle 0 degree to 45 degrees . that is , the second magnetic sensor 9 is arranged in a position where the amount of the advance angle from the position of the electrical advance angle 0 degree from the excitation switching timing at the second magnetic pole section 7 a is smaller than the amount of the lag angle from the position of the electrical advance angle 90 degrees from the excitation switching timing at the second magnetic pole section 7 a . the clockwise driving mode with high advance angle is described . the driving mode with high advance angle can achieve higher speed rotation than that in the above - described driving mode with low advance angle . in the clockwise driving mode with high advance angle , the rotor 3 is rotated clockwise by switching the magnetized polarity of the first magnetic pole section 6 a in response to the output of the third magnetic sensor 10 and switching the magnetized polarity of the second magnetic pole section 7 a in response to the output of the fourth magnetic sensor 11 . in this driving mode , the energization direction of each of the first coil 4 and the second coil 5 is switched using combinations described below . when the third magnetic sensor 10 detects the south pole of the magnet 2 ( switching from the north pole to south pole ), its detection signal is input into the control circuit 13 . the control circuit 13 controls the driving circuit 14 such that the first magnetic pole section 6 a is magnetized with the north pole . when the third magnetic sensor 10 detects the north pole of the magnet 2 ( switching from the south pole to north pole ), its detection signal is input into the control circuit 13 . the control circuit 13 controls the driving circuit 14 such that the first magnetic pole section 6 a is magnetized with the south pole . when the fourth magnetic sensor 11 detects the south pole of the magnet 2 ( switching from the north pole to south pole ), its detection signal is input into the control circuit 13 . the control circuit 13 controls the driving circuit 14 such that the second magnetic pole section 7 a is magnetized with the south pole . when the fourth magnetic sensor 11 detects the north pole of the magnet 2 ( switching from the south pole to north pole ), its detection signal is input into the control circuit 13 . the control circuit 13 controls the driving circuit 14 such that the second magnetic pole section 7 a is magnetized with the north pole . in the state illustrated in fig1 a , both the third magnetic sensor 10 and the fourth magnetic sensor 11 detect the south pole of the magnet 2 . accordingly , when the first magnetic pole section 6 a is magnetized with the north pole and the second magnetic pole section 7 a is magnetized with the south pole , a clockwise rotation force is produced in the rotor 3 and the magnet 2 . when the rotor 3 rotates clockwise from the state illustrated in fig1 a , the center q1 of each of the south poles of the magnet 2 and the center of the corresponding first magnetic pole section 6 a are opposed to each other , as illustrated in fig1 b . the third magnetic sensor 10 is arranged such that when the magnetized polarity of the first magnetic pole section 6 a is switched on the basis of the output of the third magnetic sensor 10 , the excitation switching timing for the first magnetic pole section 6 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between angle 45 degrees to 90 degrees . the third magnetic sensor 10 detects the north pole of the magnet 2 ( switching from the south pole to north pole ) between the state illustrated in fig1 a and the state illustrated in fig1 b . at this time , the driving circuit 14 energizes the first coil 4 such that the first magnetic pole section 6 a is magnetized with the south pole . because the fourth magnetic sensor 11 detects the south pole of the magnet 2 between the state illustrated in fig1 a and the state illustrated in fig1 b , the driving circuit 14 energizes the second coil 5 such that the second magnetic pole section 7 a is magnetized with the south pole . this produces the clockwise rotation force in the rotor 3 and the magnet 2 . when the rotor 3 rotates clockwise from the state illustrated in fig1 b , the state moves to the state illustrated in fig1 c , and then the center q2 of the north pole of the magnet 2 and the center of the second magnetic pole section 7 a are opposed to each other , as illustrated in fig1 d . the fourth magnetic sensor 11 is arranged such that when the magnetized polarity of the second magnetic pole section 7 a is switched on the basis of the output of the fourth magnetic sensor 11 , the excitation switching timing for the second magnetic pole section 7 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between 45 degrees to 90 degrees . the fourth magnetic sensor 11 detects the north pole of the magnet 2 ( switching from the south pole to north pole ) between the state illustrated in fig1 c and the state illustrated in fig1 d . at this time , the driving circuit 14 energizes the second coil 5 such that the second magnetic pole section 7 a is magnetized with the north pole . because the third magnetic sensor 10 detects the north pole of the magnet 2 between the state illustrated in fig1 c and the state illustrated in fig1 d , the driving circuit 14 energizes the first coil 4 such that the first magnetic pole section 6 a is magnetized with the south pole . this produces the clockwise rotation force in the rotor 3 and the magnet 2 . as described above , in the clockwise driving mode with high advance angle , the energization of the first coil 4 and the second coil 5 is sequentially switched by the outputs of the third magnetic sensor 10 and the fourth magnetic sensor 11 , and the rotor 3 and the magnet 2 rotate in a clockwise direction . when the rotor 3 rotates clockwise and the magnetized polarity of the first magnetic pole section 6 a is switched on the basis of the output of the third magnetic sensor 10 , the excitation switching timing for the first magnetic pole section 6 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between angle 45 degrees to 90 degrees . that is , the third magnetic sensor 10 is arranged in a position where the amount of the advance angle from the position of the electrical advance angle 0 degree from the excitation switching timing at the first magnetic pole section 6 a is larger than the amount of the lag angle from the position of the electrical advance angle 90 degrees from the excitation switching timing at the first magnetic pole section 6 a . when the rotor 3 rotates clockwise and the magnetized polarity of the second magnetic pole section 7 a is switched on the basis of the output of the fourth magnetic sensor 11 , the excitation switching timing for the second magnetic pole section 7 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between angle 45 degrees to 90 degrees . that is , the fourth magnetic sensor 11 is arranged in a position where the amount of the advance angle from the position of the electrical advance angle 0 degree from the excitation switching timing at the second magnetic pole section 7 a is larger than the amount of the lag angle from the position of the electrical advance angle 90 degrees from the excitation switching timing at the second magnetic pole section 7 a . the counterclockwise driving mode with low advance angle is described . even for the counterclockwise rotation , the driving mode with low advance angle can achieve larger torque than that in the driving mode with high advance angle . in the counterclockwise driving mode with low advance angle , the rotor 3 is rotated counterclockwise by switching excitation of each of the first magnetic pole sections 6 a in response to an output signal of the third magnetic sensor 10 and switching excitation of each of the second magnetic pole sections 7 a in response to an output signal of the fourth magnetic sensor 11 . the direction of the counterclockwise rotation of the rotor 3 corresponds to a second rotation direction opposite to the first rotation direction . in this driving mode , the energization direction of each of the first coil 4 and the second coil 5 is switched using combinations described below . when the third magnetic sensor 10 detects the south pole of the magnet 2 ( switching from the north pole to south pole ), its detection signal is input into the control circuit 13 . the control circuit 13 controls the driving circuit 14 such that the first magnetic pole section 6 a is magnetized with the south pole . when the third magnetic sensor 10 detects the north pole of the magnet 2 ( switching from the south pole to north pole ), its detection signal is input into the control circuit 13 . the control circuit 13 controls the driving circuit 14 such that the first magnetic pole section 6 a is magnetized with the north pole . when the fourth magnetic sensor 11 detects the south pole of the magnet 2 ( switching from the north pole to south pole ), its detection signal is input into the control circuit 13 . the control circuit 13 controls the driving circuit 14 such that the second magnetic pole section 7 a is magnetized with the north pole . when the fourth magnetic sensor 11 detects the north pole of the magnet 2 ( switching from the south pole to north pole ), its detection signal is input into the control circuit 13 . the control circuit 13 controls the driving circuit 14 such that the second magnetic pole section 7 a is magnetized with the south pole . in the state illustrated in fig1 a , both the third magnetic sensor 10 and the fourth magnetic sensor 11 detect the south pole of the magnet 2 . at this time , the control circuit 13 controls the driving circuit 14 such that the first magnetic pole section 6 a is magnetized with the south pole and the second magnetic pole section 7 a is magnetized with the north pole . this produces a counterclockwise rotation force in the rotor 3 and the magnet 2 . when the rotor 3 rotates counterclockwise from the state illustrated in fig1 a , the center q1 of the south pole of the magnet 2 and the center of the second magnetic pole section 7 a are opposed to each other , as illustrated in fig1 f . when the rotor 3 rotates counterclockwise from the state illustrated in fig1 f , the distance between the center q1 of the south pole of the magnet 2 and the second magnetic pole section 7 a is the same as the distance between the center q3 of the north pole of the magnet 2 and the first magnetic pole section 6 a , as illustrated in fig1 g . the fourth magnetic sensor 11 is arranged such that when the magnetized polarity of the second magnetic pole section 7 a is switched on the basis of the output of the fourth magnetic sensor 11 , the excitation switching timing for the second magnetic pole section 7 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between 0 degree to 45 degrees . the north pole of the magnet 2 ( switching from the south pole to north pole ) is detected between the state illustrated in fig1 f and the state illustrated in fig1 g . at this time , the driving circuit 14 energizes the second coil 5 such that the second magnetic pole section 7 a is magnetized with the south pole . because the third magnetic sensor 10 detects the south pole of the magnet 2 between the state illustrated in fig1 f and the state illustrated in fig1 g , the driving circuit 14 energizes the first coil 4 such that the first magnetic pole section 6 a is magnetized with the south pole . this produces the counterclockwise rotation force in the rotor 3 and the magnet 2 . when the rotor 3 rotates counterclockwise from the state illustrated in fig1 g , the center q3 of the north pole of the magnet 2 and the center of the first magnetic pole section 6 a are opposed to each other , as illustrated in fig1 h . when the rotor 3 rotates counterclockwise from the state illustrated in fig1 h , the distance between the center q3 of the north pole of the magnet 2 and the first magnetic pole section 6 a is the same as the distance between the center q3 of the north pole of the magnet 2 and the second magnetic pole section 7 a , as illustrated in fig1 i . the third magnetic sensor 10 is arranged such that when the magnetized polarity of the first magnetic pole section 6 a is switched on the basis of the output of the third magnetic sensor 10 , the excitation switching timing for the first magnetic pole section 6 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between angle 0 degree to 45 degrees . the third magnetic sensor 10 detects the north pole of the magnet 2 ( switching from the south pole to north pole ) between the state illustrated in fig1 h and the state illustrated in fig1 i . at this time , the driving circuit 14 energizes the first coil 4 such that the first magnetic pole section 6 a is magnetized with the north pole . because the fourth magnetic sensor 11 detects the north pole of the magnet 2 between the state illustrated in fig1 h and the state illustrated in fig1 i , the driving circuit 14 energizes the second coil 5 such that the second magnetic pole section 7 a is magnetized with the south pole . this produces the counterclockwise rotation force in the rotor 3 and the magnet 2 . as described above , in the counterclockwise driving mode with low advance angle , the energization of the first coil 4 and the second coil 5 is sequentially switched by the outputs of the third magnetic sensor 10 and the fourth magnetic sensor 11 , and the rotor 3 and the magnet 2 rotate in a counterclockwise direction . when the rotor 3 rotates counterclockwise and the magnetized polarity of the first magnetic pole section 6 a is switched on the basis of the output of the third magnetic sensor 10 , the excitation switching timing for the first magnetic pole section 6 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between angle 0 degree to 45 degrees . when the rotor 3 rotates counterclockwise and the magnetized polarity of the second magnetic pole section 7 a is switched on the basis of the output of the fourth magnetic sensor 11 , the excitation switching timing for the second magnetic pole section 7 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between angle 0 degree to 45 degrees . the counterclockwise driving mode with high advance angle is described . even for the counterclockwise rotation , the driving mode with high advance angle can achieve higher speed rotation than that in the above - described driving mode with low advance angle . in the counterclockwise driving mode with high advance angle , the rotor 3 is rotated counterclockwise by switching excitation of each of the first magnetic pole sections 6 a in response to an output signal of the first magnetic sensor 8 and switching excitation of each of the second magnetic pole sections 7 a in response to an output signal of the second magnetic sensor 9 . in this driving mode , the energization direction of each of the first coil 4 and the second coil 5 is switched using combinations described below . when the first magnetic sensor 8 detects the south pole of the magnet 2 ( switching from the north pole to south pole ), its detection signal is input into the control circuit 13 . the control circuit 13 controls the driving circuit 14 such that the first magnetic pole section 6 a is magnetized with the south pole . when the first magnetic sensor 8 detects the north pole of the magnet 2 ( switching from the south pole to north pole ), its detection signal is input into the control circuit 13 . the control circuit 13 controls the driving circuit 14 such that the first magnetic pole section 6 a is magnetized with the north pole . when the second magnetic sensor 9 detects the south pole of the magnet 2 ( switching from the north pole to south pole ), its detection signal is input into the control circuit 13 . the control circuit 13 controls the driving circuit 14 such that the second magnetic pole section 7 a is magnetized with the north pole . when the second magnetic sensor 9 detects the north pole of the magnet 2 ( switching from the south pole to north pole ), its detection signal is input into the control circuit 13 . the control circuit 13 controls the driving circuit 14 such that the second magnetic pole section 7 a is magnetized with the south pole . in the state illustrated in fig1 a , both the first magnetic sensor 8 and the second magnetic sensor 9 detect the south pole of the magnet 2 . accordingly , when the first magnetic pole section 6 a is magnetized with the south pole and the second magnetic pole section 7 a is magnetized with the north pole , the counterclockwise rotation force is produced in the rotor 3 and the magnet 2 . when the rotor 3 rotates counterclockwise from the state illustrated in fig1 a , the center q1 of the south pole of the magnet 2 and the center of the second magnetic pole section 7 a are opposed to each other , as illustrated in fig1 f . the second magnetic sensor 9 is arranged such that when the magnetized polarity of the second magnetic pole section 7 a is switched on the basis of the output of the second magnetic sensor 9 , the excitation switching timing for the second magnetic pole section 7 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between 45 degrees to 90 degrees . the second magnetic sensor 9 detects the north pole of the magnet 2 ( switching from the south pole to north pole ) between the state illustrated in fig1 a and the state illustrated in fig1 f . at this time , the driving circuit 14 energizes the second coil 5 such that the second magnetic pole section 7 a is magnetized with the north pole . because the first magnetic sensor 8 detects the south pole of the magnet 2 between the state illustrated in fig1 a and the state illustrated in fig1 f , the driving circuit 14 energizes the first coil 4 such that the first magnetic pole section 6 a is magnetized with the south pole . this produces the counterclockwise rotation force in the rotor 3 and the magnet 2 . when the rotor 3 rotates counterclockwise from the state illustrated in fig1 f , the state moves to the state illustrated in fig1 g , and then the center q3 of the north pole of the magnet 2 and the center of the first magnetic pole section 6 a are opposed to each other , as illustrated in fig1 h . the first magnetic sensor 8 is arranged such that when the magnetized polarity of the first magnetic pole section 6 a is switched on the basis of the output of the first magnetic sensor 8 , the excitation switching timing for the first magnetic pole section 6 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between 45 degrees to 90 degrees . the first magnetic sensor 8 detects the north pole of the magnet 2 ( switching from the south pole to north pole ) between the state illustrated in fig1 g and the state illustrated in fig1 h . at this time , the driving circuit 14 energizes the first coil 4 such that the first magnetic pole section 6 a is magnetized with the north pole . because the second magnetic sensor 9 detects the north pole of the magnet 2 between the state illustrated in fig1 g and the state illustrated in fig1 h , the driving circuit 14 energizes the second coil 5 such that the second magnetic pole section 7 a is magnetized with the south pole . this produces the counterclockwise rotation force in the rotor 3 and the magnet 2 . as described above , in the counterclockwise driving mode with high advance angle , the energization of the first coil 4 and the second coil 5 is sequentially switched by the outputs of the first magnetic sensor 8 and the second magnetic sensor 9 , and the rotor 3 and the magnet 2 rotate in a counterclockwise direction . when the rotor 3 rotates counterclockwise and the magnetized polarity of the first magnetic pole section 6 a is switched on the basis of the output of the first magnetic sensor 8 , the excitation switching timing for the first magnetic pole section 6 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between angle 45 degrees to 90 degrees . when the rotor 3 rotates counterclockwise and the magnetized polarity of the second magnetic pole section 7 a is switched on the basis of the output of the second magnetic sensor 9 , the excitation switching timing for the second magnetic pole section 7 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between angle 45 degrees to 90 degrees . fig1 a to 16d are illustrations for describing positions in which the first magnetic sensor 8 , the second magnetic sensor 9 , the third magnetic sensor 10 , and the fourth magnetic sensor 11 are arranged . as illustrated in fig1 a to 16d , the first magnetic sensor 8 in the motor 1 according to the present embodiment is arranged in a position that satisfies the following conditions . ( a ) in the clockwise driving , when the magnetized polarity of the first magnetic pole section 6 a is switched on the basis of the output of the first magnetic sensor 8 , the excitation switching timing for the first magnetic pole section 6 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between 0 degree and 45 degrees ( see fig1 a ). ( b ) in the counterclockwise driving , when the magnetized polarity of the first magnetic pole section 6 a is switched on the basis of the output of the first magnetic sensor 8 , the excitation switching timing for the first magnetic pole section 6 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between 45 degrees and 90 degrees ( see fig1 c ). the second magnetic sensor 9 in the motor 1 according to the present embodiment is arranged in a position that satisfies the following conditions . ( c ) in the clockwise driving , when the magnetized polarity of the second magnetic pole section 7 a is switched on the basis of the output of the second magnetic sensor 9 , the excitation switching timing for the second magnetic pole section 7 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between 0 degree and 45 degrees ( see fig1 b ). ( d ) in the counterclockwise driving , when the magnetized polarity of the second magnetic pole section 7 a is switched on the basis of the output of the second magnetic sensor 9 , the excitation switching timing for the second magnetic pole section 7 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between 45 degrees and 90 degrees ( see fig1 d ). the third magnetic sensor 10 in the motor 1 according to the present embodiment is arranged in a position that satisfies the following conditions . ( e ) in the clockwise driving , when the magnetized polarity of the first magnetic pole section 6 a is switched on the basis of the output of the third magnetic sensor 10 , the excitation switching timing for the first magnetic pole section 6 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between 45 degrees and 90 degrees ( see fig1 a ). ( f ) in the counterclockwise driving , when the magnetized polarity of the first magnetic pole section 6 a is switched on the basis of the output of the third magnetic sensor 10 , the excitation switching timing for the first magnetic pole section 6 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between 0 degree and 45 degrees ( see fig1 c ). the fourth magnetic sensor 11 in the motor 1 according to the present embodiment is arranged in a position that satisfies the following conditions . ( g ) in the clockwise driving , when the magnetized polarity of the second magnetic pole section 7 a is switched on the basis of the output of the fourth magnetic sensor 11 , the excitation switching timing for the second magnetic pole section 7 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between 45 degrees and 90 degrees ( see fig1 b ). ( h ) in the counterclockwise driving , when the magnetized polarity of the second magnetic pole section 7 a is switched on the basis of the output of the fourth magnetic sensor 11 , the excitation switching timing for the second magnetic pole section 7 a with respect to the rotation position of the rotor 3 corresponds to an electrical advance angle between 0 degree and 45 degrees ( see fig1 d ). in the present embodiment , in consideration of errors in magnetization of magnets , errors in dimensions of sensors , errors of yokes , each magnetic sensor is arranged in a range described below . the first magnetic sensor 8 is arranged in a range where the excitation switching timing for the first magnetic pole section 6 a in the clockwise driving corresponds to an electrical advance angle between 14 . 4 degrees and 33 . 6 degrees and the excitation switching timing for the first magnetic pole section 6 a in the counterclockwise driving corresponds to an electrical advance angle between 56 . 4 degrees and 75 . 6 degrees . the second magnetic sensor 9 is arranged in a range where the excitation switching timing for the second magnetic pole section 7 a in the clockwise driving corresponds to an electrical advance angle between 14 . 4 degrees and 33 . 6 degrees and the excitation switching timing for the second magnetic pole section 7 a in the counterclockwise driving corresponds to an electrical advance angle between 56 . 4 degrees and 75 . 6 degrees . the third magnetic sensor 10 is arranged in a range where the excitation switching timing for the first magnetic pole section 6 a in the clockwise driving corresponds to an electrical advance angle between 56 . 4 degrees and 75 . 6 degrees and the excitation switching timing for the first magnetic pole section 6 a in the counterclockwise driving corresponds to an electrical advance angle between 14 . 4 degrees and 33 . 6 degrees . the fourth magnetic sensor 11 is arranged in a range where the excitation switching timing for the second magnetic pole section 7 a in the clockwise driving corresponds to an electrical advance angle between 56 . 4 degrees and 75 . 6 degrees and the excitation switching timing for the second magnetic pole section 7 a in the counterclockwise driving corresponds to an electrical advance angle between 14 . 4 degrees and 33 . 6 degrees . the midpoint of a line segment connecting the first magnetic sensor 8 and the third magnetic sensor 10 corresponds to the electrical advance angle 45 degrees at the excitation switching timing for the first magnetic pole section 6 a . the midpoint of a line segment connecting the second magnetic sensor 9 and the fourth magnetic sensor 11 corresponds to the electrical advance angle 45 degrees at the excitation switching timing for the second magnetic pole section 7 a . this reduces variations in driving characteristics between the clockwise driving and the counterclockwise driving in the present embodiment . the present embodiment uses a sensor unit in which the first magnetic sensor 8 and the third magnetic sensor 10 constitute a single unit and the second magnetic sensor 9 and the fourth magnetic sensor 11 constitute a single unit . in this case , in the clockwise driving , the first magnetic sensor 8 is in the position where the excitation switching timing for the first magnetic pole section 6 a corresponds to the electrical advance angle 21 degrees , and the third magnetic sensor 10 is in the position where the excitation switching timing for the first magnetic pole section 6 a corresponds to the electrical advance angle 69 degrees . in the clockwise driving , the second magnetic sensor 9 is in the position where the excitation switching timing for the second magnetic pole section 7 a corresponds to the electrical advance angle 21 degrees , and the fourth magnetic sensor 11 is in the position where the excitation switching timing for the second magnetic pole section 7 a corresponds to the electrical advance angle 69 degrees . the present invention can provide a shutter device in which , when a driven member is driven by a stepping motor and thus a light shielding member moves from a closed state to an open state or from the open state to the closed state , a stepping motor does not lose synchronization . while the present invention has been described with reference to exemplary embodiments , it is to be understood that the invention is not limited to the disclosed exemplary embodiments . the scope of the following claims is to be accorded the broadest interpretation so as to encompass all such modifications and equivalent structures and functions . this application claims the benefit of international patent application no . pct / jp2013 / 080757 , filed nov . 14 , 2013 , which is hereby incorporated by reference herein in its entirety . | 6 |
the present invention utilizes chemically modified clay nanoparticles to significantly lower water permeation through acoustically clear polyurethane . the use of nanoparticle clay fillers allows avoidance of filler / acoustic clarity problems . this is because the amount of filler needed to achieve a large decrease in permeability is low , ca . 2 - 8 %. this minimizes the change in density , ρ , and sound speed , c . in order to form an intercalated nanocomposite , the appropriate particles must be selected . the particles should be stacks of particles having a mean diameter at least 100 times the mean thickness . in other words , preferably , the aspect ratio should be greater than 100 . an intercalated dispersion of the particles must be achieved . the polymer can then be allowed to polymerize between the plate - like particles to form a nanocomposite that functions as a permeation barrier similar to a tile roof on a building . the intercalated geometry is essential for proper functioning of the nanocomposite . if the particulates are too thoroughly dispersed or poorly dispersed , the scientific literature indicates that the desired decrease in permeability will not be realized . a considerable advantage of nanocomposites over traditional composites is that the large improvements in physical properties are achieved with relatively low filler loading levels . in some applications filler content is not a concern , but for acoustics , it is very important . as inorganic fillers such as clay particles are added to a polymer ; two critical variables , density and sound speed , will increase , and the composite &# 39 ; s acoustic clarity will degrade as a result . because of this , nanocomposites are intriguing for use as sensor encapsulants not only because of the great decrease in water permeability that may be realized , but also because these physical property enhancements occur at low filler levels ( about 5 % by weight ). thus , for the first time , it should be possible to make ultra - low permeability and acoustically clear composites . in order to make these kinds of nanocomposites , it is necessary to chemically modify the clay particulates . for charge balance , clay minerals typically contain cations such as na + , li + and ca 2 + between the individual sheets . chemical pretreatment is necessary to convert these normally hydrophilic silicate surfaces into organophilic surfaces that are compatible with polymers . suitable pretreatments include ion - exchange reactions with organic cations ( typically alkylammonium ions ), or alteration with silanes . the weight percentage of particles to polymer must be sufficient to provide barrier protection , but not so much as to interfere with the mechanical properties of the polymer . an ideal range of particle to polymer weight percentages is expected to be around 2 - 8 %. at this weight percentage the resulting material has essentially the same acoustic characteristics as the polymer without the particles . ( the addition of these particles may reduce permeability by a factor of 100 .) above this range , the material properties , including the acoustic properties decline . about 10 % would be the maximum amount of particles for use in acoustic applications . below 2 %, the particles offer an insufficient barrier to permeating gasses or fluids . the polymer resin is preferably a polyurethane resin having good acoustic properties . it has been found that the commercially available polyurethane resin uralite fh - 3140 manufactured by h . b . fuller has acceptable acoustic properties . this resin is used with the standard diamine curing agent . other polyurethane resins and curing agents having “ acoustically clear ” properties are expected to be acceptable , as well . once the clay particulates have been chemically pretreated , they are mixed into the polymer resin . the polymer resin infiltrates between the individual layers . a curing agent is added to the polymer resin mixture , and it polymerizes in situ . if the proper density of sheets / plates is achieved , the individual sheets will overlap each other , and the layers will function in a manner akin to shingles or tiles on a building roof . solution and melt intercalation methods can also be used to form the intercalated polymer . in the solution method the treated nanoparticles are placed in a polar organic solvent having the polymer dissolved therein . the solvent is allowed to evaporate leaving the polymer disposed between layers of the nanoparticles leaving a polymer composite having intercalated nanoparticles . in the melt intercalation method , treated nanoparticles are mixed into a molten thermoplastic . the molten thermoplastic is poured into place and allowed to cool resulting in a solid composite having intercalated nanoparticles . permeating molecules cannot pass through the sheets , and will need to spend a considerable amount of time moving mound each sheet to reach the next polymer - sheet layer , etc . thus , permeation though such a coating is greatly retarded , and might be so slow that it could be considered to be negligible during the planned lifetime of the underlying sensor . the development of specially - modified clay nanoparticulates / polyurethane composites with good acoustic characteristics is critical for the manufacture of miniaturized distributed sensors . fick &# 39 ; s first law is an important component of permeation theory : in this equation , “ j ” is the flux of the permeating material ; “ d ” is the diffusion coefficient ; “ c ” is the concentration of the permeable material ; and “ z ” is the thickness of the barrier coating . the flux of the permeating material , j , can also be expressed as a function of permeability : in this equation , s is the sorption coefficient , p h is the partial pressure of the diffusing species at the leading edge ; p l is the partial pressure of the diffusing species at the trailing edge : and “ ds ” is the permeability coefficient . the above expressions for flux indicate that j and z are inversely related . thus , if everything else remains the same , a reduction in z will result in an increase in the flux of permeating water , thereby shortening the useful working life of the coated device if conventional encapsulants are used . the introduction of clay nanoparticulates into a polymer reduces the flux of permeating water by lowering the diffusion constant , d . the addition of the modified clay nanoparticles has been shown to reduce permeability ( ds ) by at least an order of magnitude and possibly by several orders of magnitude in some polymers . if permeability were to be reduced by a factor of 100 by this method , then the thickness of the nanocomposite encapsulant layer could be reduced by the same factor while maintaining the same level of protection for the underlying sensor . if the thickness of the nanocomposite encapsulant layer were reduced only by a factor of 10 , then the level of protection for the underlying sensor would be ten times greater than what is possible with existing , unmodified encapsulants , and one would expect the sensor to function in the marine environment ten times longer than normal . a reduction in encapsulant thickness without a corresponding loss of protection is desirable by itself , because polymeric coatings , by their very nature , increase the volume and mass of the sensor , and also exhibit non - zero acoustic attenuation values . the thicker the encapsulant layer , the greater the amount of acoustic attenuation . attenuation disperses acoustic energy throughout the polymer as heat , and it can hamper or even prevent the detection of very weak , low - energy signals . thus , sensor designers would prefer to use the thinnest possible encapsulant layer that will still protect the underlying electronics for the desired period of time . the development of polymer - clay nanocomposites should enable a considerable reduction in encapsulant thickness ( and a corresponding increase in acoustic sensitivity ) without any decrease in performance or service life . significant improvements in barrier coatings would yield additional benefits to naval hardware . many marine components that include metal to polymer bonds fail because of a process known as “ cathodic delamination .” during cathodic delamination water and dissolved oxygen permeate through a protective polymeric coating ( encapsulant , paint , etc .) and reach an underlying , cathodically polarized metal surface . at the polymer - metal interface , a reaction occurs that generates hydroxide ions from the water and oxygen and free electrons in the metal . an osmotic potential is set up between the bond - line region and seawater that results in the formation of pressurized water blisters that debond the polymer from the metal surface . in some cases , the hydroxide ions might also directly attack the metal - polymer bond . coatings with greatly improved barrier properties could prevent , or at least significantly slow down , the cathodic delamination process , thereby extending the usable service lifetimes of many pieces of naval hardware . the potential savings in maintenance and replacement costs are considerable . in fig2 , there is shown a device 22 having a low permeability encapsulant 24 formed thereabout . the device 22 can be any kind of acoustic device known in the art . these devices include transducers , accelerometers , piezoelectric crystals , piezoelectric composites , fiber optic devices and the like . a communications path 26 extends from the device 22 . the encapsulant 24 is cast around the device 22 and communication path 26 according to well known methods . nanoparticles 28 are shown in the encapsulant 24 . this drawing is not to scale . with the methods taught herein , the encapsulant 24 can be thinner than previously known encapsulants while having the same or lower water permeability . it should be understood , of course , that the foregoing relates to preferred embodiments of the invention and that modifications may be made without departing from the spirit and scope of the invention as set forth in the following claims . | 8 |
referring now to the drawings , in which like reference numerals refer to like parts throughout , there is seen in fig1 a and 1b a spray wand , designated generally by reference numeral 100 , for use in spraying fluid , such as pesticide , herbicide , or other fluid . spray wand 100 includes telescoping sections that permit it to be used when in a fully extended position or conveniently stowed when in a fully collapsed position . advantageously , spray wand 100 minimizes any expulsion of any residual fluid that is contained within the wand sections when moved from its fully extended to its fully collapsed positions . before describing the functionality of spray wand 100 , its various structural components will be identified and described . in general , spray wand 100 comprises a handle 102 , a tube assembly 103 , and a structural framework 105 . more specifically , and with reference to fig2 , spray wand 100 extends along a longitudinal axis x - x and essentially comprises an elongated handle section 102 , an outer tube 104 and middle tube 106 that , when in their fully extended position , each co - linearly extend from the distal end of handle 102 , and an inner tube 108 that co - linearly extends from outer tube 104 . in its fully collapsed state , inner tube 108 telescopically fits within middle tube 106 which in turn telescopically fits within outer tube 104 , and outer tube 104 telescopically fits within handle section 102 . a trigger 110 pivotally mounted to handle section 102 includes a cam 112 that extends through handle section 102 and engages a cam follower 114 longitudinally movably housed within handle section 102 . manual movement of trigger 110 causes longitudinal displacement of cam follower 114 which in turn moves tube assembly 103 , thereby opening a fluid passageway that permits fluid to flow through and be expelled from wand 100 , as will be explained in greater detail hereinafter . a hose 116 longitudinally extends through the proximal end of handle section 102 and is contained there within by a cylindrical hose connector 118 which fluidly interconnects hose 116 to middle tube 106 . the hose 116 extends into a fluid filled container and serves to transport the fluid , via gravity ( although a pump could be employed ), from the container to middle tube 106 which then transports the fluid to inner tube 108 and for ultimately dispensing onto the surface / substance to be treated with the fluid . hose connector 118 extends partially within middle tube 106 and includes a circumferential groove 120 formed there around adjacent its distal end and within middle tube 106 . an o - ring 122 ( or other sealing mechanism / substance ) is securely positioned within groove 120 and sandwiched between the inner wall of middle tube 106 and hose connector 118 . thus , when the liquid passes through hose connector 118 and into middle tube 106 , o - ring 122 will prevent the fluid from leaking rearward and into handle 102 . additional grooves and o - rings could be added for further sealing if deemed necessary based on the intended use of sprayer 100 . hose connector 120 further comprises a circumferential groove 124 at an intermediate point there along and positioned adjacent and in abutting relation to the exterior of middle tube 106 . an outer tube housing 126 is partially positioned in the annular groove formed between the outer surface of middle tube 106 and the inner surface of outer tube 104 . the proximal end 127 of outer tube housing 126 is positioned within groove 124 to securely hold it in position . a shoulder 128 is formed adjacent the distal end of outer tube housing 126 and the proximal end of outer tube 104 abuts shoulder 128 and is sandwiched between the inner surface of handle 102 and the portion of outer tube housing 126 that extends from shoulder 128 to its distal end . cam follower 114 is contained within a cavity 130 formed at an intermediate position along outer tube housing 126 . as trigger 110 is manually moved from its neutral position to its active position , a spring is compressed and cam 112 engages the ramped surface of cam follower 114 , thereby moving / pushing cam follower 114 longitudinally proximally . cam follower 114 , in turn , ultimately engages outer tube assembly 103 pushing it proximally as well . as will be explained in greater detail hereinafter , the longitudinal proximal movement of cam follower 114 pulls middle tube 106 which in turn pulls inner tube 108 distally as well . this proximal movement of the tube assembly 103 opens a nozzle permitting the dispersion of liquid from spray wand 100 . when the trigger 110 is released and allowed to return to its neutral position , the spring ( which will be described in greater detail hereinafter ) decompresses and causes the longitudinal and distal movement of middle tube 106 and inner tube 108 , also resulting in the closing of the nozzle . this operation will be explained in greater detail after further describing the structure of spray wand 100 . with reference to fig4 , the junction of middle tube 106 and inner tube 108 is shown . a tube coupler 132 interconnects middle tube 106 in which it is entirely positioned and inner tube 108 . the exterior surface of tube coupler 132 slides via o - rings against the inner surface of middle tube 106 and the outward surface of inner tube 108 is assembled into the interior of tube coupler 132 . more specifically , a shoulder 134 is formed in the interior of tube coupler 132 and inner tube &# 39 ; s proximal end abuts shoulder 134 . in addition , a flanged coupler tube stop 136 is press fit into the distal end of middle tube 106 until its flanged end abuts the distal end of middle tube 106 . tube coupler 132 further comprises a pair of longitudinally spaced , circumferentially formed grooves 138 , 140 positioned proximally from shoulder 134 , and in which o - rings 142 , 144 , respectively , are positioned , to prevent leaking of any fluid that passes through middle tube 106 to inner tube 108 . to help protect the structural integrity of inner tube 108 , and provide structure to the overall wand 100 , a protective sheath 146 is positioned in co - linearly extending relation to and around inner tube 108 with an annular gap 148 positioned there between . sheath 146 is of an outer diameter that is smaller than the inner diameter of outer tube 104 and an inner diameter that is larger than the outer diameter of middle tube 106 , thereby permitting it to telescope into outer tube 104 and permit middle tube 106 to fit there within . a tube lock 150 is positioned in a portion of the annular gap 148 between sheath 146 and inner tube 108 . a tang 152 with outwardly biased fingers 154 extends proximally from tube lock 150 and into the gap between outer tube 104 and middle tube 106 . fingers 154 are manually movable towards the center - line of wand 100 and , as explained hereinafter , when depressed will permit sheath 146 and inner tube 108 to be telescopically slid proximally into outer tube 104 and middle tube 106 , respectively . a tube lock retainer 156 is mounted to the distal end of outer tube 104 and includes a flanged surface 158 that serves as an abutment to fingers 154 when in their neutral state and which prevent proximal movement of sheath 146 ( and , indirectly , inner tube 108 ). it is the manual movement of fingers 154 to a position unimpeded by flanged surface 158 that permits the proximal movement of sheath 146 and , indirectly , inner tube 108 . referring to fig5 , the final components comprising wand 100 are shown . more specifically , a shutoff valve 160 is positioned at the distal end of inner tube 108 and includes a shoulder 162 that abuts the distal end of inner tube 108 , a legged extension 164 that extends over and is attached to the outer surface of inner tube 108 , a fluid passage 166 that continues from inner tube 108 , an annular groove 168 that extends around the distal end of valve 160 and a second annular groove 170 that extends circumferentially and exteriorly around passage 166 . o - rings 172 and 174 are positioned within grooves 168 and 170 , respectively . a nozzle retainer 176 is mounted over the distal end of sheath 146 and includes a flange 178 that presses against and acts as a guide for the outer surface of the legged extension 164 of shutoff valve 160 , and together with shutoff valve 160 defines an annular gap 180 in which a spring 182 is positioned . spring 182 biases shutoff valve 160 towards the distal end of wand 100 and forces it into sealed relation with a nozzle 184 that is positioned at the distal - most position of wand 100 and extends over shutoff valve 160 and nozzle retainer 176 . nozzle 184 comprises a series of openings 186 in circumferentially spaced relation around its distal end surface 188 which is otherwise closed . spring 182 biases shutoff valve 160 ( and o - ring 172 ) into sealed relation with nozzle 184 preventing fluid from expelling through nozzle 184 . when trigger 110 is manually depressed , as will be explained in greater detail hereinafter , shutoff valve 160 is pulled proximally which permits fluid to flow through inner tube 108 and out of nozzle 184 . one final structural component of wand 100 is seen in fig1 a and 1b and comprises a button 190 that protrudes through an opening 192 formed through handle 102 adjacent the distal end thereof when wand 100 is in its fully extended position . to collapse wand 100 , a user would depress button 190 and then , after also depressing fingers 154 , slide sheath 146 , inner tube 108 , middle tube 106 and outer tube 104 all proximally . this will cause button 190 to slide within handle 102 towards an opening 194 formed at the proximal end of handle 102 and then pop through opening 194 when the assembly is fully collapsed , thereby locking wand 100 in its collapsed position . to operate wand 100 , it must be in its fully extended position . when fully extended , button 190 , as mentioned above , pops through opening 192 , fingers 154 bias outward and are prevented from proximal movement by tube lock retainer 156 and the entirety of components are locked in position . to pull liquid through hose 116 , trigger 110 is pressed downwardly towards handle 102 . when handle 110 is depressed , the cam 112 on trigger 110 engages and pushes proximally on cam follower 114 . the proximal movement of cam follower 114 , in turn , pulls middle tube 106 proximally . the components linking middle 106 to inner tube 108 ( coupler tube 132 and coupler tube stop 136 ) translate the proximal movement of middle tube 106 to inner tube 108 . the proximal movement of inner tube 108 , in turn , pulls shut - off valve 164 proximally as well , thereby permitting the fluid to pass through openings 186 formed in nozzle 184 . releasing trigger 110 causes the movable components to move distally via spring return and shut - off valve 186 to seat against the body 188 of nozzle 184 with o - ring 172 sealing off liquid from openings 186 . it is worth noting that o - ring 174 also provides sealing as shut - off valve 186 operates . wand 100 is collapsed in two stages : middle position retraction and full retraction . to collapse wand 100 to middle position retraction , fingers 154 are pressed inwardly and out of engagement with tube lock retainer 156 and inner tube 108 is slid proximally telescopically moving within middle tube 106 via retraction of the nozzle / sheath assembly . once this refraction is initiated , cam feature 112 on trigger 110 separates from cam follower 114 such that shut - off valve 160 remains closed ; the user is only able to open shut - off valve 160 via trigger 110 when wand 100 is fully extended . retraction to the middle position is complete when the end face of nozzle retainer 176 abuts tube lock retainer 156 . from this middle position , full retraction may be initiated by the user depressing button 190 out of engagement with opening 192 which releases outer tube 104 ( and its assembled components ) from its fixed position permitting proximal sliding movement thereof into handle 102 . full retraction is completed by pushing nozzle 184 proximally until button 190 engages opening 194 at which point the components are locked in their collapsed positions . referring to fig1 a - 10c , like the two stage retraction , extension is also accomplished in two phases : middle position extension and full extension . extension from the fully collapsed position to the middle phase extension is achieved by distally sliding nozzle 184 and inner tube 108 ( which indirectly follows nozzle 184 ) until the fingers 154 latch against tube lock retainer 156 ( see fig1 b ). continued extension from the middle position to full extension is initiated by depressing button 190 out of engagement with opening 194 and distally sliding outer tube 104 ( or alternatively sheath 146 which will pull the other components along with it ) until button 190 engages opening 192 at the distal end of handle 102 , thereby locking the assembly in its fully extended and operable position . | 1 |
the present invention has significant benefits across a broad spectrum of endeavors . it is the applicant &# 39 ; s intent that this specification and the claims appended hereto be accorded a breadth in keeping with the scope and spirit of the invention being disclosed despite what might appear to be limiting language imposed by the requirements of referring to the specific examples disclosed . to acquaint persons skilled in the pertinent arts most closely related to the present invention , a preferred embodiment that illustrates the best mode now contemplated for putting the invention into practice is described herein by , and with reference to , the annexed drawings that form a part of the specification . the exemplary embodiment is described in detail without attempting to describe all of the various forms and modifications in which the invention might be embodied . as such , the embodiments described herein are illustrative , and as will become apparent to those skilled in the arts , may be modified in numerous ways within the scope and spirit of the invention . although the following text sets forth a detailed description of numerous different embodiments , it should be understood that the detailed description is to be construed as exemplary only and does not describe every possible embodiment since describing every possible embodiment would be impractical , if not impossible . numerous alternative embodiments could be implemented , using either current technology or technology developed after the filing date of this patent , which would still fall within the scope of the claims . to the extent that any term recited in the claims at the end of this patent is referred to in this patent in a manner consistent with a single meaning , that is done for sake of clarity only so as to not confuse the reader , and it is not intended that such claim term by limited , by implication or otherwise , to that single meaning . further , terms such as “ pivoting portion ” and “ rear portion ” and other terms may be used interchangeably in some instances . a walker 100 with an adjustable strap 132 is shown in fig1 . the walker 100 in this particular embodiment comprises four portions disposed around the perimeter of the walker 100 . a right portion 108 is rigidly connected to a front portion 112 , which is rigidly connected to a left portion 104 . the connection between the left portion 104 and a rear portion 116 is a hinged connection 140 such that the rear portion 116 is rotatable about the hinged connection 140 relative to the remaining portions 104 , 108 , 112 . one skilled in the art will appreciate further embodiments where the connections between the portions 104 , 108 , 112 are not rigid . rather , in alternative embodiments the connections may be hinged or otherwise mobile to allow for articulation between the portions 104 , 108 , 112 . similarly , one skilled in the art will appreciate embodiments where the portions 104 , 108 , 112 are a single continuous portion . when the walker 100 is in a closed position , the rear portion 116 rotates about the hinged connection 140 and a distal end of the rear portion 116 contacts a first end of the right portion 108 . the distal end of the rear portion 116 and the first end of the right portion 108 may selectively connect to define a user region and secure and fully enclose the user within the walker 100 . this selective connection may include , but is not limited to , a latch - and - eyelet connection , a magnetic connection , a velcro ® connection , a snap fastener connection , a button connection , connections where a protrusion on the rear portion 116 is held in place in a channel or depression on the right portion 108 with a moveable lever or arm , and any other connection that selectively connects the distal end of the rear portion 116 and the first end of the right portion 108 . one skilled in the art will appreciate that the selective connection and hinged connection 140 in fig1 are merely exemplary in nature , and these connections may be positioned between any portions of the walker 100 in any combination . fig1 shows an adjustable strap 132 disposed between the front portion 112 and the rear portion 116 of the walker 100 . in this embodiment , the adjustable strap 132 is connected to the front portion 112 , and the adjustable strap 132 is operatively connected to a retraction device 128 , which is connected to the rear portion 116 . the adjustable strap 132 is generally centered on the front portion 112 , and the retraction device 128 is generally centered on the rear portion 116 . in other embodiments , the retraction strap 132 may include a retraction device 128 at both ends , and in yet further embodiments , the retraction strap 132 may have more than two ends disposed on one or more portions of the walker 100 . the retraction device 128 may be any device that retracts or extends an end of the adjustable strap 132 . examples of possible retraction devices 128 include , but are not limited to , a snubbing winch , a wakeskate winch , a glider winch , an air winch , a hoist , a pulley , and a winch puller . in addition , the possible sources of power for the retraction device 128 include , but are not limited to , an ac motor , a dc motor , hydraulic power , pneumatic power , solar power , an internal combustion engine , and a hand crank . embodiments of the retraction device 128 may include a ratchet and pawl system to prevent the adjustable strap 132 from inadvertently extending unless the pawl is retracted . again , one skilled in the art will appreciate embodiment of the present invention where the adjustable strap 132 has two or more ends , and more than one retraction device 128 is employed to retract or extend the two or more ends of the adjustable strap 132 . a seat 136 is optionally disposed on the adjustable strap 132 in the embodiment depicted in fig1 . the seat 136 may be connected or selectively connected at any point along the adjustable strap 132 . the seat 136 may be a conventional seat like a bicycle seat or a seat cushion . the seat 136 may also be an unconventional seat such as a bar or ball . in some embodiments , the seat 136 is a modular design . a receiving portion may be disposed on any point along the adjustable strap 132 . then a seat portion may be selectively connected to the receiving portion to provide a seat 136 on the adjustable strap 132 . with this two - piece configuration , a given walker 100 may accommodate any user and his or her personal seat . in some embodiments , the seat 136 and / or adjustable strap 132 may include lights such as leds or glow - in - the - dark materials or paints to illuminate the seat 136 and / or adjustable strap 132 in dimly - lit conditions . the walker 100 in fig1 comprises a left leg set and a right leg set . the right leg set comprises a fore leg 120 and an aft leg 124 . in this embodiment , the legs 120 , 124 each comprise a proximate end positioned on the right portion 108 and a distal end positioned near the ground . the proximate ends of the legs 120 , 124 are each disposed in a channel on the underside of the right side 108 . thus , the proximate ends of the legs 120 , 124 are allowed to translate positions along a longitudinal axis of the right side 108 . next , the fore leg 120 and the aft leg 124 are hingedly connected to one another at a midpoint of the fore leg 120 and a midpoint of the aft leg 124 or any other point along the fore leg 120 or aft leg 124 . therefore , as the proximate ends of the legs 120 , 124 translate positions in their respective channels , the legs 120 , 124 move about each other in a scissor - like fashion . the legs 120 , 124 may selectively lock in place in their respective channels when the legs 120 , 124 are in a collapsed position , when the legs 120 , 124 are in an extended position , or any position in between . the collapsibility of the leg sets allow for a compact reduction in size of the walker 100 . as mentioned above , the connections between the portions 104 , 108 , 112 , 116 may all be hinged or otherwise movable relative to one another . therefore , during operation the leg sets may be collapsed and the portions 104 , 108 , 112 , 116 may be folded against one another to form a fully collapsed walker 100 that may fit into a brief case or small location . in a further embodiment , hydraulic devices may be disposed on either side of the hinged connection between the fore leg 120 and the aft leg 124 such that extension and retraction of a hydraulic piston moves the legs 120 , 124 in a scissor - like fashion . one skilled in the art will appreciate other location to dispose the hydraulic pump such as in the above - mentioned channels among other locations . in addition , instead of having the portions 104 , 108 , 112 , 116 , some embodiments of the present invention may comprise only a single , continuous portion . in this embodiment , the scissor - like actuation of the legs 120 , 124 allows the walker 100 to collapse to the ground , then a user may position themselves over the adjustable strap , and the scissor - like movement of the legs 120 , 124 may raise the single , continuous portion upwards to enclose the user . the left leg set in fig1 is generally identical to the right leg set ; the left leg set comprise a fore leg and an aft leg . one skilled in the art will appreciate embodiments where the left leg set is not generally identical to the right leg set . further , one skilled in the art will appreciate embodiments of the present invention that have one leg set , no leg sets , or more than two leg sets . one skilled in the art will appreciate a variety of dimensions of the walker 100 . for example , in some embodiments , the left portion 100 is between approximately 42 ″ and 48 ″ in length , wherein “ approximately ” implies variation of +/− 10 %. in various embodiments , the left portion 100 is between approximately 30 ″ and 60 ″ in length . the right portion 108 may be identical in length to the left portion 104 in some embodiments . in alternative embodiments , the right portion 108 may comprise two pieces wherein the selective connection to define the user region exists between the two right portion 108 pieces and not between the right portion 108 and the rear portion 116 . in this embodiment , a fore piece of the right portion 108 is between approximately 32 ″ and 40 ″. in a preferred embodiment , the right portion 108 is 36 ″. an aft piece of the right portion 108 is between approximately 6 ″ and 12 ″. in a preferred embodiment , the aft piece of the right portion 108 is approximately 8 ″. fig2 shows a top plan view of a walker 100 with an adjustable strap 132 . from this view , the open and closed positions of the rear portion 116 are shown . in the closed position , a distal end of the rear portion 116 contacts a first end of the right portion 108 to define a user region and form a perimeter around the user . when the rear portion 116 is in an open position , the rear portion 116 is coaxial with the left portion 104 , and in other embodiments the rear portion 116 is not coaxial with the left portion 104 . in some embodiments , the rear portion 116 may lock into this open position . for example , a deflectable protrusion may be disposed on the proximate end of the rear portion 116 that deflects as the rear portion 116 is opening then extends or “ pops ” into place into a depression in a first end of the left portion 104 . a mechanically - linked or electronically - linked connection may depress the protrusion and allow the rear portion 116 to close . this protrusion - depression combination may be located anywhere on the walker 100 . fig3 shows a side elevation view of a walker 100 with an adjustable strep 132 . as in other embodiments described herein , four portions form a square or rectangle around a user , wherein an adjustable strap is disposed between a rear portion 116 and a front portion 112 . in the embodiment illustrated in fig3 , the walker 100 has four legs 144 that descend downwardly from the four connections between the four portions . the four legs 144 provide a way to adjust the height of the walker 100 . the legs 144 are telescoping in nature . that is , in this embodiment , a lower portion of a leg 144 is at least partially disposed in an upper portion of the leg 144 . the lower portion of the leg 144 is selectively positioned at various longitudinal lengths within the upper portion of the leg 144 . in one embodiment , a plurality of apertures is disposed on the outer surface of the upper portion of the leg 144 . the lower portion of the leg 144 comprises a deflectable protrusion that deflects , extends , or “ pops ” into place in one of the apertures of the upper portion . to adjust the position of the lower portion of the leg 144 , and thus the height of the walker 100 , a user may depress the protrusion on the lower portion of the leg 144 while simultaneously pushing or pulling the lower portion of the leg 144 to a different longitudinal position relative to the upper portion of the leg 144 . one skilled in the art will appreciate variations of the telescoping legs 144 . first , one skilled in the art will appreciate positions adjustment mechanisms beyond the aperture - protrusion combination . for example , the upper and lower portions of the leg 144 may slide freely relative to each other . a clamp disposed on the upper portion of the leg 144 may selectively press into the side of the lower portion of the leg 144 such that the longitudinal position of the lower portion is fixed relative to the upper portion of the leg 144 . in some embodiments , the upper portion of the leg 144 may be disposed within the lower portion of the leg 144 . in various embodiments , the telescoping leg 144 may comprise more than two portions . fig4 shows a front elevation view of the walker 100 with an adjustable strap 132 . similar to previous embodiments , the walker 100 in fig4 has four portions that form a rectangle or square around a user where an adjustable strap is connected to a rear portion 116 and a front portion 112 . the legs 144 are telescoping in nature , and the position of a lower portion of the legs 144 may be adjusted relative to the position of an upper portion of the legs 144 to adjust the height of the walker 100 . also shown in fig4 is a seat 136 positioned on the adjustable strap 132 . embodiments of the seat 136 as a two - piece design are discussed elsewhere herein , but one skilled in the art will appreciate further seat 136 designs . for example , in one embodiment the seat 136 is not secured to the adjustable strap 132 , and the position of the seat 136 is not fixed . in some embodiments , the seat 136 may comprise protrusions that contact the adjustable strap 132 to provide friction between the seat 136 and the adjustable strap 132 . thus , the seat 136 may translate positions along the adjustable strap 132 if a large enough force is applied to the seat 136 , but the seat 136 may remain in place relative to the adjustable strap 132 if the threshold force is not applied . in yet other various embodiments , the plurality of snap fasteners may be used to locate the seat 136 relative to the adjustable strap . the seat 136 may include a first portion of a snap fastener , and the adjustable strap 132 may include a plurality of second snap fastener portions . thus , the seat 136 may snap into a discrete number of locations along the adjustable strap 132 . fig5 depicts an alternative embodiment of the walker 100 with an adjustable strap 132 . in this embodiment , there are only two portions : the front portion 112 and the rear portion 116 . the front portion 112 has a segment with a radius at one end of the walker 100 . at the ends of the segment , the front portion 112 extends into two tubular sections that are a parallel to each other . the rear portion 116 is symmetric to the front portion 112 in this embodiment , and the two tubular sections from the front portion 112 meet the two tubular sections of the rear portion 116 at a hinged connection 140 and a selective connection . these connections may be any type of connections discussed elsewhere herein or otherwise commonly known in the art . four legs 144 are disposed at different locations on the walker 100 . in the embodiment illustrated in fig5 , two legs 144 are disposed on the rear portion 116 , and two legs 144 are disposed on the front portion 112 . the two legs 144 on the rear portion 116 are positioned symmetric to the two legs 144 on the front portion 112 about a lateral plane through the walker 100 . the two legs 144 on the right side of the walker 100 are positioned symmetric to the two legs 144 on the left side of the walker 100 about a longitudinal plane through the walker 100 . one skilled in the art will appreciate other embodiments that are not symmetric about one or both of these planes . fig6 depicts an embodiment of the walker 100 with an adjustable strap 132 wherein the front portion 112 and the rear portion 116 have segments comprising a radius . this embodiment further comprises a lower front portion 148 and a lower rear portion 152 that are shaped like the front portion 112 and rear portion 116 , respectively . however , the lower portions 148 , 152 are disposed closer to the ground surface and add rigidity and sturdiness to the overall walker 100 . the relative spacing between the portions 112 , 116 and the lower portions 148 , 152 can take many forms . for example , in the embodiment depicted in fig6 , the lower portions 148 , 152 are connected to the legs 144 , which in turn extend downward and contact the ground either directly or via another component such as wheels , without or without spring dampeners . in alternative embodiments , the legs 144 terminate at the lower portions 148 , 152 . then , wheels , skis , treads , etc . may be connected to the lower portions 148 , 152 . thus , in some embodiments , the lower portions 148 , 152 are disposed between approximately 0 ″ and 12 ″ from the ground . in various embodiments , the lower portions 148 , 152 are disposed between approximately 3 ″ and 8 ″ from the ground . the lower portions 148 , 152 may also be disposed more proximate to the front portion 112 and the rear portion 116 . in one embodiment , the lower portions 148 , 152 are disposed adjacent to the portions 112 , 116 to provide added rigidity and sturdiness to the overall walker 100 . in some embodiments , the lower portions 148 , 152 are spaced between approximately 0 ″ and 12 ″ below the portions 112 , 116 . in various embodiments , the lower portions 148 , 152 are spaced between approximately 3 ″ and 8 ″ below the portions 112 , 116 . one skilled in the art will appreciate that the lower portions 112 , 116 may be disposed at any point along the legs 144 , including the midpoint of the legs 144 . in addition , one skilled in the art will appreciate a variety of lower portion 148 , 152 combinations that add rigidity and sturdiness to the overall walker 100 . for example , the walker 100 may comprise more than one set of lower portions 148 , 152 . in some embodiments , there may be more than one lower portions that correspond to more than one portions as noted in above embodiments that comprise four portions arranged in a square or rectangle . in the embodiment depicted in fig6 , the lower portions 148 , 152 , are made of a tubular shaped material . in alternative embodiments , the lower portions 148 , 152 may be solid tubular portions or solid portions of another shape such as hexagonal . further yet , the lower portions 148 , 152 may be straps , ropes , cords , wires , magnetic couplings , etc . one skilled in the art will appreciate a variety of dimensions of the walker 100 in fig6 . for example , the overall longitudinal length of the front portion 112 is between approximately 12 ″ and 24 ″. in a preferred embodiment , the overall longitudinal length of the front portion 112 is approximately 18 ″. the overall longitudinal length of the rear portion 116 is between approximately 2 ″ and 16 ″. in a preferred embodiment , the overall longitudinal length of the rear portion 116 is approximately 6 ″. the height of the legs 144 is between approximately 20 ″ and 40 ″. in a preferred embodiment , the height of the legs 144 is approximately 30 ″. fig7 depicts an isometric view of a walker 100 that comprises an adjustable strap 132 and a plurality of planar support portions 156 and angled support portions 160 . the planar support portions 156 extend rearward of the left portion 104 and the right portion 108 . then , the rear portion 116 is disposed between the planar support portions 156 . from the point where the rear portion 116 and a planar support portion 156 meet , an angled support portion 160 descends downwardly at an angle from a generally horizontal plane . in this embodiment , the angled support portion 160 extends toward a leg 144 descending from the right portion 108 . similarly and symmetrically , an angled support portion 160 descends downwardly from a rear portion 116 - planar support portion 156 connection at an angle from a generally horizontal plane , and the angled support portion 160 extends toward a leg 144 descending from the left portion 104 . in the embodiment depicted in fig7 , the planar support portion 156 and the angled support portion 160 that are proximate to the left portion 104 are hingedly connected to the left portion 104 and the leg 144 that descends from the left portion 104 , respectively . this hinged connection allows the rear portion 116 , planar support portions 156 , and angled support portions 160 to fully enclose the user within a user region of the walker 100 . the hinged connection may be any hinged - type connection discussed elsewhere herein or otherwise commonly known in the art . in various embodiments of the invention , each of the planar support portion 156 and the angled support portion 160 proximate to the left portion 104 comprise a hinged connection to the left portion 104 and the leg 144 that descend from the left portion 104 , respectively . in alternative embodiments , an intermediate portion may extend between the distal ends of the planar and angled support portions 156 , 160 , and the intermediate portion is hingedly connected to the left portion 104 or the leg 144 descending from the left portion 104 . the planar support portion 156 and the angled support portion 160 that are proximate to the right portion 108 selectively connect to the right portion 108 and the leg 144 that descends from the right portion 108 , respectively . this selective connection allows a the combination of the rear portion 116 , the planar support portions 156 , and the angled support portions 160 to latch into place and define a user region and fully enclose the user . the selective connection may be any device or method discussed elsewhere herein or otherwise commonly known in the art . in various embodiments of the invention , an intermediate portion may extend between the distal ends of the planar and angled support portions 156 , 160 proximate to the right portion 108 , and the intermediate portion is selectively connected to the right portion 108 or the leg 144 descending from the right portion 108 . one skilled in the art will appreciate a variety of dimensions of the walker 100 in fig7 . in some embodiments , the width of the front portion 112 is between approximately 18 ″ and 26 ″. in a preferred embodiment , the width of the front portion 112 is approximately 20 ″. in various embodiments , the length of the planar support portions 156 is between approximately 2 ″ and 12 ″. in a preferred embodiment , the length of the planar support portions 156 is approximately 6 ″. the height of the legs 144 is between approximately 20 ″ and 40 ″. in a preferred embodiment , the height of the legs 144 is approximately 30 ″. fig8 depicts a walker 100 that has an upper frame and a lower frame wherein the frame have different dimensions . the upper frame &# 39 ; s length 164 represents the largest dimension of the upper frame &# 39 ; s ovoid shape . in some embodiments , the upper frame &# 39 ; s length 164 is between approximately 20 ″ and 40 ″. in other embodiments , the upper frame &# 39 ; s length 164 is between approximately 25 ″ and 35 ″. in one embodiment , the upper frame &# 39 ; s length 164 is 30 ″. a lower frame &# 39 ; s length 168 is the largest dimension of the lower frame &# 39 ; s ovoid shape . in some embodiments , the lower frame &# 39 ; s length 168 is between approximately 26 ″ and 46 ″. in other embodiments , the lower frame &# 39 ; s length 168 is between approximately 31 ″ and 41 ″. in one embodiment , the lower frame &# 39 ; s length 168 is 36 ″. in this embodiment , the lower frame is larger in size than the upper frame , but it will be appreciated that the lower frame may also be equal or smaller in size than the upper frame . the walker in fig8 also has an upper frame width 172 and a lower frame width 176 . in some embodiments , the upper frame &# 39 ; s width 172 is between approximately 12 ″ and 32 ″. in other embodiments , the upper frame &# 39 ; s width 172 is between approximately 17 ″ and 27 ″. in one embodiment , the upper frame &# 39 ; s width 172 is 22 ″. in some embodiments , the lower frame &# 39 ; s width 176 is between approximately 17 ″ and 37 ″. in other embodiments , the lower frame &# 39 ; s width 176 is between approximately 22 ″ and 32 ″. in one embodiment , the lower frame &# 39 ; s width 176 is 27 ″. in this embodiment , the lower frame is larger in size than the upper frame , but it will be appreciated that the lower frame may also be equal or smaller in size than the upper frame . the upper frame and the lower frame of the walker 100 are separated by a predetermined distance known as the frame distance 180 . in some embodiments , the frame distance 180 is between approximately 20 ″ and 40 ″. in other embodiments , the frame distance 180 is between approximately 25 ″ and 35 ″. in one embodiment , the frame distance 180 is 30 ″. the walker 100 depicted in fig8 also has a number of components . a control 184 allows a user to operate the retractable or adjustable strap among other functions discussed elsewhere herein . the outlet plug 188 communicates electrical energy from an outlet to the walker 100 . it will be appreciated that the outlet plug is not the only way to energize the walker 100 . the walker 100 may be battery - powered , or powered by any other source of energy described elsewhere herein . the seat 136 in this embodiment comprises a seat belt , which may be used to secure a user to the seat 136 and prevent the user from slipping off of the seat 136 . the legs 144 in fig8 are spring - loaded , meaning that the legs 144 comprise a spring disposed at a lower end of the legs 144 to provide a dampening effect as the walker 100 is used and moved . the walker 100 also comprises a banner 192 disposed under the upper frame . the banner 192 can display messages for walker &# 39 ; s 100 user . for example , the banner 192 may indicate what medications the user is taking or other medical signals . further , the banner 192 may include messages about the user such as “ i am a vietnam veteran ”, the user &# 39 ; s church information , holiday slogans , or other identifying information about the user , the user &# 39 ; s location , or the user &# 39 ; s environment . the banner 192 in this embodiment is interconnected underneath the top frame . however , it will be appreciated that the banner 192 may be interconnected to any component of the walker , including , but not limited to , the lower frame , the seat , the strap , the power source , the legs , the wheels , the controls , and any positions on these components . for example , on the front section of the upper frame or the rear section of the upper frame , facing inward or outward . the banner may be interconnected to the walker 100 using any means commonly known in the art . this may include glue , screws , velcro ®, hook - and - loop fasteners , etc . the exemplary devices and methods of this disclosure have been described in relation to a walker with an adjustable strap and associated devices . however , to avoid unnecessarily obscuring the present disclosure , the preceding description omits a number of known structures and devices . this omission is not to be construed as a limitation of the scopes of the claims . specific details are set forth to provide an understanding of the present disclosure . it should however be appreciated that the present disclosure may be practiced in a variety of ways beyond the specific detail set forth herein . a number of variations and modifications of the disclosure can be used . it would be possible to provide for some features of the disclosure without providing others . although the present disclosure describes components and functions implemented in the aspects , embodiments , and / or configurations with reference to particular standards and protocols , the aspects , embodiments , and / or configurations are not limited to such standards and protocols . other similar standards and protocols not mentioned herein are in existence and are considered to be included in the present disclosure . moreover , the standards and protocols mentioned herein and other similar standards and protocols not mentioned herein are periodically superseded by faster or more effective equivalents having essentially the same functions . such replacement standards and protocols having the same functions are considered equivalents included in the present disclosure . the present disclosure , in various aspects , embodiments , and / or configurations , includes components , methods , processes , systems and / or apparatus substantially as depicted and described herein , including various aspects , embodiments , configurations embodiments , subcombinations , and / or subsets thereof . those of skill in the art will understand how to make and use the disclosed aspects , embodiments , and / or configurations after understanding the present disclosure . the present disclosure , in various aspects , embodiments , and / or configurations , includes providing devices and processes in the absence of items not depicted and / or described herein or in various aspects , embodiments , and / or configurations hereof , including in the absence of such items as may have been used in previous devices or processes , e . g ., for improving performance , achieving ease and / or reducing cost of implementation . the foregoing discussion has been presented for purposes of illustration and description . the foregoing is not intended to limit the disclosure to the form or forms disclosed herein . in the foregoing detailed description for example , various features of the disclosure are grouped together in one or more aspects , embodiments , and / or configurations for the purpose of streamlining the disclosure . the features of the aspects , embodiments , and / or configurations of the disclosure may be combined in alternate aspects , embodiments , and / or configurations other than those discussed above . this method of disclosure is not to be interpreted as reflecting an intention that the claims require more features than are expressly recited in each claim . rather , as the following claims reflect , inventive aspects lie in less than all features of a single foregoing disclosed aspect , embodiment , and / or configuration . thus , the following claims are hereby incorporated into this detailed description , with each claim standing on its own as a separate preferred embodiment of the disclosure . moreover , though the description has included description of one or more aspects , embodiments , and / or configurations and certain variations and modifications , other variations , combinations , and modifications are within the scope of the disclosure , e . g ., as may be within the skill and knowledge of those in the art , after understanding the present disclosure . it is intended to obtain rights which include alternative aspects , embodiments , and / or configurations to the extent permitted , including alternate , interchangeable and / or equivalent structures , functions , ranges or steps to those claimed , whether or not such alternate , interchangeable and / or equivalent structures , functions , ranges or steps are disclosed herein , and without intending to publicly dedicate any patentable subject matter . | 0 |
most boresight components are in fixed relationships relative to each other , with no adjustment provisions . the boresight device is adjusted to zero outpointing error during fabrication , being fabricated as a sealed system . the only sources of error , then , are vibrational and thermal gradients . the devices are designed to be inherently insensitive to in - flight vibrations . it has not been possible heretofore however to design for inherent thermal insensitivity . the boresighting device herein is so designed . the thermally sensitive transfer prism has been eliminated , and the number of optical components has been minimized . as indicated , this invention contemplates a zero - expansion glass ceramic polygonal spacer . the spacer is equal in length to the separation between apertures to be boresighted and is provided with 45 degree parallel end faces , and a longitudinal bore therein forming an optical path therethrough from end face to end face . a dichroic beamsplitter plate is secured by optical temperature nullifying means to the first end face at a 45 degree angle to the entering radiation so that it reflects entering radiation into the polygonal spacer . a corner cube prism is placed to receive a transmitted portion of the incoming radiation from the beamsplitter plate for retroreflection , as the remaining portion of incoming radiation is reflected off the beamsplitter plate through the bore in the polygonal spacer . a reflective collimator is positioned to focus onto a wavelength converting material the portion of incoming radiation thus reflected so that re - emitted , excited radiation fills the entire aperture of the collimator . by optical temperature nullifying means an opaque , annular , elliptical front surface mirror is secured to the second parallel face of the polygonal spacer so that it projects a beam of the excited radiation to the flir system parallel to the retroreflected line - of - sight . the invention can perhaps best be understood from a description thereof in conjunction with the accompanying drawings in which : fig2 is a similar view showing the boresighting device of this invention ; fig3 is another embodiment of the boresighting device of the invention ; and fig4 and 6 show the obscuration improvement of the preferred embodiment of fig3 . referring first to fig1 a currently used boresighting device 1 is shown which includes dayside optics 2 with its window 3 and nightside optics 4 with window 7 spaced to be opposite day and night windows 6 and 8 ( fig3 ) of an optical instrument , such as target acquisition designator system ( tads ) laser designator 10 , housing the optical components to be aligned . the day optics includes not only window 3 , but risley prism 5 . since the forward looking infrared ( flir ) cannot sense laser energy a collimator 14 is employed including a refractory material 15 which glows in response to laser radiation . alignment of the optical instrument components is based upon the principle of retroreflection . this is accomplished by firing the laser through the boresighting module day optics 2 into a corner cube or prism 16 so that the image is retroreflected by the corner cube to be imaged by the day view optics behind day window 6 . the dtv is boresighted to the laser by pointing the common dtv / laser aperture into the boresight module and firing the laser through the boresight module day optics ( generally 2 ). the light energy is relayed through a transfer prism 20 to the corner cube 16 and hence , to the day view optics reticles . the retroreflected beam from corner cube 16 is imaged by the dtv . the optical path from the corner cube to the dtv thru the transfer prism 20 can be seen in fig1 the path being the same in all of the figures . electronic raster positioning is used to align the electrically generated dtv reticle with the centroid of the imaged laser return . the dtv now serves as a reference for boresighting the direct view optics . the nightside assembly is indirectly boresighted to the dtv because , as indicated , it does not respond to laser energy . alignment is accomplished through dtv tracking of a laser - generated spot in the boresight module . the laser irradiates a refractory transducer material 15 which converts the laser energy to thermal energy which is re - emitted and can be sensed by the flir system . since this conversion occurs in the focal plane of a collimator , the effect is analogous to a retroreflector , and both day and nightside spots are reflected similarly . the flir spot is imaged on the eo multiplexer raster , and is positioned ( i . e . tracked ) so that the nsa reticle is aligned to the spot image . it is to be noted that transfer prism 20 , corner cubes 16 , and the windows 4 , 6 and 8 are slightly tilted so that their surfaces are nonreflective . as indicated in my background of the invention , the boresighting device shown in fig1 overcomes nearly all of the problems encountered except displacement due to thermal expansion of parts such as the transfer prism . the problem is overcome herein not only by the use of a hollow transfer tube , but one fabricated of a nonexpanding , or zero expansion , glass ceramic . as is evident in fig2 the polygonal transfer tube 22 replaces transfer prism 20 . preferably it is a rhomboid spacer having a longitudinal bore 23 therein forming an optical path therethrough from beamsplitter 24 to mirror 26 in abutment with each of the two end faces of the rhomboid spacer . the hollow center , or longitudinal bore 23 , within rhomboid spacer 22 insures that there are no transfer medium thermal effects . thermal effects are also obviated by the rhomboid spacer itself . crystals of beryllium and silicon oxides have hexagonal structures , and hence high coefficients of expansion . silicates have lower coefficients of expansion than beryllia and silica but their lattices are still not so closely packed that they do not expand . lithium alumino silicates in the form of the glass ceramics beta - eucryptite and beta - spodomene , however have negative coefficients of expansion in the 0 ° to 1000 ° c . range . these glass ceramics have a beta - quartz structure with aluminum and lithium ions filling holes in the crystal lattice . at 720 ° c . lial ( sio 3 ) 2 is converted into its beta form ( lial ) o 2 . sio 2 . this beta quartz structure thus is an essential constituent of zero expansion ceramics . such ceramics are available commercially , one such product being sold as zerodur , a glass ceramic having both glass - like and crystalline phases . zerodur contains 70 to 78 percent by weight crystalline phase with the structure of a high - temperature or beta quartz . it is to be understood that , like beta quartz , the various optical elements are also well known . thus corner cube or tetrahedron 16 is fabricated of mirrors at right angles to one another or as a solid prism so that incident and reflected rays travel along identical paths . risley prisms and beamsplitters , and mirrors , 5 , 24 and 26 , are too well known to require definition . another feature of this invention is that no bonding agents subject to temperature changes , are employed . as is evident in fig3 the various optical elements are secured within enclosure or case 34 by kinematic means which isolate thermal effects of the housing and mounting stresses from the optical components . in addition , dichroic beamsplitter 24 and mirror 26 are optically polished and optically connected against polished spacer tube end faces , providing a molecular bond therebetween , with no changes in angular relation over a varying temperature range . a possible drawback of the form of boresighting device exemplified in fig1 and 2 is the prism protrusion into the collimator resulting in a detrimental obscuration and an unsymmetrical aperture as a consequence of a centroid shift . this asymmetric aperture with obscuration 30 is shown in fig4 as viewed through 1 -- 1 of fig1 and it is due to the placement of the collimator at a 90 ° angle to the transfer prism . there is also an obscuration 30 in the embodiment shown in fig2 which is 2 -- 2 shown in fig5 . in the preferred embodiment of the invention illustrated in fig3 the collimator 14 is in alignment with transfer tube 20 . the longitudinal center line of transfer tube 20 passes through the collimator center . this effects only a centric collimator obscuration 32 as shown in fig6 as viewed through 3 -- 3 of fig3 . another advantage of the hollow transfer spacer over a solid prism is that the hollow spencer , having no optical surfaces which are at normal incidence to the incoming laser beam , can be mounted parallel to the system to be boresighted while the solid prism must be tilted in both directions ( azimuth and elevation ) so that entrance and exit surfaces do not reflect and &# 34 ; blind &# 34 ; the system . the operation of the boresighting device has been described in conjunction with the prior art device . hence it remains only to show the advantage of the invention in terms of temperature stability and resulting effects on lines - of - sight changes . optical sensitivities can be viewed in terms of optical path length differences and resultant angular errors , in microradians , of the lines - of - sight . to show this displacement as a function of temperatures the following calculation is given . due to severe temperature exposure of military equipment , such as the subject boresight module , small temperature gradients in optical components can have devastating effects on boresight accuracy when requirements are of microradian magnitudes . comparing the solid transfer prism of fused silica ( quartz ) in the prior art with the hollow transfer zero - expansion spacer of the invention we have the following : the optical path length between day and nightsides is 12 . 23 inches in both cases with a transfer aperture of 1 inch . quartz has an expansion coefficient dl / l of 0 . 51 × 10 - 6 and a refractive index change coefficient dn / dt /° c . of 10 × 10 - 6 . the expansion coefficient of the zero - expansion spacer of the invention is 0 ± 0 . 05 × 10 - 6 and the index drops out because it is air in case of the hollow tube . calculating the line of sight ( los ) error for the quartz transfer prism yields : ## equ1 ## where : δ . sub . θ = los error in microradians there is no error ( δ . sub . θ ) due to temperature using the spacer tube of the invention . actual probative work was conducted to test the foregoing calculations . in so doing , two boresight modules ( bsms ) were tested , one containing a quartz transfer prism ( prior art ) and the other a hollow ( zerodur ) spacer ( invention ). a helium - neon ( he ne ) laser beam entered the bsm dayside window , focused by the bsm collimator onto a lambertian diffuser and re - emitted through the nightside bsm window into a long focal length collimator where it impinged onto a silicon quadrant detector . translation of this detector in the test collimator &# 39 ; s focal plane enabled precise centroid tracking in azimuth and elevation as the exiting bsm line - of - sight ( los ) would drift due to temperature effect when the modules were placed in a temperature chamber and cycled . results were as follows : table______________________________________bsmlos drifts in microradians 60 ° f . temp . 156 ° f . temp . range ( 40 °/ h ) range ( 100 °/ h ) azimuth elevation azimuth elevation______________________________________prior art + 82 + 58 + 500 + 400 ( quartz prism ) - 96 - 5 - 600 - 130invention + 8 + 28 + 25 + 100 ( zerodur tube ) - 30 - 16 0 - 90______________________________________ as is evident from the table , the zerodur bsm shows marked los drift reductions . even though test equipment limitations and mechanical bsm problems prevented closer correlation with theory , the boresighting module of this invention thus shows a significant line - of - sight drift reduction due to temperature changes . it will be appreciated that the invention herein can be used in the boresighting of optical systems other than those used with laser designator ranger systems . in addition , as can be seen from the description of fig2 and 3 , the invention is applicable to various boresighting devices . such variations and ramifications are deemed to be within the scope of this invention . | 6 |
