text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
referring to fig1 , a fiber preform 11 is shown . preform 11 is a fabric , preferably of a non - woven or fibrous material , such as felt , but woven material are also feasible . preferably , preform 11 is free of resin at the point in the method shown in fig1 . preform 11 has a base 13 that has two lateral portions 13 a , 13 b . each lateral portion 13 a , 13 b has a side edge 15 . preform 11 has a flow path 17 , which in fig1 comprises an open gap between lateral portions 13 a , 13 b . in this embodiment , flow path 17 extends in a straight line parallel to lateral side edges 15 . flow path 17 extends from one end of base 13 to the other . as shown in fig2 , flow path 17 ( fig1 ) could alternately comprise a conduit 19 or tube of a variety of materials . tube 19 is shown with perforations 21 along the side edges to enable lateral outward flow of resin from the hollow interior of conduit 19 . rather than perforations 21 , conduit 19 could be made of porous material that freely allows the flow of resin through its sidewalls . tube 19 is preferably secured to lateral portions 13 a , 13 b , or it may be imbedded within base 13 or located in a channel ( not shown ) in base 13 . the flow path could also be made of a fabric , such as flow path 23 in fig3 . flow path 23 is formed of fibrous material that has a greater permeability than base 13 . in fig3 , the thickness of flow path 23 is the same as the thickness of base 13 , but the fibers contained therein are fewer in number or smaller in diameter to provide less resistance to resin flow than base portions 13 a , 13 b . flow path 23 is located in the same plane as base portions 13 a , 13 b . preferably flow path 23 is joined to base lateral portions 13 a , 13 b by stitching , weaving or adhesives . in fig4 , flow path 25 is also preferably a fabric similar to flow path 23 ( fig3 ). however , base portions 13 a , 13 b join each other , and flow path 25 is shown on top of base 13 . alternately , flow path 25 could be within a groove or channel ( not shown ) formed in base 13 or embedded within base 13 . whether the flow path is gap 17 ( fig1 ), tube 19 ( fig2 ), in - plane fabric strip 23 ( fig3 ), or out - of - plane fabric strip 25 , the resistance to flow of resin is less than in base 13 . referring again to fig1 , base 13 preferably has a pair of wings or flaps 27 that are laterally spaced apart from each and on opposite side edges of flow path 17 . each flap 27 is located on one of the lateral portions 13 a , 13 b . each flap 27 is a rectangular strip of fabric that may be the same type and thickness as base 13 or different . each flap 27 has a stationary portion 29 that overlies one of the base portions 13 a or 13 b and is preferably stitched to base 13 by stitching 31 . each flap 27 is flexible relative to its stationary portion 29 so that it can be folded generally upright or 90 degrees relative to stationary portion 29 . flaps 27 are also preferably free of resin in the step shown in fig1 . in fig1 , a first component 33 is shown resting on the upper surface of base 13 . in this example , first component 33 comprises a spar such as used for an aircraft wing . spar 33 has a flange 35 on its lower side . flange 35 is flat and has lateral side edges 37 in this embodiment . lateral side edges 37 are spaced inward from flaps 27 in the step shown in fig1 . spar 33 also has a web 39 that extends at 90 degrees relative to flange 35 . an upper flange 40 ( fig5 ) may be located on the upper end of web 39 parallel to flange 35 . web 39 is preferably centered over flow path 17 . preferably first component 33 is of a composite resin and fiber material that has been cured prior to placing it on preform 11 , but it alternately could be a metal . the opposite or lower side of base 13 is in contact with a second component 41 . second component 41 is also preferably a pre - cured composite structure , but it could be of another material such as metal . second component 41 may comprise a skin of a wing , for example . flange 35 and skin 41 define upper and lower sides for flow path 17 . in fig3 , a technician has folded flaps 27 downward so that each flap 27 overlies a portion of the upper side of spar flange 35 . also , the technician has installed a vacuum bag assembly 43 . vacuum bag assembly 43 comprises one or more sheets of flexible plastic film that are arranged to form an airtight enclosure around preform 11 . in this embodiment , two edges of vacuum bag assembly 43 are secured by sealant tape 45 to web 39 . two other edges are secured by sealant tape 47 to skin 41 outward from preform lateral edges 15 . vacuum bag assembly 43 also has end portions that extend around each longitudinal end of spar 33 . because spar 33 and skin 41 are pre - cured , they are impermeable and substantially airtight , thus there is no need for enclosing them entirely within vacuum bag assembly 43 . if the two components to be joined were small enough , the entire assembly could be enclosed within a vacuum bag . referring to fig5 , a technician provides an inlet port 49 at one longitudinal end of vacuum bag assembly 43 . inlet port 49 communicates with one end of flow path 17 ( or flow paths 19 , 23 or 25 if one of those is utilized ). a resin source 51 , which comprises a container containing a liquid resin , connects to inlet port 49 . the technician also connects one or more lateral outlet ports 53 to vacuum bag assembly 43 along the lateral edges of spar 33 . in this example , three outlet ports 53 are located along each lateral side of spar 33 . also , an end outlet port 55 with a valve 61 locates on an end of spar 33 opposite from inlet port 49 . end outlet port 55 communicates with the opposite end of flow path 17 . a series of tubes 57 extend from a vacuum pump 59 to each of the outlet ports 53 and to valve 61 . inlet and outlet ports 49 , 53 and 55 communicate with the interior of vacuum bag 43 , but need not be physically joined to any portion of preform 11 . the operator turns on vacuum pump 59 and opens valve 61 , causing air to be withdrawn from vacuum bag 43 as well as from flow path 17 ( fig1 ). the suction created at valve 61 causes resin to flow from resin source 51 through inlet port 49 and along flow path 17 ( fig1 ). because the permeability of flow path 17 is greater than the permeability of base portions 13 a , 13 b ( fig1 ), the resin will flow more readily toward end outlet port 55 than laterally outward into preform lateral portions 13 a , 13 b ( fig1 .) when the resin nears end outlet port 55 of flow path 17 ( fig1 ), the technician closes valve 61 or at least substantially reduces the air flow through valve 61 . the suction created by vacuum pump 59 continues at lateral outlet ports 53 , inducing resin flow from flow path 17 laterally outward through base lateral portions 13 a , 13 b ( fig1 ). the resin also flows into and infuses flaps 27 ( fig3 ). because spar 33 and skin 41 are pre - cured , resin does not flow into these components . vacuum bag assembly 43 collapses on the components and applies pressure that causes spar 39 to move more closely toward skin 41 , compressing the thickness of base 11 . if flow path 25 of fig4 is utilized , rather than flow paths 17 ( fig1 ), 19 ( fig2 ) or 23 ( fig3 ), the vacuum pressure will cause flow path 25 to compress and to compress portions of base 13 so that after evacuation , flow path 25 will be substantially flush with the upper surface of preform base 11 . after preform 11 is entirely infused with resin , the resin flow is stopped by stopping vacuum pump 59 or by closing a valve ( not shown ) at inlet port 49 . the resin within preform 11 is then allowed to cure , preferably while still under a vacuum , at an appropriate temperature to consolidate and strengthen the assembly . once cured , vacuum bag 43 can be removed . preferably , heat is also applied during the curing process or during the resin infusion step . the invention has significant advantages . since the preform is not pre - impregnated with resin initially , there is no issue related to whether the preform is still within its shelf life . because of its thickness , the preform of this invention will conform to fabrication and assembly tolerances associated with the components to be joined . the resin infusion process is easy to implement and clearly establishes that all joint surfaces have been infiltrated with resin . being of fibrous material , the preform forms a composite once the resin has cured , providing a stronger joint than joints that are bonded with only adhesive . tooling and processing requirements are less intensive than those required for co - curing or co - bonding . the infusion joining process has a potential for a higher degree of repeatability or producibility as compared to other joining methods . while the invention has been shown in only a few of its forms , it should be apparent to those skilled in the art that it is not so limited but is susceptible to various changes without departing from the scope of the invention . for example , if desired , suction at the lateral outlets could be delayed until the resin reaches the end outlet . | 1 |
referring first to fig1 a vehicle 10 having front and rear wheels 12 and 14 , respectively , supports a chassis comprised generally of frame channels 16 , a cab 18 , and a conventional engine 20 . the feedback circuit of this invention is primarily located within cab 18 and is not shown in fig1 . vibrator assembly 24 is disposed between the first and rear wheels and connected to the frame members 16 of the truck by a lift system 26 . a prime mover or engine 28 , main hydraulic pump 30 , high pressure accumulator system 32 , hydraulic fluid tank 36 , hydraulic tank cooler 38 and associated hydraulic plumbing may be located on the frame members 16 as shown . fig2 illustrates the combination of summer 59 , power amplifier 57 , servo valve motor 58 , servo valve 51 , mass 54 , pad 40 , linear variable - differential transducers 52 and 55 , and feedback 61 . this combination is in the prior art as described in u . s . pat . no . 3 , 929 , 206 , entitled &# 34 ; servo hydraulic transducer and method of operation &# 34 ; assigned to the assignee of this invention and incorporated herein by reference . accelerometers 53 and 56 are attached to the mass 54 and tab 40 respectively and are summed in conventional summing amplifier 62 . switch 63 enables the selection of the mass accelerometer output , the pad accelerometer output , or the addition of the two outputs . any of these three signals then form the feedback signal which passes into single sideband ( mod 2 ) 68 , the output of unit 68 being a single sideband signal increased by the frequency of a local oscillator , which in this preferred embodiment operates at 2 khz . the output from unit 68 goes to multiplier 72 and to phase detector 78 . amplitude compensator 75 , phase compensator 81 and envelope generator 65 are modules within a ti 99000 microprocessor chip which , together with appropriate memory , forms a microcomputer . the envelope generator 65 provides digital words indicative of the contour of the desired amplitude envelope . also provided by the computer is a digital work relating to instantaneous frequency . the output of the envelope generator 65 provides inputs to analog wave synthesizer 66 . analog wave synthesizer 66 is known in the prior art and is described in detail in u . s . pat . no . 3 , 979 , 715 , entitled &# 34 ; method and system for achieving vibrator phase lock &# 34 ;, assigned to the assignee of this invention and incorporated herein by reference . there it is shown that the analog wave synthesizer comprises a binary rate multiplier , binary counters , a read - only memory , and a d to a converter . the output of analog wave synthesizer 66 is the pilot signal which enters single sideband ( mod 1 ) 67 and is increased in frequency by 2 khz , in this preferred embodiment . the output of unit 67 provides an input to phase detector 78 and an input to multiplier 72 . the multiplication of the feedback single sideband signal by the squared single sideband pilot signal yields the fundamental signal . the fundamental signal is input to rms converter 73 which provides a voltage level indicative of the rms value of the input fundamental signal . rms converter 73 and rms converter 69 , in this preferred embodiment , are type ad536asd / 883b , manufactured by analog devices . the output from rms converter 73 is input to a / d converter 74 whose output goes to amplitude compensator 75 . the output from rms converter 73 also provides an input to a meter available for inspecting the rms value of the fundamental signal . the output from unit 68 provides an input to rms converter 69 whose output represents the rms value of the feedback signal which is thn digitized through a / d converter 71 and input to amplitude compensator 75 . amplitude compensator 75 provides an input to multiplier 76 whose other input comes from envelope generator 65 through summer 82 . amplitude compensator 75 , as will be shown , provides a digital output for altering the output of envelope generator 65 to provide an amplitude digital indicator representing the pilot signal modified by the amplitude of the fundamental signal and by the distortion . this digital information is presented to analog wave synthesizer 77 which is in the prior art and substantially identical to analog wave synthesizer 66 to provide a control signal through summer 59 to power amplifier 57 which provides a drive signal for driving the servo valve 51 to move the hydraulic unit , mass 54 and pad 40 so that the feedback signal is equal in amplitude to the pilot signal . this broad description is of the amplitude compensation and following is a broad description of the phase compensation . phase detector 78 having inputs from units 67 and 68 provides a phase difference output to phase compensator 81 through a to d converter 79 . the output of phase compensator 81 is summed with a digital word indicative of an instantaneous frequency from envelope generator 65 at summer 82 . this frequency change , if any , is reflected through the analog wave synthesizer 77 to provide the control signal for ultimately providing a feedback signal in phase with the pilot signal . fig3 shows a filtered feedback signal and a filtered pilot signal entering units 67 and 68 , respectively . since the units are identical , the detailed description will relate to the pilot signal for this figure and following figures , with it being understood that the circuitry , unless otherwise specified , is identical for the feedback signal . the filtered pilot signal enters 90 degrees phase differential unit 13 having a cosine output which is multiplied at 19 by cosine w o t , a signal from a local oscillator to be described later . a sine wave from unit 13 is multiplied at 21 by the sine w o t which is summed at 25 with the product from multiplier 19 , providing a single output to limiter 29 for squaring the output to phase detector 78 . the feedback signal is treated in the same fashion and also inputs phase detector 78 . fig4 a and 4b , joined as shown , schematically illustrate the 90 degree phase differential unit 11 for the feedback signal . fig5 a and 5b , joined as shown , schematically illustrate the 90 degree phase differential unit 13 for the pilot signal . pilot high and pilot low signals are shown connected to the negative and positive terminals of operational amplifier 91 , respectively . in this preferred embodiment , a dual signal , such as pilot high and pilot low , is employed when moving from one location to another as , for example , from one chip to another . for purposes of transmission , the dual line is used and is single ended by the operation of amplifier 91 . operational amplifier 91 provides an input to a low pass filter made up of operational amplifiers 92 and 93 and the associated components as shown . this low pass filter rolls off at approximately 400 hz to remove any unwanted harmonic frequencies . it should be noted that in fig4 a and 4b , no such low pass filter is shown . however , such filtering is performed on the feedback signal and is simply not illustrated in these drawings . the filtering is identical to that described for the pilot signal . the output from operational amplifier 93 provides an input to operational amplifier 94 via resistor r28 and to operational amplifier 95 via resistor r30 . the positive input to amplifier 94 is provided by analog ground and impressed through resistor r29 . the positive input to amplifier 95 is provided by analog ground impressed through resistor r31 . capacitors c28 and c29 are connected between the output of amplifier 93 and the positive inputs to amplifiers 94 and 95 , respectively . the output of amplifier 94 is connected through series capacitors c98 and c106 and through resistor r34 to the negative terminal of operational amplifier 96 . analog ground is impressed through resistor r40 to the positive terminal of amplifier 96 . the output of amplifier 96 , through resistor r46 , provides the signal &# 34 ; pilot sin &# 34 ;. the output of amplifier 95 , through series capacitors c24 and c26 , and through resistor r35 is impressed on the negative terminal of amplifier 97 . analog ground is provided through resistor r118 to the positive terminal . the output of amplifier 97 , through resistor r49 , is impressed on the negative input of amplifier 98 , whose positive input is grounded through resistor r50 . the output of amplifier 98 , through resistor r60 , provides the signal &# 34 ; pilot cos &# 34 ;. reference to fig4 a and 4b illustrate the identical circuitry with amplifier 84 providing signal &# 34 ; fb sin &# 34 ; on terminal t13 and amplifier 86 providing signal &# 34 ; fb cos &# 34 ; on terminal t14 . signal &# 34 ; pilot sin &# 34 ; is impressed on terminal t11 and signal &# 34 ; pilot cos &# 34 ; is impressed on terminal t12 . all of the amplifiers discussed in the above detailed description are type tl084mj manufactured by texas instruments . fig6 a - 6d , joined as shown , illustrate the necessary timing for performing the multiplies done by multipliers 15 , 17 , 19 and 21 of fig3 and the summation of the products . a system clock , from the microcomputer , at approximately 16 mhz , is inverted through inverter 104 and impressed on one input of dual 4 - bit binary counter 102 , a texas instruments type ls393 . output terminal 2q is connected to the 2clk terminal of flip - flop 101 . the 2q output of flip flop 101 provides the 1ck input to flip - flop 105 and the negative input to terminal 1a of dual monostable multivibrator 106 . four bit up / down synchronous counters 116 and 115 are texas instruments type ls169 . the rco terminal of unit 116 is connected to the enap terminal of unit 115 . the 2q output of flip flop 105 is signal sin -/ cos which provides the ck input to units 115 and 116 and the a7 cosine or sine select input to memory 118 . outputs from terminals qa , qb , qc and qd of counter 116 and from terminals qa and qb of counter 115 provide selection inputs to memory terminals a1 , a2 , a3 , a4 , a5 and a6 , respectively . of memory 118 . sixty four segments of 2 khz sine and cosine waves are stored in memory 118 and are brought out on terminals d1 - d8 to terminals bit 8 - bit 1 of multipliers 111 and 119 , respectively . signals pilot sin , pilot cos , fb sine and fb cos are brought in on terminals t11 - t14 , respectively , to terminals s3 , s4 , s1 , and s2 of switch 114 , a type ad7512 didt / 8838 from analog devices . fb sin or fb cosin is carried on line 201 to terminal vref of unit 119 . pilot sin or pilot cos is carried on line 202 to terminal vref of unit 111 . amplifiers 112 and 113 , together with unit 111 and associated circuitry , is a four quadrant multiplier and , in this preferred embodiment , is from analog devices which provides a d to a conversion and a multiplication to yield the signal &# 34 ; pilot analog &# 34 ; impressed on terminal t17 . amplifiers 121 and 122 , together with unit 119 , form an identical d / a - multiplier combination providing signal &# 34 ; fb analog &# 34 ; at terminal t18 . nand gate 107 has one input , signal sin -/ cos , from the 2q terminal of flip - flop 105 and the other input from terminal 1q of one - shot 106 . the output of one - shot 106 also provides one input to nand gate 108 . the 1q output of flip flop 105 is connected to the 1d input to that unit and also provides the other input to nand gate 108 . the outputs of nand gates 107 and 108 are signals cos hold - and sin hold - impressed on terminals t15 and t16 , respectively . referring to fig7 a - 7c , the input signals cos hold is impressed on terminal s / h of each of sample and hold circuits 123 and 125 . signal sin hold - is impressed on the s / h terminal of each sample and hold circuits 124 and 126 . these sample and hold circuits , in this preferred embodiment , are type ad583k from analog devices . the pilot analog signal is impressed on the in + terminals of units 123 and 124 while the fb analog input is impressed on terminals in + of units 125 and 126 . the pilot analog signal is gated out of units 123 and 124 by either the cos hold - or sin hold - signals to the negative terminal of amplifier 127 whose output , through capacitor c92 and resistor r74 , is impressed on the negative input of amplifier 131 . the output of amplifier 131 , because of its biased positive input , is a squared pilot signal impressed on terminal t21 . the fb analog signal is gated out of units 125 and 126 by either the cos hold - or sin hold - signals to the negative terminl of amplifier 129 whose output is signal fb ssb ( feedback single sideband ) impressed on terminal t20 . this signal is also impressed on terminal s2 of analog switch 72 ( shown as a multiplier in fig2 ). the output of amplifier 131 of fig7 c is connected to line 202 which provides the input to terminal a1 of analog switch 72 . the multiplication of this squared wave with the signal fb ssb yields the signal fb heterodyned at terminal t19 . the squared pilot and squared fb signals at terminals t21 and t22 are input to the phase detector 78 . fig8 in block form , illustrates a digital alternative 140 to the preferred embodiment single sideband shift and phase detect technique described above . the pilot signal p ( t ) is input to a / d converter 141 whose output is signal p ( nδt ) providing an input to each of digital filters 143 and 144 . the output of digital filter 143 is signal pa ( nδt ) and the output of digital filter 144 is signal pb ( nδt ), both input to module &# 39 ; 45 of the digital computer . as indicated , digital computer 145 calculates phase b ( nδt ) by computing arctan pa ( nδt )/ pb ( nδt ). the difference between phase b ( nδt ) and a ( nδt ) ( from an identical structure for the feedback signal ) are differenced at unit 147 , also a part of the computer , to provide a digital representation of phase difference . the digital filters are designed to satisfy