embodiments of the present invention will be described with reference to the accompanying drawings . first , a basic configuration of an electron beam measurement apparatus according to the present invention will be described . fig2 is a diagram showing the basic configuration of the electron beam measurement apparatus according to the present invention . the electron beam measurement apparatus has an electron optical system 201 , a secondary electron detector 208 , a reflective electron detector 215 , a computing unit 209 , a display unit 210 , a storage unit 211 , and an electron optical system controller 212 . the electron optical system 201 uses a condenser lens 203 , a deflector 204 and an objective lens 205 to irradiate a sample ( wafer ) 207 placed on a stage 206 with an electron beam emitted by an electron gun 202 and scan the sample . the secondary electron detector 208 is adapted to detect the intensity of a charged particle ( secondary electron ) secondarily generated from the sample 207 by the irradiation of the electron beam . the reflective electron detector 215 is adapted to detect the intensity of a charged particle ( reflective electron ) secondarily generated from the sample 207 by the irradiation of the electron beam . the computing unit 209 is adapted to process the waveform of a signal obtained from the detected charged particle to calculate a characteristic value . the display unit 210 displays , through an input performed by an operator , a scanning electron microscope ( sem ) image . the storage unit 211 stores data . the electron optical system controller 212 reflects a condition for the irradiation with the electron beam to the electron optical system to control the electron optical system . it should be noted that reference numeral 213 shown in fig2 denotes flow of data ( e . g ., flow of a computed result ) to be stored in the storage unit 211 , and reference numeral 214 shown in fig2 denotes flow of data read out from the storage unit 211 . fig3 is a flowchart showing a basic measurement according to the present invention . first , coordinates of an area to be measured are acquired in step 301 . the scanning electron microscope ( sem ) image of the region located at the coordinates is acquired by means of a secondary electron in step 302 . data on the acquired image is stored in the storage unit 211 in step 303 . patterns within the acquired image are classified into two groups ( group 1 and group 2 ) in accordance with a predetermined rule in step 303 . the size of a portion of a pattern of each group is calculated in accordance with a predetermined algorithm in steps 305 and 306 . it can be determined whether or not each exposure process is properly performed by determining whether or not each calculated size is in a predetermined range . if there is a group including a pattern having a portion of which the size is not in a predetermined range , a process condition for a corresponding exposure process is reviewed . in the abovementioned way , it is possible to control processes of a multi - exposure method according to the present invention . the present embodiment will be described with reference to fig4 . in the present embodiment , an sem image of the sample in the state shown in fig1 g is acquired . fig9 is a schematic diagram showing the sem image . a pattern shown in fig9 is part of a flash memory pattern . a portion of the pattern shown in fig9 , which corresponds to a portion ( at which the hard mask layer hm remains after a first exposure ) of the sample , has higher contrast with the substrate than that of a portion of the pattern shown in fig9 , which corresponds to a portion ( at which the hard mask layer hm does not remain and the processed layer remains after a second exposure ) of the sample . as an example of the classification method shown in fig3 , it is possible to classify patterns into two patterns : a pattern delineated by the first exposure ; and a pattern delineated by the second exposure , in accordance with brightness of the patterns ( in step 401 ). when the pattern includes a defect , it is possible to easily determine which exposure process has a problem . in addition , the algorithm for calculating the size of a portion of the pattern can be changed to another algorithm for calculating the size of the portion . an sem image of a certain portion ( of the pattern ) is viewed differently from an sem image of another portion ( of the pattern ) having a height different from that of the certain portion and having other dimensions that are the same as those of the certain portion . it is therefore necessary to change the algorithm based on the portion of the pattern in order to optimally measure the portion . in the present embodiment , the size of the portion of the pattern is calculated based on coordinates of an intersection of a signal waveform and a slice level . a slice level for the hard mask layer hm is high , while a slice level for the processed layer tl is low . it is possible to set a plurality of slice levels in the electron beam measurement apparatus according to the present embodiment . in the present embodiment , dimensional control is carried out by using the average of widths of a plurality of lines formed in each layer as the size of a portion of the pattern . however , the dimensional control may be carried out by using the width of one line located at a central portion of each layer . in order to classify patterns into groups , it is effective to use a difference between white bands . the white bands are waveforms of signals coming from edge portions of the patterns when an sem performs irradiation with an electron beam . in addition , reference waveforms may be used to calculate the sizes of pattern portions . in a conventional technique , a measurement error between a first exposure layer and a second exposure layer is 3 nm . according to the present invention , however , a measurement error between exposed layers is 0 . 2 nm . in addition , although a reproducible error in the conventional technique is 0 . 6 nm , a reproducible error in the present invention is 0 . 3 nm . fig5 is a flowchart of the measurement according to a second embodiment of the present invention . in the measurement shown in fig5 , after an sem image is acquired , patterns are classified into groups by comparing the sem image with design data , in step 501 . in the pattern ( shown in fig9 ) having lines and spaces which are alternately arranged , matching of the pattern may be performed with a single pitch shifted . this measurement method shown in fig5 is suitable for a logic lsi having a complex pattern . it can be considered that a combination of this measurement method shown in fig5 with the classification method based on the brightness in the first embodiment is effective . according to the present embodiment , the contour of a portion of each pattern is detected , and the length of the contour is evaluated , to inspect a hot spot ( which is a location at which a defect is likely to occur ). as a result , detection sensitivity can be improved in the present embodiment , compared with the conventional technique . fig6 is a flowchart showing a measurement according to a third embodiment of the present invention . in the present embodiment , a plurality of images is used . after the sample is moved to a location defined by coordinates of an area to be imaged , a single sem image is acquired under a first condition in step 601 , and a single sem image is acquired in step 602 under a second condition different from the first condition . under the first condition , the number of times of scanning of an observation area is eight . under the second condition , the number of times of television scanning of the observation area is 32 . the reason for acquiring the images under the conditions different from each other is that the intensity of a signal coming from the processed layer is low . thus , the number of times of the scanning under the second condition is 32 in order to improve a signal - to - noise ratio . the intensity of a signal coming from the hard mask layer is too high when the image acquisition is performed under the second condition . thus , a detected signal is saturated . after the patterns are classified , the size of the hard mask layer is obtained based on the image acquired under the first condition , and the size of the processed layer is obtained based on the image acquired under the second condition . as a result , a reproducible error is reduced to 0 . 25 nm . fig7 is a flowchart showing a measurement according to a fourth embodiment of the present invention . in the fourth embodiment , a plurality of images is used . the sample shown in fig1 f is used only in the fourth embodiment . after the sample is moved to a location defined by acquired coordinates of an area to be measured , a single sem image is acquired by using a secondary electron in step 701 and a single sem image is acquired by using a reflective electron in step 702 . the second resist layer rl 2 shown in fig1 f can be easily observed . it is not easy to observe the hard mask layer hm since the hard mask layer hm is covered with the antireflection film barc . in order to observe the hard mask layer hm , a reflective electron is used . this results from the fact that the escape depth ( to allow the reflective electron to escape from the sample ) of the reflective electron is large . fig1 a and 10b are diagrams showing the image ( secondary electron image ) acquired by using the secondary electron and the image ( reflective electron image ) acquired by using the reflective electron image , respectively . in the secondary electron image shown in fig1 a , an image of the second resist layer rl 2 is observed . in the reflective electron image shown in fig1 b , an image of the second resist layer rl 2 and an image of the hard mask layer hm are observed . in this method , the two images can be acquired simultaneously . the throughput of the electron beam measurement apparatus is therefore not reduced . in addition , it is easy to classify the patterns into groups based on the two images . the size of the second resist layer rl 2 is obtained by using the second electron image having high contrast , while the size of the hard mask layer hm is obtained by using the reflective electron image having contrast . as a result , the sample shown in fig1 f ( which cannot be measured by a conventional technique ) can be measured with a reproducible error of 0 . 5 nm . in addition , since the processed layer tl is not etched in the state shown in fig1 f , it is easy to reproduce the sample by re - performing the manufacturing process from the exposure process . fig8 is a flowchart showing a measurement according to a fifth embodiment of the present invention . after patterns are classified into groups , a relative positional relationship between the groups is detected in step 801 . this is different from the other embodiments . the relative positional relationship between the groups means the amount of a superposition error between a pattern subjected to an exposure and a pattern subjected to another exposure . more specifically , the relative positional relationship ( positional error ) in an x direction is obtained by using the center of the contour ( extending in a y direction ) of the pattern as a reference , while the relative positional relationship ( positional error ) in a y direction is obtained by using the center of the contour ( extending in an x direction ) of the pattern as a reference . the superposition error between the pattern subjected to the exposure and pattern subjected to the other exposure is very important in order to measure the length of a space between the pattern portions , and the size of a portion of the pattern subjected to a multi - exposure . since this method is not carried out in conventional techniques , it is necessary that the apparatus automatically classify the patterns into groups . in the present embodiment , after the patterns are classified based on the brightness , and the contour of each pattern is obtained , the superposition error is obtained . when the superposition error is large , the exposure process is re - performed . this contributes to improvement in the yield of semiconductors . in the embodiments of the present invention , a scanning electron microscope using an electron beam is described as an example . the basic concept of the present invention is not limited to this . another microscope using a charged particle beam such as an ion beam can be applied to the present invention . according to the present invention , it is possible to measure , with high accuracy , the sizes of portions ( having shapes different from each other in a vertical direction ) of a pattern on a sample subjected to a multi - exposure and a relative positional relationship between groups . furthermore , it is possible to smoothly control a lithographic process and an etching process . | 7 |
in accordance with this invention a turbine blade , a method of manufacture of a turbine blade and a method of repair of a turbine blade is provided . in fig2 - 7 a newly manufactured or repaired turbine blade 10 is shown which is made of at least two pieces and generally comprises a blade body 16 and a tip section 19 . the blade body has a blade root 11 , a blade platform 17 and a first airfoil portion 18 . the tip section 19 has a tip cap 20 and a second airfoil portion 21 . in one embodiment as shown in fig3 a , 3 b , 5 a and 5 b the tip cap 20 also has a squealer tip 22 . the newly manufactured or repaired blade is an assembly of the blade body 16 and tip section 19 using a suitable bonding method such as thermal or thermo - mechanical diffusion bonding , brazing , welding , etc . when a new blade is made in accordance with the invention , the blade body 16 is manufactured without any tip cap ( see fig2 a and 2 b ). the blade body 16 is produced slightly longer than needed . no special attachment platforms , protrusions , or devices are required to be added to the blade body 16 to facilitate the attachment of the tip section 19 . a tip section 19 is manufactured separately ( see fig3 a , 3 b , 4 a and 4 b ). similarly , the tip section 19 is produced slightly longer than needed . using additional processes , the tip section maybe coated with an abrasive in order to improve its resistance to rubbing . the blade body 16 and / or tip section 19 are subsequently machined to size and bonded together in order to produce a blade of the desired overall height ( see fig5 a , 5 b , 6 a , 6 b and 7 c ). subsequently , the assembled blade may be coated and heat - treated in order to increase its environmental resistance properties and mechanical strength . a turbine blade manufactured as described above , or in accordance with the prior art can be repaired in accordance with this invention as illustrated in fig7 a , 7 b and 7 c . a blade 10 is machined using a suitable method to remove the tip cap 24 and a portion of the airfoil 25 to open the internal cavity and produce an open blade body 16 having a repair surface 26 on the airfoil 18 . the length of the removed section 23 depends on the extent of the area that needs repair . a replacement tip section 19 comprising a replacement tip cap 20 and a replacement portion of an airfoil 21 is manufactured so that it can be machined to any length needed for the repair . the replacement tip section 19 is then machined to the required length ( a - b ) based on the length of the previously prepared blade body 16 ( b ) and fitted on the repair surface 26 . subsequently , replacement tip section 19 and blade body 16 are bonded together in order to produce a blade of the desired overall height ( a ). finally , the assembled blade may be coated and heat - treated in order to increase its environmental resistance properties and mechanical strength . the repairable length ( as measured from the tip toward the base of the airfoil ) is limited by the creep strength , oxidation resistance and other properties of the specific bonding method used to unite the blade body 16 to the replacement tip section 19 . the blade body 16 and tip section 19 may be of any geometry desired , such as a hollow blade body with internal cooling passages or a solid blade body . the tip section can have a tip cap 20 with a squealer tip 22 or it can be a full solid tip cap and the tip section 19 may be made of one , two , or more materials . the base material of the tip section may or may not be identical to that of the blade body 16 . for instance , the tip section 19 or only the tip cap 20 may be made of a harder material than that of the blade body 16 and an abrasive material may be applied in order to improve rub resistance . the required cooling holes in the blade body 16 and tip section 19 may be drilled during manufacture or after the complete blade 10 has been assembled . generally , the length of the second airfoil portion 21 of the tip section 19 or the replacement airfoil portion 21 ( when repairing a turbine blade ) is limited so that the interface area where it is attached to the first portion of the airfoil or the repair surface is not in a high stress region of the airfoil . typically , the second portion of the airfoil will be from greater than 0 % to about 25 % of the total airfoil length . typically the length of the second portion of the airfoil 21 or replacement airfoil portion 21 is from greater than 0 cm to about 2 cm , preferably about 0 . 2 cm to about 1 . 2 cm . the process of manufacturing new blades in accordance with this invention provides enhanced blade casting manufacturability and improved casting yield for hollow blades resulting from having an exit at the tip of the airfoil to locate and remove the ceramic core . quartz rods are not necessary for casting and it is easier to maintain airfoil wall thickness . as the tip section is not present to interfere with crystal formation it is easier to obtain directionally solidified and single crystal orientation . casting yields are also higher and castings are less expensive . in addition , for hollow blades , core removal after casting is greatly simplified as a shorter and less expensive process is required . also , because of the easy access to the internal airfoil cavity there is no need for neutron radiography inspection for residual core material resulting in shorter turn times and reduced manufacturing cost . the inspectability of the casting is also enhanced as all blade cavities are accessible through the tip allowing comprehensive internal inspections for non - fill , residual core material , braze - ball defects , thin ribs , and other casting defects , as well as internal fluorescent penetrant ( fpi ) inspection . it is also possible for hollow blades to provide a more complex internal blade geometry due to enhanced casting manufacturability as a result of the core exit at the tip of the airfoil . the greater design freedom can provide optimized airfoil strength and cooling schemes , and longer overall blade life . generally the blade body 16 can be formed from a first superalloy material such as an equiax , directionally solidified or single - crystal nickel - based superalloy . the tip materials can also be optimized for tip - specific requirements , high oxidation resistance , rub resistance , etc . greater freedom in choice of materials is possible where the tip section or tip cap does not have to be made from the same alloy as the airfoil . the tip section can be formed from the same or distinct materials . the tip section can be formed from a second superalloy material such as an equiax , directionally solidified or single - crystal superalloy , or from an altogether different material such as ceramic . the tip section material could be upgraded during the repair of a turbine blade manufactured in accordance with the prior art , for instance , an equiax blade may receive a single - crystal tip section for improved durability . the tip section geometry can also be optimized for tip - specific requirements as separate tip manufacturing allows greater freedom in tip geometry . separate tip section manufacturing is also easier and less expensive , e . g . abrasive tips are easier and less expensive to produce . the tip section can be cast as one piece or the tip cap and second airfoil portion can be cast or manufactured separately and then assembled . a variety of manufacturing methods can be used to produce the tip section , depending on the material of choice , e . g . powder metallurgy , die injection , sintering , casting , laser welding , powder deposition , electrical discharge machining , or others . the turbine blade tip section / blade body assembly , if designed properly , may allow tip cracks in service to be arrested in the interface and not propagate further into the airfoil resulting in increased service life . reparability is enhanced and the repair costs are lowered in that removal of the old tip section and replacing with a new one is possible with the tip sections being consumable details resulting in reduced repair turn time , cost , and better repair quality . for hollow blades , removal of the tip section during repair allows easy access to the internal airfoil cavities for cleaning , inspection ( e . g . internal coating inspection ), fpi , hole redrilling , etc . for all blades , because welding of the tip section walls is no longer necessary , blade life otherwise adversely affected by weld repair will increase . | 8 |
the following description is of the best mode presently contemplated for carrying out one or more aspects of the present inventions . this description is not to be taken in a limiting sense , but is made merely for the purpose of describing the general principles of the invention . the scope of the invention should be determined with reference to the claims . in one exemplary apparatus and methods , improved speech clarity can be achieved by only stimulating the locations of the cochlea which correspond to high spectral power , namely spectral power above a defined spectral power . additionally , stimulation can be removed from all other locations along the cochlea with low spectral power , namely spectral power below the selected spectral power . “ low spectral power ” and “ high spectral power ” are defined here as being that spectral power that is below and above the selected spectral power , respectively . in one aspect of the inventions , the selected spectral power is estimated by the signal average . in the examples described herein , the “ signal average ” is the sum of the channel signals divided by the total number of channels . a representative cochlear stimulation system with which the present invention may be used is described in u . s . pat . no . 5 , 603 , 726 , which patent is incorporated herein by reference . other cochlear stimulation systems with which the present invention may be used are found in u . s . pat . nos . 6 , 308 , 101 ; 6 , 219 , 580 ; and 6 , 272 , 382 ; which patents are also incorporated herein by reference . fig1 shows a typical cochlear stimulation system 10 comprising a speech processor portion 12 and a cochlear stimulation portion 14 . the cochlear stimulation portion 12 is usually implanted , and includes an implantable cochlear stimulator ( ics ) 16 and a cochlear lead 18 . the lead 18 includes a multiplicity of electrode contacts thereon ( not visible in fig1 ) through which electrical stimulation pulses , generated by the ics 16 , are applied to selected locations or areas of the cochlea . the speech processor portion 12 includes a speech processor ( sp ) 20 and a microphone 22 . the microphone 22 may be physically connected to the sp 22 , or connected through an appropriate wireless link 21 . the microphone 22 senses acoustic sound and transduces it to an electrical signal . the electrical signal from the microphone has different intensities as a function of the loudness of the audio signal that is sensed . the electrical signal from the microphone 22 is then processed by the sp 20 in accordance with a selected speech processing strategy . based on the type of processing strategy employed , appropriate control signals are generated and sent to the ics 16 over link 24 . the ics 16 responds to these control signals by generating appropriate stimulation signals that are applied to tissue at various locations along the inside of the cochlea through the electrode contacts located near the distal end of the lead 18 . typically , the speech processor portion 12 of the cochlear stimulation system 10 is external ( not implanted ), and the link 24 between the sp 20 and the ipg 16 is a transcutaneous link . however , it is to be understood that parts of the speech processor portion 12 may also be implanted . in a fully - implantable cochlear stimulation system , such as is described in the u . s . pat . no . 6 , 308 , 101 , all of the speech processor portion 12 is implanted . when both the sp portion 12 and the cochlear stimulation portion 14 are implanted , the sp 20 and the ics 16 may reside in respective housings , as shown in fig1 , or the circuitry associated with both the sc 20 and the ics 16 may be combined into a single housing . a biphasic pulse of the type that is generated by the ics 16 in response to the control signals received from the sp 20 is shown in fig2 . in general , the amplitude and / or pulse width ( pw ) of the pulses may be varied to adjust the magnitude of the stimulus . also , the frequency , or stimulation rate , at which the pulses are generated may be controlled , as needed . a preferred platform for launching the present invention is shown in u . s . pat . no . 6 , 219 , 580 , previously incorporated herein by reference . some features associated with that platform are shown in the signal flow diagram of fig3 . additionally , a schematic of a processor assembly used on the platform is shown in fig3 a , showing a physical partitioning of the ics 2 portion of the platform described and illustrated in fig1 of u . s . pat . no . 6 , 219 , 580 . the ics 2 consists of electronic circuitry that fits inside a hermetically sealed , u - shaped ceramic case 300 , e . g ., of the type disclosed in u . s . pat . no . 4 , 991 , 582 , incorporated herein by reference . the package design may be the same as is used by the ics described in the &# 39 ; 726 patent , previously referenced . the power and telemetry coils 302 , and the back telemetry coil 304 , and all circuitry are mounted on a ceramic hybrid 306 inside of the case 300 . the majority of the circuitry is integrated into custom integrated circuits ( ics ). two ic &# 39 ; s are employed — one analog ic 308 and one digital ic 310 . discrete components are used as necessary , e . g . coupling capacitors c c . attachment of the circuitry to the sixteen external electrodes and one indifferent ( reference ) electrode is through a bulkhead connector 312 at one end of the case . ( note that electrodes are numbered 1 through 16 , with 1 the most apical and 16 the most basal .) provision for an additional indifferent electrode and two stapedius electrodes are also made in the ics . as seen in fig3 , the signal generated by the microphone 22 is split into frequency bands by a bank of bandpass filters 40 - 0 , 40 - 1 , . . . 40 - k connected in parallel . each bandpass filter 40 receives the microphone signal . each bandpass filter 40 has a center frequency that allows signal frequencies within a specified band to pass therethrough . the bandpass filter 40 - 0 , for example , allows relatively low frequency signals to pass through . the bandpass filter 40 - k , on the other hand , allows only high frequency signals to pass through . the bank of bandpass filters is an example of apparatus that can divide an incoming audio signal into channels . the signals in each frequency band are then subjected to envelope detectors 50 - 0 , 50 - 1 . . . 50 - k . each of these envelope detectors 50 senses the spectral power component of the signal in its respective frequency band . this spectral power component is represented in fig3 as the signals e 0 , e 1 , . . . e k . the average of these signals e 0 , e 1 , . . . e k is dynamically determined . the average of the power of the spectral channels can be determined through appropriate processing carried out on the ics 2 ( fig3 a ). this average allows selection of a selected spectral power , which can then be used to select which of the signals e 0 , e 1 , . . . e k represents “ low ” spectral power , and which of the signals represents “ high ” spectral power . the envelope detector is an example of apparatus that can determine the spectral power of a signal . the selected spectral power is an example of a threshold that can be used to differentiate between high and low spectral power signals , and the threshold can be determined through appropriate processing carried out on the ics 2 ( fig3 a ). a selector circuit 60 allows only those signals having “ high ” spectral power to be sent on to the ics for stimulus generation . the channels having “ low ” spectral power are de - selected , i . e ., removed so that stimulation pulses corresponding to the channels having “ low ” spectral power is effectively turned off . these low spectral power channels will be effectively zero channels , because they will be turned off , or those channels will be set at zero or have no pulses applied for those channels . the selector circuit 60 is an example of an apparatus for selecting channels having spectral power above a threshold value . the selector circuit can be implemented in the ics 2 ( fig3 a ). further , the signals of “ high ” spectral power that pass through the selector circuit 60 are sequenced using sequencer 64 so that the stimuli generated by the ics 16 are applied sequentially only on the non - zero ( spectral power ) channels . acoustic - to - electrical mapping of the signals is further carried out with mapping circuits 70 - 0 , 70 - 1 , . . . , 70 - k , which mapping further conditions the signals that are applied to the electrodes on the lead 18 . a biphasic stimulus pulse is then applied on the non - zero channels in sequence as controlled by the sequencer 64 and as conditioned by appropriate mapping circuits 70 . the mapping circuits are an example of an apparatus for sequentially applying electrical stimuli only to the electrodes of channels having a spectral power above a threshold value . because the spectral power in each channel changes dynamically as a function of the acoustic signals sensed through the microphone 22 , the non - zero channels through which a stimulus , or stimuli , are applied also changes dynamically . however , for any cycle of the sequencer 64 , there will be some zero channels on which no stimulus will be provided , and some non - zero channels on which a biphasic stimulus pulse is applied . the biphasic stimulus provides a loudness associated with the various parameters of the stimulation pulse train , such as the amplitude , pulse width of the pulses , and the time between pulses . — we refer to the perceived loudness on a given channel as intensity . intensity is controlled by the spectral power of that channel . the intensity in some applications will be the combination of the amplitude and the pulse width and number of pulses per unit time , but it should be understood that intensity for purposes of the present discussion may be manifested in other ways , for example amplitude only with relatively constant pulse width , or pulse width with relatively constant amplitude . for the example illustrated in fig3 , the spectral power is non - zero only in the 0th channel and the kth channel . all of the other channels are zero . thus , a biphasic pulse 72 is applied to electrode 0 on lead 18 , and a biphasic pulse 74 is applied to electrode k on the lead 18 . electrode 0 , corresponding to channel 0 , which represents the channel having the lowest frequency components , is located distally near the end of the lead 18 so that when the lead is inserted into the cochlea this electrode 0 is close to those nerve cells deep in the cochlea that recognize lower frequency signals . electrode k , corresponding to channel k , which represents a channel having higher frequency components , is located more proximally on the lead 18 so that when the lead is inserted into the cochlea this electrode k is close to those nerve cells closer to the entrance of the cochlea that recognize higher frequency signals . the operation of the invention is depicted in signal processing illustration of fig4 . note that fig4 is divided into five rows , labeled ( a ), ( b ), ( c ), ( d ), and ( e ). each row represents a different example of a signal processing condition . in row ( a ) of fig4 , the speech power spectrum has peaks at about 800 and 2500 hz , as seen in the speech power spectrum graph 80 a . however , these peaks are not sharp peaks , meaning that the spectral power is spread over many of the channels . this creates a power spectral spread in each of eight channels as illustrated in “ envelope output ” chart 82 a . this is basically a chart of the signals e 0 , e 1 , . . . e k , ( see fig3 ), where k = 8 in this example . the average of these signals e 0 , e 1 , . . . e k is determined and is used as a threshold . the average is taken as equal to sum ( ej )/ k , where sum is the conventional sum of elements ( ej ), “ j ” is the channel number , and “ k ” is the total number of channels , or “ k ” in this example , where k = 8 . this threshold , or “ threshold value ” 83 a , is then used as the selected spectral power , and used to identify those channels above the threshold value and those channels below the threshold value . for the example of this row ( a ), five of the eight channels — channels 2 , 3 , 4 , 5 and 6 — have spectral power signals above the threshold 83 a . hence , these five channels are selected , as seen in the dynamic peak selection output chart 88 a , and biphasic pulses are applied sequentially to these five channels , as illustrated in the stimulation pattern chart 90 a . the speech power spectrum in rows ( b ), ( c ), ( d ) and ( e ) of fig4 shows that the spectral peaks , all of which are at approximately 800 and 2500 hz , become increasingly sharper . thus , for example , in row ( e ), only two of the eight channels — channels 3 and 6 — have spectral power above the average 83 e . hence , only these two channels are selected , as seen in the dynamic peak selection output chart 88 ( e ), and biphasic pulses are applied sequentially to just these two channels , as illustrated in the stimulation pattern chart 90 ( e ). note also the rate at which the pulses are applied to these two channels is faster than the rate would be if more channels were selected . this increases the temporal resolution for the stimulated channels since the time between stimuli is shorter . thus , in general , the temporal resolution increases since the integration frame is shorter for a smaller numbers of channels . thus , it is seen that in operation for one aspect of the present signal processing method , the speech processing strategy operates by splitting the incoming signal ( obtained from the microphone 22 , or equivalent ) into k frequency bands or channels . the spectral power component of the signal present in each frequency band is determined . the average ( or mean , or other suitable collective measure ) of these spectral power components , e 0 , e 1 , . . . e k , is determined and is used as a threshold value . only those channels having a spectral power component above the threshold value is selected for stimulation as a non - zero channel . the other channels are de - selected , as zero spectral power channels , and no stimulus is applied on these zero channels . the stimuli are then applied sequentially only on the selected channels . while the mean is one example of a criterion for identifying a selected spectral power to use , for example as a threshold value , other criteria may be used as well . other examples include other statistical methods , such as using variance to determine a threshold value or a combination of the average and variance to determine a threshold value . other examples include using a weighted average , such as where the weight may be dynamically assigned or where it is assigned as a function of known speech spectra . dynamic assignment of a weighting factor may include weighting based on relative or absolute amplitude , based on noise level as may be determined dynamically , for example , or other weighting methods . additionally , weighting may be applied to incoming signals before they are analyzed or they may be applied to the threshold value or other determinant before calculating which channels will be non - zero and which will be assigned zero values . other examples for identifying a spectral power to use include identification of the median , or identification of the median with a weight factor applied . therefore , identification of the selected spectral power may be considered to be based on some function , ƒ ( e 0 , e 1 , e 2 , e 3 , . . . e k ), hereafter ƒ ( e ), as desired , which function is then used to select the non - zero channels . the function may also be a function of time , which will be designated as ƒ ( et ), indicating that the function is based preferably on both the spectral power but also on time “ t ”. the function ƒ ( e ) will be used when indicating that the spectral power is based on the channel energies regardless of any dependence on time . the function ƒ ( et ) can be used or applied dynamically , as a function of on - going speech patterns , and need not be static for a given time period or static for a given user . for example , the mean in the example discussed herein can be determined for the channels on a frame - by - frame basis or on some other basis selected by the designer or technician . the mean ( or other criterion ) can be determined at regular intervals , or when a selected event occurs , such as when signal levels rise or fall beyond a set level . for present purposes , using a function to select a selected spectral power , different than a previously selected spectral power , more than once during the lifetime of the device will be considered dynamically determining the selected spectral power . therefore , “ t ” in ƒ ( et ) can be as large as the device lifetime , and as small as a frame or less . additionally , the number of channels selected for stimulation can be varied . the selection criteria may be the same as described herein , for example , and such selection will allow the number of channels that are stimulated to be changed as a function of time as well . therefore , the number of channels for stimulation may be selected . at a later time , one or more channel signals may be evaluated , such as by applying a suitable function to the spectral power values for the channel ( or each channel desired ), and thereafter identifying those channels with spectral power values that exceed a selected value . the number of channels may then be increased or decreased as desired . the number of channels may be decreased or increased dynamically based on the desired criteria or criterion . advantageously , the present apparatus and methods can be used to increase the perceived signal - to - noise ratio ( snr ) because the stimulation from the low spectral power channels can be identified and removed . moreover , the spectral contrast increases since fewer channels receive a higher pulse rate . additionally , the temporal resolution increases since the integration frame can be made shorter for smaller number of channels . as a further advantage , the power consumption of the cochlear stimulation system can be less than when using simultaneous speech processing strategies , such as sas . because the present invention may operate using less power than an sas strategy , sas users who choose the present strategy would have the option of using a behind - the - ear ( bte ) speech processor , which consumes less power than the body - worn speech processors . while the invention herein disclosed has been described by means of specific embodiments and applications thereof , numerous modifications and variations could be made thereto by those skilled in the art without departing from the scope of the invention set forth in the claims . | 0 |
an ordinary set of battery jumper cables comprises two heavy wire gauge cables , each of which is insulated and each of which has clamps at both ends thereof for connection to battery terminals . fig1 shows one embodiment of the present invention in a simplified form wherein an on - off snap switch 1 is installed in the battery jumper cable 2 . the switch 1 may be of conventional construction and preferably is firmly secured to the other battery cable 3 . the switch 1 may be secured to the cable 3 by means of an epoxy glue . the opposite ends of the cables 2 and 3 have clamps which are not shown in fig1 but which are connected on one side to the terminals of one battery and on the other end to the terminals of the other battery . the switch 1 is maintained in its off position normally but once the cables have connected at the battery terminals the switch may then be moved to the on position to permit the jump starting of the vehicle having the dead battery . fig2 shows an alternate arrangement to the one shown in fig1 depicting only a single cable of the pair of cables . in this arrangement the battery cable 4 is connected to battery cable plug 5 . the cable or wire 4 may be connected to the plug by virtue of the plug being hollow at its end accommodating the wire and permitting the plug to be crimped about the wire . both the cable or wire 4 and the plug 5 are surrounded by thick rubber insulation 6 . the other battery cable wire 7 is connected to a jack 8 . a thick rubber insulating sleeve 9 surrounds the jack 8 and extends beyond it forming a receptacle 10 . when plug 5 is inserted into jack 8 , the surrounding rubber insulation 6 mates snugly with the insulating sleeve 9 within the receptacle 10 . the construction is designed so that there is a seal between the insulation 6 and the sleeve 9 before there is actual electrical connection between the plug and jack . thus , if there is any sparking between the plug and jack this occurs ony within the confines of the insulation provided by the insulation sleeves 6 and 9 . similarly , upon disconnection any sparking would occur prior to a break between the insulation sleeves . fig2 shows only one of the cables but it is understood that the other cable could also be provided with a similar jack and plug or could be a continuous cable as depicted in fig1 . fig3 is a view similar to that shown in fig1 with the snap switch 1 replaced by an on - off timing switch 11 . in this embodiment the switch 11 is installed in the battery jumper cable 12 and is firmly affixed to the cable 13 such as with the use of an epoxy glue . the switch 11 may be of conventional design and may , for example , be a five minute timing switch . after the cables are attached to the battery terminals the switch may be moved from the off position to its on position . the switch then times out after a period of approximately 5 minutes and then at that time reverts to its off position . this use of a timer switch thus automatically disconnects the cables after a period of time so that any disconnection that is made after the time period will not cause any sparking . in accordance with another embodiment of the present invention reference is made to fig4 and 5 . as depicted in fig4 a jumper cable clamp is shown as comprising a jaw 14 which connects to handle 15 and a jaw 16 connects to handle 17 by means of a hinge pin 18 . both of the jaws and their associated handles are pivotally connected with the use of a pin 19 . a spring preferably is wrapped around the pin 19 and normally urges the jaws 14 and 16 toward each other . this biasing spring about the pin 19 is not shown in the drawings but is a conventional spring used in arrangements of this type . a spring 20 is associated wth the hinge pin 18 and normally urges the handle 17 toward the jaw 16 . thus , in the normal relaxed position of the handle 17 there is a gap 21 that is closed . fig4 shows the handle 17 partially actuated with the jaws 14 and 16 partially open . the opening limit of gap 21 is controlled by stops 22 and 23 which are securely attached to handle 17 and jaw piece 16 , respectively . these stop blocks 22 and 23 limit the movement of handle 17 relative to the jaw piece 16 . the construction of fig4 also includes the flexible cable sheath 24 which is firmly attached to jaw piece 16 by means of clamp 25 . the sheath 24 is for housing a longitudinally movable cable 26 which terminates at one end in end ball 27 . the ball 27 is firmly held in the handle 17 as shown in fig4 . movement of the handle 17 relative to the jaw piece 16 slides the movable cable 26 in and out of the flexible cable sheet 24 . the battery jumper cable 28 is attached to handle 15 . for example , the cable 28 may be welded to the inner surface of the handle 15 . preferably , the sheath 24 and associated cable 26 are suitably secured to the battery jumper cable 28 as depicted in fig4 . in operation , the squeezing of handles 15 and 17 toward each other initially causes handle 17 to move relative to jaw piece 16 . this action pulls cable 26 through the flexible cable sheet 24 . the stop blocks 22 and 23 make contact and limit the opening of the gap 21 . these blocks stop the relative movement between handle 17 and jaw piece 16 . further pressure on handle 17 is then transferred by the stop blocks 22 and 23 to jaw piece 16 causing it to move away from jaw 14 . thus , manipulating the battery cable clamp , by squeezing the handles together first initiates a movement of the longitudinally movable cable 26 through the cable sheath prior to the actual opening of the jaws 14 and 16 . fig4 shows one of the cable clamps , it being understood that a similar cable clamp is associated with each end of the both of the cables of the battery jumper cable set thereby providing a total of four cable clamps of the type shown in fig4 . in association with each of these cable clamps there is provided a centrally actuated switch 48 shown in fig5 which is moved to its off position any time that anyone of the cable clamps is released for either connection or disconnection of the cable clamps from a battery terminal . with reference to fig5 the base plate 29 is mounted on the jumper cable set at the &# 34 ; y &# 34 ; where the cables divide into two separate cables as depicted in fig5 . thre is a similar mounting plate at the other end of the set of cables where the cables also divide into two separate cables . the flexible cable sheath 24 is firmly attached to base plate 29 by means of a clamp 30 . the clamp 30 is secured to the base plate 29 by a securing screw 31 . this clamp 30 also secures a second flexible cable sheath 32 which comes from another jumper cable ( not shown ) paired with the above - described jumper cable clamp , and preferably identical to it . the movable cables 26 and 34 both attach to the walking beam 33 . a further cable sheath 35 is attached to the base plate 29 by means of the clamp 36 and associated screws 37 . the movable cable 38 associated with sheath 35 passes through the walking beam 33 and is firmly attached to block 39 . in operation , when the cable 26 is drawn into the flexible cable sheath 24 by operation of the associated cable clamp , the walking beam 33 moves around a pivot point formed by the stationary end of movable cable 34 . this movement is transferred through block 39 to cable 38 which is moved out of the sheath 35 . likewise , when cable 34 is moved into its associated sheath 32 , movement is produced in the cable 38 . movement of both cables 26 and 34 simultaneously will produce also movement in the cable 38 . thus , the entire mechanism on the base plate 29 functions to transfer the cable movement from either or both of a pair of jumper cable clamps to one final movable cable which is cable 38 within the sheath 35 shown in fig5 . operation of either clamp will produce movement of this cable 38 . similarly , there is a like arrangement on the other end of the cable . fig5 also shows the base plate 40 which is mounted at the center of the battery jumper cables . the flexible cable sheath 35 is shown firmly attached to the base plate 40 by means of the clamp 41 and its associated screws 42 . the other end of movable cable 38 is pivotally attached to a cross bar 43 which can rotate around a center shaft 44 . shaft 44 extends from the base plate 40 . the sheath 45 is equivalent to the sheath 35 but comes from the opposite end of the jumper cable . snap switch 47 is mounted to base plate 40 in a suitable manner and connects into the jumper cable 28 for permitting connection of the two ends of the cable 28 . the lever arm 48 of the switch 47 is connected to cross bar 43 by a connecting link 49 which is pivotally attached to the lever arm 48 . the connecting link 49 passes through the cross bar 43 and is secured to block 50 . in operation , the squeezing of any jumper cable clamp is communicated to the cross bar 43 causing it to rotate in a clockwise direction as viewed in fig5 . if the cable 38 or the cable 46 is pulled into their respective sheaths 35 or 45 then the cross bar 43 will rotate clockwise and pull the lever arm 48 to the right by means of the link 49 to thus turn the switch 47 to its off position . switch 47 is turned off automatically initially before attaching or removing any jumper cable clamp . once all of the clamps have been relaxed to the position wherein the gap 21 of fig4 is closed , then the switch 47 assumes its normal on position . alternatively , after all clamps are relaxed the switch 47 may require manual arming for operation . the jumper cable clamp of fig6 is used in association with the wiring diagram of fig7 . the construction of the jumper cable clamp of fig6 is quite similar to the jumper cable clamp shown in fig4 and the complete construction and will not be discussed in detail . in place of the cable 26 and its associated sheath 24 shown in fig4 there is a switch 51 which is a normally open single pole single throw switch . the switch actuating plunger 52 is normally extended to the left as shown in fig6 . movement of handle 17 actuates switch 51 through the actuating plunger 52 . when the handles are squeezed together , switch 51 is opened . when the clamp is on a battery terminal the biasing force of a spring such as spring 20 shown in fig4 closes the switch 51 . a two - wire cable 53 extends from the switch 51 and follows a battery cable 54 . fig7 is a wiring diagram of this embodiment of the jumper cable system . each of the battery cable clamps 55 - 58 preferably is of the type shown in fig6 with each clamp having extending therefrom essentially three wires including the relatively heavy power wire such as cable 54 and two control wires such as found in cable 53 . in the diagram of fig7 the power wires are shown separate from the control wires . for example , cable 54 is one main jumper cable that connects the jumper cable clamps 55 and 56 , while the switch 51 which is associated with clamp 56 has the control wires extending therefrom . in fig7 the jumper cable clamps 57 and 58 are connected to cables 59 and 60 , respectively , and these cables are in turn wired directly to heavy duty contacts 61 of the locking solenoid 62 . the diagram of fig7 also includes rectifiers 63 and 64 . the rectifier 63 is coupled across cables 54 and 59 while the rectifier 64 is coupled across cables 54 and 60 . the bridges 63 and 64 are connected so as to deliver a positive voltage to wire 65 and a negative voltage to wire 66 regardless of the polarity of connection of the jumper cable clamps at the battery terminals . as previously mentioned , each one of the battery cable clamps has a switch associated therewith . thus , in fig7 the switches 51 , 67 , 68 and 69 are associated respectively with the battery cable clamps 56 , 58 , 55 and 57 . these switches are wired in series from the negative voltage line 66 to the locking or latching contact 70 . actuating switch 71 is wired in parallel with this latching contact 70 . the switch contacts 61 and 70 are normally open when the solenoid 62 is de - energized . the actuating switch 71 is preferably a normally - open pushbutton switch . actuation of the relay coil 62 requires operation of the switch 71 so as to impress the operating voltage across the relay coil . the four jumper cable clamps 55 - 58 are attached to the terminals of the two batteries , one of which is in a charge condition and the other of which is discharged . the clamps 55 and 56 are connected to one polarity while the clamps 57 and 58 are connected to the other polarity . it does not matter which polarity they are connected to as either or both bridges develops the appropriate battery voltage between wires 65 and 66 . also , each battery cable clamp set may be used with either battery . when all of the clamps are attached and released by the hand , all of the switches 51 , 67 , 68 and 69 are closed , thereby arming the actuating switch 71 and the contact 70 . the depressing of switch 71 energizes solenoid coil 62 causing it to close the contacts 61 and 70 . the contact 70 latches the solenoid in its closed position . simultaneously , contact 61 provides a closed path between the cables 59 and 60 . the solenoid 62 is maintained in its energized position as long as all of the switches 51 , 67 , 68 and 69 are closed . operation of any one or more of the jumper cable clamps will open its associated switch causing the solenoid 62 to become de - energized thereby disconnecting the cables 59 and 60 . the clamps are designed as shown in fig6 so that the switches such as switch 51 in fig6 moves to its open position before the clamp is actually opened and releasable from the battery terminal . this operation also occurs upon closing and in this instance the clamp is fixed on the terminal and the switch 51 is moved to its closed position thereafter upon complete release of the handles of the clamp . the connecting and disconnecting of the system always occurs through the relay contact 61 . the bridge rectifiers 63 and 64 , solenoid 62 and actuating switch 71 are preferably all housed in a sealed unit which is arranged at the middle of the battery jumper cable . the diagram of fig8 is quite similar to the one shown in fig7 and in addition detects whether the cables are connected properly with regard to polarity ; that is , the proper connection of each cable so that there is a like polarity connection at each end of the cable . with the system of fig8 battery cable connection is permitted only after all clamp switches are closed and there is the proper polarity match up between the batteries . part of the system of fig8 is substantially identical to the diagram of fig7 . thus , cable 54 interconnects the jumper cable clamps 55 and 56 . all of the jumper cable clamps shown in fig8 may be of the type previously depicted in fig6 . jumper clamp 58 connects to cable 60 while the jumper cable clamp 57 connects to 59 . the cables 59 and 60 connect to the heavy duty switch contact 61 controlled from relay coil 62 . as with the embodiment of fig7 the rectifiers 63 and 64 are wired across battery cables 54 and either cable 59 or cable 60 . with this arrangement there is a positive voltage on wire 65 and a negative voltage on wire 66 , regardless of how the cable pairs are connected to each battery . thus , for example , regardless of which of the clamps 55 and 57 are connected to which terminal of the battery with which they are associated , a positive voltage will be on line 65 and a negative voltage on line 66 . the diagram of fig8 includes distribution block 72 which receives the positive voltage from line 65 . the distribution block comprises a zener diode 75 for providing a regulated voltage of + 5 vdc which is used with the logic circuitry such as the gates shown in fig8 . the distribution block 72 also delivers power to amplifier 73 , solenoid 62 and indicator light 74 . a line from cable 59 is fed through voltage dropping resistor 77r to and gate 76 and also to nor gate 77 . similarly , a line from cable 60 is coupled by way of voltage dropping resistor 76r to the other inputs on gates 76 and 77 . the outputs from the gates 76 and 77 couple to the two inputs of or gate 79 . the output from gate 79 is coupled to one input of a total of 5 inputs on and gate 80 . the output from gate 79 also couples to inverter 81 . the output from inverter 81 couples to a red led indicator 82 . the control switch arrangement of fig8 is somewhat different than the arrangement shown in fig7 . in fig8 the actual switches 51 , 67 , 68 and 69 are not shown but each have one side connecting respectively with lines 85 , 86 , 87 and 88 . there is also provided a common line 84 which receives a + 5 vdc signal by way of resistor 83 . this voltage level in essence couples to one side of each of the control switches . thus , when each jumper cable clamp is relaxed there is a positive voltage on its associated line which is either line 85 , 86 , 87 or 88 . these lines all couple into the other inputs of gate 80 . the gates 76 , 77 and 79 detect whether the cables are connected to the correct battery terminals . if jumper cable clamps 57 and 58 are both on a positive terminal , then the two positive voltages at the input of gate 76 provide a positive output from this gate . similarly , if the clamps 57 and 58 are both on a negative terminal , then the two negative voltages at the input of gate 77 produce a positive output from that gate . if the clamps 57 and 58 are on different polarity terminals , both of the gates 76 and 77 will have a low inhibiting output . in summary , when both clamps 57 and 58 are on positive terminals , there is a positive output from gate 76 and gate 79 will be enabled providing an enabled signal for the gate 80 . if both of these same clamps are on negative terminals , then the gate 77 will have a positive output rather than the gate 76 enabling in turn gates 79 and 80 . under the other conditions there is no positive output from gate 79 but this condition is sensed by inverter 81 which will illuminate the indicator light 82 under this condition of improper connection at the battery terminals . thus , the gate 80 will only have a positive input coupled from the gate 79 when the battery cables are connected properly . further , the gate 80 will be totally enabled having a positive output when that condition is satisfied and also when the battery cable clamps are all closed as determined by the position of the switches 51 , 67 , 68 and 69 ( not shown in fig8 ). in fig8 the switch conditions are coupled on the lines 85 - 88 to gate 80 . the output from gate 80 couples to amplifier 73 which arms the actuator switch 71 and the latching contact 70 . the output from amplifier 73 also illuminates a green incandescent &# 34 ; go &# 34 ; indicator light 74 . switch 71 is preferably a normally - open momentary pushbutton switch . closing switch 71 , when armed by virtue of gate 80 being enabled , solenoid 62 is energized , closing the contact 70 thereby holding the solenoid 62 in this actuated state . the operation of solenoid 62 also closes which contact 61 , which as in the embodiment of fig7 connects the jumper cables 59 and 60 . in summary , the gate 80 has inputs that determines the two conditions of proper battery connection and battery clamp switch closure . if the proper polarity connections have been made and all of the clamps are secured on the battery terminals , then the gate 80 is totally enabled having a high output . with the switch 71 subsequently operated , because of this &# 34 ; go &# 34 ; condition , the battery cables are then interconnected through the contact 61 . thereafter , if any one of the jumper cable clamps are released , the gate 80 has a low output and the power to the relay 62 is interrupted . when this occurs , the associated contact 61 opens . this action occurs as soon as there is a slight squeezing of the cable clamps and the disconnection via contact 61 actually occurs before the clamps are physically removed from the terminals . if the removed clamp is again inserted on the terminal , the switch 71 must again be actuated in order to provide battery cable interconnection . fig9 shows an alternate embodiment of a relay that may be used , for example , in place of the relay 62 and associated switch 71 shown in fig7 and 8 . this relay is a manually - operated , self - holding relay . the relay of fig9 may in addition be used in other applications and is in itself an improvement over previous relay constructions . there are many applications where a relay is maintained in the &# 34 ; hold - in &# 34 ; position . by the closing of a switch typically , such relays are actuated by another switch which supplies initial power to the relay energizing the relay until the closing or latching contact is closed to hold the relay actuated . one drawback of the conventional arrangement is that two switch contacts are required , and secondly , relatively substantial power is required for energizing the relay ; this power being greater than the power required to hold the relay in the locked position . one objective of the improved relay of fig9 is to supply a latching relay which employs preferably only one switch which serves as both the actuating and the latching or lock - in switch . a further objective of the invention is to supply a latching relay which does not require an initial surge of high power to initiate the relay action . the foregoing objectives are accomplished by providing a relay which has two armatures . one of the armatures forms a part of the actuating switch and operates the latching contact of the relay . the other armature serves to lock out the first armature . fig9 shows the relay coil 101 having opposite end poles . the other armatures 102 and 103 are disposed adjacent these poles of the coil 101 . the armature 102 is biased away from one pole of the coil 101 by means of the spring 104 . similarly , a second spring 105 is provided for biasing the second armature 103 away from the other pole of the relay coil 101 . the armatures 102 and 103 are pivotal about the pivot pins 106 and 107 , respectively . the armature 102 integrally provided therewith a paddle switch handle 108 having alternate off and on positions as indicated in fig9 . the armature 102 also has a right angle extension which terminates with an angular surface 111 having adjacent thereto a switch actuating protrusion 112 . the armature 103 is of substantially u - shape terminating at one end in a notch 109 . the other end is rounded as shown at 110 . in fig9 the switch contact 113 operated by the protrusion 112 is a relay actuating and hold - in switch . the other contact 114 is the high power transfer switch which may couple to high power terminals not shown in fig9 . the terminals a and b shown in fig9 connect to a power source for the relay . when there is power at these terminals the relay is armed . the switch 108 may then be moved to its &# 34 ; on &# 34 ; position causing the armature assembly 102 to rotate clockwise . this action causes the protrusion 112 to close the switch contact 113 and if the power terminals are armed , the relay coil 101 is energized . this action causes the relatively light weight armature 103 to be attracted to the bottom coil pole . when this occurs the armature 103 rotates clockwise against the bias spring 105 so that the notch 109 moves away from the end of the heavier armature 102 allowing it to move toward the top pole of relay coil 101 . when the armature 103 is operated , its end 110 moves against the angled edge 111 of armature 102 , urging it in the initial direction of movement . with the notch 109 out of the path of travel of armature 102 the movement of armature 102 may continue with the assistance of armature 103 movement and its end 110 . the movement of armature 102 continues until it is seated against the top pole of coil 101 . it is noted that the actual movement of armature 102 is by manual operation of the switch 108 . also , the relay unit remains in the latched state as long as power is maintained at the terminals a and b and as long as the switch contact 113 is closed . when power is removed from the terminal a and b , spring 104 moves armature 102 along with switch 108 to its &# 34 ; open &# 34 ; relaxed position . at the same time the spring 105 moves the armature 103 to its relaxed position . with the relay device of fig9 if there is no power at the terminals a and b , a movement of the switch handle 108 towards the &# 34 ; on &# 34 ; position is inhibited , a virtue of the end of the armature encountering the notched end 109 of the other armature 103 . one of the important features of the device shown in fig9 is that a smaller less expensive coil 101 may be used . the power to hold in the relay is generally less than the power that is necessary to pull in the relay and because the pulling in of the relay is assisted by manual movement of the armature 102 an inexpensive coil may be used as only enough power need be provided to hold the relay contacts latched . having described a limited number of embodiments of this invention it should now be apparent to those skilled in the art that there are numerous other embodiments all of which are considered as falling within the scope of this invention and all of which are to be limited only by the appended claims . | 7 |
referring to fig1 a square wave oscillator 11 generates the clock frequency square wave and is connected to the input of inverter 12 , clock output terminal 13 , the input of inverter 14 , and a first input terminal of and gate 15 . the output of inverter 12 is connected to the input of inductor 16 , the output of which is connected to point 17 . capacitor 18 is connected between point 17 and ground . inductor 16 and capacitor 18 form a low pass filter , so that a sine wave is present at terminal 17 . resistors 19 and 20 form a voltage divider to reduce the voltage at point 17 to about one volt rms at terminal 21 , so that the quad bilateral switches can safely handle the carrier . capacitor 22 and resistor 23 comprise a phase shift circuit which introduces a leading phase angle to compensate for the lagging phase angle from the low pass filter at point 17 . point 24 is the sine wave carrier zero phase angle output which is accurately in phase with the square wave of clock oscillator 11 . the carrier at point 24 is connected to capacitor 25 and series resistor 26 which is grounded . point 27 delivers a leading phase angle carrier to the input of bilateral switch 28 . the zero phase angle carrier at point 29 is connected to the input of bilateral switch 30 . point 29 is connected to a lagging phase shift circuit composed of resistor 31 and capacitor 32 which is grounded . point 33 delivers a lagging phase angle carrier to the input of bilateral switch 34 . the output terminals of bilateral switches 28 and 34 are connected to point 35 which is the phase modulated carrier output . the output of bilateral switch 30 is connected to the input of bilateral switch 36 by wire 37 . the output of bilateral switch 36 is connected to point 35 . the input of inverter 14 receives the square wave of the clock frequency . during the positive excursion of the clock frequency the input of inverter 14 is high and its output low . when the clock frequency goes negative at its half cycle point , the output of inverter 14 goes positive . the output of inverter 14 is connected to the trigger of one shot multivibrator 38 which gives a short output pulse when it receives a positive pulse from the inverter 14 . the output pulse from one shot multivibrator 38 drives the control terminal 39 of switch 34 to close switch 34 and conduct the lagging phase angle carrier from point 33 to point 35 during the duration of the pulse . terminal 40 is the input connection for binary nrz data clocked by the clock output at terminal 13 , and is connected to the second input terminal of and gate 15 . the output of and gate 15 is connected to the trigger of one shot multivibrator 41 . when a digital one appears at point 40 at the start of a clock frequency cycle both inputs of and gate 15 are high and the and gate output pulse triggers one shot multivibrator 41 , which delivers a short pulse to the control terminal 42 of bilateral switch 28 , thus closing switch 28 for the duration of the pulse and conducting the leading phase angle carrier from point 27 to point 35 . the input of inverter 43 is connected to receive the output pulse from multivibrator 38 , and the output of inverter 43 is connected to control terminal 44 of bilateral switch 30 . when no pulses are being generated by normally quiescent multivibrators 38 and 41 , the inputs of inverters 43 and 45 are low , making their outputs high , thus driving bilateral switches 30 and 36 closed and thus conducting the undeviated carrier from point 29 to point 35 . when a pulse appears at the input of inverter 43 , its negative complement appears at control terminal 44 of switch 30 and opens switch 30 thus cutting off the undeviated carrier from point 35 . simultaneously , the pulse at the input of inverter 43 drives control terminal 39 of switch 34 to close switch 34 which conducts a lagging phase angle carrier to point 35 . in similar fashion , when a pulse appears at the input of inverter 45 , its negative complement appears at the control terminal 46 and opens switch 36 thus cutting off the undeviated carrier from point 35 during the duration of the pulse . simultaneously , the pulse at the input of inverter 45 drives control terminal 42 of switch 28 to close switch 28 which conducts a leading phase angle carrier from point 27 to point 35 . in this manner , point 35 receives both the undeviated and the pulsed deviated carrier from switches 28 , 34 , 30 and 36 , with coded phase deviations controlled by the simple logic circuits shown . capacitor 47 couples point 35 to load resistance 48 and to the input of isolation amplifier 49 , the output of which is delivered to output terminal 50 . referring to fig2 the waveforms at various points in the diagram of fig1 are shown graphically . in the first line , the square wave clock frequency at terminal 13 is shown . in the second line , nrz digital data at input terminal 40 is shown . in the third line , the synchronized sine wave carrier at point 29 is shown , while in the fourth line , the phase deviations of the pulsed biphase modulated carrier at point 35 are shown . the circuit of fig1 was operated at a clock frequency of 15khz , using 10 degree phase deviations and 5 microsecond wide pulses to control terminals 39 and 42 of bilateral switches 34 and 28 respectively . the oscilloscope display of the modulated carrier at point 35 looked exactly like the fourth line in fig2 . no transients were observable . the circuit of fig1 will probably operate correctly up to the upper frequency limit of the cmos integrated circuit components used . while the preferred embodiment of the invention has been described , the form of the invention should be considered as illustrated and not limiting the scope of the claims . | 7 |
certain devices prepared and used according to the present invention contain an opioid antagonist dispersed in microspheres . in certain embodiments , the amount of the opioid antagonist incorporated into the microspheres ranges from about 1 % by weight to about 90 % by weight , or from about 5 % by weight to about 70 % by weight , or from about 30 % to about 50 % by weight of the microsphere ( including active ). in the present invention , the opioid antagonist is incorporated into microspheres for use in opioid transdermal delivery devices in order to make the opioid antagonist non - releasable or substantially non - releasable upon topical application of an intact transdermal delivery device comprising the antagonist microspheres . the microspheres preferably comprise a polymeric substance . suitable polymers that can be used to form opioid - containing antagonist microspheres include soluble , insoluble , biodegradable , and non - biodegradable polymers . the use of pharmaceutically acceptable non - toxic polymers is preferred . physicochemical features of the polymers can be selected to provide further abuse resistance of the present invention . for example , hydrolysis of poly ( orthoester ) is catalyzed by acid . thus , abuse via oral ingestion of the opioid - containing portion of a transdermal delivery device containing microspheres of poly ( orthoester ) comprising opioid antagonist would result in degradation of the polymer and release of the opioid antagonist in the acid milieu of the stomach . degradation of microspheres comprising polysaccharides and proteins is catalyzed by enzymatic cleavage . thus , for example , abuse via oral ingestion of the opioid - containing portion of the transdermal delivery device containing microspheres of dextrans would result in degradation of the polymer and release of the opioid antagonist in the gastrointestinal tract . polymers that may be used for the opioid antagonist - containing microspheres of the present invention can generally be classified into three types , namely natural , semi - synthetic and synthetic , based on their sources . the natural biodegradable polymers may be further classified into proteins and polysaccharides . representative natural derived polymers include proteins , such as zein , modified zein , casein , gelatin , gluten , albumin , fetuin , orosomucoid , glycoproteins , collagen , synthetic polypeptides and elastin . biodegradable synthetic polypeptides include , for example , poly -( n - hydroxyalkyl )- l - asparagine , poly -( n - hydroxyalkyl )- l - glutamine , and copolymers of n - hydroxyalkyl - l - asparagine and n - hydroxyalkyl - l - glutamine with other amino acids , e . g ., l - alanine , l - lysine , l - phenylalanine , l - valine , l - tyrosine , and the like . polysaccharides ( e . g ., cellulose , dextrans , polyhyaluronic acid , lipopolysaccharides ), polymers of acrylic and methacrylic esters , and alginic acid , may also be used . synthetically modified , natural ( i . e ., semi - synthetic ) polymers include alkyl celluloses , hydroxyalkyl celluloses , cellulose ethers , cellulose esters , and nitrocelluloses , among others . semi - synthetic biodegradable polymers are produced by modifying natural polymers to produce polymers having altered physicochemical properties such as thermogelling properties , mechanical strength and degradation rates . examples of semi - synthetic , biodegradable polymers suitable for use in the present invention include modified chitosan complexes , chondroitin sulfate - a chitosan complexes , and water soluble , phosphorylated chitosans ( p - chitosans ), and combinations thereof , such as , for example , alginate - chitosan . lack of immunogenicity and more reproducible and predictable physicochemical properties make synthetic , biodegradable polymers preferable to the natural polymers for drug delivery uses . these polymers may be non - toxic and biodegradable , and delivery devices have been prepared from these polymers . therefore , synthetic biodegradable polymers may be particularly suitable for the microspheres of the present invention . non - limiting examples of synthetic biodegradable polymers include : polyesters , polyethers , poly ( orthoesters ), poly ( vinyl alcohols ), polyamides , polycarbonates , polyacrylamides , polyalkylene glycols , polyalkylene oxides , polyalkylene terephthalates , polyvinyl ethers , polyvinyl esters , polyvinyl halides , polyvinylpyrrolidone , polyglycolides , polysiloxanes , polylactides , polyurethanes and copolymers thereof . non - limiting examples of polyesters include polylactic acid , polyglycolic acid , poly ( lactide - co - glycolide ), poly ( e - caprolactone ), polydioxanone , poly ( ethylene terephthalate ), poly ( malic acid ), poly ( tartronic acid ), polyphosphazenes , poly ( orthoester ), poly ( valeric acid ), poly ( buteric acid ), polyhydroxybutyrate , polyhydroxyvalerate , polyanhydride , and copolymers of the monomers used to synthesize any of the above - mentioned polymers , e . g ., poly ( lactic - co - glycolic acid ) or the copolymer of polyhydroxy butyrate with hydroxyvaleric acid ( biopol ® by zeneca ). copolymers of lactic and glycolic acids , e . g ., poly ( lacetic - co - glycolic acid ) ( plga ), have been extensively studied for their use in drug delivery devices such as microspheres . in certain embodiments , the polymer ( e . g ., plga ) can have a molecular weight from about 1 kd to about 100 kd or greater , from about 5 kd to about 60 kd or from about 10 kd to about 40 kd . in certain embodiments , a portion of the plga ( e . g ., from 10 % to about 90 %) can have a molecular weight of less than 20 kd , or less than 15 kd and the corresponding , remaining portion ( e . g ., from 90 % to 10 %) can have a molecular weight of greater than 25 kd , or greater than 35 kd . poly ( e - caprolactone ) may be used in preparing microspheres for use in the present invention . the degradation rate of poly ( e - caprolactone ) is much slower than that of either polyglycolic acid or poly ( lactic - co - glycolic acid ). poly ( e - caprolactone ) has exceptional ability to form blends with many other polymers . copolymers of poly ( e - caprolactone ) can be used to control permeability and mechanical properties of drug delivery devices . polyethers and poly ( orthoesters ) may also be used in preparing microspheres for use in the present invention . these polymers have been incorporated into multiblocks for block polymers having diverse degradation rates , mechanical strength , porosity , diffusivity , and inherent viscosity . examples of polyethers include polyethylene glycol and polypropylene glycol . an example of a multiblock copolymer is poly ( ether ester amide ). additionally , triblock copolymers of poly ( orthoesters ) with various poly ( ethylene glycol ) contents are useful for their stability in water / oil ( w / o ) emulsions , and possess greater efficacy than poly ( orthoester ) when used in preparing microspheres . other useful block copolymers include diblock copolymers of poly ( lactic - co - glycolic acid ) and poly ( ethylene glycol ) ( peg ), triblock copolymers of peg - plga - peg , copolymers of plga and polylysine , and poly ( ester ether ) block copolymers . in certain embodiments , microspheres useful in practicing the present invention are spherically shaped and from about 1 to about 500 microns , from about 1 to about 300 microns , from about 1 to about 200 microns , from about 1 to about 100 microns , from about 300 to about 500 microns , from about 200 to about 500 microns , from about 100 to about 500 microns , from about 125 to about 200 microns , or from about 50 to about 100 microns in diameter . microsphere size may be dependent upon the type of polymer used . in certain embodiments , rather than being spherical , the microspheres may be irregularly shaped , wherein the diameter is considered to be the largest cross - section of the microsphere . in certain embodiments , the microspheres used in the present invention comprise opioid antagonist in an amount of from about 5 % to about 70 % by weight of the microsphere ( including active ). in certain embodiments , the opioid antagonist can be loaded into the microspheres via microencapsulation . techniques for microencapsulation for use in accordance with the present invention are described in u . s . pat . nos . 3 , 161 , 602 ; 3 , 396 , 117 ; 3 , 270 , 100 ; 3 , 405 , 070 ; 3 , 341 , 466 ; 3 , 567 , 650 ; 3 , 875 , 074 ; 4 , 652 , 441 ; 5 , 100 , 669 ; 4 , 438 , 253 ; 4 , 391 , 909 ; 4 , 145 , 184 ; 4 , 277 , 364 ; 5 , 288 , 502 ; and 5 , 665 , 428 . furthermore , the microspheres can be prepared by either solvent evaporation as described , e . g ., by e . mathiowitz , et al ., j . scanning microscopy , 4 , 329 ( 1990 ); l . r . beck , et al ., fertil . steril ., 31 , 545 ( 1979 ); and s . benita , et al , j . pharm . sci . 73 , 1721 ( 1984 ); or by hot - melt microencapsulation , as described , e . g ., by e . mathowitz , et al ., reactive polymers 6 , 275 ( 1987 ); or by spray drying . the microspheres may be prepared by any method known in the art including but not limited to coacervation , phase - separation , solvent evaporation , spray - drying , spray - congealing , pan - coating , fluid bed coating or the like . for purposes of the present invention , a microcapsule can be described functionally as a small container enclosing the contents with a film . the film may be made of synthetic , semi - synthetic , or natural polymer as described above , and can control the release ( or provide no release ) of the contents . the release rate of the contents from a microcapsule is mainly determined by the chemical structure and thickness of the capsule film and size of the microcapsule . in microcapsule formulations , small solid particles of opioid antagonist can be coated with a coating which consists of an organic polymer , hydrocolloid , sugar , wax , fat , metal , or inorganic oxide . in certain embodiments , the opioid antagonist is incorporated into the microspheres using an oil / water ( o / w ) emulsion , a water / oil ( w / o ) emulsion , an oil / oil ( o / o ) emulsion , an oil / water / oil ( o / w / o ) emulsion , an oil / water / water ( o / w / w ) emulsion , water / oil / water ( w / o / w ) emulsion , or a water / oil / oil ( w / o / o ) emulsion , or the like . in certain embodiments , the opioid antagonist is incorporated into the microspheres by microemulsification of a fixed oil and an aqueous solution of a water - soluble opioid antagonist . this emulsion is of the “ water in oil ” type . when the emulsion is of the “ water - in - oil ” type , oil is the continuous phase or external phase and water is the “ dispersed ” or internal phase as opposed to the “ oil in water ” device , where water is the continuous phase . in certain preferred embodiments , the opioid antagonist may be incorporated into the microspheres via a multi - phase emulsification device such as w / o / w . the opioid antagonist may be incorporated into multi - phase microspheres prepared by a multiple emulsion solvent evaporation technique . in this technique , the opioid antagonist is incorporated into biodegradable polymeric microspheres by an emulsification process . the device is suitable for both water soluble and insoluble opioid antagonists . the microspheres of the present invention may be multiphasic polymeric microspheres in which the opioid antagonist is dispersed in oily droplets in a polymeric matrix . the microspheres can be prepared by a multiple emulsion solvent evaporation technique as described in u . s . pat . no . 5 , 288 , 502 . this patent describes a multiple emulsion solvent technique , where the drug is protected within an oily droplet and contact with the polymer , organic solvent , and other potentially denaturing agents is avoided . multiple emulsions are devices in which drops of the oil - dispersed phase themselves contain even smaller aqueous dispersed droplets consisting of a liquid identical with the aqueous continuous phase . they are emulsions of emulsions with high capacity for entrapment of drug , protection of the entrapped drug , ability to introduce incompatible substances into the same device , and prolongation of release . any of a variety of fixed oils may be used in preparing the microspheres , including safflower , soybean , peanut , cotton seed , sesame , or cod liver oil , among others . in certain preferred embodiments , soybean , sesame or safflower oil are used . the oil phase may consist of isohexadecane or liquid paraffin . oil concentration influences the stability of the emulsion . stability is optimal with an oil percentage preferably in a range of 20 - 30 % w / w of the total emulsion . in the multiple emulsion process , the organic phase may be prepared by preparing an emulsion containing the opioid antagonist and a polymeric material . preferably , the opioid antagonist is dispersed in an organic polymer solution in either methylene chloride or ethyl acetate . the resulting primary w / o emulsion is then dispersed into an external aqueous phase to form a second emulsion that comprises microspheres containing the opioid antagonist in the polymeric matrix material ( i . e ., emulsification into the external phase ). the subsequent process steps are similar to the o / w method . the step of dissolving the drug into the internal aqueous phase is eliminated . in addition , higher theoretical drug loading is achieved because the internal drug phase consists only of solid particles and not of a drug solution . in yet other embodiments , an o / w emulsion process may be used to incorporate the opioid antagonist into the microspheres . for the o / w dispersion method , the opioid antagonist is dispersed in the polymer phase followed by emulsification in the external aqueous phase . the microspheres are then separated from the external aqueous phase by wet sieving , followed by washing and desiccator - drying . in certain embodiments , the present invention utilizes encapsulation techniques that allow liquid or solid substances to be encapsulated by polymers . in certain preferred embodiments , the opioid antagonist is in crystalline form . the crystalline opioid antagonist particles may be formed by solid - state crystallization via exposure to solvent vapors . the crystalline form may decrease the water content of the preparation , thus preserving the stability of the opioid antagonist . the crystal may be encapsulated in a fixed oil , and mixed with a solution of polymer and solvent in dispersion oil . u . s . pat . no . 6 , 287 , 693 to savoir describes stable shaped particles of crystalline organic compounds that are formed into microspheres and achieve storage stability . alternatively , any suitable method for producing crystalline particles of organic compounds can be used . the stability and release characteristics of emulsion devices are influenced by a number of factors such as the composition of the emulsion , droplet size , viscosity , phase volumes and ph . the encapsulation efficacy of the opioid antagonist can be optimized by minimizing the migration of drug from the polymer by altering the volume , temperature and chemical composition of the extraction medium ( quench solution ) during the encapsulation process . the purpose of the quench solution is to remove most of the organic solvent from the microspheres during processing . the quench liquid can be plain water , an aqueous solution , or other suitable liquid , the volume , amount , and type of which depends on the solvents in the emulsion phase . the quench liquid volume is on the order of 10 times the saturated volume ( i . e ., 10 times the quench volume needed to completely absorb the volume of solvent in the emulsion ). the quench volume can vary from about 2 to about 20 times the saturated volume . after quenching , the microspheres are separated from the aqueous quench solution by , e . g ., decantation or filtration with a sieve column . various other separation techniques can be used . residual solvent in the microspheres accelerates the degradation process , thereby reducing their shelf - life . the microspheres are therefore preferably washed with water or a solvent miscible therewith to further remove residual solvent , preferably to a level of about 0 . 2 to about 2 . 0 % or less . aliphatic alcohols such as methanol , ethanol , propanol , butanol , and isomers of the foregoing are preferred for use in the wash solution . most preferred is ethanol . alternatively , solvent removal can be accomplished by evaporation . in embodiments where the solvent evaporation method is used , the polymer can be dissolved in a volatile organic solvent . the opioid antagonist is dispersed or dissolved in a solution of the selected polymer and a volatile organic solvent like methylene chloride , the resultant dispersion or solution is suspended in an aqueous solution that contains a surface active agent such as poly ( vinyl alcohol ), and a temperature gradient is used to remove the solvent . the solvent evaporation method may involve dissolving the opioid antagonist and polymer in a co - solvent device . however , alternative methods may be used that omit the incorporation of unacceptable organic solvents . the resulting emulsion is stirred until most of the organic solvent is evaporated , leaving solid microspheres . the solution can be loaded with the opioid antagonist and suspended in 200 ml of vigorously stirred distilled water containing 1 % ( w / v ) poly ( vinyl alcohol ). after 4 hours of stirring , the organic solvent evaporates from the polymer , and the resulting microspheres can be washed with water and dried overnight in a lyophilizer . in embodiments where the spray - drying method is used , the polymer can be dissolved in methylene chloride . a known amount of drug is suspended ( where the opioid antagonist is insoluble ) or co - dissolved ( where the opioid antagonist is soluble ) in the polymer solution . the solution of the dispersion is then spray - dried . this method is used for small microspheres of between 1 - 10 microns . in certain embodiments , a hot melt encapsulation method may be used . using this method , the polymer may first be melted and then mixed with solid particles of drug that have been sieved to less than 50 microns . the mixture is suspended in a non - miscible solvent and , with continuous stirring , heated to 5 ° c . above the melting point of the polymer . once the emulsion is stabilized , it is cooled until the polymer particles solidify . the resulting microspheres are washed by decantation with petroleum ether to give a free - flowing powder . this technique is used for polyesters , polyanhydrides and polymers with high melting points and different molecular weights . the typical yield of microspheres in this process is about 80 - 90 %. the resulting microspheres have a core - shell structure . in order to create microspheres containing opioid antagonist , an organic or oil ( discontinuous ) phase and an aqueous phase may be combined . the organic and aqueous phases are largely or substantially immiscible , with the aqueous phase constituting the continuous phase of the emulsion . the organic phase includes the active agent and the wall forming polymer , i . e . the polymeric matrix material . the organic phase is prepared by dispersing the active opioid antagonist in the organic solvent ( s ). the organic and aqueous phases are preferably combined under the influence of a mixing means , preferably a static mixer . opioid antagonists useful in the present invention include , but are not limited to , nalorphine , nalorphine dinicotinate , naloxone , nalmephene , cyclazocine , levallorphan , naltrexone , nadide , cyclazocine , amiphenazole and pharmaceutically acceptable salts thereof and mixtures thereof . preferably , the opioid antagonist is an orally bioavailable antagonist , e . g ., naltrexone or pharmaceutically acceptable salt thereof . by utilizing a bioavailable antagonist , the transdermal device will deter both oral and parenteral abuse . after the formation of the microspheres containing the opioid antagonist , the microspheres are incorporated into a transdermal delivery device containing an opioid agonist . preferably , the microspheres are included in the transdermal delivery device so that they are substantially indistinguishable from the bulk of the opioid agonist - containing preparation ( e . g ., the microspheres can be imbedded in the matrix of the matrix delivery device ). in certain embodiments , the opioid agonist is in a form that can be absorbed through human skin , i . e ., the opioid agonist can be effectively administered via the transdermal route . in some embodiments , it may be necessary to further provide an absorption enhancer in order to facilitate transdermal absorption . in the transdermal delivery devices of the present invention , the opioid agonist is available for absorption , passing through pores in the intact skin surface of typically less than 50 nm to provide sustained therapeutic levels over a prolonged period . transdermal delivery devices that are prepared in accordance with the present invention may release the opioid agonist in accordance with first order pharmacokinetics ( e . g ., where the plasma concentrations of the opioid agonist increase over a specified time period ), or in accordance with zero order pharmacokinetics ( e . g ., where plasma concentrations are maintained at relatively constant level over a specified time period ), or with both first and zero order pharmacokinetics . opioid agonists that can be selected for use in the transdermal delivery devices of the present invention include any opioid agonists , mixed agonist - antagonists , or partial agonists , including but not limited to alfentanil , allylprodine , alphaprodine , anileridine , benzylmorphine , bezitramide , buprenorphine , butorphanol , clonitazene , codeine , desomorphine , dextromoramide , dezocine , diampromide , diamorphone , dihydrocodeine , dihydromorphine , dimenoxadol , dimepheptanol , dimethylthiambutene , dioxaphetyl butyrate , dipipanone , eptazocine , ethoheptazine , ethylmethylthiambutene , ethylmorphine , etonitazene , fentanyl , heroin , hydrocodone , hydromorphone , hydroxypethidine , isomethadone , ketobemidone , levorphanol , levophenacylmorphan , lofentanil , meperidine , meptazinol , metazocine , methadone , metopon , morphine , myrophine , narceine , nicomorphine , norlevorphanol , normethadone , nalorphine , nalbuphene , normorphine , norpipanone , opium , oxycodone , oxymorphone , papaveretum , pentazocine , phenadoxone , phenomorphan , phenazocine , phenoperidine , piminodine , piritramide , propheptazine , promedol , properidine , propoxyphene , remifentanil , sufentanil , tilidine , tramadol , pharmaceutically acceptable salts thereof , mixtures thereof , and the like . in preferred embodiments , the opioid agonist is selected from the group consisting of transdermally administrable forms of fentanyl , buprenorphine , sufentanyl , hydrocodone , morphine , hydromorphone , oxycodone , codeine , levorphanol , meperidine , methadone , oxymorphone , dihydrocodeine , tramadol , pharmaceutically acceptable salts thereof , and mixtures thereof . any type of transdermal delivery device may be used in accordance with the methods of the present invention , as long as the desired pharmacokinetic and pharmacodynamic response ( s ) are attained over at least a 1 day period , e . g ., from 2 to 8 days . preferable transdermal delivery devices include , e . g ., transdermal patches , transdermal plasters , transdermal discs , and the like . in a preferred embodiment , the transdermal drug delivery device of the present invention is a patch , typically in the range of from about 1 to about 30 square centimeters , preferably 2 to 10 square centimeters . the term “ patch ” as used herein includes any product having a backing member and a pressure - sensitive adhesive face surface enabling adherence to the skin of a patient . such products can be provided in various sizes and configurations , such as tapes , bandages , sheets , and the like . in the transdermal delivery device of the present invention , the opioid agonist is preferably dispersed throughout a matrix ( e . g ., a polymer matrix ). in such a matrix device , release of the opioid agonist can be predominantly controlled by diffusion of the opioid agonist out of the polymer , or by erosion of the polymer to release the opioid agonist , or by a combination of these two mechanisms . when the diffusion of opioid agonist is faster than the erosion of the polymer , drug release is controlled by diffusion . when polymer erosion is faster than diffusion of the opioid agonist , drug release is controlled by erosion of the polymer . if the delivery device is prepared with a surface - erosion polymer , the release of drug can be controlled by varying the amount of drug loaded into the device and / or by varying the geometric dimension of the delivery device . generally , the polymers used in the polymer matrix of the transdermal delivery device are those capable of forming thin walls or coatings through which the opioid agonist can pass at a controlled rate . examples of such polymers for use in preparing the polymer matrix include polyethylene , polypropylene , ethylene / propylene copolymers , ethylene / ethylacrylate copolymers , ethylenevinyl acetate copolymers , silicones , rubber , rubber - like synthetic homo -, co - or block polymers , polyacrylic esters and the copolymers thereof , polyurethanes , polyisobutylene , chlorinated polyethylene , polyvinylchloride , vinyl chloride - vinyl acetate copolymer , polymethacrylate polymer ( hydrogel ), polyvinylidene chloride , poly ( ethylene terephthalate ), ethylene - vinyl alcohol copolymer , ethylene - vinyloxyethanol copolymer , silicones including silicone copolymers such as polysiloxane - polymethacrylate copolymers , cellulose polymers ( e . g ., ethyl cellulose , and cellulose esters ), polycarbonates , polytetrafluoroethylene and mixtures thereof . preferred materials for use in preparing the polymer matrix are silicone elastomers of the general polydimethylsiloxane structures , ( e . g ., silicone polymers ). preferred silicone polymers are those that cross - link and are pharmaceutically acceptable . for example , preferred materials for use in preparing the polymer matrix layer include silicone polymers that are cross - linkable copolymers having dimethyl and / or dimethylvinyl siloxane units that can be crosslinked using a suitable peroxide catalyst . also preferred are those polymers consisting of block copolymers based on styrene and 1 , 3 - dienes ( particularly linear styrene - isoprene - block copolymers of styrene - butadiene - block copolymers ), polyisobutylenes , polymers based on acrylate and / or methacrylate . in certain embodiments , the polymer matrix includes a pharmaceutically acceptable cross - linking agent . suitable crosslinking agents include , e . g ., tetrapropoxysilane , among others . certain embodiments of the present invention include a polymer matrix layer comprising opioid agonist with intermixed microspheres of opioid antagonist . preferably , for the opioid antagonist to become bioavailable , the integrity of the microspheres must be disrupted . the combination of microsphere with polymer matrix prevents release of the opioid antagonist from the microspheres embedded within the matrix in an intact device . release of the opioid antagonist from microspheres may be further prevented by polymer coatings over the microspheres . preferably , the transdermal delivery device of the present invention comprises a backing layer made of a pharmaceutically acceptable material that is impermeable to the opioid agonist . the backing layer preferably serves as a protective cover for the opioid agonist and may also provide a support function . examples of materials suitable for making the backing layer are films of high and low density polyethylene , polypropylene , polyvinylchloride , polyurethane , polyesters such as poly ( ethylene phthalate ), metal foils , metal foil laminates of such suitable polymer films , and textile fabrics . preferably , the materials used for the backing layer are laminates of such polymer films with a metal foil such as aluminum foil . the backing layer can be any appropriate thickness that provides the desired protective and support functions . a suitable thickness will be , e . g ., from about 10 to about 200 microns . in certain alternative embodiments , the transdermal delivery device of the present invention can comprise microspheres are contained in a reservoir . in such a reservoir device , the opioid agonist and microspheres of opioid antagonist are dispersed in a reservoir ( e . g ., a liquid or gel reservoir ), and a rate limiting biodegradable membrane is situated in the flow path of the drugs , thereby limiting the flux of the opioid agonist to the skin . such a device can provide a constant release rate of opioid agonist , but serve to prevent release of the opioid antagonist . a transdermal delivery device utilizing a reservoir device can also have a backing layer , and optionally a removable protective layer as described above with the matrix device . preferred transdermal delivery devices used in accordance with the methods of the present invention preferably further include an adhesive layer to affix the delivery device to the skin of a patient for a desired period of administration , e . g ., from 2 to 8 days . if the adhesive layer of the delivery device fails to provide adequate adhesion for the desired period of time , it is possible to maintain contact between the delivery device and the skin by , e . g ., affixing the delivery device to the skin of the patient with adhesive tape , e . g ., surgical tape . it is not critical for purposes of the present invention whether adhesion of the delivery device to the skin of the patient is achieved solely by the adhesive layer of the delivery device or by use of an external adhesive source , such as surgical tape , provided that the delivery device is adhered to the patient &# 39 ; s skin for the requisite administration period . in all cases , however , the adhesive must allow for the patch to adhere firmly to the skin of the patient in need of treatment , but not be so strongly adhesive as to injure the patient when the patch is removed . the adhesive layer can be selected from any adhesive known in the art that is pharmaceutically compatible with the delivery device . the adhesive is preferably hypoallergenic . examples include a polyacrylic adhesive polymer , acrylate copolymer ( e . g ., polyacrylate ) or polyisobutylene adhesive polymer . other useful adhesives include silicones , polyisoalkylenes , rubbers , vinyl acetates , polybutadiene , styrene - butadiene ( or isoprene )- styrene block copolymer rubber , acrylic rubber and natural rubber ; vinyl - based high molecular weight materials such as polyvinyl alkyl ether , polyvinyl acetate ; cellulose derivatives such as methylcellulose , carboxymethyl cellulose and hydroxypropyl cellulose ; polysaccharides such as pullulan , dextrin and agar ; and polyurethane elastomers and polyester elastomers . while many of these adhesives are virtually interchangeable , some combinations of a specific opioid analgesic and a specific adhesive may provide marginally better properties . in some embodiments , the adhesive is a pressure - sensitive contact adhesive , which is preferably hypoallergenic . in certain embodiments , the transdermal drug delivery material provides the functions of both drug - containing matrix and adhesive . in certain embodiments with a separate adhesive layer , the drug will be distributed throughout all the layers ( with the exception of the backing layer ) according to its relative affinity for the different environments offered by the different layers . the matrix “ layer ” may consist of more than a single sub - layer , with opioid loading in the different layers adjusted to optimize its delivery characteristics and opioid antagonist containing microspheres dispersed throughout . in such embodiments , the drug - containing matrix contacts the skin directly and the transdermal delivery device is held to the skin by a peripheral adhesive or the matrix itself . in certain embodiments , the transdermal delivery device of the present invention optionally includes a permeation - enhancing agent . permeation - enhancing agents are compounds that promote penetration and / or absorption of the opioid agonist through the skin into the blood stream of the patient . as a result of these penetration enhancers , almost any drug , to some degree , can be administered transdermally . permeation - enhancing agents are generally characterized to be from the group of monovalent branched or unbranched aliphatic , cycloaliphatic or aromatic alcohols of 4 - 12 carbon atoms ; cycloaliphatic or aromatic aldehydes or ketones of 4 - 10 carbon atoms , cycloalkanoyl amides of c 10 - 20 carbons , aliphatic , cycloaliphatic and aromatic esters , n , n - di - lower alkylsulfoxides , unsaturated oils , terpenes and glycol silicates . a non - limiting list of permeation - enhancing agents includes polyethylene glycols , surfactants , and the like . permeation of the opioid agonist can be also be enhanced by occlusion of the delivery device after application to the desired site on the patient with , e . g . an occlusive bandage . permeation can also be enhanced by removing hair from the application site by , e . g . clipping , shaving or use of a depilatory agent . another approach to enhancing permeation is by the application of heat to the site of the adhered patch , such as with an infrared lamp . other approaches to enhancing the permeation of opioid agonist includes the use of iontophoretic means . in certain embodiments , the transdermal delivery device includes a softening agent to modify the skin at the point of adhesion to promote drug absorption . suitable softening agents include higher alcohols such as dodecanol , undecanol , octanol , esters of carboxylic acids , wherein the alcohol component may also be a polyethoxylated alcohol , diesters of dicarboxylic acids , such as di - n - butyladiapate , and triglycerides particularly medium - chain triglycerides of the caprylic / capric acids or coconut oil . further examples of suitable softening agents are multivalent alcohols , e . g ., levulinic acid , caprylic acids , glycerol and 1 , 2 - propanediol , which can also be etherified by polyethylene glycols . in certain embodiments , a solvent for the opioid agonist is included in the transdermal delivery device of the present invention . preferably , the solvent dissolves the opioid agonist to a sufficient extent , thereby avoiding complete salt formation . a non - limiting list of suitable solvents includes those with at least one acidic group . monoesters of dicarboxylic acids such as monomethylglutarate and monomethyladipate are particularly suitable . other pharmaceutically acceptable compounds that may be included in the transdermal delivery device of the present invention include viscosity enhancing agents , such as cellulose derivatives , natural or synthetic gums , such as guar gum , and the like . in certain embodiments of the present invention , the transdermal delivery device further includes a removable protective layer . the removable protective layer is removed prior to application , and can consist of materials used for the production of the backing layer described above , provided that they are rendered removable , e . g ., by a silicone treatment . other examples of removable protective layers are polytetra - fluoroethylene , treated paper , allophane , polyvinyl chloride , and the like . generally , the removable protective layer is in contact with the adhesive layer , and provides a convenient means of maintaining the integrity of the adhesive layer until the desired time of application . it is well understood in the art of transdermal delivery devices that in order to maintain a desired flux rate for a desired dosing period , it is necessary to include an “ overage ” of active agent in the transdermal delivery device in an amount that is substantially greater than the amount to be delivered to the patient over the desired time period . for example , to maintain the desired flux rate for a three day time period , it is considered necessary to include in a transdermal delivery device much greater than what would otherwise be 100 % of a three - day dose of the active agent . the remainder of the active agent remains in the transdermal delivery device . only that portion of active agent that exits the transdermal delivery device becomes available for absorption into the skin . the term “ overage ” means for the purposes of the present invention the amount of opioid analgesic contained in a transdermal delivery device that is not delivered to the patient . the overage is necessary for creating a sufficient concentration gradient by which the active agent will migrate from the transdermal delivery device through a patient &# 39 ; s skin to produce a sufficient therapeutic effect . preferably , the transdermal delivery device of the present invention is used for prolonged dosing , releasing the opioid agonist in a constant or pulsed manner to the patient while the opioid antagonist contained in the microspheres remains unreleasable or substantially unreleasable . non - opioid analgesics that may be included in combination with the opioid agonist are , e . g ., acetaminophen , phenacetin and non - steroidal anti - inflammatory agents . suitable non - steroidal anti - inflammatory agents include aspirin , ibuprofen , diclofenac , naproxen , benoxaprofen , flurbiprofen , fenoprofen , flubufen , ketoprofen , indoprofen , piroprofen , carprofen , oxaprozin , pramoprofen , muroprofen , trioxaprofen , suprofen , aminoprofen , tiaprofenic acid , fluprofen , bucloxic acid , indomethacin , sulindac , tolmetin , zomepirac , tiopinac , zidometacin , acemetacin , fentiazac , clidanac , oxpinac , mefenamic acid , meclofenamic acid , flufenamic acid , niflumic acid tolfenamic acid , diflurisal , flufenisal , piroxicam , sudoxicam or isoxicam , pharmaceutically acceptable salts thereof , and mixtures thereof . other suitable non - steroidal anti - inflammatory agents include cox - 2 inhibitors such as celecoxib , dup - 697 , flosulide , meloxicam , 6 - mna , l - 745337 , rofecoxib , nabumetone , nimesulide , ns - 398 , sc - 5766 , t - 614 , l - 768277 , gr - 253035 , jte - 522 , rs - 57067 - 000 , sc - 58125 , sc - 078 , pd - 138387 , ns - 398 , flosulide , d - 1367 , sc - 5766 , pd - 164387 , etoricoxib , valdecoxib , parecoxib , pharmaceutically acceptable salts thereof , and mixtures thereof . other active agents that may be combined with the opioid agonist can be , e . g ., antiemetic / antivertigo agents such as chlorpromazine , perphenazine , triflupromazine , prochlorperazine , triethylperazine , metoclopropramide , cyclizine , meclizine , scopolamine , diphenhydramine , buclizine , dimenhydrate , and trimethobenzamide ; 5 - ht 3 receptor antagonists such as ondansetron , granisetron , and dolasetron ; anti - anxiety agents such as meprobamate , benzodiazepines , buspirone , hydroxyzine , and doxepin , and the like . it is contemplated that previously known transdermal delivery devices can be modified by including in the matrix , reservoir , and / or adhesive layers opioid - antagonist - containing microspheres as described above , so as to decrease the potential for abuse of such devices . for example , the transdermal delivery devices for use in accordance with the present invention can use certain aspects described in u . s . pat . no . 5 , 240 , 711 to hille , et . al . ; u . s . pat . no . 5 , 225 , 199 to hidaka et al . ; u . s . pat . no . 4 , 588 , 580 to gale et . al . ; u . s . pat . no . 5 , 069 , 909 to sharma et al . ; u . s . pat . no . 4 , 806 , 341 to chien et al . ; u . s . pat . no . 5 , 026 , 556 to drust et al . ; and mcquinn , r . l . et al ., “ sustained oral mucosal delivery in human volunteers ” j . controlled release ; ( 34 ) 1995 ( 243 - 250 ). the present invention is also directed to the transdermal dosage forms disclosed herein utilizing different active agent / antagonist combinations ( i . e . non - opioid ) in order to deter the abuse of the active agent . for example , when a benzodiazepine is used as the active agent in the transdermal dosage form of the present invention , a non - releasable benzodiazepine antagonist can be formulated in the transdermal dosage form . when a barbiturate is used as an active agent in the transdermal dosage form of the present invention , a non - releasable barbiturate antagonist can be formulated in the transdermal dosage form . when an amphetamine is used as an active agent in the transdermal dosage form of the present invention , a non - releasable amphetamine antagonist can be formulated in the transdermal dosage form . the term “ benzodiazepines ” refers to benzodiazepines and drugs that are derivatives of benzodiazepine that are able to depress the central nervous system . benzodiazepines include , but are not limited to , alprazolam , bromazepam , chlordiazepoxied , clorazepate , diazepam , estazolam , flurazepam , halazepam , ketazolam , lorazepam , nitrazepam , oxazepam , prazepam , quazepam , temazepam , triazolam , methylphenidate and mixtures thereof . benzodiazepine antagonists that can be used in the present invention include , but are not limited to , flumazenil . barbiturates refer to sedative - hypnotic drugs derived from barbituric acid ( 2 , 4 , 6 ,- trioxohexahydropyrimidine ). barbiturates include , but are not limited to , amobarbital , aprobarbotal , butabarbital , butalbital , methohexital , mephobarbital , metharbital , pentobarbital , phenobarbital , secobarbital and mixtures thereof . barbiturate antagonists that can be used in the present invention include , but are not limited to , amphetamines , as , described herein . stimulants refer to drugs that stimulate the central nervous system . stimulants include , but are not limited to , amphetamines , such as amphetamine , dextroamphetamine resin complex , dextroamphetamine , methamphetamine , methylphenidate and mixtures thereof . stimulant antagonists that can be used in the present invention include , but are not limited to , benzodiazepines , as described herein . the present invention is also directed to the transdermal dosage forms disclosed herein utilizing adverse agents other than antagonists in order to deter the abuse of the active agent . the term “ adverse agent ” refers to any agent which can create an unpleasant effect upon administration in a releasable form . examples of adverse agents , other than antagonists , include emetics , irritants and bittering agents . irritants include , but are not limited to , capsaicin , capsaicin analogs , and mixtures thereof . capsaicin analogs include resiniferatoxin , tinyatoxin , heptanoylisobutylamide , heptanoyl guaiacylamide , other isobutylamides or guaiacylamides , dihydrocapsaicin , homovanillyl octylester , nonanoyl vanillylamide , and mixtures thereof . bittering agents include , but are not limited to , flavor oils ; flavoring aromatics ; oleoresins ; extracts derived from plants , leaves , flowers ; fruit flavors ; sucrose derivatives ; chlorosucrose derivatives ; quinine sulphate ; denatonium benzoate ; and combinations thereof . the following examples are not meant to limit the invention in any manner . using the procedure disclosed in this example , multiple batches of naltrexone - loaded microspheres were prepared using different molecular weight lactide / glycolide ( 65 : 35 ) polymers ( 40 kd , 40 kd with 0 . 01 % calcium chloride , 50 : 50 blend of 40 kd and low molecular weight ( about 10 kd ) and 11 kd ) naltrexone - loaded microspheres were fabricated using a water - in - oil - in - water ( w / o / w ) double - emulsion solvent extraction / evaporation technique . in this process , naltrexone was dissolved in phosphate - buffered saline ( pbs ) ( ph 7 . 4 ) solution containing 0 . 05 % ( w / v ) polyvinylalcohol ( pva ) as an emulsifier and mixed with ethyl acetate containing poly ( lactic - co - glycolic acid ) ( plga ). the emulsification was carried out by sonication for 15 seconds . the resulting emulsion was further injected into pbs ( ph 7 . 4 ) containing 0 . 05 % ( w / v ) pva as an emulsifier to produce a double w / o / w emulsion . the dispersion was then stirred at a constant temperature for 30 minutes . in order to extract ethyl acetate from the first emulsion into the external phase , a second buffer solution ( ph 7 . 4 ) containing 0 . 05 % ( w / v ) pva was added continuously at a rate of 3 ml / minute . the temperature of the second emulsion throughout the solvent extraction / evaporation stage was maintained constant using a low - temperature circulator . the resulting naltrexone - loaded microspheres were collected by vacuum - filtration and washed three times with pbs . the microspheres were then vacuum - dried overnight and stored at 4 c . the load of naltrexone for the microspheres is set forth below in table 1 . the microsphere prepared in example 1 were exposed to simulated extraction conditions to determine the degree of in - vitro release of naltrexone from the microspheres . the extractions were performed using 0 . 5n nacl , ph 6 . 5 phosphate buffer . the sample size was 100 mg microspheres and the naltrexone release was measures at 0 . 5 , 1 and 4 hours . the results are set forth in table 2 and fig5 . based on the amount of antagonist released from any given microsphere formulation , the amount of antagonist loaded into the microspheres can be adjusted in order to obtain the release of a desired amount upon tampering . microspheres are prepared as follows . naltrexone is mixed with requisite amounts of gelatin , tween 80 and water , and heated . the mixture is then dispersed in a mixture of aluminum monostearate , span 80 and soybean oil to form a microemulsion . the microemulsion is homogenized by a microfluidizer . thereafter , the microemulsion is dispersed in a plga - acetonitrile solution . the acetonitrile is then removed from the emulsion by evaporation under atmospheric pressure , thereby forming microspheres containing naltrexone to be incorporated into a transdermal delivery device . a transdermal patch is prepared in accordance with the disclosure of wo 96 / 19975 to lts gmbh , published jul . 4 , 1996 , with the addition of naltrexone - containing microspheres prepared in accordance with example 1 , as follows : the following are homogenized : 1 . 139 g of a 47 . 83 w / w % polyacrylate solution with a self cross - linking acrylate copolymer containing 2 - ethylhexylacrylate , vinyl acetate , acrylic acid ( dissolving agent : ethylacetate : heptan : isopropanol : toluol : acetylacetonate in the ratio of 37 : 26 : 26 : 4 : 1 ), 100 g laevulinic acid , 150 g oleyloleate , 100 g polyvinylpyrrolidone , 150 g ethanol , 200 g ethyl acetate and 100 g buprenorphine base . the mixture is stirred for about 2 hours and then examined visually to confirm that all solid substances have been dissolved . evaporation loss is controlled by method of weighing back and making up for the solvent with addition of ethylacetate , if necessary . thereafter , the mixture is combined with the naltrexone microspheres prepared as described above in example 1 . this mixture is then transferred to a 420 mm wide transparent polyester foil . the solvent is removed by drying with heated air . thereafter , the sealing film is covered with a polyester foil . a surface of about 16 cm 2 is cut with the help of the appropriate cutting tool . while the invention has been described and illustrated with reference to certain preferred embodiments thereof , those skilled in the art will appreciate that modifications can be made herein without departing from the spirit and scope of the invention . such variations are contemplated to be within the scope of the appended claims . | 1 |