the equations : ## equ1 ## coefficient fa ( j ) and fb ( j ) are selected to produce a 90 degree phase difference in the signals pa ( nδt ) and pb ( nδt ). digital filters 143 and 144 could also be implemented , as is well known , in the digital computer . fig9 a and 9b show the fb heterodyned signal from terminal t19 ( which is the fundamental signal ) applied through capacitor c4 to terminal vin of rms converter 73 . signal fb ssb from terminal t20 is shown impressed , through capacitor c3 , on terminal vin of rms conerter 69 . circuits for signals fb ssb and the fundamental are identical and the circuitry for signal fb ssb shall be described . the out terminal of unit 69 provides an input to the positive terminal of amplifier 152 , and through resistor r12 to the negative terminal of amplifier 151 . the output of amplifier 151 is signal fb rms lo and the output of amplifier 152 is signal fb rms hi . in exactly the same signal development , signal fund rms lo is output from amplifier 153 . amplifier 154 provides output signal fund rms hi . these signals , as mentioned earlier , are double ended because of an exit and are brought together in the digital computer component amplitude compensator 75 . fig1 a is a schematic diagram of a prior art phase detector circuit with input signals squared fb and squared pilot . no detailed description is required but waveforms will be discussed in connection with the mode of operation . suffice it to say at this point that nand gate 163 provides output signal lead err and nand gate 164 provides signal lag err . these signals are input to terminals a1 and a2 , respectively , of analog switch 165 , a type ad7511didt / 883b from analog devices . terminal s1 or terminal s2 will provide an output , depending upon whether it is a lead err or lag err to drive amplifier 167 . amplifier 167 in turn drives amplifiers 168 and 169 to provide a doubled ended output signal for error lo and error hi . these signals are applied to the phase compensator 81 of the digital computer . turning now to fig1 , the digitized feedback signal is shown as &# 34 ; p &# 34 ; and the digitized fundamental signal is shown as &# 34 ; q &# 34 ;. signal p is squared at multiplier 171 and signal q is squared at multiplier 172 . the difference these squares is taken at summation 173 and the square root is taken at 174 to provide , at 175 , the ratio of the distortion to the fundamental signal shown as d / q at terminal t23 . a digital fundamental signal q is provided at terminal t24 . fig1 illustrates envelope generator 65 providing an input to summation point 176 . the fundamental digital representation from terminal t24 also provides an input at 176 . the ratio of distortion to fundamental from terminal t23 is summed at 179 with a predetermined threshold level . the output of summation 179 is sent to limiter 178 to prevent any negative entry and also to limit the positive amplitude , the output of limiter 178 also being summed at 176 . the summed output from 176 enters loop filter 177 which is an integrator for controlling the loop . the output of loop filter 177 is limited through limiter 181 to prevent any negative output . at multiplier 76 , the output from limiter 181 is multiplied with the vco output from analog wave synthesizer 77 to provide a digital representation of the control signal which , by way of unit 77 , is output as an analog signal to the power amplifier 57 shown in fig2 . for this discussion , please refer continually to fig2 as well as to those figures specifically referenced . referring to fig2 the output signals from accelerometers 53 and 56 are summed in summation amplifier 62 and then selected by switch 63 as to mass accelerometer 53 , pad accelerometer 56 , o the weighted sum of the two from amplifier 62 . the selected signal is the feedback signal which is single sideband shifted by unit 68 and output to rms converter 69 and multiplier 72 . the rms value of the total feedback signal is provided out of rms converter 69 and the fundamental rms value is provided out of rms converter 73 . these signals are digitized in a to d converters 71 and 74 , respectively , and sent to the amplitude compensator 75 . referring now to fig6 a , please note that signals a - g are shown at selected points . fig1 shows the various waveforms at those points . signal a is shown as a square wave for clocking flip - flop 101 . signal b , the output of flip - flop 101 , as expected , is at one half the frequency of signal a . signal c , the output from flip - flop 105 , is again halved in frequency to provide the output signal sin -/ cos . signal d is the inverse of signal c . the output of one shot 106 is signal e . the output of nand gate 107 is signal f and the output from nand gate 108 is signal g . signal f is cos hold - and signal g is sin hold - which are used for gating the sample and hold circuits described earlier . the outputs from counters 115 - 116 of fig6 c are shown and the outputs from memory 118 are shown ( as either sine or cosine ). these signals then illustrate the operation of the timing for the single sideband shift network . refer now to fig1 a and 12 where various signals are shown in the prior art phase detector . signals h - n on the upper half of the drawing illustrate a lead err while the lower signals i , h , j , k , l , m and o illustrate the lag err situation . signal h is the squared fb and signal i is the squared pilot signal . the output of exclusive or gate 155 is represented by signal j which is twice the frequency of signals h or i and is triggered by the leading one of these two signals . signal k is the output from one shot 159 and signal l is the clock input to flip flop 162 . note the difference in time occurrence between signal k above and signal k below . signal m is the output one shot 221 and the k input to flip - flop 162 . q and q - outputs from flip - flop 122 are signals n and o . note that signals n and o are the inverse of each other , as would be expected to signify a lead or lag error . fig1 a - 15d illustrate the operation of the amplitude compensator 75 of fig2 . please note that table 1 is the computer program that makes up this flowchart illustrated in fig1 a - 15d . the various components of the flowchart are clearly set out in table 1 , detailing the flowchart symbols . referring to fig1 a , the total harmonic distortion is calculated and there is an output to the meter as shown in fig2 from amplitude compensator 75 . a determination is made as to whether the envelope switch is on and if not , the envelope switch equals off and the drive level equals drive level pot . if the envelope switch is on , the spline word is reformatted . the spline word defines a point on the envelope of the envelope generator . then the drive level is made to equal a spline word , and the determination is made as to whether the spline word is less than the low limit . if it is not , then the envelope switch is on . if it is , then the envelope switch is off . next , the high / low equals low determination is made . if the answer is yes , then the drive level is divided by two , for some reason such as proximity to a building . if the answer is no , then a determination is made as to whether the envelope switch is on . if the answer is yes , then it is determined whether the total harmonic distortion ( 7hd ) is over the high limit . if the answer is yes , then the drive level equals the level minus the high limit . if the answer is no , then the determination is made whether the thd is less than the low limit . if the answer is no , then the drive level is made equal to the drive level minus the thd . if the answer is yes , fundamental rms is converted to a peak . the signal dr level minus thd is also converted at that point . then the dr level equals the dr level minus the fundamental and the dr level equals dr level multiplied by the gain . the drive integral is set to equal the drive integral plus drive level and it is determined whether the drive integral is greater than the integral hi . if the answer is yes , the drive integral is set equal to integral and if the answer is no , it is determined whether the drive integral is less than the integral lo . if the answer is yes , the drive integral is made equal to integral lo . if the answer is no , the envelope control word is made equal to the drive integral . that also is true when the drive integral is equal to the integral hi or equal to the integral lo . this condition is also met when the envelope switch is off . in this way , the amplitude is adjusted . fig1 a - 16c from a flowchart illustrating control of the phase compensation performed in phase compensator 81 of fig2 . it should be noted that the details of the decision blocks of the flowchart on fig1 a - 16c are shown in the program listing of table ii . for minute detail of these blocks , please refer to table ii . on fig1 a , the question &# 34 ; is phase compensation switch on ?&# 34 ; is asked . if the answer is no , there will be no phase compensation . if the answer is yes , the circle count is obtained and it is determined whether this is within the preset interval . if the answer is yes , a routine is exited . if the answer is no , it is determined whether the pilot frequency is in range 1 . if the answer is yes , it is determined whether the frequency range 1 flag is set . if the answer is yes , then the routine shown in fig1 b is skipped and an entry is made to the block that refers to calculate digital filter output . if the answer was no with respect to when the pilot frequency was in range 1 , then a decision is made whether the pilot frequency is in range 3 . if it was determined that the frequency range 1 flag was set , then the digital filter for range 1 is calculated and the range 1 flag is set . if the pilot frequency is in range 3 , then it is determined whether the frequency range 3 flag is set . if the pilot frequency is not in range 3 , then the digital filter for range 2 is calculated and the range 2 flag is set . if the frequency range 3 flag is not set , then the digital filter for range 3 is set and the range 3 flag is set . for all active cases then , the next step is to calculate the digital filter output and then to calculate the vco output ( see fig1 ). next , the vco output is limited and stored and the routine is exited . the component types shown in this preferred embodiment and the particular circuit or filter configurations are not to be construed as limiting . it is understood that those skilled in the art are capable of changing configurations and timing and it is intended that this specific implementation not be limiting , but that the invention be limited only by the appended claims . | 6 |
the present invention relates generally to a still camera of the 35 mm type having a swing - open back door which when open exposes the interior of the camera housing for film loading , and , more particularly , to a unique take - up spool design and positioning control therefor which ensures receipt and reliable capture of a film leader in a slot therein when the take - up spool is subsequently rotated . in the field of electrically operated 35 mm cameras there exists a variety of means whereby the camera may be loaded rapidly and easily . a variety of approaches have been used to accomplish this . one is disclosed in u . s . pat . no . 4 , 416 , 525 . an unslotted take - up spool with one or more slightly radially projecting film - engaging capture hooks disposed to engagingly capture a film leader driven over and around the take - up spool by a sprocket , motor - driven through a slip - clutch when the shutter release button is depressed . here the user need not bother about threading the film leader through a slot in the take - up spool , as was required by conventional cameras where occasionally a hook on the spool projecting into the slot failed to capture a film aperture , thereby making it impossible to advance the film . such film capture failure is believed due to the fact that the slot and capture hook are not ideally positioned or formed to ensure capture of the film leader . in the patent described above , to insure that the capture hooks disengage without tearing the film on rewind , the take - up spool is driven overspeed with respect to the cassette take - up rate during rewind , so as to shuffle the film off automatically . where cost reduction is the principal objective , as in the case of the present invention , the prior requirement that the user place the film leader in a take - up spool slot is retained , but the leader capture reliability is enhanced by the features of the invention to be described , which involve less expensive mechanism that that disclosed in said patent . other less desirable prior approaches to take - up spool film capture use a friction coating such as a synthetic rubber - like coating around the take - up spool , and loading gates and feeding shoes to insure that the film is fed around the spool during initial leader advance to secure at least one tight turn thereabout . both of the aforementioned systems tend to be inherently complex , and therefore expensive as opposed to the long - standing method of inserting the film into or through a suitably disposed capturing slot in the take - up spool . while not a requirement of the broad aspects of the present invention , in a motor driven embodiment thereof , as in said patented camera , it is desirable that some form of tension - sensing film feed control be incorporated into the camera , wherein the sudden build - up of film tension at and end - of - film condition in the take - up spool is sensed by one means or another to disable further film advance , or to automatically switch the camera into a rewind drive configuration , where the film is automatically rewound into the cassette . such tension - responsive systems place a rather substantial load upon the take - up spool drive , and hence on the take - up spool itself , which must be sufficiently rugged to withstand the tension surges involved . a simple , rugged , small one - piece take - up spool , preferably made as a single molded plastic part , and capable of absorbing these tension surges without fracture would be a desirable feature of the most preferred form of the invention . prior to the present invention , to the applicant &# 39 ; s knowledge , there has not been provided an inexpensive film - capture system for a back - loading 35 mm camera which is easily threaded in under adverse lighting conditions without the use of special guide shoes or related paraphenalia , which preserves the requisite structural integrity of a small diameter take - up spool under high stress conditions , and which is of simple one - piece inexpensive construction . according to a feature of the invention the camera features a motor driven take - up spool having a wide - aperture film - capturing slot having a film - engaging hook therein , the camera featuring a means preferably motor driven which enables the positioning of the take - up spool in a precise position so as to present the take - up spool slot in an optimum position for placement and capture of the film leader . in the preferred form of the invention , where the camera uses an electric motor for film wind and rewind , the take - up spool is automatically moved into this optimum position by this same motor responsive to opening of the camera loading door attendant to a film loading operation . to that end , position sensing switching means are provided associated with the take - up spool which , in conjunction with a door - actuated switch , energizes the motor to cause a partial rotation of the spool to the ideal loading position . in accordance with a specific aspect of the invention , the take - up spool slot has a unique size and shape . thus , instead of being a narrow slot formed in the periphery of a cylindrical , thin , hollow shell forming the take - up spool , with a hook projecting substantially into the slot , as in the case of the take - up spool disclosed in said copending application ser . no . 477 , 247 , the slot has a much greater width and the capture hook projects only slightly into the slot . also the slot is preferably formed in a take - up spool which is a thick - walled , hollow , cylindrical , synthetic plastic molded part . the slot , which will be more fully described hereafter , permits a unique placement and construction of the captured tooth . also , the take - up spool can then take the forces built up therein when film tension responsive means are incorporated in the camera as previously described . the concept of providing a means for positioning the take - up spool in a precise optimum position , such as by an electric motor drive responding to the opening the of the film chamber door , is disclosed in applicant &# 39 ; s copending application ser . no . 477 , 247 , filed mar . 21 , 1983 . this invention as shown therein is applied to a half - frame , drop - in loading camera . unlike conventional 35 mm full frame cameras , the film cartridge and film leader are inserted edgewise into small slots and openings in the camera housing end wall , and the user has no access to the film leader once the cartridge is inside the camera . there is also no full view of the take - up spool slot to aid the operator to place the film leader into the slot the slot opens the axial end of the spool . when the take - up spool is properly positioned , the film leader - receiving slot automatically is aligned with another slot in the camera end walls so that the film leader is guided thereby into the take - up spool slot upon dropping of the film into the camera . the automatic spool positioning means is here a practical necessity . thus , to provide an automatic means for positioning the take - up spool in a pre - determined position where the poorly visible slot is aligned with the plane of the end of the film leader would not necessarily suggest such an automatic positioning feature in a camera where the take - up spool slot and film leader are fully visible and accessible . in the preferred form of the invention , when the film chamber door is opened to fully expose the film chamber , the take - up spool is automatically moved into its ideal position . the user merely drops the cassette into the cassette - receiving chamber and then places the end of the film leader into the take - up spool slot without other special threading operations . on closure of the door , pressure on the film leader is then such as to present the film leader in an ideal position to be captured by the hook on the take - up spool as soon as the take - up spool is advanced in a film winding direction . film advancement can be automatically initiated by closure of the door or by subsequent operation of the shutter release button . other advantages and features of the invention will become apparent upon making reference to the specification , claims , and drawings to follow . fig1 is a perspective view of a back - loading 35 mm camera with the back open prior to loading and showing the take - up spool film slot properly positioned for film threading ; fig2 is a partial perspective view of the take - up spool of fig1 and additionally showing a sector cam affixed thereto and rotatably operating a feeler switch according to the position of the take - up spool with respect to the camera housing ; fig3 is a representative circuit providing for automatic orientation of the take - up spool attendant to opening the camera back to the configuration indicated in fig1 by selectively actuating associated internal electric motor drive means ; fig4 a is a cross section view along the section lines 4a -- 4a indicated in fig1 where the camera is oriented so that the film compartment is open at the top of the camera housing and showing the take - up spool properly positioned for film loading ; fig4 b is a partial plan view of the take - up spool of fig1 in the vicinity of the film - loading slot , also showing a film leader proximate to the take - up spool just prior to engagement therewith ; fig4 c is a view of the camera similar to that shown in fig4 a , and showing a film leader loosely hooked to the take - up spool prior to closure of the camera door ; fig4 d is a view similar to that shown in fig4 c after an initial partial rotation of the take - up spool in a film - advancing direction and ; fig5 is an enlarged view of the central portions of fig4 a . fig1 shows an electrically operated camera of generally conventional design to which the teachings of the present invention are applied . the camera 10 features a housing 12 having a cassette - receiving chamber 16 , a take - up spool 22 , a pair of film guide rails 18 , 20 integral with the housing 12 , a film advance metering sprocket 30 , a pushbutton 28 serving to actuate the shutter and to automatically initiate advance of a subsequent film advance by electric motor drive means ( not shown ), and an end - of - film switching member 32 for disconnecting the motor drive system when the film leader has been rewound clear of the take - up spool 22 . also shown is hinged swing - open film compartment closure door 14 secured in a closed position by a latch 13 and carrying a customary pressure plate 36 which serves to flatten the film against the guide rails 18 and 20 when the door is closed . in particular , there are mounted in the housing switch actuating members 34 and 32 configured to be actuated responsively to opening or closure of the door 14 by engagement with a corresponding tang 38 or a shelf 40 respectively , each being integral with the door 14 . the upper switch member 34 may be associated with conventional switching reset means for reconfiguring the electronic circuitry ( not shown ) of the camera from a rewind to a forward film advancing configuration responsively to either opening or closing the door 14 . switch member 32 , similarly responsively actuated by movement of the door 14 between opened and closed positions , serves to actuate special drive circuitry for driving the take - up spool 22 to present the film leader loading slot 24 to be oriented properly outward for the next film loading operation . the take - up spool is shown as a thick - walled cylinder 22 having an unusually wide film leader - receiving slot 24 terminating at widely separated end walls 70 , 72 . this slot and associate capture hook 26 are shown in detail in fig2 and in fig4 a - 4d at various phases of the capture process . fig4 a shows the orientation of the film loading slot 24 properly positioned for loading when the camera housing is resting on its front wall so that the film compartment open onto the top thereof . fig4 b is a partial plan view of the take - up spool shown in fig4 with the slot 24 similarly positioned , i . e . facing directly outward from the housing 12 . the film loading slot 24 is configured only slightly longer than a width of the leader end of a standard film 62 so that the end perforations 64 -- 64 thereon will be properly aligned with respect to the capture hook 26 when the end is inserted into the slot 24 . with particular respect to the slot configuration , and its relationship to the horizontal surface of the guide rail 20 ( see also fig1 ), it will be noted that the slot is defined in its long direction by two inwardly extending walls 56 , 58 hereinafter referred to as the leading and trailing walls respectively . the leading wall 56 is shown extending in almost a vertical direction and is formed by a substantially radial cut through the relatively thick - walled take - up spool cylinder 22 and accessing a cylindrical leader - accepting interior chamber having a defining interior wall 60 . the trailing wall 58 , on the other hand , is disposed to lie generally horizontally ( and thus makes a substantial angle to a radial line ). also it is out of alignment with respect to the plane of the captured film leader , so that at most only the radially innermost portion of the trailing wall 58 contacts the film prior to initial advance thereof . the trailing wall 58 has near one end thereof a locally circumferentially extending hook 26 extending in a leading or film - advancing direction therefrom . the outer periphery 26a of the hook is a continuation of the cylindrical outer periphery of the take - up spool and it terminates in a depending surface 26c forming a film aperture capture point or edge 26b . it will be noted that as viewed from directly above the loading slot 24 ( fig4 b ), the leading edge 26b of the hook 26 extends only slightly beyond the rightmost projection of the trailing wall . fig4 c shows the film leader extended beyond the position shown in fig4 b so that the hook 26 captures one of the perforations 64 . here the film is only loosely extending over the guide rail 20 , the door not yet having been closed . it will be further noted that the radially outermost portions of the trailing wall 58 are not yet in contact with the film 62 . fig5 shows a portion of the spool 22 in more detail with respect to this phase of capture . fig4 d shows the orientation of the take - up spool and the film after a modest portion of initial film advance , and wherein the entire trailing wall 58 has been brought into contact with the proximate surface of the film 62 . here it will be noticed that the film is now fully engaged on the capture hook 26 , being fully flattened against the surface of the trailing wall 58 . a relatively thick - walled take - up spool is provided to insure adequate mechanical strength . it will be appreciated that if the trailing wall 58 were not so angled back with respect to the capture region of the film as shown in fig4 c , there would be a strong likelihood that a conventionally radially oriented trailing wall configured similarly to the leading wall 56 might well cam the film out of engagement with the hook 26 , thereby causing feeding failure and loss of film . further , it will be noted , with particular respect to fig4 b , that the relative orientation of the leading and trailing walls 56 , 58 provides a relatively wide range of initial insertion angles of the film leader ; i . e . the orientation of the leader need not be precise in order to secure reliable film capture . thus , the effective insertion area of the take - up spool 22 is raised , without substantially impairing the structural integrity of the take - up spool itself . also this geometry provides a secure anchoring for the hook 26 over a distance substantially greater than would be provided by a radially disposed leading wall such as 56 , since the effective area of anchorage between the hook 26 and the trailing wall 58 is substantially greater than the thickness of the annulus defined between the outer surface of the takeup spool 22 and interior wall 60 thereof . by this means additional strength is imparted to the take - up hook as well . with respect to the aforementioned take - up spool positioning system , fig2 shows in partial form the take - up spool 22 having mounting shafts 44 , 46 affixed to conventional bearing and drive means ( not shown ) and further having a sector cam 42 affixed to one end thereof . a sector 48 , constituting an inward extension of a radial portion of the outer surface of the cam 42 slidingly engages an appropriately shaped sensor blade 50 to drive the sensor blade in an oscillatory motion between extreme positions according to the orientation of the cam 42 as the take - up spool is rotated by the motor drive means . a sensor contact 52 is positioned to confront the sensor blade 50 , these two contacts constituting elements of a switch s2 ( see fig3 ). rotation of the take - up spool 26 holds the sensor blade 50 and the sensor contact 52 in a closed condition thereby completing the electrical circuit therebetween until the take - up spool is rotated to the appropriate position shown in fig1 ( see also fig4 a ), whereupon the sensor blade 50 springs to a circuit - opening condition . fig3 shows a representative circuit for automatically repositioning the take - up spool 22 when the door 14 is opened after rewind . a modified conventional motor driven film advance control circuit is shown . the conventional portions of this circuit are represented by a film advance control circuit facc powered by a battery b and responsive through actuation of switch s3 ( responsively coupled to pushbutton 28 ) to energize a relay coil r for a predetermined period via line l1 , which completes the circuit from relay coil r to the opposite side of battery b . the movable contactor c of a single pole double throw relay - energized contacting system alternatively throws a short circuit across the motor m connected between terminals a and c of switch s4 to brake film advance , or when the contactor c contacts terminal b , applies electrical drive to the motor m from the battery b . control of the motor direction is controlled by a polarity of reversing switch prs having its switching state responsive to the internal switching condition of the film advance control circuit facc . the film advancing control circuit facc is reset to the forward configuration by well - known means according to the settings of the end - of - film sensing switch associated with the switch member 31 of fig1 and a door - actuated switch sr operatively associated with the door actuated switch member 34 . a variety of means are well - known in the art for accomplishing such programmed reversal of the motor drive polarity via the polarity switch prs according to these switch sensings . with respect to the present invention , upon termination of rewind , and with the film advancing control circuit preferably designed to set the polarity reversing switch prs to forward ( advancing ) polarity , opening the camera door allows switch member 32 to close its associated switch s1 . in the event that the slot 24 ( fig2 ) is not properly positioned , switch s2 , corresponding to sensor blade 50 and sensor contact 52 , will be in a closed - circuit condition . thus , it will be seen that one end of the coil of the relay r will be grounded , resulting in the energization of the relay to cause the movable contactor c to contact terminal b . this causes electrical power to be delivered to the motor m from the battery b . the take - up spool will therefore be immediately energized to a forward direction , rotation continuing until the cam sector 48 causes sensor blade 50 to move away from the sensor contact 52 , thereby breaking this circuit and terminating motor drive power . at this point , the slot 24 is properly facing outward form film insertion . thus , there has been described a convenient and inexpensive system for reliably threading the film into a 35 mm ( or similar ) camera having a swing - open back , and having all of the advantanges of a narrow diameter take - up spool , and overcoming many of the principal drawbacks thereof as previously outlined in the background prior art . by automatically positioning a single slot in the take - up spool at optimum position for accepting a film leader , and by optimally positioning the dimensions of the aperture itself , its defining walls , and the capture hook thereon , a reliable and inexpensive system is provided which allows for an inexpensive solution to the problems previously outlined . while the invention has been described with reference to a preferred embodiment , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof . therefore , it is intended that the scope of the claimed invention not be limited to a particular embodiment disclosed as the best mode contemplated for carrying out the invention , but that the scope of the claimed invention will include all embodiments and equivalents falling within the scope of the general principles disclosed herein . thus , for example , a great variety of sensing means may alternatively be used in use of the cam - actuated slot positioning switch previously described . such variants as a suitably placed commutator - type switch may equally well be employed , as may a variety of other electrical sensing means , including optical sensing means . further , although the present disclosure describes momentarily actuating the motor drive circuitry to reorient the take - up spool by driving the spool in a forward or film - advancing direction responsively to switching circuitry actuated by opening the loading door , clearly similar circuitry could readily be devised which would respond to actuation of the end - of - film sensor which terminates the rewind operation . alternatively the door latch 13 itself could be coupled to switching means ( s 1 1 fig1 ) so that unlatching the door actuates the reorientation drive . the designation of the actuating switch in fig3 as &# 34 ; s 1 / s 1 &# 39 ;&# 34 ; indicates that this switch may be placed in either of the two locations . moreover , once the film has disengaged after rewind , the switching circuitry could be adapted to continue the rewind drive of the take - up spool until it is properly positioned . in short , switching means responsive either to an end - of - film condition , or to operations attendant to the opening of the camera door may be used to drive the take - up spool either in an advancing or a rewinding direction to position the slot for the next loading operation . | 6 |
referring to the electric circuit diagram of fig1 and the block diagram of fig2 a first embodiment of the invention is connected across a d . c . voltage source 20 , not shown in fig1 which supplies a voltage v in . the supply voltage v in may have a wide range of values , from 20 volts to 31 volts , for example . the voltage is applied through a diode d1 , which typically has a voltage drop of 0 . 7 volt , to a regulator 22 which includes resistors r1 , r2 , r3 and r4 , switch q1 and integrated circuit u1 in order to provide regulated 5 . 00 ± 1 % volt supply to the v cc input of microcontroller u2 . a precise v cc input voltage is vital for the analog to digital reference input of microcontroller u2 . resistor r1 is connected at one end to diode d1 and at the other end to both resistor r2 and the collector of switch q1 , which in this instance is a transistor . the other end of resistor r2 is connected to the base of switch q1 and integrated circuit u1 , which acts as a controlled zener for providing a precise 5 . 00 ± 1 % voltage supply . resistor r3 is connected between the emitter of switch q1 and the control pin of integrated circuit u1 . resistor r4 is connected at one end to both resistor r3 and the control pin of integrated circuit u1 and at the other end to one end of integrated circuit u1 , which is at the negative node 10 of the voltage source . resistors r3 and r4 are of equal value for biasing integrated circuit u1 . a reset circuit 24 includes diode d2 , resistor r5 and capacitor c1 . diode d2 and resistor r5 are connected to each other in parallel , and at one end to the emitter of switch q1 and at the other end to both capacitor c5 and the clear input to microcontroller u2 . the other end of capacitor c5 is connected to the negative node 10 of the voltage source . as stated above , microcontroller u2 is supplied with a regulated 5 volt supply at v cc . v ss is connected to the negative node 10 . capacitor c2 is connected across v cc and v ss and acts as a filter . resistor r6 , acting as a shield , is connected between an input of microcontroller u2 and negative node 10 . the resonator circuit 26 consists of oscillator y1 , capacitor c3 and capacitor c4 . oscillator y1 provides 4 mhz oscillation to the microcontroller u2 and is connected across the two oscillator inputs of the microcontroller u2 . capacitor c3 is connected between the first oscillator input and the negative node 10 . capacitor c4 is connected between the second oscillator input and the negative node 10 . an analog to digital input feed network 28 is used to provide microcontroller u2 with a voltage level proportional to v in . the network includes resistor r7 , resistor r8 , potentiometer p1 and capacitor c5 . resistors r7 and r8 and potentiometer p1 form a voltage divider . potentiometer p1 , used for fine tuning the voltage divider , is connected at one end at the common node between diode d1 and resistor r1 . the other end of potentiometer p1 is connected to resistor r7 , which in turn is connected to resistor r8 and the analog to digital input of microcontroller u2 . the other end of resistor r8 is connected to negative node 10 . capacitor c5 is connected in parallel across resistor r8 and functions as a filter . prior to describing in detail the function of microcontroller u2 , the components affected by microcontroller u2 will be described . across v in is a branch with diode d3 , inductor l1 and switch q2 . diode d3 is connected between v in and inductor l1 and has approximately a 0 . 7 voltage drop across it . inductor l1 is a first energy storage device 30 for transfer of energy to the triggering circuit . inductor l1 is connected between diode d3 and switch q2 . the other end of switch q2 is connected to negative node 10 . switch q2 in this embodiment is a mosfet transistor which cycles between a conducting state ( i . e ., position ) and a nonconducting state and is controlled by an output of microcontroller u2 . a voltage divider including resistor r9 and resistor r10 connects the output of microcontroller u2 to the gate of switch q2 . one end of resistor r9 is connected to the output of microcontroller u2 and one end of resistor r10 is connected to negative node 10 . when switch q2 is closed , node 12 , between inductor l1 and switch q2 , is pulled to the same potential of negative node 10 . in other words , inductor l1 is across v in and the flashing circuit through diode d4 is isolated . with switch q2 closed , inductor l1 stores energy until it reaches its steady state level or until switch q2 is opened . when switch q2 is opened , the energy stored in inductor l1 is at least partially transferred through diode d4 and resistor r11 to charging capacitor c6 , the second energy storage device 32 . by controlling the opening and closing of switch q2 , the rate of storing energy in inductor l1 is regulated , thereby regulating the storage of energy across charging capacitor c6 . the flashing circuit 34 includes diode d4 , resistor r11 , charging capacitor c6 and flashtube ds1 . charging capacitor c6 and flashtube ds1 are connected in parallel , one end of the two components being connected to negative node 10 . diode d4 and resistor r11 are connected in series , one end of diode d4 being connected between inductor l1 and switch q2 . diode d4 permits current flow into the flashing circuit but prevents discharge of charging capacitor c6 when the potential across it is higher than v in or the potential across inductor l1 . one end of r11 is connected to the other end of the parallel combination of charging capacitor c6 and flashtube ds1 . the triggering circuit 36 includes triggering transformer t1 , resistor r12 , capacitor c7 , scr q3 , resistor r13 , capacitor c8 and resistor r14 . output pa2 of microcontroller u2 , at the appropriate time , signals scr q3 , triggering transformer t1 to pulse flashtube ds1 . resistor r14 provides over voltage and current protection to output pa2 . capacitor c8 and resistor r13 ensure that only the leading edge of the pa2 pulse reaches the gate of scr q3 , which only requires a small pulse . resistor r13 helps isolate scr q3 from noise . the potential across capacitor c7 slowly reaches the potential across charging capacitor c6 . the rate of potential increase across c7 is dictated by resistor r12 . when scr q3 is fired , capacitor c3 is in effect across the primary of trigger transformer t1 , causing a 4000 volt potential across the secondary of trigger transformer t1 , thus ionizing the gas in flashtube ds1 , causing the flash . resistor r12 also prevents scr q3 from shorting charging capacitor c6 . basically , microcontroller u2 uses an internal analog to digital converter to arrive at a digital equivalent of the supply voltage . microcontroller u2 then uses this digitized information to control the opening and shutting of switch q2 . as a result , the charging of inductor l1 , charging capacitor c6 and capacitor c7 is controlled by microcontroller u2 so that the desired potential across the charging capacitor c6 and flashtube ds1 is achieved just in time for microcontroller u2 to signal trigger transformer t1 , via output pa2 , to trigger flashtube ds1 . the functions of microcontroller u2 are illustrated by the flow charts of fig3 ( a ) and 3 ( b ). in this preferred embodiment , microcontroller u2 is a pic16c71 microcontroller , having an eight bit resolution , built - in analog to digital converter . the supply voltage is measured by the analog to digital converter in approximately 1 / 4 volt steps to a total of 256 steps . the program of the microcontroller u2 equates each step with a location in a look up table . one conversion or measurement is made for each cycle of the switch q2 . each time a measurement is made , a new value is read from the look up table . these values control the on time of switch q2 . the on time for each value in the look up table is empirically derived with testing equipment prior to manufacturing . for low voltages , the on time is long . for high voltages , the on time is short , the charging of inductor l1 being the limiting factor . thus , the energy stored throughout a flash cycle is kept somewhat constant . the switching frequency of switch q2 has a range of approximately 3 khz to 30 khz and has a high duty cycle ( roughly 50 % to 90 %). each value in the look up table equates to a switching frequency for ensuring that switch q2 will be on for sufficient time to charge charging capacitor c6 , and thus flashtube ds1 , to the precise amount needed for the minimum required intensity of the once per second flash . the high duty cycle results in storing of the energy in inductor l1 for most of the one second interval between flashes . this means that peak currents are lower than if the routine utilized a low duty cycle in which inductor l1 was charged for a relatively shorter period during each flash cycle . this is illustrated by comparing fig4 ( a ) and 4 ( b ), depicting the prior art , and fig4 ( c ) and 4 ( d ), depicting the present invention &# 39 ; s cycling frequency . the low voltage ( lv ) graphs of fig4 ( a ) and 4 ( c ) are similar with average currents of 1 unit and peak currents of 2 . 5 units . the high voltage ( hv ) graph in fig4 ( b ) shows a peak current of 5 units with an average current of 0 . 5 units . however , the high voltage ( hv ) graph in fig4 ( d ) shows a peak current of 2 units while maintaining an average current of 0 . 5 units . the on time in both figures is dictated by the input voltage . if the supply voltage sensed is below a minimum ( e . g ., less than 13 volts below which the precision 5 . 00 ± 1 % input might be lost ), microcontroller u2 turns off switch q2 and waits for the level to rise above the preset start up voltage ( e . g ., 14 volts ). microcontroller u2 has an interrupt , a real time clock and a prescaler which are used to produce an accurate , one second flash rate . the real time clock and prescaler generate a one - fifteenth of a second interrupt . the interrupt service routine then counts these pulses . when fifteen pulses have occurred , a pulse is sent to the scr q3 and flashtube q3 is triggered . in addition , the interrupt routine also controls the variable off time function . the off time of switch q2 is programmed to be a different predetermined value dependent on the number of cycles completed in the fifteen hertz rate of the interrupt ( i . e ., dependent on the time since the last flash ). a high value of off time is used after a trigger event , followed by several progressively lower values . for example the off time is longest during the first 1 / 15 second period after a flash . the off time is lowered for a 2 / 15 second period , lowered again for another 2 / 15 second period , lowered a third time for a 2 / 15 second period , then remains at its lowest value for the remaining 8 / 15 second period , until the next flash . this helps to minimize current anomalies during and immediately after a flash . fig4 ( e ) illustrates a change in the off time interval between periods . note that each of the five cycles shown in fig4 ( e ) represents multiple cycles ( e . g . at a frequency of 10 khz , 667 cycles may be represented by the first cycle ). by way of example , the following parameters may be used for the elements of the fig1 circuit to obtain a flash frequency of one flash per second : ______________________________________element value or no . ______________________________________c1 cap ., . 47 μfc2 cap ., 15 μf , 16 vc3 , c4 cap ., 33 pf , 200 vc5 cap ., . 1 μf , 50 vc6 cap ., 180 μf , 250 vc7 cap ., . 047 μf , 400 vc8 cap ., . 01 μf , 50 vd1 , d3 diode , 1n4007d2 diode , 1n914d4 diode , her106l1 inductor , 1 . 4 mhq1 transistor , 2n5550q2 transistor , irf740q3 scr , ec103dr1 res ., 330 , 1 / 4w , 5 % r2 res ., 4 . 7k , 1 / 4w , 5 % r3 , r4 res ., 10k , 1 / 4w , . 1 % r5 res ., 39k , 1 / 4w , 5 % r6 res ., 100 , 1 / 4w , 5 % r7 res ., 11 . 8k , 1 / 4w , . 1 % r8 res ., 1k , 1 / 4w , . 1 % r9 , r14 res ., 220 , 1 / 4w , 5 % r10 res ., 100k , 1 / 4w , 5 % r11 res ., 22 , 1 / 2w , 5 % r12 res ., 220k , 1 / 4w , 5 % r13 res ., 10k , 1 / 4w , 5 % t1 transformer , trigger coilu1 i . c ., tl431aclpu2 i . c ., pic16c71y1 ceramic res 4 mhzp1 pot ., 5k ohms______________________________________ a second preferred embodiment of the invention uses the electric circuit shown in fig1 . however , this embodiment is capable of operating on unregulated full wave - rectified d . c . supply voltage , in addition to a d . c . supply voltage . fig5 ( a ) and 5 ( b ) are flow charts illustrating this embodiment . microcontroller u2 utilizes a second internal look up table . the program distinguishes between full wave rectified d . c . and &# 34 ; clean &# 34 ; ( i . e ., filtered ) d . c . by detecting the valleys in the full wave rectified signal . valleys are detected , counted , and compared to a programmed value . the program then determines which look up table to use , d . c . or full wave rectified . if the present measurement of the supply voltage is less than the previous measurement , a drop out test is performed instead of the look up . this feature ensures that peaks rather than valleys of the full wave rectified signal are used for the look up table . the interrupt routine discussed above is also responsible for resetting the peak hold characteristic of the analog to digital converter program . the peak hold characteristic holds constant the input to the look up table for 1 / 15 of a second to accommodate full wave rectified input to the look up table once digitized . by way of summary , because the present circuit coordinates the charging of the energy used to flash the flashtube so that the predetermined amount of energy is attained just prior to the signal to flash the flashtube , at its constant flash rate , and because the inductor is charged for as long an amount of time as is possible between the flashes , a constant flash rate with a constant flash intensity is obtained while at the same time minimizing the peak current drawn by the inductor . while preferred embodiments have been shown and described , various modifications and substitutions may be made thereto without departing from the spirit and scope of the invention . accordingly , it is to be understood that the foregoing description of the present invention is by way of illustration and not limitation . | 7 |