the present disclosure will now be described more fully with reference to the accompanying figures , which show preferred embodiments . the accompanying figures are provided for general understanding of the structure of various embodiments . however , this disclosure may be embodied in many different forms . these figures should not be construed as limiting and they are not necessarily to scale . “ twc ” refers to a three way catalyst or three - way catalytic converter . fig1 depicts a schematic top view of an internal combustion engine in accordance with embodiments of the present invention . fig1 depicts four cylinders ( 16 , 76 , 106 , 46 ) in - line with each other . as will become apparent , one skilled in the art will understand that any number of even cylinders may be used in this engine , and the cylinders may be in - line or rotated ( e . g . in v - shape or the like ). the four cylinders of the engine , being in - line , define a longitudinal axis 138 . the longitudinal axis 138 generally splits the engine shown into two opposing sides of the engine ( 1 , 2 ). the first side 11 contains the primary intake manifold 15 and the primary exhaust manifold 17 . the second side 13 contains the egr manifold 6 , constructed in accordance with the teachings of the present disclosure . as depicted in fig1 , intake air may come into the engine via the primary intake manifold 15 , coupled to a throttle and cooled by a water cooled air cooler (“ wcac ”). similarly , eg may leave through the primary exhaust manifold 17 , a turbine , and twc . each of the four cylinders depicted preferably have four ports operably connected to four valves . for example , the first cylinder 16 has a first primary exhaust port 21 operably connected to a first primary exhaust valve 19 , and a first primary intake port 25 connected to a first primary intake valve 23 . the first cylinder 16 also has a first auxiliary exhaust port 28 operably connected to a first auxiliary exhaust valve 18 , and a first in auxiliary intake port 36 connected to a first auxiliary intake valve 30 . in further example , the second cylinder 46 may also have a second auxiliary exhaust port 58 operably connected to a second auxiliary exhaust valve 48 , and a second auxiliary intake port 66 operably connected to a second auxiliary intake valve 60 . the engine may further have a valve actuator , such as a camshaft , ( not shown here ) connected to the first auxiliary exhaust and intake valves and the second auxiliary exhaust and intake valves to open and close the first auxiliary exhaust and intake ports and the second auxiliary exhaust and intake ports , respectively . the valve actuator may operate the valves to directly connect the first auxiliary exhaust port 28 to only the second auxiliary intake port 66 . likewise , the valve actuator may also directly connect the second auxiliary exhaust port 58 two only the first auxiliary intake ports 36 . this provides direct exchange of eg between only the first and second cylinders ( 16 , 46 ). as shown in fig1 , the engine may further have a third cylinder 76 and a fourth cylinder 106 . just as with the first and second cylinders , the third cylinder 76 may have a third auxiliary exhaust ports 88 operably connected to a third auxiliary exhaust valve 78 , and a third auxiliary intake port 96 operably connected to a third auxiliary intake valve 90 . the fourth cylinder 106 may have a fourth auxiliary exhaust port 118 operably connected to the fourth auxiliary exhaust valve 108 , and a fourth auxiliary intake port 126 operably connected to a fourth auxiliary intake valve 120 . as described above , the valve actuator may operably connect to the third auxiliary exhaust and intake valves and the fourth auxiliary exhaust and intake valves to open and close the third auxiliary exhaust and intake ports and the fourth auxiliary exhaust and intake ports , respectively . the valve actuator may operate the valves to directly connect the third auxiliary exhaust port 88 to only the fourth auxiliary intake port 126 , and directly connecting the fourth auxiliary exhaust ports 118 to only the third auxiliary intake port 96 . this provides direct exchange of eg only between the third and fourth cylinders ( 76 , 106 ). by directly providing egr between the first and second cylinders ( or third and fourth cylinders ) eg phasing is simplified . likewise , issues with controlled distribution among the cylinders ( mal - distribution ) are mitigated or eliminated . the structure to preform egr is also simplified , as a single manifold with limited piping and a single cam shaft can be used in this design . this direct exchange of eg may be accomplished by the formation of the egr manifold 6 . the egr manifold 6 may comprise a first flow path 38 connected to the first auxiliary exhaust port 28 and extending only from the first auxiliary exhaust port 28 to the second auxiliary intake port 66 . the first flow path 38 may be in selective fluid communication with the first cylinder 16 and the second cylinder 46 by way of the first auxiliary exhaust port 28 and a second auxiliary intake port 66 . similarly , the egr manifold 6 may comprise a second flow path 68 connected to the second auxiliary exhaust port 58 and extending only from the second auxiliary exhaust port 58 to the first auxiliary intake port 36 . the second flow path 68 may be in selective fluid communication with the first cylinder 16 and a second cylinder 46 by way of the second auxiliary exhaust or 58 and the first auxiliary intake port 36 . in this way , a first exhaust gas 44 may flow from the first auxiliary exhaust port 28 only to the second auxiliary intake port 66 . a second exhaust gas 74 may flow from the second auxiliary exhaust port 58 only to the first auxiliary intake port 36 . the engine may generate a third exhaust gas 104 in a third flow path 98 and a fourth exhaust gas 134 in a fourth flow path 128 , each being similar to the first and second egs ( 44 , 74 ). the first flow path 38 and a second flow path 68 may be formed similarly . for example , the first flow path 38 and a second flow path 68 may have the same length and accommodate the same volume . in one example , the first flow path may have a first flow path length 40 and the second flow path may have a second flow path length 70 such that each length is less than or equal to 1 meter ( m ). this 1 meter or shorter length may provide advantages in the direct flow of blowdown eg . it will be apparent that neither of the first cylinder 16 nor the second cylinder 46 may be fluidly connected to either of the third cylinder 76 or the fourth cylinder 106 via their respective auxiliary exhaust and intake ports . fig1 also depicts two chambers within the egr manifold 6 . for example , the egr manifold 6 may have a first chamber 8 with a first length and a first volume 10 , and a second chamber 12 with a second length and a second volume 14 . both chambers ( 10 , 12 ) may be visible here , but it may be apparent that one chamber may also be obscured by the other ( e . g . under the other ) in a top view . the first chamber 8 may directly connect the first cylinder 16 to only the second cylinder 46 . the second chamber 12 may directly connect the third cylinder 76 to only the fourth cylinder 106 . as with the first and second flow path lengths ( 40 , 70 ), the first length may be about or substantially the same as the second length . likewise , the first volume 10 may be about the same or substantially the same as the second volume 14 . the first chamber 8 may not be in fluid communication , or out of fluid communication with , the second chamber 12 . in fig1 , each manifold depicted may have a cooling element disposed about the manifold . for example , cooling element or unit 160 may be disposed about the primary intake manifold 15 , and cooling element 162 may be disposed about the egr manifold 6 . the cooling element may be water cooled , air cooled , and the like , as will be known to a person of ordinary skill in this art . each cylinder may have primary ports located on the first side 11 and secondary ports located on the second side 2 . for example , the first cylinder 16 is positioned between the first side 11 and a second side 13 of the engine . the first cylinder 16 has a first primary exhaust port 21 and a first primary intake port 25 positioned on the first side 1 , and the first auxiliary exhaust port 28 and the second auxiliary exhaust port 36 being positioned on the second side 2 . likewise , the second cylinder 46 has the second primary exhaust and intake ports being positioned on the first side 1 , and the second auxiliary exhaust port 58 and the second auxiliary intake port 66 being positioned on the second engine side 2 . in this arrangement , the first and second primary exhaust ports are in selective fluid communication with the primary exhaust manifold 17 . thus , first and second auxiliary exhaust and intake ports are in selective fluid communication with the egr manifold 6 . this arrangement is also seen with the third and fourth cylinders ( 76 , 106 ). by providing egr exhausting and intaking on the same side of the engine , the flow paths can be shortened ( e . g . & lt ; 1 m ). in addition , this arrangement may allow for simplified routing ( e . g . a single manifold without additional pipes ). fig2 depicts side views of the engine described herein performing egr . as described above , the engine may have four cylinders with four ports each . in fig2 , only two ports are shown per cylinder because the two other ports may be obscured . the first cylinder 16 has a first primary exhaust port 21 and a first primary intake port 25 . the first cylinder 16 also has a first auxiliary exhaust port and a first auxiliary intake port ( obscured by the primary ports ). the ports may be operably connected to a valve actuator , such as camshaft 136 . the auxiliary valves ( obscured in this view ) may be operated by rocker arms ( 20 , 50 , 80 , 110 ), discussed further below . each rocker arm may be operated by a rocker arm lobe around the camshaft 136 ( 26 , 56 , 86 , 116 ). for example , a first rocker arm 20 may be operated to open and close the first auxiliary intake port by a first rocker arm lobe 26 . this operation will be discussed in further detail in fig3 below . it will be understood that the second cylinder 46 , the third cylinder 76 , and the fourth cylinder 106 each have the same arrangement as the first cylinder 16 , with a primary exhaust port , a primary intake port , an auxiliary exhaust port , and an auxiliary intake port . in fig2 a , the valve actuator 136 is positioned at 0 ° crank angle . the first cylinder 16 is at tdc preparing for its firing stroke , and the third cylinder 76 is at bdc after exhausting . in this position , the second cylinder 46 is intaking air via the second primary intake port . in fig2 b , the crank angle has rotated to 50 ° and the first cylinder 16 is in its firing stroke , generating a first exhaust gas . firing pushes the first cylinder 16 towards bdc , and exhausts a portion of the first exhaust gas through only the first auxiliary exhaust port . after the first exhaust gas is exhausting through only the first auxiliary exhaust port , the second cylinder 46 is intaking the portion of the first exhaust gas from the first auxiliary exhaust port into only the second auxiliary intake port . after the portion of the first exhaust gas has is intaken into the second cylinder 46 , a remainder of the first exhaust gas is exhausted through the first primary exhaust port 21 . in fig2 c , the crank angle has rotated to 180 °, and the fourth cylinder 106 is preparing for its firing stroke . at this point , the third cylinder 76 is intaking air via the third primary intake port . in fig2 d , the crank angle has rotated to 230 °, and the fourth cylinder 106 is in its firing stroke , generating a fourth exhaust gas . a portion of the fourth exhaust gas is exhausted through only the fourth auxiliary exhaust port . the portion of the fourth auxiliary exhaust gas is intaken into only the third auxiliary intake port . subsequently , a remainder of the fourth exhaust gas is exhausted through the fourth primary exhaust port to empty the cylinder . in fig2 e , the crank angle has rotated to 360 °, and the second cylinder 46 is preparing for its firing stroke . in this position , the first cylinder 16 is intaking air via the first primary intake port 25 . in fig2 f , the second cylinder 46 is in its firing stroke , generating a second exhaust gas . a portion of the second exhaust gas is exhausted through only the second auxiliary exhaust port . subsequently , the portion of the second auxiliary exhaust gas is intaken from the second auxiliary exhaust port two only the first auxiliary intake port . after intaking , a remainder of the second exhaust gas is exhausted through the second primary exhaust port . in fig2 g , the crank angle has rotated it to 540 ° about the valve actuator 136 , and the fourth cylinder is intaking air via the fourth primary intake port . subsequently , the third cylinder may fire , wherein firing the third cylinder generate a third exhaust gas . a portion of the third exhaust gas may exhaust through only the third auxiliary exhaust port . then , the portion of the third exhaust gas may be intaken from the third auxiliary exhaust port into only the fourth auxiliary intake port . subsequently , a remainder of the third exhaust gas may be exhausted through the third primary exhaust port . as shown in fig2 a - g , the overall firing sequence and blowdown sequence may be : cylinder 16 , cylinder 106 , cylinder 46 , cylinder 76 . the overall intaking sequence may be : cylinder 46 , cylinder 76 , cylinder 16 , cylinder 106 . fig3 a - c show further details of firing and intaking for two paired cylinders . for example , the first cylinder 16 with piston 210 is in its firing stroke . in this firing stroke , at 50 ° crank angle , the intake port 36 would be closed and the exhaust port 28 would be exhausting from the first cylinder 16 into the second cylinder 46 . the second cylinder 46 with piston 220 may be in its intaking stroke . in this position , the second cylinder 46 would be intaking eg directly from the first auxiliary exhaust port 28 into the second auxiliary intake for 66 . the second auxiliary exhaust port 58 would be closed . when cylinder 16 is intaking , first primary intake valve 23 will be open for air 170 and the first auxiliary intake valve 30 will be open to intake second exhaust gas 74 . line b - b depicts a top view , shown further in fig3 b . fig3 b shows the top of the first and second cylinders ( 16 , 46 ) when the first cylinder 16 is in its firing stroke and the second cylinder 46 is in it intaking stroke . first auxiliary exhaust port 28 is open to allow first flow path 38 to connect from only the first auxiliary exhaust port 28 directly into the second auxiliary intake port 66 , which is also open . simultaneously , the second primary intake port of the second cylinder 46 is also open . at this time , the second primary exhaust port of the second cylinder 46 is closed , the second auxiliary exhaust port 58 is closed , and the second flow path 68 contains no eg . the first auxiliary intake port 36 is closed , and the first primary exhaust and intake ports ( 21 , 25 ) are also closed . fig3 c shows graphs of the paired first and second cylinders ( 16 , 46 ). for example , the first cylinder 16 begins exhausting a first exhaust gas at approximately 50 ° crank angle , showing in peak 222 . after a portion of the first exhaust gas is exhausted , the remainder of the first exhaust gas exhausts through the first primary exhaust port , in peak 224 . around 360 ° crank angle , the first cylinder 16 began intaking air , shown in peak 226 . correspondingly , the second cylinder 46 is finishing exhausting a second exhaust gas through the second primary exhaust port , in peak 228 . subsequently in peak 230 , the second cylinder 46 begins it intaking stroke . this intaking stroke begins slightly before the first cylinder 16 starts to exhaust the first exhaust gas ( peak 222 ). next in peak 232 , the second cylinder 46 begins intaking the first exhaust gas through the second auxiliary intake port . fig4 a - c show further details of the valve actuator and rocker arms for controlling the cylinders . the valve actuator 136 may be a soho . more preferably , the valve actuator 136 has a cam - in - cam arrangement to accommodate operation of the primary and auxiliary valves . fig4 a depicts each cylinder having three operably connected lobes around the cam 136 . lobe e may control the primary exhaust valve . lobe i may control the primary intake valve . the third lobe positioned with each cylinder may control the rocker arm associated with each cylinder ( i . e . a rocker arm lobes 26 , 56 , 86 , 116 ). line b - b depicts a top view shown in fig4 b . fig4 b depicts a top view . the cam 136 is positioned above the primary exhaust and intake valves of each cylinder . in addition , the auxiliary exhaust and intake valves are shown next to the primary exhaust and intake valves . each auxiliary exhaust and intake valve has a corresponding rocker arm positioned above . fig4 c depicts one exemplary rocker arm ( e . g . first rocker arm 20 ). the first rocker arm 20 will be used as an example to demonstrate the details of any rocker arm ( 50 , 80 , 110 ). the first rocker arm 20 may be operably connected to the first auxiliary intake valve , in a first intake position . the first intake position allows the first cylinder to intake directly from the second cylinder . the first rocker arm 20 may be operably connected to the first auxiliary exhaust valve , in a first exhaust position . the first exhaust position allows the first cylinder to exhaust directly into the second cylinder . likewise , the second rocker arm 50 may be operably connected to the second auxiliary intake valve , and a second intake position . the second rocker arm 50 may also be operably connected to the second auxiliary exhaust valve , and a second exhaust position . the first rocker arm 20 may be movable between the first exhaust and intake position by the valve actuator 136 because the valve actuator may have a first rocker arm lobe 26 . the first rocker arm lobe 26 may have 360 ° rotation about the valve actuator 136 . it may be apparent to one skilled in the art that the first rocker arm 20 may be in the first exhaust position when the second rocker arm 50 may be in the second intake position . correspondingly , the first rocker arm 20 may be in the first intake position when the second rocker arm 50 is in the second exhaust position . this arrangement may provide for exchange of eg between the first and second cylinders . as stated above , a third rocker arm 80 may be operably connected to the third auxiliary intake valve , in a third intake position . the third rocker arm 80 may also be operably connected to the third auxiliary exhaust valve , and a third exhaust position . the fourth rocker arm 110 may be operably connected to the fourth auxiliary intake valve , and a fourth intake position . the fourth rocker arm 110 may also be connected operably to the fourth auxiliary exhaust valve , in a fourth exhaust position . it will be understood that the rocker arms could be operated in the opposite manner , such that contacting one rocker arm with an intake valve closes the intake valve and operates the corresponding exhaust position , and contacting the one rocker arm with the exhaust valve closes the exhaust valve and operates the corresponding intake position . likewise , electronically controlled valves may also be used in place of the camshaft and / or rocker arms . fig5 depicts another view of the chambers ( 8 , 12 ). in fig5 a , one skilled in the art will understand that second chamber 12 may be obscured by first chamber 8 . the first chamber 8 may have a first volume 10 being equal to the second volume 14 of the second chamber 12 . additionally , cooling element 160 may be disposed about both chambers . the first flow path 38 may flow from the first cylinder 16 through first chamber 8 into the second cylinder 46 , without flowing into the second chamber at all . likewise , the second flow path 68 may flow from the second cylinder 46 through the first chamber 8 into the first cylinder 16 . in a similar manner , the third flow path 98 may flow from the third cylinder 76 through the second chamber 12 into the fourth cylinder 106 , without flowing into the first chamber at all . the fourth flow path 128 may flow from the fourth cylinder 106 through the second chamber 12 to the third cylinder 76 . line b - b depicts an end view of the chambers . in fig5 b , the first chamber 8 is not fluidly connected to the second chamber 12 . it should be understood that the foregoing relates to exemplary embodiments of the disclosure and that modifications may be made without departing from the spirit and scope of the disclosure as set forth in the following claims . while the disclosure has been described with respect to certain embodiments it will be appreciated that modifications and changes may be made by those skilled in the art without departing from the spirit of the disclosure . | 5 |
in view of the product on the market of the design in the patents , all of them are not taken into consideration of the requirements of user , convenient to the user and the usage of a remote control in match with the environment . referring to fig1 , the remote control body ( 1 ) is mainly composed of the first casing ( 110 ), the second casing ( 100 ) and mirror ( 10 ). the first casing ( 110 ) has the back shell ( 112 ), and the internal of which is installed with a remote control signal transceiver components ( not shown in figure ) whereby to remote control signal to the specific electrical appliances ( such as television ), or to be set to receive a specific remote control signals . the second casing ( 100 ) are hinge ( 12 ) connected with the back shell ( 112 ) in a manner of open and close and a storage space ( 11 ) is formed between a back shell ( 112 ) and the second casing ( 100 ), which can store specific cosmetic accessories or devices . mirror ( 10 ) can also be installed in the storage space ( 11 ), in this example , set in the back shell ( 112 ) of the first casing ( 110 ). in addition , storage space ( 11 ) mentioned as above can hold cosmetic accessories , for example , comb ( 119 ), powder puff ( 111 ), etc . with a mirror ( 10 ). it is convenient for user to notice their appearance or complete make - up action when watching television ; and products placed in the storage space ( 11 ) are not limited to as mentioned as above . also , the first magnetic peripheral ( 115 ) can be set up on the peripheral in the back shell ( 112 ) of the first casing ( 110 ), and the corresponding second magnetic peripheral ( 116 ) can be set up on the peripheral in the second shell ( 100 ), which to make the first casing ( 110 ) and the second casing ( 100 ) close for magnetic phase magnetize each other to close tightly . further , the remote control body ( 1 ) in this example is also installed with an additional magnifying glass like the installation of the magnifying glass ( 20 ) as shown in the fig2 - 1 and fig2 - 2 , set in the second casing ( 100 ), especially on the back of the second casing ( 100 ). referring to fig2 - 1 and fig2 - 2 , this example is mainly related with the remote control body ( 1 ) and magnifying glass ( 20 ). the remote control body ( 1 ) has a back shell ( 21 ) electroplated which function as a mirror , and the internal part of said remote control body is installed with a remote control signal transceiver components ( not shown in figure ) whereby to remote control signal to the specific electrical appliances ( such as television ), or to be set to receive a specific remote control signals . magnifying glass ( 20 ) is connected to the remote control body ( 1 ), and may be used in such as : rotating , or flipping way . in this example , magnifying glass ( 20 ) are located in the top of back shell ( 21 ) of remote control body ( 1 ), the so - called “ top ” means near around the infrared signal receiver ( 7 ) as shown fig2 - 2 , the magnifying glass ( 20 ) can be rotate out by a pivot ( 200 ) connected to the remote control body ( 1 ), the remote control body ( 1 ) itself becomes the grip of a magnifying glass ( 20 ), the back shell ( 21 ) can be used as a mirror . in addition , the back shell ( 21 ) mentioned as above can be made from the mirror material , or through electroplating making the back shell ( 21 ) like a mirror . referring to fig3 - 1 and fig3 - 2 , the back shell ( 21 ) of the remote control body ( 1 ) in this example is located at on the top of a concave space ( 212 ) so as to store the magnifying glass ( 20 ). a rotating hinge ( 211 ) is connecting to the magnifying glass ( 20 ) and the remote control body ( 1 ), then to flip upward , that is to say , magnifying glass ( 20 ) can be rotated above upward to a remote control body ( 1 ), the remote control body ( 1 ) can be used as a grip on their own as a magnifying glass and back shell ( 21 ) can be used as a mirror . in addition , the back shell ( 21 ) mentioned as above can be made from the mirror material , or through electroplating making the back shell ( 21 ) like a mirror . referring to fig4 , this example is mainly related with the remote control body ( 1 ), magnifying glass ( 20 ) and mirror set ( 10 ). remote control body ( 1 ) has a first slot and a second slot . the first slot and a second slot respectively have a first - guiding structure and a second - guiding structure . in this example , the first slot and second slot mentioned as above are storage space ( 205 ), and the first - guiding structure and the second - guiding structure are a guided combined structure composed of protruding tracks ( 261 ) and grooves ( 102 ). additionally , the magnifying glass ( 20 ) is set in the first slot , and guided by the first - guiding structure in sliding locating ; the mirror ( 10 ) is set in the second slot , and guided by the second - guiding structure in sliding locating . in this example , storage space ( 205 ) is set at the top , and on the left or the right side of a remote control body ( 1 ), on whose side there are two lateral grooves ( 102 ), sliding in the storage space ( 205 ) altogether the protruding tracks ( 261 ) on two sides of the magnifying glass ( 20 ). when use the magnifying glass ( 20 ), the handle ( 203 ) position on top of the magnifying glass ( 20 ) and can the magnifying glass ( 20 ) pulled out along the protruding tracks ( 261 ) and groove ( 102 ) in a compatible direction . as the same as the magnifying glass ( 20 ), the mirror ( 10 ) set inside of remote control body ( 1 ) will be used by the mirror handle ( 103 ) to pull the mirror ( 10 ) out along the protruding tracks ( 261 ). referring to fig5 , a storage space ( 205 ) is located at the top of the remote control body ( 1 ). both sides of said storage space ( 205 ) are two protruding tracks ( 101 ), which correspond to concave tracks ( 260 ) in two sides of magnifying glass ( 20 ), making the magnifying glass ( 20 ) sliding inside the storage space ( 205 ). when using the magnifying glass ( 20 ), the release key ( 274 ) on the remote control body ( 1 ) is pressed downward , the clip ( 272 ) in one side of the magnifying glass ( 20 ) deviates from the slot ( 273 ), so the spring ( 120 ) inside the remote control body ( 1 ) push the magnifying glass ( 20 ) out of remote control body ( 1 ). when the magnifying glass ( 20 ) slides upwards , the spring plate ( 272 ) pushes over the protruding member ( 150 ) into the track ( 130 ), until the clip ( 272 ) stop against the stopper ( 140 ). mentioned as the same as above , a mirror set ( 10 ) can be situated on one side of the remote control body ( 1 ) ( no shown in figure ), and like the device of the magnifying glass ( 20 ), mirror ( 10 ) can be spring out of remote control body ( 1 ). referring to fig6 - 1 , 6 - 2 and 6 - 3 , this example is mainly composed of the remote control body ( 1 ), the screen ( 39 ) and embedded lens ( 31 ). remote control body ( 1 ) has a front face and a top face , a guided - positioning structure at the top face as mentioned above . in this example , by means of the first - guiding structure in sliding locating is guided - positioning combined structure composed of positioning pole ( 32 ) and sliding track ( 170 ). additionally , the screen ( 39 ) is located in the front face mentioned as above ; embedded lens ( 31 ) are installed at the top face mentioned as above , and is hidden located by the first guided - positioning structure . in this example , there is a screen ( 39 ) in the remote control body ( 1 ) at the top , the embedded lens ( 31 ) in one of its drawtube ( 30 ) in the back . mode selection keys ( 50 ) is set below the screen ( 39 ), and the mode selection keys ( 50 ) when pressed right is the increase key ( 54 ), pressed left is the reduce key ( 53 ), pressed up is the next key ( 51 ), pressed down is the back key ( 52 ), on the bottom of the mode selection key ( 50 ) is the enter key ( 60 ). when a magnifying glass is used , firstly select magnifying glass function in the mode selection keys ( 50 ), and at the same time press increase key ( 54 ) to use its built - in circuit chip &# 39 ; s features of zoom in or zoom out , and then through rearview window ( 35 ) shoot the scene to enlarge the images by the embedded lens ( 31 ), by pressing increase key ( 54 ) to make the image enlarged so as to reach the function of a magnifying glass . the embedded lens ( 31 ) in the back of a remote control body ( 1 ) is rotated by means of the knob ( 33 ) on the remote control body ( 1 ) and the embedded lens ( 31 ) to both sides of positioning poles ( 32 ) slide upward or downward by sliding channel ( 170 ), after rotate 180 degrees to the front of the camera positioning , and then press mode selection keys ( 50 ) to select the mirror mode , can be through the embedded lens ( 31 ) taking images and display on the screen ( 39 ), which can function as a mirror , the image can also be enlarged by pressing increase key ( 54 ) to zoom in the images and function as a magnifying glass . referring to fig7 - 1 and fig7 - 2 , this example is mainly composed of the remote control body ( 1 ), the screen ( 39 ) and embedded lens ( 31 ). remote control body ( 1 ) has a front face ( 105 ), back face ( 106 ), and the established surface . screen ( 39 ) is located in the front face ( 105 ) mentioned as above ; embedded lens ( 31 ) can be set at the established surface , which can be established in the front face ( 105 ) mentioned as above , as shown in the fig7 - 1 , and can be also located in the back face ( 106 ) as shown in the fig7 - 2 . now referring to fig7 - 1 , if embedded lens ( 31 ) can be set on the front face ( 105 ) of a remote control body ( 1 ) used as an example , a front window ( 75 ) and a former lens ( 71 ) are installed at the top of the front face ( 105 ) of a remote control ( 1 ). and referred to the structure and operation principle as same as made in example 6 , the model selection keys ( 50 ) can be used to switch into a mirror mode to be used as a mirror . the function likewise as a magnifying glass is the same way . since certain changes may be made in the above described invention without departing from the spirit and scope of as the invention herein involved , it is intended that all of the subject matter of the above description or shown in the accompanying drawings shall be interpreted merely as examples illustrating the inventive concept herein and shall not be construed as limiting the invention . | 0 |
the invention is described more fully hereinafter with reference to the accompanying drawings , in which exemplary embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the exemplary embodiments set forth herein . rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . in the drawings , the size and relative sizes of layers and regions may be exaggerated for clarity . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . embodiments of the invention are described herein with reference to illustrations that are schematic illustrations of idealized embodiments ( and intermediate structures ) of the invention . as such , variations from the shapes of the illustrations as a result , for example , of manufacturing techniques and / or tolerances , are to be expected . thus , embodiments of the invention should not be construed as limited to the particular shapes of regions illustrated herein but are to include deviations in shapes that result , for example , from manufacturing . unless otherwise defined , all terms ( including technical and scientific terms ) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . it will be further understood that terms , such as those defined in commonly used dictionaries , should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein . fig1 provides a block diagram for various electronic components which may be used within an exemplary electronic display assembly . one or more power modules 21 may be placed in electrical connection with a backplane 22 , which could be provided as a printed circuit board which may facilitate electrical communication and / or power between a number of components in the display assembly . a display controlling assembly 20 may also be in electrical connection with the backplane 22 . the display controlling assembly 20 preferably includes a number of different components , including but not limited to a video player , electronic storage device , and a microprocessor which is programmed to perform any of the logic that is described within this application as well as other logic common to this technology but not explicitly described herein . it should also be noted that any storage of data for any of the embodiments described herein can occur at either : ( 1 ) the electronic storage device on the display controlling assembly 20 , ( 2 ) a remote server 42 which can be accessed through second data interface connection 33 , or ( 3 ) stored both on the local storage device on the display controlling assembly 20 as well as a periodic backup stored on the remote server 42 . this figure also shows a backlight 23 , lcd assembly 24 , and a front transparent display panel 25 . the backlight 23 may be a ccfl or light emitting diode ( led ) backlight . it should be noted that although the setup for an lcd is shown , embodiments can be practiced with any electronic image - producing assembly . thus any other flat panel display could be used , including but not limited to plasma , light - emitting polymers , and organic light emitting diode ( oled ) displays . a fan assembly 26 is shown for optionally cooling displays which may reach elevated temperatures . one or more temperature sensors 27 may be used to monitor the temperature of the display assembly , and selectively engage fan assembly 26 when cooling is needed . an ambient light sensor 28 is preferably positioned to measure the amount of ambient light that is contacting the front display panel 25 . a variety of different electrical inputs / outputs are also shown , and all or only a select few of the inputs / outputs may be practiced with any given embodiment . the ac power input 30 delivers the incoming power to the backplane 22 . a video signal input 31 can receive video signals from a plurality of different sources . in a preferred embodiment the video signal input 31 would be an hdmi input . two data interface connections 32 and 33 are also shown . the first data interface connection 32 is preferably a bluetooth low energy transmitter / receiver . in an exemplary embodiment , the data interface connection 32 is provided as an ibeacon transmitter / receiver . the second data interface connection 33 may be a network connection such as an ethernet port , wireless network connection , or a satellite network connection . the second data interface connection 33 preferably allows the display assembly to communicate with the internet , and may also permit a remote user to communicate with the display assembly . the second data interface connection 33 can also provide the video data through a network source . the second data interface connection 33 can also be utilized to transmit display settings , error messages , and various other forms of data to a website for access and control by the user . optional audio connections 34 may also be provided for connection to internal or external speaker assemblies . a backlight sensor 29 is preferably placed within the backlight cavity to measure the amount of luminance being generated within the backlight cavity . additionally , a display luminance sensor 40 is preferably positioned in front of the display 24 in order to measure the amount of luminance exiting the display 24 . a camera 41 may be positioned to record the area surrounding the display and is also preferably placed in electrical connection with the backplane 22 . the bluetooth low energy transmitter / receiver 32 allows communication with smart phone devices which may be within relatively close proximity of the electronic display . generally speaking , the bluetooth low energy transmitter / receiver 32 sends out a signal to notify smart phone devices in the area of the presence of the transmitter / receiver 32 and can both push data to these devices as well as pull data from these devices . a number of functions using this communication is described further below . fig2 is a schematic illustration of a user 14 approaching one type of electronic menu board on foot . in this embodiment , three separate displays 10 , 11 , and 12 are placed in a 1 × 3 array and contained within a housing that places a portion of the bezel 13 in between each display . each display 10 , 11 , and 12 may contain each of the components shown above in fig1 or only a portion of the shown components . once the user 14 enters a certain proximity to the displays 10 , 11 , and 12 , the transmitter / receiver 32 of one or more of the displays may begin communicating with the smart phone device 15 of the user 14 . fig3 is a schematic illustration of a user approaching a second type of electronic menu board while operating an automobile 16 . here , a single monolithic display 110 is contained within a housing . the assembly lacks the bezels which would need to be placed between each display . the display 110 can be driven in separately controllable areas 100 a - 100 f , where in this case each area is being driven to show a different image . this assembly only requires a single collection of the components shown in fig1 . once the automobile 16 enters a certain proximity to the display 110 , the transmitter / receiver 32 of the display may begin communicating with the smart phone device 15 within the automobile 16 . it should be noted that a user can approach a monolithic display such as this on foot ( similar to what is shown in fig2 ). further , it should also be noted that the array of displays shown in fig2 can be approached by a user operating an automobile 16 , as shown in fig3 . fig4 is a logic flowchart showing one embodiment for operating the displays described herein . initially , the transmitter / receiver 32 transmits outgoing signals as well as receives incoming signals . the system then determines if a smart device is within close proximity to the display . if not , the system returns to transmit outgoing signals and receive incoming signals . if a smart device is in close proximity to the display , the system preferably begins to search through stored identifying information ( which can be stored electronically on the electronic storage device on the display controlling assembly 20 or remotely on a server that can be accessed through second data interface connection 33 ) to determine if the smart device matches any of the stored identifying information . if not , the system preferably stores identifying information for the smart device along with the products ordered , which are stored in association with the identifying information for the smart device . if the smart device matches any of the stored identifying information , the system should preferably access the electronic storage device to retrieve previous product orders by this smart device . ideally , the system would then generate a message for the smart device making an offer to sell a previous product or previous purchase to the user . this message is transmitted to the smart device . alternatively , the system could also display the previous order on the display , prompting the user on whether they would like to place the same order . the system would then receive incoming signals and determine if the smart device indicates an acceptance of the offer by the user ( if using the embodiment where the offer is sent to the smart device ). if yes , the system would place the order for the accepted offer and optionally display the order confirmation to the user on the display . if not , the system simply returns to again transmit outgoing signals and receive incoming signals until another smart device is detected . fig5 is a logic flowchart showing a second embodiment for operating the displays described herein . similar to the initial start of the method shown in fig4 , the transmitter / receiver 32 transmits outgoing signals as well as receives incoming signals . the system then determines if a smart device is within close proximity to the display . if not , the system returns to transmit outgoing signals and receive incoming signals . in this embodiment , if a smart device is detected in close proximity to the display , the system will transmit menu data to the smart device . in this embodiment , the menu data can be stored electronically on the electronic storage device on the display controlling assembly 20 . the transmitter / receiver 32 would then receive any incoming signals and determine if the smart device has placed an order for a menu selection . if not , the system returns to transmit outgoing signals and receive incoming signals . if so , the system places the order for the menu selection and optionally displays a confirmation of the order to the user through the display . fig6 is a logic flowchart showing a third embodiment for operating the displays described herein . this embodiment is similar to the logic shown above in fig4 , but with a couple notable differences . first , in this embodiment , if the system does not detect a smart device in close proximity , a message is displayed which prompts the viewer to turn on their smart device bluetooth functionality . the second difference between this embodiment and that of fig4 is that the time elapsed during the taking and / or filling of the order can be stored . this permits a later statistical analysis of the times for taking an order and filling an order , to improve or analyze the performance of the system . fig7 is a logic flowchart showing a fourth embodiment for operating the displays described herein . this embodiment would preferably utilize the camera 41 described above . in this embodiment , the display would normally be driven with the backlight at a reduced power level in order to save power ( as well as wear and tear on some of the electronics and fans ). as the system receives data from the camera 41 , the backlight power can be increased once a vehicle or viewer is determined to be in close proximity to the display . once the system determines that a vehicle or viewer is in close proximity to the display , the system may check to see if the viewer &# 39 ; s sex can be identified . optionally , the system can also check to see if the viewer &# 39 ; s age can be identified as well . if the viewer &# 39 ; s age and sex can be identified , then an offer is displayed or transmitted to the viewer which is tailored to the viewer &# 39 ; s age and sex . if the viewer &# 39 ; s age can be determined but not sex , then an offer is displayed or transmitted to the viewer which is tailored to the viewer &# 39 ; s age . if the viewer &# 39 ; s sex can be determined but not age , then an offer is displayed or transmitted to the viewer which is tailored to the viewer &# 39 ; s sex . if neither the viewer &# 39 ; s sex nor age can be determined , then the system may display or transmit the normal menu offerings . as used in this embodiment , the term ‘ transmit ’ is used to mean the electronic transmission of an offer to the user &# 39 ; s smart device . camera recognition software having the functionality described herein is commercially available from keylemon in switzerland ( www . keylemon . com ) as well as facefirst in westlake village , calif . ( www . facefirst . com ). having shown and described a preferred embodiment of the invention , those skilled in the art will realize that many variations and modifications may be made to affect the described invention and still be within the scope of the claimed invention . additionally , many of the elements indicated above may be altered or replaced by different elements which will provide the same result and fall within the spirit of the claimed invention . it is the intention , therefore , to limit the invention only as indicated by the scope of the claims . | 6 |
the gemcitabine -[ phenyl - benzoxy - l - alaninyl )]- phosphate used and / or obtained in the processes of the invention may be obtained , stored and / or reacted in the form of a salt . the salt may be a pharmaceutically acceptable salt but this is not necessarily the case . it may be that a pharmaceutically less - preferred salt is used in carrying out the process of the invention and that that salt is converted to the free base or to a pharmaceutically acceptable salt once the gemcitabine -[ phenyl - benzoxy - l - alaninyl )]- phosphate has been obtained in the desired form . suitable pharmaceutically acceptable salts include , but are not limited to , salts of pharmaceutically acceptable inorganic acids such as hydrochloric , sulphuric , phosphoric , nitric , carbonic , boric , sulfamic , and hydrobromic acids , or salts of pharmaceutically acceptable organic acids such as acetic , propionic , butyric , tartaric , maleic , hydroxymaleic , fumaric , malic , citric , lactic , mucic , gluconic , benzoic , succinic , oxalic , phenylacetic , methanesulphonic , toluenesulphonic , benzenesulphonic , salicylic , sulphanilic , aspartic , glutamic , edetic , stearic , palmitic , oleic , lauric , pantothenic , tannic , ascorbic and valeric acids . suitable base salts are formed from bases which form non - toxic salts . examples include the aluminium , arginine , benzathine , calcium , choline , diethylamine , diolamine , glycine , lysine , magnesium , meglumine , olamine , potassium , sodium , tromethamine and zinc salts . hemisalts of acids and bases may also be formed , for example , hemisulfate and hemicalcium salts . the gemcitabine -[ phenyl - benzoxy - l - alaninyl )]- phosphate obtained from the methods of the invention may exist in a single crystal form or in a mixture of crystal forms or they may be amorphous . the methods of the present invention can also be used to provide all pharmaceutically acceptable isotopically - labelled forms of compounds 3 or 4 wherein one or more atoms are replaced by atoms having the same atomic number , but an atomic mass or mass number different from the atomic mass or mass number of the predominant isotope usually found in nature . examples of isotopes suitable for inclusion in the compounds used in and obtained by the invention include isotopes of hydrogen , such as 2 h and 3 h , carbon , such as 11 c , 13 c and 14 c , chlorine , such as 36 cl , fluorine , such as 18 f , iodine , such as 123 i and 125 i , nitrogen , such as 13 n and 15 n , oxygen , such as 15 o , 17 o and 18 o , phosphorus , such as 32 p , and sulphur , such as 35 s . certain isotopically - labelled compounds , for example , those incorporating a radioactive isotope , are useful in drug and / or substrate tissue distribution studies . the radioactive isotopes tritium , i . e . 3 h , and carbon - 14 , i . e . 14 c , are particularly useful for this purpose in view of their ease of incorporation and ready means of detection . substitution with heavier isotopes such as deuterium , i . e . 2 h , may afford certain therapeutic advantages resulting from greater metabolic stability , for example , increased in vivo half - life or reduced dosage requirements , and hence may be preferred in some circumstances . substitution with positron emitting isotopes , such as 11 c , 18 f , 15 o and 13 n , can be useful in positron emission topography ( pet ) studies for examining substrate receptor occupancy . isotopically - labelled compounds can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described using an appropriate isotopically - labelled reagent in place of the non - labelled reagent previously employed . it is known in the art that an x - ray powder diffraction pattern may be obtained which has one or more measurement errors depending on measurement conditions ( such as equipment , sample preparation or machine used ). in particular , it is generally known that intensities in an x - ray powder diffraction pattern may fluctuate depending on measurement conditions and sample preparation . for example , persons skilled in the art of x - ray powder diffraction will realise that the relative intensities of peaks may vary according to the orientation of the sample under test and on the type and setting of the instrument used . the skilled person will also realise that the position of reflections can be affected by the precise height at which the sample sits in the diffractometer and the zero calibration of the diffractometer . the surface planarity of the sample may also have a small effect . hence a person skilled in the art will appreciate that the diffraction pattern data presented herein is not to be construed as absolute and any crystalline form that provides a power diffraction pattern substantially identical to those disclosed herein fall within the scope of the present disclosure ( for further information see jenkins , r & amp ; snyder , r . l . ‘ introduction to x - ray powder diffractometry ’ john wiley & amp ; sons , 1996 ).” throughout the description and claims of this specification , the words “ comprise ” and “ contain ” and variations of them mean “ including but not limited to ”, and they are not intended to ( and do not ) exclude other moieties , additives , components , integers or steps . throughout the description and claims of this specification , the singular encompasses the plural unless the context otherwise requires . in particular , where the indefinite article is used , the specification is to be understood as contemplating plurality as well as singularity , unless the context requires otherwise . features , integers , characteristics , compounds , chemical moieties or groups described in conjunction with a particular aspect , embodiment or example of the invention are to be understood to be applicable to any other aspect , embodiment or example described herein unless incompatible therewith . all of the features disclosed in this specification ( including any accompanying claims , abstract and drawings ), and / or all of the steps of any method or process so disclosed , may be combined in any combination , except combinations where at least some of such features and / or steps are mutually exclusive . the invention is not restricted to the details of any foregoing embodiments . the invention extends to any novel one , or any novel combination , of the features disclosed in this specification ( including any accompanying claims , abstract and drawings ), or to any novel one , or any novel combination , of the steps of any method or process so disclosed . the reader &# 39 ; s attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification , and the contents of all such papers and documents are incorporated herein by reference . the individual isomers of gemcitabine -[ phenyl - benzoxy - l - alaninyl )]- phosphate can be characterised using the following characterisation methods : proton ( 1 h ), carbon ( 13 c ), phosphorus ( 31 p ) and fluorine ( 19 f ) nmr spectra were recorded on a bruker avance 500 spectrometer at 25 ° c . spectra were auto - calibrated to the deuterated solvent peak and all 13 0 nmr and 31 p nmr were proton - decoupled . the purity of final compounds was verified to be & gt ; 95 % by hplc analysis using varian polaris c18 - a ( 10 μm ) as an analytic column with a gradient elution of h 2 o / meoh from 100 / 0 to 0 / 100 in 35 min . the hplc analysis was conducted by varian prostar ( lc workstation - varian prostar 335 lc detector ). ( es +) m / z , found : ( m + na + ) 603 . 14 . c 25 h 27 f 2 n 4 o 8 nap required : ( m +) 580 . 47 . 1 h nmr ( 500 mhz , meod ): δ h 7 . 58 ( d , j = 7 . 5 hz , 1h , h - 6 ), 7 . 38 - 7 . 32 ( m , 7h , arh ), 7 . 26 - 7 . 20 ( m , 3h , arh ), 6 . 24 ( t , j = 7 . 5 hz , 1h , h - 1 ′), 5 . 84 ( d , j = 7 . 5 hz , 1h , h - 5 ), 5 . 20 ( ab system , j ab = 12 . 0 hz , 2h , och 2 ph ), 4 . 46 - 4 . 43 ( m , 1h , h - 5 ′), 4 . 36 - 4 . 31 ( m , 1h , h - 5 ′), 4 . 25 - 4 . 19 ( m , 1h , h - 3 ′), 4 . 07 - 4 . 00 ( m , 2h , h - 4 ′, chch 3 ), 1 . 38 ( d , j = 7 . 2 hz , 3h , chch 3 ). 19 f nmr ( 470 mhz , meod ): δ f - 118 . 0 ( d , j = 241 hz , f ), − 120 . 24 ( broad d , j = 241 hz , f ). 13 c nmr ( 125 mhz , meod ): δ c 174 . 61 ( d , 3 j c — p = 5 . 0 hz , c ═ o , ester ), 167 . 63 ( c — nh 2 ), 157 . 74 ( c ═ o base ), 152 . 10 ( d , 2 j c — p = 7 . 0 hz , c — ar ), 142 . 40 ( ch - base ), 137 . 22 ( c — ar ), 130 . 90 , 129 . 63 , 129 . 39 , 129 . 32 , 126 . 32 ( ch — ar ), 124 . 51 ( d , 1 j c — f = 257 hz , cf 2 ), 121 . 47 , 121 . 43 ( ch — ar ), 96 . 67 ( ch - base ), 85 . 92 ( broad signal , c - 1 ′), 80 . 31 ( c - 4 ′), 71 . 27 ( apparent t , 2 j c — f = 23 . 7 hz , c - 3 ′), 68 . 03 ( och2ph ), 65 . 73 ( d , 2 j c — p = 5 . 30 hz , c - 5 ′), 51 . 66 ( chch3 ), 20 . 42 ( d , 3 j c — p = 6 . 25 hz , chch 3 ). reverse hplc , eluting with h 2 o / meoh from 100 / 0 to 0 / 100 in 35 min , showed one peak of diastereoisomer with t r = 22 . 53 min . ( es +) m / z , found : ( m + na + ) 603 . 14 . c 25 h 27 f 2 n 4 o 8 nap required : ( m +) 580 . 47 . 1 h nmr ( 500 mhz , meod ): δ h 7 . 56 ( d , j = 7 . 5 hz , 1h , h - 6 ), 7 . 38 - 7 . 31 ( m , 7h , arh ), 7 . 23 - 7 . 19 ( m , 3h , arh ), 6 . 26 ( t , j = 7 . 5 hz , 1h , h - 1 ′), 5 . 88 ( d , j = 7 . 5 hz , 1h , h - 5 ), 5 . 20 ( s , 2h , och 2 ph ), 4 . 49 - 4 . 46 ( m , 1h , h - 5 ′), 4 . 38 - 4 . 34 ( m , 1h , h - 5 ′), 4 . 23 - 4 . 17 ( m , 1h , h - 3 ′), 4 . 07 - 4 . 01 ( m , 2h , h - 4 ′, chch 3 ), 1 . 38 ( d , j = 7 . 2 hz , 3h , chch 3 ). 19 f nmr ( 470 mhz , meod ): δ f - 118 . 3 ( d , j = 241 hz , f ), − 120 . 38 ( broad d , j = 241 hz , f ). 13 c nmr ( 125 mhz , meod ): δ c 174 . 65 ( d , 3 j c — p = 5 . 0 hz , c ═ o , ester ), 167 . 65 ( c — nh 2 ), 157 . 75 ( c ═ o base ), 152 . 10 ( d , 2 j c — p = 7 . 0 hz , c — ar ), 142 . 28 ( ch - base ), 137 . 50 ( c — ar ), 130 . 86 , 129 . 63 , 129 . 40 , 129 . 32 , 126 . 31 ( ch — ar ), 124 . 50 ( d , 1 j c — f = 257 hz , cf 2 ), 121 . 44 , 121 . 40 ( ch — ar ), 96 . 67 ( ch - base ), 85 . 90 ( broad signal , c - 1 ′), 80 . 27 ( c - 4 ′), 71 . 30 ( apparent t , 2 j c — f = 23 . 7 hz , c - 3 ′), 68 . 02 ( och2ph ), 65 . 50 ( c - 5 ′), 51 . 83 ( chch 3 ), 20 . 22 ( d , 3 j c — p = 7 . 5 hz , chch 3 ). reverse hplc , eluting with h 2 o / meoh from 100 / 0 to 0 / 100 in 35 min , showed one peak of diastereoisomer with t r = 21 . 87 min first a solvent screening was conducted with 17 different solvents ( see table 1 ). approximately 25 mg of a diastereomeric mixture ( 33 : 67 ( r ):( s )) of nuc - 1031 was suspended in the listed solvents ( 1 ml ) and stirred overnight . in case dissolution occurred more solid was added . the suspensions were sedimented and the relative amounts of the two diastereoisomers in solution was determined by hplc . thus a number of solvents ( acetone , etoh , ipa , mek , can , nproh , toluene , nbuoh ) exhibited high diastereoisomeric enrichment of the ( s )- epimer in the solution . the screening identified three solvents that led to excellent (& gt ; 94 %) enrichment of the ( s )- diastereoisomer in the solution : isopropanol , acetonitrile and n - butanol . the enrichment provided by acetonitrile and isopropanol were evaluated at a range of concentrations and temperatures ( see table 2 ). two types of experiments were conducted : simple slurries ( 20 ° c .) in different volumes and slurries / recrystallisations at 80 ° c . for the experiments 200 mg of the diastereomeric mixture ( 33 : 67 ( r ):( s )) was suspended in the solvents and volume indicated below and optionally heated to reflux and cooled to 20 ° c . the suspensions were stirred overnight and isolated . the relative proportions of the two epimers present in both the solution and in the solid cake were determined by hplc . for each sample , the treatment was repeated but this did not lead to further enrichment . this demonstrates that simple dissolution of the diastereoisomeric mixture , as described in the statement of the first aspect , can provide excellent diastereoisomeric enrichment , particularly of the ( s )- epimer . this effect is substantially unaffected by the concentration of the solvent relative to the mass of nuc - 1031 and is also substantially unaffected by temperature . thus the process provides an efficient ambient temperature separation technique . 2 × 25 g of a diastereomeric mixture of the ( r ) and ( s ) epimers ( 33 : 67 ( r ):( s )) were each dissolved in 75 vol acetonitrile at 25 ° c . the suspensions were combined during filtration . the first filtration provided a solution a2 and a solid a1 . the filter cake was re - slurried and the resultant suspension filtered to obtain a second solution b2 and a second solid cake b1 ( see table 3 ). the remainder of the two solutions a2 and b2 from the scale - up in acetonitrile ( ca . 2 . 6 l ) were combined , concentrated to about 50 % of the original volume and stirred for 3 days . the formed suspension was filtered and this resulted a very highly diastereoisomerically enriched solid sample of the ( s )- epimer on the filter ( table 4 ). thus , the ( s )- epimer can be obtained in excellent diastereoisomeric purity on a large scale using the processes of the invention . this represents a substantial advantage for manufacturing on a larger scale since the process avoids the need for a chromatographic step with all its attendant difficulties . in order to obtain high diastereoisomeric enrichment of the ( r )- epimer , samples of solid b1 were slurried in solvent mixtures ( 50 mg of the solid in 1 ml of the solvent mixtures indicated in table 5 ) and filtered . the resultant solids were enriched in the ( r )- epimer , as indicated in table 5 , with the best result being obtained with water added to acetonitrile as an antisolvent . the yield from the acetonitrile / water mixture was low and so the experiment was repeated with smaller amount of water in the solvent mixture . the results showed improved recovery and some diastereoisomeric enrichment ( table 6 ). material mainly containing the ( r )- epimer ( solid b2 ) was reslurried in 20 volumes acn / water 10 / 1 for 18 h and filtered and the obtained solid was washed with acetonitrile . the resulting solid contained the ( r )- epimer in excellent diastereoisomeric purity ( table 7 ). thus , the ( r )- epimer can be obtained in excellent diastereoisomeric purity on a large scale using the processes of the invention . again , this represents a substantial advantage for manufacturing on a larger scale since the process avoids the need for a chromatographic step with all its attendant difficulties . 2 ′- deoxy - 2 ′, 2 ′- difluoro - d - cytidine - 5 ′- o -[ phenyl ( benzoxy - l - alaninyl )] phosphate ( 120 g ; 4 : 6 ( r ):( s ); also contained 5 % by mass of unknown impurities resulting from the process by which the compound was prepared ) was added to ipa ( 600 ml ) to form a slurry . the slurry was heated to 50 - 54 ° c . and agitated at that temperature for 2 hours . the slurry was then filtered while warm . the cake was washed with a further portion of warm ( 50 - 52 ° c .) ipa ( 60 ml ) while still on the filter . the filtrate was slowly ( over about 2 hours ) cooled to 26 - 30 ° c . about 2 hours and seed material ( 600 mg or 95 % diastereoisomeric purity s - isomer as a slurry in 12 ml ipa ). the mixture was stirred for 18 hours at 26 - 30 ° c . the mixture was then cooled to 18 - 22 ° c . and stirred for a further 8 hours . the suspension was filtered and the cake was washed with cooled ( about 15 ° c .) ipa ( 120 ml ) the solid product was dried under vacuum at about 42 ° c . to provide the ( s )- epimer ( 25 % yield based on total amount of gemcitabine -[ phenyl - benzoxy - l - alaninyl )]- phosphate starting material ; final diastereoisomeric purity : 96 - 98 %) the process described in example 6 provides the ( s )- epimer of nuc - 1031 as the crystalline form , form i . form i is a polymorph of the unsolvated free base of the ( s )- epimer . this form differs from that which it has been observed that the ( s )- epimer adopts when isolated following separation of the epimers by chromatographic techniques and also the form which has been observed that the ( s )- epimer adopts when it is obtained as part of a mixture of the two isomers . it has been found that polymorph i is the thermodynamically most stable polymorphic form of the ( s )- isomer . a sample of polymorph i of the ( s )- epimer of nuc - 1031 was scanned between 3 and 35 ° 2θ . material was gently compressed into a well mounted on kapton film . the sample was then loaded into a panalytical x &# 39 ; pert pro diffractometer running in transmission mode and analysed using the following experimental conditions : the resulting spectrum is shown in fig1 . the observed peaks were as follows : ° 2th = ° 2θ . typically an error of ± 0 . 2 ° 2θ is present in xrpd peak positions . infrared spectroscopy of polymorph i of the ( s )- epimer of nuc - 1031 was carried out on a bruker alpha p spectrometer . a sample was measured as a suspension in nujol ( a paraffin oil ), which has major peaks at 2950 - 2800 cm − 1 , 1465 - 1450 cm − 1 and 1380 - 1370 cm − 1 . therefore , the recorded spectra showed these absorptions in addition to the material &# 39 ; s absorption peaks . the suspensions were placed onto the centre of the plate of the spectrometer and the spectra were obtained using the following parameters : the resulting spectrum is shown in fig2 . the observed peaks were as follows : | 2 |
it will be readily understood that the components of the invention , as generally described and illustrated in the figures herein , may be arranged and designed in a wide variety of different configurations . thus , the following detailed description of the embodiments of systems , methods , apparatuses , and computer program products for a reusable license activation key , as represented in the attached figures , is not intended to limit the scope of the invention , but is merely representative of selected embodiments of the invention . if desired , the different functions discussed below may be performed in a different order and / or concurrently with each other . furthermore , if desired , one or more of the described functions may be optional or may be combined . as such , the following description should be considered as merely illustrative of the principles , teachings and embodiments of this invention , and not in limitation thereof . when a user or customer buys a specific software product , a purchase registration record is created in a database and the user is given an activation key for that product . if a user later purchases a maintenance renewal or product upgrade , finance constraints may require the creation of a new purchase registration record with new activation keys for these actions . as will be discussed in detail below , embodiments provide a reusable activation key feature which allows users to still use the original activation key even if it is not related to a current state of their purchase . to achieve this feature , related registration records are linked together by a unique identifier . whenever a user enters the original activation key and proceeds with product activation , a licensing server searches the linked registration records for this activation key and selects the corresponding current activation key for activation . as mentioned above , there are a number of types of licenses and types of licensing models . for example , the types of licenses may include evaluation licenses , commercial licenses , temporary licenses , volume licenses , and free licenses . an evaluation license provides customers with a temporary license for a testing period ; they can be valid for a limited number of days ( e . g ., 30 days ) and once the evaluation period expires , the license would need to be converted into a commercial , temporary or extension license or the product will stop working . a commercial license is defined as being perpetual in term and therefore can be used any time without expiration . its usage is limited by a maintenance period that defines for which product versions it can be used . in other words , the commercial license can be used only with the product released before the end of the last maintenance period . in contrast , a temporary license has a limited time frame and is used for special purposes , such as migration and update scenarios , etc . a free license may be valid for any predefined time period and provides a free version of a product , which may develop into a commercial version . a volume license refers to a special type of license bundled with the product release . this license is bound to a specific product version and customer , and is used to install the product on any number of computers . the volume license does not expire , but a new version of a product will need a new volume license . in addition to the above license types , there are several licensing models . for example , these may include single activation , multi activation , and seat based models . the single activation model refers to licenses that can be activated on a single computer only . the multi activation model refers to a license that can be activated on multiple computers . the licensing server can keep track of activated licenses and prevents activation on more than the allowed number of computers . a seat based model refers to a license that contains a defined number of “ seats .” seats can be activated all on a single computer or they can be distributed over multiple computers as needed . according to an embodiment , as illustrated in fig1 , a licensing system 100 is configured to provide a set of services to enable a user or software product to activate , maintain , and deactivate licenses . licensing system 100 may comprise several dedicated parts connected to form a network to enable license processing . licensing system 100 may be configured to handle many types of licenses and licensing models created to cover most , if not all , licensing scenarios . licenses of any type and model have a set of attributes named features that are used by the product to recognize its required behavior . according to certain embodiments , licensing system 100 may include a licensing server 101 , licensing client 110 , product licensor 120 ( e . g ., customer ), and a set of tools and utilities 122 . licensing server 101 may include a licensing service 102 and licensing database 105 . licensing service 102 may store information on customer &# 39 ; s licenses , provide a set of services related to licenses , such as creation , activation , deactivation , synchronization , license maintenance , etc . licensing server 101 may be accessed from the internet , for example via a licensing framework 111 or via a customer portal website or application 130 , or internally by sales and support via a business management software ( e . g ., netsuite ™). licensing client 110 may include a licensing framework 111 and licensing store 112 . licensing framework 111 is a software package configured to manage licenses in licensing store 112 and communication with licensing server 101 . a license can hold an unlimited set of attributes named features . each feature may have a name and numeric value , and can be used by the product or licensing system 100 to find out what that specific license allows or disallows , how many elements are licensed , etc . licensing store 112 includes one or more files that contain encrypted records ( e . g ., licenses ) located on the customer &# 39 ; s computer . the licenses ( represented by the encrypted records ) are managed by licensing framework 111 , which works upon licensing store 112 and communicates with licensing server 101 . in one embodiment , licensing store 112 may include one or more locally stored encrypted file ( s ) in xml format , for example . these file ( s ) may contain license records encoded as base64 text and some extra information ( e . g ., umid for the license record , type of license , date of creation and last access , etc .). according to an embodiment , the license records in the licensing store 112 can be automatically synchronized with the licensing server 101 . this synchronization may occur , for example , periodically once per 24 hours or it can be performed on demand . in an embodiment , synchronization compares licenses in licensing store 112 with licenses available on the licensing server 101 . if there are any updates available they are downloaded , and local licenses in the licensing store 112 are updated . product licensor 120 includes a dedicated software module included in a licensed product to check license validity and may perform operations , such as license activation , synchronization , etc . in an embodiment , licensing system 100 may also include tools and utilities 122 , which include a set of dedicated software modules used for license related tasks , such as license management , maintenance checking , license store maintenance , etc . a license lifecycle may be defined as a state machine , as illustrated in fig2 . according to an embodiment , an empty licensing store is created if no existing licensing store is found . then , specific folders in a computer are scanned for license files (*. lic ) and newly found licenses are imported to the licensing store . after the automated import , evaluation licenses 200 are now stored in the licensing store . a unique machine id ( umid ) may be generated for the license and the umid is sent during activation together with license information to the licensing server . the umid may be a base64 encoded sequence of bytes that uniquely identifies a particular machine and license on that machine the umid can have an extension separated by character “:” that contains additional information about the product version , rtm date , etc . umid can be generated for each machine and license on that machine the umid can be used for both online and offline activation . referring again to fig2 , if the license can be activated , the licensing server creates a commercial license under maintenance 220 and sends it back to the user . the commercial license 220 is imported into the licensing store . subsequently , the maintenance period may expire resulting in the commercial license under maintenance 220 to convert into a commercial license out of maintenance 230 . if the evaluation period expires and the evaluation license 200 is not activated , the evaluation license 200 becomes an expired evaluation license 210 and the product cannot be run . the activated commercial license 220 can be deactivated , which means that the license is removed from the licensing store and is marked as deactivated on the licensing server . this allows the license to be activated again ( e . g ., after migration , upgrade , maintenance , etc .). in addition , activated licenses can be upgraded . for instance , the number of seats can be increased , e . g ., if the license is originally approved for 10 computers , it can be upgraded to 20 computers , etc . returning to fig1 , in an embodiment , licensing system 100 may be configured to look for all evaluation licenses installed with product as *. lic files and imports these licenses into the licensing store 112 during first initialization . these evaluation licenses provide a starting point for activation of a commercial license , as discussed above in connection with fig2 . activation of a commercial license may be performed manually , while subsequent changes to the commercial license may occur automatically in the background , for example once per 24 hours . with respect to seat based licenses , it is possible to upgrade the license ( number of seats ) upon activation of the commercial license . fig3 illustrates an example of a state diagram for the licensing store , according to one embodiment . initially , at 300 , the license is not installed . at 310 , product installation occurs in which the product is deployed on a target machine and any evaluation license shipped with the product is imported into the licensing store . at 320 , an evaluation license is installed . at 330 , the evaluation may time out when the product is in trial mode and the customer has used the product longer than the evaluation license &# 39 ; s lifetime ( days from the product installation ). as a result , at 340 , the license expires and becomes invalid such that the product stops working . when this happens , the customer will need to activate a commercial license to make product working again . at 350 , once a commercial license is purchased , the product can be activated , which includes registration of a machine id on the licensing server . the evaluation license is then upgraded to commercial and the product can run indefinitely . according to an embodiment , if the product is moved onto a new computer ( e . g ., server migration , etc . ), the license record is deactivated . the product cannot run anymore on the original computer after deactivation , but the license can be activated on the new computer . with respect to synchronization , if a customer changes the license status ( e . g ., upgrade , maintenance renewal , seat upgrade ), those changes may be applied automatically in the background ( e . g ., once per 24 hours ) or manually by the customer at any time . in certain embodiments , tier upgrade , version upgrade or maintenance renewal can be performed automatically or manually . once the license record is updated in the licensing store , the customer has access to all features defined by the new ( upgraded ) license . another type of upgrade is a seat based upgrade , which ( re ) allocates number of activated license seats over the computers . it should be noted that , in some embodiments , data transfers between the licensing server and licensing store may be realized by licensing framework modules over web services , for example . in an embodiment , an encrypted extension of the simple object access protocol ( soap ) ( ref1 - web services enhancements architecture ) may be used for communication with the licensing proxy over the internet . web services can activate and deactivate licenses , check license status , update customer information and can be called by product ( either automatically or from an interface by user ), customer ( via customer portal ), or support person ( e . g ., via netsuite ™). depending upon the licensing model , embodiments may provide several subsequent data models based upon set of database tables , which may be stored in the licensing server . in an embodiment , the following tables may be used : registrations ( license record , license master record for multi activation model ) registrations_multiactivations ( only for multiactivation ), applications ( defines application licensing model , template used , etc . ), templatelicenses ( defines license properties , references table features ), templatelicenses_xref ( references table templatelicenses , used for 1 : n relationships between applications and license template ) subscriptions ( holds info on license maintenance ) features ( holds set of features related to the license ) once a license is created ( i . e ., license key is generated and related record is created by licensing server ) it can be activated and deactivated , as discussed above . the created license has a fixed set of parameters that cannot be changed . any changes to the license , such as upgrade or downgrade , are done by decommissioning of the old license record and the creation of a new record . when a license is marked as decommissioned , the “ paid ” column of the “ registration ” table is changed from yes to replaced or upgraded , and it is not possible to activate / deactivate that license anymore . when the customer makes a change to the license ( e . g ., upgrade or downgrade ), the license is marked as decommissioned and a new license record ( with the parameters required by customer ) having a new activation key is created to replace the decommissioned record . fig4 illustrates a flow diagram for linking the decommissioned license with the new license record , according to one embodiment . as mentioned above , in one embodiment , this new record is bound to the decommissioned one by a licensegroupid and / or netsuitelicenseid column , for example . this mechanism allows the customer , at 400 , to identify the license by the first - ever activation key provided ( i . e ., the old license key that was created before the license was decommissioned ). at 410 , the licensing server fetches the licenseid associated with the received activation key . then , at 420 , the licensing server is able to locate the most recent license from all in the group and work with it internally as if the customer provided its activation key . the single activation license model works mostly upon tables “ applications ” and “ registrations .” a license record can be in states of ready - to - be - activated ( blank license ) or activated . as mentioned above , a license record is identified by the activation key which may be guid based . an upgrade to the license may be performed by creating new license record ( new record in table registrations ) which is bound by value of column netsuitelicenseid / licensegroupid . a license can be upgraded or downgraded for license parameters ( tier ) or product major version ( only upgrade ). license creation — upon data from license template ( table templatelicense ) a new license record is created in “ registrations ” table . during processing a new license key is written into record ( registrations . activationkey ) and column “ paid ” is set to value yes , column “ used ” is set to value 0 . license activation — the record ( with correct activationkey ) in the table “ registrations ” is marked as activated column used is set to value 1 license decommissioning — occurs if deactivation is performed . column “ paid ” in “ registrations ” table is set to replaced and new blank license ( with new activation key , but bound to the old activation key by netsuitelicenseid value ) is created as described above . tier upgrade — new blank license is created upon a different license template with different tier . version upgrade — new blank license is created upon a different license template with different major product version . maintenance upgrade — maintenance is renewed for next time period ( table subscriptions ). the following tables show the sequence of initialization - activation - deactivation operations . changed values , or records added are italicized . in the initial state , there exists one record with activation key and it has assigned a license id value ( column netsuitelicenseid ) used for linking with all related records , and the value of column “ used ” is set to 0 . the maintenance record contains related information for license maintenance . it is linked to the “ registrations ” table by value of column “ netsutelicense ”. after activation value of column “ used ” is set to 1 , there are set content columns , license blob &# 39 ; s value is set up . after deactivation , the previous record is marked as replaced ( paid = replace ) and a new one is added with a different activation key value . while a new activation customer can use the first activation key because these records are linked by netsuitelicenseid value , according to an embodiment . in an embodiment , the customer can use any of the activation keys , and the licensing server may locate the appropriate activation key at any time ( paid = yes , used = 0 ) by netsuite license id , for example . the multi - activation license model works mostly with tables “ applications ”, “ registrations ” and “ registrations_multiactivations .” a license record can be in states ready - to - be - activated ( blank license ) or activated to x of n licenses . again , the record may be identified by an activation key ( e . g ., guid based ). the upgrade mechanism is the same as described above for the single activation model . however , to allow the license to be used on more than one computer , there is an added “ registrations_multiactivations ” table that holds computer - specific information . shared information is still in the “ registrations ” table . during activation of the license , a new record is created in “ registrations_multiactivations ” table and “ registrations ” table record is updated with the correct activation count value . since each computer has a unique machine id , for any single computer there is always present a record related to the activation key and machine id . table “ registrations ” may store information on how many licenses total are available and how many are in use . these counters are incremented / decremented during activation / deactivation . if license limit is reached , it is not possible to activate new licenses . master license creation — a new record is created in table “ registrations ” from data related to license template . license activation , license x activation — machine id ( from umid ) related record is created in the “ registrations_multiactivations ” ( column isactivation = 1 ) table for the activation key and counter is modified in the registration table ( activationcount column is incremented ). if activationcount column &# 39 ; s value is equal to value of column maxinstallationcount , then all licenses are exhausted and activation fails . license x deactivation — machine id related record in registrations_multiactivations table of activation key is closed by creation of new record in the same table ( isactivation = 0 ). value of column activationcount of master record in table registrations is modified ( decremented ). license decommissioning — same as above discussed for single activation model . version upgrade — same as above discussed for single activation model . maintenance upgrade — same as above discussed for single activation model . the seat based model extends the multi - activation model with a new mechanism in which one computer can have more than 1 license seat activated for a single license . this is important for certain server products to be able to cover number of clients connected to the server . in this model , the counter activationcount in the table “ registrations ” contains the total number of seats available for the license and this counter is incremented / decremented during activations / deactivations in similar way as for multi - activation licenses . as mentioned above , multi - activation licensing use an extra table — registrations_multiactivations — which is related to single instance of installation and is linked to master record in table “ registrations ”. these records are addressed by machineid used , or if not found then a new one is created . when in initial state , master record does exist in the table similarly like in the single activation model . maintenance information is treated the same way as for single activation model . in the multi - activation model , activation is not value of column “ used ” set to 1 , rather counters and related logic behind license size computation ( licenseunitsize , activationcount , maxinstallationcount ) are employed . if value of activationcount reaches maxinstallationcount value , further activations are blocked . because there are many installations linked to one key , shared information is stored in the “ registrations ” table , and installation - related part of information ( customer info , machine id , computer name , license blob , etc .) are stored in the table “ registrations_multiactivations .” additionally , there can be activated different versions of a product ( key for higher version can cover lower one ). while filling “ registrations_multiactivations ” data , there can be copied some information into a master record in the table “ registrations ”, this may be used mainly for triggering internal synchronization mechanisms between systems working with the licensing server . for deactivation , there may be employed counter mechanisms as mentioned above . however , instead of marking a record as used , there is licensing logic based on computations with counters and limits . in this embodiment , the deactivation process works the opposite way and decreases counters . thus , the same product license can be moved over many computers provided that , at the time , the number of simultaneously activated licenses does not reach license size ( maxinstallationsize ). if there is tier upgrade performed upon license in multiactivation model , there is master record in the registrations table abandoned and the new one is created . however these records are linked by netsuite license id thus customer can use any of the the activations keys . fig5 illustrates an example of an apparatus 20 according to an embodiment . in an embodiment , apparatus 20 may be a node , host , or server in a communications network or serving such a network , such as the licensing server discussed above . it should be noted that one of ordinary skill in the art would understand that apparatus 20 may include components or features not shown in fig5 . as illustrated in fig5 , apparatus 20 may include a processor 32 for processing information and executing instructions or operations . processor 32 may be any type of general or specific purpose processor . while a single processor 32 is shown in fig5 , multiple processors may be utilized according to other embodiments . in fact , processor 32 may include one or more of general - purpose computers , special purpose computers , microprocessors , digital signal processors ( dsps ), field - programmable gate arrays ( fpgas ), application - specific integrated circuits ( asics ), and processors based on a multi - core processor architecture , as examples . apparatus 20 may further comprise or be coupled to a memory 34 ( internal or external ), which may be coupled to processor 32 , for storing information and instructions that may be executed by processor 32 . memory 34 may be one or more memories and of any type suitable to the local application environment , and may be implemented using any suitable volatile or nonvolatile data storage technology such as a semiconductor - based memory device , a magnetic memory device and system , an optical memory device and system , fixed memory , and removable memory . for example , memory 34 may be comprised of any combination of random access memory ( ram ), read only memory ( rom ), static storage such as a magnetic or optical disk , or any other type of non - transitory machine or computer readable media . the instructions stored in memory 34 may include program instructions or computer program code that , when executed by processor 32 , enable the apparatus 20 to perform tasks as described herein . apparatus 20 may also comprise or be coupled to one or more antennas 35 for transmitting and receiving information and / or data to and from apparatus 20 . alternatively , apparatus 20 may include a communication interface or ports for transmitting and receiving information over a network . apparatus 20 may further comprise or be coupled to a transceiver 38 configured to transmit and receive information . the transceiver may be an external device , such as a remote radio head . for instance , transceiver 38 may be configured to modulate information on to a carrier waveform for transmission by the antenna ( s ) 35 and demodulate information received via the antenna ( s ) 35 for further processing by other elements of apparatus 20 . in other embodiments , transceiver 38 may be capable of transmitting and receiving signals or data directly . processor 32 may perform functions associated with the operation of apparatus 20 including , without limitation , precoding of antenna gain / phase parameters , encoding and decoding of individual bits forming a communication message , formatting of information , and overall control of the apparatus 20 , including processes related to management of communication resources . in an embodiment , memory 34 stores software modules that provide functionality when executed by processor 32 . the modules may include , for example , an operating system that provides operating system functionality for apparatus 20 . the memory may also store one or more functional modules , such as an application or program , to provide additional functionality for apparatus 20 . the components of apparatus 20 may be implemented in hardware , or as any suitable combination of hardware and software . as mentioned above , according to one embodiment , apparatus 20 may be a server , node or host or base station in a communications network or serving such a network , such as a licensing server . in this embodiment , apparatus 20 may be controlled by memory 34 and processor 32 to create a registration record in a database upon activation of a license for a product . the registration record may include an activation key for the license . according to one embodiment , apparatus 20 may be further controlled by memory 34 and processor 32 to generate a new registration record comprising a new activation key when a change to the license occurs , to generate a globally unique identifier for linking the registration record with the new registration record , and to store the linked registration records in the database . in an embodiment , the change to the license comprises at least one of a product upgrade or a maintenance renewal . in an embodiment , apparatus 20 may be further controlled by memory 34 and processor 32 to receive the activation key for the license from a user seeking to activate a feature of the product , and to search the linked registration records for the new activation key using the received activation key . when the new activation key is found , apparatus 20 may be further controlled by memory 34 and processor 32 to use the new activation key to activate the feature of the product . fig6 illustrates an example flow diagram of a method , according to one embodiment . in an embodiment , the method of fig6 may be performed by a server , such as the licensing server discussed above . according to one embodiment , the method may include , at 600 , creating a registration record in a database upon activation of a license for a product . the registration record may include at least an activation key for the license . the method may then include , at 610 , generating a new registration record comprising a new activation key when a change to the license occurs . the method may also include , at 620 , generating a globally unique identifier ( guid ) for linking the registration record with the new registration record . at 630 , the method may further include storing the linked registration records in the database . in an embodiment , the method of fig6 may also include , at 640 , receiving the activation key for the license from a user seeking to activate a feature of the product , and , at 650 , searching the linked registration records for the new activation key using the received activation key . when the new activation key is found in the linked registration records , the method may include , at 660 , using the new activation key to activate the feature of the product . another embodiment is directed to a method including creating , by a server , a registration record in a database upon activation of a license for a product . the license may be for multiple seats and the registration record includes a single activation key for all seats under the license . the method may further , when a user activates one or more available seats on a machine , linking unique activation information for the machine to the registration record in the database . this unique activation information may be used to track the number of used and available seats for the license and allows for correctly deactivating one or more of the seats based on the specific machine on which it was activated . another embodiment is directed to an apparatus including at least one processor and at least one memory including computer program code . the at least one memory and computer program code are configured , with the at least one processor , to cause the apparatus at least to create a registration record comprising an activation key for the license in a database upon activation of a license for a product . the license may be for multiple seats and the registration record may include a single activation key for all seats under the license . the at least one memory and computer program code are further configured , with the at least one processor , to cause the apparatus at least to , when a user activates one or more available seats on a machine , link unique activation information for the machine to the registration record in the database . this unique activation information may be used to track the number of used and available seats for the license and allows for correctly deactivating one or more of the seats based on the specific machine on which it was activated . another embodiment is directed to a computer program embodied on a non - transitory computer readable medium . the computer program is configured to control a processor to perform a process including creating a registration record in a database upon activation of a license for a product . the license may be for multiple seats and the registration record includes a single activation key for all seats under the license . the method may further , when a user activates one or more available seats on a machine , linking unique activation information for the machine to the registration record in the database . this unique activation information may be used to track the number of used and available seats for the license and allows for correctly deactivating one or more of the seats based on the specific machine on which it was activated . in some embodiments , the functionality of any of the methods described herein , such as that of fig6 , may be implemented by software and / or computer program code stored in memory or other computer readable or tangible media , and executed by a processor . in other embodiments , the functionality may be performed by hardware , for example through the use of an application specific integrated circuit ( asic ), a programmable gate array ( pga ), a field programmable gate array ( fpga ), or any other combination of hardware and software . one having ordinary skill in the art will readily understand that the invention as discussed above may be practiced with steps in a different order , and / or with hardware elements in configurations which are different than those which are disclosed . therefore , although the invention has been described based upon these preferred embodiments , it would be apparent to those of skill in the art that certain modifications , variations , and alternative constructions would be apparent , while remaining within the spirit and scope of the invention . in order to determine the metes and bounds of the invention , therefore , reference should be made to the appended claims . | 6 |