in fig2 , mailing system 22 includes address printer controller 13 , address printer 14 , postage meter 16 , and indicia printer 20 , which are substantially similar to the corresponding prior art elements shown in fig1 . system 22 differs in including data stores 21 and 23 communicating with controller 13 and in the manner in which controller 13 generates characterizing information . data store 21 stores a plurality of characterizing of characterizing algorithms , as will be described further below , and data store 23 stores at least a print / scan filter which , when applied to the pristine image generates a filtered image which approximates the transformation of the pristine image by the printing and scanning processes . in other embodiments , data store 26 stores one or more defacing filters which simulate blots , smudges , failure of print elements or scanner sensors , or other , similar occasional events which can not easily be incorporated into said print / scan filter to create one or more defaced images . together , meter 16 , printer 20 , form secure postal indicia printing system 22 . fig2 also shows verification controller 25 , camera 27 , data store 28 , storing the characterizing of characterizing algorithms used in system 22 , and diverter 29 ; which together comprise verification system 30 for comparing address block a with information recovered from indicium in and diverting mail pieces which do not match , as described above . ( system 30 is typically located at a postal facility distant from system 22 .) except as to programming of controller 25 to carry out the comparison algorithm of the subject invention , as will be described further below , operation of verification system 30 is substantially conventional and need not be described further here for an understanding of the subject invention . three methods for generation of image - based characterizing information which are believed to provide improved compactness and robustness in accordance with the above object of the invention , have recently been developed by the assignee of the present application and are described below as illustrative of the type of characterizing algorithms which can be used with the subject invention . numerous other algorithms will be apparent to those skilled in the art and particular choices of algorithms to be used form no part of the subject invention , except as may be recited in the claims below and equivalents . a characterizing algorithm where the characterizing information comprises measurements of the lengths of the individual words which make up address a , is shown in fig3 . address block a is parsed to identify individual words by first identifying line spaces is by determining the occurrence of large amounts of horizontal white space between blocks of printed text , and then identifying word spaces ws by determining the occurrence of large amounts of vertical white space between blocks of printed text ( as shown with respect the first line of address a ). word lengths / 1 through / 9 are then determined for address a . preferably , word lengths are taken ( measured in pixels ) from the edges of word spaces ws ( or the address edges ) as shown , but can be taken in any convenient manner , such as along the midline of the words . it is believed that using four or fewer bits per word would not be useful in postal applications . thus , in a preferred embodiment , the number of bits used can be selected to encode all words in the address , and two control bits will be sufficient to indicate selection of five to eight bits per word to encode the length of the word . in other embodiments , a fixed number of words in the address , for example the first eight , can be scanned at a fixed number of bits per word ; eight in this case , since control bits would not be needed to specify the number of bits per word . another algorithm , where the characterizing information comprises measurements of the number of “ outliers ” in each word ( or each line ) which make up address a , is shown in fig4 . ( by “ outliers ” herein is meant ascenders or descenders and portions capitals of which project beyond thresholds , which are preferably determined by the upper and lower bounds of lower case letters without ascenders or descenders , such as “ a ”, “ c ”, “ e ”, etc .) address a is parsed to identify individual words , if necessary , by first identifying line spaces is by determining the occurrence of large amounts of horizontal white space between blocks of printed text , and then identifying word spaces ws by determining the occurrence of large amounts of vertical white space between blocks of printed text ( as shown with respect the first line of address a ). otherwise only the lines need be identified . assuming six bits are allocated per word , the number of upwards (+) and downwards (−) outliers per word can be encoded as “ xxx / yyy ” where x and y are binary digits and xxx is the number of (+) outliers and yyy is the number of (−) outliers . another algorithm in which the characterizing information comprises a description of the shape of the address block is shown in fig5 . the shape is determined by using a conventional “ best fit ” scanning algorithm which encloses address block a with “ best fit ” closed curve 50 . ( it should be understood that various algorithms for generating a best fit curve will generate different curves . these differences do not affect the subject invention so long as the same algorithm is used to generate the curve whose description is incorporated into the indicium and to recover the curve from the address block when the indicium is validated .) preferably , curve 50 is constrained . that is the manner in which a curve can be generated is limited so that the resulting curve is simplified and can be described with limited information . in fig5 , curve 50 is formed from linked straight line segments , such as segment 51 , which are limited to eight “ directions ”, up ( u ), down ( d ), left ( l ), right i , up - right ( ur ), up - left ( ul ), down - right ( dr ), and down - left ( dl ); viewed as being generated starting in the upper left corner of address block a and traveling clockwise around address block a . preferably the curve 50 also accounts for spaces between characters , words and lines , treating these spaces as equivalent to printed space , so that curve 50 does not become too convoluted and require extensive descriptive information . it is within the skill of a person skilled in the art to provide an algorithm which will generate robust and compact characterizing information , as described above . the characterizing information , i . e . the description of curve 50 , can be encoded in a number of ways . in the present example , the characterizing information consists of only the directions , without lengths , of each successive line segment . programming of a data processor to analyze scan data to perform imaging operations such as identifying lines and words , measuring the dimensions of letters and words or fitting a curve to an image in accordance with predetermined constraints are well known . such operations are substantially routine in the character and general pattern recognition arts , for example . techniques for carrying out such operations are also taught in : handbook of pattern recognition and image processing edited by t young and k - s fu , academic press , 1986 and need not be discussed further here for an understanding of the subject invention . bit streams such as those describe above comprise ordered sequences of values which are typically , though not necessarily , numeric values associated with words in the address block . ( such bit streams are hereinafter sometimes “ characterizing information descriptors ” or “ descriptors ” and such values are hereinafter sometimes “ characterizations ”.) as described above , when an indicium is validated , i . e ., tied to the mail piece on which it is printed , at a distant postal facility the descriptor generated from the pristine image and incorporated into the indicium is compared with a descriptor recovered from an image scanned from the address block printed on the mail piece . it will be apparent to those skilled in the art that the recovered image will be transformed with respect to the pristine image by the characteristics of the printing and scanning processes , as well as possibly by the occurrence of occasional events such as blots . thus , it is important that the algorithm used to characterize the address block be robust ; that is that it produces descriptors that match sufficiently when an indicium is valid , and do not match for invalid indicia , despite small differences between the scanned image and the pristine image . it will also be apparent that the robustness of a particular characterizing algorithm can vary for different address blocks . ( as a hypothetical example , the above described algorithm based on word length may be less robust for address blocks printed in a small font while algorithms based on the number of outliers , or address block shape may be relatively insensitive to font size .) fig6 shows a flow diagram of the operation of controller 13 in accordance with one embodiment of the subject invention . at step 60 , controller 13 obtains a pristine digital image , p , of address block a from a conventional source ( not shown ) such as a data processing system for preparing a bulk mailing . at step 62 , controller 13 carries out printing of address block a in a conventional manner . preferably , this printing process is carried out concurrently with the selection of a characterizing algorithm but , in other embodiments of the subject invention , printing of address block a can be carried out sequentially or by a separate processor . at step 64 , controller 13 inputs a print / scan filter which simulates the printing process of printer 14 and the scanning process to be carried out at a remote postal facility from data store 26 and applies it to image p to generate a filtered image , f , which approximates the image which will be scanned from the mail piece at the postal facility . and at step 66 sets index i equal to 1 and variable r equal to 0 . at step 66 controller 13 sets index i = 1 and variable r = 0 , and at step 70 applies the ith characterizing algorithm c i to images p and f to generate corresponding descriptors c i ( p ) and c i ( f ); each comprising a sequence of m characterizations , or values , c i ( p ) 1 through c i ( p ) m ; c i ( f ) 1 through c i ( f ) m . then at step 72 , controller 13 compares descriptors c i ( p ) and c i ( f ) to estimate a robustness value r i for the ith algorithm c i , with respect to a particular image p . the comparison at step 72 is carried out using a comparison algorithm associated with characterizing algorithm c i and which preferably is the same comparison algorithm used at the postal facility to compare the descriptor recovered from the scanned image with the descriptor incorporated into indicium in . preferably , the comparison is carried out on a characterization by characterization basis , comparing each c i ( p ) j with the corresponding c i ( f ) j to determine if the characterizations match ; i . e ., if they are “ close enough ” as defined by the particular comparison algorithm used . ( as a hypothetical example , where the characterizations are word lengths they may be considered to “ match ” if the lengths differ by no more than one or two units ; while if the characterizations are the number of outliers in a word a “ match ” may require exact equality .) in a preferred embodiment , once descriptors c i ( p ) and c i ( f ) have been compared an estimate r i for the robustness of algorithm c i , with respect to particular image p , is calculated as : r i = total no . of [ c i ( p ) j matching c i ( f ) j ]/ m ( for j = 1 through m ); where m is the number of characterizations generated by c i . ( note that since robustness is defined with respect to small changes in the image , in normal use the filters , and the printing and scanning processes , will be such that the descriptors c i ( p ) and c i ( f ) will have the same number of characterizations . otherwise an error condition is generated .) once estimate r i is determined at step 74 , controller 13 stores r i and c i ( x ); where , in different embodiments of the subject invention , x can be p or f . that is , the descriptors incorporated into indicium in can be based on either pristine image p or filtered image f . then , at step 78 , controller 13 sets i = i + 1 and , at step 80 determines if i & gt ; n , where n is the number of algorithms to be evaluated . if so , controller 13 returns to step 66 to process the next algorithm ; and otherwise goes to fig7 . in fig7 , at step 90 controller 13 determines the size of all descriptors which have been generated , i . e . the number of bytes required to express each descriptor , and at step 92 sets index j = 1 and variable or = 0 . then , at step 94 controller 13 tests the jth combination , combj = c a ( x ), c b ( x ), . . . c y ( x ) against predetermined rules . in a preferred embodiment , this is carried out by a table look - up which determines whether or not comb j is permitted . such table can be up dated off - line in response to accumulated experience or heuristic experimentation . as a hypothetical example , the rules might require that a particular descriptor be included in permitted combinations while prohibiting other particular sub - combinations of descriptors . in other embodiments , each combination is logically tested against the rules to determine if the combination is permitted . then at step 96 , if it is determined that comb j is permitted , then at step 100 controller 13 determines if the size of comb j is small enough to fit in the available space in indicium in . if so , then at step 102 controller 13 calculates or j , the overall robustness of comb j . preferably : or j = avg ( r a , r b , . . . r y ) then , at step 106 controller 13 determines if or j & gt ; or , and if so at step 108 , sets or = or j . then , or if the results at steps 96 , 100 or 106 are negative , at step 110 controller 13 sets j = j + 1 , and at step 112 determines if j & gt ; 2 n − 1 , that is if all combinations have been processed . if not , controller 13 returns to step 94 to process the next combination , and otherwise at step 116 sends j and comb j to meter 16 for incorporation into indicium in . the postal facility can then recover j to identify comb j and use comb j to validate indicium in as will be described below . fig8 shows a flow diagram of the operation of controller 13 in accordance with another embodiment of the subject invention . similar to the above described embodiment , at step 90 , controller 13 obtains pristine digital image , p , of address block a , at step 94 carries out printing of address block a concurrently with the selection of a characterizing algorithm and , at step 96 inputs a print / scan filter . at step 100 controller 13 inputs defacing filters d 1 through d t ( described above ) and applies each of these filters to filtered image f to generate defaced images f * d 1 through f * d t which approximate scanned images of address blocks which have been defaced by occasional events such as blots . at step 102 controller 13 sets index i equal to 1 and variable r equal to 0 . at step 104 controller 13 applies the ith characterizing algorithm c i to images p , f and f * d 1 through f * d t to generate corresponding descriptors c i ( p ), c i ( f ) and c i ( f * d 1 ) through c i ( f * d t ); each comprising a sequence of m characterizations , or values , c i ( p ) 1 through c i ( p ) m ; c i ( f ) 1 through c i ( f ) m , etc . then at step 108 , controller 13 compares descriptors c i ( p ) with descriptors c i ( f ) and c i ( f * d 1 ) through c i ( f * d t ) to estimate a robustness value r i for the ith algorithm c i , with respect to a particular image p . in a preferred embodiment , once descriptors c i ( p ) and c i ( f ) have been compared an estimate r i for the robustness of algorithm c i , with respect to particular image p , is calculated as : r i = total no . of : [ c i ( p ) j matching c i ( f ) j ( for j = 1 through m )+ c i ( p ) j matching c i ( f * d k ) j / m ( for j = 1 through m , k = 1 through t )]/ m ( t + 1 ); where m is the number of characterizations generated by c i . again similar to the embodiment described above , once estimate r i is determined at step 110 controller 13 stores c i ( x ) ( where again x can be either p or f depending upon the embodiment ) and r i . at step 112 , controller 13 sets i = i + 1 , and at step 116 determines if i + 1 is greater than n , the number of characterizing algorithms stored . if not , controller 13 returns to step 104 to test the next algorithm . otherwise , at step 120 , controller 13 goes to fig7 and continues as described above . fig9 shows a flow diagram of the operation of controller 13 in accordance with another embodiment of the subject invention in which estimates of the robustness of algorithms c i have been previously obtained and stored . such estimates can be predetermined on the basis of experience with use or heuristic experimentation , or in any other convenient manner . again , at step 120 controller 13 obtains pristine digital image , p , of address block a , at step 122 carries out printing of address block a concurrently with the selection of a characterizing algorithm and , at step 124 sets index i = 1 . in a preferred embodiment , at step 126 , controller 13 applies algorithm c i to image p to generate descriptor c i ( p ). in another embodiment , additional step 125 is carried out immediately after step 124 to generate filtered image f , and step 126 a is substituted for step 126 to generate descriptor c i ( f ). at step 130 , controller 13 stores c i ( x ) ( where again x can be either p or f depending upon the embodiment ). at step 132 controller 13 sets i = i + 1 and at step 136 determines if i + 1 is greater than n , the number of characterizing algorithms stored . if not , controller 13 returns to step 126 ( or 126 a depending upon the embodiment ) to test the next algorithm . otherwise , at step 136 , controller 13 goes to fig7 and continues as described above . it is anticipated that other estimates for robustness of characterizing algorithms will be developed as experience with different applications is gained or will be apparent to those skilled in the art . accordingly , it should be understood that , except for particular recitations in the claims below and equivalents thereof , details of particular estimates used form no part of the subject invention . fig1 shows a flow diagram of the operation of verification system 30 in verifying indicium in . after envelope e is scanned by camera 27 , at step 140 verification controller 125 inputs a digital scanned image si of address block a , and at step 142 inputs comb j = c a ( x ), c b ( x ), . . . c y ( x ) and index value j . at step 144 controller 25 identifies algorithms c a , c b , . . . c y from index value j , at step 146 calculates descriptors c a ( si ), c b ( si ), . . . c y ( si ), and at step 150 compares corresponding descriptors . at step 152 , if the descriptors do not match controller 25 activates diverter 29 at step 154 to divert envelope e for inspection ; and otherwise , at step 158 sends envelope e on for normal processing . at step 150 , in a preferred embodiment , the descriptors are determined not to match if any pair of characterizations do not match . that is if for any i , k the characterizations c i ( x ) k , c i ( si ) k do not match then at step 152 no match is found . preferably comparisons are made using comparison algorithms associated with each of characterizing algorithms ci , and stores in data store 28 . in other embodiments , a predetermined threshold number of characterizations which fail to match is required before no overall match is found . in still other embodiments , this threshold may vary between 1 and another predetermined value or values associated with particular combinations j and stored in data store 28 . in other embodiments threshold values are specified in indicium in . the embodiments described above and illustrated in the attached drawings have been given by way of example and illustration only . from the teachings of the present application those skilled in the art will readily recognize numerous other embodiments in accordance with the present invention . accordingly , limitations on the present invention are to be found only in the claims set forth below . | 6 |