referring now to the drawings , and particularly to fig1 there is shown an embodiment of a mold assembly 10 which can be utilized to form a porous surface on the outer surface of an orthopaedic implant . mold assembly 10 generally includes a first mold half 12 and a second mold half 14 . second mold half 14 includes a flange 16 for positioning first mold half 12 relative thereto . further , second mold half 14 includes a contoured surface 18 which is either integral with or separably associated with second mold half 14 . as illustrated , second mold half 14 is configured to accommodate and otherwise support a metal acetabular cup 1 . it should be understood that while an acetabular cup is illustrated , this should not be considered a limitation on the invention . for example , the invention could apply equally to the fixation of a porous layer to the exterior surface of a femoral hip stem implant , or femoral knee joint component with the molds altered respectively . as another example , contoured surface 18 may be in the form of a prosthetic implant which is separately associated with second mold half 14 . first mold half 12 , with acetabular cup 1 supported thereon , and contoured surface 18 of second mold half 14 define a mold cavity 20 therebetween . mold cavity 20 is in communication with an inlet 22 which is sized and configured for receiving metallic particles 24 therein . metallic particles 24 may be in the form of metal beads . inlet 22 is also adapted to receive a binder therein , such as a water - soluble protein mixture 26 . in the embodiment shown in fig1 protein mixture 26 is in the form of gelatin 26 having an alloying material ( to be discussed hereinafter ) therein . gelatin 26 is preferably suspended in water at a concentration between 0 . 10 % to 50 % by weight . glycerin may also be added to the gelatin mixture as a plasticizer . in a preferred embodiment , the gelatin mixture consists essentially of 10 ml of water , 0 . 75 grams gelatin , and 0 . 02 to 0 . 05 grams glycerin . during use , metallic particles 24 and gelatin 26 may be mixed together and introduced into mold cavity 20 , such that the mixture substantially and entirely fills mold cavity 20 about the outer surface of acetabular cup 1 . mold cavity 20 is configured to form a shell about the cup having a desired shape with the mixture of metallic particles 24 and gelatin 26 . after the mixture fills the mold cavity , gelatin 26 is allowed to set - up or harden within mold cavity 20 . alternatively , the mixture , mold and implant may be frozen to allow the mold halves to be separated and the implant removed . in either instance , the implant with the gelatine and bead mixture adhered thereto is allowed to dry for a period of time . drying causes the gelatine to become very hard . after drying , implant 1 with shell 28 adhering thereto is placed within a furnace 30 shown in simplified form in fig2 . furnace 30 provides the dual functionality of both converting the gelatin mixture substantially to carbon , and bonding metallic particles 24 together via sintering . more particularly , after shell 28 is place within furnace 30 , the air within furnace 30 is evacuated using a pump or other suitable mechanism ( not shown ) down to a pressure of 1 × 10 - 5 torr pressure . furnace 30 is thereafter backfilled by pumping an inert gas such as high purity argon therein to a pressure zero ( 0 ) psig . subsequently , furnace 30 is again evacuated by pumping the high purity argon within furnace 30 down to a pressure of 1 × 10 - 5 torr . this evacuating and backfilling process is repeated two additional times and furnace 30 is thereafter backfilled with high purity argon to a partial pressure of at least 100 micrometers . reactive gases such as nitrogen , hydrogen and mixture of nitrogen and hydrogen gas can also be used in the process . the temperature within furnace 30 is then increased at a rate of 25 ° f . per minute to a predetermined temperature of 1 , 000 ° f . and held at this temperature for 15 minutes . furnace 30 is then heated again at a rate of 20 ° f . per minute to a sintering temperature of 2 , 350 ° f . and held at this temperature for a time period of between 15 minutes to 8 hours which is effective for carrying out a sintering process which provides an implant having a suitable bead bond strength for a particular application . it is anticipated that the preferred cycle time will be approximately 2 hours . in the embodiment shown in fig1 and 2 , metallic particles 24 and gelatin 26 are mixed prior to delivery within mold cavity 20 . however it is to be understood that metallic particles 24 can be introduced into mold cavity 20 , and gelatin 26 can thereafter be injected into mold cavity 20 . when shell 28 is disposed in furnace 30 and the temperature therein is increased at the predetermined rate as described above , at a temperature around 1300 degrees fahrenheit the gelatin mixture within shell 28 is converted essentially into residual carbon which then covers metallic particles 24 . the carbon defines an alloying material which is diffused into metallic particles 24 from which metallic particles 34 are made ( fig5 ). further , as the furnace temperature ramps up , all volatile constituents in the binder are removed leaving only the carbon . for example , fig5 illustrates a fragmentary , sectional view of a metal bead after the diffusion of carbon 32 therein from the binder as described above to form metal bead 34 . since the gelatine contacts only the periphery of the bead , carbon 32 may be disposed at a higher concentration about the periphery 36 of metal bead 34 , as shown ( fig5 ). the carbon illustrated deeper within the bead represents carbon already present in the bead . carbon 32 within alloyed metal bead 34 results in a lower melting point at the interface surface ( e . g ., periphery ) of alloyed metal bead 34 . that is , the eutectic composition of alloyed metal bead 34 having carbon 32 therein results in an interface surface 36 having a eutectic melting point which is less than the melting point of the co -- cr -- mo alloy from which alloyed metal bead 34 is initially constructed . the sintering process takes place at a temperature which is less than the eutectic melting point of alloyed bead 34 , which in turn is less than the melting point of the co -- cr -- mo alloy from which alloyed metal bead 34 is constructed . in the embodiment shown in fig5 the alloying material within alloyed metal bead 34 is in the form of carbon 32 , as described above . however , it is also possible that the alloying material can be in the form of silicon , ferrosilicon , f - 75 alloy , and / or iron . such alloying materials are typically in the form of a powder which is suspended within gelatin 26 ( fig1 ). referring now to fig3 an enlarged , fragmentary view of shell 28 shown in fig2 is illustrated prior to carbonization of gelatin 26 . metallic particles 24 are in the form of metal beads 24 which are held together using gelatin 26 . metal beads 24 may contact adjacent metal beads 24 along respective interface surfaces 36 ( fig3 and 5 ). referring now to fig4 an enlarged , fragmentary view of an alternate embodiment of a shell is shown . a metal layer is partially illustrated formed from metallic metal mesh as is well known in the industry . the metal mesh is formed from a plurality of metal fibers 38 which are in contact with each other at respective interface surfaces 40 . metal fibers 38 are held in place prior to sintering using gelatin 26 ( fig1 ) which has been allowed to set - up . in the embodiments described above , metallic particles 24 and binder 26 are introduced within mold cavity 20 of mold assembly 10 . however , it is also to be understood that a mixture of metallic particles 24 and binder 26 can be manually applied to an orthopaedic implant surface , such as a contoured surface 18 shown in fig1 . further , it is also possible to use a mixture of metallic particles 24 and binder 26 within a compression molding and / or injection molding machine to form a shell 28 &# 39 ;. as illustrated in fig6 a shell 28 &# 39 ; is formed using a mold 10 &# 39 ; having an upper mold portion 12 and a lower mold portion 14 . a mold cavity 20 &# 39 ; is formed between the upper and lower mold portions and may be filled with metal beads 24 and binder 26 . after molding , the shell 28 &# 39 ; is dried and then sintered in oven 30 ( fig7 ) to form a rigid porous shell . the rigid porous shell 28 &# 39 ; is may then be placed in an injection mold machine to form the porous backing for a molded acetabular cup . a further example of the usefulness of the binder method of this invention is illustrated in fig8 a wherein a fiber metal mesh pad 40 is connected to an implant 42 via a layer of small beads 44 . in use , the beads 44 are layered on the implant and the fiber mesh is supported by the layer of beads . the beads and mesh are coated or impregnated with the binder . the binder and implant are processed in a manner consistent with the above method . during sintering , the small beads are bonded to the fiber mesh and to the implant . alternatively , several spot welds 43 ( preferably formed by a laser welder ) may be used ( fig8 b ) to fix the metal pad 40 and beads 44 in place on the implant 42 prior to sintering . the advantage of such a construction would be two fold . first , the bead would present a greater surface area and thereby bond better with the implant as compared to fiber metal . second , the fiber metal is believed to form a better area for the ingrowth of bone as compared to the beads . while it is believed that the binder will , when dry , adequately hold a layer of fiber metal mesh to the implant during sintering , fig9 illustrates a potential variation of the method of the invention . in the embodiment of fig9 after the fiber metal is positioned on the implant , several spot welds 45 are made to fix the metal mesh 46 to the implant 48 prior to sintering . either before or after the spot welding , the metal mesh is impregnated with the binder material consistent with the above description . it has been found that if cobalt - chromium - molybdenum metallic beads 24 are used which have an initial concentration of 0 . 24 to 0 . 26 % carbon , the final carbon content within metal beads 34 ( fig3 and 5 ) using the process of the present invention is approximately 0 . 31 %. it is therefore possible to vary the final carbon content within metal beads 34 by varying the initial carbon concentration within metal beads 34 and the concentration of carbon within gelatin 26 . while this invention has been described as having a preferred design , the present invention can be further modified within the spirit and scope of this disclosure . this application is therefore intended to cover any variations , uses , or adaptations of the invention using its general principles . further , this application is intended to cover such departures from the present disclosure as come within known or customary practice in the art to which this invention pertains and which fall within the limits of the appended claims . | 0 |
the drawing depicts a preferred embodiment of the invention . it is to be understood , however , that the particular spatial geometries of the electrical sockets is merely an exemplary . also , the individual components may vary significantly from those which are depicted , somewhat schematically , in the drawings without departing from the scope of the invention . making reference first to fig1 which is a top plan view of the universal electrical plug adaptor 10 of this invention , the drawing illustrates the top of the distal housing 20 . the distal housing 20 is pivotally mounted on the proximal housing 40 which , in use , is permanently mounted to an electrical connection box , or otherwise connected to the source of electricity , the line voltage and the installation . exemplary pivot means 60 are provided to permit the distal housing to pivot or rotate relative to the proximal housing . the distal housing 20 is provided with openings in which a plurality of differently configured electrical sockets indicated at 12 , 14 , 16 and 18 , are mounted . these sockets are constructed and configured and have a spatial geometry to receive different plugs . the geometries depicted are merely exemplary and the sockets may have electrical connectors mounted in any geometric configuration to adapt to any variety of electrical plugs . referring to fig2 in particular , the distal housing carries an insulator board 22 on to which or in connection of which a plurality of electrical contacts indicated generally at 24 are mounted . in a preferred embodiment , in another electrical contact 26 retained in place by a keeper 28 is also mounted in association with the pivot means , which will be described in greater detail . electrical conductors 31 , 32 and 33 lead from the respective electrical connectors in the plug 14 to contacts mounted on or moveable with the insulator board 22 . in the exemplary embodiment , two of the conductors 31 and 33 connect to the source of voltage whereas another of the conductors 32 leads to a ground connector 26 . a similar arrangement involving electrical connectors 34 and 35 is provided with respect to plug 16 and likewise , a pair of conductors 36 and 37 permit electricity to be applied to the socket 18 . continuing to make reference to fig2 the proximal housing 40 has an insulator board 42 to which a set of electrical contacts in 44 are attached with which the contacts are associated . the electrical contacts 44 are connected by electrical conductors 51 , 52 and 53 . at the exemplary embodiment , the conduit 53 permits electricity to be applied from a transformer 46 in the proximal housing 40 whereas the conduits 51 and 52 provide electricity directly from the line voltage indicated by the electrical conduits 56 and 57 . a ground line 54 applies voltage to a connector 55 which is mounted on the pivot means 60 . the pivot means 60 is , in the exemplary embodiment , a pin that extends from the outer surface of the distal housing through the two insulator boards and is provided with a keeper 62 and a spring or other originally biasing means at 64 . in this embodiment , the conductor 54 extends to the ground circuit of the source of electricity and provided a grounding for the respective sockets , where the sockets are adapted to provide a ground contact . the ground connection in the exemplary embodiment is through the metal pin 60 by means of a pair of contacts 26 and 55 that make electrical contact with a pin . it will be noted that only one set of contacts 44 is provided on the insulator board 42 . the electricity which is provided through the electrical conduits 54 , 56 and 57 , which extend from the building wiring through an opening 41 into the proximal housing 40 , is connected to the contacts 44 on the insulator board 42 . only one set of the contacts on the insulator board 22 is in electrical contact with the contacts 44 on the insulator board 42 in the proximal housing . thus , electricity is applied to only one of the sockets in the distal housing at any given time . any of the sockets can be selected to receive electrical power simply by rotating the distal housing with respect to the proximal housing about the pivot pin 60 . referring to fig3 it is desirable to provide some means for making a quick connect and disconnect between the contacts as the contacts are rotated . in the preferred embodiment , a projection 20p is adapted to be received in a detent 40d . there are four such projections and four such detents , only one being depicted in the drawing . one is on each of the four sides of the housings . thus , when the distal housing 20 is rotated relative to the proximal housing 40 , the interaction of the projection and the detent lifts the distal housing and separates the contacts that are mounted in the distal housing from those mounted in the proximal housing breaking the circuit quickly . in the exemplary embodiment , four different styles of socket are provided , contact to permit electrical energy to be applied to the respective contacts being facilitated by the interaction of four sets of projections and detents . it will be understood that the exemplary embodiment is intended merely to illustrate the principal of the invention and that the particular configuration of the sockets is not limiting nor even necessarily fully representative , depending where the invention is utilized . furthermore , the housings 40 and 20 need not be square and , indeed , may be circular , hexagonal or octagonal , for example . while four sockets are illustrated as being exemplary , the housing may facilitate five or six such sockets , especially if the housing is made in a round configuration . it will also be understood that the invention need not require the detent and projection arrangement and that other means may be provided for locating the distal housing relative to the proximal housing so as to provide a desired electrical voltage to a particular socket . in general , it will be understood that the exemplary embodiment is not all encompassing and that the scope of the invention is limited only by the claims herein . | 7 |
golfball is a system and method of playing a team golf game . it consists of a set of rules which incorporate the rules of match play promulgated by the united states golf association , adding the following specific variations : 1 ) a team consisting of nine players who compete against another team consisting of nine players . 2 ) a single game score consisting of the total number of holes won by each team . 3 ) the object of the game being to win more holes than the opposing team , 4 ) a shot gun , or simultaneous start on the front nine of the golf course . 6 ) a second shotgun or simultaneous start on the back nine of the golf course . 7 ) an extra - hole protocol continuing all nine matches in case of a tie after play of the first 18 holes . 8 ) a system for assigning players to the several holes creating match ups between players of the respective home and visiting teams . 9 ) a rule allowing for the substitution of players whereby a player may be removed from the game prior to teeing off on any given hole , and a new player substituted . 10 ) a rule preventing platooning by prohibiting a player removed from the game to return to the game until the next period of play . 11 ) a system of score keeping whereby the result of play on every hole is communicated to a central scoreboard . 12 ) a system of score keeping whereby the score of the game is recalculated as each hole is played , displayed on a single consolidated scoreboard and the current score of the game transmitted to all of the players on the golf course . [ 0036 ] fig1 depicts the golfball scoreboard , which may be displayed on a desk top or lap top computer , projected onto a screen or wall , or embodied in a dedicated apparatus or structure of any size . the golfball scoreboard displays the name of the home team , in fig1 shown as “ state university ”. it displays the name of the visiting team , shown in fig1 as “ city college ”. the golfball scoreboard displays the current score of the home team directly beneath the name of the home team , shown in fig1 as “ 24 ”. it displays the current score of the visiting team directly beneath the name of the visiting team , shown in fig1 as “ 23 ”. the golfball scoreboard also displays the number of holes remaining to be played in the regulation game in the center of the scoreboard and between the scores of the respective teams , shown in fig1 as “ 97 ”. the golfball scoreboard displays the numbers of the several individual matches in a vertical column in the center of the scoreboard under the heading “ match ”, shown in fig1 by the consecutive numerals “ 1 ” through “ 9 ”. the golfball scoreboard identifies the 18 holes of the golf course shown in fig1 as the numerals “ 1 ” through “ 18 ” arranged horizontally beneath the displays of the team scores . the golfball scoreboard displays the names of the players in the first match in the first horizontal row beneath the hole numbers , shown in fig1 as “ allen ” being the home team player , and “ katz ” being the visiting team player . the current status of the first match is displayed in the first row , with the number of holes won by the home team player appearing immediately to the left of the home team player &# 39 ; s name , shown in fig1 as the numeral “ 3 ” to the left of the player “ allen ”, and the number of holes won by the visiting team player appearing immediately to the right of the name of the visiting team player , shown in fig1 as the numeral “ 4 ” to the right of the player “ katz ”. the cumulative results of the first match are displayed in the first row of spaces beneath the hole numbers , with the letter “ h ” indicating that the home team player won the hole , the letter “ v ” indicating that the visiting team player won the hole and the numeral “ 0 ” indicating that the hole was halved or tied . the golfball scoreboard displays the names of the players in the second match in the second horizontal row beneath the hole numbers , shown in fig1 as “ burke ” being the home team player , and “ lewis ” being the visiting team player . the current status of the second match is displayed in the second row , with the number of holes won by the home team player appearing immediately to the left of the home team player &# 39 ; s name , shown in fig1 as the numeral “ 2 ” to the left of the player “ burke ”, and the number of holes won by the visiting team player appearing immediately to the right of the name of the visiting team player , shown in fig1 as the numeral “ 4 ” to the right of the player “ lewis ”. the cumulative results of the second match are displayed in the second row of spaces beneath the hole numbers , with the letter “ h ” indicating that the home team player won the hole , the letter “ v ” indicating that the visiting team player won the hole and the numeral “ 0 ” indicating that the hole was halved or tied . the golfball scoreboard displays the names of the players in the third match in the third horizontal row beneath the hole numbers , shown in fig1 as “ clark ” being the home team player , and “ martin ” being the visiting team player . the current status of the third match is displayed in the third row , with the number of holes won by the home team player appearing immediately to the left of the home team player &# 39 ; s name , shown in fig1 as the numeral “ 4 ” to the left of the player “ clark ”, and the number of holes won by the visiting team player appearing immediately to the right of the name of the visiting team player , shown in fig1 as the numeral “ 2 ” to the right of the player “ martin ”. the cumulative results of the third match are displayed in the third row of spaces beneath the hole numbers , with the letter “ h ” indicating that the home team player won the hole , the letter “ v ” indicating that the visiting team player won the hole and the numeral “ 0 ” indicating that the hole was halved or tied . the golfball scoreboard displays the names of the players in the fourth match in the fourth horizontal row beneath the hole numbers , shown in fig1 as “ dunn ” being the home team player , and “ nelson ” being the visiting team player . the current status of the fourth match is displayed in the fourth row , with the number of holes won by the home team player appearing immediately to the left of the home team player &# 39 ; s name , shown in fig1 as the numeral “ 3 ” to the left of the player “ dunn ”, and the number of holes won by the visiting team player appearing immediately to the right of the name of the visiting team player , shown in fig1 as the numeral “ 3 ” to the right of the player “ nelson ”. the cumulative results of the fourth match are displayed in the fourth row of spaces beneath the hole numbers , with the letter “ h ” indicating that the home team player won the hole , the letter “ v ” indicating that the visiting team player won the hole and the numeral “ 0 ” indicating that the hole was halved or tied . the golfball scoreboard displays the names of the players in the fifth match in the fifth horizontal row beneath the hole numbers , shown in fig1 as “ edwards ” being the home team player , and “ oswald ” being the visiting team player . the current status of the fifth match is displayed in the fifth row , with the number of holes won by the home team player appearing immediately to the left of the home team player &# 39 ; s name , shown in fig1 as the numeral “ 2 ” to the left of the player “ edwards ”, and the number of holes won by the visiting team player appearing immediately to the right of the name of the visiting team player , shown in fig1 as the numeral “ 4 ” to the right of the player “ oswald ”. the cumulative results of the fifth match are displayed in the fifth row of spaces beneath the hole numbers , with the letter “ h ” indicating that the home team player won the hole , the letter “ v ” indicating that the visiting team player won the hole and the numeral “ 0 ” indicating that the hole was halved or tied . the golfball scoreboard displays the names of the players in the sixth match in the sixth horizontal row beneath the hole numbers , shown in fig1 as “ franklin ” being the home team player , and “ proctor ” being the visiting team player . the current status of the sixth match is displayed in the sixth row , with the number of holes won by the home team player appearing immediately to the left of the home team player &# 39 ; s name , shown in fig1 as the numeral “ 3 ” to the left of the player “ franklin ”, and the number of holes won by the visiting team player appearing immediately to the right of the name of the visiting team player , shown in fig1 as the numeral “ 1 ” to the right of the player “ proctor ”. the cumulative results of the sixth match are displayed in the sixth row of spaces beneath the hole numbers , with the letter “ h ” indicating that the home team player won the hole , the letter “ v ” indicating that the visiting team player won the hole and the numeral “ 0 ” indicating that the hole was halved or tied . the golfball scoreboard displays the names of the players in the seventh match in the seventh horizontal row beneath the hole numbers , shown in fig1 as “ grant ” being the home team player , and “ quinlan ” being the visiting team player . the current status of the seventh match is displayed in the seventh row , with the number of holes won by the home team player appearing immediately to the left of the home team player &# 39 ; s name , shown in fig1 as the numeral “ 1 ” to the left of the player “ grant ”, and the number of holes won by the visiting team player appearing immediately to the right of the name of the visiting team player , shown in fig1 as the numeral “ 2 ” to the right of the player “ quinlan ”. the cumulative results of the seventh match are displayed in the seventh row of spaces beneath the hole numbers , with the letter “ h ” indicating that the home team player won the hole , the letter “ v ” indicating that the visiting team player won the hole and the numeral “ 0 ” indicating that the hole was halved or tied . the golfball scoreboard displays the names of the players in the eighth match in the eighth horizontal row beneath the hole numbers , shown in fig1 as “ harrington ” being the home team player , and “ roberts ” being the visiting team player . the current status of the eighth match is displayed in the eighth row , with the number of holes won by the home team player appearing immediately to the left of the home team player &# 39 ; s name , shown in fig1 as the numeral “ 3 ” to the left of the player “ harrington ”, and the number of holes won by the visiting team player appearing immediately to the right of the name of the visiting team player , shown in fig1 as the numeral “ 1 ” to the right of the player “ roberts ”. the cumulative results of the eighth match are displayed in the eighth row of spaces beneath the hole numbers , with the letter “ h ” indicating that the home team player won the hole , the letter “ v ” indicating that the visiting team player won the hole and the numeral “ 0 ” indicating that the hole was halved or tied . the golfball scoreboard displays the names of the players in the ninth match in the ninth horizontal row beneath the hole numbers , shown in fig1 as “ innsfield ” being the home team player , and “ sullivan ” being the visiting team player . the current status of the ninth match is displayed in the ninth row , with the number of holes won by the home team player appearing immediately to the left of the home team player &# 39 ; s name , shown in fig1 as the numeral “ 3 ” to the left of the player “ innsfield ”, and the number of holes won by the visiting team player appearing immediately to the right of the name of the visiting team player , shown in fig1 as the numeral “ 2 ” to the right of the player “ sullivan ”. the cumulative results of the ninth match are displayed in the ninth row of spaces beneath the hole numbers , with the letter “ h ” indicating that the home team player won the hole , the letter “ v ” indicating that the visiting team player won the hole and the numeral “ 0 ” indicating that the hole was halved or tied . [ 0046 ] fig2 depicts the golfball scorecard , which in the preferred embodiment , would be a hand held apparatus which displays the name of the home team , shown in fig2 as “ state university ”, the name of the visiting team , shown in fig2 as “ city college ”; the number of the match being scored , shown in fig2 as the numeral “ 1 ” appearing between the names of the teams , the name of the home team player in the match being scored , shown in fig2 as “ allen ”; the name of the visiting team player in the match being scored , shown in fig2 as “ katz ”; the current score of the home team , shown in fig2 as the number “ 24 ” appearing beneath the name of the home team ; the current score of the visiting team , shown in fig2 as the number “ 23 ” beneath the name of the visiting team ; the number of holes remaining to be played , shown in fig2 as the number “ 97 ” appearing between the scores of the two teams ; the name of the home team player competing in the match being scored , shown in fig2 as the name “ allen ” appearing immediately beneath the score of the home team ; the name of the visiting team player in the match being scored , shown in fig2 as the name “ katz ” appearing immediately beneath the score of the visiting team ; the number of holes won by the home team player , shown in fig2 as the numeral “ 3 ” appearing immediately beneath the name of the home team player ; the number of holes won by the visiting team player , shown in fig2 as the number “ 4 ” appearing immediately beneath the name of the visiting team player ; and the cumulative results of the match on each of the holes which have been played , shown in fig2 by the letters “ h ” and “ v ” and the numeral “ 0 ” in the spaces beneath the numbers “ 1 ” through “ 18 ”, being the designation of the 18 holes of the golf course . | 0 |
embodiments of the invention use one or more driver arrays to induce an oscillating stress to produce shear waves that propagate through a human to allow tissue and / or organs to be imaged . the shear waves alter the phase of the magnetic resonance signals produced by a mri system , and from the altered phase , mechanical properties of the subject can be determined , such as the elasticity , viscosity of the tissue or organ , the density of the tissue or organ , and the size and / or shape of tissue or organ . note that multiple tests conducted at different times , can provide changes in elasticity , density , viscosity , size , and shape over time to detect diseases at a very early stage . the information provided by mre test ( s ) can be used by a practitioner , along with data from other sources , e . g . x - ray test , ct tests , ultrasound tests , pet tests , regular mri tests , chemical tests ( e . g . blood tests , etc . ), to provide a more accurate diagnosis of a disease or illness of a patient at a very early stage . data that includes the mechanical properties of the subject can allow for earlier diagnosis of diseases with increased specificity and sensitivity . the earlier and more accurate the diagnosis , the better chance of recovery for the patient . diseases that benefit from having mechanical property data include brain diseases such as alzheimer &# 39 ; s disease and mild cognitive impairments , liver diseases such as cirrhosis , spleen diseases , kidney diseases such as kidney stones or tumors , pancreas diseases such as tumors , prostate diseases such as prostate carcinoma , uterine diseases such as uterine tumors , and arterial diseases such as arteriosclerosis and the like . for example , liver cirrhosis may manifest itself as a change in elasticity of the liver tissue , but not show any change in liver chemistry . thus , detecting a change in the elasticity may lead to an earlier diagnosis and treatment of liver disease . as another example , alzheimer disease manifests itself as a change in elasticity and density of the brain , which can be readily detected at an early stage by a mre test . other tests can also detect alzheimer disease at an earlier stage , e . g . a pet scan test , however a pet scan uses radiation , which is detrimental to a patient . any disease that manifests itself as a change in the mechanical properties of tissue or organs can be detected using embodiments of the invention . in some applications , the production of shear waves in the tissues can be accomplished by physically vibrating the surface of the subject with a pneumatic or an electromechanical device . for example , shear waves may be produced in the breast or liver or prostate by direct contact with the oscillatory driver to the surface of the human body . also , with organs like the liver or breast , the oscillatory force can be directly applied by means of an applicator that is inserted into the organ by a needle driver . however , if possible , it is preferential to apply the force noninvasively , i . e . to the surface of the subject . the driver may comprise a piezoelectric device , which vibrates to produce the shear waves . one type is a piezoelectric material that is made especially for mri applications . materials for nonmagnetic bending actuators are made by piezo systems , inc ., 186 massachusetts avenue , cambridge , mass . 02139 . another type of piezoelectric device is uses a polyvinylidene fluoride ( pvf2 ) membrane as the vibrating surface . such a material is known as pro - wav , which is available from s . square enterprise company limited , pro - wave electronics corporation . one advantage of using the pvf2 material is that the membrane is not brittle , and is capable of conforming to different curved surfaces of the body of the patient . this provides a more accurate reading , by allowing full contact with the body of the patient , and thus better insertion of the shear waves . another advantage of using piezoelectric drivers is that the size for the drivers are much smaller than the other types of drivers , e . g . pneumatic drivers , and thus allow for easier set up . also the piezoelectric drivers do not suffer the power attenuation that pneumatic drivers experience , namely the air tube loses power rapidly over distance . another advantage is that the piezoelectric drivers do not use coils which are susceptible to mri induced eddy currents , which can produce artifacts in the images . fig1 depicts an exemplary arrangement for an mre system 100 , according to embodiments of the invention . system 100 includes a mre driver 101 , which is a piezoelectric driver that comprises a mri compatible piezoelectric material or a pvf2 membrane . the driver 101 is placed in contact with patient 102 , which may be a normal subject . the patient 102 with the driver is then placed into a mri system 103 , which comprises a mri scanner 109 . the mri scanner 109 is controlled by mri console 108 . the operation of the mre system 100 produces mre data 107 , which may be graphically viewed on a display device , not shown . the mre driver 101 uses a signal that is produced by generator 104 , and is amplified by amplifier 105 . the oscilloscope 106 monitors the signal from the generator 104 . the signal generation of generator 104 is synchronized with the operation of the mri system 103 . a trigger on the mri scanner provides a signal to the generator to initiate a vibration . for example , the signal activates the generator to form ten pulses at its set frequency . fig2 depicts exemplary results 200 of a test using the system of fig1 . in fig2 , the driver 101 is located on the surface of any interested region 201 of patient 102 . the driver 101 is vibrated to produce shear waves 202 in the tissue region 201 . the resulting data 200 depicts an image that shows the differences in elasticity of the region 201 . the image is formed by analysis of the mre data produced by the test . the wave image is inverted to produce the elastogram image of the resulting data 200 . fig3 depicts another exemplary results 300 of another test using the system of fig1 . in fig3 , the driver 101 is located over tissue / organ region 301 of patient 102 . in this example , the tissue region 301 includes tumors 303 ab . the driver 101 is vibrated to produce shear waves 302 in the tissue region 201 . the resulting data 300 depicts an image that shows elasticity of the region 201 . as the shear wave passes through a tumor 303 a , which is softer or more elastic than the surrounding region , the wave becomes shorter . as the shear wave passes through a tumor 303 b , which is harder or less elastic than the surrounding region , the wave becomes longer . note that the tumors have different elasticity values than the surrounding regions , and thus are readily identifiable . fig4 a - 4b depict the components of an exemplary driver , according to embodiments of the invention . fig4 a depicts an exploded perspective view showing the different components of the driver . fig4 b depicts a perspective view of the driver showing the side that is placed onto the patient . fig4 c depicts a perspective view of the driver showing the side that faces away from the patient . the driver 400 includes a housing 401 that includes a fixing device 402 that connects the driver to the patient . the fixing device 402 may be velcro ™, an adhesive , a snap , or the like . the driver 400 includes mounting frame 403 that supports the piezoelectric element 404 . the element 404 may comprise a piezoelectric device composed of special made mri compatible piezoelectric material or pvf2 . the driver 400 also includes reinforcement layer 405 that supports and protects the piezoelectric element 400 , and insulation layer 406 to prevent electric current from the piezoelectric material traveling to the patient . the driver operates by receiving electricity through wires 407 . this embodiment is useful for tests involving breasts , heart , abdominal organs such as the liver , the spleen , the pancreas , a kidney , the prostate , as well as the pelvis . fig5 a - 5b depict the components of another exemplary driver , according to embodiments of the invention . fig5 a depicts an exploded perspective view showing the different components of the driver . fig5 b depicts a perspective view of the driver showing the side that is placed onto the patient . fig5 c depicts a perspective view of the driver showing the side that faces away from the patient . the driver 500 includes a housing 501 that includes a fixing device 502 that connects the driver to the patient . the fixing device 502 may be velcro ™, an adhesive , a snap , or the like . the driver 500 includes the piezoelectric element 504 . the element 504 may comprise a piezoelectric device composed of a special made mre compatible material or pvf2 . the driver 500 also includes reinforcement layer 505 that supports and protects the piezoelectric element 500 , and insulation layer 506 to prevent the electric current from the piezoelectric material traveling to the patient . the driver operates by receiving electricity through wires 507 . this embodiment is useful for tests involving the head , neck , and extremities . fig6 depicts the components of another exemplary driver , according to embodiments of the invention . the driver 600 includes a flexible housing 601 that includes a fixing device 602 that connects the driver to the patient . the fixing device 602 may be velcro ™, an adhesive , a snap , or the like . the driver 600 includes a pvf2 piezoelectric element within the housing . the driver operates by receiving electricity through wires 603 . this embodiment is useful for tests involving the arms or legs . fig7 depicts the components of another exemplary driver , according to embodiments of the invention . the driver 700 is adapted to be used in tests involving breasts . the driver includes a flexible housing 701 that includes a fixing device 702 that connects the driver to the patient . the fixing device 702 may be velcro ™, an adhesive , a snap , or the like . the driver 700 includes two pvf2 piezoelectric elements within the housing thus allowing both breasts to be examined at the same time . the size of the drivers may be varied as needed . some regions of a patient &# 39 ; s body may require a larger vibration , and hence a larger driver , to produce the shear waves needed to examine the region . some portions may be thicker or comprise tissue that is more attenuating than other regions . for example , the human brain is encased in the skull , which comprises a thick bone material . the shear waves are greatly attenuated by the skull . thus , the vibration power needed to analyze the brain should be larger . other regions , e . g . arms and legs , are thinner and therefore , a lower vibration power can be used . typically , the deeper the region of interest , the greater the power should be . one embodiment of a mre system can use a plurality of drivers in a phased array . a plurality of drivers would be located at various sites on the patient . the sites are selected according to the anatomic location of the human body to minimize interference between the waves created by the drivers and to illuminate the region of interest ( roi ) wholly . the drivers may comprise mri compatible piezoelectric materials or pvf2 material . using a phased array of drivers increases the sensitivity of the mre test and reduces the effects of attenuation . to reduce the wave interference induced by having multiple drivers , each driver is synchronized with the same frequency , and the same power , and triggers at the same time . fig8 a - 8d depict a comparison of the shear waves generated by a single driver and the shear wave generated by a phased array of two drivers , according to embodiments of the invention . in fig8 a , a single driver is used to produce the shear waves as shown . the driver 803 is arranged on the tissue as shown in fig8 b . the waves produced are relatively strong near the surface , but are rapidly attenuated as the distance increases from the driver , as shown in the diagram 802 . in fig8 c , an array of two drivers is used to produce the shear waves 804 as shown . the drivers 806 are arranged around the tissue as shown in fig8 d . the waves produced appear to be relatively unattenuated throughout the sample , as shown in the diagram 805 . the drivers trigger at the same time , with the same power , and the same frequency , and have symmetrical locations so the shear waves constructively interfere with each other to form a stronger signal . tests conducted on regions of the body that are relatively deep or include attenuating tissue benefit by using a phased array . the pluralities of drivers allow the shear wave to penetrate to the deeper areas , and pass through attenuating materials . the drivers of the area may be located in areas that have less attenuating materials than other regions . for example , some locations of the skull attenuate less than other areas . knowledge of human anatomy and physiology will allow for proper placement . fig9 a and 9b depict exemplary arrangements of phase array drivers , according to embodiments of the invention . fig9 a depicts a plurality of drivers 400 of fig4 a - 4c . fig9 b depicts a plurality of drivers 500 of fig5 a - 5c . in each embodiment , the drivers are located on a belt that may be secured to a patient . in fig9 a , only two of the four drivers will be used in a test , so the wires of the other two are disconnected . in fig9 b , all four drivers are to be used , and thus all four drivers have power wires . note that the number of drivers is by way of example only as two or more drivers may be used to form the array . note that each driver may be shaped differently from the other drivers to accommodate different shapes , sizes and contours of patient . fig1 a and 10b depict exemplary arrangements of phase array drivers located on a patient , according to embodiments of the invention . fig1 a depicts the array of fig1 a being used on a patient . in this example , all four of the drivers are being used , and thus all four have wires to receive power . fig1 b depicts the array of fig1 b being used on a patient . in this example , only two drivers are used because the arm is small relative to other regions of the body . note that each driver may be shaped differently from the other drivers to accommodate different shapes , sizes and contours of patient . fig1 depicts another exemplary arrangement for an mre system , according to embodiments of the invention . system 1100 includes a mre driver 1101 , which is a piezoelectric driver that comprises a mre compatible piezoelectric material or membrane . the driver 1101 is placed in contact with patient 1102 , which may be a normal subject . the patient 1102 with the driver is then placed into a mri scanner 1103 . the patient 1102 with the driver 1101 and the mri scanner 1103 are located in a shielded room 1104 . the mri scanner 1103 is controlled by mri console 1105 . the operation the mre system 1100 produces mre data 1106 , which is processed by post - processing software 1107 to produce images 1108 that may be graphically viewed on a display device 1109 . the mre driver 1101 uses a signal that is produced by generator 1110 , and is amplified by amplifier 1111 . the oscilloscope 1112 displays the signal from the generator 1110 . the signal generation of generator 1110 is synchronized with the operation of the mri system 1103 by signal 1114 . typical frequencies are 60 hz , 80 hz , 100 hz , or 150 hz . the signal duration lasts through the mre scan . this arrangement also includes an electrical - optical - electrical conversion . the driver 1101 requires an electric signal to operate . however , using metal wire to provide the signal may induce interference in the signal , because the metal wire will inductively receive em fields generated by the mri scanner 1103 . thus , the scanner 1103 can interfere with the operation of the driver 1101 . the signal leaving the amplifier 1111 is converted to an optical signal by converter 1113 . such a conversion may be accomplished by using an led or an led laser . the light signal is then carried on a fiber optic line to the driver 1101 . another converter 1115 that is proximate to the driver 1101 converts the light signal back into an electrical signal . the second converter may be located next to the driver 1101 or may be integrated with the driver 1101 . the second converter may also comprise an amplifier to boost the electric signal that is being sent to the driver . the amplifier may be instead of or in addition to amplifier 1111 . note that in this arrangement , the generator 1110 , the oscilloscope 1112 , and the amplifier 1111 comprise a single component 1115 that may be portable . note that in this embodiment , the mri scanner 1103 controls the activation of the signal generation 1110 . however , the mri console 1105 gives the command to the mri scanner 1103 to control signal generator 1110 . the generator can be controlled to change the frequency of all or some of the drivers . thus , each of the drivers can receive the same signal frequency or may receive different signal frequencies . note that the drivers may receive the signal frequency at the same time to have the same phase or may receive the signal at different times to have different phase . additionally , the amplifier 1111 can be controlled to change the power of the signal being sent to all or some of the drivers . the power can be increased to all or some of the drivers . thus , the drivers may all be operating at the same power level or may have different power levels . note that each of the drivers in the array may be the same size or may have different sizes . furthermore , a smaller driver located in one region may receive more power than a larger driver located in another region . thus , the shear wave produced by the drivers may have similar wave power , because the smaller driver is receiving more power . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , composition of matter , means , methods and steps described in the specification . as one of ordinary skill in the art will readily appreciate from the disclosure of the present invention , processes , machines , manufacture , compositions of matter , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention . accordingly , the appended claims are intended to include within their scope such processes , machines , manufacture , compositions of matter , means , methods , or steps . | 6 |
referring now to fig1 and 2 , a wordprocessor of lap - top type provided with a liquid crystal display in accordance with the present invention is illustrated . the wordprocessor comprises a processer frame 1 , a key board 3 , and a display board 7 pivotally fixed to the frame 1 . the display board functions as a lid of the computer system . in the open position of the display board , the display area 9 formed in the inner side of the display board 3 is errected as shown in fig1 in order to enable the operation of the wordprocessor . in the closed position , as shown in fig2 the external side of the display board 7 becomes the upper side . the rear side is provided with a photoelectric conversion device 11 . the conversion device can convert the incident light into electricity and accumulate the electric energy by means of a secondary cell which is not shown in fig1 and 2 . reference numeral 5 designates a built - in printer . fig3 is a cross section of the display board 7 . the liquid crystal display 9 comprises a pair of transparent glass substrates 25 , electrode arrangements 27 formed in the inside surfaces of the substrates 25 , a ferroelectric liquid crystal layer 23 interposed therebetween , and a polarizing plate 29 . the electrode arrangements 27 define a plurality of pixels in matrix form in order to apply electric fields thereto . the photoelectric conversion device 11 in turn comprises a transparent glass substrate 17 , a reflective electrode 21 made of a metal such as al , cr and mo , a photoelectric convertion semiconductor film 13 made of an amorphous silicon semiconductor , a transparent electrode made of ito , and an external glass plate 15 . light enters the structure from the left side of the glass substrate 25 and is reflected on the reflective electrode 21 of the photoelectric conversion device 11 . images can be constructed through the modulation of the incident light by passing through the polarizing plate 29 and the liquid crystal layer 23 . it should be noted that , in the reflective type constuction of the liquid crystal display 9 , the reflective plate has been dispensed with . fig4 illustrates the display board 7 when constructed into the transmissive type . the construction of the liquid crystal device 9 is similar to that illustrated in fig3 except for the provision of a light - scattering plate 45 behind the inner substrate 25 . the light - scattering plate 45 may be made of an organic sheet or a frosted glass pane . the photoelectric conversion device 41 is also similar to that illustrated in fig3 except that a transparent electrode 22 is provided in place of the reflective electrode 21 . in addition , a fluorescent lamp 43 is provided between the liquid crystal display 9 and the photoelectric conversion device 41 . the combination of the liquid crystal display 9 and the lamp 43 is the same as the construction of a usual transmissive type liquid crystal display arrangement . light emitted from the lamp 43 is made white and uniform by passing through the light - scattering plate 45 and modulated by the liquid crystal layer and the polarizing plate . the construction shown in fig4 is , however , adapted to collect the energy of the light rays going away from the liquid crystal display by means of the photoelectric conversion device 41 . of course , the conversion device 41 functions also to collect light incident from the external side . fig5 is a circuit diagram for explaining the driving operation of the liquid crystal display shown in fig3 or fig4 . reference numeral 35 designates the driving circuit for the liquid crystal display . the driving circuit is adapted to supply appropriate addressing signals to the electrode arrangements 27 in order to construct desired images thereon . reference numeral 33 designates a switch 33 by which the driving circuit 35 is turned on . the energy is supplied selectively , by means of a dual switch 37 , from the photoelectric conversion device 11 associated with a secondary cell 29 , or an ac power source 30 , e . g . the line supply , through a rectifier 41 . the dual switch 37 opens , in one position , the connection between the driving circuit 35 and the ac source 30 and closes the connection between the photoelectric conversion device 11 and the driving circuit 35 at the same time . in the other position , the dual switch 37 closes the connection between the driving circuit 35 and the ac source 30 and opens the connection between the photoelectric conversion device 11 and the driving circuit 35 at the same time . when the wordprocessor is not used , the electricity generated from the conversion device 11 is accumulated in the secondary cell 29 through the rectifying diode 31 . while several embodiments have been specifically described by way of examples , it is to be appreciated that the present invention is not limited to the particular examples described and that modifications and variations can be made without departing from the scope of the invention as defined by the appended claims . some examples are as follow . for example , although the example is the display for a wordprocessor , the present invention can be applied for forming the display devices of general computer system , e . g . lap - top personal computer systems . colour images can be constructed by making use of a colour filter . | 6 |
in exemplary embodiments described herein , an electronic device in a communication network manages a cache that holds or stores a number of objects . the communication network may include a core network and at least one access network . the objects may represent data that has been requested by a user device in one of the access networks . the objects may have been directed to the access network by a core services platform in the core network . the electronic device , which may be located in the same access network as the user device , in a different access network , or in a core network , may determine a content replacement rule that applies to an object in the cache , the content replacement rule defining a policy for when the object in the cache should be replaced . when it is determined that the object in the cache should be replaced , the electronic device may apply the content replacement rule to replace the object in the cache . the content replacement rule may be specific to a certain object type , and different content replacement rules may be applied to different object types . further , different content replacement rules may be applied to the same object type in response to different conditions related to the communications network , the object , or the system that the cache resides in . by providing different content replacement rules for different object types or different conditions , a user or administrator may provide a greater degree of granularity in caching and refreshing data . for example , object types that have a high resource cost to refresh may be refreshed less often than low - cost object types . further , object types that are likely to become outdated the fastest may be refreshed more often . because the content replacement rules may be applied in response to a triggering condition , such as the state of the network , content may be replaced proactively . this means that the cached content may be replaced at any time that it is advantageous to replace it , in contrast to waiting to replace the content until it becomes necessary to do so because the content has become stale . for example , if the network is experiencing temporarily high traffic , the caching device may wait for a more opportune time to cache new data . alternatively , if the network has excess bandwidth , the device may take the opportunity to cache or re - cache objects that will soon become out of date . fig1 depicts a communication network 100 suitable for exemplary embodiments . according to one embodiment , the communication network 100 may be a wireless network , and includes a core network 110 and access networks 150 , 152 and 154 . nevertheless , those skilled in the art will appreciate that the communication network may include wired networks as well . according to other embodiments , communication network 100 may include more or fewer access networks . one skilled in the art will recognize that the functionality described herein example is equally applicable in different types of communication networks , such as a network utilizing a wifi framework , a utran or umts framework , a cdma framework , a wimax framework , or a umb framework , among others . fig2 depicts an exemplary access network 150 in more detail . each access network serves as the point of contact with the communication network for users , and connect subscribers with their service providers . the communication network 100 may have multiple access networks , serving different sets of users , in communication with a single core network . examples of access networks include the umts terrestrial radio access network ( utran ), the gsm radio access network ( gran ), and the gsm edge radio access network ( geran ). in the access network 150 , an electronic device 170 maintains a cache 400 ( depicted in fig3 ). as will be discussed in more detail below , the electronic device 170 may serve as both the cache maintenance device and the storage device for storing the cache 400 . alternatively , cache maintenance and cache storage may be split into two or more separate electronic devices . electronic device 170 may be , for example , a server or a router , or may be a custom - designed device . alternatively , the cache may be maintained at another device in the access network , such as base station 190 , intermediate service platform 180 , or user device 160 . according to other embodiments , electronic device 170 maintaining the cache 400 is located in the core network 110 . alternatively , electronic device 170 maintaining the cache 400 may be located in any other access network , such as access network 152 or access network 154 . core services platforms 112 may be , for example , servers within core network 110 . core services platforms 112 may provide services within the core network , such as ( but not limited to ) fetching data from a storage repository 114 or routing data throughout communications network 100 . a cores services platform 112 can take a number of forms , depending on the services to be provided . for example , a core services platform 112 may be a switch or a router . alternatively , a core services platform 112 may be a server , such as a file server or a mail server , a network bridge , a network hub , or a repeater . storage repository 114 may be located within core network 110 , or alternatively may be located in an access network . storage repository 114 may be a file server , though it may be another type of device capable of storing content , such as a personal computer , a mail server , a cellular phone , a personal digital assistant , or a global positioning system device . a user 158 using a user device 160 may interact with access network 150 via a communications device 330 ( depicted in fig3 ), such as a modem , fiber optic connection , or a transmitter and receiver for radio communication . user device 160 may be , for example , but is not limited to , a computing device , a personal digital assistant , a cellular phone , or a global positioning system device . user device 160 will typically send and receive data through a base station 190 located in access network 150 . base station 190 may be , for example , a gateway , a cell tower , a node b , or an enhanced node b . the base station may interact with one or more intermediate service platforms 180 located in access network 150 or may interact directly with core network 110 . intermediate service platforms 180 may perform tasks such as resource management ( directing control of the network in a manner that allows the efficient use of network resources ), filtering ( inspecting incoming and outgoing data in order to remove extraneous , harmful , or harassing data ), and routing ( directing network traffic towards its appropriate destination ). examples of intermediate service platforms 180 include radio network controllers , bridges , routers , and virtual private network ( vpn ) servers . when user 158 using user device 160 requests data , the core network may locate the requested data in a storage repository 114 . storage repository 114 may be in the user device &# 39 ; s access network 150 , or core network 110 , or in a different access network 152 . once storage repository 114 is located , the data may be sent back to the user device 160 , potentially after being routed through the core network 110 . once data has been retrieved from storage repository 114 , it may be routed through access network 150 via intermediate service platform 180 or base station 190 , or both . intermediate service platform 180 or base station 190 may maintain a cache 400 for temporarily storing recently used data . for ease of discussion , the figures depict the cache device as a separate electronic device 170 , though electronic device 170 may be the same as intermediate service platform 180 or base station 190 . if the same data is subsequently requested from user device 160 , or a different user device in the same access network 150 , intermediate service platform 180 or base station 190 may check its cache 400 to see if cache 400 contains an up - to - date copy of the data 450 . if cache 400 does contain an up - to - date copy of the data 450 , then the copy of the data 450 may be forwarded to the user device 160 . thus , it is not necessary to fetch the same data multiple times , and hence a trip through core network 110 is avoided . fig3 depicts electronic device 170 in more detail . electronic device 170 may contain a storage 310 for storing instructions 312 to be executed by a processor 320 . instructions 312 may be storage on one or more electronic device readable media . examples of electronic device readable media include , but are not limited to , ram , rom , magnetic storage media , or optical storage media . instructions 312 may cause processor 320 to perform a series of steps described in detail below in reference to fig6 . instructions 312 may be in any form that describes how to perform these steps . for example , the instructions may be uncompiled code in any suitable programming language , compiled code , assembly language instructions , or any other type of instructions . storage 310 may also store an operating system 314 for operating electronic device 170 . storage 310 may store additional applications 316 for providing additional functionality . storage 310 also stores a cache 400 , which will be discussed in more detail with reference to fig4 , and a policy engine 318 . the policy engine 318 may enforce defined cache replacement policies on object groups , take automated cache refresh and replacement actions on groups of objects as defined by policy directives , collect cache metrics and events , and respond to internal system and external event triggers . a user 158 or administrator may interact with the policy engine 318 in a number of ways . for example , an administrator may wish to define different object groups , and apply different object replacement policies to each group . an instruction may be sent to electronic device 170 to define an object group . an exemplary structure for such an instruction is described below , in relation to fig5 . such an instruction may be encapsulated as a data packet and sent over network 100 to electronic device 170 , loaded directly onto electronic device 170 via an input device , or otherwise communicated to electronic device 170 in any manner that electronic device 170 is capable of receiving instructions . electronic device 170 may have a communication device 330 for communicating with communication network 100 . communication device 330 may be , for example , a modem , an ethernet connection , a fiber optic connection , a radio antenna , or any suitable means for communicating with a network . electronic device 170 may proxy a transport protocol in access network 150 . for example , if the network is a umts network , electronic device 170 may proxy an iu - b or an iu - ps protocol . however , the present disclosure is not limited to implementation in a umts network , and may be deployed in any suitable communication network . the transport protocol employed will vary based on the type of communication network utilized . fig4 depicts an example of cache 400 . cache 400 may be stored in storage 310 of electronic device 170 . for ease of discussion , the exemplary cache 400 is shown divided into sections 402 - 420 , each section representing an equal amount of storage space . cached objects 440 and 450 are present in the cache . objects 440 and 450 represent data that has been recently requested by user device 160 . cached objects 440 and 450 may represent any type of data than can pass through the network . for example , if user device 160 has requested a web page from the world wide web , the request may be forwarded to core network 110 , which may locate the web page on storage repository 114 . the web page may consist , for example , of two elements , an html document 440 and an image present in document 450 . these elements will be referred to as “ objects .” core network 110 may route these objects 440 and 450 back through access network 150 towards user device 160 . as the data passes through intermediate service platform 180 , intermediate service platform 180 forwards this data to electronic device 170 to be cached . alternatively , cache 400 may be maintained directly on intermediate service platform 180 . in the present example , cache 400 is maintained on electronic device 170 , which is shown separately from the intermediate service platform 180 for ease of discussion . because electronic device 170 ( depicted in fig3 ) maintains cache 400 storing objects 440 and 450 , future requests for the web page that objects 440 and 450 represent may be intercepted at intermediate service platform 180 ( fig2 ). these future requests may come from user device 160 ( fig2 ), or any other user device in access network 150 ( fig2 ). the electronic device 170 ( fig3 ) will determine whether objects 440 and 450 are still up to date using any of a number of methods . for example , some objects carry a “ time - to - live ” ( ttl ) tag that specifies how long the object will be considered valid before it becomes out - of - date or “ stale .” alternatively , a user device may specify when an object should be forcefully refreshed in cache 400 . other conditions that may indicate that an object is out - of - date will be discussed in more detail in relation to fig6 . if the cached objects 440 and 450 are still up to date , then cached objects 440 and 450 may be provided back to the requesting user device , thus preventing the need for a request to be fulfilled through core network 110 . the cache may be maintained by specifying cache replacement policy statements . these cache replacement policy statements may define cache replacement policy actions to be taken if certain conditions are met . cache replacement policy actions may be applied to each data object in cache 400 , or may be applied to a subset of the objects in cache 400 . for example , the cache replacement policy action may be applied only against objects of a certain object type , or object “ group .” object groups are discussed in more detail below in reference to fig8 . alternatively , multiple cache replacement policy actions may be defined for different object groups . fig5 depicts a flow chart of steps that may be performed in order to manage a cache 400 . in order to manage the cache 400 , the user may write cache management policy statements ( step 510 ). cache management policy statements provide a way to interact with the policy engine in order to define how the cache 400 should be maintained . cache management policy statements may provide a definition of object classes , a set of defined policy statements including policy rules , policy condition definitions , object keys , policy condition threshold values , policy actions , and , optionally , policy action arguments . each of these elements will be discussed in more detail below . cache management policy statements may be taken together to define a cache management policy ( step 515 ), which may be received by , and stored on , electronic device 170 ( step 520 ). alternatively , the cache management policy statements or the cache management policy may be stored elsewhere . fig6 depicts steps that may be performed by a user in order to define a cache management policy statement that specifies the details of how to manage the cache . the user may provide an object class definition that defines targets for policy actions ( step 610 ). the definition groups cached data objects based on their type . multiple different types may be included in a single object class definition . the use of object class definitions allow the application of policy rules against object groups , rather than individual objects . an example of a generic object class definition statement may be : at step 620 , the user may specify a condition to be satisfied and an associated cache management action . a policy action will be taken if the defined condition is met . an example of a generic object class definition may be : a user may use an object key and a threshold value to determine a condition of a network , system , device , or object . an object key is an attribute taken from an object request or response header ( for example , & lt ; object key & gt ;::=& lt ; http / rtsp_request_key & gt ;|& lt ; http / rtsp_response key & gt ;). a threshold value is the value defined to be matched against the key , and may be defined as : at step 630 , the user may provide a policy condition definition . policy condition definitions define a way to evaluate an object key against a specified threshold value . the policy condition definitions may use a relation operator to evaluate the object key against the threshold value . for example , a policy condition definition may look like : at step 640 , the user may establish a policy action . a policy action defines policy enforcement actions to take in the case that the condition from step 630 is satisfied . it may specify a cache algorithm to be applied to an object or object class , or specify an automated cache refresh action . for example , a policy action may appear as : at optional step 650 , a user may specify action arguments . action arguments are an optional part of a cache management policy statement . these arguments modify a policy action , or set a new priority for the policy action , so that some policy actions may take precedence over others . for example , if two policy actions are defined to be taken in response to a certain triggering condition , the policy action with the higher priority should be executed in preference to the policy action with a lower priority . this may mean that the policy action with higher priority is executed before the lower priority policy action , or that the higher priority policy action is executed instead of the lower priority policy action . other parts of a cache management policy statement may include a name for the statement or the name of the policy to which the statement belongs . examples of cache management policy statements follow : after defining the above elements , user 158 might issue a command to transmit this policy statement to electronic device 170 ( step 520 ). alternatively , the user may define several policy statements and transmit them together . for example , the user may define a policy regarding when to refresh images based on the latency of the system in this way : the priority of 2 in the above example indicates that if the first policy and the second policy conflict , the first policy should be applied in preference to the second . further , user 158 may define a policy regarding when to refresh html documents . once the user has defined these three cache management policy statements , the user may package these cache management policy statements together as a cache management policy . if a user 158 later decides to change certain aspects of cache management policy statements that have already been issued , the user 158 may do this by issuing an action argument ( step 525 ). a user may modify policy statements by issuing a new policy statement to overwrite the existing policy statement , or by modifying the existing policy statement through action arguments . when electronic device 170 receives the cache management policy identified above ( step 520 ), electronic device 170 may store the cache management policy and begin monitoring for the triggering conditions identified in the policy ( step 550 ). in the above example , electronic device 170 would begin monitoring access network 150 to determine when the bandwidth available exceeded 100 megabytes per second , and might begin monitoring messages sent over the network to determine when the latency falls below 200 ms . when either of these conditions are met , electronic device 170 may take the action specified in the appropriate policy statement . one having ordinary skill in the art will see that multiple policy statements may be defined for the same object type , and multiple policy statements may be defined for different object types . in this way , an administrator might decide that images , which have a higher cost to cache than html documents , should be proactively refreshed when the network has excess bandwidth . within the object type “ images ,” perhaps the largest images will be refreshed only when network bandwidth rises to a very high level , while smaller images may be refreshed when network bandwidth rises to an intermediate level ( e . g ., images over 10 mb should only be refreshed if network bandwidth is higher than 150 mbps , while images less than 10 mb should be refreshed once the network bandwidth is higher than 90 mbps ). on the other hand , because html documents tend to be less resource intensive to fetch , html documents can wait to be refreshed until their time - to - live tag indicates that they have become stale . fig7 depicts a flowchart of procedures that may be carried out by electronic device 170 ( fig3 ). according to one embodiment , storage 310 ( fig3 ) of electronic device 170 may store executable instructions 312 ( fig3 ) for causing electronic device 170 to proxy a network protocol ( step 710 ). as electronic device 170 receives data running through network 100 ( fig1 ), electronic device 170 ( fig3 ) may build a data object cache 400 . at step 720 , instructions 312 ( fig3 ) may cause processor 320 to receive an object to be cached . at step 730 , the object may optionally be classified into an “ object group .” these object groups will be discussed in more detail below , in reference to fig5 . after a number of requests for data have been fulfilled , cache 400 ( fig4 ) may become filled with data . additionally , some data objects in cache 400 may expire , and thus need to be either re - cached or abandoned . one option for maintaining cache 400 is to simply wait until the cache is full , or until an object that is requested if found to be out - of - date ( or “ stale ”), and apply an algorithm that selects an object from the cache 400 to replace . alternatively , at step 750 , electronic device 170 ( fig3 ) may monitor the data objects in the cache , the properties of the electronic device 170 , or the network . when a certain triggering condition is met , the electronic device 170 may apply an algorithm to select an object in the cache 400 ( fig4 ) for replacement , in response to the triggering condition . these triggering conditions will be discussed in more detail below , with reference to fig9 . step 750 allows for electronic device 170 ( fig3 ) to take proactive action to maintain the cache . for example , instead of waiting for an out - of - date object to be requested , electronic device 170 may monitor network 100 in order to determine when excess bandwidth is available , and update cache 400 ( fig4 ) when network traffic is low . thus , at step 760 a cache replacement algorithm or cache object refresh process may be applied against the data objects in the cache . such an algorithm or process is referred to herein as a “ cache replacement policy action .” some examples of cache replacement policies that may inform cache replacement policy actions are described in detail below . for the algorithms presented below , consider two objects 440 and 450 present in a cache 400 ( fig4 ). examples are provided describing the management of the cache in relation to how each algorithm would choose which of the two objects to replace , once it is determined that an object must be updated . the least recently used ( lru ) algorithm replaces the object that has not been used for the longest time , counting backwards from the present . for example , if object 440 was last requested by a user device 160 at 0 : 20 and object 450 was last requested by a user device 160 at 0 : 40 , lru would replace object 440 . note that it is not necessary that the same user device request the objects ; object 450 might have been requested by a user device other than user device 160 at 0 : 40 , and the same results would follow . the least frequently used ( lfu ) algorithm replaces the object that has been least frequently used over a certain time window . this might be a window stretching back in time from the present ( e . g ., “ over the last five minutes ”) or a window over some other time period ( e . g ., “ from ten minutes ago to five minutes ago ”). the latter option allows the network to ignore certain events — for instance , if there is a spike in requests for a certain kind of data content that is not likely to be repeated . for example , if object 440 was requested twenty times in the last five minutes , and object 450 was requested thirty times in the last five minutes , lru would replace object 440 . the frequency based replacement ( fbr ) algorithm maintains lru ordering but discard an object based on frequency of use ( lru + lfu ). this policy balances the amount of use of an object with the amount of time since usage . the greedy dual size ( gds ) algorithm assigns a cost / size value to objects . for example , the policy may take the object reference count ( the number of times that the object is currently being referenced ) plus the object cost ( a value that reflects how difficult it is to recache or serve the object ) divided by the object size ( e . g ., the size of the object in megabytes ). the greedy dual size + aging ( gds - aging ) algorithm adds a cache age factor to gds . the cache age factor may be , for example , the amount of time that the object has been in the cache since it was originally cached , or since it was most recently refreshed . this allows the policy to minimize the influence of recently popular documents . the size algorithm discards the largest object . instead of choosing an object to refresh , the size algorithm chooses an object to eliminate from the cache . size may be measured , for example , based on the size of the object in megabytes . a similar algorithm is random ( rand ), which selects a random object to be discarded . alternatively , a user or administrator may specify explicit cache object refresh actions . these explicit cache object refresh actions instruct the caching device to collect remote data objects from their original source , refresh cache attributes of certain data objects , discard certain data objects , or substitute administratively - defined cache attribute values for cached object values . fig8 depicts exemplary object groups for use in an illustrative embodiment . for example , object groups include images 800 , such as images in the gif 802 , tiff 804 , jpg 806 , or bmp 808 formats . “ media ” 810 may include 3gp media 812 , mp3 music objects 814 , mp4 multimedia objects 816 , or quicktime movies 818 . examples of html formatted text 820 include htm 822 and html 824 formatted documents . further , it is possible to have user - defined classifications for object groups 830 . such user - defined classifications 830 could be , for example , traffic selectors 832 based on the data object &# 39 ; s origin host , or the ip address of the data packet that contained the data object . additionally , user - defined classifications 830 could include application - layer data types 834 , such as mime data types . fig9 depicts policy conditions for use as metric thresholds or event triggers . the policy conditions may include object metrics 900 that define when to replace or refresh an object based on one or more attributes of the object itself , system metrics 910 that define when to replace or refresh objects based on attributes of the device that the cache is being stored on , or event triggers 920 that replace or refresh cache objects based on the happening of an event external to the caching device . object metrics 900 may include object age metrics 902 , object use metrics 904 , or object attribute metrics 906 . object age metrics 902 may include such attributes as the object local age . object use metrics 904 may include attributes such as object use frequency , object last - used time , object delivery attributes such as early user aborts , and object retrieval time . object attribute metrics 906 may include , for example , object size or object header attributes , such as header tags like age , expires , last - modified / e - tag , date , and cache control . system metrics 910 may include hit / miss rate metrics 912 , the stale object ratio 914 , system resource attributes 916 , or system latency 918 . hit / miss rate metrics 912 may be such attributes as the system &# 39 ; s byte hit rate or object hit rate , or byte miss rate or object miss rate . the stale object ratio 914 represents the ratio of out - of - date or stale objects to the size of the cache 400 . system resource attributes may include the cpu workload of the electronic device 170 , or the available bandwidth of the system . event triggers 920 may include bandwidth events 922 , static date / time windows 924 , or upstream object update notifications 926 . bandwidth events 922 may include dynamic link bandwidth events such as link utilization threshold crossings measured within a certain time period . static date / time windows 924 may include , for example , a defined object refresh period . upstream object update notifications 926 include such events as an inbound notification of origin content change , for example a notification from the core network or a storage repository 114 . the ability of a device located in the access network to predict and observe the availability of excess network resources presents an opportunity to proactively maintain cached object freshness with minimal impact on user data flows . in addition , maintaining the cache at a higher degree of granularity allows for cached objects to be refreshed on a “ per object class ” basis in a dynamic manner . by using user - configured policy definitions , it is possible to define a proactive retrieval and refresh policy . numerous modifications and alternative embodiments of the present invention will be apparent to those skilled in the art in view of the foregoing description . accordingly , this description is to be construed as illustrative only and is for the purpose of teaching those skilled in the art the best mode for carrying out the present invention . details of the structure may vary substantially without departing from the spirit of the invention , and exclusive use of all modifications that come within the scope of the appended claims is reserved . it is intended that the present invention be limited only to the extent required by the appended claims and the applicable rules of law . | 7 |