the invention relates to a water recovery device which is integrated into a fuel cell power plant or cell stack assembly . this advantageously provides for auxiliary water recovery in the device without external components and the like . [ 0018 ] fig1 schematically illustrates a cell stack assembly 10 in accordance with one embodiment of the present invention . cell stack assembly 10 has an air inlet manifold 12 , a primary cell stack portion 14 , an auxiliary coolant portion 16 and an air manifold 18 . primary portion 14 and auxiliary coolant portion 16 are defined by a series of stacked plates ( fig3 ), which will be further illustrated and described below , and define a primary air flow path , a fuel flow path , and a main coolant flow path through primary portion 14 . these plates also define an auxiliary air flow path and an auxiliary coolant flow path through auxiliary coolant portion 16 . these paths will be further discussed and illustrated below . according to the invention auxiliary coolant is utilized to condense water from the exhaust stream and thereby assist in maintaining water balance . auxiliary coolant for the auxiliary coolant flow path can be obtained from any source of sufficiently cool fluid , for example , from an air conditioning unit of a vehicle and the like . in the embodiment of fig1 primary portion 14 is a substantially rectangular - shaped member having a top surface 20 , a bottom surface 22 , two long sides and two short sides . in this embodiment , auxiliary coolant portion 16 is defined extending from one of the short sides in one dimension only , which is shown as the length or l dimension . thus , auxiliary coolant portion 16 advantageously increases only the length of cell stack assembly 10 , and not the height or width . the plates of cell stack assembly 10 , as will be discussed below , define a fuel flow path as shown by arrow f , and a primary air flow path as shown by arrow a . air enters air inlet manifold 12 , and flows through the primary air flow path in primary portion 14 to air manifold 18 . from air manifold 18 , air flows to auxiliary coolant portion 16 and eventually exits cell stack assembly 10 . main coolant is fed through the main coolant path , a portion of which is shown in fig1 at reference number 15 , and the remainder of which is schematically illustrated by arrows 17 , to cool primary portion 14 . in addition , auxiliary coolant is fed to an auxiliary coolant path , a portion of which is shown in fig1 at reference number 19 , and the remainder of which is schematically illustrated by arrow 21 , so as to further cool air in auxiliary coolant portion 16 and thereby condense water in the air and assist in maintaining cell stack assembly 10 in water balance . this is particularly desirable when cell stack assembly 10 is being used in an environment where the air or oxidant source is ambient air at a high temperature which typically makes maintaining the water balance difficult . cell stack assembly 10 in accordance with the present invention advantageously provides for additional cooling of the at least partially saturated exhaust stream or air flow coming from primary portion 14 so as to condense water in this flow and assist in recovery of same . turning to fig2 an alternative embodiment is shown of a cell stack assembly 10 ′ wherein adjacent plates ( fig4 ), which will be described below , define a primary portion 24 and an auxiliary coolant portion 26 as shown . in this embodiment , as in the embodiment of fig1 the plates define a substantially rectangular structure having a top surface 28 and a bottom surface 30 , and primary portion 24 is defined in an upper portion of cell stack assembly 10 ′, while auxiliary coolant portion 26 is defined in a lower portion thereof . cell stack assembly 10 ′, as in the embodiment of fig1 also includes an air inlet manifold 32 and an air outlet manifold 34 . the plates of cell stack assembly 10 ′ define a fuel flow passage in primary portion 24 as shown by arrow f , and an air flow path in primary portion 14 as shown by arrow a . the air flow path continues from primary portion 24 through auxiliary portion 26 and into air outlet manifold 34 as desired . in the embodiment of fig2 the cell stack plates also define a main coolant flow path a portion of which is shown at 35 with the remainder illustrated schematically by arrows 37 for cooling primary portion 24 as desired . further , the cell stack plates also define an auxiliary coolant flow path a portion of which is shown at 39 with the remainder being schematically illustrated by arrows 41 . the main and auxiliary coolant inlets and outlets are shown in fig2 . it should be appreciated that in the embodiment of fig1 the main coolant flow travels the length of primary portion 14 only , while the auxiliary coolant flow travels the length of auxiliary cooling portion 16 . in the embodiment of fig2 both coolant flow paths travel the entire length of the assembly . turning to fig3 a plate 40 is shown having structure which would be used for defining cell stack assembly 10 of the embodiment of fig1 . as shown , plate 40 is a substantially planar member having oppositely facing flat sides 42 , 44 . plates 40 are provided with through passages 46 and / or internal grooves or passages 48 which define a particular coolant flow path , and exterior grooves ( not shown ) for the fuel and air flow paths , which are needed for a functional cell stack assembly . adjacent plates in this embodiment would also be provided having through passages 46 which collectively form portions 15 , 19 of the coolant flow paths of fig1 . external grooves ( not shown ) in such plates would alternatively be positioned so as to define the desired air flow paths from top surfaces to bottom surfaces , and fuel flow paths from side to side . in this manner , each plate 40 serves as a cell separator plate , and has , typically , air flow paths defined on one side , fuel flow paths defined on the other , and an internal coolant flow path defined by internal passages 48 . in this embodiment , coolant would flow in through one series of lined up through passages 46 , to an end plate of primary portion 14 , which is illustrated by a divider 50 in fig1 and then would return to the main coolant outlet through the other series of through passages 46 , with peripheral coolant flow traveling through grooves 48 which peripheral flow is schematically illustrated in fig1 at arrows 17 , 21 . plate 40 is also illustrative of the plates used to define auxiliary coolant portion 16 , wherein through passages 46 define the main auxiliary coolant flow path , with internal channels positioned therebetween for peripheral auxiliary coolant flow , and with these plates also having external grooves for defining the auxiliary air flow path as desired . in this portion 16 of cell stack assembly 10 , ( still referring also to fig1 ), no fuel flow is desirable , and therefore plates in auxiliary coolant portion 16 do not define a fuel flow path . turning to fig4 a typical plate 60 which would be used to define cell stack assembly 10 ′ in accordance with the present invention is further illustrated . as shown , plate 60 also has substantially flat sides 62 , 64 . each plate 60 has a first portion 66 having through passages 68 and interior coolant passages or grooves 70 . plate 60 defines the primary air and fuel paths as desired with external grooves on sides 62 , 64 ( not shown ) as described above . plates 60 further have a second portion 72 also having through passages 74 and interior grooves or passages 76 defining auxiliary coolant flow paths . in fig4 a side 62 is illustrated wherein through passages 68 and internal passages or grooves 70 define portions 35 and 37 respectively of the primary coolant path , and through passages 74 and internal passages or grooves 76 define the auxiliary coolant path in similar fashion . as with the embodiment of fig1 and 3 , in this embodiment additional plates 60 would be provided having different groove structures for defining the air , fuel , and coolant flow paths . grooves defining the air flow paths would preferably travel along a side of the plate from a top surface 78 of plate 60 to a bottom surface 80 of plate 60 , and the portion of such air flow grooves corresponding to the primary coolant passages would constitute the primary air flow passage , which extends from top surface 78 . the portion of such air flow grooves defining the air flow passage which corresponds to second portion 72 , or the auxiliary coolant flow passage , would constitute the auxiliary air flow passage and would extend to bottom surface 80 . further , plates 60 would be provided having external grooves arranged to define the fuel flow passages which would preferably travel from one side 81 to the other side 83 of plate 60 , along a flat side 62 , 64 , but only in first portion 66 corresponding to the primary air and coolant flow paths . in this embodiment as well , it should be appreciated that cell stack assembly 10 ′ includes an auxiliary coolant assisted water recovery device which is incorporated into the substantially rectangular - shape of the cell stack - assembly and which increases the size of the cell stack assembly in only one dimension in this case height h ( fig2 ). further , and advantageously , this embodiment likewise provides such structure and function without additional external devices or ducting and the like . it should also be appreciated that the flow paths as illustrated in fig1 and 3 are exemplary of a preferred embodiment of the flow paths for coolant , air and fuel and such paths can be varied to include , for example , multiple flow paths using various turn manifolds as is known in the art . it should also be understood that the cell configuration , while shown to be rectangular , may be configured in any number of other shapes such as square , circular or others , as may be desired for a particular application . in connection with the embodiment of fig1 and 3 , a particular advantage is that air manifold 18 allows for selective venting of at least partially saturated air or exhaust stream , or feed of this stream to auxiliary coolant portion 16 , as desired depending upon the operating conditions . as set forth above , ambient air is typically used as oxidant source for cell stack assemblies such as those described in the present invention , and in some instances , for example when ambient air temperature is sufficiently low , auxiliary cooling and water recovery will not be needed . thus , this auxiliary cooling capacity can be reserved for when actually needed so as to preserve efficiency of operation of cell stack assembly 10 in accordance with the present invention . the auxiliary coolant for use in accordance with the present invention may be from any suitable coolant source , and any flowable fluid having a temperature less than the temperature of the at least partially saturated air exhaust stream may be suitable . one excellent source of coolant material is from an associated air - conditioning unit or the like , which provides a readily available supply of coolant at the desired temperature . of course , other sources of coolant are acceptable and well within the scope of the present invention . it should also be noted that the embodiments of fig1 and 2 will both provide excellent benefits in connection with either hydrogen or reformate fuel cells , and the embodiment of fig1 is particularly well suited to embodiments wherein reformate is the fuel source since , in such devices , it is frequently desirable to treat exhaust from the fuel or anode flow path as well , and such exhaust can readily be treated through burners and recycle loops and the like and then fed to air manifold 18 to combine for treatment in auxiliary coolant portion 16 as desired . in either embodiment , one particular advantage is the provision of auxiliary coolant capability which serves to enhance water recovery from wet or at least partially saturated exhaust streams from the fuel cell , which advantageously allows for broadening of operating parameters of the fuel cell into higher - temperature conditions , without the addition of external components and ducting , and with minimal increase in size and weight , if any , of the fuel cell as desired . in the embodiments of fig1 and 2 , the primary cell stack portion is , of course , a three - dimensional structure , and the auxiliary coolant stack portion extends from each of these structures in a single dimension , which is desirable from the standpoint of minimizing size of the device . this provision of auxiliary coolant for additional water recovery advantageously results in an increase in size , if any , being in less than or equal to one dimension , and this is particularly advantageous in accordance with the present invention . it is to be understood that the invention is not limited to the illustrations described and shown herein , which are deemed to be merely illustrative of the best modes of carrying out the invention , and which are susceptible of modification of form , size , arrangement of parts and details of operation . the invention rather is intended to encompass all such modifications which are within its spirit and scope as defined by the claims . | 7 |
fig1 shows a pump arrangement 1 in the form of a magnetic clutch pump arrangement . the pump arrangement 1 has a multi - part pump casing 2 of a centrifugal pump , which pump casing comprises a hydraulics casing 3 in the form of a spiral casing , a casing cover 4 , a bearing carrier cage 5 , a bearing carrier 6 and a bearing cover 7 . the hydraulics casing 3 has an inlet opening 8 for the intake of a delivery medium and has an outlet opening 9 for the discharge of the delivery medium . the casing cover 4 is arranged on that side of the hydraulics casing 3 which is situated opposite the inlet opening 8 . the bearing carrier cage 5 is fastened to that side of the casing cover 4 which is opposite from the hydraulics casing 3 . the bearing carrier 6 is mounted on that side of the bearing carrier cage 5 which is situated opposite the casing cover 4 . the bearing cover 7 in turn is fastened to that side of the bearing carrier 6 which is opposite from the bearing carrier cage 5 . a containment can 10 , preferably produced by deep drawing or by casting , is fastened to that side of the casing cover 4 which is opposite from the hydraulics casing 3 , and said containment can extends at least partially through an interior space 11 delimited by the pump casing 2 , in particular by the casing cover 4 , by the bearing carrier cage 5 and by the bearing carrier 6 . the containment can 10 hermetically seals off a chamber 12 , which is enclosed by said containment can , with respect to the interior space 11 . an impeller shaft 13 which is rotatable about an axis of rotation a extends from a flow chamber 14 , which is delimited by the hydraulics casing 3 and by the casing cover 4 , into the chamber 12 through an opening 15 provided in the casing cover 4 . an impeller 16 is fastened to a shaft end , situated within the flow chamber 14 , of the impeller shaft 13 , and an inner rotor 17 arranged within the chamber 12 is arranged on the opposite shaft end , which has two shaft sections 13 a , 13 b with increasing diameters in each case . the inner rotor 17 is equipped with multiple magnets 18 which are arranged on that side of the inner rotor 17 which faces toward the containment can 10 . between the impeller 16 and the inner rotor 17 there is arranged a bearing arrangement 19 which is operatively connected to the impeller shaft 13 , which can be driven in rotation about the axis of rotation a . a drive motor , preferably an electric motor , which is not illustrated drives a drive shaft 20 . the drive shaft 20 , which can be driven rotatably about the axis of rotation a , is arranged substantially coaxially with the impeller shaft 13 . the drive shaft 20 extends through the bearing cover 7 and through the bearing carrier 6 and is mounted in two ball bearings 21 , 22 which are accommodated in the bearing carrier 6 . on the free end of the drive shaft 20 there is arranged an outer rotor 24 , which bears multiple magnets 23 . the magnets 23 are arranged on that side of the outer rotor 24 which faces toward the containment can 10 . the outer rotor 24 extends at least partially over the containment can 10 and interacts with the inner rotor 17 such that the rotating outer rotor 24 , by way of magnetic forces , sets the inner rotor 17 and thus likewise the impeller shaft 13 and the impeller 16 in rotation . the containment can 10 , illustrated on an enlarged scale in fig2 and 3 , has a substantially cylindrical main body 25 with a central longitudinal axis b arranged substantially coaxially with respect to the axis of rotation a as per fig1 . the main body 25 is open on one side , and is closed by way of a domed base 28 on the side situated opposite the open side . on the open side , there is arranged a ring - like attachment flange 27 which is formed integrally with the main body 25 or which is connected to the latter by welding or other suitable fastening means or devices , for example screws , rivets or the like . the attachment flange 27 has multiple bores 28 which extend parallel to the central longitudinal axis b and through which screws ( not shown ) can be passed and screwed into corresponding threaded bores in the casing cover 4 as per fig1 . the base 26 is formed by a substantially spherical — segment - shaped spherical cap region 29 and an outer rim region 30 which forms the transition region between main body 25 and spherical cap region 29 . in the spherical cap region 29 there are provided multiple beads 31 which project into the chamber 12 and which have a bead base 32 and a bead wall 33 . the beads 31 have a bead inner edge 31 a , arranged close to the central longitudinal axis b , and a bead inner edge 31 b , arranged remote from the central longitudinal axis b . the chamber 12 has the greatest axial extent close to the central longitudinal axis b , wherein the ratio of inner radius r is of the containment can 10 to spacing a sa of bead outer edge 31 b and central longitudinal axis b of the containment can 10 lies in a range from 1 . 3 to 1 . 6 , and preferably in a range from 1 . 38 to 1 . 57 . the spacing a si of the bead inner edge 31 a to the central longitudinal axis b of the containment can 10 is defined by the formula 1 / 7 * containment can inner radius y , wherein y preferably lies in a range from approximately 1 . 14 to 1 . 17 . the containment can 10 is produced by deep drawing or by casting , wherein at least one bead 31 is produced in the base 26 , which bead is arranged with a radial spacing to the central longitudinal axis b of the containment can 10 . in the case of a containment can 10 produced by deep drawing , the beads 31 are stamped into the base 26 during the deep drawing process . the beads 31 , which are arranged with a radial spacing to the central longitudinal axis b of the containment can 10 , extend in a radial direction to a point close to the rim region 30 , or even extend as far as the latter . as can be seen from fig2 , the bead base 32 runs in a plane which is situated substantially parallel to the plane which corresponds to the transition from the spherical cap region 29 to the rim region 30 . in particular , the inner wall 34 of the containment can 10 in the region of the bead base 32 lies substantially in the same imaginary plane , perpendicular to the central longitudinal axis b , as the transition from the spherical cap region 29 to the rim region 30 . alternatively , as shown in fig4 , the bead base 32 of the containment can 10 may be formed so as to run parallel to the spherical cap region 29 . here , a part of the bead base 32 extends as far as a plane which runs perpendicular to the central longitudinal axis b and which lies in the rim region 30 . as illustrated in fig1 , in the region of the bead base 32 , the maximum spacing x of the inner wall 34 of the containment can 10 to a face side 35 , facing toward the base 26 of the containment can 10 , of the inner rotor 17 is approximately 20 mm . it is preferably the case that , in the region of the bead base 32 , the maximum spacing x of the inner wall 34 of the containment can 10 to the face side 35 of the inner rotor 17 is approximately 10 mm . the transitions between the spherical cap region 29 and the bead walls 33 have greater radii than the transitions from the bead walls 33 to the respective bead base 32 . the beads 31 illustrated in fig1 to 4 have a substantially stadium - shaped geometry . alternatively , said beads may have any other desired geometry . the beads 31 may for example be of prism - shaped , cuboidal or spherical form or may be formed from similar truncated geometries or combinations thereof or may , as shown in fig5 , have a bead base 32 which is domed in the direction of the inner rotor . the foregoing disclosure has been set forth merely to illustrate the invention and is not intended to be limiting . since modifications of the disclosed embodiments incorporating the spirit and substance of the invention may occur to persons skilled in the art , the invention should be construed to include everything within the scope of the appended claims and equivalents thereof . a sa spacing between bead outer edge and central longitudinal axis a si spacing between bead inner edge and central longitudinal axis | 5 |