hereafter , an embodiment of an image forming apparatus and a power control method therefor according to the present invention will be described in detail with reference to the attached drawings . fig1 is a view showing a configuration of the image forming apparatus according to the embodiment of the present invention . the image forming apparatus mainly comprises an image output unit 10 ( a printer unit ) that outputs an original image onto a recording sheet , and an image input unit 11 ( a scanner unit ) that reads data of an original image . moreover , an automatic document feeder 12 is mounted on the top of the image input unit 11 . this image forming apparatus can be operated when a user sets up copy mode etc . via an operation unit 14 . various setting values and a present job condition of the image forming apparatus can be displayed on a display unit 14 b of the operation warning for a serviceman call is displayed when a trouble arises in the image forming apparatus , and a position of a recording sheet stagnated in the apparatus is displayed when a paper jam occurs . the image output unit 10 has sheet feed trays 34 , 35 , 36 , and 37 on which recording sheets are stacked . a user distributes recording sheets to these sheet feed trays 34 , 35 , 36 , and 37 freely according to a paper size . a large - capacity paper deck 15 can be connected the image output unit 10 at the exterior thereof . a recording sheet is conveyed by feed conveying rollers 38 , 39 , 40 , 41 , and 42 driven by a motor ( not shown ) toward a below - mentioned image formation unit . in the image input unit 11 , an original placed on an original platen glass at a top face of the unit is irradiated by a light emitted from a light source 21 that moves in the lateral direction in fig1 . the irradiation light is reflected by the original and its optical image is formed on a ccd 26 via mirrors 22 , 23 , and 24 and a lens 25 . the ccd 26 converts the optical image formed thereon into an electric signal that becomes digital image data . an image conversion processing such as enlargement or reduction is applied to the image data according to a demand of a user , and then , the image to which the image conversion processing has been applied is stored into an image memory ( not shown ). at the time of outputting an image , the image output unit 10 reads the image data stored in the image memory , and reconverts from the digital signal to an analog signal . the image output unit 10 irradiates a laser beam , which is modulated by an optical irradiation unit 27 according to the analog signal , onto a photoconductive drum 31 via a scanner 28 , a lens 29 , and a mirror 30 , so that a beam spot scans on the photoconductive drum 31 . the photoconductive drum 31 has a photoconduction layer that is made of organic photo conductor of its surface , and is driven to rotate at a fixed rotational velocity during an image output job . toner ( not shown ) is adhered to the photoconductive drum 31 from a development unit 33 that is filled by the toner so as to form a visible image on its surface . on the other hand , a recording sheet is carried through a paper carrying path from one of the sheet feed trays 34 , 35 , 36 , and 37 , and passes under the photoconductive drum 31 so as to be coincident with the visible image . the visible image on the photoconductive drum 31 is transferred to the recording sheet by a transferring charging unit 48 . the recording sheet that carries an unfixed visible image ( the unfixed toner image ) is guided to a position between a fixing roller 32 and a pressure roller 43 . the unfixed toner image is melted and fixed on the recording sheet by the fixing roller 32 and the pressure roller 43 , and the recording sheet is ejected outside the image output unit 10 . it should be noted that the image input unit 11 configures a reading unit that reads an image of an original ; the feed conveying rollers 38 , 39 , 40 , 41 , and 42 of the image output unit 10 configure a carrying unit that conveys the recording sheet ; the optical irradiation unit 27 , the scanner 28 , the lens 29 , the mirror 30 , the photoconductive drum 31 , the development unit 33 , and the transferring charging unit 48 configure a transferring unit ( equivalent to an image formation unit ) that transfers an image onto the recording sheet ; and the fixing roller 32 and the pressure roller 43 configure a fixing unit that fixes the transferred toner image to the sheet , respectively . each unit is an operation unit that operates with the power supplied from the power source unit ( not shown ). in this embodiment , the fixing unit is a specific operation unit that is a target of a power control . fig2 is a view showing a configuration of a driving power source circuit of the fixing unit of the ih method that heats the fixing roller 32 . alternating current ( ac ) from a commercial power source 100 roughly branches into two channels in the image forming apparatus . one is an induction - heating power source 101 that is a control power source of the induction heating unit for heating the fixing roller 32 of the fixing unit , and the other is a load power source 106 that supplies power to the carrying unit , the transfer unit , etc . the induction - heating power source 101 mainly consists of a power - switching element tr 1 that is configured by a mos - fet , an induction - heating coil l 1 that is a power load of the circuit , and a flywheel diode d 5 that regenerates the power accumulated in the induction - heating coil l 1 . rectifier elements d 1 through d 4 , which are diodes for rectifying input power of alternating current , are included in the induction - heating power source 101 in the present embodiment . the transformer nf 1 and a capacitor c 1 constitute a noise filter whose constant is set so as to secure sufficient magnitude of attenuation to the switching frequency of the power - switching element tr 1 and to allow the current to pass without attenuation in the power source frequency . when the alternating current input voltage ac_in is applied from the commercial power source 100 , the alternating current input voltage passing through a relay switch rl 1 is rectified by the rectifier elements d 1 through d 4 , and is converted into a pulsating flow . the voltage is applied to the both terminals of the capacitor c 1 through the transformer nf 1 . at this time , the voltage between both terminals of the capacitor c 1 becomes a waveform formed by rectifying the alternating current input voltage . a thermistor 68 is arranged at a position where the surface temperature of the fixing roller 32 can be detected . the output vt corresponding to the detected temperature is inputted into a cpu 105 via an analog - to - digital conversion circuit ( a / d ) 92 . two kinds of detection signals are inputted into the cpu 105 . one is a detection signal of an ac voltage detection circuit 107 that detects a voltage ( a voltage value ) of the ac power source inputted into the induction - heating power source 101 , and the other is a detection signal of an ih current detection circuit 108 that detects a current consumed via the induction - heating power source 101 . the ac voltage detection circuit 107 is an example of a voltage value detection unit . at the time of the regular start - up , the cpu 105 can output an output signal to a power decision circuit 104 so as to start by predetermined power without reference to the temperature detection signal of the thermistor 68 and the signals of the ac voltage detection circuit 107 and the ih current detection circuit 108 . the cpu 105 controls the power decision circuit 104 to keep temperature constant by adjusting the power , when the detection temperature of the thermistor 68 reaches a target temperature . that is , the cpu 105 compares the present surface temperature of the fixing roller calculated from the output vt of the thermistor 68 with a setting value of the heating target temperature , finds a new supplied power value p so that the difference therebetween becomes small , and outputs the signal based on the difference to the power decision circuit 104 . the cpu 105 is connected to a rom 111 and a ram 112 , and stores backup data into these memories , or stores temporarily values of calculations performed inside the cpu 105 . it should be noted that a nonvolatile memory that can hold data even in the power off time is used for the ram 112 . the power decision circuit 104 controls a digital analog ( d / a ) conversion circuit 95 so that the d / a conversion circuit 95 outputs a control signal ( a reference voltage ) vref corresponding to the power value p . the control signal vref is inputted into a pulse frequency modulation ( pfm ) oscillator circuit 102 . the pfm oscillator circuit ( a resonance control circuit ) 102 has a one - shot pulse generator 102 a and a comparator 102 b , and generates a pfm signal corresponding to the control signal vref . via a switch sw 1 , the pfm signal is applied to a point between a gate and a source of the power - switching element tr 1 to drive the switching of the power - switching element tr 1 . accordingly , a drain current id flows and the induction - heating coil l 1 is energized . when a temperature control signal ( the pfm signal ) is inputted into the induction - heating power source 101 for the induction - heating coil l 1 , a high - frequency alternating current power with a frequency from about 20 khz to 100 khz occurs in the output terminals of the induction - heating power source 101 . according to this operation , the induction - heating coil l 1 generates an alternating current magnetic field . the alternating current magnetic field generated in the induction - heating coil l 1 makes the high frequency magnetic flux pass through the fixing roller 32 through a ferrite core , and generates an eddy current in the fixing roller 32 . then , the fixing roller 32 heats itself because the joule &# 39 ; s heat occurs inside the fixing roller 32 . the value of the control signal vref outputted from the power decision circuit 104 determines a duty of the pfm signal generated by the pfm oscillator circuit 102 , and the time to flow a current to the induction - heating coil l 1 . the cpu 105 can calculate the calorific value of the fixing roller 32 and the power consumption based on these numeric values stored in the ram 112 . in the case of the fixing unit , the power consumed by the above - mentioned heating operation is usually from about 200 w to several kilowatts . fig3 is a timing chart showing operations of the resonance control circuit 102 . the resonance control circuit 102 generates a pfm signal that is an output signal of a square wave by comparing a serrate pulse vsaw generated by the one - shot pulse generator 102 a with the reference voltage vref by using the comparator 102 b . the duty of the pfm signal can be changed by changing the reference voltage vref at point 1 and point 2 shown in fig3 . as shown in fig3 , when the reference voltage vref is lowered , the high level ( high ) time of the pfm signal that is an output signal becomes longer , increasing the time to flow a current to the induction - heating coil l 1 , which also increases the temperature of the fixing roller 32 and the power consumption . fig4 is a flowchart showing operation procedures at a time of a start - up of the image forming apparatus . a processing program for these operation procedures is stored in the rom 111 , and executed by the cpu 105 when a user pushes a switch ( a main switch 14 a of the operation unit 14 ) on the image forming apparatus and then the apparatus starts . first , the cpu 105 determines how the image forming apparatus started at the last start - up by determining whether a value of a shutdown flag stored in the ram 112 is zero or not ( step s 1 ). the value of the shutdown flag becomes data showing whether the image forming apparatus started successfully . the value “ 0 ” of the shutdown flag means that the apparatus started successfully at the last start - up . the value “ 1 ” of the shutdown flag means that the apparatus did not start successfully at the last start - up . when the value of the shutdown flag at the end of the last start - up stored in the ram 112 is “ 1 ”, it means that the image forming apparatus did not start successfully , and the cpu 105 ( acting as a mode selection unit ) starts the image forming apparatus in a second mode that is a start - up sequence under an abnormal condition ( step s 7 ). in the second mode , in order to prevent the shutdown by a voltage drop , the electric power that is lower than regular electric power is applied to the fixing unit at the beginning of a start - up . and then , the applied electric power increases up to the regular electric power . the process in the step s 7 will be described later . then , the cpu 105 finishes the process of the start - up . on the other hand , when the value of the shutdown flag is determined to be “ 0 ” in step s 1 , the cpu 105 rewrites the value of the shutdown flag to “ 1 ” ( step s 2 ). and the cpu 105 ( acting as a mode selection unit ) starts the image forming apparatus in a first mode that is a normal start - up sequence ( step s 3 ). in the first mode , in order to shorten a warm - up time , the regular electric power is supplied to the fixing unit from the beginning of the start - up . namely , the time period required to reach the regular electric power from starting to supply the electric power in the second mode is longer than that in the first mode . and the cpu 105 waits until the temperature of the fixing unit reaches the target temperature ( step s 4 ). when the temperature of the fixing unit reaches the target temperature and the start - up of the image forming apparatus is completed in the first mode , the cpu 105 sets the value of the shutdown flag to “ 0 ” ( step s 5 ), and continues the operation of the image forming apparatus ( step s 6 ). that is , the value of the shutdown flag is changed to the data showing that the image forming apparatus started up successfully . then , the cpu 105 finishes the process of the start - up . at the time of the start - up in the first mode in step s 3 , since large electric power is supplied to the fixing unit instantaneously , the image forming apparatus may suddenly shut down at a location where the power source condition is poor etc . in such a case , the value of the shutdown flag stored in the ram 112 still remains as “ 1 ”. therefore , in the next start - up , it will be determined to start up in the second mode in step s 1 , and the image forming apparatus will start in the second mode in step s 7 . fig5 is a flowchart showing start - up operation procedures in the second mode shown in step s 7 of fig4 . when the image forming apparatus starts up in the second mode , the cpu 105 ( acting as a power control unit ) raises a power step n by “ 1 ” ( step s 11 ). it should be noted that an initial value of the power step n is “ 0 ”. first , the cpu 105 raises electric power wf that is supplied to the fixing unit ( referred to as “ fixing electric power ”, hereinafter ) to a power value wfn that is the target power corresponding to the n - th step ( step s 12 ). the cpu 105 determines whether the ac detection voltage vac ( dtc ) at this time is less than a low threshold value vac ( th 1 ) that is a guaranteed operation voltage of the image forming apparatus ( step s 13 ). when the ac detection voltage vac ( dtc ) is less than the low threshold value vac ( th 1 ), the cpu 105 stops the operation of the image forming apparatus and displays a warning showing that a serviceman call is needed on the display unit 14 b ( step s 14 ). then , the cpu 105 returns to the original process . on the other hand , when the ac detection voltage vac ( dtc ) is not less than the low threshold value vac ( th 1 ), the cpu 105 determines whether the ac detection voltage vac ( dtc ) is less than a predetermined threshold value vac ( th 2 ) ( step s 15 ). the predetermined threshold value vac ( th 2 ) is a threshold of a power source voltage used in order to determine the fixing electric power when starting up in the second mode . when the ac detection voltage vac ( dtc ) is less than the predetermined threshold value vac ( th 2 ), the cpu 105 starts the image forming apparatus with the fixing electric power ( the target power ) determined in step s 12 , and determines whether the fixing unit reaches the target temperature ( step s 16 ). in order to determine whether the temperature of the fixing unit reaches the target temperature , the cpu 105 compares the output of the above - mentioned thermistor 68 with the target temperature . when the difference therebetween falls within a predetermined range , the cpu 105 determines that the temperature of the fixing unit reaches the target temperature . the cpu 105 repeats the process in step s 16 to continue giving the target electric power to the fixing unit ( supplies the electric power ) until the fixing unit reaches the target temperature . and when reaching the target temperature , the cpu 105 shifts the mode to a standby mode for waiting until a print start instruction is issued , and continues the operation of the image forming apparatus ( step s 17 ). then , the cpu 105 returns to the original process . on the other hand , when it is determined that the ac detection voltage vac ( dtc ) is not less than the predetermined threshold value vac ( th 2 ) in s 15 , the cpu 105 determines whether the current power step n is “ 4 ” corresponding to the power value wf 4 that enables the start - up in the first mode ( step s 18 ). when the current power step n is “ 4 ”, the cpu 105 determines whether the fixing unit reached the target temperature ( step s 19 ). the cpu 105 repeats the process in step s 19 to continue giving the target electric power to the fixing unit until the fixing unit reaches the target temperature . when reaching the target temperature , the cpu 105 writes the value “ 0 ” to the shutdown flag stored in the ram 112 in order to start in the first mode at the next start - up ( step s 20 ). then , the cpu 105 shifts the mode to the standby mode for waiting until a print start instruction is issued in step s 17 . on the other hand , when it is determined that the current power step n is not “ 4 ” in step s 18 , the cpu 105 gives electric power to the fixing unit during a predetermined period δt ( step s 21 ). and the cpu 105 returns to the process in step s 11 , raises the power step by “ 1 ”, and shifts to a target power of the next step . fig6 , fig7 , and fig8 are timing charts that show examples of a relationship between the fixing electric power wf and the detection voltage vac ( dtc ) detected by the ac voltage detection circuit 107 when the image forming apparatus is started in the second mode . that is , when the apparatus has shut down for a certain reason at the time of the start - up in the first mode , at the next start - up , the apparatus starts up in the second mode in which an increasing rate of the fixing electric power is mild . the charts show the relationships between the fixing electric power wf and the detection voltage vac ( dtc ) when the apparatus starts in the second mode . in the second mode , the fixing electric power wf increases in stages using the power values wf 1 through wf 4 . here , it is assumed that the power value wf 1 is the minimum operating power of the image forming apparatus and the power value wf 4 is the fixing electric power supplied at the time of the start - up in the first mode . although the present embodiment shows the case where the fixing electric power increases in stages in the second mode , it may vary continuously . although the present embodiment changes the fixing electric value wf in four steps to the power value wf 4 , the number of steps is not limited to four steps , it may be changed in any steps . the predetermined threshold value vac ( th 2 ) of the power source voltage is set to be higher than the low threshold value vac ( th 1 ) in which the operation guarantee of the image forming apparatus becomes impossible due to a source voltage drop . in fig6 , at the start - up in the second mode , the fixing electric power wf increases in stages up to the power value wf 4 every time the predetermined period δt elapses ( time from tstart 1 to tstop 1 ). and since the ac detection voltage vac satisfies a formula ( 1 ), the image forming apparatus operates with the power value wf 4 . in this case , setting the value “ 0 ” in the shutdown flag stored in the ram 112 after the completion of the start - up with the power value wf 4 , the apparatus can be started in the first mode at the next start - up . therefore , when the source voltage drops temporarily , the start - up in the second mode does not repeat many times . in fig7 , at the start - up in the second mode , the fixing electric power wf increases in stages up to the power value wf 3 ( time from tstart 2 to tstop 2 ). and the ac detection voltage vac satisfies the formula ( 2 ). in this case , it is impossible to start the image forming apparatus in the first mode . however , since it is possible to start the image forming apparatus with the power value wf 3 , the start - up time is extended as compared with the first mode ( tstop 2 & gt ; tstop 1 ), which enables to start up the image forming apparatus . in fig8 , when the fixing electric power wf increases to the power value wf 1 in the second mode ( time from tstart 3 to tstop 3 ), the ac detection voltage vac comes to satisfy a formula ( 3 ) in this case , when the image forming apparatus starts with the power value wf 1 that is the minimum operating power required for starting the apparatus , the ac detection voltage vac ( dtc ) becomes less than the low threshold value vac ( th 1 ) in which the operation guarantee of the image forming apparatus is impossible . in this case , since the minimum operating power for the image forming apparatus cannot be obtained at the time of the start - up , the image forming apparatus stops the operation , prohibits a start - up on and after the next time , and displays a serviceman call on the display unit 14 b . as described above , according to the present embodiment , when the image forming apparatus has shut down for a certain reason at the time of the start - up in the normal first mode , at the next start - up , the apparatus starts up in the second mode in which an increasing rate of the electric power is mild . accordingly , the causes of the shutdown can be divided . the causes can be divided into the following cases : ( a ) the power source capacity is enough , and the apparatus can start up in the normal first mode ; ( b ) the power source capacity is small , but the electric power can be supplied so that the apparatus can operate ; and ( c ) the power source capacity is small , and the electric power stops because the operation of the apparatus cannot be guaranteed . this division enables to operate the apparatus with grasping the operating environment of the apparatus . therefore , the image forming apparatus can operate with reliability and the down time can be shortened . at the same time , it becomes easy to search a cause at the time of a halt . in the above case ( c ), since a message describing the content of the case ( c ) is displayed , a user can easily know that the image forming apparatus cannot be started , and a user can notify a serviceman promptly . the message urges a user to check the circumstance of branch and the power source voltage , and make it possible for a user to change the power source arrangement into a suitable arrangement . accordingly , a possibility of a halt at the next start - up can be reduced . it should be noted that a message describing the content of the case ( b ) can be displayed to inform a user of the operation condition in the above case ( b ). according to the embodiment , the electric power supplied to the induction - heating coil l 1 of the fixing roller 32 that needs much power can be controlled . the electric power supplied to the induction - heating coil l 1 of the fixing roller 32 can be reduced according to the voltage drop of the alternating current ( ac ) voltage from the commercial power . therefore , the image forming apparatus can be started without resulting in a halt even in the installed location where the power source condition is poor . while the present invention has been described with reference to exemplary embodiments and it is to be understood that the invention is not limited to the disclosed exemplary embodiments . the scope of the following claims is to be accorded the broadest interpretation so as to encompass all such modifications and equivalent structures and functions . for example , although the above - mentioned embodiment shows the case where the load is the fixing unit , the present invention is not limited to this . that is , the load may be another unit that needs large electric power in the image forming apparatus , or various attachment devices that are connected to the image forming apparatus and whose powers are supplied by the image forming apparatus . further , the present invention can be applied to not only a system that consists of a plurality of devices , but also an apparatus that consists of one device . the image forming apparatus may be a multifunctional printer ( mfp ) that has a printing function , a copying function , and a scanning function , etc . ; a facsimile machine that has a printing function ; or a single functional printer . although the above - mentioned embodiment shows the case where the printing method of the image forming apparatus is an electro photography method , the present invention is not limited to the electro photography method . that is , the present invention can be applied to various methods , such as an inkjet method , a thermal transfer method , a thermal method , an electrostatic method , and a discharge - breakdown method . further , the sheet is not limited , and a paper medium , an ohp sheet , a thick paper , etc . can be used . this application claims priority from japanese patent application no . 2008 - 214100 , filed on aug . 22 , 2008 , which is hereby incorporated by reference herein in its entirety . | 6 |
in an embodiment of the present invention , when an active os ( os operating on an active vm ) is operating normally , more resources are allocated to the active os than to a standby os . the active os calculates resources required and allocates them each time an application program is initiated , and if resources owned by it are insufficient , contacts a virtual machine monitor for resource extension . upon detection of abnormal stop of the active os , the system deallocates resources having been used by the active os and allocates the resources to a standby os ( os operating on a standby vm ). furthermore , the system keeps track of uses of a main storage area allocated to the active os ( active vm ), and when an application program operating on the active os stops abnormally , reallocates the main storage area to the standby os ( standby vm ) according to uses kept track of , thereby to reexecute the application program on the standby os . hereinafter , an embodiment on a method of allocating resources in a virtual machine of the present invention will be described in detail with reference to the accompanying drawings . [ 0032 ] fig2 shows a hardware structure of a virtual machine system ( vms ) in the present invention . a virtual computer system 50 is a computer system that comprises one or more cpus 10 - 1 and 10 - 2 , a main storage 20 , and an i / o control unit 40 . a communication controller 60 and an auxiliary memory 70 are connected to the virtual computer system 50 . the cpus 10 are processors that interprets and executes instruction words stored in the main storage 20 . the main storage 20 is a storage unit for supplying programs and data to the cpus 10 - 1 and 10 - 2 . the i / o control unit 40 is a unit for transferring programs and data between the auxiliary memory 70 or communication controller 60 and the main storage 20 . the auxiliary memory 70 is a nonvolatile recording device that stores programs and data . the communication controller 60 is a control device for transferring data to other computer systems over communications . in the virtual computer system 50 , for the purpose of management by software or firmware to manage virtual machines , the main storage 20 is split into a main storage area for active os ( active os area ) 30 - 1 , a main storage area for standby os ( standby os area ) 30 - 2 , a main storage area of virtual machine monitor 30 - 3 for managing the virtual computer system 50 , and a not - used area 30 - 4 . [ 0035 ] fig1 shows the software structure of a virtual machine system ( vms ) of the present invention . in a virtual computer system 50 , the following software modules are operating : a virtual machine monitor 200 for managing resources of the computer system ; an active operating system ( active os ) 100 - 1 controlling the execution of application programs a 400 - 1 and b 410 - 1 , based on resources allocated by the virtual machine monitor 200 ; and a standby operating system ( standby os ) 100 - 2 that allocates resources to an application program a 400 - 2 or b 410 - 2 stored in an auxiliary memory 70 and executes them when the active os fails . the active os 100 - 1 and the standby os 100 - 2 may or may not be an os of a same strain . where the active os 100 - 1 and the standby os 100 - 2 are oss of a same strain , the application programs a 400 - 1 and a 400 - 2 maybe the same ( at least programs to perform a similar application ). likewise , the application programs b 410 - 1 and b 410 - 2 may be the same ( at least programs to perform a similar application ). in short , the application program a 400 - 2 is a hot standby program of the application program a 400 - 1 , and the application program b 410 - 2 is a hot standby program of the application program b 410 - 1 . the virtual machine monitor 200 manages resources of the virtual computer system 50 . to be more specific , the virtual machine monitor 200 manages the active os 100 - 1 and the standby os 100 - 2 operating on the virtual machine system ; assigns cpus 10 - 1 and 10 - 2 for executing the application programs a 400 - 1 and b 400 - 1 ; manages a main storage 20 in a specific assignment unit ; and manages an area for active os 30 - 1 , an area for standby os 30 - 2 , an area of virtual machine monitor 30 - 3 , and a not - used area 30 - 4 . the cpu 10 - 1 and 10 - 2 under control of the virtual machine monitor 200 may be assigned by a method as described in japanese unexamined patent publication no . hei 9 - 26889 . namely , an os has means , according to a change of external conditions , for issuing a command specifying a specific vm to change the amount of processor assignment , and a virtual machine control program changes the amount of processor assignment of the specified vm . in the present invention , the virtual machine monitor 200 has an os fault detection routine 210 that detects an abnormal condition of the active os 100 - 1 and the standby os 100 - 2 , which are operating systems operating on the virtual computer system 50 . the os fault detection routine 210 detects faults in a manner that detects that the cpu 10 - 1 or 10 - 2 is in a specific state ( e . g ., processing stalls ) during execution of the active os 100 - 1 or standby os 100 - 2 . the active os 100 - 1 has : a resource allocation request processing routine 110 - 1 that calculates resources required to execute the application program a 400 - 1 and asks the virtual machine monitor 200 for resource extension if resources owned by the active os 100 - 1 are insufficient ; a fault level notification routine 120 - 1 that , when a fault occurs in the application programs a 400 - 1 and b 410 - 1 , notifies the virtual machine monitor 200 of the level of the fault ; a resource disconnection routine 130 - 1 that deallocates resources owned by the active os 100 - 1 upon a request from the virtual machine monitor 200 ; and a resource engaging routine 140 - 1 that enables resources allocated to the active os 400 - 1 upon a request from the virtual machine monitor 200 . likewise , the standby os 100 - 2 also has : a resource allocation request processing routine 110 - 2 ; a fault level notification routine 120 - 2 ; a resource disconnection routine 130 - 2 ; and a resource engaging routine 140 - 2 . first , a description will be made of a method of allocating a resource to the application program a 400 - 1 by the resource allocation request processing routine 110 - 1 that requests resource extension of the active os 100 - 1 . as a concrete example of the method , a method is described which allocates an area 80 - 1 used by the application program a to the application program a 400 - 1 from an area of the main storage 20 . although the description uses the main storage 20 as an example , the auxiliary memory 70 can also be treated as a resource . [ 0044 ] fig3 shows a system structure when the application program a 400 - 1 is operating on the active os 100 - 1 . the area 80 - 1 used by the application program a , which is a part of a main storage area on the main storage 20 , allocated for management of the active os 100 - 1 , stores a program , data , and dynamic execution information of the application program a 400 - 1 . a resource management table 90 is a table for managing the purposes of using the main storage 20 and is in an area 30 - 3 managed by the virtual machine monitor . in allocating the area 80 - 1 used by the application program a , for execution of the application program a 400 - 1 , the active os 100 - 1 , from job control parameters , system parameters , user &# 39 ; s environment variables , and other information , detects that the application program a 400 - 1 is a job ( hereinafter simply referred to as a hot standby job ) that operates on the active os 100 - 1 and is switched to the application program a 400 - 2 on the standby os 100 - 2 when a fault occurs , calculates a resource amount used by the application program for execution , and compares it with a resource amount owned by the active os 100 - 1 to determine whether resources are sufficient . if resources are sufficient , the active os 100 - 1 notifies the virtual machine monitor 200 of what resource is in use , through the resource allocation request processing routine 110 - 1 . where resources are insufficient , the active os 100 - 1 obtains a new resource from the virtual machine monitor 200 through the resource allocation request processing routine 110 - 1 . by the resource allocation request processing routine 110 - 1 , the virtual machine monitor 200 records the area 80 - 1 used by the application program a 400 and information for managing it in the resource management table 90 . the virtual machine monitor 200 may allocate resources to the active os 100 - 1 using the method described in japanese unexamined patent publication no . hei 6 - 110715 . the japanese unexamined patent publication no . hei 6 - 110715 describes that an area at a high - order address of a guest area of the vm to be extended is placed into an unconnected state before being placed into a connected area of the vm , thereby to extend an area . the active os 100 - 1 can allocate resources to the application program a 400 - 1 in a manner that splits and allocates the resources from the area 80 - 1 used by the application program a . the active os 100 - 1 operating on a conventional virtual machine splits and manages resources allocated by the virtual machine monitor 200 , and allocates apart of the resources during execution of the application program a 400 - 1 . specifically , the application program a 400 - 2 stored on the auxiliary memory 70 is expanded onto an area 30 - 1 allocated to the os 100 - 1 and executed by the cpus 10 - 1 and 10 - 2 . the active os 100 - 1 in the present invention , before executing the application program a 400 - 1 , determines whether resources owned by the active os 100 - 1 are sufficient , and if they are insufficient , asks the virtual machine monitor 200 for resource extension . the virtual machine monitor 200 arbitrates resource allocation between virtual machines , and as a result , if the active os 100 - 1 is allowed for resource extension , adds a part of resources owned by the virtual machine monitor 200 to the active os 100 - 1 . thereby , the application program a 400 - 1 obtains a suitable resource on the active os 100 - 1 and becomes executable . [ 0049 ] fig4 shows the structure of the resource management table 90 and state transition of the table during application program execution . state a designates a state in which no application program is executed ; state b designates a state in which the application program a , a hot standby job , is executed ; and state c designates a state in which the application program b , not a hot standby job , is executed in the state b . the resource management table 90 comprises entries 91 - 1 , 91 - 2 , 91 - 3 , and 91 - n in each of which an area name for identifying an individual area , used size , owner , and resource switching destination in abnormal status are recorded . not all application programs are continued to execute in a standby system when a fault occurs in an os . only predetermined , important application programs are continued to execute under control of the standby os . if a fault occurs in an os , processing other than predetermined application programs is stopped , and areas used for the processing are returned to a virtual machine monitor . if a fault occurs only in an important application program , the application program is continued to execute under control of a standby os and other application programs are continued to execute under control of an active os . in a change from state a to state b , 160 mb is initially allocated to the active os 100 - 1 , and when the hot standby application program a 400 - 1 using a resource of 128 mb is executed , in the resource management table , 128 mb is subtracted from the used size of the active os , and a switching destination os is defined for the hot standby application program . in a change from state b to state c , the active os 100 - 1 holds no sufficient resources to execute the application program b . therefore , the active os 100 - 1 issues a resource allocation request to the virtual machine monitor 200 to secure an area not used in the virtual machine system , thereby to run the application program b on the active os 100 - 1 . the target system to change in abnormal status indicates to which area to reallocate the resources of the active os 100 - 1 or the application program a 400 - 1 when they stop abnormally . next , referring to fig5 the resource engaging routine 140 - 2 is described using , as an example , a processing flow when the active os 100 - 1 fails . the virtual machine monitor 200 detects a fault of the active os 100 - 1 by the os fault detecting routine 210 ( step 501 ), determines where to reallocate a resource owned by the active os 100 - 1 by referring to entries 91 - 1 , 91 - 2 , . . . , 91 - n of the resource management table 90 ( step 502 ), and issues a resource exchange request to the active os 100 - 2 according to a target system to change in abnormal status specified in the resource management table 90 ( step 503 ). upon receipt of the request , the standby os 100 - 2 attaches the added resource into os resources by calling the resource engaging routine 140 - 2 ( step 504 ), and reports the completion of attaching the resource to the virtual machine monitor 200 ( step 505 ). upon receipt of the report , the virtual machine monitor 200 updates owners of the entries 91 - 1 , 91 - 2 , . . . , 91 - n of the resource management table 90 ( step 506 ), and requests the standby os 100 - 2 to start the application program a 400 - 2 in the areas where application programs were operating ( step 507 ). thereby , the standby os 100 - 2 can execute the application program a 400 - 2 with sufficient resources . in this embodiment , the resource engaging routine 140 - 2 of the active os 100 - 2 indicates that the amount of main storage available to the operating system has increased , and can be realized by enabling main storage addresses having been so far disabled . next , referring to fig6 the fault level notification routine 120 - 1 and the resource disconnection routine 130 - 1 are described using , as an example , a processing flow when only the application program a 400 - 1 operating on the active os 100 - 1 fails . the active os 100 - 1 detects a fault of the application program a 400 - 1 ( step 601 ), and reports a fault level of the application program to the virtual machine monitor 200 ( step 602 ). the virtual machine monitor 200 evaluates the fault level ( step 603 ), determines where to reallocate a resource owned by the application program a 400 - 1 by referring to entries 91 - 1 , 91 - 2 , . . . , 91 - n of the resource management table 90 ( step 604 ), and requests the active os 100 - 1 to disconnect a resource used by the application program a 400 - 1 ( step 605 ). the active os 100 - 1 calls the resource disconnection routine 130 - 1 to disconnect the resource ( step 606 ) and reports the completion of disconnecting the resource to the virtual machine monitor 200 ( step 607 ). the virtual machine monitor 200 , by referring to entries 91 - 1 , 91 - 2 , . . . , 91 - n of the resource management table 90 , and issues a resource exchange request to the standby os 100 - 2 according to a target system to change in abnormal status of the application program a 400 - 1 ( step 608 ). upon receipt of the request , the standby os 100 - 2 attaches the added resource to os resources by calling the resource engaging routine 140 - 2 ( step 609 ), and reports the completion of attaching the resource to the virtual machine monitor 200 ( step 610 ). upon receipt of the report , the virtual machine monitor 200 updates owners of the entries 91 - 1 , 91 - 2 , . . . , 91 - n of the resource management table 90 ( step 611 ), and requests the standby os 100 - 2 to start the application program a 400 - 2 in the area where the application program was operating ( step 612 ). in the determination of a fault level of the application program a 400 - 1 in the virtual machine monitor 200 , for minor faults from which the active os 100 - 1 can recover by itself , resources are not reallocated and the application program is restarted . even for minor faults from which the active os 100 - 1 can recover by itself , if fault recovery by the active os 100 - 1 is difficult , the application program can be restarted in a short time by switching to the active os 100 - 2 . in this way , according to the present embodiment , a virtual machine system can be provided which can dynamically reallocate resources among plural operating systems . also , a virtual machine system can be provided which can dynamically reallocate resources in units of application programs . furthermore , a virtual machine system can be provided which , where such a serious fault as to disable access to an area used by the active os 100 - 1 occurs , by reserving a small unused area in the virtual machine monitor 200 , can restart the application program on the standby os by disconnecting a part of the disabled resource and adding a part of the unused area . furthermore , a virtual machine system can be provided which , where the computer system can dynamically add resources , by temporarily holding resources in the virtual machine monitor , can add the computer resources without stopping hot standby operation . according to the present invention , resources of a virtual machine system can be distributed among operating systems , so that resources required in the virtual machine system can be decreased . | 6 |
with reference now to the drawings , the lift assembly comprises a flat , rigid platform 1 made up of a pair of parallel side elements 2 , transverse end plates 3 , rigid mesh 4 extending between the end plates , and a pair of spaced vertical pivot plates 5 extending up from the front or outer end of each side element . the platform must support the weight of the user , so it is usually of steel construction . a locking plate 6 extends along the front edge of the front end plate 3 and is pivotally attached to side elements 2 by pivot members 7 . this locking plate 6 can be rotated upwardly to an upstanding position , as shown in fig2 to prevent the user &# 39 ; s wheel chair from rolling off the platform 1 . the platform 1 is pivotally connected to the vehicle 8 by a pair of spaced , parallelogrammatic - like linkages 9 . each linkage 9 comprises a pair of vertically spaced , outwardly extending , parallel arms 10 . at their front ends , the arms 10 are pivotally attached to the pivot plates 5 ; at their rear ends , they are pivotally attached to a link 11 , which , in turn , is pivotally attached at its upper end to a member 12 forming part of the mounting frame 13 . it will thus be noted that the corners of each linkage are pivotally connected , the front link 5 of each linkage 9 is rigidly fixed to the platform 1 , and the rear link 11 is pivotable relative to the vehicle 8 . all of these pivot connections are about axes which are substantially parallel to the vehicle floor 14 . a mounting frame 13 is attached to the vehicle 8 in its doorway 16 . the frame 13 comprises forwardly and rearwardly extending horizontal plates 17 , 18 connected by a vertical plate 19 . the step - like frame 13 is adapted to fit into the step well 20 of the vehicle 8 and to be affixed thereto by bolts 21 . a pair of spaced , upstanding standards 22 extend upwardly from the two edge portions of the mounting frame 13 . each standard 22 carries a pulley 23 at its upper end and a kick - out member 24 intermediate its ends . with reference to fig6 each kick - out member comprises a housing 25 having a piston 26 . the piston 26 extends through the standard 22 into the housing 25 . a washer 27 is fixed to its inner end and a spring 28 is disposed within the housing and acts to urge the piston outwardly . a cap 28a retains the spring 28 within the housing 25 . a cable drum 29 is mounted on frame plate 13 . cables 30 extends from the drum 29 , up over the standard pulleys 23 , and then down for securance to the side portions of the rear end of the platform 1 . more particularly , each cable 30 extends under a pulley 31 , rotatably mounted on the rear end portion of the platform side element 2 , and along the side element to an eye element 32 attached to the locking plate 6 , to which it is fastened . the cable drum 29 is driven in either direction by an electric motor 33 powered by the vehicle battery 34 . more particularly , the output shaft 35 of the motor 33 drives a sprocket 36 which drives the cable drum sprocket 37 through chain 38 . the cable drum 29 can be thereby rotated to payout or reel in the cables 30 . the platform side elements 2 are located between the linkages 9 , so that the platform 1 can pass between the latter . extending outwardly from each side element 2 are tabs 39 which function to associate the platform 1 and linkages 9 together in a manner to be described . a hinge plate 40 is pivotally attached to the frame plate 18 so that it may rotate about its inner edge . it will be noted from fig2 that the platform &# 39 ; s inner end plate 3 is spaced from the pivot connection with the vehicle 8 . this spacing permits the platform 1 to clear the step well 12 when it is being lowered or raised . the hinge plate 40 functions to bridge the gap between the edge of the vehicle floor 14 and the platform 1 to permit the user to wheel himself on or off . a pair of springs 41 connect the hinge plate 40 and the mounting plate 17 and function to cause the hinge plate to follow the platform 1 . a follower arm 42 is pivotally connected to one of the linkages 9 , by the arm 43 , and to the mounting frame 13 . this follower arm 42 carries a control switch 103 , so that it is within reach of the user during raising and lowering operations . in operation , the platform 1 is movable between three positions : an upstanding stored position illustrated in fig3 ; an intermediate position shown in fig2 wherein its upper surface is generally substantially level with the floor of the vehicle 8 ; and a third position shown in fig1 wherein the platform 1 rests on the ground . in the stored position , the linkages 9 and platform 1 are connected for conjoint movement by the tabs 39 . the follower arm 42 is folded alongside one linkage 9 . the link 11 is disposed in a plane parallel to the floor 14 of the vehicle 8 . the linkages 9 , platform 1 and follower arm 42 are slightly inwardly slanted , to accomodate the curved form of the doors of the vehicle , and rest against the pistons 26 of the kick - out members 24 . the pistons 26 are displaced inwardly and compress the springs 28 . although not shown , the platform pulleys 31 are located just beneath and near to the standard pulleys 23 ; the cables 30 are tight and press the platform 1 and linkages 9 against the kick - out members 24 . when the doors 44 of the vehicle 8 are open and the cables 30 are payed out , in a manner to be described below , the kick - out springs 28 force the platform 1 , linkages 9 and follower arm 42 to rotate together outwardly about the pivots 45 , 46 , 47 until they are over - balanced and are capable of rotating by gravity . as the cables 30 continue to unwind , the links 11 rotate about the pivot 46 and move from the horizontal position shown in fig3 to the vertical position shown in fig2 . the linkages 9 and platform 1 , which are connected to the links 11 , also rotate conjointly to assume the position shown in fig2 i . e . level with the vehicle floor 14 . the follower arm 42 , which is also connected to the link 11 , follows the linkages 9 and platform 1 . the drive motor 33 is stopped , in a manner to be described , when the platform 1 is level with the vehicle floor 14 . the user then wheels himself on to the platform 1 . the locking plate 6 , in the upstanding position , limits the outward movement of the wheel chair . the user actuates the control switch 103 to re - activate the drive motor 33 and commence paying out more cable 30 . because the vertically positioned links 11 are blocked from further rotation about the pivot 46 , the platform 1 begins to rotate about its front pivot connections 48 , 49 with the front of the linkage 9 . when the platform 1 contacts the ground surface 50 , the tension in the cables 30 is relieved due to the weight of the platform and occupant being carried by the ground surface rather than the cables . the springs 51 which were previously stretched , pull the cables 30 through the pulleys 23 , 31 and thus allow the locking plate 6 to rotate to the ground . this locking plate 6 is attached to the now loose end of the cables 30 with the cable tension being supplied by the springs 51 . as the cables 30 move due to contraction of the springs 51 , a point is reached where a means is activated to stop the paying out of cable from the drum 29 . when the unit is to be operated in the reverse manner , that is to go from the ground position ( deployed position ) to the intermediate position , the user activates the control switch 103 which activates the drive system to commence retrieval of the cables 30 . as the cables 30 are retrieved , the springs 51 are extended until the cables rotate the locking plate 6 into its upward position . the cables 30 then , being relatively inextensible , prevent further extension of the springs 51 and , through interaction with the pulleys 23 , 31 begin to lift the platform 1 from the ground surface . because the vertically positioned links 11 are maintained in a vertical position by the stop of the vehicle frame 13 , the platform 1 is maintained in a substantially horizontal position while it is lifted by the cables 30 from the ground position to the intermediate position substantially level with the vehicle floor 14 . when the platform 1 is in the intermediate position , means are activated to stop the retrieval of cable . at this point an occupant would wheel himself into the vehicle 8 . another control switch 102 is then activated interior of the vehicle 8 to resume retrieval of the cables 30 . this results in lifting the platform 1 further until the tabs 39 on the platform 1 interconnect the platform with the linkages 9 . the platform 1 and linkages 9 then move as a unit , both rotating about the pivot 46 until they nest against pistons 26 of kick - out members 24 . at that point , a means is automatically activated to prevent further retrieval of the cables 30 . also , means are automatically activated to close the doors 44 of the vehicle 8 . in the preferred embodiment , the invention is fitted with three manually activated control switches 101 , 102 , and 103 . switch 101 , which is outside the vehicle is preferably key operated and has three positions 101a , 101b and 101c . in the 101b position , which is the normal position of switch 101 , the switch is off . in the 101a position , switch 101 completes a circuit which controls the opening of the vehicle doors 44 and the deployment of the platform 1 from the stored position to ground level . in the 101c position , switch 101 completes a circuit which controls the raising of the platform 1 from ground level to the stored position and the closing of the vehicle doors 44 . switch 102 , which is inside the vehicle , is preferably a toggle switch with three positions : 102a , 102b , and 102c . in the 102b position which is the normal position of switch 102 , the switch is off . in the 102a position , switch 102 completes a circuit which controls the opening of the vehicle doors 44 and the deployment of platform 1 from the stored position to a position substantially level with the vehicle floor . in the 102c position , switch 102 completes a circuit which controls the raising of the platform 1 from either the ground position or the position level with the vehicle floor to the stored position and the closing of the vehicle doors 44 . switch 103 is preferably a toggle switch which is mounted on the follower arm 37 and has three positions : 103a , 103b , and 103c . in the 103b position which is the normal position of switch 103 , the switch is off . in the 103a position , the switch 103 completes a circuit which controls the deployment of the platform 1 from a position substantially level with the vehicle floor to the ground level . in the 103c position , switch 103 completes a circuit which controls the raising of the platform 1 from ground level to a position substantially level with the vehicle floor . the controlling of the sequencing of deployment and raising of the platform 1 and the opening and closing of the doors 44 is preferably performed by a number of mechanically activated limit switches or microswitches . in the preferred embodiment of the invention , there are a total of 10 limit switches with each limit switch having two positions . limit switch 110 having positions 110a and 110b and limit switch 111 having positions 111a and 111b are located on bracket 52 and are switched by the movement of hinge plate 40 . limit switch 112 having positions 112a and 112b is located on standard 22 and is switched by deployment and retraction of the platform 1 . limit switch 113 with positions 113a and 113b is located on the platform 1 and is switched by slackening or tightening of the lift cable 30 . limit switches 115 with positions 115a and 115b , 118 , with positions 118a and 118b , and 119 with positions 119a and 119b are located on the front door motor 33 and are switched by rotation of cams on the motor output shaft . limit switches 114 with positions 114a and 114b , 116 with positions 116a and 116b , and 117 with positions 117a and 117b are located on the rear motor and are switched by rotation of cams on the motor output shaft . the reversible front door motor , 130 , is energized through relay 131 containing a coil 131a having contacts , 132 , 133 , 134 , 135 , 136 , 137 , 138 and 139 . the reversible rear door motor 140 is energized through relay 141 containing coil 141a and having contacts 142 , 143 , 144 , 145 , 146 , 147 , 148 , and 149 . the reversible lift motor 33 is energized in the platform deploying rotation by solenoid 151 and in the platform raising rotation by solenoid 152 . terminal strips 121 , 122 , 123 , 124 , 125 and 126 are provided to interconnect conductors in the circuits . the vehicle battery 34 with positive terminal 128a and negative terminal 128b is connected through fuse 127 into the control circuits and door motors . to deploy the platform from outside the vehicle , switch 101 is switched from the 101b to the 101a position which energizes terminal strip 126 . current is then directed through limit switch 108 which is in the 108a position . this energizes relay 131 at connection 135 and 136 which actuates the front door motor 130 through connections 132 and 139 or relay 131 . as the motor 130 rotates and the door opens , limit switch 115 is switched from 105a to 105b position by a cam on motor 130 . when limit switch 105 is switched to 105b , current passes through limit switch 116 which is in the 116a position . this energizes relay 141 at connection 146 and 145 which starts the rear motor 140 operating through connections 142 and 149 . at this point in time , both doors are opening with the front door being almost open and the rear door just starting to open . when the front door is open , a cam on motor 130 switches limit switch 118 from the 118a to the 118b position which shuts off power to the front door opening motor 130 and thus holds the door in the open position . when the rear door is open , a cam on motor 140 switches limit switch 116 from the 116a to the 116b position which shuts off power to the rear door opening motor 140 thus holding the rear door in the open position . when limit switch 116 switches to the 116b position , it energizes terminal strip 125 which feeds current to limit switch 113 which is at that time in the 113b position due to the cable tension of the lift cable on the platform . due to limit switch 113 being in the 113b position , current is fed to terminal strip 123 and from there to solenoid 152 , which activates the solenoid thus energizing lift motor 150 across 150a and 150b . the lift motor 150 then feeds out cable , thus allowing the platform to rotate from the stored position to the intermediate position and to be lowered to the ground . when the platform contacts the ground , the springs switch limit switch 113 from 113b position to 113a position which results in cutting of the current to the motor 150 and thus stops the motor from paying out more cable . from the foregoing , it is seen that first mechanical and electrical means , carried by the vehicle , are provided which may be actuated to sequentially open a door at the vehicle doorway , rotate the platform from the stored position to the intermediate position , and lower the platform from the intermediate position to the ground position . to close the platform or to raise the platform from the ground position into the stored position and close the doors can be done from outside the vehicle by the use of switch 101 . in order to raise the platform , switch 101 is switched from 101b position to 101c position which energizes terminal strip 124 . current then passes through limit switch 112 which is in the 112a position . this energizes terminal strip 122 which feeds power to solenoid 151 which results in activating the lift motor 150 across terminals 150c and 150b . the lift motor 150 then retrieves cable until the platform is folded up in the vertical position . when the platform is in the vertical position , it contacts limit switch 112 on the standard and switches 112 from the 112a to the 112b position . this tops lift motor 150 and switches the current to 114 which is in the 114a position . power is then directed to the relay 141 to connections 143 and 148 . this results in energizing coil 141a which switches internal connections from 145 to 144 and from 146 and 147 . this energizes the rear door closing motor 140 in reverse with the motor being energized across terminals 142 and 149 of relay 141 . this starts closing the rear door . when the car door is closed partway , the inner cam on motor 140 switches limit switch 117 from 117a position to 117b position which then directs current through limit switch 119 which is in the 119a position . current is thus directed through limit switch 119 to the relay 131 across terminals 133 and 138 which results in energizing coil 131a in relay 131 which results in switching internally from 135 to 134 and from 136 to 137 . this energizes the front motor 130 across relay terminals 132 and 139 and since the motor is now energized in reverse , it starts closing the front door . when the rear door is closed , the cam on motor 140 switches limit switch 114 to the 114b position to shut off power to motor 140 . when the front door is closed , the cam on front motor 130 switches limit switch 119 to the 119b position to shut off power to the front motor 130 . at this point , the platform is completely nested in the stored position , both doors are closed , and the circuitry is completely de - energized . it will be noted that second mechanical and electrical means , carried by the vehicle , are thus provided which may be actuated to sequentially lift the platform from the ground position to the intermediate position , rotate it from the intermediate position to the stored position and close the vehicle door . using the switch inside the vehicle , switch 102 , the platform can be deployed from the stored position down to the horizontal intermediate position or it can be raised from either the intermediate position to the stored position or from the ground position to the stored position . to deploy the platform from the stored or nested position with the doors closed down to the horizontal position ready for loading , switch 102 is switched by an occupant who is in the vehicle from the 102b position to the 102a position . this energizes terminal strip 126 which directs current through limit switch 118 which is in the 118a position at this time . this energizes relay 131 at contacts 135 and 136 to actuate the front drive motor 130 through relay contacts 132 and 139 . as the front door opening motor 130 rotates and the front door opens , limit switch 115 which is normally in the 115a position is switched to the 115b position by a cam on the actuating arm of motor 130 . when limit switch 115 is switched into the 115b position , current is directed through limit switch 116 which is in the 116a position . this energizes relay 141 at contact 145 and 146 which starts the rear motor 140 through relay contacts 142 and 149 . when the rear door motor is started operating , it starts to open the rear door . at this point , both doors are opening with the front door being over half open while the rear door is just starting to open . when the front door is fully opened , the cam on motor 130 switches limit switch 118 to the 118b position thus shutting off power to the front motor 130 and holding the front door in the open position . when the rear door is fully opened , a cam on the rear door opening motor 140 switches limit switch 116 to the 116b position which shuts off power to the rear door motor 140 thus holding the rear door in the open position . when limit switch 116 is switched from 116a to 116b position , it directs current to terminal strip 125 which directs the current through limit switch 113 which is in the 113b position due to the fact that the lift cable is under tension at the time . the current is thus directed to terminal strip 123 which is energized and directs the current to solenoid 152 which activates solenoid 152 thus energizing the lift motor 150 across terminals 105a and 105b which result in the lift motor 150 paying out cable which allows the platform to lower under its own weight until limit switch 111 is switched by the hinge plate . when limit switch 111 is contacted by the hinge plate , it is switched from the 111a position to the 111b position at which point it cuts off current to solenoid 152 and thus de - energizes the lift motor 150 . at this point the switch 102 circuit is not operable to lower the platform further . thus it is seen that third mechanical and electrical means may be actuated to sequentially open the vehicle door and rotate the platform from the stored position to the intermediate position . to raise the platform from the position substantially horizontal with the vehicle floor or from the ground position , switch 102 is switched from the 102b position to the 102c position . this energizes terminal strip 124 which directs current through limit switch 112 which is at that time in the 112a position . this energizes terminal strip 122 which feeds power to solenoid 151 activating solenoid 151 and consequently energizing lift motor 150 across terminals 150c and 150b . this rotates the motor 150 in such a direction to retrieve cable until the platform is folded up in the vertical position . when the platform is folded up in the vertical position , limit switch 122 is switched by the nesting action of the platfrom against the standard with limit switch 112 being switched from the 112a position to the 112b position . this stops the lift motor 150 from retrieving cable and the current is now directed through limit switch 114 which is in the 114a position . this energizes the coil 141a in relay 141 through terminals 143 and 148 . energizing of coil 141a results in switching internally from 145 to 144 and from connections 146 to 147 . this results in energizing the rear door motor 140 across terminals 142 and 149 with the motor being energized in such a way that it operates in reverse and starts closing the rear door . when the rear door is closed partway , the cam on motor 140 switches limit switch 117 from the 117a position to the 117b position which then directs current through limit switch 119 which is in the 119a position to terminals 133 and 138 of relay 131 . this energizes coil 131a of relay 131 which results in internal switching of contacts 135 to 134 and 136 to 137 . this results in energizing the front motor 130 in reverse across terminals 132 and 139 of the relay and starts closing the front door . when the rear door is closed , a cam on motor 140 switches limit switch 114 to the 114b position to shut off power to the rear door motor 140 thus maintaining the door in a closed position . when the front door is closed , a cam on motor 130 switches limit switch 119 from the 119a position to the 119b position thus shutting off power to the front motor and effectively maintaining the front door in a closed position . at this point , the platform is completely nested in a vertical position , both doors are closed , and the circuitry is completely de - energized . thus it will be noted that fourth mechanical and electrical means are provided which may be actuated to sequentially rotate the platform from the intermediate position to the stored position and close the vehicle door . switch 103 , which is on a follower arm , is available and used by the operator as he is lowered on the platform from the vehicle floor intermediate level to the ground level or as he is raised from the ground level up to the intermediate position . this gives the operator control so he can move himself up and down between these two positions . when the platform is in the position substantially parallel to and level with the vehicle floor , the operator can wheel onto the platform and use switch 103 to lower himself to the ground . switch 103 would be switched from the 103b position to the 103a position which feeds or directs current through limit switch 111 , which at that time is in the 111b position due to the action of the hinge plate . this energizes terminal strip 126 which directs power through limit switch 115 which is in the 115b position and then through limit switch 116 which is in the 116b position . this results in energizing terminal strip 125 which feeds or directs current through limit switch 113 which is in the 113b position to energize terminal strip 123 and subsequently activate solenoid 152 which results in energizing the lift motor 150 across terminals 150a and 150b . this rotates the motor in such a direction as to pay out cable . when the platform contacts the ground , the lift motor 150 continues paying out cable until limit switch 113 is switched from the 113b position into the 113a position by slackening of the cable . when limit switch 113 is switched in the 113a position , it cuts off power to the lift motor 150 and de - energizes the control circuitry . at this point , the operator would wheel himself off the platform onto the ground . it is thus seen that fifth mechanical and electrical means are provided which may be actuated to lower the platform from the intermediate position to the ground position . when the platform is on the ground , the operator can wheel himself onto the platform and use switch 103 to raise himself and the platform into the intermediate position substantially horizontal or level with the vehicle floor . he does this by switching switch 103 from the 103b position to the 103c position . this directs the current through the limit switch 110 which is in the 110b position and subsequently energizes terminal strip 124 which directs the current through limit switch 112 , which is in the 112a position , to energize terminal strip 122 . this results in activating solenoid 151 which then energizes lift motor 150 across terminals 150c and 150b . this rotates the motor in such a direction as to retrieve the cable . as the cable is retrieved , the springs on the platform are tightened , the cable is tensioned , and limit switch 113 is switched to the 113b position . the motor continues retrieving cable and lifting the platform until a substantially level position is reached . when the substantially level position is reached , limit switch 110 is switched from the 110b position to the 110a position by the action of the hinge plate lifting off the limit switch . when limit switch 110 is switched to the 110a position , power is shut off to the lift motor 150 and the platform is then maintained in substantially this level position while the operator wheels off the platform . thus it is noted that sixth mechanical and electrical means are provided and may be activated to raise the platform from the ground position to the intermediate position . it is apparent that a number of functions can be performed by different sequences of manipulating switches 101 , 102 , and 103 . for instance , if a wheel chair operator is outside the vehicle and no operator inside the vehicle , he would use switch 101 to open the vehicle doors and to deploy the platform into the ground position . he would then wheel himself onto the platform and use switch 103 to lift the platform from the ground position to the position substantially level with the vehicle floor . he would then wheel himself into the vehicle and use switch 102 to lift the platform from the horizontal position into the nested position and to close the doors . if , on the other hand , the operator is inside the vehicle with the platform in the nested position and the doors closed , he would use switch 102 to open the doors and to lower the platform into the horizontal or level position . he would then wheel himself onto the platform and use switch 103 to lower himself to the ground position . he would then wheel himself off the platform to the ground and use switch 101 to lift the platform from the ground position to the nested position and to close the doors . another potential variation would be if there are two wheel chair operators , one of which wants to leave the vehicle . in that case , the inside switch 102 would be used to open the doors and bring the platform down to the horizontal position . the one wheel chair patient may then wheel onto the platform and lower the platform to the ground and the wheel chair patient in the vehicle may then use the inside switch 102 to raise the platform back up from the ground position back up to the nested position . it is apparent that there are probably other combinations of usage of these three particular switches which could be used under different circumstances . | 0 |
the protective enclosure 1 shown in the figures is designed to conform exactly to the grinding machine tool 100 , as known for example from german patent application p 44 31 634 . 8 . it is comprised ( see for example fig4 ) essentially of a machine stand 102 , which receives a pivotably mounted carrier arm 106 . on the carrier arm 106 a grinding column 108 is mounted , which makes possible a vertical movement of the grinding head 110 . with the aid of the grinding head 110 a work piece 99 , for example a borer or a miller , can be ground or sharpened . for this the work piece 99 is fixed to a work piece carrier 104 , which is anchored on a work platform 112 integrated on a machine stand 102 . further , a cooling means device 120 is provided , which is designed to be mobile and which can be introduced into a therefore provided opening in the machine stand . as can be seen for example from fig1 the protective enclosure 1 is essentially comprised of three side walls 12 , 14 , 16 a closing off wall 18 and a sealing element 20 . they completely enclose the grinding machine tool 100 according to fig4 . the two side walls 12 , 14 are designed to be essentially planar . the front side wall 16 in comparison is designed to be contoured . the contour is so selected , that a mobile ground plan results . this shape is selected for reasons of space and weight savings , since in this area the pivotable carrier arm 106 carries out a semicircular movement as seen from a top view , to which the geometry of the side wall 16 substantially corresponds . the side walls 12 , 14 , 16 and the sealing element 20 are fixedly connected to each other in a known manner which need not be further discussed here . the result is a tight and stable construction , which can be manipulated as a free standing assembly independent of the machine tool 100 . it is with respect to its ground plan , designed to essentially have a u - shape , so that it can be pushed over the grinding machine tool 100 which is set up in its place of use . for simplification of the sliding movement the protective enclosure 1 is mounted on rollers 36 , 38 , 40 , 42 . the two rollers , which are adjacent to the side wall 16 , are constructed as steerable rollers 36 , 38 , in comparison to which the other rollers are constructed as fixed guide rollers 40 , 42 . the steering rollers 36 , 38 make possible a steering movement , so that the protective enclosure 1 can be exactly positioned the side wall 12 and the ceiling element 20 are cut out for reception of two sliding doors 26 , 30 . the sliding doors 26 , 30 are provided with observation windows 28 , 32 on their side , which enable a view into the inside of the protective enclosure 1 and therewith enable the observation of the running of the working process . the sliding doors 26 , 30 are on the one side slidably mounted in a guide track 34 , which is provided in the sealing element 20 . on the other side they are supported in the lower region of the side wall 12 in a well known manner which need not be described in greater detail here . for conformance with the safety requirements , in particular ce - requirements , the sliding door 26 is provided with contact tongues 48 , 50 , which operate in coordination with correspondingly provided safety switches 44 , 46 , which are secured to the side wall 16 . the safety switches 44 , 46 in combination with the contact tongues 48 , 50 are a component of a safety locking system which , on the one hand , during opening of the sliding door 26 during a running work process interrupt this immediately and , on the other hand , make possible a startup of the work process of the grinding machine tool 100 only then when the sliding door 26 is closed . for this a here not further discussed connection is provided between and the security switches 44 , 46 of the grinding machine tool 100 . this connection is designed to be releasable , and more particularly in the form of a plug - in system , so that after a sliding of the protective enclosure 1 over the grinding machine tool 100 a coupling of the safety system can rapidly be established . in the side wall 16 a further observation window 24 is provided , which in the immediate illustrative embodiment is not capable of being opened and would make possible a further possible observation from a different perspective or advantage point . as can be seen particularly from fig2 and 3 , the protective enclosure 1 is provided with further components or features , which on the one hand improve the manipulability of the protective enclosure 1 and on the other hand improve the operation of the grinding machine tool 100 . the side walls 12 and 14 guide rails 62 , 64 are provided on oppositely lying sides facing each , which make possible a precise alignment of the protective enclosure 1 when sliding this over the grinding machine tool 100 . additional guide rollers 66 , 68 provided on the guide rails 62 , 64 can facilitate the sliding movement , since the guide rollers 66 , 68 can abut against the machine stand 102 and the rollers be guided thereby . after the protective enclosure 1 is pushed over the grinding machine tool 100 and its definitive position has been achieved , it is on its back side closed off with a enclosure wall 18 . the enclosure wall 18 is in the simplest case fixed or secured by means of screws in the presented side of the side walls 12 , 14 and the ceiling element 20 . it is also conceivable , that the closing off wall 18 is attached on one side by hinging mechanisms and that a securing mechanism is provided on the oppositely lying side . the closing off wall 18 is in the previous illustrative embodiment constructed angularly , in order that the ground plan contour of the protective enclosure 1 is conformed as much as possible to that of the grinding machine tool 100 . the protective enclosure 1 is provided with an introduction opening 22 in the area of the side wall 12 , through which a cooling means container 120 corresponding to the grinding machine tool 100 can be introduced . this is of particular advantage , since in this manner the cooling means can be changed out as a consumable material without removal of the protective enclosure 1 . in the inside of the protective enclosure 1 there are further provided duct works 52 , 54 , 56 , 58 , 60 , of which the design and arrangement is so selected , that during the working of the work piece 99 expended cooling medium is captured and is channeled so as to drip into the cooling medium container . from the above it can be seen , that with the help of the inventive concept it has been accomplished to provide a economical complete protective enclosure , which has advantages both in the construction as well also as during operation of the machine tool . ______________________________________figure legend______________________________________1 protective enclosure 56 conduit12 side wall 58 conduit14 side wall 60 conduit16 side wall 62 guide rail18 closing off wall 64 guide rail20 sealing element 66 guide roller22 introduction opening 68 guide roller24 observation window26 sliding door 99 work piece28 observation window 100 grinding machine tool30 sliding door 102 machine stand32 observation window 104 work piece carrier34 guide rails 106 carrier arm36 steerable roller 108 grinding column38 steerable roller 110 grinding head40 running roller 112 work platform42 running roller 120 cooling means44 safety switch container46 safety switch48 contact tongue50 contact tongue52 conduit54 conduit______________________________________ | 1 |
the repositonable downspout extension 2 as shown in the drawings has a downspout connector end 4 , an expandable corrugated or pleated middle section 6 , and a drainage pipe connector end 8 . the product is of a plastic material and is typically manufactured by a blow molding process , a corrugated extrusion process or other appropriate molding process . eavestroughing and downspouts are most commonly made of a plastic or aluminum material and are available in different sizes . the most common downspout sizes are a three by four rectangular in cross section downspout , a three by three generally rectangular in cross section downspout , and a two by three rectangular in cross section downspout . as can be appreciated , the corners of the rectangular sections are curved to provide a more pleasing eye appeal . the present repositionable downspout extension is adapted for connection with either of these standard downspout sizes . the large rectangular connector 14 is used for the larger size whereas the smaller rectangular connector 16 is used for a smaller size . as can be appreciated , from a review of the perspective view of fig1 , it is not necessary for the end user to remove the large rectangular connector 14 if the smaller rectangular connector 16 is required . this larger size can merely be left on the downspout extension as it is larger than the downspout which can pass through the large connector and connect with the smaller rectangular connector therebelow . for a more precise finish , the large connector 20 can be cut off as will be more fully described . located between the corrugated middle section 6 and the smaller rectangular connector 16 , is a corrugation / rectangular connector 18 . the corrugation / rectangular connector includes an outwardly projecting locking rib 20 . this locking rib provides an interference fit when the connector is inserted in the corrugated middle section of a second downspout extension ( see fig7 ). it is preferred that the locking rib be continuous , however , it is also possible to have a series of projections extending outwardly from the corrugation connector which would also serve to provide the necessary interference fit . the corrugation / rectangular connector 18 is also used to join with a smaller or third size of rectangular in cross section downspout . the corrugated middle section 6 has a series of pleats which are effectively collapsible upon themselves . each pleat includes two walls which are joined by a hinged connection . in the collapsed configuration , these walls are abutting or in close proximity to one another and are generally parallel . in the extended position as shown in fig1 and 3 , the pleats are separated from one another to define a greater length of the downspout extension . these locking pleats basically go through an over center position ( similar to a spring biased over center latch ) and prefer to be either in an extended position or a collapsed position . this also allows for changing the position of the downspout position to allow curving of the middle section for repositioning around objects such as trees and bushes . these lockable corrugated pleats have been used for many years in association with children &# 39 ; s toys as well as plumbing fixtures , such as a tail pipe extension , where the locking and repositioning aspects of the pleats are used to join pipes which are not aligned . fig4 shows additional details of the downspout connector end 4 . as can be seen , the large rectangular connector 14 ( for fitting with a three by four inch downspout ) also includes on at least two walls , if not four walls of the connector , inwardly directed protrusions 54 . these protrusions serve to improve the fit and retention of the large rectangular connector 14 when it is forced over the appropriate size of downspout . in addition , these protrusions can be used as a screw location positions in mechanically connecting the connector to a downspout . similar projections 56 are provided for the smaller rectangular connector 16 ( three by three inch downspout ). in addition , the corrugation / rectangular connector 18 also includes an inwardly directed projection 58 for mechanically securing the connector 18 with a third size of downspout ( two by three inch ). these inward protrusions compensate for relatively high tolerance variations associated with blow molding manufacturing and ensure contact with a downspout . it is apparent other sizes of connectors can be used . the downspout of fig4 also includes guide instructions 30 and cut line 32 to inform the user as to the location and manner of removing of one or both of the rectangular connectors 14 and 16 . basically , a razor knife depiction is used in combination with the engraved cut line 32 for removing of these connectors . thus , the product itself provides instructions to the user regarding its intended use . fig5 is a partial perspective view of the drainage pipe connector end . guide instructions 40 are molded into the product in the form of a razor knife in combination with the cut line 42 . should the user wish to remove the drainage pipe connector 8 , he merely uses a razor knife in combination with the cut line to remove the connector at the indicated position . this engraved cut line also acts as a guide . the end user would use to corrugation / rectangular connector 18 to join two downspout extensions to one another without using the drainage pipe connector . the drainage pipe connector of the first downspout exterior is removed and the rectangular connectors of the second downspout extension are removed by cutting at the second cut line to expose or make available the corrugation connector . the exposed corrugation / rectangular connector 18 is then forced into the corrugations of the first extension . such a connection is shown in the partial cutaway view of fig6 . as shown , the corrugation / rectangular connector 18 has been forced into the middle section 6 of another downspout extension and at least one pleat of the middle section is retained between the locking rib 20 and the first corrugation locking pleat 23 of the second downspout extension . as clearly shown in the drawings , the locking rib cooperates with the pleat on the inner periphery of the pleat and provides an effective connection therewith . the generally flat sidewalls of the rectangular cross section of pleated section can have a tendency to sink or deform inwardly if the product is released from the mold before the plastic has cooled sufficiently . any inward deformation merely improves the interference connection . fig7 is a partial cutaway where two extensions have been joined one to the other . for illustrating purposes they are shown of reduced length . each of these products would be substantially longer in normal use . as shown in fig7 , the corrugation / rectangular connector 18 of the one downspout extension 2 a has been inserted within the corrugated middle section 6 of the second downspout extension 2 b . the drainage pipe connector of the second downspout extension 2 b has been removed . the drainage pipe connector of the extension 2 b could have been left in place but has been removed to provide a cleaner appearance . in some applications , it may be desirable to leave the drainage pipe connector of the extension 2 b in place to provide additional protection for the connection . for example , it may be preferable in buried applications to leave the connector in place . the corrugation / rectangular connector 18 can easily be forced through the larger drainage pipe connector 8 for locking the middle portion . fig8 shows additional details of the guide instruction 40 in the form of a razor knife positioned in close proximity to the engraved cut line 42 . these instructions provide a simple arrangement for informing the user of the appropriate cut locations and providing a cut guide . an alternate corrugation connector is shown in fig9 . in this case , the corrugation connector includes on each of its corner , inwardly directing channels 60 . these channels 60 cooperate with the interior hinge points 62 of the pleats as shown in fig1 . thus the inward hinged points 62 of the pleats interlock or provide an overlapping fit with the corrugation / rectangular connector 18 a as shown in fig9 . the inward projections 60 are provided on the corners as the corrugations tend to be stiffer at the corners and the fit is more precise . by providing two such locking arrangements on each corner of the corrugation / rectangular connector 18 , strong securement is achieved . with the product as shown in the drawings , a user need not remove any of the components if he does not wish to do so or the circumstances dictate a fast response . for example , the product can be connected to the larger standard four by three downspout extension using the large connector 14 . if the downspout is a two by three connector , the user merely forces the extension somewhat further on to the downspout and uses the smaller connector located therebelow . this smaller connector can then be mechanically fastened or otherwise secured to the downspout . often problems associated with the discharge of water from eavestroughs is not realized until there is a problem such as during a rainstorm or extended period of rain . the ability to quickly use the downspout extension without cutting is desirable . the final precise solution can be completed when the weather permits . if two such downspout extensions are to be joined one to the other , it is not necessary to use the corrugation / rectangular connector 18 . for example , the first downspout extension could be connected to a downspout and the drainage pipe connector can be forced over the drainage pipe connector of the second extension . the downspout extensions are preferably blow molded plastic products with relatively thin walls . it is possible to insert one drainage pipe connector within the other connector as some distortion of the connectors occurs . the inward protrusions on the drainage pipe connectors can be used to provide a lock fit , one with the other . it has been found that this particular product is useful for repositioning of the downspout extension and accommodating different length requirements . although the product has been described where two products are connected one to the other , it would be more common and practical to connect the downspout extension to an underground drainage system . this application typically uses a buried corrugated plastic pipe which allows bending but does not allow elongation , or a rigid plastic pipe . in either case , the drainage pipe connector 18 can be mechanically fastened to the drainage system with a suitable overlap . with the present product the rectangular shape of the known downspout systems is maintained in both the downspout connector end and the middle section . the drainage pipe connector can be removed if it is not required . in this may the downspout extension is more consistent with the eavestrough system and less obtrusive . although various preferred embodiments of the present invention have been described herein in detail , it will be appreciated by those skilled in the art , that variations may be made thereto without departing from the spirit of the invention or the scope of the appended claims . | 8 |
as noted , in one embodiment , the present invention provides filled silicone compositions useful in the manufacture of acoustic lenses for medical imaging and therapy . the filled silicone compositions comprise a silicone resin and a nano - particulate inorganic filler . the nano - particulate inorganic filler is selected from the group consisting of nano - particulate monoclinic alpha - phase bismuth oxide , nano - particulate erbium oxide , and combinations thereof . as is disclosed herein , the presence of either or both nano - particulate inorganic fillers provides filled silicone compositions displaying outstanding performance characteristics in both the cured and uncured states . by nano - particulate it is meant that the metal oxide being referred to has an average particle size in a range from about 10 nanometers to about 1 micron . in one embodiment , the nano - particulate metal oxide selected from nano - particulate monoclinic alpha - phase bismuth oxide , nano - particulate erbium oxide , and combinations thereof , has an average particle size in a range from about 10 nanometers to about 1 micron . in another embodiment , the nano - particulate metal oxide selected from nano - particulate monoclinic alpha - phase bismuth oxide , nano - particulate erbium oxide , and combinations thereof , has an average particle size in a range from about 10 nanometers to about 500 nanometers , in another embodiment from about 10 nanometers to about 200 nanometers , and in another embodiment , from about 10 nanometers to about 100 nanometers . in one embodiment , the nano - particulate metal oxide comprises nano - particulate monoclinic alpha - phase bismuth oxide having an average particle size of from about 10 nanometers to about 1 micron , in another embodiment from about 10 nanometers to about 500 nanometers , in yet another embodiment from about 10 nanometers to about 200 nanometers , and in yet another embodiment from about 10 to about 100 nanometers . in one embodiment , the nano - particulate metal oxide comprises nano - particulate erbium oxide having an average particle size of from about 10 nanometers to about 1 micron , in another embodiment from about 10 nanometers to about 500 nanometers , in yet another embodiment from about 10 nanometers to about 200 nanometers , and in yet another embodiment from about 10 to about 100 nanometers . in one embodiment , the present invention provides a uncured filled silicone composition . in another embodiment , the present invention provides a cured filled silicone composition . desirable properties of the uncured filled silicone composition provided by the present invention include relatively low viscosity for ease of handling , degassing and mold filling , relatively low cure temperatures , and colorability . desirable properties of the cured filled silicone composition include excellent acoustic properties , wear resistance and subdued color . transformation of the uncured filled silicone composition provided by the present invention to the corresponding cured filled silicone composition may be effected by a variety of means but is most conveniently effected by hydrosilylation of one component of the uncured filled silicone composition by another component present in the uncured composition . thus , in one embodiment , the silicone resin present in the uncured filled silicone composition comprises vinyl siloxane moieties and silicone hydride moieties , which react in the presence of a hydrosilylation catalyst to form a cured filled silicone composition . suitable cure catalysts include precious metals which can serve as hydrosilylation catalysts , for example platinum , palladium , rhodium , and mixtures thereof . in one embodiment , the cure catalyst is karstedt &# 39 ; s catalyst . an important advantage of using cure chemistry based on hydrosilylation is that useful cure rates can be achieved at relatively low temperatures , for example at temperatures below about 80 ° c . in one embodiment , the uncured filled silicone composition may be cured at temperatures below about 60 ° c . in another embodiment , the uncured filled silicone composition may be cured at temperatures below about 50 ° c . the silicone resin components of the uncured filled silicone compositions provided by the present invention are well known in the art and are in many instances commercially available . the silicone resin present in the cured filled silicone composition provided by the present invention is at times referred to as a silicone rubber . nano - particulate monoclinic alpha - phase bismuth oxide may be prepared by heat treatment of a nano - particulate tetragonal beta - phase bismuth oxide at one or more temperatures in a range between about 305 ° c . and about 600 ° c . at temperatures in excess of about 600 ° c . the nano - particulate monoclinic alpha - phase bismuth oxide tends to form larger aggregates and is thereafter unsuited for use in an acoustic lens for medical imaging . nano - particulate erbium oxide is available commercially . in one embodiment , the present invention provides a filled silicone composition wherein the nano - particulate inorganic filler is selected from the group consisting of nano - particulate monoclinic alpha - phase bismuth oxide , nano - particulate erbium oxide , and mixtures thereof , and is present in an amount corresponding to from about 0 . 1 volume percent to about 15 volume percent , in another embodiment from about 1 to about 10 volume percent , in another embodiment from about 2 to about 10 volume percent , in another embodiment from about 2 to about 8 volume percent , and in yet another embodiment from about 4 to about 8 volume percent , of the total volume of the composition . in one embodiment , the present invention provides a filled silicone composition wherein the nano - particulate inorganic filler is nano - particulate monoclinic alpha - phase bismuth oxide , and is present in an amount corresponding to from about 0 . 1 volume percent to about 15 volume percent , in another embodiment from about 1 to about 10 volume percent , in another embodiment from about 2 to about 10 volume percent , in another embodiment from about 2 to about 8 volume percent , and in yet another embodiment from about 4 to about 8 volume percent , of the total volume of the composition . in another embodiment , the present invention provides a filled silicone composition wherein the nano - particulate inorganic filler is nano - particulate erbium oxide , and is present in an amount corresponding to from about 0 . 1 volume percent to about 15 volume percent , in another embodiment from about 1 to about 10 volume percent , in another embodiment from about 2 to about 10 volume percent , in another embodiment from about 2 to about 8 volume percent , and in yet another embodiment from about 4 to about 8 volume percent , of the total volume of the composition . in yet another embodiment , the present invention provides a filled silicone composition wherein the nano - particulate inorganic filler is a combination of nano - particulate monoclinic alpha - phase bismuth oxide and nano - particulate erbium oxide , and is present in an amount corresponding to from about 0 . 1 volume percent to about 15 volume percent , in another embodiment from about 1 to about 10 volume percent , in another embodiment from about 2 to about 10 volume percent , in another embodiment from about 2 to about 8 volume percent , and in yet another embodiment from about 4 to about 8 volume percent , of the total volume of the composition . in one embodiment , the nano - particulate erbium oxide is present in an amount corresponding to less than about 75 volume percent of a total amount of inorganic filler present in the composition . the filled silicone compositions provided by the present invention may comprise other inorganic fillers in addition to nano - particulate monoclinic alpha - phase bismuth oxide , nano - particulate erbium oxide , or combinations of nano - particulate monoclinic alpha - phase bismuth oxide and nano - particulate erbium oxide . additional inorganic fillers which may be present include silica , quartz , titania , alumina , zinc oxide , and combinations thereof . in one embodiment , the filled silicone composition provided by the present invention comprises fumed silica . in another embodiment , the filled silicone composition provided by the present invention comprises quartz . in one embodiment , the filled silicone composition provided by the present invention further comprises a pigment , for example carbon black . in one embodiment , the filled silicone composition provided by the present invention further comprises a pigment selected from the group consisting of carbon black , sodium aluminosulfosilicate , manganese ferrite , and iron oxide . in one embodiment , the present invention provides an ultrasonic probe comprising ( a ) a substrate material ; ( b ) a piezoelectric transducer ; and ( c ) an acoustic lens wherein the acoustic lens comprises a filled silicone composition provided by the present invention . thus , in one embodiment , the acoustic lens comprises a filled silicone composition comprising a silicone resin and a nano - particulate monoclinic alpha - phase bismuth oxide . in one embodiment , the nano - particulate monoclinic alpha - phase bismuth oxide has an average particle size of from about 10 nanometers to about 200 nanometers . in another embodiment , the filled silicone composition further comprises nano - particulate erbium oxide . in yet another embodiment , the filled silicone composition further comprises a pigment . in one embodiment , the pigment is selected from the group consisting of carbon black , sodium aluminosulfosilicate , manganese ferrite , and iron oxide . in one embodiment , the acoustic lens comprises a filled silicone composition comprising a silicone resin and a nano - particulate erbium oxide . in one embodiment , the present invention provides an acoustic lens having a first curved surface and a second surface , the acoustic lens comprising a filled silicone composition of the present invention . in one embodiment , the filled silicone composition comprising the acoustic lens comprises a silicone resin and a nano - particulate monoclinic alpha - phase bismuth oxide . in one embodiment , the present invention provides ultrasound diagnostic apparatus comprising an acoustic lens made from a composition provided by the present invention . thus , in one embodiment , the present invention provides a ultrasound diagnostic apparatus comprising ( a ) an ultrasonic probe comprising ( i ) a substrate material , ( ii ) a piezoelectric transducer , and ( iii ) an acoustic lens comprising a filled silicone composition comprising a silicone resin and a nano - particulate monoclinic alpha - phase bismuth oxide ; ( b ) a signal processing unit ; and ( c ) an image display . in one embodiment , the present invention provides an ultrasonic probe comprising an acoustic lens comprising a composition of the present invention , said acoustic lens having a first curved outer surface and a second inner surface in contact with a first surface of an acoustic matching film layer . a second surface of the acoustic matching film layer is in contact with a piezoelectric transducer comprising a piezoelectric layer , and a pair of electrodes , the piezoelectric layer being disposed on a substrate material ( backing ) which may comprise a filled epoxy thermoset material or other suitable material . the piezoelectric transducer comprises a plurality of such piezoelectric layer - electrode combinations in contact with an acoustic matching layer . each of the electrodes is connected to a ground electrode plate or a printed circuit board . in one embodiment , the ultrasonic probe provided by the present invention comprises piezoelectric elements and acoustic matching layers configured as a one dimensional array . in one embodiment , the present invention provides an ultrasound diagnostic apparatus comprising an ultrasonic probe , a signal processing unit , and an image display . the signal processing unit may be any electronic device capable of directing the acoustic output of the piezoelectric transducer and receiving and processing the input from the piezoelectric transducer . signal processing units are typically a central processing unit ( cpu ) as used in personal computers or a digital signal processing chip like the tms320 series digital signal processors available from texas instruments . a variety of image display devices are available and include conventional image display monitors . one of ordinary skill in the art will understand the utility of the compositions provided by the present invention and their use as components of devices such as ultrasonic probes , acoustic lenses , and ultrasound diagnostic apparatus . thus , the present disclosure provides novel compositions which may be used to form an acoustic lens using standard lens - forming techniques and thereafter the acoustic lens may be incorporated into a more complex device comprising conventional components such as a piezoelectric transducer element formed on a substrate material , a signal processing unit , and an image display . nano - partiuculate metal oxides were purchased from three sources : nanostructured and amorphous materials inc . huston tex ., sigma - aldrich corporation milwaukee , wis ., and nanophase technologies corporation romeoville , ill . properties of various nano - particulate metal oxides studied are gathered in table 1 . silicone 2 - part addition cure resins rtv615 and sle 5401 were obtained from momentive performance materials waterford , n . y . silicone components such as silicone resin ( 88295 ), silicone vinylstopped polydimethylsiloxane ( pdms ) ( sl6000 ), and silicone crosslinker ( 88104 ) were obtained from momentive performance materials . tetramethyltetravinylcyclotetrasiloxane ( sit7900 . 0 ) and platinum - cyclovinylmethylsiloxane complex — 2 - 2 . 5 wt % pt ( sip6832 . 2 ) were purchased from gelest inc . morrisville , pa . phenyltrimethoxysilane , octyltrimethoxysilane , vinyltrimethoxysilane , allyltrimethoxysilane were purchased from gelest . silcopas black 220 ( dispersion of fe 3 o 4 in vinylstopped polydimethylsiloxane fluid ) was obtained from gayson specialty dispersion inc . barberton , ohio . liquid formulations : dispersions of metal oxide nanoparticles in a low viscosity silicone formulations comprising rtv615 and about 4 . 2 vol % r8200 well treated fumed silica and a desirable amount of the filler required to obtained a target density were prepared and the acoustic properties of cured samples prepared from these formulations were screened . a target density of the resultant cured composite composition was 1 . 55 g / cm 3 +/− 0 . 05 g / cm 3 . the dispersions were prepared on a speedmixer dac 400 available from flacktek inc . landrum , s . c . a typical procedure is illustrated as follows : ( a ) charge 10 g of rtv615a pre - filled with r8200 treated fumed silica to a 50 ml plastic container , ( b ) add from 7 to 9 grams of the nano - particulate metal oxide filler , ( c ) mix in speedmixer 4 times for 45 seconds at 2700 rpm , ( caution : the material may become hot during the mixing step ), ( d ) cool the resultant composite mixture to 20 ° c ., ( e ) add 1 g of rtv615b , ( f ) mix by hand , ( g ) mix in speedmixer 3 times for 10 seconds at 2700 rpm , ( h ) degas in a vacuum desiccator for 15 minutes at 1 mm hg ( i ) pour the degassed dispersion to a teflon ® mold , ( j ) degas the dispersion contained in the teflon ® mold in a vacuum desiccator for 5 minutes at 1 mm hg , ( k ) remove excess dispersion from the mold , and ( l ) cure the dispersion in the mold at 60 ° c . for 4 hrs to afford a cured test sample . formulation with 88295 silicone resin : the dispersions of nano - particulate metal oxide in a silicone resin were prepared using an exakt 50 three roll mill . a typical procedure is as follows : ( a ) charge 10 g of 88295 silicone resin to 50 ml plastic container , ( b ) add desired amount of the nano - particulate metal oxide powder ( 30 - 40 g ), ( c ) mix in speedmixer , 3 × 45 seconds at 2700 rpm ( caution : the material may heat up during high speed mixing ), ( d ) transfer resulting paste to a three roll mill , ( e ) mill at the minimum gap setting and collect the dispersion on the scrape blade , ( f ) return the dispersion to the three roll mill and repeat the milling process from three to ten times , ( g ) transfer the final dispersion to a plastic container , ( h ) add required amount of the 88295 resin , ( i ) mix in the speedmixer ( 3 × 45 sec at 2700 rpm ), ( j ) add the pt catalyst and tetramethyltetravinylcyclotetrasiloxane inhibitor , ( k ) mix in the speedmixer 3 times 30 sec at 2700 rpm , ( l ) cool the resultant mixture to at least 20 ° c ., ( m ) add the desired amount of silcopas black 220 and hydrido functionalized siloxane crosslinker ( 88104 ), ( n ) mix well by hand until the mixture is a uniform rich gray color , ( o ) perform a final mix on speedmixer 2 × 15 sec at 2700 rpm , ( p ) degas the mixture in vacuum desiccator for 15 minutes at 1 mmhg , ( q ) pour the mixture into a teflon ® mold , ( r ) degas mixture in the mold in the vacuum desiccator for 5 minutes at 1 mmhg , ( s ) remove excess material from the mold , and ( t ) cure at 60 ° c . for 4 hrs . in - mold cure conditions : the uncured filled silicone composition was degassed and poured into a teflon ® mold 5 × 5 × 0 . 3 cm . the mold containing the uncured filled silicone composition was placed in a vacuum desiccator for 5 minutes at 1 mmhg . any excess uncured filled silicone composition was removed with a doctor blade . the mold containing the uncured filled silicone composition was placed in a laboratory oven ( model vwr 1330lm ) and held at 60 ° c . for 4 hours to effect curing and providing a cured filled silicone composition . filler treatments , bismuth oxide : 250 g of a commercial nano - particulate beta - phase bismuth oxide powder was placed on a ceramic tray and inserted into a lindberg blue m high temperature programmable box furnace . the beta - phase bi 2 o 3 sample was heated at 450 ° c . for 2 hrs and then cooled to ambient temperature over 5 hrs to provide nano - particulate alpha - phase bismuth oxide . the heat treated bi 2 o 3 was stored in a closed glass jar until needed . filler treatments erbium oxide : 500 g of commercial nano - particulate erbium oxide powder and 12 . 5 g of phenyltrimethoxysilane were charged to a glass jar . the powder was mixed on a roller mixer for 3 hrs at ambient temperature . the closed jar was placed in a vacuum oven at 110 ° c . for 1 hour . caution should be exercised as pressure may build up during heating . to this end , the jar was carefully vented at 15 minute intervals throughout the heating step . after 1 hour the lid of the jar was removed and the treated erbium oxide was heated at 160 ° c . in the vacuum oven to remove volatiles for at least 2 hours . the treated er 2 o 3 was cooled to ambient temperature and stored in a closed jar until needed . the acoustic properties of the new lens material were characterized . cured test samples were prepared by casting the lens material in a mold having dimensions of ( 5 cm )×( 5 cm )×( 0 . 2 - 0 . 5 cm ). the sample was degassed and then cured in the mold . the acoustic longitudinal velocity , impedance , and attenuation of the cured test samples were measured . the measurements were done in a water tank with two identical transducers mounted facing each other . using one as a transmitter , a short pulse from a panametrics 5800 pulser / receiver , was sent through a water path to the receiving transducer . a thin sample can be suspended between the transducers , in the path of the ultrasound beam . the time of flight and echo amplitude are recorded with the sample present and absent . where “ c h2o ” is the sound velocity in water , “ t s ” is the delay time with the sample in the sound beam , “ t 0 ” is the delay time of the reference water path beam , and ‘ d ’ is the thickness of the sample . the sample thickness ‘ d ’ is measured with a micrometer height gauge at five points ( the corners of a square and the center ). this measurement is done in the region that intercepts the beam . it is a good practice to measure the temperature of the water bath at the beginning and end of the experiment since the velocity of sound in water has a small dependence on temperature . in order to accurately measure the time delay , the received signal is displayed with the expanded time base on the oscilloscope . the vertical position is adjusted so that the signal &# 39 ; s baseline coincides with a horizontal grid line , called the “ zero line ”. a time cursor is positioned near the first significant ( i . e . easily identifiable ) zero crossing . the use of an early point on the waveform minimizes dispersion effects . for the sample measurement , the sample position is rotated to generate an extremum . for materials with velocity slower ( faster ) than water , the sample is positioned so that the cursor finds the extremum near the tail ( front ) of the received waveform . the cursor is then adjusted to line up with the zero line and the time delay from the oscilloscope is recorded . standard methods use the waveform analysis feature of the oscilloscope to measure the peak to peak signal voltage . the signal is allowed to average for about 10 seconds before recording the results , and the amplitude measurements were repeated twice to assure consistency . the attenuation per unit length , ‘ attn ’ is given by where v pps and v pp are the peak to peak signal voltages from the sample and reference respectively . one advantage of a relatively thin sample is that the signal is not significantly distorted . test samples were 2 - 3 mm thick and time delays of more than 5 wavelengths at 5 mhz along with raw signal attenuation usually less than 15 db were observed . acoustic impedance differences between the sample and water could also contribute to the reflection losses although such losses were usually found to be insignificant for test sample materials with acoustic impedance similar to the human body ( 1 . 25 mrayls & lt ; z lens & lt ; 1 . 6 mrayls ). the impedance and attenuation of the cured test samples were recorded on a measurement bench using the broadband pulse technique over a wide frequency range of 3 to 10 mhz . the measurement bench included a water tank including 3 sets of wide band transducers ( transducer center frequencies are : 3 , 7 . 5 and 10 mhz ) aligned in opposition , a sample holder , which allowed sample rotation , a waveform generator , a numerical oscilloscope , and computer to drive the waveform generator and the numerical scope . abrasion testing of the cured filled compositions was conducted on a conventional pin - on - disc tribometer using astm g09 - 095a ( 2000 ). mechanical properties of the cured silicone elastomers were evaluated using an instron testing device at ambient conditions . chemical resistance : test samples were soaked in four different chemicals for 24 hours . the test chemicals included , paraben soup ( 20 % dichlorobenzene in 80 % ethanol ), commercially available disinfectant cidex opa , 2 % isopropyl myristate in 98 % ethanol , and 100 % isopropanol . for each test chemical , four samples were weighed before and after the soak . the percentage weight gain was calculated . the new lens materials provided by the present invention exhibited lower chemical absorption than a standard lens material . viscosity of the uncured filled silicone composition was measured using a cap2000 + brookfield viscometer . thermal conductivity of the filled silicone compositions was determined using a thermetrix tca - 300 thermal conductivity analyzer using cured 2 - inch diameter test samples . the thickness of the test samples was measured with a digital micrometer . test samples were coated with dow corning 340 heat sink compound and thermal conductivity measurements were taken at approximately 65 ° c . shore a hardness values of the cured filled silicone compositions were determined using a handheld starrett digital durometer no . 3805 . a typical flowable silicone formulation used to manufacture ultrasound lenses is filled with quartz micron size particles as an inorganic filler . while serviceable , as a castable lens - forming material , such materials may suffer from a number of deficiencies including low abrasion resistance , relatively high permeability to gels employed in ultrasound procedures , and cleaning chemicals such as paraben , iso - propanol , isopropyl myristate , and cidex opa , and exhibit relatively low acoustic impedance . at the outset of the research underlying the present invention , a list of desired properties was established as a basis for screening new filled silicone compositions useful as acoustic lens materials . this list of target properties of a new lens material is presented in table 2 . nano - particulate metal oxide powders in an amount required to obtain a final density in a range from about 1 . 55 to about 1 . 65 g / cm 3 ) were blended into the “ addition curable ” silicone resin material rtv615 obtained from momentive performance materials which contained approximately 4 volume percent ( vol %) r8200 ( treated fumed silica from degussa corporation ). the filled silicone compositions comprising nano - particulate metal oxides were screened for evidence of low viscosity and flowability before curing , and low acoustic attenuation of cured samples prepared from the uncured filled silicone compositions . the results of the screening studies are summarized in table 3 . most of the filled silicone compositions screened were found to be unsuitable for use in the manufacture of acoustic lenses because , for example , the uncured filled silicone composition did not flow , had an inappropriate density , or exhibited excessive sound attenuation upon curing . based on the initial screening results shown in table 3 , two nano - particulate metal oxide fillers appeared to show promise : erbium oxide ( er 2 o 3 ) having an average particle size of about 43 nanometers and beta - phase bismuth oxide having an average particle size of from about 30 nanometers to about 210 nanometers . uncured filled silicone compositions comprising the erbium oxide or tetragonal beta - phase bismuth oxide fillers exhibited excellent dispersion of the nano - particulate metal oxide in the rtv615 silicone resin . the uncured filled silicone compositions were flowable and exhibited relatively low viscosity . the uncured filled silicone compositions containing the nano - particulate erbium oxide or beta - phase bismuth oxide were cured in a mold at 60 ° c . to provide cured test samples which showed good acoustic properties and hardness from 50 to 61 shore a . however , the cured filled silicone composition comprising beta - phase bismuth oxide was bright yellow in color . in contrast , the cured filled silicone composition comprising er 2 o 3 was pink in color . as will be appreciated by those skilled in the art , inherently brightly colored materials may present difficulties when attempting to adjust the color of articles comprising the inherently brightly colored material . this is particularly true of filled silicone compositions which are inherently bright yellow but which are intended to be used in applications requiring a more subdued color such as light blue or grey . while a bright yellow acoustic lens as a component of an ultrasonic probe might not be of itself objectionable , the inability to adjust the color of the lens to an alternative color may be viewed as a serious design limitation . when the uncured filled silicone compositions were prepared on a larger scale , the nano - particulate tetragonal beta - phase bismuth oxide was found to exhibit a significant inhibition of the cure reaction . for example , after heating the uncured filled silicone composition containing nano - particulate beta - phase bismuth oxide for 6 hours at 60 ° c . the cured samples exhibited significantly lower hardness ( about 35 shore a ) than had been observed earlier , and the lower hardness was attributable to incomplete curing . a different batch of beta - phase bismuth oxide obtained from a second supplier ( nanophase technologies corp .) showed even stronger cure inhibition , and the cured samples were sticky to the touch . cure inhibition of uncured filled silicone compositions containing nano - particulate beta - phase bismuth oxide was suspected initially to be due to the presence of impurities which inhibited the hydrosilylation reaction responsible for the curing process , or alternatively to a particularly strong interaction of the nano - particulate beta - phase bismuth oxide particles with the crosslinking agent present in the curable silicone resin , or the hydrosilylation ( pt ) catalyst . elemental analysis of three separate batches of nano - particulate tetragonal beta - phase bismuth oxide from different suppliers did not reveal the presence of distinguishing contaminants or species known to inhibit the hydrosilylation reaction . each of the nano - particulate beta - phase bismuth oxide samples appeared to be high purity bi 2 o 3 containing some excess oxygen . x - ray diffraction ( xrd ) analysis confirmed that all three nano - particulate bismuth oxide samples were indeed tetragonal β - phase bi 2 o 3 . samples of the beta - phase bismuth oxide were also analyzed by thermal gravimetric analysis ( tga ). tga analysis of the commercial beta - phase bismuth oxide samples showed about 0 . 25 % weight loss during the first heating cycle ( ambient temperature to 500 ° c . over approximately 80 minutes ). interestingly , a second heating cycle after exposure to ambient conditions for 16 hrs showed only 0 . 07 % weight loss . this result suggested that there were two different sources of the mass loss observed since mass loss due to desorption of surface water alone might be expected to be the same in the first heating cycle and the second heating cycle following re - exposure of the sample to atmospheric moisture . examination of the tga curve from the first heating cycle revealed two separate mass loss events . the first , and smaller , loss of mass occurred in a temperature range between ambient temperature and about 200 ° c . and was attributed to loss of water adsorbed on the surface of nano - particulate beta - phase bismuth oxide particles . the second , and larger , loss of mass took place in a temperature range between about 200 ° c . and about 500 ° c . and was attributed to the loss of excess oxygen from the nano - particulate beta - phase bismuth oxide and a transition from a meta - stable tetragonal beta - phase bismuth oxide to a more stable monoclinic α - phase ( monoclinic alpha - phase bismuth oxide ). the transformation of the beta - phase bismuth oxide to monoclinic alpha - phase bismuth oxide crystal was confirmed by xrd and shown to be quantitative or nearly so . the heat - treated bi 2 o 3 ( monoclinic alpha - phase nano - particulate bismuth oxide ) was mixed with rtv615 to determine the effect of heat treatment on viscosity and cure behavior of the uncured filled silicone composition . blends of rtv615 with heat - treated bi 2 o 3 from multiple suppliers had viscosities similar to blends of untreated beta - phase bismuth oxide , and cured well to form cured filled silicone compositions ( at times referred to herein as “ silicone composites ”) exhibiting shore a hardness values of 49 to 50 . the mechanism by which the β - phase bi 2 o 3 inhibits curing of the filled uncured silicone composition is not well understood , but was both reproducible and presented a significant obstacle to the preparation of test articles from uncured filled silicone compositions comprising beta - phase bismuth oxide . it is noteworthy that heat treatment of the nano - particulate beta - phase bismuth oxide at temperatures above 600 ° c . led to formation of large crystals of alpha phase bismuth oxide . as will be appreciated by one of ordinary skill in the art , the presence of large crystals of bismuth oxide in the uncured filled silicone composition employed will result in silicone composites with very high acoustic attenuation . interestingly , a significant color change from bright orange - yellow to pale yellow was observed as the nano - particulate bismuth oxide was converted thermally from the β phase to the α phase . this color change has significant implications from a design point of view in that the pale yellow alpha - phase bismuth oxide provides filled silicone compositions which are more readily colorable than the corresponding filled silicone compositions comprising the bright yellow beta - phase bismuth oxide . typically , ultrasound probes feature an acoustic lens which is either blue or grey in color . untreated β - phase bi 2 o 3 exhibits such an intense yellow color that it was difficult to change the color of the filled silicone composition to gray by the addition of carbon black or black iron oxide particles . the pale yellow color of filled silicone compositions comprising the α - phase bi 2 o 3 can be changed easily from pale yellow to gray by incorporation of small amounts of iron oxide or carbon black into the composition . during the course of this study it was found that blends of er 2 o 3 ( erbium oxide ) with rtv615 exhibited higher viscosity than the blends of rtv615 with bi 2 o 3 and , moreover , filled uncured silicone compositions comprising the nano - particulate erbium oxide at times performed poorly during degassing and required a longer degassing step . poor performance during the degassing step was thought to be related to the surface characteristics of the nano - particulate erbium oxide . a series of filler treatment experiments was carried out in order to determine if the degassing performance of the nano - particulate erbium oxide - containing formulations could be improved . the effect of filler treatment with different organoalkoxysilanes on the degassing performance characteristics of filled silicone compositions comprising treated nano - particulate erbium oxide was investigated and results are presented in table 4 . the filled silicone compositions comprising the treated nano - particulate erbium oxides were prepared as generally described herein . in table 4 all - si ( ome ) 3 represents allyl trimethoxysilane , vi — si ( ome ) 3 represents vinyl trimethoxysilane , ph — si ( ome ) 3 represents phenyl trimethoxysilane , and oct - si ( ome ) 3 represents octyl trimethoxysilane . the filled silicone composition comprising erbium oxide exhibiting the shortest degassing time , the most favorable viscosity and providing the highest post cure hardness values comprised the erbium oxide filler treated with phenyltrimethoxy silane . thus in one aspect the present invention provides an improved filled silicone composition comprising an alpha - phase bismuth oxide , and in another embodiment the present invention provides a filled silicone composition comprising alkoxysilane treated nano - particulate erbium oxide . it is known that acoustic attenuation of a composite composition is proportional to volume % of the filler present , the filler density , and the size of the filler particles . it was hoped that cured filled silicone compositions comprising a nano - particluate filler in an amount corresponding to a relatively small volume % of the composition as a whole might exhibit superior acoustic attenuation properties . commercial nanoparticles are typically provided as micron size aggregates . dispersion of these aggregates into a silicone resin to form filled silicone compositions comprising nano - particulate fillers presents a significant challenge , especially when employing standard laboratory equipment . several methods of dispersion of bi 2 o 3 nanoparticles were evaluated . the degree of dispersion was evaluated by scanning electron microscopy (“ sem ”) and by measurement of the acoustic attenuation of the cured samples prepared from the uncured filled silicone compositions . results are summarized in table 5 . sem images of bi 2 o 3 filled silicone composites revealed a high level of dispersion of the filler when dispersion of the filler was carried out using a three - roll mill . the three - roll mill offers several advantages such as the ability to mix relatively high viscosity blends , efficient mixing , sample size flexibility , ease of scale - up , and is a common piece of equipment among commercial compounders . moreover , uncured filled silicone compositions prepared by dispersion of the nano - particulate bismuth oxide in a silicone resin on a three - roll mill afforded cured samples exhibiting consistently low acoustic attenuations . two commercially available unfilled 2 - part silicone resins were examined initially , rtv615 and sle5401 . properties of both materials are summarized in table 6 . both of the commercial materials rtv615 and sle5401 are low viscosity resins , and afford high strength silicone rubbers upon curing . a potential advantage of sle5401 is its primer - less adhesion characteristic . it is believed that silicone resins exhibiting a primer - less adhesion characteristic may offer manufacturing process advantages and improve the reliability of the ultrasound probe acoustic lenses . unfortunately , compositions studied herein comprising sle5401 exhibited a reluctance to undergo curing under standard conditions ( 12 hrs ambient temperature and 2 hrs at 50 ° c .). rtv615 can be cured under standard conditions but the cured resin has relatively low elongation compared to a quartz filled 2 - part silicone resin standard . the incorporation of small amounts of treated fumed silica r8200 from degussa into the uncured resin improves significantly the elongation at break while maintaining the low viscosity characteristic of rtv615 . rtv615 filled with about 4 vol % of r8200 fumed silica was selected as the base resin for evaluation of metal oxide nano - particulate fillers . rtv615 containing 4 vol % of r8200 fumed silica was blended with about 9 . 5 vol % of nano - particulate bismuth oxide ( or erbium oxide ) on a three roll mill . the formulations ( table 7 ) exhibited relatively low viscosites , typically in range from about 13000 to about 20000 cps . the formulations with as much as 11 vol % of alpha - phase bismuth oxide flowed well and were found to be self - leveling . the corresponding erbium oxide - containing formulations with similar volume percent of nano - particulate erbium oxide were thixotrophic and did not self - level under ambient conditions . formulations comprising nano - particulate erbium oxide did , however , exhibit better mechanical properties such as hardness and tensile strength . the abrasion resistance of cured samples prepared from the uncured filled silicone compositions comprising the silicone resin rtv615 , fumed silica , and either nano - particulate monoclinic alpha - phase bismuth oxide or nano - particulate erbium oxide were compared to formulations which employed a standard quartz filled 2 - part silicone resin . abrasion resistance tests indicated that the quartz filled 2 - part silicone resin afforded cured test samples having superior abrasion resistance . in one embodiment , the present invention provides a filled silicone composition comprising a silicone resin which is addition curable and comprises a vinyl - fuctionalized silicone resin such as 88295 from momentive performance materials . the vinyl containing silicone resin provides good reinforcement without affecting rheological properties of the fluid . filled silicone compositions comprising 88295 resin were also evaluated . the filled silicone compositions comprising 88295 and nano - particulate monoclinic alpha - phase bismuth oxide or nano - particulate erbium oxide exhibited superior physical and acoustic properties ( table 8 ) as well as good abrasion resistance . filled silicone compositions comprising nano - particulate alpha - phase bismuth oxide having an average particle size in a range between about 90 nanometers and about 210 nanometers were evaluated and judged suitable for use in ultrasound acoustic lenses due to high filler density , relatively small effect on rheological properties of the uncured blends , and excellent acoustic attenuation performance characteristics of the cured composite compositions . nano - particulate alpha - phase bismuth oxide has a strong impact on sound velocity . the incorporation of as little as 10 volume percent ( vol %) of nano - particulate alpha - phase bismuth oxide results in about 20 % reduction in the speed of sound traveling through a cured test sample prepared from a composition of the present invention . the lower speed of sound observed in the cured filled silicone compositions provided by the present invention provides additional flexibility in the design of acoustic lenses for ultrasonic probes , in that it permits the use of thinner lenses relative to a standard lens without changing the lens focal point , an effect which leads to the reduction in the lens attenuation . this effect may be accompanied , however , by the need for a higher filler level in order to achieve the desired acoustic impedance . a figure of merit ( fom ) for each result given in table 9 may be calculated by multiplying the composite attenuation by its speed of sound . the calculated fom may be used to rank the acoustic properties of the experimental materials . in principle , the material with the lowest fom should have the best acoustic properties for use in an acoustic lens application . in practice , however , significant variance in acoustic attenuation values may be observed . sample variance is believed to be related to variations in process conditions which in turn produce variations in sample homogeneity and the presence at times of larger , micron size aggregates of the nano - particulate bismuth oxide . tables 10 and 11 present data for filled silicone compositions comprising both nano - particulate monoclinic alpha - phase bismuth oxide and nano - particulate erbium oxide . the data further illustrate the performance characteristics of filled silicone compositions provided by the present invention . the foregoing examples are merely illustrative , serving to illustrate only some of the features of the invention . the appended claims are intended to claim the invention as broadly as it has been conceived and the examples herein presented are illustrative of selected embodiments from a manifold of all possible embodiments . accordingly , it is the applicants &# 39 ; intention that the appended claims are not to be limited by the choice of examples utilized to illustrate features of the present invention . as used in the claims , the word “ comprises ” and its grammatical variants logically also subtend and include phrases of varying and differing extent such as for example , but not limited thereto , “ consisting essentially of ” and “ consisting of .” where necessary , ranges have been supplied ; those ranges are inclusive of all sub - ranges there between . it is to be expected that variations in these ranges will suggest themselves to a practitioner having ordinary skill in the art and where not already dedicated to the public , those variations should where possible be construed to be covered by the appended claims . it is also anticipated that advances in science and technology will make equivalents and substitutions possible that are not now contemplated by reason of the imprecision of language and these variations should also be construed where possible to be covered by the appended claims . | 2 |
for the first time , there is provided with the present invention a new method of increasing life span by modulating the biology of telomeres . we had shown previously that clk - 2 mutants have a phenotype similar to that of clk - 1 mutants , including the maternal rescue effect , their slow development and behavior , and their increased life span ( hekimi , et al ., genetics 141 , 1351 ( 1995 ); lakowski , b . and hekimi , s . science 272 , 1010 ( 1996 ). we have characterized the defects of clk - 2 mutants in much further detail , the results of which follow . from 15 ° c . to 20 ° c . the phenotype of clk - 2 mutants is similar to that of clk - 1 mutants . the average developmental , reproductive and behavioral rates are dramatically slower , and the mean and maximum life span longer , than those of the wild type as summarized in table 1 . in particular , the embryonic development of clk - 2 ( qm37 ) mutants lasts 17 . 0 ± 1 . 5 hours ( n = 97 ) at 20 ° c ., while the wild type lasts 13 . 2 ± 0 . 7 hours ( n = 80 ). the post - embryonic development of clk - 2 ( qm37 ) mutants is also slower lasting 95 . 7 ± 1 . 3 hours at 20 ° c . ( n = 73 ), while the wild - type worms take only 53 . 6 ± 8 . 7 hours ( n = 184 ). the defecation cycles are slowed down as well , occurring every 105 . 7 ± 15 . 2 seconds in clk - 2 mutants at 20 ° c . ( n = 10 ) and every 54 . 9 ± 0 . 6 seconds in the wild type ( n = 70 ). the pumping rate is lower , 180 . 9 ± 24 . 8 pumps per minute occurring in the clk - 2 mutants at 20 ° c . ( n = 25 ), and 265 . 3 ± 64 . 4 pumps per minute in the wild type ( n = 25 ). in addition , we have also examined the self - brood size at 20 ° c . and found that is reduced in clk - 2 mutants where it is 83 . 4 ( n = 10 ), while it is 302 . 4 ± 30 . 5 in the wild type ( n = 20 ). the peak egg - laying rate is 1 . 3 ( n = 10 ) in clk - 2 mutants at 20 ° c ., and 5 . 3 ( n = 10 ) in the wild type . we have also examined the life span . clk - 2 ( qm37 ) mutants live longer than the wild type , living on average 22 . 4 ± 7 . 4 days ( n = 100 ) at 20 ° c . and having a maximum life span of 40 days , which is longer that the average life span of 19 . 3 ± 5 . 3 days ( n = 100 ) and maximum life span of 32 days of wild - type n2 worms . the developmental and behavioral phenotypes are fully maternally rescued , that is to say that homozygous clk - 2 / clk - 2 mutants derived from a clk - 2 ( qm37 )/+ heterozygous mother display wild - type phenotypes . in fact , the embryonic development of homozygous mutants derived from a heterozygous mother takes only 13 . 3 ± 1 . 6 hours ( n = 40 ) and their post - embryonic development lasts only 53 . 9 ± 12 . 4 hours ( n = 98 ) at 20 ° c . also maternally rescued are both defecation , which occurs every 60 . 3 ± 9 . 1 seconds at 20 ° c . ( n = 8 ) and pumping , which occurs at a rate of 245 . 2 ± 24 . 6 pumps per minute at 20 c . ( n = 11 ). however , the reproductive phenotypes are only partially rescued by a wild - type copy of the gene clk - 2 in the mother . the self - brood size is 113 . 9 ± 30 . 3 at 20 ° c . ( n = 24 ), and the peak egg - laying rate is 3 . 6 ± 0 . 9 ( n = 24 ). this indicates that the wild - type clk - 2 gene in the mother induces an epigenetic state that lasts for only one generation . erasure of the epigenetic state in the germ - line prevents the animal from having a wild - type rate of reproduction . in addition , the life span of maternally rescued homozygous mutants is dramatically shortened vs . both the mutant and the wild - type life span . indeed , homozygous mutants derived from a heterozygous mother live only 14 . 9 ± 4 . 1 days on average ( n = 106 ) and have a maximum life span of 27 days at 20 ° c . interestingly , wild - type siblings of maternally rescued clk - 2 live slightly shorter than wild - type n2 worms , 17 . 3 ± 4 . 1 days ( n = 206 ). this observation indicates that wild - type physiological rates imposed by a maternal epigenetic setting are deleterious to animals that are partially incapable of regulating their physiological rates in response to environmental conditions . we characterized the life span increase produced by clk - 2 ( qm37 ) by comparing it to that produced by other aging genes as summarized in table 2 . among the other genes that affect life span in worms , the best understood are the daf genes . mutations in the eat genes prolong life span through caloric restriction by reducing the food intake of the animals , a process that also prolongs life span in vertebrates . mutations in daf genes prolong life span by partial activation of the dauer formation pathway . the dauer stage is a dormant , long - lived , alternative developmental stage which is induced by adverse environmental conditions . the increased life span of all dauer formation mutants that have been tested is suppressed by loss of function mutations in daf - 16 . in fact , we found that while daf - 16 ( m26 ) lives 18 . 1 ± 2 . 6 days on average with a maximum life span of 25 days , the double mutants daf - 16 ( m26 ) clk - 2 ( qm37 ) lives an average life span of 21 . 7 ± 5 . 8 days with a maximum life span of 41 days . furthermore , although double mutants with two long - lived dauer formation mutations do not live longer than mutants carrying only one of the component mutations , daf - 2 ( e1370 ) clk - 2 ( qm37 ) double mutants live substantially longer than daf - 2 , almost three times longer than the wild type . we have shown that while daf - 2 ( e1370 ) lives 29 . 3 ± 10 . 3 days on average with a maximum life span of 51 days , the double mutants daf - 2 ( e1370 ) clk - 2 ( qm37 ) lives an average life span of 54 . 5 ± 21 . 4 days with a maximum life span of 101 days . in contrast to these observations , the effects of clk - 2 and eat - 2 are not additive . in fact , the double mutants live somewhat shorter than eat - 2 mutants . we have shown that eat - 2 ( ad465 ) lives 30 . 0 ± 7 . 0 days on average with a maximum life span of 42 days , and that the double mutants daf - 2 ( e1370 ) clk - 2 ( qm37 ) live 26 . 6 ± 6 . 3 days on average with a maximum life span of 45 days . these observations are also consistent with the finding that daf - 2 eat - 2 double mutants live longer than daf - 2 or eat - 2 mutants in isolation ( lakowski , b . and hekimi , s . science 272 , 1010 ( 1996 )). together , these results show that daf - 2 and clk - 2 prolong life span by distinct mechanisms but that clk - 2 works in a way that resembles caloric restriction . in addition to the clk phenotype displayed by clk - 2 ( qm37 ) mutants , they exhibit a temperature - sensitive embryonic lethal and sterile phenotypes at 25 ° c . we knew that qm37 is a temperature sensitive mutation and that the mutants lay dead embryos when they are transferred to 25 ° c . ( hekimi , s . et al ., genetics 141 , 1351 ( 1995 )). these findings have now been extended , and the phenotype of clk - 2 mutants at 25 ° c . has been examined after a number of temperature shift experiments at different stages of development , from permissive to restrictive temperature and vice versa . at the permissive temperatures ( 15 to 20 ° c . ), clk - 2 embryos all develop normally and grow up to become long - lived adults . however , when hermaphrodites that have developed at a permissive temperature are transferred to 25 ° c . before egg - laying begins , they produce only progeny that dies during embryogenesis at various stages of development . when these hermaphrodites , that have been producing dead embryos at 25 ° c ., are transferred back to 18 ° c ., they lay only dead eggs at first , but start to lay live eggs that develop into adults after having been 5 - 6 hours at 18 ° c . when hermaphrodites that are kept at 18 ° c ., and that lay only live eggs , are transferred to 25 ° c . it also takes 5 - 6 hours before they lay only dead eggs . both conditions ( laying live or dead progeny ) are fully reversible upon temperature shift even when the animal &# 39 ; s entire post - embryonic development was carried out at a single temperature ( permissive or non - permissive ). in addition , when larvae that developed at the permissive temperature are shifted to 25 ° c ., some arrest development and others reach a sterile and sick adulthood . these phenotypes are fully reversible as well . finally , all these lethality and sterility phenotypes displayed by clk - 2 ( qm37 ) mutants at 25 ° c . can be fully maternally rescued : heterozygous animals produce only live progeny at any temperature . we have also found that the embryonic lethality at 25 ° c . is a strict maternal phenotype . that is to say that despite qm37 behaving as a recessive mutation , a wild - type allele in the genome of the embryo is not sufficient for survival if the mother was clk - 2 / clk - 2 homozygous mutant . when clk - 2 hermaphrodites are mated to wild - type males at 25 ° c . they nonetheless produce only dead embryos . when shifted to 18 ° c . at various times after mating they produce live males , indicating that the mating was successful . the strictly maternal lethal action of clk - 2 indicates a very early focus of action , before activation of the zygotic genome . to establish how early clk - 2 acts during the development of the worm , we dissected embryos at the 2 - 4 cell stage from wild - type n2 and clk - 2 mutant hermaphrodites kept at either permissive ( 20 ° c .) or non - permissive ( 25 ° c .) temperature and transferred them to the other temperature ( or not , as a control ). as summarized in table 3 , we found that when development up to the 2 - 4 cell stage proceeded at the permissive temperature , almost all eggs hatched and carried out further embryonic and post - embryonic development at 20 ° c . { 100 % of dissected n2 eggs ( n = 35 ) hatched and 87 % of dissected clk - 2 eggs hatched ( n = 91 )} or 25 ° c . { 97 % of dissected n2 eggs ( n = 36 ) hatched and 91 % of dissected clk - 2 eggs hatched ( n = 93 )}. in contrast , when eggs had carried out development up to the 2 - 4 cell stage at 25 ° c . and were then transferred to 20 ° c ., only very few clk - 2 eggs hatched and succeeded in completing development at 20 ° c . { 12 % of dissected clk - 2 eggs hatched ( n = 136 )}. as a control , when n2 eggs had carried out development up to the 2 - 4 cell stage at 25 ° c . and were then transferred to 20 ° c ., almost all hatched and succeeded in completing development at 20 ° c . { 98 %, n = 45 }, or at 25 ° c . { 96 %, n = 45 }. these results indicate that clk - 2 is required for viability before the 2 - 4 cell stage . clk - 2 is required in a narrow window between the very end of oogenesis and the initiation of embryonic development . indeed , clk - 2 hermaphrodites that have spent 26 hours of adulthood at 25 ° c ., carry on average 9 . 9 developing eggs in the uterus ( n = 125 ), but produce on average 10 . 7 dead eggs ( n = 133 ) when shifted down to permissive temperature . this observation indicates that , upon transfer from the lethal temperature , only one oocyte or embryo dies on average in addition to those that have already formed an eggshell . this corresponds to the time at which fertilization , oocyte meiosis , pronuclear formation and eggshell formation occurs . we observed early embryonic development using dic microscopy but did not detect any obvious abnormality in the events which follow fertilization . the early embryos look invariably normal and healthy with cells and nuclei of normal size and shape . we also visualized dna using dapi in oocyte and early embryos and did not detect abnormal patterns of chromosome segregation or any other defects . finally , meiosis per se is not affected as clk - 2 homozygous males can sire abundant cross - progeny at 25 ° c . when mated to wild - type hermaphrodites . we have molecularly identified the gene clk - 2 by positional cloning . the gene was localized on the genetic map within an interval of 0 . 84 cm on the left cluster of linkage group iii of caenorhabditis elegans , between the genetic markers sma - 4 and mab - 5 ( hekimi , s . et al ., genetics 141 , 1351 ( 1995 )). we refined this genetic position by a series of additional mapping experiments involving the genetic markers sma - 3 , unc - 36 , lin - 13 , and lin - 39 by multi - and two - point crosses . the following multi - point results were obtained ( the genotypes whose progeny was scored is given in brackets ): dpy - 17 14 clk - 2 18 unc - 32 ( clk - 2 / dpy - 17 unc - 32 ); lon - 1 47 clk - 2 23 unc - 36 ( clk - 2 / lon - 1 unc - 36 ); sma - 4 35 clk - 2 3 mab - 5 14 unc - 36 ( clk - 2 / sma - 4 mab - 5 unc - 36 ); sma - 3 18 clk - 2 0 lin - 13 10 unc - 36 ( sma - 3 clk - 2 unc - 36 / lin - 13 ); clk - 2 3 lin - 13 49 unc - 32 ( lin - 13 / clk - 2 unc - 32 ); sma - 3 40 lin - 39 0 clk - 2 33 unc - 36 ( sma - 3 clk - 2 unc - 36 / lin - 39 ). in addition , a two - point cross was carried out ( clk - 2 unc - 36 /++) and 5 / 630 uncs were found to develop quickly ( p = 0 . 4 cm ). we also found that the deletion ndf2o does not delete clk - 2 and that the duplication qdp3 does include clk - 2 . we thus placed the gene clk - 2 within an interval of 0 . 3 cm , between sma - 3 ( at − 0 . 9 cm on lgiii ) and lin - 13 ( at − 0 . 6 cm on lgiii ), and lying very close to the gene lin - 39 ( at − 0 . 65 cm ). by aligning the genetic and physical maps , we predicted the physical region which likely would contain the clk - 2 gene . groups of cosmids from this region were tested for their ability to rescue the clk - 2 mutant by dna microinjection . clk - 2 was rescued by a pool of 4 cosmids ( h14a12 , k07d8 , c34a5 , c07h6 ). individual injection of cosmids c07h6 and c34a5 also rescued the clk - 2 phenotype , narrowing the physical position of clk - 2 to within approximately 15 kb . fragments of cosmid c07h6 ( obtained by restriction digests from base pair 31 , 528 to base pair 36 , 545 of cosmid c07h6 [ accession : ac006605 ]) were then tested for rescue and a short region of approximately 5 kb was shown to fully rescue the phenotype , indicating that this 5 kb fragment contains the clk - 2 gene . the identity of the gene was further confirmed by phenocopying the clk - 2 phenotype with rna interference ( rnai ) experiments , that is the injection of double stranded rna corresponding to the coding mrna sequence of a gene of interest to fully abolish the function of this gene . double stranded rna was produced by in vitro transcription from a cdna ( est 447b4 , gift of y . kohara ) that mapped to this region , and injected into wild - type as well as into clk - 2 ( qm37 ) worms . all wild - type and clk - 2 animals injected with clk - 2 dsrna initially produced embryos that hatched and developed into worms phenotypically resembling clk - 2 ( qm37 ), that is , slow development , slow defecation and sterility . after 24 hours , the injected animals started laying only dead eggs . these results confirmed the identity of clk - 2 . the observation that rnai - treated mothers produce dead eggs , a phenotype more severe than the weak embryonic lethality normally present in the clk - 2 ( qm37 ) strain , indicated that qm37 is a partial loss - of - function mutation that displays the null phenotype only at 25 ° c . we further confirmed the identity of the gene by characterizing the molecular lesion underlying the clk - 2 mutation . genomic dna from the clk - 2 ( qm37 ) strain was isolated and the nucleotide sequence of the clk - 2 region determined . the qm37 mutation is a g -& gt ; a transition at in base 2321 of the cdna . the structure of the gene was established experimentally by determining the nucleotide sequence of the est yk447b4 cdna , thus defining the actual intron / exon boundaries in vivo and allowing to predict the encoded protein . the gene clk - 2 is sl2 transpliced . we have further established the gene structure by rt - pcr experiments , which not only showed that clk - 2 is sl2 transpliced , but also that the gene just upstream to clk - 2 , which we called cex - 7 , is expressed and is sl1 transpliced . the transplicing by sl1 of a gene placed upstream , and by sl2 of a gene downstream constitutes a hallmark of genes which are in an operon , and are transcriptionally co - expressed . therefore , clk - 2 and cex - 7 are transcriptionally co - expressed , and thus play functionally related roles . the cdna ( yk215f6 ) that corresponds to cex - 7 was also sequenced . the gene cex - 7 encodes a predicted protein of 481 amino acid residues in length ( fig3 ), that is similar to a human polypeptide of 550 amino acids ( fig3 ). clk - 2 encodes a predicted protein of 877 amino acids and the clk - 2 ( qm37 ) mutation is a cysteine to tyrosine substitution at residue 772 of the predicted protein . we have been able to detect the expressed protein by western blot analysis of protein extracted from both mutant and wild - type worms at different temperatures . clk - 2 is similar to unique predicted proteins in human ( fig3 ), drosophila ( fig1 ), rice ( fig1 ), soybean ( fig2 - 30 ) and to saccharomyces cerevisiae tel2p ( fig3 ) and in other species ( fig7 - 12 , 14 , 17 - 19 ). the structural conservation among these proteins is illustrated by the alignment presented in fig3 , 39 , 40 and 41 . no homologue of tel2p had previously been recognized because aligning multiple sequences is necessary to reveal the homology . tel2p has been shown to bind yeast telomeric dna in a sequence - specific manner ( kota , r . s . runge , k . w . chromosoma 108 , 278 ( 1999 ); kota , r . s ., runge , k . w . nucleic acids research 26 , 1528 ( 1998 )) and to affect the length of telomeres . we determined the spatial and temporal expression pattern of the gene clk - 2 by analyzing transcript and protein levels ( fig5 ) and by examining transgenic worms carrying reporter fusions . panel a of fig5 illustrates northern and western ( 37 ) analyses of clk - 2 at all developmental stages . the level of ck - 2 mrna appears uniform throughout pre - adult development ( e , embryos ; l1 - l4 , larval stages ; a , adult ; glp - 4 , adult glp - 4 ( bn2ts ) mutants at 25 ° c .). the low level of clk - 2 expression in l4 larvae and in glp - 4 mutants that lack a germline at 25 ° c . suggest that most clk - 2 rna in adults is located in gametes . in contrast to the finding with mrna , the level of clk - 2 protein is similar at all stages including adults ( lower panel of a ). panel b of fig5 , clk - 2 mrna and protein levels ( lower panel ) in mutant backgrounds ( glp - 4 ( bn2ts ), fem - 3 ( q20ts ), which produces only sperm at 25 ° c ., and fem - 2 ( b245ts ), which produces only oocytes at 25 ° c .). the mrna and protein levels of clk - 2 expression are similar to the wild type in fem - 3 and elevated in fem - 2 mutants . glp - 4 mutants have wild type protein levels but reduced mrna levels . clk - 2 mrna appears strongly elevated in clk - 2 mutants . panel c of fig5 , clk - 2 protein levels in wild type and clk - 2 mutants at three temperatures . clk - 2 ( qm37 ) is a missense ( c772y ) and temperature - sensitive mutation . the level of clk - 2 is greatly reduced in the mutant , but does not change as a function of temperature in either the wild type or the mutant . worms were raised at 20 ° c . except when specified otherwise . we grew populations of worms synchronized at different developmental stages and extracted total or polya + selected rna from them . the highest level of clk - 2 mrna is detected in young adults . we used several mutants to determine the origin of the transcript level in young adults . since clk - 2 mrna level is highly reduced in glp - 4 ( bn2ts ) mutants that do not develop a germline at the non - permissive temperature , most of the rna present in wild - type young adults is in the germline . given the low abundance of rna in l4 larvae which possess an already large germline but only a few male gametes , most of the clk - 2 mrna in wild - type adults is localized to meiotic gametes , in particular to oocytes . we have analyzed the clk - 2 protein level in different genetic backgrounds and in worms grown at different temperatures . we immunodetected clk - 2 protein on western blots by using two different polyclonal antibodies , mg19 and mg20 . we obtained these antibodies by injecting rabbits with a bacterially expressed his 10 - clk - 2 protein . we found that the content of clk - 2 protein is uniform across developmental stages in wild type and in clk - 2 animals . furthermore , the concentration of clk - 2 is not different from the wild type in , glp - 4 mutants which have no germline , nor in fem - 3 and fem - 2 mutants that contain only sperm and only oocytes , respectively . taken together these results indicate that gametes specifically accumulate high levels of clk - 2 mrna , presumably as a store to be used by the embryo . finally , we observed that in qm37 mutants , while the level of clk - 2 mrna appears slightly elevated , the level of clk - 2 protein is greatly reduced . we constructed three reporter constructs of the clk - 2 gene that comprised different upstream promoter regions and / or the coding region of the clk - 2 gene fused to the green fluorescent protein . two of the constructs are transcriptional fusions , one containing bases 36932 to 37319 and the other containing bases 36932 to 40010 of cosmid c07h6 [ accession : ac006605 ]. a third reporter construct ( pmq251 ) is a translational fusion that contains bases 30501 to 37319 , except bases 35078 to 36545 which are part of the gene cex - 7 . we microinjected these reporter genes into wild type and clk - 2 ( qm37 ) mutant worms , and analyzed numerous worms from several transgenic lines carrying these reporters . we observed that the clk - 2 promoter region directs expression in all somatic tissues , including hypodermis , muscles , neurons , excretory system , gut , pharynx , somatic gonad , vulva , and presumably all cells . no expression was visible in the germline , despite the use of both standard and complex array mixes . this is commonly the case for transgenes in c . elegans and does not indicate an absence of expression in the germline tissue . a full length fusion protein between clk - 2 and gfp ( encoded by the construct pmq251 ) that complements the mutant phenotype for development , behavior and viability at 25 ° c ., is localized exclusively into the cytoplasm , which is consistent with the absence of an obvious nuclear localization signal in the predicted protein . the pattern observed is not a consequence of overexpression as very small transgene concentrations have been used in complex arrays ( kelly et al ., genetics 146 : 227 - 238 , 1997 ). however , although the nucleus appears dark in the fluorescent images , it still may contains very small amounts of the fusion protein . this analysis of expression indicates that clk - 2 protein is indeed produced in the nematode , as shown by western analysis on total c . elegans extracts using anti - clk - 2 antibodies . yeast tel2p has been found to bind telomeric repeats in vitro , and thus is expected to be nuclear in vivo . however , it was found that clk - 2 :: gfp is excluded from the nucleus . subtelomeric silencing and telomere length regulation can also be affected by events in the cytosol . for example , hst2p , a cytosolic nad +- dependent deacetylase homologous to sir2p , can modulate nucleolar and telomeric silencing in yeast perrod et al ., embo j ., 20 ( nos 1 & amp ; 2 ), 197 - 209 , 2001 ), and the nonsense - mediated mrna decay pathway appears to affect both telomeric silencing and telomere length regulation ( lew et al ., molecular and cellular biology , 18 ( 10 ): 6121 - 6130 , 1998 ). other proteins that affect telomere length , like tankyrase smith , s . and de lange , titia , j . of cell science , 112 : 3649 - 3656 , 1999 ), are mostly extranuclear chi , n .- w ., and lodish , h . f ., j . of biological chemistry , 275 ( 49 ): 38437 - 38444 , 2000 ), with only a very small amount of protein localized to the telomeres smith et al ., science 282 : 1484 - 1487 , 1998 ). telomere function has been found to affect replicative life span in yeast and in vertebrate cells . it also has also been shown to affect the immortality of the germline in c . elegans . however , an involvement of telomere function in determining the life span of muiticellular organisms has not been established prior to this work . here we have shown that the maternal - effect clk - 2 gene of c . elegans regulates telomere length , and prolongs life span by a mechanism that is distinct from the regulation of dauer formation but resembles caloric restriction , and encodes a protein that is similar to the yeast telomere binding protein tel2p . the timing of the lethal action of clk - 2 ( qm37 ) indicates a function for clk - 2 during the events that immediately follow fertilization , including oocyte meiosis , pronuclei formation and karyogamy , and this would be consistent with the known importance of telomeres in meiosis . however , our examination of the morphology of chromosomes in oocytes and early embryos did not reveal any abnormalities . similarly , although telomere function appears linked to double strand break repair and chromosome stability , including in worms , clk - 2 mutants appear only moderately sensitive to ionizing radiation and do not display signs of chromosome instability . in fact , we examined the response of clk - 2 ( qm37 ) mutants to gamma - radiation and found that among the progeny of irradiated animals , the proportion of dead eggs and larvae was about 10 times higher than among the progeny of irradiated wild - type animals . there is also no report of a function of tel2p in the response to ionizing radiation in yeast . the null phenotype of tel2 is lethal but a hypomorphic mutation of tel2 results in short telomeres and slow growth ( runge , k . w . and zakian , v . a . molecular & amp ; cellular biology 16 , 3094 ( 1996 ). tel2p has been shown to be involved in telomere position effect ( tpe ) and thus contributes to silencing of sub - telomeric regions ( runge , k . w . and zakian , v . a . molecular & amp ; cellular biology 16 , 3094 ( 1996 ), one of the best studied examples of epigenesis . mutations in other genes , such as tell , that also result in telomere shortening do not result in abnormal tpe , indicating that the tpe defect in tel2 mutants is not a simple consequence of short telomeres . furthermore , the rapid death and abnormal cellular morphology of cells fully lacking tel2p suggests that tel2p , like rap1p and the sir proteins , also functions at non - telomeric sites ( zakian , v . a . ann . rev . genet . 30 , 141 ( 1996 )). in light of this , the absolute requirement for maternal clk - 2 in embryogenesis suggests a function for clk - 2 in silencing genes that - are needed during some part of the worm &# 39 ; s life cycle but that are deleterious when expressed during early development . the study of the mes genes which are required for the specification of the germline in c . elegans and can confer maternal - effect sterile phenotype has shown that mechanisms of silencing are part of the normal development of worms . indeed , some of the mes genes have been found to encode proteins that resemble polycomb group proteins and appear generally to be involved in the regulation of chromatin structure . mutations in clk - 1 and clk - 2 ( qm37 ) at the permissive temperature confer a similar clk phenotype and in particular an increase of life span of similar magnitude ( lakowski , b . and hekimi , s . science 272 , 1010 ( 1996 ) and show similar pattern of interactions with other aging genes ( lakowski , b . hekimi , s . proc . nat . acad . sci . us 95 , 13091 ( 1998 )). clk - 1 is a mitochondrial protein of unknown function ( felkai , s . et al , embo journal 18 , 1783 ( 1999 ).). in an attempt to explain many puzzling features of the clk - 1 phenotype , including the maternal effect , we have suggested that the action of clk - 1 is to indirectly , but specifically , regulate nuclear gene expression ( branicky r , c . benard , s . hekimi , bioessays 22 : 48 , 2000 ). one possibility might be that clk - 2 might be one of the molecules that implements changes in gene expression in response to alteration of clk - 1 activity . clk - 1 clk - 2 double mutants have a phenotype that is more severe than either of the single mutants ( lakowski , b . and hekimi , s . science 272 , 1010 ( 1996 ). however , the phenotype of a double mutants containing the null allele clk - 1 ( qm3o ) is not more severe than a double mutant containing the much weaker allele clk - 1 ( e2519 ), in contrast to the situation with clk - 3 , for which double mutants with clk - l ( qm30 ) are much more severe than with clk - 1 ( e2519 ) ( lakowski , b . and hekimi , s . science 272 , 1010 ( 1996 ). these observations indicate that at least part of the activity of clk - 1 requires clk - 2 . furthermore , clk - 1 clk - 2 double mutant embryos resemble clk - 1 mutant in that the interphases of the embyronic cell cycles are slowed down , but mitoses appear unaltered . this indicates that clk - 2 as well as clk - 1 is involved in determining the rate of cellular multiplication , and thus affects mechanisms which are known to lead to cancer when deregulated . telomere function has also been implicated in the replicative life span of yeast , where sir proteins mediate silencing at the telomeres and the hm loci . when displaced from the telomeres by mutation or by shortage of telomeric dna , part of the sir complex can move to the nucleolus where its action appears to prolong replicative life span . these and other studies indicate that telomeres are a reserve compartment for silencing factors and participate in regulating silencing in other parts of the genome . it has been suggested that the effect on cellular senescence of expressing telomerase in cultured human cells might be mediated by an effect on silencing rather than by preventing chromosome erosion . therefore , clk - 2 must be involved in determining cellular senescence , including in vertebrates , and affect in this manner aging and diseases linked to cellular senescence such as cancer . as mentioned earlier , clk - 2 is similar to predicted proteins in vertebrates and plants as well as to saccharomyces cerevisiae tel2p . tel2p has been shown to bind yeast telomeric dna in a sequence - specific manner , and to affect the length of telomeres . we found that clk - 2 also affected the length of telomeres in worms ( fig5 ). in worms , genomic dna hybridization to telomeric probes after restriction digestion with hinfi reveals the end fragments of the chromosomes carrying the telomeres , which appear as smears , as well as fragments carrying tracts of telomeric repeats that are internal to the chromosome , which appear as discrete bands . the regions where the telomeric smears are the most intense are indicated by stippled lines . two lanes are shown for each genotype and each temperature . the length of telomeres in wild - type and clk - 2 mutants was examined by southern blotting at three temperatures , including the lethal temperature . for 18 and 20 ° c ., worms were grown for numerous generations at each temperature before dna extraction . since clk - 2 ( qm37 ) is lethal at 25 ° c ., mixed stage worms from 20 ° c . were transferred to and grown at 25 ° c . for 3 - 4 days . genomic dna was prepared , hinfi digested and separated on a 0 . 6 % agarose gel at 1 . 2vcm − 1 . southern blots were hybridized with gamma 32 p datp end - labelled ttaggcttaggcttaggcttaggcttaggcttaggcttaggcttagg oligo - nucleotide . use of a second type of probe , made by direct incorporation of alpha 32 p datp during pcr amplification of telomeric repeats from the plasmid ctel55x with primers t7 and shp1617 ( gaataatgagaattttcaggc ), gave identical results . the extrachromosomal array in mq691 clk - 2 ( qm37 ); qmex159 contains a clone with the entire coding sequence of clk - 2 as well as the promoter of the operon but excluding cux - 7 ( bases 37319 to 31528 of cosmid c07h6 , except bases 36544 to 35077 ) and rescues clk - 2 mutant phenotypes . in clk - 2 mutants , telomeres are two to three times longer than in the wild type on average ( fig5 ). however , the chromosomes are of wild - type length in strain mq691 , which carries an extrachromsomal array expressing wild - type clk - 2 in a clk - 2 ( qm37 ) chromosomal background ( fig5 ) indicating that the alteration of telomere length clk - 2 ( qm37 ) mutants is indeed due to abnormal function of clk - 2 in these mutants . the length of terminal telomeric fragments in the animals of the strain mq691 , which carries an extrachromosomal array ( qmex159 ) containing functional wild - type clk - 2 that rescues development and behavior at 25 ° c . in a clk - 2 ( qm37 ) chromosomal background , was further analyzed . a similar clone containing the qm37 mutation fails to rescue the clk - 2 phenotypes . in mq691 animals , the length of terminal telomeric fragments appear very similar to the wild - type , and even shorter , indicating that the lengthened telomere phenotype of qm37 mutants is rescued by the expression of clk - 2 (+). the telomere length of non - transgenic animals of the strain mq931 , derived from mq691 , which have lost the extrachromosomal array and thus again lack clk - 2 (+) has been further examined . the terminal telomeric repeats in this strain are long again . thus , the lengthened telomere phenotype of clk - 2 ( qm37 ) can be rescued by clk - 2 (+) and reverses back to mutant length after the loss of the transgene . in c . elegans , tracks of numerous ttaggc telomeric repeats are present at the ends of the 6 chromosomes ( wicky c ., et al ., proc . natl . acad . sci . usa , 93 : 8983 - 8988 , 1996 ). in addition , numerous interstitial blocks of perfect and degenerate telomeric repeats are located more internally to the chromosomes ( c . elegans ii . edited by riddel d et al . published by plainview , n . y . : cold spring harbor laboratory press ( 1997 ), pp 56 - 59 , chapter 3 ). analysis of genomic dna after restriction digestion with a frequent cutter that does not cleave within the telomeric repeats ( hinfi ), electrophoresis , and hybridization to telomeric probes , reveals the telomere - carrying end fragments of the chromosomes ( wicky c ., et al ., proc . natl . acad . sci . usa , 93 : 8983 - 8988 , 1996 ). telomeres , and thus the restriction fragments containing them , are heterogeneous in size and appear as smears . on the other hand , restriction fragments carrying tracts of internal telomeric repeats are of fixed size and appear as discrete bands in the 0 . 5 - 3 kb range ( ahmed s , hodgkin j . nature , 403 ( 6766 ): 159 - 64 , 2000 ; and wicky c ., et al ., proc . natl . acad . sci . usa , 93 : 8983 - 8988 , 1996 ). the quality of visualization of the length of telomeres in c . elegans with a hybridization probe that detects telomeric repeats is marred by the numerous internal repeats that also hybridize to the probe . in particular , they can mask the detection of the telomeres of chromosomes that have small hinfi terminal telomeric fragments . to further describe the telomere phenotype of clk - 2 ( qm37 ) mutants , the length of individual telomeres has been characterized . the subtelomeric regions just adjacent to the terminal telomeric repeats share no sequence homology among the chromosomes ( wicky c ., et al ., proc . natl . acad . sci . usa , 93 : 8983 - 8988 , 1996 ). taking advantage of this sequence diversity , probes specific to particular telomeres were designed . the size of a given hinfi terminal fragment is related to the fixed distance between the most exterior hinfi site of the chromosome and the beginning of the telomeric repeats , and by the variable number of terminal telomeric repeats . upon genomic dna digestion with hinfi and southern blotting with a probe specific to a particular telomere , the terminal fragments , which are heterogeneous in size , again appear as a smear . detailed results obtained for two individual telomeres are illustrated in fig5 . the length of the terminal fragment of the left telomere of chromosome x is ˜ 1 kb longer in qm37 than in the wild type , ranging from 2 . 4 to 4 . 2 kb and from 1 . 7 to 2 . 8 kb , respectively . this telomere is of wild - type length in mq691 , which carries the rescuing transgene , and lengthens again to the clk - 2 ( qm37 ) values in the non - rescued mq931 strain . the length of another terminal fragment ( left telomere of chromome iv ) is also ˜ 1 kb longer in qm37 than in the wild type , ranging from 2 . 2 to 3 . 9 kb and from 1 . 8 to 2 . 8 kb respectively . this telomere becomes shorter than the wild type in mq691 , ranging from 1 . 3 to 2 kb only . this telomere acquires the mutant length again after loss of the transgene in mq931 . thus , the overexpression of clk - 2 can shorten the tracks of telomeric repeats , but not at each telomere . the gene coq7 / cat5 of the yeast s . cerevisiae is the homologous gene to clk - 1 ( ewbank , j . j . et al , science 275 , 980 ( 1997 ); pct / ca97 / 00768 ). while coq7p does not structurally resemble an enzyme , it is required for ubiquinone biosynthesis in yeast . a second gene , coq4 ( marbois , b . n . and clark , c . j biol chem , 271 , 2995 ( 1996 ) ( accession : np — 010490 ), that is also required for ubiquinone biosynthesis in yeast , does not code for an enzyme , and like coq7 , has no homologue in bacteria . we have generated a deletion mutant worm to describe the role of the gene coq - 4 and its functional relationships with the clk genes we have identified and described , including clk - 1 , clk - 2 , and gro - 1 . the gene coq - 4 in c . elegans largely corresponds to the predicted gene t03f1 . 2 of the cosmid t03f1 ( accession u88169 ). it is localized on lgi , between unc - 73 and unc - 11 . coq - 4 is less than 100 kb away from the characterized gene , unc - 73 , and less than 40 kb away from the other characterized gene , unc - 11 . coq - 4 is 843 bp long and has four exons . we experimentally established the structure of the gene coq - 4 by sequencing a cdna clone , yk140a2 . a second gene , t03f1 . 3 , which is highly similar to phosphoglycerate kinase ( pgk ), is 264 bp upstream of coq - 4 and , as we have shown , forms an operon with coq - 4 and is thus transcriptionally co - expressed . we showed that coq - 4 is in the same operon as t03f1 . 3 by rt - pcr , that coq - 4 is sl2 trans - spliced and that t03f1 . 3 is sl1 trans - spliced . we have generated a coq - 4 -( qm143 ) deletion mutant by carrying out pcr - based mutant screen following a large scale ems mutagenesis wild - type worm . coq - 4 ( qm143 ) has a 1469 bp deletion , which starts from 44 bp downstream of t03f1 - 3 , and ends 406 bp downstream of coq - 4 . the predicted gene downstream is 1521 bp away from coq - 4 and 1115 bp away from the deletion . therefore , coq - 4 ( qm143 ) is a null mutant and it does not affect the coding sequence of any gene other than coq - 4 . cog - 4 ( qm143 ) is a non - strict maternal - effect lethal mutation . most of the progeny , from a homozygous coq - 4 hermaphrodite , dies during embryogenesis . very few eggs hatch , and those which do hatch fail to complete development and die as young larvae . we have also shown that maternal cog - 4 product is sufficient for homozygous coq - 4 to develop normally until adulthood . however , homozygous coq - 4 adult worms from a heterozygous hermaphrodite ( coq - 4 /+) are paralytic and are defective in egg - laying . moreover , coq - 4 homozygous mutants can be mated by n2 males and produce progeny , which grow normally . taken together , these results indicate that either maternal or zygotic coq - 4 product is sufficient for coq - 4 mutant to go through embryonic and post - embryonic development . coq - 4 deletion ( qm143 ) is kept as a balanced strain , coq - 4 ( qm143 )/ unc - 73 ( e936 ). we demonstrated that the phenotypes of the coq - 4 mutants , in particular the sterility , can be rescued by an extrachromosomal wild - type copy of coq - 4 dna fragment . the spatial expression pattern of coq - 4 was determined by using translational reporter fusion to the green fluorescence protein , containing 2 . 2 kb of upstream promoter region . these constructs were injected into both n2 and heterozygous coq - 4 ( coq - 4 / unc - 73 ), and animals of several transgenic lines were examined . we found that a functional coq - 4 :: gfp is expressed in the hypodermis , muscles , the gut , the excretory canal and embryos . in addition , we detected that the reporter fusion localizes to the mitochondria , in particular , in muscle cells . while the invention has been described in connection with specific embodiments thereof , it will be understood that it is capable of further modifications and this application is intended to cover any variations , uses , or adaptations of the invention following , in general , the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth , and as follows in the scope of the appended claims . ala val glu ala ile cys glu ser ile asp tyr phe gly lys phe leu asp trp leu lys tyr val val glu lys ser leu thr ser ala ile cys arg glu phe ala ser ala cys ser asn ile pro glu lys val ser asn cys cys ala lys ala leu ser gly glu his val lys tyr ile asn thr val lys trp ile phe lys met asn leu val gln gly ile gln lys ala met leu leu ala his asp asp ile val thr ala ala pro phe thr ser phe tyr gly ser gly gly pro tyr met lys thr val ala glu ile ile ser ser gly arg ile asp ile thr asn lys asp gly leu leu val gln met ile glu trp ile gly ser leu asn asn phe asp ser gln trp arg arg met met phe leu ile phe gln glu pro thr tyr gln gly ile gln gln ile leu lys arg cys ile glu ala thr asp leu thr gly thr leu lys thr ile glu ile leu ile asn phe val tyr arg thr lys glu gln phe ala ile gln leu leu glu thr ser val lys ile trp ser asp leu asn tyr ala lys ser ala pro glu ser gln glu arg his ile val arg met ile leu tyr leu val his leu phe arg thr cys ser ser ile asp trp glu ser leu phe leu asn ser met asp gly val his cys arg met ser met leu pro met tyr val gln ser gly ile phe val asn gln ala leu cys lys gln ala thr lys his arg ser lys thr his gly ser asp val gly lys ile trp phe glu glu met thr ser ile leu glu his gly glu pro lys asn lys val thr pro pro ala tyr ile ala asp ala phe gly thr pro lys phe lys glu thr val asp glu ile ala val ala cys ala pro gly gln gly phe ser ile lys gln arg leu leu his tyr ile cys val met ala gln gln leu arg ile gly gly pro thr leu ser ile ala gly val val asn arg leu ala gln ala ala lys tyr met phe tyr val arg cys gly val cys pro gln ile his arg met ser ser glu leu ile ser tyr ala thr pro his arg phe ser glu asn ala lys leu arg asp leu met asp glu leu phe asp val pro ala leu ile gly trp phe lys asp met thr arg gln phe gly his ser val thr lys his leu gln his ala leu ser ser ser glu asp gly gly his ile phe cys thr leu asp gln ala phe leu val leu met glu thr ile glu gly ala ala gly thr gln pro gly phe ile leu leu arg glu thr leu leu gly lys val val ala leu pro asp his leu gly asn arg leu gln gln glu asn leu ala glu phe phe pro gln asn tyr phe arg leu leu gly glu glu val leu thr gln gly ser tyr leu his gln arg val cys trp arg leu val glu gln val pro asp arg ala met glu ala val leu thr gly leu val lys glu leu leu glu thr trp gly ser ser ser ala ile arg his thr pro leu pro gln gln arg his val ser lys ala val leu ile cys leu ala ser met met ala gly val lys cys arg leu asp ser ser leu pro ile his pro glu gly pro pro leu lys phe gln tyr glu glu asp glu pro tyr asp met ser gly asp arg glu leu lys ser ser lys ala pro ala tyr val arg asp cys val glu ala leu thr thr ser glu asp ile leu his leu glu glu lys thr cys val val gly phe ala gly leu arg arg met asp ile leu asp val leu thr leu ala ala gln glu leu ser asn thr pro cys leu pro glu ala ala val ser gln pro gly ser ala glu phe val trp ala leu arg phe his ile asp ala tyr val arg gln leu leu ile gln val leu lys glu leu leu glu thr trp gly cys ser ser ala val arg his thr pro leu glu gln gln cys tyr ile ser lys ala ile leu val cys leu ala his leu gly glu pro glu leu gln asp ile arg asp glu leu leu ala ser met met ala gly val lys cys arg glu val ile ser ser arg ile his pro glu gly pro leu leu lys phe ser gln phe tyr gly leu asn tyr ser leu arg gln arg met asp ile leu gln arg arg ser gln his gly pro pro val pro gly thr met cys ser lys gly cys pro gln arg asp val ser gly val pro asn glu phe ser ser val ala gly tyr phe phe phe pro leu leu gln his phe asp val trp ala leu arg phe his val asp ile tyr val arg arg gly leu leu leu ile gln val leu lys glu leu leu glu thr trp gly cys ser ser ala val arg his thr pro leu glu gln gln cys tyr ile ser lys ala ile leu val cys leu ala his leu gly glu pro glu leu gln asp ile arg asp glu leu leu ala ser met met ala gly val lys cys arg glu val ile ser ser arg ile his pro glu gly pro leu leu lys phe pro glu pro ala gly asp cys ser ser ser gln phe tyr gly leu asn phe phe pro leu leu gln his phe asp leu thr ser glu val ala val lys ala pro val tyr val arg asp cys val glu ala leu thr ala ser arg val ala glu tyr leu thr ala gln phe tyr ala leu asn tyr ser pro glu thr phe ala pro val ser tyr gln lys leu leu leu arg gln trp leu lys ser leu his phe val leu gln cys asp asp asn arg glu tyr phe asp leu glu pro tyr ser trp leu leu ser gln ala ile asn asp tyr ala val ala pro arg gly arg lys val val his thr ile leu thr pro val asp asn lys gln leu ile thr leu ala ser tyr leu asn ser asn asp thr thr thr thr ile asp gln arg pro lys phe val ile asp leu leu his leu leu arg glu lys val glu asn tyr gln val phe leu cys arg gln phe his thr asp asn ser phe tyr ser ala ser val leu arg ala lys thr lys arg tyr phe ser lys pro lys ala gly asp gln met glu lys ala asn pro phe his pro val ala gly thr phe phe phe ser leu val arg gly gln arg thr arg gln met leu tyr val lys tyr glu ile asp thr gln leu leu val asn leu leu asn thr met ser thr pro ala his val leu ala gln his phe ala glu ser leu asn glu leu gln arg trp leu asn asp phe ile arg ser pro leu val gly gly val asp pro ser leu phe ser gly asn phe glu met leu his ile val trp leu glu thr phe tyr arg gly val ala phe pro thr phe ala arg leu leu asn ser lys ile gly ala ile glu val asp thr phe gln leu asp pro thr thr arg ile trp ser lys thr met glu ala val thr asp ala glu his pro ser asp val glu ala phe trp thr ile trp thr leu phe his arg asn val ile his gln ala ser val arg gln ala lys cys his phe his pro asn ala val lys gln cys val leu glu cys pro pro thr thr gln arg leu ala ser val trp ser lys arg glu phe leu gln met ser arg glu glu leu asp arg thr lys asp val met his ser ile leu gln gly val ser cys arg leu glu asn pro gly asp leu val arg trp glu phe gly leu gln thr ala ser ile thr asn thr met glu asn gly asp gly glu asn lys arg ser ala ser leu thr glu val asn glu ser ala phe val leu ala asp pro asn glu ile val asp leu ala thr lys ala ile tyr val ala glu lys leu val arg ala ser pro asp glu arg gln arg ala leu ile ala leu leu val thr arg pro phe glu ser ala asn ser lys thr leu lys pro lys his glu ala arg gly pro leu ser thr pro trp lys lys val ser glu thr gly ser phe his leu asn trp ala asn arg phe glu arg glu leu gln ser lys pro gly gln thr gln asn ser thr asp trp ser gln asn arg phe pro leu tyr ala ala ala phe met leu pro ala met lys glu phe asp lys lys arg his gly met leu gly val cys met gln cys ala ser met his pro glu ala ser ala leu ala ile ser leu leu asp met leu gln arg arg glu val cys asn his pro glu ala tyr val arg arg ala val leu phe ala ala ser glu gly asn leu asp leu ser arg ala leu glu trp ile arg thr trp ala leu gln ile ala asp ser asp ile asp arg asp cys tyr thr met pro trp arg glu val ser glu ser gly thr leu leu asn trp ser his lys ser arg lys trp gly leu gly lys ala lys asp leu gln thr glu trp ser lys asn arg phe pro leu tyr ala ala ala phe met leu pro val met gln gly tyr asp lys arg ser his gly val asp leu leu asn arg asp phe val val leu gly lys leu ile tyr met leu gly val cys leu glu trp ile arg thr trp ala leu pro cys cys arg asn tyr arg met his ile asn gly tyr asp pro pro cys gly phe his ser glu met pro trp arg glu val ser glu ser gly thr leu leu asn trp ser his lys ser arg lys trp gly leu gly lys ala lys asp leu gln thr glu trp ser lys asn arg phe pro leu tyr ala ala ala phe met leu pro val met gln gly tyr asp lys arg ser his gly val asp leu leu asn arg asp phe val val leu gly lys leu ile tyr met leu gly val cys leu leu asp met ile arg ser arg ala val leu glu trp ile arg thr trp ala leu pro cys cys arg asn tyr arg met his ile asn gly tyr asp pro pro cys gly phe his ser glu met ala leu gln thr ser arg xaa pro thr gln gln asn gln met glu tyr ser his asn lys leu pro lys leu ile tyr met leu gly val cys met lys ser val ala met his phe ala ala ala cys val leu val ala leu his pro thr tyr ile ser gln asn gln met glu tyr ser his asn lys leu pro met tyr ala ala ala phe met leu pro ala met glu gly tyr asp lys lys arg gln gly met leu gly val cys met lys ser val ala met his pro glu ala ser arg ala ser pro asp glu leu lys his ala ala arg asp met thr arg thr leu val gln val arg cys ser asp ile ala leu glu gly ala glu gln val ile arg ala leu his ser leu val thr leu leu phe pro phe val ala ser asn trp leu gly cys phe pro phe met ala gln lys tyr glu ile ser thr gly leu glu trp ile arg thr trp ala leu asp val ile gln leu his val glu met ala leu gln thr ser arg ala leu glu gln val ile arg ala leu his ser leu val thr leu leu phe pro phe val ala ser asn trp leu gly cys phe pro phe met ala gln lys tyr ala leu arg lys ser asn asp ala asp gly val glu arg ala ile asp val ala glu lys leu ile arg ala ser pro asp glu leu lys his ala ala arg asp met thr arg thr leu val gln val arg cys ser asp ile thr cys ile gln leu his val glu met ala leu gln thr ser arg ala asp ala ser lys val thr ile lys ile pro his leu asn asn trp ser met glu tyr ser his asn lys leu pro met tyr ala ala ala phe met leu pro ala met glu gly tyr asp lys lys arg gln gly val asp leu pro ser leu leu asn met leu arg ser arg glu val cys his his gln val ala leu his pro thr tyr ile ser ser thr leu leu glu gly asn ala val glu ala ile cys glu ser ile asp tyr phe gly lys phe leu asp trp leu lys tyr val val glu lys ser leu thr ser ala ile cys arg glu phe ala ser ala cys ser asn ile pro glu lys val ser asn cys cys ala lys ala leu ser gly glu his val lys tyr ile asn thr val lys trp ile phe lys met asn leu val gln gly ile gln lys ala met leu leu ala his asp asp ile val thr ala ala pro phe thr ser phe tyr gly ser gly gly pro tyr met lys thr val ala glu ile ile ser ser gly arg ile asp ile thr asn lys asp gly leu leu val gln met ile glu trp ile gly ser leu asn asn phe asp ser gln trp arg arg met met phe leu ile phe gln glu pro thr tyr gln gly ile gln gln ile leu lys arg cys ile glu ala thr asp leu thr gly thr leu lys thr ile glu ile leu ile asn phe val tyr arg thr lys glu gln phe ala ile gln leu leu glu thr ser val lys ile trp ser asp leu asn tyr ala lys ser ala pro glu ser gln glu arg his ile val arg met ile leu tyr leu val his leu phe arg thr cys ser ser ile asp trp glu ser leu phe leu asn ser met asp gly val his cys arg met ser met leu pro met tyr val gln ser gly ile phe val asn gln ala leu cys lys gln ala thr lys his arg ser lys thr his gly ser asp val gly lys ile trp phe glu glu met thr ser ile leu glu his gly glu pro lys asn lys val thr pro pro ala tyr ile ala asp ala phe gly thr pro lys phe lys glu thr val asp glu ile ala val ala cys ala pro gly gln gly phe ser ile lys gln arg leu leu his tyr ile cys val met ala gln gln leu arg ile gly gly pro thr leu ser ile ala gly val val asn arg leu ala gln ala ala lys tyr met phe tyr val arg tyr gly val cys pro gln ile his arg met ser ser glu leu ile ser tyr ala thr pro his arg phe ser glu asn ala lys leu arg asp leu met asp glu leu phe asp val pro ala leu ile gly trp phe lys asp met thr arg gln phe gly his ser val thr lys his leu gln met val leu glu thr leu lys gln gly leu asp ser ser gln ile his glu ala leu ile gln leu asp ser tyr pro arg glu pro val asp leu asp ala ser met val leu ile lys phe val ile pro val tyr pro ser ile ile ser phe glu pro gly cys leu thr phe tyr leu lys ala ser ser lys leu phe asn val leu ala asn arg ile asp met ala lys tyr leu gly tyr leu arg leu gln trp lys phe leu leu glu ser asn glu ser leu ile asp gln lys arg leu ile ala lys phe leu leu pro tyr leu phe ala val his asn leu asn his ser gln arg glu glu ile ala his asp glu arg phe leu asn gly val thr lys his leu gly ser asn gly gly his leu lys tyr glu ser asp phe lys ile asn ile pro asn leu lys asn pro ser ile cys asn thr gln thr asp val gly lys asp lys ile thr glu val ser gly his val gln ser leu thr leu asp cys arg ile val phe leu lys asp leu met lys glu tyr glu lys thr gly glu ser arg lys ala pro leu ile pro leu leu lys gln thr val lys leu ile arg gln lys ala asp phe gln leu glu val gly tyr tyr ala gln gly ile leu ser ser ile val cys leu asn asn glu phe asp glu pro leu phe glu gln trp arg ile asn ala leu thr ser ile leu val val leu pro glu lys val asn gly ala ile asn ile leu phe asn ser ser ala arg glu leu arg gly leu asp asp pro thr ile val lys pro lys phe asp phe pro thr asn arg leu pro trp asp asp gln ser his his asn ser arg leu val glu val gln glu ser thr ser met ile lys pro leu ala his gly trp leu asn gly ile asp val gly thr tyr asn cys ala asn pro val his asp phe glu ser met thr glu leu met asn met ala arg asn phe pro leu tyr leu gly ser glu ala glu asp phe asn lys ala gln his leu tyr leu lys pro met ala val ile lys ile thr val val leu pro arg met thr ile pro gly gln ser ile ser asn trp asp leu met glu arg leu lys arg ala ile asp pro ile gln met asp gly phe ser met lys val ser gly phe ala glu pro leu lys val lys thr lys glu ala lys leu asp phe pro ser arg his asp trp asp pro asp thr val tyr leu ala arg ile pro val lys trp phe cys asp gly tyr asn asp leu pro ser glu arg arg leu arg val ala met glu ala phe gly ser val arg val val asp ile pro ile cys asp pro leu tyr lys gly phe ala thr ala met asp ser leu arg asn arg lys trp phe asp arg ser arg his leu ser glu val gln ile ala lys arg ala trp glu val met glu arg leu lys gly met val gln asn his gln phe arg ala ala glu phe lys ile asp phe pro thr arg his asp trp asp ser phe phe arg asp ala lys asp met asn glu thr leu pro gly glu arg pro asp thr ile his leu glu gly leu pro cys lys trp phe ala val phe glu lys phe gly glu ile arg asn val asp ile pro met leu asp pro tyr arg glu glu met thr gly arg asn phe his thr phe ser phe gly gly his leu asn phe glu ala tyr val gln tyr arg glu tyr tyr lys gly glu asp gly lys ala val ala cys asn ile lys val ser phe asp ser thr lys his leu ser asp ala ser ile lys lys arg gln pro lys arg gly asp met val ala ala met gly glu thr thr ala ile gly pro val leu glu asn ile arg lys arg met glu ser asp val val thr val lys tyr ile asp asn leu glu his leu tyr val met gln arg tyr arg glu thr his asp phe thr his ile ala leu glu gln lys thr asn met leu gly glu val thr val lys tyr phe glu gly ile gln tyr gly leu pro met cys val thr gly gly ile phe gly gly ala arg leu leu thr lys asn arg gln glu leu val asp arg asn leu pro trp val val glu gln ala thr asn ala arg phe phe met ala phe asp trp glu pro asp ile leu phe ser lys gly his pro gly phe trp arg val leu ser ile ala ala leu leu asn pro arg arg his asp met ile ala cys met gln ala ser glu glu gly gln arg ile met ala asp lys pro arg ile his thr ser thr ile asp phe lys tyr leu glu thr leu pro pro asp thr phe gly ala ala tyr val lys phe leu lys asp asn gln val thr pro asp ser arg met ala val arg phe leu glu asp pro lys leu ala tyr leu met thr arg tyr arg glu cys his asp leu ile his thr val leu asp met pro thr asn met leu gly glu val ala val lys trp val glu ala leu asn thr gly leu pro met cys tyr gly gly ala val his tyr leu pro trp ala leu glu asn gly lys arg thr lys pro leu met pro val tyr trp glu lys arg trp glu gln asn ile his glu leu arg ser glu leu gly ile thr val leu asn lys ala tyr arg his asp met val ala val leu gly glu thr thr gly his arg thr leu lys val leu arg asp gln met arg arg asp pro glu gly ala glu val his asp met leu his thr leu leu gly met pro thr asn ile leu gly glu ile val val lys trp phe glu ala val gln thr gly leu met phe tyr leu asn ala his leu glu ile asn lys val val asp val gln leu arg leu leu phe thr ala ala glu arg lys val asn tyr pro gly his val pro leu ser pro leu gln arg ile phe leu val ala gly ser ala ile met gly leu lys ala pro trp arg gly gly asp met ile ser val leu gly asp ala ser gly gln pro phe phe leu his arg leu leu asn lys met leu val asp lys thr gly arg glu ile leu lys asp leu pro pro asn thr leu gly lys ile tyr val asp trp ile asp lys pro glu glu ala tyr val met gln arg tyr arg glu ser his asp phe tyr his ala ile cys asn met pro thr asn ile glu gly glu leu ala ile lys trp leu glu phe val asn met gly leu pro val gly ala leu ser ala leu phe gly pro leu arg leu asn cys glu gln ala ser arg phe arg arg val tyr ile pro trp ser ile arg asn gly leu asn ala met ile ile glu arg ala arg val pro leu ser arg trp gln gln ala leu leu glu arg pro arg val val ser glu gln val gly his ala trp asp leu pro glu asn thr phe gly ala ala tyr ala lys phe met gly leu trp his thr leu phe gly leu pro thr asn leu ile gly glu ser ser leu lys val ile glu phe glu gln met tyr leu pro met cys met leu ser val ile gly gly thr val arg phe asn glu lys gln arg ser met phe leu lys his tyr leu pro trp ala val arg ala gly arg gln cys thr asp leu met cys val tyr tyr glu arg his phe ser glu asp leu glu gln val arg arg lys trp gly ile ile pro ala pro gln his ala leu tyr asn pro tyr arg his asp met val ala val leu gly glu thr thr gly cys his thr leu lys phe leu arg asp gln met lys lys gly arg glu tyr leu arg phe leu asp val asn lys val ser pro asp ile gln arg tyr arg glu val his asp met leu his thr leu leu gly met pro thr asn met leu gly glu val val val lys trp phe glu ala val gln thr gly leu pro met cys ile leu gly ala leu phe gly pro tyr pro asp his ile pro thr thr pro leu gln lys met leu leu ala arg asp gln met lys lys asp pro glu gly ala gln ile leu gln glu lys trp phe glu ala val gln thr gly leu pro met cys ile leu gly ala leu phe gly pro ile arg leu arg thr gln ser leu gln val leu phe ser glu leu ile pro trp ala ile gln asn gly arg arg ala thr cys val leu asn ile tyr tyr glu gln arg trp glu gln pro leu thr tyr pro asp his ile pro thr thr pro leu gln lys met leu leu ala arg asp gln met lys lys asp pro glu gly ala gln ile leu gln glu glu glu leu ala tyr val ile gln arg tyr arg glu val his asp met val lys trp phe glu ala val gln thr gly leu pro met cys ile leu gly ala leu phe gly pro ile arg leu arg thr gln ser leu gln val leu phe ser glu leu ile pro trp ala ile gln asn gly arg arg ala thr cys val leu asn ile tyr tyr glu gln arg trp glu gln pro leu leu pro ala asn thr phe gly ala ala tyr ala arg phe met gly ser trp his thr leu phe asp leu pro thr asn leu ile gly glu thr ala leu lys val ile glu phe glu gln met gly leu pro met cys leu leu ser val ile gly gly thr ala arg phe ser glu lys gln arg lys leu thr asp leu met cys val tyr tyr glu arg his phe asp glu asp leu tyr pro glu his ile pro thr ser val leu gln lys val leu leu ala arg asp gln met lys arg asp pro glu gly ala gln ile leu gln glu leu pro glu gly ser phe gly cys ala tyr leu his phe leu asp val glu glu leu ala tyr val ile gln arg tyr arg glu ile his asp met glu leu ala tyr val ala met arg ala arg glu val his asp phe trp his thr leu phe asp leu pro thr asn leu ile gly glu ser ala leu lys val ile glu phe glu gln met his leu pro met cys val met ser val leu gly gly thr ala arg phe ser glu lys gln arg lys leu phe tyr gln his tyr phe pro trp ala val arg ala gly thr gln cys asn lys phe val gln asn ser glu his leu tyr val met gln arg tyr arg glu thr his asp phe asn his val leu leu gln met pro thr his met pro met cys val thr ala gly leu phe gly ala ala arg leu arg lys asn his arg his arg phe leu thr gln his leu pro trp ile val glu gln ala thr lys gly arg phe phe met ala ile asp trp glu asn his phe val ala ala thr thr arg ser ile trp asp pro val asn ala asp thr gln pro arg val thr asp glu thr leu glu phe ala ser arg gln pro pro gly thr phe gly his arg tyr ala gln phe met lys phe xaa xaa phe thr pro asn gly arg thr pro val ala his ile ala asp pro thr leu ala tyr val met gln arg gln arg glu thr his asp phe leu his pro tyr arg his asp met leu pro val leu gly glu thr thr gly cys his thr leu lys phe leu arg asp gln met lys lys asp pro glu tyr leu arg phe leu asn ala asn lys val ser pro asp thr arg ala pro thr arg phe val asp asp glu glu leu ala tyr val ile gln arg gly glu thr thr gly lys pro ala phe glu arg val leu glu arg met ile ser ala asn val gly his ala trp asp leu pro lys asn thr phe gly ala ala tyr ala arg phe leu gly ser xaa asn phe ser pro asp asp arg pro pro val arg phe met asp thr asp glu leu ala tyr val | 2 |
referring to fig1 to 4 , embodiments of the invention will be described below in detail . fig1 is an exploded perspective view of a putter head according to an embodiment of the present invention . fig2 is a perspective view of the putter head . fig3 is a bottom view of the putter head . fig4 is a cross - sectional view taken along line iv - iv in fig3 . the putter head includes a forward half body 10 made of a low specific gravity metal material , a backward half body 20 made of a high specific gravity metal material , and an insert 30 made of rubber or a synthetic resin . the insert have hardness in a range of 20 ( jisc ) to 90 ( jisc ), preferably in a range of 30 ( jisc ) to 80 ( jisc ). the forward half body 10 has a shape of almost rectangular parallelepiped extending in a toe - heel direction connecting a toe ( left end in fig2 ) and a heel ( right end in fig2 ). a sole face 10 s of the forward half body 10 has a circular arc shape in which a central part in the toe - heel direction slightly bulges toward the lower side . a front face of the front half body 10 is a face surface 10 a for hitting a ball . on the back face of the forward half body 10 , a recess 11 is formed in the neighbor of a middle part in the toe - heel direction . this recess 11 includes an entrance portion 11 a , an innermost portion 11 b , and a step surface 11 c . the innermost portion 11 b is concave from the innermost side of the entrance portion 11 a ( the side of the face surface 10 a ) toward the face surface 10 a . the step surface 11 c is formed in a boundary between the entrance portion 11 a and the innermost portion 11 b . the entrance portion 11 a is a notch extending in the toe - heel direction and opening to the back face and the bottom face of the forward half body 10 . the innermost portion 11 b is a groove being concave from the face surface 10 a side of the entrance portion 11 a . the inner most portion 11 b extends in the toe - heel direction . the innermost portion 11 b is slightly smaller than the entrance portion 11 a . the step surface 11 c resides all around the innermost portion 11 b . notch portions 12 are formed on both ends of the forward half body 10 in the toe - heel direction on the back surface thereof . the notch portions open to the sole face 10 s . insertion holes 13 for bolts 14 are formed to communicate the face surface 10 a side of the notch portion 12 with the face surface 10 a . each insertion hole 13 has a large diameter portion on the face surface 10 a side and a small diameter portion on the back face side , as with an insertion hole 23 a described later . a head portion of the bolt 14 is disposed in the large diameter portion of the insertion hole 13 . a shaft insertion hole 15 is formed in an upper face of the forward half body 10 on the heel side . the backward half body 20 includes an outer circumferential bar - like body 21 having a semi - circular arc shape , a central bar - like body 22 integrated with a central part of the outer circumferential bar - like body 21 in an extending direction , and a lid body 23 attached to a top end face of the central bar - like body 22 by a bolt 24 . a rear bottom face of the central bar - like body 22 constitutes a slant face 20 a ( fig4 ) with a gradient rising toward the aftermost end of the backward half body 20 . both end portions of the outer circumferential bar - like body 21 have a shape and dimension so that the both ends can be fitted into the notch portions 12 . female screw holes ( not shown ) coaxial with the insertion hole 13 are formed on surfaces of the both ends of the outer circumferential bar - like body 21 , respectively . the both ends of the outer circumferential bar - like body 21 is fitted to the notch portions 12 and the bolts 14 are screwed into the screw holes , thereby the forward half body 10 and the backward half body 20 are connected . the lid body 23 has dimension so that the lid body 23 can be fitted to the entrance portion 11 a as shown in fig4 , the lid body 23 is fixed to the central bar - like body 22 by screwing a bolt 24 into the female screw hole 22 a provided at the top end face of the central bar - like body 22 through the insertion hole 23 a provided in the lid body 23 . the insert 30 has longitudinal and transverse dimensions almost equivalent to the innermost portion 11 b , and has a thickness ( dimension in forward and backward direction of the head ) slightly larger than the depth of the innermost portion 11 b ( e . g ., by about 0 . 5 mm to 2 mm ). in assembling the putter head , after the insert 30 is inserted into the innermost portion 11 b , the backward half body 20 with the lid body 23 is assembled with the forward half body 10 , and then the bolts 14 are screwed . thereby , both end faces 21 a of the outer circumferential bar - like body 21 are contacted with the innermost faces of the notch portions 12 , and the lid body 23 is contacted with the step surface 11 c while pressing the insert 30 . the insert 30 is closely contacted with all the inner periphery of the innermost portion 11 b and the entire face of the lid body 23 . when a shaft is attached to the putter head 1 , a putter is finished . since the insert 30 absorbs shock occurring when the putter hits a ball , the feeling of hitting is softened . the insert 30 is closely contacted with the forward half body 10 and the lid body 23 without gap . also , a distance between the insert 30 and the face surface 10 is short ( preferably , in a range of from 1 mm to 5 mm , more preferably , from 2 mm to 4 mm ). therefore , the shock is sufficiently absorbed . in this embodiment , since the backward half body 20 having high specific gravity is formed in a circular arc , the sweet area of the putter head is wide , and less shock occurs when a golfer hits a ball out of the sweet spot . preferably , the forward half body 10 is made of aluminum , magnesium , titanium , or their alloy , with the specific gravity of from 2 to 5 . it should be noted that the invention is not limited thereto . preferably , the backward half body 20 is made of stainless , copper alloy , tungsten alloy ( e . g ., w — cu alloy , w — ni alloy ), with the specific gravity of 7 to 14 . | 0 |