discussing the apparatus which has been illustrated in an exemplary embodiment of fig1 it will be seen that a methanol fuel supply is stored in a tank 3 and circulated by a pump 4 through conduit means to a first section of a heat exchanger 2 . an inlet valve 5 is located in the conduit means to control the methanol flow . the first section of the heat exchanger accommodates a catalyst whose presence makes the cracking of methanol feasible . this catalyst is preferably composed of reduced copper and nickel in a ratio from about 2 . 5 : 1 to about 4 . 0 : 1 and supported on an inert carrier as fully disclosed in u . s . pat . no . 2 , 010 , 427 . after the methanol has been cracked into its constituent parts , hydrogen gas and carbon monoxide , the cracked - methanol is conveyed via the fuel feed system 7 to a fuel - combusting device 6 where it joins with air supplied from the air supply vent 19 to support combustion in the fuel - combusting device 6 . the hydrogen gas and carbon monoxide serve as the primary fuel to power the fuel - combusting device 6 , thereby producing heated combustion gases of carbon dioxide , unburnt carbon monoxide , nitric oxides , nitrogen , unburnt hydrogen and steam or water exhausted to the catalytic converter 9 through the exhaust outlet 1 . a second bypass conduit taps off the main fuel feed sytem 7 and conveys a portion of the hydrogen gas constituent of the cracked - methanol to the exhaust outlet 1 by means of a regulator valve 8 and a hydrogen - permeable membrane 24 . the hydrogen permeable membrane 24 , which can be chemically composed of palladium or silver - palladium as disclosed in u . s . pat . no . 2 , 773 , 561 , or alternatively constructed of a steel membrane operating by means of diffusion , effectively bars the entry of the carbon monoxide constituent of the cracked - methanol and only allows hydrogen gas to enter the exhaust outlet 1 , so as to create a reduction atmosphere inside the catalytic converter 9 . the principle also functions without using the membrane 24 . the catalytic converter 9 cooperating with the presence of the hydrogen and carbon monoxide mixture or a hydrogen atmosphere alone reduces the nitric oxides to heated inert gases by accommodating a catalyst therein which is known to the prior art as disclosed in the 1973 foreign german publication entitled &# 34 ; katalysatoren zur reinigung von autoabgasen &# 34 ;, weigert , koberstein , and lakatos , and published in chemiker - zeitung , 97 , jahrgang , nr . 9 , and is preferably a metal selected from the group of noble or precious metals such as platinum or palladium , or selected from the group of non - precious metals . the heated inert gases are thereupon conveyed to a second section of the heat exchange 2 , so that an exchanger of heat will occur with the first section to make cracking possible ; and thereupon , the inert gases are discharged to the outside atmosphere via the exhaust conduit 22 . the cracking process is well known in the art and takes place at a cracking temperature from about 260 ° to about 345 ° c . the cracking process is more than 97 % efficient , and can be best summarized by the chemical equation : a sensing element 11 to detect the presence of carbon monoxide and a sensing element 12 to detect the presence of nitric oxides is located downstream of the flow of the inert gases . both sensing elements cooperate with a controller 13 which in turn cooperates with the regulator valve 8 , and then in turn with the inlet valve 5 along the line of application 23 . if carbon monoxide and / or nitric oxides are detected prior to discharge to the outside atmosphere , the regulator valve 8 will open to allow an increased flow of cracked - methanol to flow towards the hydrogen - permeable membrane 24 , so as to increase the effectiveness of the hydrogen - reduction atmosphere by increasing the quantity of hydrogen . the principle also functions without using the membrane 24 . in addition , the inlet valve 5 will be concurrently opened to increase the flow of methanol , so that additional cracking occurs . sensing elements 11 and 12 are entirely conventional and are believed not to require any detailed discussion . for example , sensing element 11 may be constituted by an analyzer known commercially as a &# 34 ; model 315a beckman infrared analyzer &# 34 ;; and sensing element 12 may be constituted by an analyzer known commercially as &# 34 ; dynasciences corporation model nx 130 air pollution monitor .&# 34 ; in fig2 a preferred embodiment of the features illustrated . in addition to having all of the features mentioned above for the exemplary embodiment of fig1 it has the following additional features . reference numeral 10 is a heater unit having at least two sections , each of which is in heat exchanging relationship with the other . reference numeral 17 is a compressor which is powered by the motor - generator 18 along a common shaft 16 . air enters through the air supply vent 19 into the compressor 17 to be compressed , and thereupon is conveyed to one of the sections of the heater unit 10 . the other section of the heater unit surrounds a path for the heated combustion gases to pass through , thus allowing a heat exchange with the first section . the compressed and heated air may be injected into the fuel - combusting device 6 along with the cracked - methanol so as to increase the efficiency of the combustion process . in all other respects , the operation is the same as previously described for the apparatus as described for fig1 . in fig3 a further preferred embodiment has been illustrated . in addition to having all the features mentioned above for the embodiments of fig1 and fig2 it has the following additional features . reference numeral 6 is generically a fuel - combusting device , but more specifically a rotary piston engine of the screw type as more fully described in u . s . pat . no . 3 , 518 , 975 . under all loading conditions of the rotary piston engine 6 , the primary fuel feed system 7 is feeding hydrogen and carbon monoxide into the engine chamber . however , for medium or higher loading conditions additional fuel is required to be supplied in a controlled manner so as to insure an isothermal combustion during the expansion cycle of the engine so that the thermodynamically advantageous ericsson process can be thus closely approached and efficiencies substantially in excess of 40 % can be obtained . accordingly , a secondary fuel feed system 21 conducts methanol from the tank 3 by means of the pump 4 to a valve 20 and thereupon to a compressor 17 which is operative by means of a motor - generator 18 along a comon shaft 16 . an air supply vent 19 mixes incoming air with the methanol . thereupon , the compressed air - methanol mixture is conducted by means of conduits to one section of a heater unit 10 . the heater unit 10 has at least two sections in heat - exchanging relationship with each other ; the second section accommodating a path for the heated combustion gases to pass through , thus allowing a heat exchange with the first section . the compressed and heated mixture of air and methanol is a combustible secondary fuel which may be squirted or injected or sprayed at appropriate time intervals in order to increase the efficiency of the rotary engine 6 by allowing isothermal combustion for a nitric oxides minimum and to take place at less tha 1500 ° c . ignition device 14 ignites the hydrogen and carbon monoxide gas and / or the compressed and heated air - methanol mixture depending upon the loading conditions . a cooling medium supply 15 cools the rotary - engine 6 and conducts excess heat away . a common shaft 16 for the motor - generator 18 , the compressor 17 , and the rotary - engine 6 may be advantageously employed . it will be understood that each of the elements described above , or two or more together , may also find a useful application in other types of constructions differing from the types described above . specifically , the fuel - combusting device 6 may be a stirling motor , or a gas turbine , or any internal or external combustion engines of the reciprocating - piston or rotary - piston type , or any burner device , or any boiler device . while the invention has been illustrated and described as embodied in the method of and apparatus for improved methanol operation of combustion systems , it is not intended to be limited to the details shown , since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention , that others can be applying current knowledge readily adapt it for various applications without omitting features that from the standpoint of prior art fairly constitute essential characteristics of the generic or specific aspects of this invention . | 8 |
reference will now be made in detail to embodiments , examples of which are illustrated in the accompanying drawings . in the following detailed description , numerous non - limiting specific details are set forth in order to assist in understanding the subject matter presented herein . it will be apparent , however , to one of ordinary skill in the art that various alternatives may be used without departing from the scope of the present invention and the subject matter may be practiced without these specific details . for example , it will be apparent to one of ordinary skill in the art that the subject matter presented herein can be implemented on any type of all outdoor radios link aggregation system using a wireless channel . fig2 illustrates an exemplary embodiment of an all outdoor radios link aggregation system using a wireless channel operating at a license - free 60 ghz band in accordance with the present invention . in the exemplary embodiment 300 a , the all outdoor radios link aggregation system may include a first radio unit 301 a and at least a second radio unit 302 a . the first radio unit 301 a may include a first rear - end transceiver 304 a , a first rear - end modem 305 a , a first digital data interface 306 a , a first wireless controller 307 a , a first front - end modem 308 a , a first front - end transceiver 309 a , and a first 60 ghz antenna 310 a . the second radio unit 302 a may include a second rear - end transceiver 311 a , a second rear - end modem 312 a , a second digital data interface 313 a , a second wireless controller 314 a , a second front - end modem 315 a , a second front - end transceiver 316 a , a second 60 ghz antenna 317 a . an upstream user data 318 a may be received at the first digital data interface 306 a . the first digital data interface 306 a may split the upstream user data 318 a into at least a first sub - stream digital data 319 a and a second sub - stream digital data 320 a . the first sub - stream digital data 319 a may be transmitted through the first rear - end modem 305 a and the first rear - end transceiver 304 a . the second sub - stream digital data 320 a may be transmitted to the first wireless controller 307 a . the first wireless controller 307 a may encapsulate the second sub - stream digital data 320 a into a second sub - stream data packet 321 a addressed to a first destination radio unit . the first front - end modem 308 a may convert the second sub - stream data packet 321 a into a first downstream data intermediate frequency ( if ) signal 322 a . the first front - end transceiver 309 a may convert the first downstream data if signal 322 a into a first 60 ghz radio frequency ( rf ) signal 323 a , and amplify the first 60 ghz rf signal 323 a . the first 60 ghz antenna 310 a may transmit the first 60 ghz rf signal 323 a . the second 60 ghz antenna 317 a may receive the first 60 ghz rf signal 323 a . the second front - end transceiver 316 a in the second radio unit 302 a may amplify the first 60 ghz rf signal 323 a , and convert the first 60 ghz rf signal 323 a into a second upstream data if signal 324 a . the second front - end modem 315 a may convert the second upstream data if signal 324 a into a second upstream data packet 325 a . the second wireless controller 314 a may decapsulate the second upstream data packet 325 a , accept the second upstream data packet 325 a if the second radio unit 302 a is the addressed first destination radio unit , and convert the second upstream data packet 325 a into a second upstream digital data 326 a . the second digital data interface 313 a may receive the second upstream digital data 326 a , and transmit the second upstream digital data 326 a through the second rear - end modem 312 a and the second rear - end transceiver 311 a . fig3 illustrates another exemplary embodiment of an all outdoor radios link aggregation system using a wireless channel operating at a license - free 60 ghz band in accordance with the present invention . in the exemplary embodiment 400 a , the all outdoor radios link aggregation system may include a first radio unit 401 a and at least a second radio unit 402 a . the first radio unit 401 a may include a first rear - end transceiver 404 a , a first rear - end modem 405 a , a first digital data interface 406 a , a first wireless controller 407 a , a first front - end modem 408 a , a first front - end transceiver 409 a , and a first 60 ghz antenna 410 a . the second radio unit 402 a may include a second rear - end transceiver 411 a , a second rear - end modem 412 a , a second digital data interface 413 a , a second wireless controller 414 a , a second front - end modem 415 a , a second front - end transceiver 416 a , and a second 60 ghz antenna 417 a . the first digital data interface 406 a may be further configured to receive a third sub - stream digital data 419 a . the second digital data interface 413 a in the second radio unit 402 a may be further configured to receive a fourth sub - stream digital data 427 a . the second wireless controller 414 a may be further configured to encapsulate the fourth sub - stream digital data 426 a from the second digital data interface 413 a into a fourth sub - stream data packet 425 a addressed to a second destination radio unit . the second front - end modem 415 a may be further configured to convert the fourth sub - stream data packet 425 a into a second downstream data if signal 424 a . the second front - end transceiver 416 a may be further configured to convert the second downstream data if signal 424 a into a second 60 ghz radio rf signal 423 a , and amplify the second 60 ghz rf signal 423 a . the second 60 ghz antenna 417 a may be further configured to transmit the second 60 ghz rf signal 423 a . the first 60 ghz antenna 410 a may be further configured to receive the second 60 ghz rf signal 423 a . the first front - end transceiver 409 a may be further configured to amplify the second 60 ghz rf signal 423 a , and convert the second 60 ghz rf signal 423 a into a first upstream data if signal 422 a . the first front - end modem 408 a may be further configured to convert the first upstream data if signal 422 a into a first upstream data packet 421 a . the first wireless controller 407 a may be further configured to decapsulate the first upstream data packet 421 a , accept the first upstream data packet 421 a if the first radio unit 401 a is the addressed second destination radio unit , and convert the first upstream data packet 421 a into a first upstream digital data 420 a . the first digital data interface 406 a may be further configured to receive the first upstream digital data 420 a , aggregate the first upstream digital data 420 a and the third sub - stream digital data 419 a , reconstruct a first downstream user data 418 a , and transmit the first downstream user data 418 a . in some embodiment , the first sub - stream digital data is configured with a data rate equal to or less than the throughput of the first radio unit and the second sub - stream digital data is configured with a data rate equal to or less than the throughput of the second radio unit . in some embodiment , the third sub - stream digital data is configured with a data rate equal to or less than the throughput of the first radio unit and the fourth sub - stream digital data is configured with a data rate equal to or less than the throughput of the second radio unit . in some embodiment , the first radio unit and the second radio unit are configured to connect to an acu 304 a or 404 a . fig4 illustrates an exemplary method of an all outdoor radios link aggregation system using a wireless channel operating at a license - free 60 ghz band in accordance with the present invention . the method includes : step 501 a for receiving an upstream user data at a first digital data interface of a first radio unit ; step 502 a for splitting the upstream user data into at least a first sub - stream digital data and a second sub - stream digital data at the first digital data interface ; step 503 a for transmitting the first sub - stream digital data through a first rear - end modem and a first rear - end transceiver of the first radio unit ; step 504 a for transmitting the second sub - stream digital data to a first wireless controller of the first radio unit ; step 505 a for encapsulating the second sub - stream digital data into a second sub - stream data packet addressed to a first destination radio unit at the first wireless controller , and transmitting the second sub - stream data packet to a first front - end modem of the first radio unit ; step 506 a for converting the second sub - stream data packet into a first downstream data intermediate frequency ( if ) signal at the first front - end modem , and transmitting the first downstream data if signal to a first front - end transceiver of the first radio unit ; step 507 a for converting the first downstream data if signal into a first 60 ghz radio frequency ( rf ) signal , and amplifying the first 60 ghz rf signal at the first front - end transceiver ; step 508 a for transmitting the first 60 ghz rf signal at a first 60 ghz antenna of the first radio unit ; step 509 a for receiving the first 60 ghz rf signal at a second 60 ghz antenna of a second radio unit ; step 510 a for amplifying the first 60 ghz rf signal , and converting the first 60 ghz rf signal into a second upstream data if signal at a second front - end transceiver of the second radio unit , and transmitting the second upstream data if signal to a second front - end modem of the second radio unit ; step 511 a for converting the second upstream data if signal into a second upstream data packet , and transmitting the second upstream data packet to a second wireless controller of the second radio unit ; step 512 a for decapsulating the second upstream data packet at the second wireless controller , accepting the second upstream data packet if the second radio unit is the addressed first destination radio unit , and converting the second upstream data packet into a second upstream digital data ; step 513 a for transmitting the second upstream digital data to a second digital data interface of the second radio unit ; and step 514 a for transmitting the second upstream digital data through a second rear - end modem and a second rear - end transceiver of the second radio unit . fig5 illustrates another exemplary method of an all outdoor radios link aggregation system using a wireless channel operating at a license - free 60 ghz band in accordance with the present invention . the method includes : step 601 a for receiving at least a third sub - stream digital data at the first digital data interface and a fourth sub - stream digital data at the second digital data interface ; step 602 a for transmitting the fourth sub - stream digital data to the second wireless controller ; step 603 a for encapsulating the fourth sub - stream digital data into a fourth sub - stream data packet addressed to a second destination radio unit at the second wireless controller , and transmitting the fourth sub - stream data packet to the second front - end modem ; step 604 a for converting the fourth sub - stream data packet into a second downstream data if signal at the second front - end modem , and transmitting the second downstream data if signal to the second front - end transceiver ; step 605 a for converting the second downstream data if signal into a second 60 ghz radio rf signal , and amplifying the second 60 ghz rf signal at the second front - end transceiver ; step 606 a for transmitting the second 60 ghz rf signal at the second 60 ghz antenna ; step 607 a for receiving the second 60 ghz rf signal at the first 60 ghz antenna ; step 608 a for amplifying the second 60 ghz rf signal , and converting the second 60 ghz rf signal into a first upstream data if signal at the first front - end transceiver , and transmitting the first upstream data if signal to the first front - end modem ; step 609 a for converting the first upstream data if signal into a first upstream data packet , and transmitting the first upstream data packet to the first wireless controller ; step 610 a for decapsulating the first upstream data packet , accepting the first upstream data packet if the first radio unit is the addressed second destination radio unit , and converting the first upstream data packet into a first upstream digital data ; step 611 a for transmitting the first upstream digital data to the first digital data interface ; and step 612 a for aggregating the first upstream digital data and the third sub - stream digital data , reconstructing a first downstream user data , and transmitting the first downstream user data . fig6 illustrates an exemplary embodiment 200 b of an all outdoor radios protection system using a wireless channel operating at a license - free 60 ghz band in accordance with some embodiments of the present invention . in the exemplary embodiment 200 b , the all outdoor radios protection system may include a first radio unit 201 b and a second radio unit 202 b . the first radio unit 201 b may include a first protection interface 203 b , a first modulator / demodulator unit 204 b , a first transceiver 205 b , and a first antenna 206 b . the second radio unit 202 b may include a second protection interface 207 b , a second modulator / demodulator unit 208 b , a second transceiver 209 b , and a second antenna 210 b . a first downstream protection digital data 211 b may be received at the first protection interface 203 b , and transmitted to the first modulator / demodulator unit 204 b . the first modulator / demodulator unit 204 b may convert the first downstream protection digital data 211 b into a first downstream protection intermediate frequency ( if ) signal 212 b , and transmit the first downstream protection if signal 212 b to the first transceiver 205 b . the first transceiver 205 b may convert the first downstream protection if signal 212 b into a first 60 ghz radio frequency ( rf ) signal 213 b , and amplifies the first 60 ghz rf signal 213 b . the amplified first 60 ghz rf signal 213 b may be transmitted to a first antenna 206 b connected to the first transceiver 205 b . in some embodiment , the first antenna 206 b may transmit the first 60 ghz rf signal 213 b to the second antenna 210 b . the second antenna 210 b may transmit the received first 60 ghz rf signal 213 b to the second transceiver 209 b . the second transceiver 209 b may amplify the received first 60 ghz rf signal 213 b , and convert the received first 60 ghz rf signal 213 b into a second upstream protection if signal 214 b . the second upstream protection if signal 214 b may be transmitted to the second modulator / demodulator unit 208 b . the second modulator / demodulator unit 208 b may convert the second upstream protection if signal 214 b into a second upstream protection digital data 215 b . the second upstream protection digital data 215 b may be received at the second protection interface 207 b . in some embodiment , the first antenna 206 b and the second antenna 210 b are configured to operate at the license - free 60 ghz band . in some embodiment , the first radio unit 201 b and the second radio unit 202 b are configured to operate at a space diversity manner . in another embodiment , the first radio unit 201 b and the second radio unit 202 b are configured to operate at a frequency diversity manner . in yet another embodiment , the first radio unit 201 b and the second radio unit 202 b are configured to operate at a hybrid diversity manner . fig7 illustrates another exemplary embodiment 300 b of an all outdoor radios protection system using a wireless channel operating at a license - free 60 ghz band in accordance with some embodiments of the present invention . in the exemplary embodiment 300 b , the all outdoor radios protection system may include a first radio unit 301 b and a second radio unit 302 b . the first radio unit 301 b may include a first protection interface 303 b , a first modulator / demodulator unit 304 b , a first transceiver 305 b , and a first antenna 306 b . the second radio unit 302 b may include a second protection interface 307 b , a second modulator / demodulator unit 308 b , a second transceiver 309 b , and a second antenna 310 b . a second downstream protection digital data 31 lb may be received at the second protection interface 307 b , and transmitted to the second modulator / demodulator unit 308 b . the second modulator / demodulator unit 308 b may convert the second downstream protection digital data 311 b into a second downstream protection intermediate frequency ( if ) signal 312 b , and transmit the second downstream protection if signal 312 b to the second transceiver 309 b . the second transceiver 309 b may convert