the overall system architecture for the present invention 20 is best shown in fig1 . as shown therein , an insurance company computer system 22 , which itself may be virtually any computer configuration or even a stand alone pc accesses the internet 24 through any convenient access point 26 such as even including an isp ( internet service provider ), as known in the art . also connected to the internet 24 is a web portal 28 which is preferably provided by a server appropriately programmed as explained herein below . this web portal 28 may be appropriate configured as desired to suit any particular business relationship or arrangement , although preferably the inventors herein and assignee of this invention have determined that a 24 / 7 or full time connection to the internet 24 is preferable , except for scheduled downtimes for maintenance , etc . the service provider 30 which for purposes of explaining the present preferred embodiment is preferably a vehicle rental organization , has itself an internet portal mainframe 32 connected by a bi - directional communication link 34 to a second computer network 36 which may itself preferably have a mainframe server 38 . this second computer system 36 is preferably a network having a database 40 for communication with what may be thousands of branch offices each of which has its own computer interface 44 which communicates to this second mainframe server 38 to conduct the integrated business functions of a service provider organization . instead of communicating with the branch offices directly , a reservation may be communicated to a centralized location for further processing , such as a call center , and then relayed on to an appropriate branch office . this might be desirable under certain circumstances , such as if a branch office is closed , or when a purchaser requires some specialized service such as close monitoring of the rental . this may be done electronically and automatically , or with human intervention . it should be noted that the particular computer configuration chosen as the preferred embodiment herein may itself be subject to wide variation . furthermore , the term “ mainframe ” as used herein refers solely to a computer which can provide large scale processing of large numbers of transactions in a timely enough manner to suit the particular business application . preferably , as is presently used by the assignee hereof , an ibm as / 400 mainframe computer is used as each of computers 32 , 38 . however , as is well known in the art , computer technology is subject to rapid change and it is difficult if not impossible to predict how these computer systems may evolve as technology advances in this art . for example , it is not beyond the realm of possibility that in the not so distant future a network of computers would provide the processing power to conduct these business operations as presently handled by “ mainframe ” computers . thus , the term “ mainframe ” is not used in a limiting sense but merely to indicate that it is descriptive of a computer suited to handle the processing needs for a large scale business application . it should also be noted that the communication link 46 extending between the server 42 and each of the branch offices 44 may have alternative configurations . for example , in some applications access over the internet may itself be adequate , recognizing the vagaries of internet service availability , reliability , and processing speed . alternatively , this communication link 46 could well be a dedicated pipeline providing broadband service connection full time with back up connections to ensure continuous communication between a particular branch office or groups of branch offices and the service providers business operations computer system 36 . some branch offices might even be served through satellite links . indeed , it is even possible that a mixture of these wide variations of service level be present within a single organization &# 39 ; s structure depending upon communication link cost and availability balanced against service needs . it should merely be noted for present purposes that this communication link 46 serves as the electronic umbilical cord through which branch offices 44 communicate with the business computer system 36 of the present invention . attached hereto as exhibits are functional descriptions of the software program &# 39 ; s resident on the computers comprising the two computer systems 32 , 38 which implement the present invention . more particularly , attached hereto as exhibit a is a functional description of the software to implement the integrated business functions resident on the as / 400 or mainframe computer 38 . attached hereto as exhibits b and c are related flow diagrams and explanatory text , respectively , for the software resident on the mainframe as / 400 computer 32 . attached hereto as exhibit d is a functional description of the software resident on computer 32 but which also appears on the server 28 which creates the web portal for access to the mainframe 32 and its resident program . server 28 may use a bi - directional gui to character based interface translator program , well known to those skilled in the art , to present the displays and information obtained and transmitted between the user and the computer 32 . however , the software of exhibit d could also be run on server 28 , as would be appreciated by those of skill in the art . it is believed that these functional descriptions and accompanying text as exemplified in these exhibits are adequate to enable an ordinary programmer to implement corresponding software programs for executing the preferred embodiment of the present invention using ordinary programming skills and without inventive effort . as a further example of the flow of data and the functional advantages provided by the present invention , reference is made to fig2 . as shown therein , a right hand column is identified as “ ecars ” which represents the integrated business software implemented as part of the mainframe operation 38 in computer network 36 . the center column headed “ arms ” is resident on mainframe computer 32 and coordinates the communication of data . the left column headed “ arms / web ” represents the software resident on computer but which is presented on server 28 and accessible by users through the internet . along the left side of fig2 are designated three separate sections of operational activity . these are “ reservation ” followed by “ open ” and concluded by “ close ”. generally , the functional descriptions are arranged in chronological order proceeding from the top of fig2 to the bottom . however , some functional features are permitted throughout the entirety of one of the three periods designated at the left side of fig2 . one such example is the “ message ” function which allows messages to be sent between users at one business organization 22 and branch offices 44 and others connected to the other business organization 30 . proceeding with a description of the transaction , the first set of communications allow for the reservation of the services . these can include requests for authorization or a rescind authorization request to be sent from the service provider to the service purchaser . correspondingly , authorizations and authorization cancels can be sent from the services purchaser to the services provider . confirmations are communicated upon confirmation of an authorized reservation request . authorization changes may be made and communicated from the services purchaser to the service provider . corresponding rental transaction changes may be communicated from the services provider to the services purchaser . as indicated , through the entirety of this process messages may be sent between users and others connected or having access to the integrated business software , as desired . the consummation of this portion of the transaction is a reservation that has been placed , authorized , confirmed , and provision is made for changes as necessary . during the next phase of the transaction , a reservation is opened and services intended to be provided are started . generally , and preferably for the rental of vehicles , a start and end date are established in the reservation process . however , along the way , transactional changes may be made , such as for changing the type of vehicle provided , extensions may be requested and entered from either business partner , messages may be transmitted between the business partners , and the transaction may be terminated such as by voiding the contract by one business partner or terminating the authority by the other business partner . the term “ reservation ” has been used herein to refer not only to the act of placing the order but also to filling the order for services including providing the rental vehicle to the ultimate user and even invoicing for those services . the last phase of the process involves closing the transaction . during this phase of the transaction , the contract is indicated as being closed and invoiced , the services purchaser can approve invoices , reject invoices , and also remit invoices . such invoice remittance may also include the actual transfer of funds through an electronic funds transfer medium , or otherwise as previously arranged between the business partners . it should be understood that this is a streamlined description of the handling of a transaction , and by no means is exhaustive . for example , much more functionality is available to the user including accessing the data base to generate production reports regarding status of open or closed reservations , preparing action item lists to allow a user to organize and prioritize his work , obtaining information available in the system from having been entered by others which would otherwise require phone conversations which are inefficient and occupy still another person &# 39 ; s time . a more detailed explanation of the functionality provided is found in the exhibits . in summary , the present invention creates almost an illusion that the services purchaser , and the great number of users at various levels of the multi - tier purchaser users , are actually part of the services provider organization in that immediate online access is provided to significant data which enable the user to make reservations for services , monitor those services as they are being provided , communicate with those providing the services , obtain information relating to the status of services as they are being provided , and close transactions , all by interacting with the services provider business organization over that user &# 39 ; s pc and without human interaction required by the business providers personnel . by way of contra - distinction , for many years business has been conducted on a human level by customers picking up the telephone and calling services providers and talking to their human counterparts in order to convey information , place orders , monitor orders , including obtaining information as to status , canceling orders , questioning invoices and paying invoices , along with a myriad of other related interactions . not only did the conduct of business in this manner entail significant amounts of human resources at both ends of the transaction , but it also led to inefficiencies , mistakes and delays all of which increase the cost of doing business and contribute to an increased risk of services being rendered in an unsatisfactory manner in many instances to the end user . the present invention has taken the preexisting solution of providing electronic communication between the business partners to another level by “ web enabling ” this system for improved connectivity , improved usability , reduced training , enhanced mobility , and other advantages as described herein . various changes and modifications to the preferred embodiment as explained herein would be envisioned by those of skill in the art . examples of these changes and modifications include the utilization of computer systems configured in any one of a myriad of ways using present technology alone . for example , mobile computers are presently available and wireless technology could be used to extend the integrated business network of the services provider , as well as match the mobility needed by the various users connected to and using the present invention . the particular software , and various aspects and features of its design , have been adapted for particular application to the vehicle rental business . of course , computer software applications satisfying other business needs would necessarily require adaptation to their particular business models . thus , it is envisioned by the inventors herein that the various software programs described herein would be matched to the particular business application to which the invention is utilized . these and other aspects of the preferred embodiment should not be viewed as limiting and instead be considered merely as illustrative of an example of the practical implementation of the present invention . these changes and modifications should be considered as part of the invention and the invention should be considered as limited only by the scope of the claims appended hereto and their legal equivalents . | 6 |
reference will now be made in detail to the exemplary embodiments consistent with the present invention , an example of which is illustrated in the accompanying drawings . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . it is apparent , however , that the embodiments shown in the accompanying drawings are not limiting , and that modifications may be made without departing from the spirit and scope of the invention . fig1 is an exploded perspective view of a light fixture assembly 10 consistent with the present invention . light fixture assembly 10 includes a front cover 100 , a led assembly 200 , a socket 300 , and a thermally - conductive housing 400 . fig2 is an exploded perspective view of led assembly 200 . led assembly 200 may include a reflector , or optic , 210 ; a first shell 220 ; a lighting element , such as an led 230 ; a thermally conductive material 240 ; a printed circuit board 250 ; a second shell 260 ; a thermal interface member 270 ; and a thermal pad 280 . first shell 220 may include an opening 221 adapted to receive optic 210 , which may be fixed to first shell 220 through an optic - attaching member 222 . first shell 220 may also include one or more airflow apertures 225 so that air may pass through airflow apertures 225 and ventilate printed circuit board 250 , led 230 , and thermally - conductive housing 400 . first shell 220 may also include one or more engaging members 223 , such as protrusions , on its outer surface 224 . while in this exemplary embodiment engaging members 223 are shown as being “ t - shaped ” tabs , engaging members 223 can have a variety of shapes and can be located at various positions and / or on various surfaces of led assembly 200 . furthermore , the number of engaging members 223 is not limited to the embodiment shown in fig2 . additionally , the number , shape and / or location of airflow apertures 225 can also be varied . however , in certain applications , ventilation may not be required , and airflow apertures 225 may thus be omitted . second shell 260 may include a resilient member , such as resilient ribs 263 . the thickness and width of ribs 263 can be adjusted to increase or decrease compression force , and the openings between ribs 263 can vary in size and / or shape . ribs 263 in second shell 260 are formed so as to provide proper resistance to create compression for thermal coupling of led assembly 200 to thermally - conductive housing 400 . second shell 260 may also include one or more positioning elements 264 that engage with one or more recesses 251 in printed circuit board 250 to properly position printed circuit board 250 and to hold printed circuit board 250 captive between first shell 220 and second shell 260 . positioning elements 264 may also engage with receivers ( not shown ) in first shell 220 . first and second shells 220 and 260 may be made of a plastic or resin material such as , for example , polybutylene terephthalate . as shown in fig2 , the second shell 260 may also include an opening 261 adapted to receive thermal interface member 270 , which may be fixed to ( 1 ) second shell 260 through one or more attachment members 262 , such as screws or other known fasteners and ( 2 ) a thermal pad 280 to create thermal interface member assembly 299 . thermal interface member 270 may include an upper portion 271 , and a lower portion 272 with a circumference smaller than the circumference of upper portion 271 . as shown in fig3 , lower portion 272 may be inserted through opening 261 of second shell 260 such that upper portion 271 engages with second shell 260 . second shell 260 may be formed of , for example , nylon and / or thermally conductive plastics such as plastics made by cool polymers , inc ., known as coolpoly ®. referring now to fig2 , thermal pad 280 may be attached to thermal interface member 270 through an adhesive or any other appropriate known fastener so as to fill microscopic gaps and / or pores between the surface of the thermal interface member 270 and thermally - conductive housing 400 . thermal pad 280 may be any of a variety of types of commercially available thermally conductive pad , such as , for example , q - pad 3 adhesive back , manufactured by the bergquist company . while thermal pad 280 is used in this embodiment , it can be omitted in some embodiments . as shown in fig2 , lower portion 272 of thermal interface member 270 may serve to position led 230 in led assembly 200 . led 230 may be mounted to a surface 273 of lower portion 272 using fasteners 231 , which may be screws or other well - known fasteners . a thermally conductive material 240 may be positioned between led 230 and surface 273 . the machining of both the bottom surface of led 230 and surface 273 during the manufacturing process may leave minor imperfections in these surfaces , forming voids . these voids may be microscopic in size , but may act as an impedance to thermal conduction between the bottom surface of led 230 and surface 273 of thermal interface 270 . thermally conductive material 240 may act to fill in these voids to reduce the thermal impedance between led 230 and surface 273 , resulting in improved thermal conduction . moreover , consistent with the present invention , thermally conductive material 240 may be a phase - change material which changes from a solid to a liquid at a predetermined temperature , thereby improving the gap - filling characteristics of the thermally conductive material 240 . for example , thermally conductive material 240 may include a phase - change material such as , for example , hi - flow 225ut 003 - 01 , manufactured by the bergquist company , which is designed to change from a solid to a liquid at 55 ° c . while in this embodiment thermal interface member 270 may be made of aluminum and is shown as resembling a “ top hat ,” various other shapes , sizes , and / or materials could be used for the thermal interface member to transport and / or spread heat . as one example , thermal interface member 270 could resemble a “ pancake ” shape and have a single circumference . furthermore , thermal interface member 270 need not serve to position the led 230 within led assembly 200 . additionally , while led 230 is shown as being mounted to a substrate 238 , led 230 need not be mounted to substrate 238 and may instead be directly mounted to thermal interface member 270 . led 230 may be any appropriate commercially available single - or multiple - led chip , such as , for example , an ostar 6 - led chip manufactured by os ram gmbh , having an output of 400 - 650 lumens . fig4 is a perspective view of socket 300 including one or more engaging members , such as angled slot 310 arranged on inner surface 320 of led socket 300 . slot 310 includes a receiving portions 311 that receives and is engageable with a respective engaging member 223 of first shell 220 at an alignment position , a lower portion 312 that extends circumferentially around a portion of the perimeter of led socket 300 and is adapted to secure led assembly 200 to led socket 300 , and a stopping portion 313 . in some embodiments , stopping portion 313 may include a protrusion ( not shown ) that is also adapted to secure led assembly 200 to led socket 300 . slot 310 may include a slight recess 314 , serving as a locking mechanism for engaging member 223 . socket 300 also includes a front cover retaining mechanism 330 adapted to engage with a front cover engaging member 101 in front cover 100 ( shown in fig1 and 10 ). a front cover retaining mechanism lock 331 ( fig5 ) is provided such that when front cover retaining mechanism 330 engages with and is rotated with respect to front cover engaging member 101 , the front cover retaining mechanism lock holds the front cover 100 in place . socket 300 may be fastened to thermally - conductive housing 400 through a retaining member , such as retaining member 340 using a variety of well - known fasteners , such as screws and the like . socket 300 could also have a threaded outer surface that engages with threads in thermally - conductive housing 400 . alternatively , socket 300 need not be a separate element attached to thermally - conductive housing 400 , but could be integrally formed in thermally - conductive housing 400 itself . additionally , as shown in fig7 , socket 300 may also include a tray 350 which holds a terminal block 360 , such as a battery terminal connector . referring now to fig5 , to mount led assembly 200 in socket 300 , led assembly 200 is placed in an alignment position , in which engaging members 223 of led assembly 200 are aligned with receiving portions 311 of angled slots 310 of socket 300 . in one embodiment , led assembly 200 and socket 300 may have a circular perimeter and , as such , led assembly 200 may be rotated with respect to socket 300 in the direction of arrow a in fig4 . as shown in fig5 , when led assembly 200 is rotated , engaging members 223 travel down receiving portions 311 into lower portions 312 of angled slots 310 until engaging members 223 meet stopping portion 313 , which limits further rotation and / or compression of led assembly 200 , thereby placing led assembly 200 and socket 300 in an engagement position . referring now to fig6 a and 6b , second shell 260 is shown in compressed and uncompressed states , respectively . the rotation of led assembly 200 , and the pressing of engaging members 223 on upper surface 314 of angled slots 310 causes resilient ribs 263 of second shell 260 to deform axially inwardly which may decrease the height h c of led assembly 200 with respect to the height h u of led assembly 200 in an uncompressed state . referring back to fig5 , as engaging members 223 descend deeper down angled slot 310 , the compression force generated by resilient ribs 263 increases . this compression force lowers the thermal impedance between led assembly 200 and thermally - conductive housing 400 . engaging members 223 and angled slots 310 thus form a compression element . fig9 is a perspective cross - sectional view of an exemplary embodiment of a light fixture assembly showing led assembly 200 in a compressed state such that it is thermally and electrically connected to thermally - conductive housing 400 . as shown in fig6 b , if led assembly 200 is removed from socket 300 , resilient ribs 263 will return substantially to their initial undeformed state . additionally , as shown in fig8 a and 8b , the rotation of led assembly 200 forces printed circuit board electrical contact strips 252 on printed circuit board 250 into engagement with electrical contacts 361 of terminal block 360 , thereby creating an electrical connection between led assembly 200 and electrical contacts 361 of housing 400 , so that operating power can be provided to led 230 . alternate means may also be provided for supplying operating power to led 230 . for example , led assembly 200 may include an electrical connector , such as a female connector for receiving a power cord from housing 400 or a spring - loaded electrical contact mounted to the led assembly 200 or the housing 400 . as shown in fig7 , while in this embodiment receiving portions 311 of angled slots 310 are the same size , receiving portions 311 , angled slots 310 , and / or engaging members 223 may be of different sizes and / or shapes . for example , receiving portions 311 may be sized to accommodate a larger engaging member 223 so that led assembly 200 may only be inserted into socket 300 in a specific position . additionally , the location and number of angled slots 310 are not limited to the exemplary embodiment shown in fig7 . furthermore , while the above - described exemplary embodiment uses angled slots , other types of engagement between led assembly 200 and led socket 300 may be used to create thermal and electrical connections between led assembly 200 and thermally - conductive housing 400 . as shown in fig1 , in a second exemplary embodiment of a light fixture assembly , led assembly 230 may be mounted to a thermal interface member 270 , which may include a male threaded portion 232 with a first button - type electrical contact 233 insulated from threaded portion 232 . male threaded portion 232 of thermal interface member 270 could rotatably engage with , for example , a female threaded portion 332 of socket 300 , such that one or both of male and female threaded portions 232 , 332 slightly deform to create compressive force such that first electrical contact 233 comes into contact with second button - type electrical contact 333 and the thermal impedance between thermal interface member 270 and housing 400 is lowered . a thermal pad 280 with a circular center cut - out may be provided at an end portion of male threaded portion 232 . the thermal pad 280 can have resilient features such that resilient thermal interface pad 280 acts as a spring to create or increase a compression force to lower the thermal impedance between thermal interface member 270 and housing 400 . male and female threaded portions 232 , 332 thus form a compression element . as shown in fig1 , in a third exemplary embodiment of a light fixture assembly , a resilient thermal interface pad 500 may be provided at an end portion of thermal interface member 270 such that resilient thermal interface pad 500 acts to create a compression force for low thermal impedance coupling . socket 300 may include tabs 395 that engage with slots in thermal interface member 270 to form a compression element and create additional compression as well as to lock the led assembly into place . as shown in fig1 , in a fourth exemplary embodiment of a light fixture assembly , thermal interface member 270 may have a buckle catch 255 that engages with a buckle 355 on thermally - conductive housing 400 , thus forming a compression element . as shown in fig1 , in a fifth exemplary embodiment of a light fixture assembly , a fastener such as screw 265 may attach to a portion 365 of heat - dissipating fixture housing 400 so as to form a compression element and create the appropriate compressive force to provide low impedance thermal coupling between thermal interface member 270 and thermally - conductive housing 400 . referring back to fig1 , after led assembly 200 is installed in thermally - conductive housing 400 , a front cover 100 may be attached to socket 300 by engaging front cover engaging member 101 on the front cover 100 with front cover retaining mechanism 330 , and rotating front cover 100 with respect to socket 300 to secure front cover 100 in place . front cover 100 may include a main aperture 102 formed in a center portion of cover 100 , a transparent member , such as a lens 104 formed in aperture 102 , and a plurality of peripheral holes 106 formed on a periphery of front cover 100 . lens 104 allows light emitted from a lighting element to pass through cover 100 , while also protecting the lighting element from the environment . lens 102 may be made from any appropriate transparent material to allow light to flow therethrough , with minimal reflection or scattering . as shown in fig1 , and consistent with the present invention , front cover 100 , led assembly 200 , socket 300 , and thermally - conductive housing 400 may be formed from materials having a thermal conductivity k of at least 12 , and preferably at least 200 , such as , for example , aluminum , copper , or thermally conductive plastic . front cover 100 , led assembly 200 , socket 300 , and thermally - conductive housing 400 may be formed from the same material , or from different materials . peripheral holes 106 may be formed on the periphery of front cover 100 such that they are equally spaced and expose portions along an entire periphery of the front cover 100 . although a plurality of peripheral holes 106 are illustrated , embodiments consistent with the present invention may use one or more peripheral holes 106 or none at all . consistent with an embodiment of the present invention , peripheral holes 106 are designed to allow air to flow through front cover 100 , into and around led assembly 200 and flow through air holes in thermally - conductive housing 400 to dissipate heat . additionally , as shown in fig1 , peripheral holes 106 may be used to allow light emitted from led 230 to pass through peripheral holes 106 to provide a corona lighting effect on front cover 100 . thermally - conductive housing 400 may be made from an extrusion including a plurality of surface - area increasing structures , such as ridges 402 ( shown in fig1 ) as described more completely in co - pending u . s . patent application ser . no . 111715 , 071 assigned to the assignee of the present invention , the entire disclosure of which is hereby incorporated by reference in its entirety . ridges 402 may serve multiple purposes . for example , ridges 402 may provide heat - dissipating surfaces so as to increase the overall surface area of thermally - conductive housing 400 , providing a greater surface area for heat to dissipate to an ambient atmosphere over . that is , ridges 402 may allow thermally - conductive housing 400 to act as an effective heat sink for the light fixture assembly . moreover , ridges 402 may also be formed into any of a variety of shapes and formations such that thermally - conductive housing 400 takes on an aesthetic quality . that is , ridges 402 may be formed such that thermally - conductive housing 400 is shaped into an ornamental extrusion having aesthetic appeal . however , thermally - conductive housing 400 may be formed into a plurality of other shapes , and thus function not only as a ornamental feature of the light fixture assembly , but also as a heat sink for cooling led 230 . other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . it is intended that the specification and examples be considered as exemplary only , with a true scope and spirit of the invention being indicated by the following claims . | 5 |
referring to fig1 and 2 , a display device 10 is shown . display device 10 may be used to transmit light images or information to human observers , such as for use with display assemblies such as signs , message boards , information displays , etc . for providing lighting , alphanumeric messaging , imaging or signaling ( e . g . device - to - eye applications ). display device 10 may also be used as an interface to transmit / receive light images or information to non - human observers , such as for use with optical couplers and equipment interfaces ( e . g . device - to - device , fiber - to - fiber , fiber - to - device , or device - to - fiber applications ). the display device is adapted for use as an assembly that includes an array of pixels ( as shown schematically in fig2 ), and for use as an individual pixel ( as shown schematically in fig5 a - 5 c ) or an assembly of individual pixels . display device 10 includes a base member ( shown schematically as a substrate material 20 ), a conductive material provided thereon forming a circuit pattern , light devices 22 such as a light receiving device or a light transmission source ( such as a visible light source , shown schematically as leds in fig5 a - 5 c , an infrared light source , etc .) and a guide member ( shown as light guide 30 ) having an inward surface 32 adapted to overlay and be molded onto substrate 20 , and including apertures 40 adapted to guide the light emitted from the light source 22 ( or received from other sources when used as an optical coupler ). a contrast coating 14 is provided on an outward surface 34 of molded light guide 30 to provide a contrasting background to the light source 22 . a coating layer 16 ( e . g . a seal , sealant , lens , or an optical coating layer having characteristics that are transparent , semi - transparent , colored , etc .) may be provided on the outward surface 34 of molded light guide 30 and contrasting coating 14 to provide a desired optical imaging when viewing display assembly 10 . in other embodiments , a potting material ( e . g . epoxy , etc .) may be used to fill the volume within the apertures and a coating layer may either be included or omitted . the potting material may be an optical diffusant or a colored material to provide the desired “ output ” or “ input .” referring further to fig1 and 2 , the substrate 20 has a conductive material 25 ( see fig5 c ) provided thereon ( e . g . overlayed , embedded , etc .) to form suitable circuitry 26 for providing electrical conductivity ( e . g . anode , cathode , etc .) to an array of light sources ( shown schematically as leds 22 in fig5 a - 5 c ) that are positionable on the conductive material of substrate 20 . each light source may be a single light source or may be a plurality of light sources ( e . g . multiple leds , etc .). the conductive material may be gold , silver , aluminum , or other suitable conductor for providing circuitry on the substrate . light sources 22 may be formed of any suitable material to provide light of various colors and intensities suited for the intended application . the light sources may also be configured and controlled to combine or mix the color of the light emitted to provide other light colors . in a preferred embodiment , the light sources are leds that are provided in a sixteen ( 16 ) by sixteen ( 16 ) array and the substrate is approximately seventy - one millimeters in length and approximately seventy - one millimeters in width , with a thickness of approximately 0 . 5 millimeters . the leds are attached to the conductive material 25 of substrate 20 by a die attachment method , such as with silver epoxy conductors , or by other suitable methods . the leds may be discrete color leds configured to emit light in a single color ( e . g . monochromatic ), such as white , red , green or blue , or multicolor leds ( e . g . red , green and a mixture of red and green to create amber ) or may be any suitable combination of leds of individual colors to provide the desired display image on display device 10 . in a preferred embodiment , substrate 20 is made of a ceramic material for providing electrical insulation for circuitry 26 and to provide suitable heat transfer for heat generated by the light sources , but may be made of any suitable material such as phenolic , fiberglass , paper or other conventional types of materials commonly used in circuit board applications . the substrate 20 includes interfaces ( shown schematically as openings or cylindrical apertures 24 in fig5 c ) positioned around the leds 22 and extending through conductive material 25 and substrate 20 . the conductive material 25 extends along a wall of cylindrical apertures 24 to provide electrical continuity to conductive pads 27 located on the bottom of substrate 20 ( see fig5 c ). the conductive pads 27 are positioned to provide electrical contacts suitable for engaging other circuit components ( e . g . of a conventional type ) for use with the display device such as printed circuit boards , etc . for communicating with the light source on the top of the substrate . cylindrical apertures 24 also provide structure intended to enhance securing the light guide 30 to the substrate 20 ( to be further described ). in a preferred embodiment , the cylindrical apertures 24 are provided as four apertures that are spaced around the outside of each light source . the leds may be any conventional led adapted for mounting on a substrate and may be provided in any suitable color to provide the intended optical image from the display device . in alternative embodiments , the substrate may have any suitable size , shape ( e . g . rectangular , etc . ), thickness and any suitable number of leds or other light sources such as infrared may be provided in any pattern desired to suit the intended display device application . referring further to fig3 a - 3 b , the light guide 30 is shown as a generally planar member having an array of apertures 40 positioned to correspond to the location of the light sources such as leds 22 on the substrate 20 , such that each led is surrounded by an aperture 40 on the light guide 30 . the light guide 30 is made of a material such as a plastic - based material that may be formed in a suitable molding process and provides the desired light reflection or absorption qualities for the intended display application . the light guide material is selected to provide suitable performance characteristics such as a melting point greater than the heat generated by the light source so that the light guide material will not deform during operation . in a preferred embodiment , the light guide 30 is formed by molding the light guide material onto the surface of the substrate 20 and conductive material 25 , whereby the light guide material enters or “ flows ” into the cylindrical apertures 24 on the substrate 20 to enhance securing the light guide 30 onto the substrate in the vicinity of each of the light sources . application of the light guide material directly on to the substrate is intended to provide a seal between the light guide and substrate ( e . g . a hermetic seal , etc .). in a particularly preferred embodiment , the light guide material is plastic having a generally white color that is formed onto substrate 20 in an injection molding process , such that the thickness of the light guide is approximately one ( 1 ) millimeter . in an alternative embodiment , the light guide may be secured to the printed circuit board using other configurations , such as structure ( e . g . ribs , ridges , posts , etc .) extending from the printed circuit board , or a light guide material that adheres to the surface of the substrate , or adhesive , etc . in other alternative embodiments , the light guide may be formed of other material compositions and colors , in any desired thickness , or by other suitable molding processes . referring further to fig3 a - 3 b , the apertures 40 in the light guide 30 are formed with a side wall 42 to create a light emission profile configured to guide or focus the light emitted from each of the light sources . in a preferred embodiment , the light emission profile of the side wall 42 is in the shape of a truncated cone with a first ( e . g . “ narrow ”) portion 44 having a diameter of approximately 2 . 4 millimeters and oriented inwardly and surrounding the led 22 , and a second portion ( e . g . “ wide ”) 46 having a diameter of approximately 3 . 2 millimeters and oriented outwardly , where the side wall 42 forms an angle φ from a reference line extending perpendicularly outwardly from the printed circuit board 20 . the angle φ may be formed at any suitable angle to provide the desired emitted light leakage quantities and peripheral readability characteristics for the intended display device application . the shape of the light emission profile of side wall 42 and the angle φ are selected to optimize the emission of light for a particular application . for example , angle φ may be relatively narrow for non - visible light applications ( e . g . infrared , etc .) and may be relatively wider for visible light applications . in a particularly preferred embodiment , the angle φ is approximately within the range of 20 - 25 degrees , but may be within any suitable range to optimize the emission of light for an application . the shape of the light emission profile of the side walls may be in shapes other than a truncated cone . for example , the light guide may be formed with side walls having a parabolic shape ( e . g . cup - shape , etc .) to provide increased or modified reflective light emission or to provide a desired light reflection pattern . for example , the pattern may be adjusted to increase the light signal to noise ratio , or reduce the light signal to noise ratio , or to minimize cross - talk or interference of the light signals from adjacent light sources . in an alternative embodiment , the shape of aperture may be non - circular ( e . g . oval , elliptical , etc .) to provide the desired light transmission or reception profile . the space within the aperture 40 may be unfilled ( e . g . air space ), or may be filled with an encapsulating or fill material ( e . g . potting , etc .) for sealing and enhancing the optical image ( e . g . intensity , color , color mixing , etc .) of light source 22 . in a preferred embodiment , a fill material 45 shown schematically as a clear epoxy is provided that enhances the durability of the display assembly 10 and provides the desired optical emission of light from the light source . the fill material may be allowed to cure under ambient conditions or may be oven - cured to expedite manufacturing processing time . the fill material may result in a surface that is concave ( as shown schematically in fig5 c ) or may be generally flat of convex , as necessary to provide the desired optical performance . according to any preferred embodiment , the seal provided between the light guide and the substrate permits the fill material to be applied from the outward surface 34 ( e . g . “ front ”) of light guide 30 , rather than applying the fill material from an inward ( or “ back ”) side of the light guide as is typically necessary in conventional display applications . in an alternative embodiment , the apertures may have side walls configured at other angles suitable for providing the desired light emission qualities , or the side walls may be formed in a cupped or parabolic shape , and the fill material may be any suitable material for encapsulating the light source within the aperture and may be provided in any suitable color for providing the desired optical image . in another alternative embodiment , the light guide may also be adapted for use in applications where light is received by the circuitry on the substrate . for example , the light guide may be applied over a substrate or printed circuit board that is adapted to interface with light signals from a source ( e . g . from fiber optic sources , etc . ), in which the aperture acts as a lens to direct light from the source to the printed circuit board . referring to fig1 and 5a , a contrast coating 14 ( e . g . a layer or film of ink or other suitable pigment or coloration , etc .) may be provided on the outward surface of the light guide 30 according to a preferred embodiment . the contrast coating 14 , if used , is applied to the surface of the light guide 30 to provide a contrasting background for viewing the light images emitted from the light source ( s ) 22 ( shown as leds ) on the display device 10 . contrast coating 14 may be applied in any conventional manner such as screen printing and provided in a color such as black , or other suitable contrasting color to suit an intended display application . another coating 16 ( e . g . tape layer , adhesive panel , lens , etc .) may be provided over the contrast coating 14 to seal the apertures 40 and to improve optical uniformity of the light emitted from the light source . such coating 16 may be substantially transparent , such as for single led or may be semi - transparent , such as for a multicolor led or for multiple single - color leds to provide a color - blending effect . coating 16 may also be provided in various colors to act as a lens through which the emitted light from the light source is viewed . the assembled display device 10 provides a plurality of individual cells or pixels 50 ( shown schematically in fig4 b ) that are formed by the light source 22 ( shown as leds ) and the respective portions of the substrate 20 , conductive material 25 , light guide 30 , contrasting coating 14 and coating 16 . in an alternative embodiment , the contrast coating and the top coating may be combined into a single coating layer for application on the light guide . in another alternative embodiment , the contrast coating may be applied by other methods such as inkjet printing , screen printing or digital printing . referring to fig2 and 4 , the display device 10 may be used as a single component or separated into multiple display components according to a preferred embodiment . as shown in fig2 the assembled display device may be used as a single display assembly and may be provided in a sufficient size with a sufficient number of leds to suit a particular display device . display device 10 may be made as a large unit or board and segregated into smaller elements for use in smaller sign or display applications . referring to fig4 the display device 10 may be separated into smaller groups of pixels or into individual pixels by separating the display device 10 into subgroups of pixels or into individual pixels . the components of the display device may be made in any suitable size to provide pixels having any desired size , intensity , and light transmission / reception characteristics . in one embodiment , the pixels are separated by cutting the display device 10 along one or more lines 48 between the apertures 40 . such cutting of the display device 10 into individual pixels or groups of pixels may be performed by a dicing saw having a diamond cutting wheel in a semi - automatic or fully automated operation , or the cutting operation may be accomplished by a laser cutting techniques . in an alternative embodiment , the pixels may be separated into subgroups or individual pixels by any suitable non - destructive separation or cutting operation that does not damage the pixels . referring to fig5 a - 5 c an individual pixel of a display device is shown according to a preferred embodiment . the pixels include a corresponding portion of the substrate 20 , the conductive material 25 , the light guide 30 , the light source 22 ( shown as an led ), an encapsulating material 45 , the contrast coating 14 and ( if provided ) a coating 16 . as shown in fig1 and 5c , substrate 20 has a conductive material 25 on a top surface that provides conductive regions ( e . g . traces , patterns , etc .) of circuitry 26 for providing conductivity with the light sources 22 ( shown as leds ). the conductive material on the top of the substrate extends through aperture 24 and provides continuity with conductive pads 27 on the bottom of substrate 20 . in a preferred embodiment , four apertures 24 are configured at each corner of the pixel and are each configured to provide continuity to one of four conductive pads at the corners of the pixel that correspond to four conductive regions of circuit 26 for use with three individual leds provided as a light source . each led is electrically interconnected to the appropriate regions of circuit 26 . in a preferred embodiment the anode of each led is attached to a respective conductive region of circuitry 26 by silver epoxy and the cathode of each led is attached by a wire 29 to a common conductive region of circuitry 26 . the conductive regions of circuitry 26 may be configured for placement of the light source ( s ) approximately at the center of aperture 40 of the light guide 20 to provide improved optical performance of the display device . placement of the light source ( s ) at the approximate center of the light guide also tends to minimize the length of the wires used for electrical interconnection of the light source ( s ), which is believed to reduce the tendency of the wires to break during high temperature application or usage . the placement of the light source within aperture 40 may be substantially non - centered for applications as necessary to develop desired light emission or reception profiles . conductive pads 27 provide contact locations for suitable connecting circuitry used to control ( e . g . drive , modulate , etc .) the light sources ( such as by printed circuit boards , etc .). in a preferred embodiment , the individual pixels 50 are individually tested and graded according to established operating criteria and performance standards ( e . g . conductivity , brightness , color , clarity , etc .) and “ binned ” or segregated into groups having like or similar performance characteristics . the segregated groups of pixels may then be used to assemble signs , displays or message boards comprised of individual pixels having relatively uniform and consistent display characteristics , or for positioning lower grade pixels in certain areas of the sign , display or message board that are more optically or aesthetically acceptable . the segregated groups of pixels may also be assembled into graded pixels blocks ( having any suitable number of pixels of like or otherwise desirable performance characteristics ) that may then be assembled as components of larger signs , displays or message boards having the desired pixel performance and display qualities . such separated display device portions , individual pixels or pixel blocks may be used for rapidly assembling custom - order signs , displays or message boards without having to specially create a new display device for each new application . display device 10 may be formed as an individual unit for use in various led display devices , alphanumeric message boards , signs , etc . including ( by way of example ) taxiway signs or signs for transportation depots or facilities ( e . g . airports , railway stations , bus stations , ports , highways , etc . ), having suitable software for displaying multilingual messages , retrofit led display boards for drop - in display modules that replace or supplement conventional display signs or provide enhanced messaging or imaging capability with existing displays in commercial ( restaurants , stores , shopping centers , etc . ), industrial ( factories , offices , manufacturing and assembly facilities , etc . ), institutional ( schools , libraries , hospitals , etc .) or governmental facility signage or display applications . such display devices may also be used in one or more arrays for residential applications , such as to provide lighting ( e . g . normal or emergency ), in which the circuitry is suitably coupled to a circuit device ( not shown ) for converting standard residential electrical power , such as 120 volts ac and 60 hertz , or from a back - up source , to a suitable power level adapted for use by the display device . the structure of the display device may be used in other applications for transmitting and receiving light . for example , the light guide may be used as an integral component with any optoelectronic device . the light guide , substrate , and suitable circuitry may be configured as mating halves of a coupler ( e . g . plug , connector , interface , etc .) for coupling , modulating or amplifying light signals between various devices . for example , a “ plug ” having suitable light transmission or receiving structure , or electrical conductivity device , may be molded onto the top or bottom of the display device and configured to interconnect with other pugs or devices . the light guide may also be used with suitable substrates and circuitry for night vision applications and for coupling of fiber optic devices . in fiber optic applications , the light guide may be used as an optical coupler for use in “ plugs ” or connectors configured to fit together for transmitting and receiving light signals among various equipment . display device 10 may also be used for upgrading existing displays or signage or for providing additional display capabilities by sizing the display assembly 10 for use as a “ drop - in ” replacement for an existing sign , panel or display , particularly in applications that would otherwise require application for a new “ permit ” or other authorization where necessary for use of a new or replacement sign or display . additionally , multiple display assemblies may be grouped together and coordinated with suitable messaging or imaging software to provide alphanumeric or imaging displays ( e . g . single color or multicolor ) for large scale signs , such as ( by way of example ) large display applications including stadium scoreboards , electronic billboards , video devices , viewing screens and the like . referring to fig6 display device 10 may further be used to provide signal devices ( shown schematically as a vehicle signal 60 for a vehicle 62 , but may include other signal applications such as airport runway signals , highway traffic signals , railway crossing signals , other visual indication signals , etc .). such signals may be provided with , or assembled from pixels or pixel arrays having , various led configurations adapted to emit light having different colors according to the different functions of the signal . in one embodiment , signal 60 includes , or is coupled to , control circuitry ( not shown ) of a type that is responsive to a vehicle user &# 39 ; s actions to actuate the signal 60 to emit light from leds 22 in a first color ( e . g . red ) during braking , or a second color ( e . g . amber ) during turn - signaling or hazard signal operation , or a third color ( e . g . white ) during operation of vehicle 62 in a reverse direction . the control circuitry may be configured such that signal 60 may provide indication for one or more functions separately and may also be configured to provide indication for one or more functions simultaneously . for example , signal 60 may indicate multiple functions simultaneously by alternating the emitted light color according to the corresponding functions on a predetermined time interval , or the display of the signal 60 may have several portions , each configured to provide indication of a particular function . alternatively , signal 60 may indicate multiple functions simultaneously by alternating the emitted light color of certain groups of the leds 22 on the display device 10 to create a desired pattern for a first function , such as a directional signal , interposed on a desired pattern for a second function such as a brake signal . in a similar manner , multi - portion traffic lights may be replaced with a single portion having an array of multicolor leds or a range of discrete color leds . this arrangement would permit merely changing the color portion rather than having three separate portions as are currently used . this arrangement would also permit displaying an alphanumeric message or graphic image in the traffic light signal display portion . signal 60 according to the embodiment may be provided as a substantially flat panel display device adapted for installation on a surface , such as a vehicle panel 64 , without the necessity for wells , recesses or compartments in the body of vehicle 62 as are typically required for conventional vehicle signal devices . such surface installation may provide increased space within the interior of vehicle 62 and reduce the complexity and time associated with vehicle panel forming operations and assembly activities . of course , signal 60 could be positioned in a similar manner as are conventional light bulbs by placing them in a housing under a lens or transparent cover . according to any preferred embodiment , the display device includes a substrate material ( such as ceramic , etc . ), having a conductive material ( such as gold , etc .) provided thereon in a suitable pattern to provide a circuit board configured to interface with one or more light sources and a control circuit ( e . g . external ). a moldable material is molded onto one or both of the substrate and conductive material to provide a light guide that surrounds a portion of the circuitry that is adapted for mounting one or more light sources thereon . the substrate may have suitable structure ( such as apertures ) intended to improve the adhesion of the light guide to the substrate . one or more light sources ( such as leds ) are installed on the substrate and electrically interconnected to the appropriate portions of the circuitry ( e . g . by conductive epoxy , wires , etc .). if desired , the light sources may be encapsulated within the light guide by a suitable material ( e . g . epoxy , etc .). according to any preferred embodiment , the display device may be manufactured by providing a substrate material , providing a conductive overlay material to form the desired circuit patterns thereon , molding a light guide onto the substrate and conductive material , installing the light source ( s ) on the appropriate portion ( s ) of the circuit patterns , installing the electrical interconnections between the light source ( s ) and the appropriate portion of the circuit pattern , encapsulating the light source ( s ) within the light guide . if desired , the display device can be separated ( e . g . cut , sawed , diced , etc .) into individual pixels that may be graded and “ binned ” for use in assembling graded pixel blocks . the formation of the light guide on the substrate and / or the conductive material prior to installing and electrically interconnecting the light source ( s ) is intended to improve the durability and ruggedness of the device . further , the installation of the encapsulating material after electrical interconnection of the light sources is also intended to improve the durability and ruggedness of the device . it is important to note that the construction and arrangement of the elements of the display device provided herein are illustrative only . although only a few exemplary embodiments of the present invention have been described in detail in this disclosure , those skilled in the art who review this disclosure will readily appreciate that many modifications are possible in these embodiments ( such as variations in installation location and orientation , sizes , structures , shapes , angles and proportions of the various elements , mounting arrangements , use of materials , combinations of shapes , etc .) without materially departing from the novel teachings and advantages of the invention . for example , the light guide may be used in any application for directing , focusing or dispersing the light emitted from a display , sign , message board or other light transmitting or receiving system . also the light guide may have any suitable shape , length , thickness , location or orientation for use in connection with manufacturing large arrays of light sources such as , but not limited to , leds and separating the large array into groups of smaller arrays . additionally , the light guide may be used with any suitable light emitting device surface other than printed circuit boards having leds . the light guide may be used to control the outward emission of light from the leds , or may be used to receive light from a source ( e . g . fiber optics source , etc .) configured to interface with a printed circuit board . further , it is readily apparent that the light guide may be provided in a wide variety of shapes , sizes , thickness , and light distribution profiles and adapted for installation on any size printed circuit board . additionally , the sign , message board , imaging screen or information display may be any display adapted to visually convey alphanumeric messages , signals , information or images for use in original design applications or for use in retrofit applications for replacing , enhancing or upgrading existing signs or display devices . accordingly , all such modifications are intended to be within the scope of the invention . while the present invention has been described in connection with a particularly preferred embodiment thereof , the invention is not to be limited by the drawings . the order or sequence of any process or method steps may be varied or re - sequenced according to alternative embodiments . in the claims , any means plus - function clause is intended to cover the structures described herein as performing the recited function and not only structural equivalents but also equivalent structures . other substitutions , modifications , changes and omissions may be made in the design , operating configuration and arrangement of the preferred and other exemplary embodiments without departing from the spirit of the inventions as expressed in the appended claims . | 7 |
the reinforced composite wood flooring of the present invention is an improvement over conventional wood flooring of truck trailers in that it provides both moisture proofing and reinforcement to such flooring . in order to understand the benefits provided by the composite wood flooring , it is first necessary to understand the construction of conventional laminated wood flooring . conventional wood flooring 11 for over - the - road truck trailers 12 such as that shown in fig1 is normally manufactured with hardwoods such as ash , aspen , elm , yellow - poplar , and preferably oak , maple , birch , beech and the like , although softwoods such as douglas fir and spruce could be employed . the green lumber used as a starting material in such manufacture is suitably dried in special drying chambers under controlled conditions . the dried lumber is then sawed into strips 21 of rectangular cross - section and defective portions are eliminated by cross cutting the strips . during the cross - cutting process , “ hooks ” 24 are formed at the ends of the lumber strips ( see fig4 b ). the relatively defect - free lumber strips are coated on their vertical sides or edges 25 with an adhesive such as urea - melamine formaldehyde or polyvinyl acetate . the uncured edge - glued lumber strips are then assembled on a conveyor by placing them side to side and behind other strips which were previously assembled forming glue lines 22 between adjacent strips 21 . the adhesive is cured by applying heat and edge pressure to large sections of the assembled lumber strips thus forming a unitary panel of laminated wood 20 such as that shown in fig4 a . during the assembly of the lumber strips , “ hook joints ” 23 are formed at each end of every strip ( see fig4 c ). these joints are simple mechanical couplings with no significant adhesive bonding . often times , due to imperfect assembly , a readily visible gap 26 is formed at the hook joints which can be seen from the top and bottom surfaces of the completed laminated wood floor ( see fig4 d ). the cured laminated wood 20 is cut to a desired length ( up to about 60 feet ) and width ( about 6 to 18 inches ) and then machined to form several laminated wood boards 16 ( see fig5 ). each laminated wood board 16 is planed to a desired thickness and shiplaps 18 and crusher beads 19 are machined on its sides . a shiplap 18 is a rectangular projecting lip running along the length on each side of a floor board . the crusher bead 19 is a small semi - circular projection running along the length on each side of a board and placed above or below a shiplap 18 . when the floor boards are assembled in a trailer such that the side edges of corresponding boards are squeezed together , the shiplaps 18 of adjacent boards overlap to form a seam . the crusher bead 19 provides spacing between adjacent boards and help in preventing buckling of the boards when they expand on absorbing moisture . a wood putty is applied at the hook joints 23 on the top and bottom surfaces of the boards to fill any resident gaps . finally , the underside of the floor boards are coated with a polymeric substance termed as “ undercoating ” 27 ( fig5 ) to provide moisture protection . the finished floor boards are assembled into a kit of about eight boards for installation in trailers . normally , a kit consists of two boards with special shiplaps so that they will fit along the road and curb sides 15 , which are usually metallic components of the trailer 12 . the other boards may be identical in design and they are placed between the road and curb side boards . in some trailers , a metallic component such as a hat - channel may be placed between any two adjacent boards . the metallic component becomes part of the floor area . the boards adjacent to the hat - channel have side edge profiles designed to mate with the flanges of the hat - channel . all the boards are supported by thin - walled cross - members 14 of i , c or hat sections , each having an upper flange , which span the width of the trailer and are spaced along the length of the trailer . each floor board is secured to the cross - members by screws 13 extending through the thickness of the board and the flanges of the cross - members ( see fig1 - 3 ). the reinforced composite wood floor board 28 improves the above described construction of conventional wood floor board 16 by reinforcing and moisture proofing a laminated wood member 16 with a layer of fiber reinforced plastic ( frp ) 17 ( as representatively shown in fig6 ). two basic designs of the composite wood floor board 28 of the invention with laminated wood member 16 on top and frp 17 on the bottom are presented below . these designs differ from one another in the width of the frp as related to the face width of the wood member . as shown in fig7 the reinforced composite wood floor board 28 consists of a laminated wood member 16 with an underlayer of frp 17 . the shiplaps 18 and crusher beads 19 are incorporated on the sides of the reinforced composite wood floor board 28 similarly to those in a conventional laminated wood floor board ( fig5 ). the finished width of the frp 17 is nearly equal to the face width of the wood member 16 . during manufacturing , the starting width of the frp is selected to be equal or slightly wider than the face width of the board . after bonding the frp to the board , the corners are machined so that the frp does not overhang the face width of the board . the embodiment of fig8 differs slightly from that of fig7 . in this case , the frp 17 has a narrower width than the face width of the wood member 16 . at each of the lateral sides of the board , the edge of the frp is at least { fraction ( 1 / 64 )}″ inside the edge of the wood member . by bonding the frp to the wood member at the correct location relative to the edges of the board , final machining of the lateral sides of the composite floor board is avoided . a laminated wood member 16 with shiplaps 18 and crusher beads 19 is fabricated by the process set forth above for producing conventional laminated wood floor boards . however , the wood member is not coated with an undercoating and the hook joints are not coated with a wood putty . if required , each hook joint at the ends of the lumber strips is substituted with a lap joint 29 or a finger joint 30 or a butt joint 31 or a scarf joint 32 as illustrated in fig9 a to 9 d . in addition to using a wood member with edge profiles to produce a composite board as shown in fig6 other types of profiles are used to produce composite boards as shown in fig1 a and 10 b . the frp is fabricated with continuous fibers in the form of continuous rovings and fabrics . about 70 % to about 100 % of the fiber reinforcement are aligned along the longitudinal direction while the remaining fibers are aligned along the lateral direction of the frp . the reinforcing fibers are glass , carbon or aramid fibers or mixtures thereof . glass fiber is more economical than carbon and aramid fibers , but provides lower weight savings and flexural modulus than the other fibers . for higher performance , carbon fiber is better suited to reinforce wood . mixtures of glass and carbon fibers can also be used to improve performance at moderate costs . epoxy resin is the preferred matrix for the fabrication of the frp . other thermoset and thermoplastic polymers such as vinyl ester , phenolic , polyester , polypropylene and polyamide can be used to fabricate the frp . the method of fabrication of the frp is dictated by the type of polymer selected . conventional pultrusion and continuous lamination processes are better suited for thermosetting resins . typically , in these processes the reinforcing fibers are placed under tension and wetted with a reactive liquid resin , which is subsequently cured around the fibers . to fabricate the frp with a thermoplastic polymer , the fibers are coated with the polymer and then the coated fibers are consolidated under he at and pressure followed by cooling . alternatively , co - mingled fibers of reinforcement and thermoplastic polymer can be used to form the frp . irrespective of the fabrication process of the frp , the frp for composite wood flooring is preferably designed to have 70 % to 100 % of the continuous fibers aligned along the longitudinal direction while the remaining fibers are aligned along the lateral direction of the frp . the frp sheet is preferably sanded or abraded on at least one side to render it flat and clean for bonding to the wood member . the laminated wood member with shiplaps and other edge details is sanded or abraded on one side to develop a flatter surface than that provided by planing . alternatively , a knife - planed surface of the wood member can be used for bonding to the frp . a reactive hotmelt adhesive is coated on the sanded or planed surface of the board . preferably , the sanded surface of the frp is also coated with the reactive hotmelt . commercially available hotmelt roller coaters are used to coat the substrates with the reactive hotmelt typical weight of coating on any one substrate is about 5 to 20 gms / sq ft . the reactive hotmelt is applied on the substrates in a molten state at a temperature generally in the range of about 200 ° f . to 350 ° f . prior to bonding , the edges of the frp are aligned with respect to the edges of the wood member . to manufacture a composite floor board of embodiment i , the width of the frp is selected to be equal or wider than the face width of the wood member . after bonding the frp to the wood member , the frp is either in line with or overhanging the edges of the wood member . in case of an overhanging frp on the wood member , a secondary machining operation is employed to trim the frp and wood . since glass and carbon fibers are hard to machine than wood , a softer fiber such as polyester or cellulose is employed at the edges of the frp during its fabrication . to manufacture a composite floor board of embodiment ii , the width of the frp is selected to be at least { fraction ( 1 / 16 )}″ less than the face width of the wood member . the edges of the frp are aligned with respect to the edges of the wood member such that there is no overhang of the frp over the edges of the wood member . the coated surface of the frp is mated with the coated surface of the wood member while maintaining proper alignment of the edges of the board and frp . the joining of the frp and wood member is done while the reactive hotmelt coating is in a tacky state . in case of a short open time of the reactive hotmelt , to maintain the tacky state of the coating , radiant heat is applied on the bonding surface of the frp and wood member before or after the coating step . after the joining of the frp and wood board , a series of rollers are used to apply pressure on the substrates . cooled air is blown over the substrates while pressure is applied to remove residual heat of the substrates and develop green strength of the bond . quick development of green strength helps to hold the frp flat against the wood board and prevents debonding at the edges . to manufacture the composite floor boards in a continuous fashion , a series of wood members of desired length and edge profiles are run one behind the other . the frp is drawn from a roll of material and continuously joined to the boards as the boards pass below the roll . after joining the frp and wood members , the frp is cut between the ends of two boards next to each other . the cutting of the frp is done by means of an automatic cut - off saw without stopping the flow of the boards . a 10 foot long composite wood floor kit consisting of eight composite boards was fabricated by bonding a glass / epoxy frp to each of the eight laminated wood members using commercially available polyurethane reactive hotmelt , namely pur - fect lok 34 - 9028 of national starch and chemical company . the laminated wood was made of red and white oak strips which were edge - glued using urea - melamine formaldehyde adhesive . the fiber reinforcement of the frp was composed of about 50 oz / sq yd of continuous glass rovings in the longitudinal direction of the frp . a fabric weighing about 4 oz / sq yd of glass fibers oriented in the weft direction was used for transverse reinforcement . wood members having a rectangular cross - section and without any shiplaps were used . the planed surface of the wood members and the sanded surface of the frp sheets were coated with a reactive hotmelt . upon joining and pressing of the substrates with rollers , the composite boards were allowed to cure at ambient conditions for five days . the boards were then machined to provide the required shiplap profiles and crusher beads at the longitudinal edges . the finished thickness of the reinforced composite wood floor was about 1 . 125 inches . eight composite floor boards were installed in a partial section of a trailer . the floor was supported by several i - beam cross - members running along the full width of the trailer and regularly spaced at 12 inches along the length of the trailer section . the cross - members with a section of 4 inches by 2 . 25 inches were made of steel with a yield strength of 80 ksi and weighing about 3 . 2 lbs / foot . each floor board was secured to each cross - member in the test section by three screws running through the thickness of the boards and the top flange of the cross - member . a lift truck load simulator with two loading wheels was stationed on the floor . the simulator was loaded with dead weights so that a force of about 17 , 000 lbs could be applied on the floor through the loading wheels . the loading wheels were stationed on the third and sixth boards in the eight board configuration of the floor . to subject the floor to fatigue loading , the simulator was moved back and forth on the floor . the simulator was allowed to complete 5 , 000 fatigue loading cycles , wherein during each cycle the simulator moved forward in one direction and then returned back to its starting line on the floor . at the end of 5 , 000 fatigue loading cycles , the reinforced composite floor experienced little or no significant damage . the loading wheels were repositioned on the first and fourth board and the fatigue test was redone for another 5000 cycles . since the damage to the composite floor boards was not significant , the fatigue test was continued at 20 , 000 lbs of loading on the same set of floor boards . the loading wheels were positioned in two different locations as described above and an additional 10 , 000 fatigue load cycles were applied . there was no catastrophic damage to the floor boards and cross - members at any time during the test . a conventional hardwood floor with a nominal thickness of 1 . 38 ″ supported by standard cross - members at 12 ″ spacing is rated for 17 , 000 lbs by the trailer industry . during fatigue testing , the conventional hardwood floor typically undergoes cracking of some wood segments and opening of some hook joints at the bottom side of the floor . the mechanical properties of conventional hardwood flooring show a large variation due to the random location of joints and variation of properties of the wood segments . compared to the conventional floor boards , the composite floor boards show superior performance with little or no opening of the joints of the wood segments at the bottom side of the floor . the composite floor boards show significantly lower variation of mechanical properties due to the strengthening of the hook joints and better distribution of load to the tensile bottom side of the floor . the thinner composite floor of this experiment weighed about 4 . 8 lbs / sq ft , while the thicker conventional oak floor weighed about 5 . 4 lbs / sq ft . thus , the composite floor provides weight saving over the conventional hardwood floor while providing similar load capacity . by using carbon fibers or mixtures of carbon and glass fibers in a continuous roving form along the longitudinal direction of the frp , additional weight saving and even higher performance can be obtained . since the underside of the trailer flooring is subjected to water spray in service , the environmental durability and aged properties of the floor is of importance to the long term performance of the floor . to determine the weathering characteristics of the floor boards the following accelerated environmental test was conducted . samples of composite floor boards with a thickness of 1 ″ and conventional laminated oak floor boards with a thickness of 1 . 31 ″ were tested . the sample boards with a length of about three feet and width of about 12 ″ were fastened with screws to steel frames built with cross - members used in trailers to support the floor . the attachment of the boards to frames simulated a section of a single floor board of a trailer . the boards , which were attached to the frames were degraded by immersing them in water for seven days and then drying them in a kiln at about 140 ° f . to 160 ° f . for two days . the soaking and drying cycle was repeated once more . finally , the boards were removed from the frames and subjected to bend test to determine the loss of ultimate failure load . it was found that the conventional oak floor suffered a loss of ultimate failure load from 5200 lbs for the virgin boards to 3980 lbs for the degraded boards . on the other hand , the composite floor boards fabricated with glass / epoxy frp and reactive hotmelt adhesive suffered a loss of ultimate failure load from 5920 lbs for the virgin boards to 4690 lbs for the degraded boards . further , conventional wood floor boards failed in a relatively brittle mode . the composite wood floor boards failed in a ductile fashion with little or no debonding of the frp and without opening of the hook joints at the bottom side . the ductile failure mode and integrity of the composite boards provides higher performance to trailer floor . with the foregoing description of the invention , those skilled in the art will appreciate that modifications may be made to the invention without departing from the spirit thereof . therefore , it is not intended that the scope of the invention be limited to the specific embodiments illustrated and described . | 8 |
referring now to fig1 a papermaking machine constructed in accordance with the teachings of the present invention is illustrated . the machine includes a paper web - forming device of any suitable type such as a fourdrinier machine , the fourdrinier wire 11 of which is illustrated . the fourdrinier wire delivers the wet web w ( normally in the order of from about 7 % to about 23 % solids ) to a pick - up felt 14 forming an endless loop about a plurality of rollers including a suction pressure roll 16 and a blinded drilled pressure roll 18 . web pick - up by the felt may be facilitated through use of a steam box arrangement under the wire at the vacuum slot pick - up 20 . preferably a water shower 22 and uhle box combination are provided to clean and condition the felt prior to web pick - up . felt 14 forms a nip with a rotatable dryer can 26 which is heated by steam or other means and has a smooth solid outer surface . transfer of the web w takes place at the location of suction pressure roll 16 so that roll 16 and the dryer can compact the web overall . while on the dryer can the web also passes through a nip defined by the pick - up felt and the dryer can in the vicinity of pressure roll 18 . from that second nip continued rotation of the dryer can brings the web into contact with an imprinting fabric 30 looped about a roll 32 which may be plain or suction . closely adjacent to roll 32 the web w is removed from dryer can 26 by a skinning doctor 34 and the web is applied to the imprinting fabric 30 . u . s . patent application ser . no . 933 , 203 hulit et al , filed aug . 14 , 1978 , may be referred to for details of an imprinting fabric preferred for use in connection with the present invention . specifically the imprinting fabric disclosed therein is an open mesh fabric formed of woven filaments . the fabric has compaction elements defined by the knuckles formed at the warp and weft crossover points of the fabric filaments and defines voids between the filaments . the imprinting fabric has a surface void volume of from about 15 cc / m 2 to about 250 cc / m 2 and preferably from about 40 cc / m 2 to about 150 cc / m 2 . the compaction element area of the imprinting fabric constitutes between about 5 % and about 50 %, and preferably from about 20 % to about 35 %, of the total web supporting surface area of the fabric . imprinting fabric 30 is in the form of a continuous loop rotating in a clockwise manner as viewed in fig1 . at the time the partially dewatered web is applied to the imprinting fabric 30 it has an overall fiber consistency of from about 40 % to about 50 %. the partially dewatered web then passes through a nip formed between the imprinting fabric and a papermaker &# 39 ; s dewatering felt 36 also in the form of a continuous loop and moving in a counterclockwise manner as viewed in fig1 . a pressure roll 38 is in opposition to roll 32 to provide the desired nip pressure between the felt 36 and fabric 30 . the imprinting fabric - felt press just described serves to increase the apparent bulk of web w by impressing from about 50 % to 95 % of the web into the voids of the imprinting fabric with the only significant compaction of the web taking place in the vicinity of the compaction elements . as noted in the aforesaid hulit et al . application , an imprinting fabric of the type just described will retain the wet paper web impressed therein by the papermakers &# 39 ; dewatering felt after passing through the nip formed by these two elements . the web w is now transferred to a through dryer 42 comprising a rotatable perforated dryer drum 44 and an outer hood 46 which receives the pressurized hot air or other heated fluid from the rotatable perforated drum in the conventional manner . the imprinting fabric 30 is looped about the perforated dryer drum 44 so that the web w passes about almost the entire circumference of the dryer drum sandwiched between the drum outer surface the imprinting fabric . after the web has passed through the through dryer it has an overall fiber consistency generally equal to or greater than 80 % solids . the web is then transported by imprinting fabric 30 to a yankee dryer 50 and applied to the smooth heated outer creping surface thereof . transfer to the yankee takes place at the location of a solid yankee pressure roll 52 with transfer to the creping surface preferably being facilitated by the application of a suitable adhesive , such as animal glue , to the yankee surface or web by any suitable adhesive applicator 54 just prior to engagement of the web w with the yankee creping surface . after being rotated about the yankee drum the web is creped therefrom by a creping blade 56 and transferred to a suitable winding mechanism . as the imprinting fabric continues its travel from the yankee back to the dryer can , it is cleaned as by means of a vacuum box 60 and air jet 62 . the air jet may also be utilized to apply a spray of release agent such as emulsified mineral oil in water to the imprinting fabric . fig2 illustrates in schematic fashion an alternative form of papermaking machine layout incorporating the teachings of the present invention . the arrangement is in most respects identical to the arrangement of fig1 and for this reason like components have been designated by the same reference numerals employed with respect to the fig1 embodiment . the principal difference of this configuration as compared to that of fig1 resides in the elimination of a through air dryer in the arrangement . rather than proceed through a through dryer the imprinting fabric 30 transfers the web directly to the creping surface of the yankee 50 . it is obvious that the web w will be much wetter ( in the order of 40 - 50 % solids ) when applied to the yankee surface in fig2 than is the case in the fig1 embodiment . for this reason , the drying capacity of the yankee 50 in fig2 must be much greater , requiring either a larger yankee or a reduction in web speed . another difference resides in the fact there is an open draw between roll 32 and dryer can 26 . this open draw arrangement could also be utilized in connection with the system of fig1 . | 3 |
fig1 a , 1 b and 2 a , 2 b show a continuous ceramicizing furnace 3 , which can be in the form of a grating furnace or roller furnace . a hollow mold 2 is introduced into the continuous ceramicizing furnace 3 . the green glass article or plate 1 to be ceramicized is placed in the hollow mold 2 . the green glass plate 1 can be made by rolling or according to a float process . the hollow mold 2 has a molding surface 2 a with a shape that corresponds to or is suitable for the desired reshaping . the hollow mold 2 with the green glass plate 1 is conveyed in a known manner for thermal ceramicizing treatment through the continuous ceramicizing furnace 3 by means of a symbolically represented conveyor belt 3 b or the like . the hollow mold 2 with the green glass plate 1 is stopped in that region of the continuously ceramicizing furnace 3 , in which the exothermic crystal growth occurs . because of that the green glass plate 1 experiences a temporary viscosity lowering . movable vacuum lines or conduits 5 are pushed through lateral openings 4 in a furnace section , in which exothermic crystal growth occurs , into previously prepared openings 6 in the hollow mold 2 . the hollow mold 2 is evacuated by these vacuum lines 5 and because of that causes the softened glass on the mold to be drawn into the mold , assisted by the force of gravity . the vacuum connectors 5 a on the tube ends of the vacuum lines 5 are formed ( e . g . cone or ball shaped ), so that they automatically center themselves in the openings 6 fitting their shape . because of that a sufficient vacuum - tight connection arises for evacuation . the state of the reshaped glass and / or now glass - ceramic plate 1 ′ is shown in fig1 b . the stop or halt of the hollow mold 2 required for docking of the vacuum conduits or lines 5 in the hollow mold 2 can be provided when the hollow mold is accelerated in a furnace section upstream of a reshaping region rr so that subsequently sufficient time for the stop or halt for a short time interval results and the hollow mold 2 can be synchronized again to the normal furnace speed after the stopping stage . the continuous ceramicizing furnace 3 is preferably equipped with automatic slide gates upstream and downstream of the reshaping region rr , which can be moved into and moved out of the continuous ceramicizing furnace 3 to help maintain a uniform temperature distribution in this region . furthermore the continuous ceramicizing furnace 3 is equipped with an air circulation system acs for keeping the temperatures more uniform within the reshaping region rr , as shown in fig2 b . an alternative embodiment to that shown in fig1 a and 1b is shown in fig2 a and 2b , in which pressing and hold - down tools 7 can be inserted temporarily through the additional lateral openings 3 a in the furnace section for reshaping , which cause reshaping alone or with additional assistance of an applied vacuum , especially at the edge regions of the glass - ceramic plate or which prevent unwanted bulges of the edge regions , which result from the sinking of the center portion into the mold due to the vacuum and / or the force of gravity . pressurized air lines or conduits are temporarily inserted through the additional lateral openings 3 a in the furnace section in the reshaping zone , as described in fig1 a and 1b for the vacuum lines , so that reshaping tools integrated in the mold , e . g . pressing elements or centering bolts , can be moved into the mold ( not shown ) alone and / or additionally to the action of the applied vacuum and / or the pressing and hold - down tools 7 . the reshaping process is preferably observed in the furnace section in which reshaping occurs or in the reshaping region rr by means of a furnace probe or a viewing window vp . another embodiment besides that shown in fig1 a and 1b is shown in fig3 a and 3b , in which the apparatus for performing the method has a reshaping device 2 ′ with reshaping tools 9 , e . g . two pressing elements , instead of the hollow mold 2 . the green glass plate 1 to be reshaped is placed in the reshaping device 2 ′ and transported through the furnace 3 . the pressing elements are to be understood as only examples of movable reshaping tools 9 for forced reshaping , whose number is determined by the number of reshaping events performed on the green glass plate 1 . the reshaping device 2 ′ has two activating openings 6 , to which activating lines 8 are connected after they are inserted through openings 4 in the furnace section , in which the ceramicizing occurs . the green glass plate 1 can be held fixed by a vacuum in this reshaping device 2 ′. hold - downs 7 according to fig2 a and 2b can also be used for this purpose . the reshaping tools 9 can be moved vertically by means of a vacuum or low pressure or pressurized air supplied through the activating lines 8 , which forces out an area of the surface of the softened green glass plate 1 locally to form a desired raised region , e . g . an operators &# 39 ; panel for a cooking surface . further description regarding this third embodiment would be the same as for the embodiments shown in fig1 a and 1b and 2 a and 2 b and has therefore been omitted here . the reshaped glass - ceramic part 1 ′ can be the desired product , but it can also be divided up into a number of individual desired products . the reshaped glass - ceramic parts are preferably used as cooking panels , especially for glass - ceramic cooking ranges , and for fireplace viewing windows or similar applications . the glass - ceramic parts made according to the invention have the advantages of improved aesthetic properties and / or increased strength because of the method of reshaping green glass parts made by rolling and float processes according to the invention , because of their undamaged smooth or structured surfaces , for example a knobbed lower or upper side . the disclosure in german patent application 10 2004 008 595 . 1 - 45 of feb . 21 , 2004 is incorporated here by reference . this german patent application describes the invention described hereinabove and claimed in the claims appended hereinbelow and provides the basis for a claim of priority for the instant invention under 35 u . s . c . 119 . while the invention has been illustrated and described as embodied in a method for making reshaped glass - ceramic articles , apparatus for performing the method and glass - ceramic articles made thereby , it is not intended to be limited to the details shown , since various modifications and changes may be made without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention . | 2 |
fig1 and 2 show diagrammatically and not to scale a plan view and a cross - sectional view , respectively , of an electron source 1 according to the invention . this source comprises a support or substrate 2 mainly consisting of silicon in this embodiment , with a thickness of approximately 0 . 4 mm . a first main surface 3 of the substrate 2 is provided with a thin layer 4 ( approximately 50 nm ) of silicon oxide and with a second layer 5 of silicon nitride having a thickness of approximately 120 nm . the overall surface area of the electron source 1 is approximately 2 × 2 mm 2 . at the location of the actual emissive part 11 , the substrate 2 is much thinner than outside this part 11 because the substrate , viewed from the rear face 6 , has a depression with side walls 7 . in this case this depression has been obtained by means of anisotropic etching . since the silicon nitride is used as an etch - stop in this embodiment , the substrate 2 ( and the layer of silicon oxide ) has completely disappeared at the location of the depression . however , this is not necessary , for example when a layer of highly doped silicon is used as an etch - stopping material . a heating element 8 , which is constituted by a resistive element , for example a meandering strip of a high melting point metal such as tungsten , tantalum or molybdenum and which is connected to external conductors 15 by means of connection strips 9 via bonding flaps 14 , is present on the silicon nitride layer 5 . the assembly is coated with a second protective layer 10 of silicon nitride , which layer 10 has apertures at the location of the bonding flaps 15 . materials such as aluminium nitride or oxide , boron nitride , hafnium oxide or zirconium oxide can also be chosen for the layer 10 . instead of a single metal layer 8 , 9 , a layer consisting of a plurality of sub - layers may also be chosen , if necessary , for example a titanium - tungsten - titanium layer or a titanium - molybdenum - titanium layer . a metal pattern 12 , in this embodiment of molybdenum , is present on the second silicon nitride layer 10 , which pattern functions as cathode support at the location of the actual emissive part 11 and can be given the desired cathode voltage via an external connection 16 . other suitable materials for the metal pattern 12 are , for example ( cathode ) nickle , tantalum , tungsten , titanium or double layers of titanium and tungsten or molybdenum . the choice also depends on the emissive material to be used and on the desired cathode temperature . the emissive material 13 , a barium - strontium carbonate in this embodiment , is present on this metal pattern 12 at the location of the actual emissive part 11 , directly above the heating element 8 . other possible materials are , for example a barium - calcium - strontium carbonate to which , if desired , small quantities of rare earth oxides are added . moreover , it is possible to choose organometallic compounds as electron - emissive materials , for example an acetyl acetonate of barium , calcium or strontium . these compounds decompose to oxides at lower temperatures than the corresponding carbonates so that the electron source can be activated more rapidly . since , according to the invention , the substrate is much thinner at the location of the actual emissive layer 13 and the associated heating element 8 than at other locations ( in the present embodiment the substrate is even etched away entirely ), substantially no heat of conduction is lost in the substrate and the emissive material 13 is more rapidly heated to the desired temperature . the device of fig1 can be manufactured as follows . the starting material is a silicon wafer 2 having a thickness of approximately 400 μm which is polished along its & lt ; 100 & gt ; faces and whose main surface 3 is provided with a layer 4 of thermal silicon oxide having a thickness of 50 nm . a silicon nitride layer 5 is provided on the layer of silicon oxide 4 by means of cvd methods , or the like . this layer 5 has a thickness of approximately 120 nm . similar layers are simultaneously provided on the other side . after the other side has been photolithographically provided with a mask having apertures at the location of the thinner parts to be formed , the silicon nitride and silicon oxide are removed in these apertures . subsequently the silicon is anisotropically etched from the other side with a diluted solution of potassium hydroxide . the silicon nitride 5 then functions as an etch - stop . the silicon nitride 5 is subsequently coated with a 200 nm thick layer of molybdenum . from this layer the metal pattern of the heating element 8 , with the associated connection strips 9 and bonding flaps 14 , is manufactured by etching in a solution of nitric acid , phosphoric acid and acetic acid in water . the assembly is subsequently coated with an approximately 200 nm thick layer 10 of silicon nitride which is provided by means of , for example sputtering . this process of manufacturing the heating element and providing the nitride layer 10 may also precede the anisotropic etching treatment . the silicon nitride 10 is removed at the location of the bonding flaps 14 . a 200 nm thick layer of molybdenum from which the metal pattern 12 is formed by means of etching and which functions as the actual cathode metallization is provided on the silicon nitride layer 10 . in this embodiment a second metal pattern 18 is formed simultaneously . this metal pattern 18 may function , for example , as a grid in an ultimate arrangement in , for example an electron beam tube . subsequently the emissive layer 13 is provided , which consists of a layer of barium strontium carbonate in this embodiment . after the substrate has been divided into separate cathodes or groups of cathodes by means of scratching and breaking , connection wires 15 , 16 and 17 are provided by means of , for example , thermocompression or other bonding techniques on the bonding flaps 14 as well as on suitable parts of the metal layer 12 and the grid 18 . said division into groups may be realised in such a way that one substrate 2 comprises , for example 3 separate emissive structures 11 , for example for colour display tubes . cathodes thus obtained were tested at 700 °- 800 ° c . in a diode arrangement with a cathode - anode gap of 0 . 2 mm . at a continuous load , current densities of 0 . 3 - 2 a / cm 2 were measured . the lifetest results were also satisfactory . the invention is of course not limited to the embodiment shown , but several variations are possible within the scope of the invention . for example , at the location of the emissive material to be provided the substrate 2 need not be etched away throughout its thickness , but a layer of silicon may remain , notably if it has a higher doping and consequently functions as an etch - stop . other methods of making the substrate locally thinner are alternatively possible . for example , dependent on the substrate material , other etchants may be used , but mechanical methods , for example , grinding are alternatively possible , notably when ceramic material substrates are used . combinations of grinding and etching are also possible . moreover , the heating element may have various shapes . a device including this heating element only can of course be used in itself , or , for example , as a part of an ( alkali ) metal source or field emitter . a metalorganic compound may alternatively be used as an emissive material in addition to numerous other generally known emissive materials . similarly , several variations of the materials for the heating element , the connection layers and the other materials are possible , provided that they are chemically ( and mechanically ) compatible in a given combination . | 8 |
an extract of inula britannica has been isolated that has use as a cancer preventative agent due to its activity to induce apoptosis in cancer cells . the extract contains several sesquiterpene compounds , including but not limited to the sesquiterpene lactones known as britannilactone , 1 - o - acetylbritannilactone ( oabl ), and 1 , 6 - o , o - diacetylbritannilactone ( oodabl ). the extract and the chemicals isolated therefrom can be used as a pharmaceutical for cancer treatment and / or prevention as well as a medical food , or nutraceutical , and a dietary supplement . the flowers ( approximately 10 kg ) of inula britannica var . chinensis were extracted three times with 95 % ethanol . the chloroform - soluble fraction of the ethanol extract ( 500 g ) was chromatographed on a silica gel column eluting with a gradient of chloroform - methanol . from the fraction collected with chloroform - methanol ( 20 : 1 ), 1 , 6 - o , o - diacetylbritannilactone ( 52 g ) was obtained . from the fraction collected with chloroform - methanol ( 10 : 1 ), 1 - o - acetylbritannilactone ( 10 . 5 g ) was obtained . experiments were performed to determine the activity of two of the sesquiterpene compounds isolated from inula britannica , oabl and oodabl , as cancer preventative agents . using a western blot technique , the ability of these compounds to phosphorylate bcl - 2 in cancer cells was examined . using the breast cancer cell line mcf - 7 , it was found that oabl induced bcl - 2 phosphorylation , with effective doses of 10 and 20 μm . oodabl induced bcl - 2 phosphorylation at lower effective doses , 2 . 5 and 5 μm . these results were compared to the ability of a known chemotherapeutic paclitaxel , which induced bcl - 2 phosphorylation at a dose of 100 μm . these data indicate that the sesquiterpenes are more potent than paclitaxel at inducing bcl - 2 phosphorylation in mcf - 7 cells . in two ovarian cancer cell lines , ovcar and pa - 1 , similar results were seen . in ovcar cells , oodabl induced bcl - 2 phosphorylation at a dose of 5 μm , while oabl induced bcl - 2 phosphorylation at a dose of 10 μm . in pa - 1 cells , oodabl induced bcl - 2 phosphorylation at a dose of 5 μm , while oabl induced bcl - 2 phosphorylation at a dose of 10 μm . in a prostate cancer cell line , these compounds were also able to induce bcl - 2 phosphorylation . oodabl induced bcl - 2 phosphorylation at a dose of 5 μm while oabl induced bcl - 2 phosphorylation at a dose of 10 μm . using cleavage of parp as an indicator of apoptosis , the compositions of the present invention were tested in pa - 1 ovary cells . parp is a 116 kd nuclear poly ( adp - ribose ) polymerase that appears to be involved in dna - repair , predominantly in response to environmental stress ( satoh , m . s . and t . lindahl . 1992 . nature 356 : 356 - 358 ). parp is important for cells to maintain their viability . cleavage of parp facilitates cellular disassembly and serves as a marker of cells undergoing apoptosis ( oliver , f . j . et al . 1998 . j . biol . chem . 273 : 33533 - 33539 ). this protein can be cleaved by many ice caspases to form a 85 kd protein in cells undergoing apoptosis . pa - 1 cells were treated with oodabl for 24 hours . cells were lysed and parp cleavage was measured by western blot using a monoclonal antibody to parp ( pharmingen , inc ., san diego , calif .). oabl induced parp cleavage at doses of 10 and 20 μm , while oodabl induced parp cleavage at a dose of 5 μm . the effect of oodabl on cell cycle was analyzed by flow cytometery using breast cancer cell lin t47d . oodabl arrested cells at the g2 / m phase at a 20 μm concentration as compared to control cells . the effect of oodabl on microtubules was examined by indirect immunofluorescence of mcf - 7 cells using an antibody to tubulin after 12 hours treatment with either a vehicle control , 10 μm paclitaxel ( positive control ), or 20 μm oodabl . the results showed , that oodabl polymerized microtubules like paclitaxel . in a tunel assay , the effect of oodabl on late apoptosis was examined . hl - 60 cells lines were subjected to flow cytometry analysis using apo - brdu . apoptosis was detected by incorporation of br - dutp using a fluorescein labeled anti - brdu monoclonal antibody after treatment with a vehicle control , 1 μm camptothecin or 20 μm oodabl for 12 hours . oodabl was shown to induce apoptosis , as did the positive control camptothecin . cell viability was then assessed in a microculture tetrazolium / formazan assay ( mtt ; scudiero , d . a . et al . 1988 . cancer res . 48 : 4827 - 4833 ) using a variety of cell lines . absorbance was measured at 550 nm and cell viability was expressed as the percentage of drug treated cells relative to that of controls . the ic 50 was then defined as the concentration of drug that produced a 50 % decrease in cell viability relative to controls . oodabl was first tested in a variety of cell lines . results in mcf - 7 cells treated with various concentrations of oodabl ( 1 . 25 , 12 . 5 , 25 . 50 and 100 μm oodabl ) showed that cell viability decreased with treatment in a dose - dependent manner . the ic 50 was less than 12 . 5 μm . in pa - 1 cells treated with various concentrations of oodabl ( 1 . 953 , 3 . 9 , 7 . 815 , 15 . 625 , 31 . 25 , and 62 . 5 μm oodabl ), cell viability was decreased in a dose - dependent manner with an ic 50 of less than 7 . 815 μm . in du - 145 cells treated with various concentrations of oodabl ( 3 . 4 , 7 . 86 , 15 . 6 , 31 . 5 , 62 . 5 , and 125 μm oodabl ), cell viability was decreased in a dose - dependent manner with an ic 50 of less than 15 . 6 μm . in nci - h - 460 cell treated with various concentrations of oodabl ( 3 . 9 , 7 . 81 , 1 { grave over ( )} 5 . 62 , 31 . 25 , 62 . 5 and 125 μm oodabl ), cell viability was decreased in a dose - dependent manner with an ic 50 of between 31 . 25 and 62 . 5 μm . in nih 3t3 ( normal mouse fibroblasts ) cells treated with various concentrations of oodabl ( 1 , 10 , 20 and 50 μm oodabl ), cell viability was decreased in a dose - dependent manner with an ic 50 of 50 μm . oabl was then tested in some of these same cell lines . in mcf - 7 cells , oabl was tested at doses of 0 . 3 nm , 3 nm , 30 nm , 300 nm , 3 μm , and 30 μm . results showed that oabl decreased cell viability with an ic 50 of around 200 μm . in pa - 1 cells , oabl ( 1 . 953 , 3 . 9 , 7 . 815 , 15 . 62 , 31 . 25 and 62 . 5 μm ) decreased cell viability with an ic 50 of about 2 μm . in du - 145 cells , oabl ( 4 . 68 , 9 . 37 , 18 . 75 , 37 . 5 , 75 and 100 μm ) decreased cell viability . cell cytotoxicity was also assessed by a clonogenic assay . mcf - 7 breast cells were treated with various concentrations of oodabl ( 625 nm , 1 . 25 , 2 . 5 , 5 and 10 μm ) for 15 days and cells were then stained with methylene blue and colonies counted . the ic 50 was in the range of 2 . 5 to 5 μm oodabl . pc - 3 prostate cells were treated with various concentrations of oodabl ( 20 and 200 nm , and 2 and 20 μm ) for 15 days and cells were then stained with methylene blue and colonies counted . the ic 50 was in the range of 200 nm oodabl . rko cells were treated with various concentrations of oodabl ( 20 and 200 nm , and 2 and 20 μm ) for 15 days and cells were then stained with methylene blue and colonies counted . the ic 50 was in the range of 20 μm oodabl . baby rat kidney cells were transformed with e1a and transfected with the bcl - 2 gene to form brk - 4b - bcl - 2 cells . these cells were treated with various concentrations of oodabl ( 20 and 200 nm , and 2 , 10 and 20 μm ) for 15 days and cells were then stained with methylene blue and colonies counted . the ic 50 was in the range of 200 nm oodabl . baby rat kidney cells were transformed with e1a and transfected with bcl - 2 gene in which phosphorylation sites were mutated to form phosphomutant brk - 4b - bcl - 2 cells . these cells were treated with various concentrations of oodabl ( 20 and 200 nm , and 2 and 20 μm ) for 15 days and cells were then stained with methylene blue and colonies counted . the ic 50 was in the range of 2 μm . the level of bcl - 2 phosphorylation was then assessed in the non - mutated and mutated brk - 4b - bcl - 2 cells using a western blot assay . cells were initially treated for 12 hours with the test compound , oodabl ( at concentrations of 10 , 20 , 30 , 40 , or 60 μm ). taxol was used as a positive control at a concentration of 5 μm . cells were then lysed in ice cold radio - immune precipitation buffer with inhibitors . equivalent amounts of proteins were electrophoresed by 12 % dodecyl sulfate - polyacrylamide gel electrophoresis and transferred to nitrocellulose . bcl - 2 and phosphorylated bcl - 2 proteins were detected using a monoclonal bcl - 2 primary antibody and a secondary goat anti - mouse horseradish peroxidase conjugated antibody followed by enhanced chemiluminescence detection . the results showed that there was a dose - dependent increase in bcl - 2 phosphorylation with oodabl in the non - mutated cells . taxol also produced an increased in protein phosphorylation . in the mutated rat kidney cells , there was no phosphorylation evident with either taxol or oodabl . these data demonstrate that the extract of inula britannica has use as a cancer preventative and treatment agent due to its activity to induce apoptosis and cell cytotoxicity in cancer cells . the extract and the chemicals isolated therefrom , oabl and oodabl , can be used as a pharmaceutical for cancer treatment and / or prevention as well as a medical food , or nutraceutical , and a dietary supplement . the data presented support the development of either foods for animal consumption , where animals include humans , or as dietary supplements for animals including humans . these foods and supplements are referred to by those of skill in the art as “ nutraceuticals ”. compositions of the present invention would be useful as nutraceuticals for prevention or treatment of cancer . one of skill would be able to use the results of experiments in cells and animals to determine an effective amount to be administered in humans . an effective amount would be an amount that induces apoptosis or inhibits tumor growth either in vitro or in vivo in animals . for example , human test doses can be extrapolated from effective doses in cell studies , such as ic 50 values , or from effective doses in vivo by extrapolating on a body weight or surface area basis . such extrapolations are routine in the art . further , one of skill would know how to formulate or prepare diets or dietary supplements containing the analogs . in the case of animal diets , the analogs could be added in concentrations up to 5 % by weight and mixed according to methods routine in the art . dietary supplements for animals or humans could be prepared in a variety of forms that would include but not be limited to liquid , powder , or solid pill forms . pill forms for the supplements would be prepared by methods routine in the art of dosage formulation and could include but not be limited to production of gel capsules , time - release capsules , or solid pills formulated with excipients and binders . again , one of skill in the art would know how to formulate the extracts or compounds isolated therefrom based on its chemical nature and the desired effect . the extract and / or the compounds isolated therefrom could also be administered topically in liquid or creme of lotion forms or by injection . injectable forms would be prepared by solubilizing in a pharmaceutically acceptable vehicle . | 0 |
the following describes embodiments of the invention with reference to the accompanying drawings : the concept of an embodiment of the invention is first described with reference to fig2 ( d - i ), 2 ( d - ii ) and 2 ( d - iii ). fig2 ( d - i ) shows a writing / reading control pulse for writing and reading into and from a memory . reading is performed when the pulse is at a high level . writing is performed when the pulse is at a low level . fig2 ( d - ii ) and 2 ( d - iii ) show the vd and hd signals included in a video signal obtained under the control of the writing / reading control pulse . a 263h portion of the video signal is written into the memory beginning with the falling of the vd signal ( fig2 ( a - ii )) of the input video signal . a 262h portion of the signal is - read out in the order in which the signal is written in . following this , the 263h portion of the signal is read out . the signal is thus read out alternately in a quantity corresponding to 262h and in another quantity corresponding to 263h . during the last one h part of the 263h portion of the video signal being thus read out , the leading part of the vd signal is read out for a period of 0 . 5h . therefore , the leading part of the vd signal is read out from the memory at every period of 262 . 5h . the scanning lines of a reproduced image obtained by the video signal thus read out from the memory are interlaced . an embodiment of this invention in which the invention is applied to still picture reproduction by a helical scanning vtr is arranged as described below : fig3 shows in a block diagram the arrangement of the reproducing system of a vtr arranged as the embodiment of the invention . fig4 ( a ) to 4 ( i ) show in a timing chart the wave forms of the outputs of various parts of fig3 . in fig3 the same component parts as those shown in fig1 are indicated by the same reference numerals and the details of them are omitted from description . a step - up device 22 &# 39 ; is arranged to receive a clock signal of a color subcarrier frequency fsc obtained from a chrominance signal processing circuit 10 and to step up the frequency by n times to obtain a driving pulse to be used for driving a timing controller 26 . the output of the n step - up device 22 &# 39 ; is frequency - divided by an n frequency divider 24 &# 39 ; to obtain a clock signal . the clock signal thus obtained is supplied via an and gate 21 to the timing controller 26 . the timing controller 26 is arranged to control the various parts of the vtr on the basis of the clock signal . a terminal 18 is arranged to receive a still instruction signal which is shown in fig4 ( b ). the still instruction signal is synchronized by a d - ff 36 with a frame pulse which is produced from an or gate 34 and which is shown in fig4 ( c ). the q output of the d - ff 36 is supplied to the terminal d of a d - ff 35 . the d - ff 35 also receives a vd signal which is shown in fig4 ( d ) and which is separated from the output of a mixer 12 by a sync separation circuit 23 . an mm ( monostable multivibrator ) 38 is arranged to be triggered by the rise of the q output of the d - ff 35 which is shown in fig4 ( e ) and which is in synchronism with the falling edge of the vd signal . the mm 38 produces one shot pulse when it is thus triggered . the one shot pulse is applied to an sr - ff ( set - reset flip - flop ) 40 to set the latter . the q output of the sr - ff 40 which is shown in fig4 ( f ) is used for effecting change - over between writing and reading actions on a memory 42 . more specifically , the memory 42 is brought into a writing state by the timing of a fall taking place in the vd signal immediately after the level of the still instruction signal coming via the terminal 18 becomes high . the timing at which the writing action begins on the memory 42 is allowable to be within a period of 0 . 5h from the fall timing of the vd signal for obtaining the same advantageous effect of the embodiment . when the level of the q output of the d - ff 35 becomes high , the and gate 21 allows the clock signal produced from the n frequency divider 21 to be supplied to the timing controller 26 ; and an and gate 33 cancels the cleared state of an address counter 46 to permit a writing action to begin on the memory 42 . further , at this time , the reset state of a t type flip - flop ( hereinafter referred to as t - ff ) 37 is also cancelled . the writing action on the memory 42 is as follows : a composite color video signal produced from a mixer 12 is supplied to a front lpf ( low - pass filter ) 50 to have its frequency and band limited thereby . after that , the video signal is digitized by an a / d converter 52 which is arranged to operate under the control of a signal obtained through an m frequency divider 31 by frequency - dividing by a value m the output of the n step - up device 22 &# 39 ;. input - output interfaces ( hereinafter referred to as ifs ) 54 and 56 are arranged to control the data transfer speed , the transfer timing , the mode , etc . of the memory 42 . the ifs 54 and 56 operate on the basis of a clock signal produced from the timing controller 26 . when the vtr is in the above stated condition of having begun writing data into the memory 42 , the levels of the q and q of the t - ff 37 are high and low respectively . a 263h detection circuit 39 is in an operative state . a 262h detection circuit 41 is in an inoperative state . these detection circuits 39 and 41 are arranged to produce negative pulses when the address counter 46 counts addresses for 263h and 262h respectively . therefore , when a portion of the video signal for 263h has been stored by the memory 42 as addressed by the address counter 46 , the 263h detection circuit 39 produces a negative pulse as shown in fig4 ( g ). this pulse becomes a clearing pulse as shown in fig4 ( i ) and is applied via the and gates 43 and 33 to the address counter 46 to clear it for address resetting . meanwhile , the above stated pulse is supplied also to the reset terminal of the sr - ff 40 . this changes the level of the q output of the sr - ff 40 to a high level to bring the memory 42 into a reading state . further , the level of the output of the and gate 45 changes to a high level to shift the connecting position of the switch 14 to one side m thereof . the output of the and gate 43 is supplied also to the check terminal of the t - ff 37 . this causes the level of the q output and q output of the t - ff 37 to change to low and high levels respectively . as a result , the 262h detection circuit 41 becomes operative and the 263h detection circuit inoperative respectively . with the address counter 46 reset in this manner , the data is read out from the memory 42 according as addressed by the address counter 46 . the data thus read out from the memory 42 is converted into an analog signal by a d / a converter 58 through the if 56 . the analog signal thus obtained is supplied to a rear lpf 60 to have its frequency band limited there . the output of the lpf 60 is supplied to the terminal of the switch 14 on the side m thereof . since the connecting position of the switch 14 is then on the side m as mentioned above , the signal read out from the memory 42 is allowed to be produced from a terminal 16 . with a process of reading out from the memory 42 having commenced in this manner , when a 262h portion of the video signal is read out , the 262h detection circuit 41 produces a negative pulse as shown in fig4 ( h ). this pulse resets the address counter 46 and inverts the output of the t - ff 37 . in this manner , the 262h detection circuit 41 and the 263 detection circuit 39 thereafter alternately become operative to alternately read out the 262h portion of the video signal and the 263h portion thereof . this arrangement ensures that an interlaced still picture signal can be obtained without any skew . after that , when the still picture reproduction mode is cancelled with the level of the still instruction signal becoming low , the level of the q output of the d - ff 36 is changed to a low level by a pulse produced from an or gate 34 immediately after the cancellation of the still picture reproduction mode . then , the output level of the d - ff 35 is changed to a low level by the fall of the vd signal which takes place immediately after the change . as a result , the operation of the address counter 46 comes to a stop . the connecting position of the switch 14 shifts to another side n thereof to bring the vtr into a motion picture reproduction mode . in the case of the vtr of this embodiment , the heads ha and hb are rotating during the process of still picture reproduction . meanwhile , the capstan of the vtr remains in repose . as shown in fig2 ( d - i ) and 2 ( d - ii ), there is obtained a still image signal in which the fall of the vd signal appears at every period of 262 . 5h and the hd signal in a continuous manner . in other words , the vtr gives an adequate still picture which has interlaced scanning lines and has no skew . while the processing arrangement of this invention is applied to the reproducing system of the vtr in the case of the embodiment described , a still picture having interlaced scanning lines and having no skew is likewise obtainable by storing a 263h portion of an ntsc signal produced from some other apparatus , such as a tv tuner or the like . the following describes another embodiment of this invention with reference to fig5 to 8 ( g ): fig5 is a block diagram showing in outline a vtr which is arranged as the embodiment . in fig5 the same component parts as those of fig3 are indicated by the same reference numerals and the details of them are omitted from description . referring to fig5 the recording operation of the vtr is first briefly described as follows : a composite color video signal which is supplied to a terminal 1 is separated into a luminance signal and a carrier chrominance signal at a y / c separation circuit 3 . the luminance signal is supplied to a luminance signal processing circuit 5 to be subjected to various processes such as frequency modulation , etc . the carrier chrominance signal is supplied to a chrominance signal processing circuit 7 to be frequency - converted into a low band chrominance signal having the lower frequency band of the frequency - modulated luminance signal fm - y obtained from the luminance signal processing circuit 5 . the luminance signal fm - y and the low band chrominance signal c thus obtained are mixed together by a mixer 9 . the output signal of the mixer 9 is supplied to rotary heads ha and hb via a switch 11 the connecting position of which is shifted to one side r thereof during recording and another switch 4 which is arranged to be changed by the pg signal from one connecting position over to another . the output of the mixer 9 is thus recorded on a tape while forming recording tracks one after another . further , in case that an instruction for recording is produced from an operation part 13 , a system controller 15 causes a drum motor control circuit 17 to have the rotary heads ha and hb revolved at a given constant speed in synchronism with the input video signal . the system controller 15 also causes a capstan motor control circuit 19 to have a capstan which is not shown rotate at a given constant speed to cause the tape to travel at a given speed . fig6 shows a concrete example of the recording chrominance signal processing circuit 7 . the carrier chrominance signal separated by the y / c separation circuit 3 is supplied to a publicly known acc circuit 102 via a buffer amplifier 101 . the level of a burst signal extracted from an output of the acc circuit 102 is detected by a level detection circuit 103 . in response to an output of the level detection circuit 103 , the acc circuit 102 controls the level of the burst signal to be constant . a sync separation circuit 104 is arranged to separate the hd and vd signals from the input signal . the hd signal is then supplied to an afc circuit 106 , the level detection circuit 103 and a burst gate circuit 105 . an afc circuit 106 is arranged to control the oscillation frequency of a voltage - controlled oscillator ( hereinafter referred to as vco ) 107 in such a way as to have the phase of a signal of a frequency fh which is obtained by frequency - dividing the oscillation signal of the vco 107 by means of a 1 / 378 frequency divider 108 coincide with that of the hd signal separated by the sync separation circuit 104 . the output of the vco 107 is frequency - divided to 1 / 8 thereof by a frequency divider 109 and is thus made into a signal of a frequency fc (= 378 fh / 8 ). this signal is supplied to a balanced modulator ( bm ) 110 . meanwhile , a color burst signal which is gated by the burst gate circuit 105 is supplied to a phase comparator ( pc ) 111 to have its phase compared with that of a signal obtained by the oscillation of a variable frequency - controlled oscillator ( vxo ) 112 . the output of the pc 111 controls the oscillation frequency of the vxo 112 . as a result , the vxo 112 produces a signal of a frequency fsc the phase of which is in synchronism with that of the color burst signal . that signal is supplied to the bm 110 as another input thereof . the bm 110 then produces a signal of a frequency ( fc + fsc ), which is supplied via a band - pass filter which is not shown to another bm 113 as a frequency converting signal . the carrier chrominance signal which is level - controlled by the acc circuit 102 is supplied to a burst emphasis ( bu ) circuit 114 . then , the side - band component of the carrier chrominance signal is emphasized by a side - band emphasis circuit 115 . after that , the carrier chrominance signal is frequency - converted at the bm 113 by using the signal produced from the bm 110 . the output signal of the bm 113 is supplied to an lpf 116 . the output of the lpf 116 is then supplied to the mixer 9 of fig5 as a carrier chrominance signal having a carrier frequency fc . fig6 further includes a frequency divider 117 which is arranged to frequency - divide to 1 / 2 the vd signal which is separated by the sync separation circuit 104 ; and a 519h delay circuit 118 which is arranged to delay the output of the frequency divider 117 as much as 519h . the output of the delay circuit 118 is in synchronism with the pg signal . the standard reproducing operation of the vtr is as follows : the system controller 15 causes the connecting position of the switch 11 to be on one side p thereof to allow the output signal of the head switch 4 to be supplied to the y / c separation circuit 6 . as a result of this , a reproduced composite color video signal is obtained from the mixer 12 in the same manner as in the case of the conventional vtr shown in fig1 . the reproduced composite color video signal is produced from a terminal 16 via the switch 14 the connecting position of which is on the side n thereof . fig7 shows by way of example the details of the reproduced chrominance signal processing circuit 10 of fig5 . referring to fig7 the low - band chrominance signal c separated by the y / c separation circuit 6 is supplied via a bpf 201 to an acc circuit 202 . the level of the burst signal obtained at the output stage of the processing circuit 10 is detected by a level detection circuit 203 . the acc circuit 202 then controls the output signal of the bpf 201 in such a way as to make the level of the burst signal constant . the output signal of the acc circuit 202 is supplied to a burst suppression ( bd ) circuit 204 to have the level of the burst signal suppressed there . the output of the circuit 204 is supplied to a bm 205 to undergo a balanced modulation with a signal which will be described later . the output of the bm 205 is supplied to a bpf 206 . the bpf 206 separates a frequency band of the input signal having the frequency fsc at the center thereof . the output of the bpf 206 is supplied to a comb filter 207 to remove therefrom a noise component in the neighborhood of a frequency which is an integer times as high as the frequency fh . a burst gate ( bg ) circuit 208 is arranged to separate a color burst signal from the carrier chrominance signal produced from the comb filter 207 . the color burst signal is supplied to a pc 210 to be phase - compared with an oscillation signal of the frequency fsc which is produced from a quartz oscillator ( x &# 39 ; tal ) 209 . a phase error voltage which is thus obtained as a result of comparison is used as a control voltage for a vco 211 which is arranged to oscillate at a center frequency of 378 fh . a sync separation circuit 212 is arranged to separate hd and vd signals . the hd signal is supplied to an afc circuit 213 . the afc circuit 213 is arranged to synchronize with this hd signal a signal obtained by frequency - dividing the oscillation signal of the vco 211 to 1 / 378 by means of a frequency divider 214 . a bm 215 is arranged to balance - modulate the output of the oscillator ( x &# 39 ; tal ) 209 and that of the vco 211 . a bpf 216 is arranged to filter a frequency component ( fc + fsc ) of the output signal of the bm 215 and to supply it to the bm 205 as a signal to be used for modulation . the carrier chrominance signal produced from the comb filter 207 is supplied to a side - band deemphasis circuit 217 to have its side - band component suppressed there before it is supplied to the mixer 12 . in the case of the standard reproduction , the capstan motor control circuit 19 controls the travel of the tape to have the heads ha and hb accurately trace each of recording tracks formed on the tape . a drum motor control circuit 17 is arranged to control the revolution of the rotary heads ha and hb in such a way as to have the vd signal separated by the sync separation circuit 104 of fig6 at the same phase as that of the vd signal separated by the sync separation circuit 212 of fig7 . the still picture reproducing operation of the vtr is as follows : when an instruction for still picture reproduction is produced by a manual operation on the operation part 13 , the level of a still instruction signal still , as indicated in fig5 becomes high . the operator is assumed to designate beforehand either a long - time still picture reproducing mode ( ls mode , for long ) or a standard still picture reproducing mode ( ss mode , for short ). in case that the ls mode is designated , the level of a still mode designation signal sl , as shown in fig5 is arranged to be at a high level . in the event of the ss mode designation , this signal is at a low level . in the case of the high level of this still mode designation signal , signal selection circuits 121 , 123 and 125 all produce signals received at their terminals b . in the event of the low level of the still mode designation signal , they produce signals received at their other terminals a . in the case of still picture reproduction in the ss mode , the vtr operates as follows : referring to fig8 ( a ) to 8 ( g ), the selection circuit 121 , in this instance , produces the pg signal as shown in fig8 ( a ). then , a frame pulse which is shown in fig8 ( b ) is obtained from an or gate 34 . the still instruction signal which is produced from the operation part 13 and which is shown in fig8 ( c ) is changed by the d - ff 36 into a signal which is in synchronism with the frame pulse as shown in fig8 ( d ). meanwhile , the selection circuit 123 produces the signal of the frequency fsc received from the x &# 39 ; tal 209 of fig7 and supplies it to an n step - up device 127 which is composed of a pll . the output of the step - up device 127 serves as a driving pulse for the timing controller 26 and is supplied to an m frequency divider 129 and an l frequency divider 131 . the output of the l frequency divider 131 is used as the operation clock for an a / d converter 52 and a d / a converter 58 . the output of the m frequency divider 129 is supplied to the timing controller 26 . the timing controller 26 is arranged to produce operation clock signals for controlling the ifs 54 and 56 , the memory 42 , the address counter 46 , etc . the q output of the d - ff 36 which is shown in fig8 ( d ) is supplied to the mm 38 . the output of the mm 38 which is shown in fig8 ( e ) is applied to the sr - ff 40 to set it . the level of the q output of the sr - ff 40 which is shown in fig8 ( f ) then changes to a low level to bring the memory 42 into a writing state . at this time , the level of the q output of the d - ff 36 becomes high . therefore , the level of the clear ( cl ) input of the address counter 46 is changed to a high level via the and gate 133 . as a result , the address counter 46 begins to operate to control the writing address of the memory 42 . the output of the and gate 135 remains at a low level as the still mode designation signal is at a low level . therefore , the flip - flop 37 is in a cleared state . the level of the q output of the flip - flop 37 becomes low and that of the q output high . these outputs are supplied to the enable terminals ( en ) of the 263h detection circuit 39 and the 262h detection circuit 41 . therefore , the 262h detection circuit 41 remains inoperative while the 263h detection circuit 39 alone becomes operative . when a 263h portion of the video signal is written into the memory 42 , the 263h detection circuit 39 generates a negative pulse . the negative pulse clears ( resets ) the address counter 46 coming via the and gate 143 , the selection circuit 125 and the and gate 133 . further the pulse also resets the sr - ff 40 to make the level of the q output of the sr - ff 40 high . as a result , the memory 42 is brought into a reading state . the output level of the and gate 145 then changes to a high level . with the output level of the and gate 145 becoming high , the connecting position of the switch 14 shifts from the side n to the other side m . after that , the switch 14 produces the video signal read out from the memory 42 . the output of the and gate 145 is supplied also to the capstan motor control circuit 19 . with the output level of the and gate 145 changed to a high level , the capstan motor control circuit 19 stops the capstan from rotating to bring thereby the tape to a stop . after this , a frame pulse is supplied from the or gate 34 to the and gate 143 when a 262h portion of the video signal is read out from the memory 42 . the frame pulse then comes to clear the address counter 46 via the selection circuit 125 and the and gate 133 . following that , when a 263h portion of the video signal is further read out from the memory 42 , the 263h detection circuit 39 generates a negative pulse . the negative pulse clears the address counter 46 . the address counter 46 is thereafter repeatedly cleared in this manner to have the 262h portion of the video signal and the 263h portion of the video signal alternately read out from the memory 42 . this arrangement ensures that a still picture signal is produced from the terminal 16 without any skew . when the operation part 13 is operated to cancel the still picture reproduction mode , the level of the still instruction signal becomes low . then , the output level of the d - ff 36 changes to a low level in synchronism with a next frame pulse . following this , the output levels of the and gates 133 and 145 become low . the operation of the address counter 46 comes to a stop . the capstan motor control circuit 19 causes the capstan to have the tape travel at a speed for standard reproduction . the connecting position of the switch 14 is shifted to the other side n . then , a reproduced signal obtained in the standard reproduction mode comes to be produced from the terminal 16 . in this case , the rotary heads ha and hb are allowed to continuously revolve even during the process of still picture reproduction . the address counter 46 is , therefore , repeatedly reset in synchronism with the pg signal . this arrangement ensures that the vd signal included in the video signal produced from the terminal 16 does not deviate from predetermined intervals and thus never causes any disturbance in the reproduced picture even when the vtr is shifted from the still picture reproduction mode back to the standard reproduction mode . before the description of the operation of the vtr in the ls mode , control over the drum motor for the standard reproduction is described as follows : the vtr is assumed to have a composite video signal supplied to the terminal 1 either from a video camera or a video tuner and the circuits within its recording system remain in their operative states even while the vtr is in its reproducing state . the vd signal which is produced from the sync separation circuit 104 of fig6 and the vd signal which is produced from the sync separation circuit 212 of fig7 are being received at the drum motor control circuit 17 . the revolution of the heads ha and hb is controlled by the circuit 17 to have the phases of these vd signals coincide with each other . when the ls mode is designated for still picture reproduction , the vtr operates as follows : the still mode designation signal , in this instance , is at a high level . all the selection circuits 121 , 123 and 125 produce the signals coming to their sides b . the selection circuit 121 produces a signal of a rectangular wave of 30 hz which is synchronized with the pg signal produced from the delay circuit 118 of fig6 . the wave form of this signal is as shown in fig8 ( a ). the wave forms shown in fig8 ( a ) to 8 ( f ) remain the same both in the ss mode and ls mode . in the case of fig8 ( g ), however , a wave form part indicated by a broken line is obtained solely in the ss mode . the or gate 34 produces a pulse in synchronism with the falling edge of the rectangular wave signal produced from the selection circuit 121 . the selection circuit 123 produces a signal of the frequency fsc produced from the vxo 112 of fig6 . the timing controller 26 is driven on the basis of this signal . in synchronism with the pulse output of the or gate 34 which is shown in fig8 ( b ) and which is obtained immediately after the level of the still instruction signal ( fig8 ( c )) becomes high , the level of the q output of the d - ff 36 ( fig8 ( d )) changes to a high level . by this , the cleared state of the address counter 46 is cancelled to render it operative . meanwhile , with the level of the q output of the d - ff 36 having become high , the mm 38 generates a pulse to set the sr - ff 40 . this pulse brings the memory 42 into a writing state . at this time , the output level of the and gate 135 also changes from a low level to a high level . the high level output cancels the cleared state of the ff ( flip - flop ) 37 . under this condition , the 263h detection circuit 39 is in an operative state . when the 263h portion of the video signal is written into the memory 42 , the 263h detection circuit 39 produces a negative pulse . the negative pulse comes via the and gate 147 , the selection circuit 125 and the and gate 133 to clear the address counter 46 . the sr - ff 40 is also reset . the memory 42 then comes to assume a reading state . the output level of the and gate 145 changes to a high level . the connecting position of the switch 14 is shifted to the side m thereof . the capstan motor control circuit 19 stops the capstan from rotating to bring the travel of the tape to a stop . the drum motor control circuit 17 has the output of the and gate 135 supplied thereto . in the case of the ls mode , the level of this output of the and gate 135 changes to a high level when writing begins on the memory 42 . in response to this output of the and gate 135 , the drum motor control circuit 17 brings drum rotation to a stop after completion of the process of writing the 263h portion of the video signal on the memory 42 . this stops the heads ha and hb from revolving . the output of the and gate 147 is supplied to the clock terminal of the ff 37 . the level of the q output of the ff 37 changes to a high level to render the 263h detection circuit 39 inoperative and the 262h detection circuit 41 operative . therefore , when the 262h portion of the video signal is read out after commencement of reading from the memory 42 , the 262h detection circuit 41 produces a negative pulse to reset the address counter 46 . at the same time , the output of the ff 37 is inverted . following this , the 263h detection circuit 39 again become operative . the 262h detection circuit 41 and the 263h detection circuit 39 thus alternately become operative to read out the 262h portion of the video signal and the 263h portion of the video signal alternately from the memory 42 . by virtue of this arrangement , the vtr is capable of producing a still image signal with no skew . after that , the ls mode is cancelled when the level of the still instruction signal becomes low . then , immediately after the cancellation of the ls mode , the pulse output of the or gate 34 changes the level of the q output of the d - ff 36 , which is shown in fig8 ( d ), to a low level . the operation of the address counter 46 comes to a stop . the connecting position of the switch 14 shifts to the other side n . the capstan motor control circuit 19 causes the capstan to rotate to have the tape travel at a given speed . by this , a motion picture can be reproduced continuously from the reproduced still picture . the above stated arrangement of the embodiment , enables the vtr to shift from the short - time still picture reproduction mode to the motion picture reproduction mode without disturbing the reproduced picture and , in the event of the long - time still picture reproduction mode , to obtain a still picture with no skew and without causing any damage to the tape . further , in the case of the vtr of this embodiment , a signal which is obtained by dividing into 1 / 2 the frequency of the vd signal included in the video signal received at the terminal 1 and by delaying it is used for controlling the start timing of the writing process on the memory 42 . however , since the heads ha and hb are revolving at the time of commencement of writing , the falling edge of the pg signal may be used for controlling the writing start timing like in the case of the ss mode . further , in the case of ls mode , the timing controller 26 is arranged to operate on the basis of the output of the controlled oscillator 112 which is included in the recording chrominance signal processing circuit 7 . however , this arrangement may be changed to use the output of the x &# 39 ; tal 202 which is used for the ss mode by allowing it to operate in a free running state . further , in shifting from the still picture reproducing mode to the motion picture reproducing mode , the capstan and the drum are assumed to immediately follow the shift in the foregoing description . in actuality , however , they probably require some period of time before their rotation reaches a normal constant state for the motion picture reproduction after the change - over . this problem , however , can be solved by allowing the rotation of the capstan and the drum to build up immediately after an instruction is given by the operation part 13 for change - over from the still picture reproduction to the motion picture reproduction and by allowing the level of the still instruction signal to become low after stabilization of the rotating parts . the period of time after the instruction for shifting the mode and before the level of the still instruction signal is allowed to become low can be adequately predetermined according to the results of actual tests for the servo - stabilization of the above stated rotation system . | 7 |
it is known that zirconium hydroxide is prepared by alkali precipitation of an aqueous solution of a zirconyl salt . for the present invention it is preferred that the alkali be ammonia since it is more efficiently washed out than the alkali metal hydroxides or alkaline earth metal hydroxides . precipitation at cold ( ambient ) temperature gives a gelatinous product which is substantially zr ( oh ) 4 containing about 26 . 5 % water or more . a partially dehydrated zirconyl hydroxide , zro ( oh ) 2 , results from drying it at elevated temperature ( e . g ., 100 ° c . ), or from hot - precipitation ( e . g ., 85 ° c .) followed by hot drying . thus , in the present invention the expression &# 34 ; hydrous zirconium oxide &# 34 ; has within the purview of its meaning any of the various amorphous polymeric hydrated forms of zirconium oxide which are substantially or largely insoluble in plain water . the macroporous cation exchange resin is one which contains sulfonic acid ( so 3 - ) functional groups . such resins are available commercially , such as sulfonated polymers of styrene crosslinked with divinylbenzene . for instance a macroporous cation exchange resin with so 3 - na + groups affixed to a styrene - divinylbenzene resin structure is sold by the dow chemical company under the tradename dowex msc - 1 - na + . it is within the purview of the present invention to use any porous resin containing sulfonic acid functional groups , so long as the resin is substantially inert or non - reactive , when used in the present invention , except for the reactivity of the sulfonic acid functionality groups . in general , the polymeric hydrous zirconium oxide is formed within the resin beads by wetting the resin with an aqueous solution of a soluble zirconyl compound , such as zrocl 2 . 8h 2 o . if excessive zirconyl solution is present , it should be drained off and the resin substantially dried , such as by air - drying . the dried resin , containing the zirconyl compound is neutralized , preferably by use of nh 4 oh , thereby forming polymeric zro ( oh ) 2 and / or zr ( oh ) 4 . excess nh 4 oh and nh 4 cl ( which forms ) is washed out , such as by repeated contact with water or nacl brine . the composite is impregnated with acrylic acid which is polymerized in - situ with a free - radical or redox polymerization initiator or catalyst . the composite is then preferably treated with an acid , e . g ., with hcl . in the general process outlined above , the beginning zirconyl compound may be zrocl 2 . xh 2 o or the like , such as zr ( no 3 ) 4 . 5h 2 o , zrobr 2 . xh 2 o , zroi 2 . 8h 2 o , or zr ( so 4 ) 2 . 4h 2 o , or any such zirconium compound which will precipitate to form zr ( oh ) 4 and / or zro ( oh ) 2 when contacted with a base , especially nh 4 oh . the so - formed zr ( oh ) 4 and / or zro ( oh ) 2 , also called &# 34 ; zirconium hydrous oxide &# 34 ; or &# 34 ; zirconyl hydrate &# 34 ;, is an amorphous , polymeric structure . following the above alkalizing step , acrylic acid monomer is polymerized in - situ in the composite ; the acid used for lowering the ph is preferably hcl , but may also be hbr , hi , hno 3 , and the like . polymerization of acrylic acid in aqueous solution is readily and conveniently carried out by application of heat , especially in the presence of a free - radical generator , e . g ., a small amount of k 2 s 2 o 8 . redox initiators may also be used . the addition of and in - situ polymerization of acrylic acid may , alternatively , be performed prior to addition of and precipitation of the zirconium compound . other polymerizable carboxylic acid monomers may be used , e . g ., methacrylic acid , but acrylic acid is preferred because it is the smallest in molecular size of the unsaturated carboxylic acids . as stated above , once the resin has been acidized , the composite is ready to take on so 4 = values from alkali metal salt brine . this is done , for example , by placing the composite in a vessel , preferably a column , and passing sulfate - containing brine through the composite until the composite is substantially &# 34 ; loaded &# 34 ; with so 4 = values and is ready for another water - washing . it is within the purview of this invention that the alkali metal salt brine may be a natural brine , such as seawater or mineral brine , a licl brine , a kcl brine , or an alkali metal salt brine which comes from an ore dressing , ore leaching , mineral dressing , and the like . the brine may contain only a small amount , say less than about 1 % of hardness values , preferably less than about 0 . 1 % hardness values . the present novel composite exhibits a high affinity for , and a strong preference for , so 4 = ions , but is also effective for borate , bicarbonate , and / or phosphate ions . in certain embodiments the product may be described as a macroporous ion exchange resin of the sulfonated styrene - divinyl benzene type ( e . g ., dowex ® msc - 1 ) containing throughout its bead structure gelatinous zirconium hydroxide or zirconyl hydroxide , and further modified by polyacrylic acid formed by absorbing monomeric acrylic acid into the structure and polymerizing in situ . the resin is initially activated for so 4 = pick - up by acidizing to 2 - 3 ph with hcl , thus converting the polymeric zr ( oh ) 4 to a polymer of the composition zr ( oh ) 3 cl . the so 4 = pick - up is an exchange of 2cl - for 1so 4 = . water regeneration removes na 2 so 4 ; the so 4 = comes from the ( zr ( oh ) 3 + ) 2 so 4 = and the na + from the -- so 3 - na + and the -- coo - na + . the initial resin generally contains on the order of at least about 1 meq . -- so 3 - h + groups per ml , zr ( oh ) 4 is added to about 0 . 8 atom zr per atom s , and acrylic acid is added to approximately 1 molecule per atom zr . preferred operation is counterflow at rates of 0 . 01 - 0 . 1 v b / min . at 40 °- 60 ° c . with about 2 to about 3 ph . the flow rate may be increased to 0 . 2 - 0 . 25 v b / min . at 100 °- 120 ° c . where hot salt brine and water are available . at ph values of much less than 2 the coona will be present as cooh and thus will reduce the efficiency of h 2 o regeneration ; at ph values much above about 3 some of the zr will exist as zr ( oh ) 4 and pick up much less so 4 = . the following is intended to illustrate the present invention , but the invention is not limited to the particular embodiment examples shown . performance in the removal of so 4 = from 26 % nacl with water regeneration is compared between resins with and without -- cooh groups . detailed preparation and operating data are given below . about 150 ml of dowex ® msc - 1 ( 8 % dvb , 50 - 100 mesh ground ) in h + form was washed and put in a glass column . 32 % aqueous zrocl 2 was run through the column downflow until the effluent density was the same as the influent . n 2 gas was run through the resin until it was dry and free flowing . dry weight was 119 . 7 gms . this resin was poured into 120 ml of 30 % aqueous nh 3 and allowed to react for 15 minutes . the resin was washed well with water and then with 26 % nacl . immersed in excess 26 % nacl it was titrated with n / l hcl to 2 . 4 ph requiring 85 meg . hcl . the resin volume was now 130 ml . 116 ml of resin was put in a column and operated upflow with 25 % nacl containing 1800 mg / l so 4 = at 2 . 4 ph at 10 ml / min and 72 ° c . 715 ml of brine effluent was obtained with the last 100 ml analyzing 1230 mg / l so 4 . the resin was regenerated with water downflow at 3 . 3 ml / min and 72 ° c ., taking cuts of the effluent for analysis . ______________________________________cut # vol . ( ml ) so . sub . 4 . sup .═ ( mg / 1 ) ______________________________________1 50 16902 25 11143 10 11144 10 22565 10 35046 10 33317 10 29288 10 not analyzed9 50 1981______________________________________ brine was then run upflow again at 10 ml / min and 72 ° c ., with effluent cuts . ______________________________________cut # vol . ( ml ) so . sub . 4 . sup .═ ( mg / l ) ______________________________________1 50 not analyzed2 30 not analyzed3 50 5384 100 9025 100 1114______________________________________ the resin ( 130 ml ) was then well washed with water and sucked almost dry . it was added to a stirred pot with 75 ml h 2 o and a solution containing 20 ml h 2 o , 5 gm . acrylic acid , and 0 . 2 gm . k 2 s 2 o 8 . the mix was stirred for 60 minutes at 25 ° c . to initiate polymerization . the mix was then put in a beaker , covered with aluminum foil and put in a 95 ° c . oven overnight to complete polymerization . it boiled to dryness with a small amount of overflow and loss of resin . it was washed with water to give a resin volume of 124 ml ( hence a loss of 6 ml ). immersed in 26 % nacl and titrated up to 2 . 4 ph with 3 ml n / l naoh . 116 ml of resin was put in a column and saturated upflow with 900 ml of 2 . 4 ph 26 % nacl containing 1800 mg / l so 4 = , at a flow rate of 10 ml / min and a temperature of 72 ° c . the resin was then regenerated downflow with water at 3 . 2 ml / min and 72 ° c ., taking cuts of the effluent for so 4 analysis : ______________________________________cut # vol . ( ml ) so . sub . 4 . sup .═ ( mg / l ) ______________________________________1 50 1 , 6902 25 1 , 5173 10 2 , 9764 10 8 , 7365 10 11 , 6166 10 9 , 4567 10 7 , 7768 10 5 , 9049 10 4 , 77210 10 4 , 14711 10 not analyzed12 10 3 , 31213 10 not analyzed14 10 not analyzed15 25 not analyzed16 50 1 , 440______________________________________ other embodiments will become apparent to persons skilled in the art without departing from the scope of the presently disclosed invention . | 2 |
while the specification concludes with claims particularly pointing out and distinctly claiming the subject matter regarded as forming the present invention , it is believed that the invention will be better understood from the following detailed description of preferred embodiments of the invention taken in conjunction with the appended drawings , in which , briefly : fig1 is a graphical representation which shows the fluorescence emission spectra ( excitation wavelength = 337 nm ) of 0 . 1 mm solutions of an illustrative novel substrate of the invention , abz - thr - ile - nle - phe ( p - no 2 )- gln - arg - nh 2 ( abz - nf * - 6 ) and product , abz - thr - ile - nle - oh ( abz - tin - oh ), demonstrating quenched fluorescence in substrate due to proximity of donor ( abz ) and acceptor ( phe ( p - no 2 )) chromophores . fluorescence magnitude is plotted versus emission wavelength . fig2 is a graphical representation which shows the hplc profile of elution pattern of abz - thr - ile - nle - phe ( p - no 2 )- gln - arg - nh 2 ( abz - nf * - 6 ), elution time = 42 . 1 min , and products , abz - thr - ile - nle - oh ( elution time = 37 . 4 min ) and h - phe ( p - no 2 )- gln - arg - nh 2 ( elution time = 17 . 7 min ). other peaks are due to buffer components . uv absorbtion is plotted versus time . fig3 is a graphical representation which shows the fluorescence emission increase as function of time demonstrating linear portion of assay under conditions used . initial kinetics were monitored on the slm 8000 c fluorometer at 25 ° with magnetic stirring at optimal conditions ( excitation = 337 nm and emission = 410 nm ). fluorescence is plotted versus time . the preferred novel fluorogenic substrates of this invention and their analogs can be made by known solution and solid phase peptide synthesis methods but modified to incorporate the acceptor residue , e . g . phe ( p - no 2 ), in the pl &# 39 ; position , and the fluorogenic group , e . g . 2 - aminobenzoic acid ( abz ), at the n - terminal position and amide at the c - terminus . the preferred peptide syntheses method follows conventional merrifield solid - phase procedure [ j . amer . chem . soc . 85 , 2149 - 54 ( 1963 ); science 150 , 178 - 85 ( 1965 )] modified by the procedure of tam et al ., j . amer . chem . soc . 105 , 6442 - 6445 ( 1983 ). in order to illustrate specific preferred embodiments of the invention in greater detail , the following exemplary laboratory preparative work was carried out . it should be understood that the invention is not limited to these specific examples . solid phase synthesis of hiv protease substrates . acetyl hexapeptide amides were prepared by conventional solid phase peptide synthesis using the p - methylbenzhydrylamine polymer . for each synthesis , 0 . 5 grams of polymer was used ( 0 . 5 mmole ). the following synthetic protocol was used for incorporation of the boc - amino acids : ______________________________________deprotection : 50 % trifluoroacetic acid / ch . sub . 2 cl . sub . 2 5 min and 25minch . sub . 2 cl . sub . 2 2 × 1 minisopropanol 2 × 1 minch . sub . 2 cl . sub . 2 2 × 1 minneutralization : 10 % diisopropylethylamine / ch . sub . 2 cl . sub . 23 min and 5 minch . sub . 2 cl . sub . 2 2 × 1 mindmf 2 × 1 min______________________________________ coupling : 4 equivalent of boc - amino acid and 4 equivalents of diisopropylcarbodiimide in the presence of 4 equivalents of hydroxybenzotriazole in dmf for 2 hours . coupling in dmf was repeated if the kaiser test were positive . completed peptides were cleaved by the hf / anisole 9 : 1 procedure of tam et al ., j . am . chem . soc . 105 , 6442 - 6445 ( 1983 ). crude peptides were dissolved in 20 % acetic acid and lyophilized . they were purified by reversed - phase hplc on a c 18 semipreparative column using a 0 . 1 % tfa and acetonitrile gradient . their identity was confirmed by high - resolution mass spectrometry , nmr and amino acid analyses . hplc assay . the hplc hiv protease assay was conducted using either synthetic hiv protease [ schneider and kent , cell 54 , 363 - 368 ( 1988 )] in which the two cys residues ( cys 67 , cys 95 ) were replaced by the isosteric α - aminobutyric acid to eliminate the complications of free sulfhydryl groups , or cloned material expressed in e . coli . in all cases examined , the cleavage patterns and inhibition results were identical . synthetic hplc - purified protease ( 0 . 05 mg / ml ) was dissolved in assay buffer ( 20 mm phosphate , 20 % glycerol , 0 . 1 % chaps , ph 6 . 4 ). 20 μl of 0 . 1 mm substrate was mixed with 20 μl assay buffer and 10 μl of hiv protease stock were added and then incubated at 25 ° for the desired time . the reaction was stopped by the addition of 50 μl of 10 % tfa . the sample was applied to a c 18 hplc column developed with 0 . 05 % tfa for 5 min followed by a gradient of 0 - 40 % acetonitrile in 40 min . for inhibitor studies , 10 μl of the protease solution was preincubated at 25 ° for 10 min with the 20 μl of 0 . 1 mm inhibitor ( dissolved in dmso and diluted to 0 . 1 mm with assay buffer ). then 20 μl of test substrate , acetyl - thr - ile - met - met - gln - arg - nh 2 or abz - nf * - 6 , was added in order to determine inhibition of cleavage . reactions were stopped and cleavage rates were monitored by hplc as above . in order to confirm the cleavage pattern of abz - thr - ile - nle - phe ( p - no 2 )- gln - arg - nhz , cleavage was allowed to finish as judged by hplc and the two product peaks were isolated by hplc . incubation with either synthetic hiv protease or enzyme expressed and purified from e . coli gave the same hplc pattern ( fig2 ). retention time of the substrate was 41 . 1 min , while abz - thr - ile - nle was 37 . 4 min and phe ( p - no 2 )- gln - arg - nh 2 was 17 . 7 min . identity of the product peptides was confirmed by fabms and amino acid analysis . fluorescence spectra . the excitation and emission spectra were measured on a slm 8000 c spectrometer . both the substrate , abz - nf * - 6 , and the n - terminal product , abz - thr - ile - nle - oh , show absorption maxima at 337 nm and broad emission maxima between 390 - 440 nm . the comparison between substrate and product at the same concentration shows dramatically the increase of ten fold in excitation and 6 fold in emission upon enzymatic hydrolysis . initial kinetics were monitored at 25 ° with magnetic stirring at optimal conditions ( excitation = 337 nm and emission = 410 nm ). uv spectra . the absorbtion spectra of the substrate , abz - nf * - 6 , and the n - terminal product , abz - thr - ile - nle - oh , were recorded on a bechman du - 8 spectrophotometer . the substrate shows maxima at 328 nm and 254 nm while the cleavage product has maxima at 318 nm and 252 nm . fluorescence assay . fluorescence measurements on 96 - well elisa plates were made with the titertek fluoroskan ii , version 3 . 1 . an excitation filter of 355 nm and an emission filter of 430 nm was used . ten μl of a stock solution ( 0 . 1 mg / ml ) of hiv protease was incubated with five different concentrations of abz - nf * - 6 in a final volume of 100 μl at 37 ° c . with the increase in fluorescence monitored in each well every five minutes . a stock solution of 1 mm abz - nf * - 6 in dmso was used . a standard curve relating changes in fluorescent intensity to changes in concentration of product was used to convert fluorescence changes into molar velocities . in order to predetermine the concentration range for k i determination of inhibitors , it was found convenient to do a preliminary assay by hplc . twenty μl of 0 . 1 mm inhibitor in assay buffer ( ph 6 . 4 ) and 10 μl of hiv protease ( stock solution of 0 . 05 mg / ml ) were preincubated for 5 - 10 min at 25 ° c . twenty μl of 0 . 1 mm abz - nf * - 6 was added and the reaction continued for 1 hour . sixty μl of 10 % tfa was added to stop the reaction and the amount of cleavage determined by hplc . in the absence of inhibition , complete cleavage occurs . by the amount of substrate remaining , an estimated k i allows appropriate choice of concentration ranges for the inhibitor for the fluorescence assay . six peptides were thus prepared as potential chromogenic substrates with the following sequences : h - ser - phe - asn - phe ( p - no 2 )- pro - gln - val - thr - oh ; h - arg - lys - ile - leu - phe ( p - no 2 )- leu - asp - gly - oh ; h - thr - leu - asn - phe ( p - no 2 )- pro - ile - ser - pro - oh ; ac - leu - asn - phe ( m - no 2 )- pro - ile - ser - nh 2 ; ac - thr - ile - phe ( p - no 2 )- nle - gln - arg - nh 2 ; ac - thr - ile - nle - phe ( p - no 2 )- gln - arg - nh 2 . of the six peptides , only the last with the phe ( p - no 2 ) residue in the pl &# 39 ; position showed cleavage under the desired conditions of hplc assay and with incubation times of one hour . hyland et al ., supra ., have reported a chromogenic octapeptide substrate , ac - arg - lys - ile - leu - phe ( p - no 2 )- leu - asp - gly - nh 2 , which is somewhat analogous to one prepared above , but with blocked amino and carboxyl terminals . nashad et al ., supra ., have reported two chromogenic peptide substrates , ac - lys - ala - ser - gln - phe ( p - no 2 )- pro - val - val - nh 2 and h - thr - phe - gln - ala - phe ( p - no 2 )- pro - leu - arg - ala - oh , which can form the basis of a spectrophotometric assay . in these three cases , however , the hydrolysis occurs to leave the chromogenic residue at the c - terminus , resulting in greater spectral changes . because of the small spectral changes seen with the chromogenic residue at the n - terminus , the novel fluorogenic substrate defined herein was developed to provide a novel fluorometric assay . modification of the hexapeptide substrate , ac - thr - ile - nle - phe ( p - no 2 )- gln - arg - nh 2 , with the acceptor residue in the c - terminal product required the addition of a donor fluorescent group to the n - terminal product . replacing the acetyl group with 2 - aminobenzoic acid ( abz ) resulting in the novel fluorogenic peptide , abz - thr - ile - nle - phe ( p - no 2 )- gln - arg - nhz , gave the same combination of donor and acceptor used by carmel and yaron , eur . j . biochem . 87 , 265 - 273 ( 1978 ), in their substrate for angiotensin converting enzyme . since those authors had shown that quenching efficiency depends on the proximity of the donor and acceptor chromophores , an analog with the abz group at position p3 , abz - ile - nle - phe ( p - no 2 )- gln - arg - nh 2 was synthesized by the present inventors , but the cleavage efficiency was dramatically reduced . the above novel hexapeptide substrate of the invention , also referred to as abz - nf * - 6 , shows a small amount of fluorescent background due to incomplete quenching of the fluorophore , but an approximate 6 - fold increase in fluorescence upon hydrolysis with a broad maximum between 390 and 440 nm as seen in fig1 . a variety of other fluorescent groups can be incorporated in the p4 position consistent with its surface location as seen in the x - ray crystal structure [ miller et al ., science 246 , 1149 - 1152 ( 1989 )] of the complex of synthetic hiv protease with mvt - 101 , an inhibitor of similar structure , ac - thr - ile - nle - ψ [ ch 2 nh ]- nle - gln - arg - nh 2 . kinetic measurements of the cleavage of abz - nf * - 6 by synthetic hiv protease showed typical michaelis - menten behaviour with linear kinetics over the twenty minutes of reaction when less than 15 % of the substrate is cleaved by the enzyme ( fig3 ). a lineweaver - burk plot of the velocities calculated from the linear phase of the reactions gave a k m = 110 mm . v max was calculated to be 3 . 45 mm - mil - 1 with a k cat = 2 . 9 sec - 1 . the chromogenic substrates of nashed et al ., biochem . biophys . res . commun . 163 , 1079 - 1085 ( 1989 ), had k m &# 39 ; s estimated to be greater than 450 mm . the ratio k cat / k m for abz - nf * - 6 with synthetic hiv protease is 26 , 364 m - 1 s - 1 , while the ratio for the nonapeptide chromogenic substrate of nashed et al ., supra ., was estimated to be 23 , 000 m - 1 s - 1 using purified hiv protease expressed in e . coli . utilizing the novel fluorogenic substrate of the present invention , abz - nf * - 6 , a screening procedure for potential hiv protease inhibitors was established which allowed the determination of inhibitor affinity . eight wells allowed the determination of the effect of four different concentrations of inhibitor on two substrate concentrations which was minimally sufficient to calculate a k i value based on a dixon plot ( 1 / v vs . inhibitor concentration ). fluorescence was measured every two minutes for 20 minutes . thus , it is feasible to determine the affinity of 12 inhibitors in twenty minutes . this is to be contrasted with the hplc analysis which requires about 30 separate hplc runs , each of which takes approximately one hour , for the determination of one k i . under routine conditions , however , one would likely run determinations in duplicate and include a inhibitor standard which would reduce the number of k i determinations to 15 per hours . amino acids are shown herein by standard three letter abbreviations as follows : ______________________________________abbreviated designation amino acid______________________________________ala alaninecys cysteineasp aspartic acidglu glutamic acidphe phenylalaninegly glycinehis histidineile isoleucinelys lysineleu leucinemet methionineasn asparaginepro prolinegln glutaminearg arginineser serinethr threonineval valinetrp tryptophantyr tyrosine______________________________________ other standard abbreviations used herein are : nle = norleucine , abz = 2aminobenzoic acid , ac = acetyl , cha = cyclohexylalanine , tfa = trifluoroacetic acid , dmf = dimethylformamide , dmso = dimethylsulfoxide , chaps = 3 [ 3 - chloramidopropyl )- dimethylammonio ]- 1 - propanesulfonate , and fabms = fluroescent antibody mass spectrometry . various other examples will be apparent to the person skilled in the art after reading the present disclosure without departing from the spirit and scope of the invention . it is intended that all such other examples be included within the scope of the appended claims . | 8 |
the present invention pertains to a wear assembly 10 ( fig1 ) for releasably attaching a wear member 12 to excavating equipment ( not shown ). in this application , wear member 12 is described in terms of a point or tip for an excavating tooth that is attached to a lip of an excavating bucket . however , the wear member could be in the form of other kinds of wear parts ( e . g ., shrouds ) or attached to other excavating equipment ( e . g ., dredge cutterheads ). moreover , relative terms such as forward , rearward , vertical , horizontal up or down are used for convenience of explanation with reference to fig1 ; other orientations are possible . in one embodiment , the wear member or point 12 is adapted to fit on a nose 14 ( fig1 ) of a base member 16 , which in this example , is an adapter . adapter 16 is a medial adapter which includes a rearwardly opening socket 18 to fit onto a nose of a second base ( not shown ). this second base is fixed to the digging edge of the bucket by welding , mechanical attachment or being integrally cast with the bucket lip . alternatively , wear member 12 could be mounted directly to the nose that is fixed directly to the lip , without medial adapter 16 . in any case , wear member 12 is releasably secured to the nose by a lock 20 . in a preferred construction , nose 14 includes a front stabilizing end 21 , upper and lower walls 22 , 24 converging toward front end 21 , and sidewalls 26 ( fig2 - 5 ). a slot 28 is defined in a central portion of each of the upper and lower walls 22 , 24 to define stabilizing surfaces 30 , 32 . top and bottom end surfaces 34 , 36 of stabilizing end 21 and stabilizing surfaces 30 , 32 each preferably extends substantially parallel to the longitudinal axis 38 of adapter 16 . substantially parallel includes surfaces which are parallel or which diverge rearwardly from axis 38 at a small angle ( e . g ., of about 1 - 7 degrees ) for manufacturing or other purposes . nevertheless , surfaces 30 , 32 , 34 , 36 could diverge from axis 38 at larger angles for some uses . a recess 40 is formed along each sidewall 26 to receive a lug 42 of point 12 ( fig1 ). of course , a variety of changes ( e . g ., omitting recesses 40 and lugs 42 , or changing the nose and socket configurations ) could be made to the nose and point . a cavity 44 is formed in upper stabilizing surface 30 for receiving lock 20 ( fig2 - 5 ). while the cavity may be formed in lower stabilizing surface 32 or a sidewall 26 , in this embodiment the cavity is formed in upper surface 30 for easier access . cavity 44 preferably has a lower opening 44 a for easier manufacturing and the release of fines from the cavity . cavity 44 has a generally pentagonal - shaped inlet 45 with front angled bearing surfaces 46 each inclined to axis 38 at an angle of about 25 to 55 degrees , and most preferably at an angle of about 40 degrees . nevertheless , the angles could be outside the preferred range . while a pentagon shape is used to provide a sufficient opening for lock 20 , other shapes are possible . further , while bearing surfaces 46 are generally linear in a lateral direction , they could also be curved . point 12 has a wedge - shaped configuration with upper and lower walls 48 , 50 that converge toward a free end 52 for penetrating the ground ( fig1 - 3 and 6 - 7 ). a socket 54 generally corresponding to nose 14 opens in a rear end of the point upper wall 48 includes an opening 56 through which lock 20 is received . opening 56 has a pair of rear angled bearing surfaces 58 to engage the lock . surfaces 58 are preferably at an angle of about 40 to 70 degrees relative to axis 38 , and most preferably at an angle of about 55 degrees , but could be set outside of the preferred range . the angle at which surfaces 58 are oriented is preferably larger than the angle for surfaces 46 , but they could be the same or smaller . although bearing surfaces are preferably linear in a lateral direction , they could also be curved . a rear end wall 60 preferably connects to the two angled bearing surfaces 58 . nevertheless , rear end wall 60 could be omitted such that bearing surfaces 58 join at a corner . also , although not preferred in this construction , a single rear bearing surface could be used . side surfaces 62 of opening 56 preferably taper toward front end wall 64 to minimize the overall size of the opening . each pair of bearing surfaces 46 , 58 are angled to generally define a concave v - shape configuration facing the other pair of surfaces . as can be appreciated , the opposed angled surfaces 46 , 58 generally define a diamond - shaped configuration such that the angled bearing surfaces direct the applied loads toward the central region of the main portion of lock 20 . the diamond shape is a general description that could include additional linear or curved connecting surfaces between the angled bearing surfaces as well as forming strictly a diamond shape . in an alternative construction , an opening 56 for receiving lock 20 could be included in both converging walls 48 , 50 to enable reversing of the wear member on the nose and / or to permit the use of two locks ; however , only a single lock on one side is needed to secure the wear member to the nose . alternatively , reversible mounting could be achieved by providing two openings in the nose or a through - hole accessible from each side . moreover , opening 56 could be formed in one or both of the sidewalls 51 with a corresponding cavity in the side of nose 14 . lock 20 includes a main portion or body 66 and an anchoring portion or arm 68 ( fig2 - 3 and 10 - 15 ). the free end 70 of arm 68 defines a pivot member 72 about which lock 20 swings between a hold position that retains wear member 12 to nose 14 , and a release position which permits installation and removal of the wear member to and from the nose . in the hold position ( fig1 - 3 ), body 66 is received within opening 56 and cavity 44 . when released , lock 20 is withdrawn from cavity 44 and typically from assembly 10 . in this embodiment , body 66 preferably has a generally diamond - shaped cross section with rear angled bearing faces 74 to oppose angled bearing surfaces 58 in opening 56 , and front angled bearing faces 76 to oppose angled bearing surfaces 46 in cavity 44 ( fig2 - 3 and 10 - 15 ). rear bearing faces 74 are set at an angle to correspond to the inclination of bearing surfaces 58 , and front bearing faces 76 are angled to correspond to the inclination of bearing surfaces 46 . in this way , the loads applied to the lock are directed inward toward a central portion of body 66 generally irrespective of whether the loads applied to wear member 12 during use have vertical or side components or are reverse loads . this arrangement causes the lock to be gripped securely between the wear member 12 and nose 14 with minimal shifting . as a result , the lock is stable and reduces wear between the components . moreover , the use of the angled bearing surfaces tends to result in broad surface contact between the opposed surfaces 58 , 74 and 46 , 76 with less stress . lock 20 includes a rear face 78 between rear angled bearing faces 74 in opposition to rear wall 60 . with new parts , rear face 78 and rear wall 60 may be spaced by a slight gap to ensure bearing pressure between surfaces 58 , 74 . however , after some use , rear face 78 may abut rear wall 60 under certain loads due to wearing of the components . moreover , even when new , face 78 and wall 60 could be in abutment . similarly , front edge 80 between front angled surfaces 76 may be spaced slightly by a gap 81 from the corresponding front portion 82 in cavity 44 to ensure contact between surfaces 46 , 76 when the components are new . these surfaces , though , may abut in time , and they could also be formed to abut when new . of course , variations in the shape of the lock 20 , cavity 44 and opening 56 could be used . for example , surfaces 58 , 74 could extend to a corner like surfaces 46 , 76 , or a connecting wall could be provided between surfaces 46 , 76 . connecting walls could also be provided between adjacent surfaces 74 , 76 and the corresponding surfaces in cavity 44 and opening 56 . arm 68 extends forward from an upper portion 86 of body 66 so that pivot member 72 sets against fulcrum 88 defined in front end wall 64 of opening 56 ( fig2 and 3 ). fulcrum 88 is forward of and generally aligned with bearing surfaces 58 along longitudinal axis 38 . as seen in fig2 and 3 , fulcrum 88 preferably has a lip 90 that overlies pivot member 72 to prevent disengagement during use ; although other retention structures could be used . arm 68 also preferably includes a base surface 92 that presses against upper stabilizing surface 34 under certain loading ( e . g ., vertical or pull - off loads on the point ) for enhanced support and stability . alternatively , pivot member 72 could be received in a recess formed wholly by wear member 12 . arm 68 could also extend laterally or rearwardly relative to body 66 to change the swinging direction of the lock . as seen in fig2 , 3 and 15 , front surface 86 of cavity 44 is preferably convex and curved in a vertical direction to form an undercut gripping surface for lock 20 . front surface 84 of lock 20 is preferably concave and curved to complement surface 86 and fit into the undercut formed by front surface 86 . nevertheless , front surface could have other configurations to engage the convex front surface 86 and provide the desired gripping to help retain lock 20 . the curved front surface 84 includes angled bearing faces 76 and front edge 80 . likewise , front surface 86 includes angled bearing surfaces 46 and front portion 82 . this curved , fitting relationship is formed relative to the pivot axis of lock 20 so that under vertical or reverse loading on wear member 12 during use lock 20 is pulled into the undercut defined by front surface 86 to grip nose 14 and resist ejection of the lock from the assembly . lock 20 includes a latch 94 that fits in slot 95 in body 66 and projects from rear face 78 to cooperate with keeper 98 , which in this embodiment is a ledge formed by a channel 99 in rear end wall 60 of opening 56 ( fig2 - 3 and 10 - 15 ). a ridge 100 preferably fits within channel 99 to limit build up of fines against the latch and under certain conditions to provide additional side support . latch 94 could alternatively project from other surfaces of lock 20 and cooperate with other kinds of keepers . moreover , the latch 94 could be placed in wear member 12 with the keeper in lock 20 . other kinds of retaining elements could also be used to hold lock 20 in assembly 10 . it is also possible to eliminate arm 68 and rely only upon body 66 so long as a retaining element is provided to adequately secure body 66 in the assembly . also , as an alternative , translating latch 94 may be replaced with other kinds of latches such as a rotating latch as disclosed in u . s . pat . no . 7 , 178 , 274 , herein incorporated by reference . in any event , latch 94 preferably includes a tongue 101 of steel or other rigid material and a resilient element 103 ( fig2 , 3 and 15 , 16 ). tongue 101 is preferably tapered on its distal end and becomes wider than channel 99 to ensure latch 94 remains properly seated within slot 95 . the resilient element can be formed of foams , polymers or rubbers or even of other kinds of spring elements . tongue 101 and resilient element 103 can be bonded together ( as seen in fig2 ) and / or by mechanically attachment such as by a tongue and groove arrangement ( as seen in fig1 ). in this example only , tongue 101 includes a triangular projection 105 that fits in a corresponding triangular groove 107 in elastomer 103 . of course , other arrangements are possible . in any event , resilient element 103 normally biases tongue 101 outward and , in use , beneath ledge 98 to retain lock 20 in assembly 10 . body 66 preferably includes a removal hole 109 ( fig2 , 3 , 12 and 15 ) adapted to receive a pry tool ( not shown ). latch 94 includes a passage 111 which in the normal position is partially aligned with hole 109 . in use , the pry tool is placed into hole 109 and passage 111 via inlet 113 . the tool is then manipulated to push latch 94 forward as described in co - pending u . s . patent application ser . no . entitled lock assembly for securing a wear member to earth - working equipment , with internal reference number 358 , filed concurrently herewith , which is incorporated herein by reference . alternatively , the tool is tapered so that its sides expand so as to push latch 94 forward by being inserted farther into removal hole 109 . in either case , this forward shifting causes latch 94 to release ledge 98 . the pry tool can then be manipulated to pivot lock 20 about fulcrum 88 and out of cavity 44 . removal hole 109 preferably includes a notch 110 to reduce the risk of the pry tool slipping , but could have a wide variety of shapes . ordinarily , lock 20 will be removed completely from assembly 10 . the pry tool can also be used to install lock 20 ; the lock may also be pushed into opening 56 and cavity 44 with the user &# 39 ; s hands . tongue 101 preferably includes an inclined front face 115 to permit easy insertion . with this lock , then , there is no need to use hammers to remove or install the locks . rear surface 78 of body 66 is preferably formed with a convex , curved surface to generally follow the swinging motion of the lock in and out of cavity 44 to minimize the size of opening 56 ( fig2 and 3 ). the rear wall 60 of opening 56 is concave and curved to accommodate the swinging motion of lock 20 and to depress latch 94 to ease installation . in a preferred construction , the curvature of rear wall 60 is broader than the curvature of rear surface 78 and is defined by a radius of curvature having a different origination point ( i . e ., offset from the pivot axis of lock 20 ) so that rear surface 78 pulls away from rear wall 60 as lock 20 is swung out of assembly 10 , as described in co - pending u . s . patent application ser . no . ______ , entitled lock assembly for securing a wear member to earth - working equipment , with internal reference number 358 , and filed currently herewith . in this way , impacted fines pose less resistance to removal of the lock . opening 56 preferably includes a shoulder 121 along each side 62 to support lock 20 in the hold position ( fig7 - 9 ). in a preferred arrangement , body 66 includes a groove 123 to receive each shoulder 121 . shoulders 121 prevent lock 20 from falling too far into cavity 44 and becoming wedged into opening 56 , thus , making removal difficult . shoulders 121 could be longer or shorter than shown or arranged in different portions of opening 56 . if the shoulders are lengthened , they could be used to support lock 20 in opening 56 without nose 14 in socket 18 . in this arrangement , lock 20 can be secured to wear member 12 to form a single , integral component . the lock and wear member can , then , be shipped as a single unit and stored by a dealer or end user without fear of losing the lock . since fewer parts are required to be shipped and stored , shipping costs and inventory concerns are reduced . other arrangements could also be used to secure lock 20 integrally to wear member 12 . for example , a different fulcrum could be used to more securely hold the pivot member of the lock from moving vertically in either direction . also , other kinds of retaining members in addition to or in lieu of shoulders 121 could be used . in an alternative embodiment , the wear member or point 212 is adapted to fit on a nose 214 ( fig1 - 21 ). the nose is the front portion of a base 216 ( fig2 and 22 ) that is fixed to a bucket ( not shown ) or other equipment . in the illustrated example , base 216 includes rearward legs 219 , 221 that extend over and are welded to the lip of the bucket . wear member 212 is releasably secured to nose 214 by a lock 220 . as one example , the nose and socket are generally as described in co - pending u . s . patent application ser . no . 11 / 706 , 592 filed feb . 14 , 2007 , which is hereby incorporated by reference ; i . e ., the nose and socket constructions are the same except for the formations associated with the locking arrangement . in general , nose 214 includes a front stabilizing end 222 and a body 224 having stabilizing recesses 226 , 228 ( fig2 and 22 ). wear member 212 includes a socket 218 adapted to matingly receive nose 214 ( fig2 and 29 ). accordingly , socket 218 has a complementary front stabilizing end 232 and a main portion 234 provided with stabilizing projections 236 , 238 to fit in recesses 226 , 228 . nevertheless , other nose and socket formations could be used with the locking concepts of the present invention . lock 220 includes a body 240 and a threaded member 242 ( fig2 - 27 ). in one preferred construction , body 240 includes a pivot member 244 at one end , a retention member 246 at the opposite end , and a central hole 248 for receiving and cooperating with the threaded member 242 . in general , lock 220 swings about pivot member 244 between a hold position that retains wear member 212 to nose 214 , and a release position which permits installation and removal of the wear member to and from the nose . wear member 212 includes converging walls 250 and sidewalls 252 ( fig1 - 18 and 28 - 29 ). in a preferred construction , at least one of the sidewalls includes an opening 253 for receiving lock 220 . an opening could be included in both sidewalls to enable reversing of the wear member on the nose and / or to permit the use of two locks ; however , only a single lock on one side is needed to secure the wear member to the nose . alternatively , reversible mounting could be achieved by providing two openings in the nose ( as shown in fig2 ). mounting the lock in a sidewall enables a secure attachment for the wear member in a location that is more protected from wear in most applications . the illustrated construction of lock 220 is particularly suited for side mounting so as to enhance stability and reduce wear for loads and shifting anticipated during a digging operation . nevertheless , opening 253 could , in the same way , be formed in one or both of the converging walls 250 instead of sidewalls 252 . opening 253 includes a pivot support 254 , preferably at a front end of the opening , to cooperate with pivot member 244 of lock 220 ( fig2 and 29 ). pivot support 254 is preferably in the form of a recess 256 open to exterior surface 260 . pivot member 244 is defined by a lug 274 that extends forward from a front end 276 of body 240 ( fig2 - 27 ). lug 274 sets in recess 256 to facilitate rotation of 220 ( fig1 and 20 ). threaded member 242 retains the lock to the wear member . to maximize strength in the wear member , opening 253 narrows toward front wall 270 . of course , other pivoting constructions could be used . opening 253 further includes a through - hole 280 at its rear end for passage of the retention member 246 through sidewall 252 to engage nose 214 ( fig2 and 29 ). in the illustrated embodiment , retention member 246 has a wide abutment surface 282 to oppose the rear wall 284 of opening 253 ( fig2 - 27 ). in addition , in the preferred nose and socket design , the cooperating recess 228 and projection 238 provide rear wall 284 with an increased depth ( i . e ., inward toward nose 214 ) for additional surface area to engage abutment surface 282 . since the engagement of abutment surface 282 and rear wall 284 resists removal of wear member 212 from nose 214 , a larger surface area reduces stress in the components and increases the life of the locking arrangement . abutment surface 282 and rear wall 284 are each preferably curved to complement each other . rear wall 284 is a concave surface that is preferably defined by a radius of curvature originating at a location directly forward of rear wall 284 that generally corresponds to about the middle one - third portion of socket 20 that receives nose 214 . this broad curvature generally conforms to the anticipated shifting of the wear member 212 on nose 214 to reduce wearing and improve stability . likewise , front surface 285 of lock 220 is concave and curved such that its radius of curvature has the same origination point as the radius of curvature for rear wall 284 . front surface 285 abuts complementary convex wall 318 on nose 214 . a medial wall 286 is provided in opening 253 between recess 256 and through - hole 280 to cooperate with threaded member 242 ( fig1 , 27 and 28 ). medial wall 286 is preferably depressed relative to outer wear surface 260 to enable lock 220 to be fit within opening 253 to eliminate obstructions to the flow of material around the wear member and to partially protect the lock from wear during use . in a preferred construction for this embodiment , threaded member 242 is a bolt with a threaded shank 290 and head 292 , and a nut 294 to engage shank 290 ( fig2 - 27 ). medial wall 286 includes a central hole 248 through which shank 290 extends . a cavity 298 is formed on the interior side of medial wall 286 to receive and prevent nut 294 from rotating . cavity 298 preferably narrows outward to complement side walls 293 of nut 294 to retain nut 294 , though other shapes are possible . in use , lock 220 is tightened down against nut 294 but is loosely held with respect to wear member 212 to reduce stress and wear in the lock . lock 220 is secured to wear member 212 prior to installation on nose 214 . in this way , nut 294 can be held from within socket 218 for engagement with shank 290 . nevertheless , other arrangements could be used . for example , nut 294 could be secured within cavity 298 by an adhesive , welding or other means for later attachment to shank 290 . alternatively , bore 296 could be threaded instead of using nut 294 . body 240 of lock 220 also includes a hole 248 that generally aligns with hole 248 in medial wall 286 . hole 248 is oversized relative to shank 290 to permit the pivotal motion of body about pivot support 254 . a pocket 303 is provided about bore 296 to receive head 292 and permit the attachment of a tool ( e . g ., a socket wrench ) for turning of threaded member 242 . the free end 307 of threaded member 242 may be deformed to prevent its release from nut 294 . in use , lock 220 is attached to wear member 212 by inserting pivot member 244 into recess 256 . threaded member 242 is fed through hole 248 and threaded to nut 294 in cavity 298 . retention member 246 is received into through - hole 280 . in an extended position of lock 220 ( fig1 and 20 ), i . e ., the release position , retention member 246 sets within through - hole 280 but does not extend into socket 218 . as an alternative , lock 220 may be provided with a latch as opposed to a threaded member . for example , lock 220 may have a translating latch as in lock 20 or a rotating latch as in u . s . pat . no . 7 , 178 , 274 . lock 220 , once secured , forms a single , integral component with wear member 212 . the lock and wear member can , then , be shipped as a single unit and stored by a dealer or end user without fear of losing the lock . also , since fewer parts are required to be shipped and stored , shipping costs and inventory concerns are reduced . additionally , since lock 220 remains secured to wear member 212 in the release and hold positions , the wear member can be installed with the lock to reduce the number of components needed for assembly and virtually eliminate the problems associated with dropped and / or lost locks in the field . once the wear member 212 has been fit onto nose 214 , threaded member 242 can be rotated to drive lock body 240 in an arc about pivot support 254 and move retention member 246 into socket 218 to engage nose 214 ( fig1 and 19 ). nose 214 includes a groove 315 to receive the free end 317 of retention member 246 ( fig1 - 22 ). the retention member is then positioned between rear wall 284 of wear member 212 and front face 318 of groove 315 ( fig1 ). as a result , the loads are carried by retention member 246 , which is formed as a rigid block ( preferably of steel ) to accommodate heavy loading . in this way , the loads are not transmitted forward to threaded member 246 . as a result , there is no deformation of shank 290 during use to impede the movement of the lock to the release position . an elastomer 291 or other spring means ( not shown ) can be provided on retention member 246 to press against wall 318 to provide take up for wear member 212 . groove 315 is preferably a narrow channel in a side 320 of nose 314 ( fig2 and 22 ). the top and bottom ends of groove 315 are preferably closed to retain , as much as possible , the strength and continuity of nose 214 despite the engagement with lock 220 . nevertheless , groove 315 could have other constructions . for example , groove 315 may extend across the entire side 320 and be open at its top and bottom . also , groove 315 may be open rearwardly so that groove is essentially a shoulder with a rearwardly facing abutting surface 318 . when wear member 212 needs to be replaced , threaded member 242 is loosened so that head 292 backs outward away from nose 214 ( fig1 and 20 ). once loosened , the lock can be rotated to its release position with just the operator &# 39 ; s hands or via a pry tool . pry slots 321 in body 240 are provided to facilitate the use of a pry tool in rotating lock 220 from the hold position to the release position ( fig1 - 20 and 26 ). an elastomer or other spring ( not shown ) may be provided to push lock 220 outward or to pull the lock inward as threaded member 242 is turned . in addition , a fixed flange ( not shown ) on shank 290 could be provided between medial wall 286 and body 240 to push lock 220 to its release position when threaded member 242 is loosened . while preferred constructions and some variations are disclosed for illustration purposes , many other variations in the nose , point and lock constructions could be made without departing from the spirit of the invention . | 4 |
in the circuit shown in fig1 a degraded input data - stream 1 at a first wavelength λ 1 is received at 2 ; for purposes of illustration , a linear optical amplifier is shown at 3 where it acts on the unregenerated data - stream : its main function here is to amplify the signal to a level at which the regenerator itself operates effectively and preferably optimally . additionally ( or alternatively , if the input signal is strong enough ) a linear optical amplifier will usually be positioned to act on the 3r regenerated output at 5 , where its main function is to obtain the desired output power level . the incoming or amplified data - stream is passed to a splitter / coupler 6 from which a major part goes to the semiconductor optical amplifier 7 and a minor part to a clock recovery unit 8 , in this case of any conventional design . an unmodulated continuous wave at a different wavelength λ 2 ( which will become the output wavelength ) is generated locally and enters at 9 to pass predominantly through the semiconductor optical amplifier 7 , in co - propagation with the signal . the semiconductor optical amplifier 7 modulates the λ 2 carrier in the manner described above , and a bandpass filter 10 prevents the original signal at wavelength λ 1 from propagating further . a mach - zehnder interferometer 11 co - operates with the semiconductor optical amplifier to complete a 2r regenerator , and its delay is set so that it generates a stream of output pulses ( 12 ) in which the peak amplitude is sustained for sufficiently more than the desired length of the output pulses to be regenerated to provide a safe margin for jitter ( it will be remembered that the lengths of these pulses are determined by the interferometer delay period and not limited by the length of the input pulses ). this stream of pulses is now retimed by electro - absorption modulator which is turned on by the clock recovery unit 8 for a time period corresponding to the desired output pulse length and centred on the time - averaged pulses arriving there from the 2r regenerator . a 3r regenerated output pulse stream 14 , aligned with the central part of the incoming signal pulses , is thus obtained . the arrangement of fig2 is substantially the same , except that the electroabsorption modulator 13 acts additionally as a phase - sensitive detector in the clock recovery unit 8 . the minor part of the input data - stream , freed of light of wavelength λ 2 by a bandpass filter 15 , is passed in a counter - propagating direction through the electroabsorption modulator and thence to a photodiode 16 , which has a bandwidth greater than the loop bandwidth of the clock - recovery phase - locked loop ( but not sufficient for it to respond to the system pulse frequency )— typically in a range from a few hundred kilohertz to a few megahertz . the phase relationship is set ( in an integrated optical implementation ) or adjusted ( in a fibre - optic implementation ) such that the arrival there of the steepest part of the rise ( or alternatively of the fall ) of the incoming pulses is in the middle of the period for which the eam is turned on , and so the electrical output of photodiode 16 responds markedly to a fluctuation in timing ( a phase error ); phase - locked loop controller 17 commands clock 18 in the usual way to correct such errors and hold the output of the photodiode in a narrow variance band . [ 0046 ] fig3 shows an alternative arrangement in which the new continuous wave is introduced by a wavelength - division multiplexor ( wdm ) 21 ( or a coupler ) immediately upstream of the semiconductor optical amplifier 7 and so downstream of the coupler 6 . this allows the 3r regenerated output 22 to be taken from the splitter / coupler 6 , makes it unnecessary to have a filter tuned to the signal wavelength in the lower half of the loop , and enables the lower arm of the coupler 6 to be used as the output for the regenerated signal . the use of a wdm at 21 has the advantage , compared with the arrangements of fig1 and 2 , that substantially all the continuous - wave input power is available to the semiconductor optical amplifier , but also has the disadvantage that the operating wavelengths of the device becomes fixed , and it is also likely to be a little more expensive ; a simple coupler would avoid those disadvantages , but is likely to introduce a 3 db ( 50 %) loss . [ 0047 ] fig4 differs from fig1 in two respects . significantly , a further electroabsorption modulator 25 has been added ; this is switched “ off ” in the inter - pulse periods of the input data - stream to convert an incoming stream from nrz to rz format so that it can be regenerated as described . secondly , the new continuous wave is introduced directly into the soa , as in fig3 . [ 0048 ] fig5 shows a regenerator that is essentially the same as the one in fig3 except that the nrz input signal propagates in a direction counter to the output through the electroabsorption modulator for conversion to rz format before entering the semiconductor optical amplifier . it will be appreciated that precise dimensional design and / or path length adjustment will be needed to ensure correct phase relationships for both functions . the arrangement shown in fig6 is similar except that the input and output signals co - propagate through the electroabsorption modulator 13 , and a splitter 30 and band - pass filters 31 and 32 are needed to separate them ( or a wdm could be used ). [ 0050 ] fig7 shows a regenerator generally similar to the one shown in fig1 but using a modified form of mach - zehnder interferometer in which separate , identical soa &# 39 ; s are provided in the two arms ; the data input signal ( after amplification , if required ) is , apart from a minor fraction needed for clock recovery , divided between the two soa &# 39 ; s , as is the continuous wave input at 9 . time delay 36 may be located at any convenient position in one of the arms . function is substantially the same as in the arrangement of fig1 . [ 0051 ] fig8 is also generally similar to fig1 but illustrates the use of a sagnac interferometer , in which the continuous wave input is split and launched into both arms 40 and 41 of a loop waveguide . a single soa 42 is positioned asymmetrically in the loop to establish a time delay of 2t ( where t is the transit time from the centre of the loop to the soa , or vice versa ), producing wavelength translation and interference as before . it should be noted that , because part of the output light counter - propagates with the input light , the length of the soa needs to be limited to avoid pulse spreading due to the input data signal producing changes in the soa within the transit time of the output light : for a 40 gbit / s system , we estimate that an soa no more than 1 mm long will be needed . the arrangements described are generally capable of implementation in either fibre or integrated optical circuit form ( or partly in each ); because of the loop configuration , the arrangement of fig8 is primarily suitable for implementation in fibre . when fine adjustment of timing is needed to establish the correct optical phase relationship for the required interference , fibre implementations will usually provide facility to stretch a length of fibre , whereas integrated implementations will usually provide for adjustment by local heating of a waveguide , or more generally by temperature adjustment ( these adjustment techniques are not applicable to sagnac interferometer implementations , but they do not need them as the two path lengths are automatically equal ). it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the spirit and scope of the invention . thus it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents . | 7 |
the present invention will be explained hereinafter with reference to the embodiments shown in the attached drawings . [ 0022 ] fig1 is a front view showing an electrophotographic copier as an image forming apparatus and a large capacity paper feeding apparatus according to a first embodiment of the present invention . in the drawing , a reference numeral 1 denotes an electrophotographic copier . a large capacity paper feeding apparatus 2 is mounted on one side of the electrophotographic copier 1 . the large capacity paper feeding apparatus 2 is provided with a main unit 2 a . the main unit 2 a contains a stack of about 4000 sheets of paper . a paper feeding mechanism ( not shown ) is provided in the main unit 2 a , and supplies paper sheet by sheet to the electrophotographic copier 1 . a caster 4 is provided at the bottom of the main unit 2 a to move the main unit 2 a smoothly . [ 0025 ] fig2 is an exploded perspective view showing the mounting structure of the large capacity paper feeding apparatus 2 . a pair of u - shaped support rails 5 / 5 are provided at the bottom of the copier 1 , on which a mounting table 6 is supported on the support rails 5 / 5 . a stand piece 7 is welded to one side of the mounting table 6 . positioning pins 8 / 8 are provided projecting at both ends of one side of the stand piece 7 . a plurality of through - holes 10 to insert a plurality of fixing screws 9 are made in the stand piece 7 . positioning holes 11 , 11 to insert the positioning pins 8 / 8 and screw holes 12 opposite to the through - holes 10 are made in the lower part of one side of the copier 1 . bends 13 bending downward are formed at the front and rear ends of the mounting table 6 . the bends 13 have screw holes 14 and positioning pins 15 . the mounting table 6 is supported on the support rails 5 / 5 , and positioned by inserting the position pins 8 / 8 of the stand piece 7 into the positioning holes 11 , 11 in the lower part of one side of the copier 1 . the positioned mounting table 6 is fixed by inserting the fixing screws 9 / 9 into the screw holes 12 , 12 in the lower part of one side of the copier 1 , through the through - holes 10 / 10 of the stand piece 7 . a reference numeral 17 denotes a bottom unit to be fixed to the bottom of the main unit 2 a of the paper feeding apparatus . bends 18 bending downwardly are formed at the front and rear ends of the bottom unit 17 . the bends 18 have screw holes 20 to pass through fixing screws 19 and concaves 21 to engage with the positioning pins 15 . the bottom unit 17 of the main unit 2 a of the paper feeding apparatus is placed and pushed on the mounting table 6 , thereby the recesses 21 / 21 ends are engaged with the positioning pins 15 / 15 of the mounting table 6 . after being positioned , the bottom unit 17 is fixed to the mounting table 6 with the fixing screws 19 , 18 inserted into the screw holes 14 , 14 through the through - holes 20 , 20 . [ 0032 ] fig3 is a perspective view showing the caster 4 fixed to the bottom of the main unit 2 a of the paper feeding apparatus . fig4 is a front view showing the mounting structure of the casters . fig5 is a side view showing the mounting structure of the casters . first to third support members 17 a - 17 c are provided at the bottom of the main unit 2 a of the paper feeding apparatus . the first support member 17 a comprises a pair of support plates 17 a ′, 17 a ″ provided with a predetermined space therebetween , in the axial direction of the caster 4 . the second support member 17 b is provided between the support plates 17 a ′ and 17 a ″, along the axial direction of the caster 4 . the third support member 17 c forms an inclined plane with an inclination angle of about 45 degrees . the caster 4 is rotatably fixed to a bracket 24 through a rotary axle 25 . the bracket 24 is revolvably fixed to the pair of support plates 17 a ′, 17 a ″ of the first support member 17 a , and the upper side of the revolving end is fixed with a fixing screw 28 to the second support member 17 b . a horizontal projection 29 is formed in the lower part of the revolving end of the bracket 24 . an insertion port 29 a , described later , to insert a screw driver or the like , is made in the projection 29 . the caster 4 is made in a spindle shape as shown in fig5 . next , a procedure of mounting the large capacity paper feeding apparatus 2 will be explained with reference to fig6 to fig9 . first , before the caster 4 is fixed to the large capacity paper feeding apparatus 2 , the bracket 24 is turned 45 degrees upward , and the upper side of the revolving end is fixed to the support member 17 c with the fixing screw 28 , as shown in fig6 and fig7 . that is , the caster is retracted to the safety position b ( the second position ). with the caster 4 retracted upward , the large capacity paper feeding apparatus 2 is placed on the mounting table 6 , moved toward the copier 1 and loaded into one side of the copier 1 . after the large capacity paper feeding apparatus 2 is loaded , the fixing screw 28 of the bracket 24 is removed . then , a screwdriver d is inserted into the insertion port 29 a of the projection 29 of the bracket 24 of the caster 4 , and moved downwards , as shown in fig8 or the bracket is moved downward by stepping on projection 29 . the upper end of the revolving end of the bracket 24 joins the second support 17 b , and the caster 4 moves toward the position a ( the first position ) on the bottom of the large capacity paper feeding apparatus 2 , and contacts the floor s , as shown in fig9 . the upper end of the revolving end of the bracket 24 is fixed to the second support member 17 b with the fixing screw 28 . this completes the mounting . as explained above , before the large capacity paper feeding apparatus 2 is mounted , the caster 4 is retracted to the upper safety position b ( the second position ), and the caster 4 does not contact the inclined plane s 1 even if the floor s is inclined like the inclined surface s 1 in fig7 . thus , the large capacity paper feeding apparatus 2 is not inclined , and can be mounted on one side of the copier by smoothly moving on the mounting table 6 . further , the caster 4 is made in a spindle shape , and only a point of the lower side of the middle of the caster 4 contacts the floor . therefore , the friction resistance of the caster 4 is small , enabling smooth movement of the large capacity paper feeding apparatus 2 in the axial direction of the caster 4 . the present invention is not limited to the above described embodiments , and is modifiable within the gist . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents . | 1 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.