the second downstream protection if signal 312 b into a second 60 ghz radio frequency ( rf ) signal 313 b , and amplifies the second 60 ghz rf signal 313 b . the amplified second 60 ghz rf signal 313 b may be transmitted to a second antenna 310 b connected to the second transceiver 309 b . in some embodiment , the second antenna 310 b may transmit the second 60 ghz rf signal 313 b to the first antenna 306 b . the first antenna 306 b may transmit the received second 60 ghz rf signal 313 b to the first transceiver 305 b . the first transceiver 305 b may amplify the received second 60 ghz rf signal 313 b , and convert the received second 60 ghz rf signal 313 b into a first upstream protection if signal 315 b . the first upstream protection if signal 314 b may be transmitted to the first modulator / demodulator unit 304 b . the first modulator / demodulator unit 304 b may convert the first upstream protection if signal 314 b into a first upstream protection digital data 315 b . the first upstream protection digital data 315 b may be received at the first protection interface 303 b . in some embodiment , the first antenna 306 b and the second antenna 310 b are configured to operate at the license - free 60 ghz band . in some embodiment , the first radio unit 301 b and the second radio unit 302 b are configured to operate at a space diversity manner . in another embodiment , the first radio unit 301 b and the second radio unit 302 b are configured to operate at a frequency diversity manner . in yet another embodiment , the first radio unit 301 b and the second radio unit 302 b are configured to operate at a hybrid diversity manner . fig8 illustrates an exemplary method of an all outdoor radios protection system using a wireless channel operating at a license - free 60 ghz band in accordance with some embodiments of the present invention . the method includes : step 401 b for receiving a first downstream protection digital signal 211 b at a first protection interface 203 b of a first radio unit 201 b , step 402 b for converting the first downstream protection digital signal 211 b into a first downstream protection intermediate frequency ( if ) signal 212 b at a first modulator / demodulator unit 204 b of the first radio unit 201 b , step 403 b for converting the first downstream protection if signal 212 b into a first 60 ghz radio frequency ( rf ) signal 213 b , and amplifying the first 60 ghz rf signal 213 b at a first transceiver 205 b of the first radio unit 201 b , step 404 b for transmitting the first 60 ghz rf signal 213 b at a first antenna 206 b of the first radio unit 201 b , step 405 for receiving the first 60 ghz rf signal 213 b at a second antenna 210 b of a second radio unit 202 b , step 406 b for amplifying the first 60 ghz rf signal 213 b , and converting the first 60 ghz rf signal 213 b into a second upstream protection if signal 214 b at a second transceiver 209 b of the second radio unit 202 b , step 407 b for converting the second upstream protection if signal 214 b into a second upstream protection digital data 215 b at a second modulator / demodulator unit 208 b of the second radio unit 202 b , step 408 b for receiving the second upstream protection digital data 215 b at a second protection interface 207 b of the second radio unit 202 b . fig9 illustrates another exemplary method of an all outdoor radios protection system using a wireless channel operating at a license - free 60 ghz band in accordance with some embodiments of the present invention . the method includes : step 501 b for receiving a second downstream protection digital signal 311 b at the second protection interface 307 b , step 502 b for converting the second downstream protection digital signal 311 b into a second downstream protection intermediate frequency ( if ) signal 312 b at the second modulator / demodulator unit 308 b , step 503 b for converting the second downstream protection if signal 312 b into a second 60 ghz radio frequency ( rf ) signal 313 b , and amplifying the second 60 ghz rf signal 313 b at the second transceiver 309 b , step 504 b for transmitting the second 60 ghz rf signal 313 b at the second antenna 310 b , step 505 b for receiving the second 60 ghz rf signal 313 b at the first antenna 306 b , step 506 b for amplifying the second 60 ghz rf signal 313 b , and converting the second 60 ghz rf signal 313 b into a first upstream protection if signal 314 b at the first transceiver 305 b , step 507 b for converting the first upstream protection if signal 314 b into a first upstream protection digital data 315 b at the first modulator / demodulator unit 304 b , step 408 b for receiving the first upstream protection digital data 315 b at a first protection interface 303 b of the first radio unit 301 b . fig1 illustrates an exemplary embodiment of an all outdoor radios system configured with an xpic application using a wireless channel operating at a license - free 60 ghz band in accordance with the present invention . in the exemplary embodiment 300 c , the all outdoor radios system configured with an xpic application using a wireless channel operating at a license - free 60 ghz band may include a first radio unit 301 c and a second radio unit 302 c , both of which are coupled to an acu 350 c . the first radio unit 301 c may include a first duplexer 303 c , a first receiver 304 c , a first demodulator 305 c , a first transceiver 306 c , a first 60 ghz antenna 307 c , and a first digital data interface 308 c . the second radio unit 302 c may include a second duplexer 309 c , a second receiver 310 c , a second demodulator 311 c , a second transceiver 312 c , a second 60 ghz antenna 313 c , and a second digital data interface 314 c . a first downstream xpic if signal 315 c may be received at the first receiver 304 c , and transmitted to the first demodulator 305 c and the first transceiver 306 c , respectively . the first transceiver 306 c may convert the first downstream xpic if signal 315 c into a first 60 ghz rf signal 316 c , and amplify the first 60 ghz rf signal 316 c . the amplified first 60 ghz rf signal 316 c may be transmitted to a first 60 ghz antenna 307 c connected to the first transceiver 306 c . in some embodiment , the first 60 ghz antenna 307 c may transmit the first 60 ghz rf signal 316 c to the second 60 ghz antenna 313 c . the second 60 ghz antenna 313 c may transmit the received first 60 ghz rf signal 316 c to the second transceiver 312 c . the second transceiver 312 c may amplify the received first 60 ghz rf signal 316 c , and convert the received first 60 ghz rf signal 316 c into a second upstream xpic if signal 317 c . the second upstream xpic if signal 317 c may be transmitted to the second demodulator 311 c . in some embodiment , the first radio unit 301 c may use vertical polarization , and the second radio unit 302 c may use horizontal polarization . in some embodiment , the second demodulator 311 c may use the second upstream xpic if signal 317 c to cancel interference of the vertical polarization in the second downstream xpic if signal 318 c received at the second receiver 310 c . fig1 illustrates another exemplary embodiment of an all outdoor radios system configured with an xpic application using a wireless channel operating at a license - free 60 ghz band in accordance with the present invention . in the exemplary embodiment 400 c , the all outdoor radios system configured with an xpic application using a wireless channel operating at a license - free 60 ghz band may include a first radio unit 401 c and a second radio unit 402 c , both of which are coupled to an acu 450 c . the first radio unit 401 c may include a first duplexer 403 c , a first receiver 404 c , a first demodulator 405 c , a first transceiver 406 c , a first 60 ghz antenna 407 c , and a first digital data interface 408 c . the second radio unit 402 c may include a second duplexer 409 c , a second receiver 410 c , a second demodulator 411 c , a second transceiver 412 c , a second 60 ghz antenna 413 c , and a second digital data interface 414 c . a second downstream xpic if signal 415 c may be received at the second receiver 410 c , and transmitted to the second demodulator 411 c and the second transceiver 412 c , respectively . the second transceiver 412 c may convert the second downstream xpic if signal 415 c into a second 60 ghz rf signal 416 c , and amplify the second 60 ghz rf signal 416 c . the amplified second 60 ghz rf signal 416 c may be transmitted to a second 60 ghz antenna 413 c connected to the second transceiver 412 c . in some embodiment , the second 60 ghz antenna 413 c may transmit the second 60 ghz rf signal 416 c to the first 60 ghz antenna 407 c . the first 60 ghz antenna 407 c may transmit the received second 60 ghz rf signal 416 c to the first transceiver 406 c . the first transceiver 406 c may amplify the received second 60 ghz rf signal 416 c , and convert the received second 60 ghz rf signal 416 c into a first upstream xpic if signal 417 c . the first upstream xpic if signal 417 c may be transmitted to the first demodulator 405 c . in some embodiment , the first radio unit 401 c may use vertical polarization , and the second radio unit 402 c may use horizontal polarization . in some embodiment , the first demodulator 405 c may use the first upstream xpic if signal 417 c to cancel interference of the horizontal polarization in the first downstream xpic if signal 418 c received at the first receiver 404 c . fig1 illustrates an exemplary embodiment of an all outdoor radios system configured with a protection system and an xpic application using a wireless channel operating at a license - free 60 ghz band in accordance with the present invention . in the exemplary embodiment 500 c , the all outdoor radios system configured with a protection system and an xpic application using a wireless channel operating at a license - free 60 ghz band may include : a first radio unit 501 c configured to use vertical polarization , a second radio unit 502 c configured to use horizontal polarization , a third radio unit 503 c configured to use vertical polarization , and a fourth radio unit 504 c configured to use horizontal polarization . the first radio unit 501 c and the second radio unit 502 c are communicatively coupled to an acu 550 c and the third radio unit 503 c and the fourth radio unit 504 c are communicatively coupled to an acu 555 c , respectively . the first radio unit 501 c may include a first duplexer 505 c , a first receiver 506 c , a first demodulator 507 c , a first protection interface 508 c , a first wireless controller 509 c , a first modem 510 c , a first if combiner 511 c , a first if splitter 512 c , a first transceiver 513 c , and a first 60 ghz antenna 514 c . a first downstream xpic if signal 515 c and a first downstream protection if signal 516 c may be received at the first if combiner 511 c . the first if combiner 511 c may combine the first downstream xpic if signal 515 c and the first downstream protection if signal 516 c , and generate a first downstream combined if signal 519 c . the first downstream combined if signal 519 c may be transmitted to the first transceiver 513 c . the first transceiver 513 c may convert the first downstream combined if signal 519 c into a first 60 ghz rf signal 520 c , and amplify the first 60 ghz rf signal 520 c . the amplified first 60 ghz rf signal 520 c may be transmitted to a first 60 ghz antenna 514 c connected to the first transceiver 513 c . in some embodiment , a first downstream protection digital signal 517 c may be received at the first protection interface 508 c . the first downstream protection digital signal 517 c may be transmitted to the first wireless controller 509 c . the first wireless controller 509 c may encapsulate the first downstream protection digital signal 517 c into a first downstream protection digital packet 518 c , and transmit the first downstream protection digital packet 518 c to the first modem 510 c . the first modem 510 c may convert the first downstream protection digital packet 518 c into the first downstream protection if signal 516 c , and transmit the first downstream protection if signal 516 c to the first if combiner 511 c . in some embodiment , the first 60 ghz rf signal 520 c may be received at a second 60 ghz antenna 521 c of the second radio unit 502 c . the second 60 ghz antenna 521 c may transmit the received first 60 ghz rf signal 520 c to a second transceiver 522 c of the second radio unit 502 c . the second transceiver 522 c may amplify the received first 60 ghz rf signal 520 c , and convert the received first 60 ghz rf signal 520 c into a second upstream combined if signal 523 c . the second upstream combined if signal 523 c may be transmitted to a second if splitter 524 c of the second radio unit 502 c . the second if splitter 524 c may extract a second upstream xpic if signal 525 c from the second upstream combined if signal 523 c , and transmit the second upstream xpic if signal 525 c to a second demodulator 526 c of the second radio unit 502 c . the second demodulator 526 c may use the second upstream xpic if signal 525 c to cancel interference of the vertical polarization in the second downstream xpic if signal 537 c . in some embodiment , the first 60 ghz rf signal 520 c may be received at a third 60 ghz antenna 527 c of the third radio unit 503 c . the third 60 ghz antenna 527 c may transmit the received first 60 ghz rf signal 520 c to a third transceiver 528 c of the third radio unit 503 c . the third transceiver 528 c may amplify the received first 60 ghz rf signal 520 c , and convert the received first 60 ghz rf signal 520 c into a third upstream combined if signal 529 c . the third upstream combined if signal 529 c may be transmitted to a third if splitter 530 c of the third radio unit 503 c . the third if splitter 530 c may extract a third upstream protection if signal 531 c from the third upstream combined if signal 529 c . in some embodiment , the third upstream protection if signal 531 c may be transmitted to a third modem 532 c of the third radio unit 503 c . the third modem 532 c may convert the third upstream protection if signal 531 c into a third upstream protection digital packet 533 c , and transmit the third upstream protection digital packet 533 c to a third wireless controller 534 c of the third radio unit 503 c . the third wireless controller 534 c may decapsulate the third upstream protection digital packet 533 c , and convert the third upstream protection digital packet 533 c into a third upstream protection digital signal 535 c . the third upstream protection digital signal 535 c may be transmitted to a third protection interface 536 c of the third radio unit 503 c . in some embodiment , the first wireless controller 509 c of the first radio unit 501 c may encapsulate the first downstream protection digital signal 517 c into the first downstream protection digital packet 518 c addressed to a destination radio unit . the third wireless controller 534 c of the third radio unit 503 c may decapsulate the third upstream protection digital packet 533 c , accept only the upstream protection digital packet addressed to the destination radio unit that includes the third wireless controller 534 c , and convert the accepted upstream protection digital packet into the third upstream protection digital signal 535 c . in some embodiment , the first radio unit 501 c and the third radio unit 503 c may be configured to operate as a vertical polarization protection pair , and the second radio unit 502 c and the fourth radio unit 504 c may be configured to operate as a horizontal polarization protection pair . in some embodiment , the first radio unit 501 c and the second radio unit 502 c may be configured as a first xpic pair , and the third radio unit 503 c and the fourth radio unit 504 c may be configured as a second xpic pair . in some embodiment , the first downstream xpic if signal 515 c and the second downstream xpic if signal 537 c are configured to use different carrier frequencies within the license - free 60 ghz band . in some embodiment , a protection interconnection within any one of the vertical polarization protection pair and the horizontal polarization protection pair and an xpic interconnection within any one of the first xpic pair and the second xpic pair are configured to use different channels allocated within the license - free 60 ghz band . fig1 illustrates another exemplary embodiment of an all outdoor radios system configured with a protection system and an xpic application using a wireless channel operating at a license - free 60 ghz band in accordance with the present invention . in the exemplary embodiment 600 c , the all outdoor radios system configured with a protection system and an xpic application using a wireless channel operating at a license - free 60 ghz band may include : a first radio unit 601 c configured to use vertical polarization , a second radio unit 602 c configured to use horizontal polarization , a third radio unit 603 c configured to use vertical polarization , and a fourth radio unit 604 c configured to use horizontal polarization . the first radio unit 601 c and the second radio unit 602 c are communicatively coupled to an acu 650 c and the third radio unit 603 c and the fourth radio unit 604 c are communicatively coupled to an acu 655 c , respectively . the second radio unit 602 c may include a second duplexer 605 c , a second receiver 606 c , a second demodulator 607 c , a second protection interface 608 c , a second wireless controller 609 c , a second modem 610 c , a second if combiner 611 c , a second if splitter 612 c , a second transceiver 613 c , and a second 60 ghz antenna 614 c . a second downstream xpic if signal 615 c and a second downstream protection if signal 616 c may be received at the second if combiner 611 c . the second if combiner 611 c may combine the second downstream xpic if signal 615 c and the second downstream protection if signal 616 c , and generate a second downstream combined if signal 619 c . the second downstream combined if signal 619 c may be transmitted to the second transceiver 613 c . the second transceiver 613 may convert the second downstream combined if signal 619 c into a second 60 ghz rf signal 620 c , and amplify the second 60 ghz rf signal 620 c . the amplified second 60 ghz rf signal 620 c may be transmitted to a second 60 ghz antenna 614 c connected to the second transceiver 613 c . in some embodiment , a second downstream protection digital signal 617 c may be received at the second protection interface 608 c . the second downstream protection digital signal 617 c may be transmitted to the second wireless controller 609 c . the second wireless controller 609 c may encapsulate the second downstream protection digital signal 617 c into a second downstream protection digital packet 618 c , and transmit the second downstream protection digital packet 618 c to the second modem 610 c . the second modem 610 c may convert the second downstream protection digital packet 618 c into the second downstream protection if signal 616 c , and transmit the second downstream protection if signal 616 c to the first if combiner 611 c . in some embodiment , the second 60 ghz rf signal 620 c may be received at a first 60 ghz antenna 621 c of the first radio unit 601 c . the first 60 ghz antenna 621 c may transmit the received second 60 ghz rf signal 620 c to a first transceiver 622 c of the first radio unit 601 c . the first transceiver 622 c may amplify the received second 60 ghz rf signal 620 c , and convert the received second 60 ghz rf signal 620 c into a first upstream combined if signal 623 c . the first upstream combined if signal 623 c may be transmitted to a first if splitter 624 c of the first radio unit 601 c . the first if splitter 624 c may extract a first upstream xpic if signal 625 c from the first upstream combined if signal 623 c , and transmit the first upstream xpic if signal 625 c to a first demodulator 626 c of the first radio unit 601 c . the first demodulator 626 c may use the first upstream xpic if signal 625 c to cancel interference of the horizontal polarization in the first downstream xpic if signal 637 c . in some embodiment , the second 60 ghz rf signal 620 c may be received at a fourth 60 ghz antenna 627 c of the fourth radio unit 604 c . the fourth 60 ghz antenna 627 c may transmit the received first 60 ghz rf signal 620 c to a fourth transceiver 628 c of the fourth radio unit 604 c . the fourth transceiver 628 c may amplify the received first 60 ghz rf signal 620 c , and convert the received first 60 ghz rf signal 620 c into a fourth upstream combined if signal 629 c . the fourth upstream combined if signal 629 c may be transmitted to a fourth if splitter 630 c of the fourth radio unit 604 . the fourth if splitter 630 c may extract a fourth upstream protection if signal 631 c from the fourth upstream combined if signal 629 c . in some embodiment , the fourth upstream protection if signal 631 c may be transmitted to a fourth modem 632 c of the fourth radio unit 604 c . the fourth modem 632 c may convert the fourth upstream protection if signal 631 c into a fourth upstream protection digital packet 633 c , and transmit the fourth upstream protection digital packet 633 c to a fourth wireless controller 634 c of the fourth radio unit 604 c . the fourth wireless controller 634 c may decapsulate the fourth upstream protection digital packet 633 c , and convert the fourth upstream protection digital packet 633 c into a fourth upstream protection digital signal 635 c . the fourth upstream protection digital signal 635 c may be transmitted to a fourth protection interface 636 c of the fourth radio unit 604 c . in some embodiment , the second wireless controller 609 c of the second radio unit 602 c may encapsulate the second downstream protection digital signal 617 c into the second downstream protection digital packet 618 c addressed to a destination radio unit . the fourth wireless controller 634 c of the fourth radio unit 604 c may decapsulate the fourth upstream protection digital packet 633 c , accept only the upstream protection digital packet addressed to the destination radio unit that includes the fourth wireless controller 634 c , and convert the accepted upstream protection digital packet into the fourth upstream protection digital signal 635 c . in some embodiment , the first radio unit 601 c and the third radio unit 603 c may be configured to operate as a vertical polarization protection pair , and the second radio unit 602 c and the fourth radio unit 604 c may be configured to operate as a horizontal polarization protection pair . in some embodiment , the first radio unit 601 c and the second radio unit 602 c may be configured as a first xpic pair , and the third radio unit 603 c and the fourth radio unit 604 c may be configured as a second xpic pair . in some embodiment , the first downstream xpic if signal 637 c and the second downstream xpic if signal 615 c are configured to use different carrier frequencies within the license - free 60 ghz band . in some embodiment , a protection interconnection within any one of the vertical polarization protection pair and the horizontal polarization protection pair and an xpic interconnection within any one of the first xpic pair and the second xpic pair are configured to use different channels allocated within the license - free 60 ghz band . fig1 illustrates yet another exemplary embodiment of an all outdoor radios system configured with a protection system and an xpic application using a wireless channel operating at a license - free 60 ghz band in accordance with the present invention . in the exemplary embodiment 700 c , the all outdoor radios system configured with a protection system and an xpic application using a wireless channel operating at a license - free 60 ghz band may include : a first radio unit 701 c configured to use vertical polarization , a second radio unit 702 c configured to use horizontal polarization , a third radio unit 703 c configured to use vertical polarization , and a fourth radio unit 704 c configured to use horizontal polarization . the first radio unit 701 c and the second radio unit 702 c are communicatively coupled to an acu 750 c and the third radio unit 703 c and the fourth radio unit 704 c are communicatively coupled to an acu 755 c , respectively . the third radio unit 703 c may include a third duplexer 705 c , a third receiver 706 c , a third demodulator 707 c , a third protection interface 708 c , a third wireless controller 709 c , a third modem 710 c , a third if combiner 711 c , a third if splitter 712 c , a third transceiver 713 c , and a third 60 ghz antenna 714 c . a third downstream xpic if signal 715 c and a third downstream protection if signal 716 c may be received at the third if combiner 711 c . the third if combiner 711 c may combine the third downstream xpic if signal 715 c and the third downstream protection if signal 716 c , and generate a third downstream combined if signal 719 c . the third downstream combined if signal 719 c may be transmitted to the third transceiver 713 c . the third transceiver 713 c may convert the third downstream combined if signal 719 c into a third 60 ghz rf signal 720 c , and amplify the third 60 ghz rf signal 720 c . the amplified third 60 ghz rf signal 720 c may be transmitted to a third 60 ghz antenna 714 c connected to the third transceiver 713 c . in some embodiment , a third downstream protection digital signal 717 c may be received at the third protection interface 708 c . the third downstream protection digital signal 717 c may be transmitted to the third wireless controller 709 c . the third wireless controller 709 c may encapsulate the third downstream protection digital signal 717 c into a third downstream protection digital packet 718 c , and transmit the third downstream protection digital packet 718 c to the third modem 710 c . the third modem 710 c may convert the third downstream protection digital packet 718 c into the third downstream protection if signal 716 c , and transmit the third downstream protection if signal 716 c to the third if combiner 711 c . in some embodiment , the third 60 ghz rf signal 720 c may be received at a fourth 60 ghz antenna 721 c of the fourth radio unit 704 c . the fourth 60 ghz antenna 721 c may transmit the received third 60 ghz rf signal 720 c to a fourth transceiver 722 c of the fourth radio unit 704 c . the fourth transceiver 722 c may amplify the received third 60 ghz rf signal 720 c , and convert the received third 60 ghz rf signal 720 c into a fourth upstream combined if signal 723 c . the fourth upstream combined if signal 723 c may be transmitted to a fourth if splitter 724 c of the fourth radio unit 704 c . the fourth if splitter 724 c may extract a fourth upstream xpic if signal 725 c from the fourth upstream combined if signal 723 c , and transmit the fourth upstream xpic if signal 725 c to a fourth demodulator 726 c of the fourth radio unit 704 c . the fourth demodulator 726 c may use the fourth upstream xpic if signal 725 c to cancel interference of the vertical polarization in the fourth downstream xpic if signal 737 c . in some embodiment , the third 60 ghz rf signal 720 c may be received at a first 60 ghz antenna 727 c of the first radio unit 701 c . the first 60 ghz antenna 727 c may transmit the received third 60 ghz rf signal 720 c to a first transceiver 728 c of the first radio unit 701 c . the first transceiver 728 c may amplify the received third 60 ghz rf signal 720 c , and convert the received third 60 ghz rf signal 720 c into a first upstream combined if signal 729 c . the first upstream combined if signal 729 c may be transmitted to a first if splitter 730 c of the first radio unit 701 c . the first if splitter 730 c may extract a first upstream protection if signal 731 c from the first upstream combined if signal 729 c . in some embodiment , the first upstream protection if signal 731 c may be transmitted to a first modem 732 c of the first radio unit 701 c . the first modem 732 c may convert the first upstream protection if signal 731 c into a first upstream protection digital packet 733 c , and transmit the first upstream protection digital packet 733 c to a first wireless controller 734 c of the first radio unit 701 c . the first wireless controller 734 c decapsulates the first upstream protection digital packet 733 c , and converts the first upstream protection digital packet 733 c into a first upstream protection digital signal 735 c . the first upstream protection digital signal 735 c may be transmitted to a first protection interface 736 c of the first radio unit 701 c . in some embodiment , the third wireless controller 709 c of the third radio unit 703 c may encapsulate the third downstream protection digital signal 717 c into the third downstream protection digital packet 718 c addressed to a destination radio unit . the first wireless controller 734 c of the first radio unit 701 c may decapsulate the first upstream protection digital packet 733 c , accept only the upstream protection digital packet addressed to the destination radio unit that includes the first wireless controller 734 c , and convert the accepted upstream protection digital packet into the first upstream protection digital signal 735 c . in some embodiment , the first radio unit 701 c and the third radio unit 703 c may be configured to operate as a vertical polarization protection pair , and the second radio unit 702 c and the fourth radio unit 704 c may be configured to operate as a horizontal polarization protection pair . in some embodiment , the first radio unit 701 c and the second radio unit 702 c may be configured as a first xpic pair , and the third radio unit 703 c and the fourth radio unit 704 c may be configured as a second xpic pair . in some embodiment , the third downstream xpic if signal 715 c and the fourth downstream xpic if signal 737 c are configured to use different carrier frequencies within the license - free 60 ghz band . in some embodiment , a protection interconnection within any one of the vertical polarization protection pair and the horizontal polarization protection pair and an xpic interconnection within any one of the first xpic pair and the second xpic pair are configured to use different channels allocated within the license - free 60 ghz band . fig1 illustrates yet another exemplary embodiment of an all outdoor radios system configured with a protection system and an xpic application using a wireless channel operating at a license - free 60 ghz band in accordance with the present invention . in the exemplary embodiment 800 c , the all outdoor radios system configured with a protection system and an xpic application using a wireless channel operating at a license - free 60 ghz band may include : a first radio unit 801 c configured to use vertical polarization , a second radio unit 802 c configured to use horizontal polarization , a third radio unit 803 c configured to use vertical polarization , and a fourth radio unit 804 c configured to use horizontal polarization . the first radio unit 801 c and the second radio unit 802 c are communicatively coupled to an acu 850 c and the third radio unit 803 c and the fourth radio unit 804 c are communicatively coupled to an acu 855 c , respectively . the fourth radio unit 804 c may include a fourth duplexer 805 c , a fourth receiver 806 c , a fourth demodulator 807 c , a fourth protection interface 808 c , a fourth wireless controller 809 c , a fourth modem 810 c , a fourth if combiner 811 c , a fourth if splitter 812 c , a fourth transceiver 813 c , and a fourth 60 ghz antenna 814 c . a fourth downstream xpic if signal 815 c and a fourth downstream protection if signal 816 c may be received at the fourth if combiner 811 c . the fourth if combiner 811 c may combine the fourth downstream xpic if signal 815 c and the fourth downstream protection if signal 816 c , and generate a fourth downstream combined if signal 819 c . the fourth downstream combined if signal 819 c may be transmitted to the fourth transceiver 813 c . the fourth transceiver 813 may convert the fourth downstream combined if signal 819 c into a fourth 60 ghz rf signal 820 c , and amplify the fourth 60 ghz rf signal 820 c . the amplified fourth 60 ghz rf signal 820 c may be transmitted to a fourth 60 ghz antenna 814 c connected to the fourth transceiver 813 c . in some embodiment , a fourth downstream protection digital signal 817 c may be received at the fourth protection interface 808 c . the fourth downstream protection digital signal 817 c may be transmitted to the fourth wireless controller 809 c . the fourth wireless controller 809 c may encapsulate the fourth downstream protection digital signal 817 c into a fourth downstream protection digital packet 818 c , and transmit the fourth downstream protection digital packet 818 c to the fourth modem 810 c . the fourth modem 810 c may convert the fourth downstream protection digital packet 818 c into the fourth downstream protection if signal 816 c , and transmit the fourth downstream protection if signal 816 c to the first if combiner 811 c . in some embodiment , the fourth 60 ghz rf signal 820 c may be received at a third 60 ghz antenna 821 c of the third radio unit 803 c . the third 60 ghz antenna 821 c may transmit the received fourth 60 ghz rf signal 820 c to a third transceiver 822 c of the third radio unit 803 c . the third transceiver 822 c may amplify the received fourth 60 ghz rf signal 820 c , and convert the received fourth 60 ghz rf signal 820 c into a third upstream combined if signal 823 c . the third upstream combined if signal 823 c may be transmitted to a third if splitter 824 c of the third radio unit 803 c . the third if splitter 824 c may extract a third upstream xpic if signal 825 c from the third upstream combined if signal 823 c , and transmit the third upstream xpic if signal 825 c to a third demodulator 826 c of the third radio unit 803 c . the third demodulator 826 c may use the third upstream xpic if signal 825 c to cancel interference of the horizontal polarization in the third downstream xpic if signal 837 c . in some embodiment , the fourth 60 ghz rf signal 820 c may be received at a second 60 ghz antenna 827 c of the second radio unit 802 c . the second 60 ghz antenna 827 c may transmit the received fourth 60 ghz rf signal 820 c to a second transceiver 828 c of the second radio unit 802 c . the second transceiver 828 c may amplify the received second 60 ghz rf signal 820 c , and convert the received fourth 60 ghz rf signal 820 c into a second upstream combined if signal 829 c . the second upstream combined if signal 829 c may be transmitted to a second if splitter 830 c of the second radio unit 802 c . the second if splitter 830 c may extract a second upstream protection if signal 831 c from the second upstream combined if signal 829 c . in some embodiment , the second upstream protection if signal 831 c may be transmitted to a second modem 832 c of the second radio unit 802 c . the second modem 832 c may convert the second upstream protection if signal 831 c into a second upstream protection digital packet 833 c , and transmit the second upstream protection digital packet 833 c to a second wireless controller 834 c of the second radio unit 802 c . the second wireless controller 834 c decapsulates the second upstream protection digital packet 833 c , and converts the second upstream protection digital packet 833 c into a second upstream protection digital signal 835 c . the second upstream protection digital signal 835 c may be transmitted to a second protection interface 836 c of the second radio unit 802 c . in some embodiment , the fourth wireless controller 809 c of the fourth radio unit 804 c may encapsulate the fourth downstream protection digital signal 817 c into the fourth downstream protection digital packet 818 c addressed to a destination radio unit . the second wireless controller 834 c of the second radio unit 802 c may decapsulate the second upstream protection digital packet 833 c , accept only the upstream protection digital packet addressed to the destination radio unit that includes the second wireless controller 834 c , and convert the accepted upstream protection digital packet into the second upstream protection digital signal 835 c . in some embodiment , the first radio unit 801 c and the third radio unit 803 c may be configured to operate as a vertical polarization protection pair , and the second radio unit 802 c and the fourth radio unit 804 c may be configured to operate as a horizontal polarization protection pair . in some embodiment , the first radio unit 801 c and the second radio unit 802 c may be configured as a first xpic pair , and the third radio unit 803 c and the fourth radio unit 804 c may be configured as a second xpic pair . in some embodiment , the third downstream xpic if signal 837 c and the fourth downstream xpic if signal 815 c are configured to use different carrier frequencies within the license - free 60 ghz band . in some embodiment , a protection interconnection within any one of the vertical polarization protection pair and the horizontal polarization protection pair and an xpic interconnection within any one of the first xpic pair and the second xpic pair are configured to use different channels allocated within the license - free 60 ghz band . fig1 illustrates an exemplary method performed by an all outdoor radios system configured with an xpic application using a wireless channel operating at a license - free 60 ghz band in accordance with the present invention . the method includes : step 901 c for receiving a first downstream xpic if signal at a first receiver of a first radio unit ; step 902 c for transmitting the first downstream xpic if signal to a first demodulator of the first radio unit and a first transceiver of the first radio unit , respectively ; step 903 c for converting the first downstream xpic if signal into a first 60 ghz rf signal , and amplifying the first 60 ghz rf signal at the first transceiver of the first radio unit ; step 904 c for transmitting the first 60 ghz rf signal at a first 60 ghz antenna of the first radio unit ; step 905 c for receiving the first 60 ghz rf signal at a second 60 ghz antenna of a second radio unit ; step 906 c for amplifying the first 60 ghz rf signal , and converting the first 60 ghz rf signal into a second upstream xpic if signal at a second transceiver of the second radio unit ; and step 907 c for transmitting the second upstream xpic if signal to a second demodulator of the second radio unit . fig1 illustrates another exemplary method performed by an all outdoor radios system configured with an xpic application using a wireless channel operating at a license - free 60 ghz band in accordance with the present invention . the method includes : step 1001 c for receiving a second downstream xpic if signal at a second receiver of the second radio unit ; step 1002 c for transmitting the second downstream xpic if signal to the second demodulator of the second radio unit and the second transceiver of the second radio unit , respectively ; step 1003 c for converting the second downstream xpic if signal into a second 60 ghz rf signal , and amplifying the second 60 ghz rf signal at the second transceiver of the second radio unit ; step 1004 c for transmitting the second 60 ghz rf signal at the second 60 ghz antenna of the second radio unit ; step 1005 c for receiving the second 60 ghz rf signal at the first 60 ghz antenna of the first radio unit ; step 1006 c for amplifying the second 60 ghz rf signal , and converting the second 60 ghz rf signal into a first upstream xpic if signal at the first transceiver of the first radio unit ; and step 1007 c for transmitting the first upstream xpic if signal to the first demodulator of the first radio unit . fig1 illustrates an exemplary method performed by an all outdoor radios system configured with a protection system and an xpic application using a wireless channel operating at a license - free 60 ghz band in accordance with the present invention . the method includes : step 1101 c for receiving a first downstream xpic if signal at a first if combiner of a first radio unit ; step 1102 c for receiving a first downstream protection if signal at the first if combiner of the first radio unit ; step 1103 c for combining the first downstream xpic if signal and the first downstream protection if signal , and generating a first downstream combined if signal at the first if combiner of the first radio unit ; step 1104 c for converting the first downstream combined if signal into a first 60 ghz rf signal , and amplifying the first 60 ghz rf signal at a first transceiver of the first radio unit ; step 1105 c for transmitting the first 60 ghz rf signal at a first 60 ghz antenna of the first radio unit ; step 1106 c for receiving the first 60 ghz rf signal at a second 60 ghz antenna of a second radio unit ; step 1107 c for amplifying the first 60 ghz rf signal , and converting the first 60 ghz rf signal into a second upstream combined if signal at a second transceiver of the second radio unit ; step 1108 c for extracting a second upstream xpic if signal from the second upstream combined if signal at a second if splitter of the second radio unit ; step 1109 c for transmitting the second upstream xpic if signal to a second demodulator of the second radio unit ; step 1110 c for receiving the first 60 ghz rf signal at a third 60 ghz antenna of a third radio unit ; step 1111 c for amplifying the first 60 ghz rf signal , and converting the first 60 ghz rf signal into a third upstream combined if signal at a third transceiver of the third radio unit ; step 1112 c for extracting a third upstream protection if signal from the third upstream combined if signal at a third if splitter of the third radio unit ; and step 1113 c for converting the third upstream protection if signal into a third upstream protection digital signal and transmit it to a third protection interface . fig1 illustrates another exemplary method performed by an all outdoor radios system configured with a protection system and an xpic application using a wireless channel operating at a license - free 60 ghz band in accordance with the present invention . the method includes : step 1201 c for receiving a second downstream xpic if signal at a second if combiner of the second radio unit ; step 1202 c for receiving a second downstream protection if signal at the second if combiner of the second radio unit ; step 1203 c for combining the second downstream xpic if signal and the second downstream protection if signal , and generating a second downstream combined if signal at a second if combiner of the second radio unit ; step 1204 c for converting the second downstream combined if signal into a second 60 ghz rf signal , and amplifying the second 60 ghz rf signal at the second transceiver of the second radio unit ; step 1205 c for transmitting the second 60 ghz rf signal at the second antenna of the second radio unit ; step 1206 c for receiving the second 60 ghz rf signal at the first antenna of the first radio unit ; step 1207 c for amplifying the second 60 ghz rf signal , and converting the second 60 ghz rf signal into a first upstream combined if signal at the first transceiver of the first radio unit ; step 1208 c for extracting a first upstream xpic if signal from the first upstream combined if signal at a first if splitter of the first radio unit ; step 1209 c for transmitting the first upstream xpic if signal to a first demodulator of the first radio unit ; step 1210 c for receiving the second 60 ghz rf signal at a fourth antenna of a fourth radio unit ; step 1211 c for amplifying the second 60 ghz rf signal , and converting the second 60 ghz rf signal into a fourth upstream combined if signal at a fourth transceiver of the fourth radio unit ; step 1212 c for extracting a fourth upstream protection if signal from the fourth upstream combined if signal at a fourth if splitter of the fourth radio unit ; and step 1213 c for converting the fourth upstream protection if signal into a fourth upstream protection digital signal and transmit it to a fourth protection interface . fig2 illustrates yet another exemplary method performed by an all outdoor radios system configured with a protection system and an xpic application using a wireless channel operating at a license - free 60 ghz band in accordance with the present invention . the method includes : step 1301 c for receiving a third downstream xpic if signal at a third if combiner of the third radio unit ; step 1302 c for receiving a third downstream protection if signal at the third if combiner of the third radio unit ; step 1303 c for combining the third downstream xpic if signal and the third downstream protection if signal , and generating a third downstream combined if signal at the third if combiner of the third radio unit ; step 1304 c for converting the third downstream combined if signal into a third 60 ghz rf signal , and amplifying the third 60 ghz rf signal at the third transceiver of the third radio unit ; step 1305 c for transmitting the third 60 ghz rf signal at the third antenna of the third radio unit ; step 1306 c for receiving the third 60 ghz rf signal at the fourth antenna of the fourth radio unit ; step 1307 c for amplifying the third 60 ghz rf signal , and converting the third 60 ghz rf signal into a fourth upstream combined if signal at the fourth transceiver of the fourth radio unit ; step 1308 c for extracting a fourth upstream xpic if signal from the fourth upstream combined if signal at the fourth if splitter of the fourth radio unit ; step 1309 c for transmitting the fourth upstream xpic if signal to a fourth demodulator of the fourth radio unit ; step 1310 c for receiving the third 60 ghz rf signal at the first antenna of the first radio unit ; step 1311 c for amplifying the third 60 ghz rf signal , and converting the third 60 ghz rf signal into the first upstream combined if signal at the first transceiver of the first radio unit ; step 1312 c for extracting a first upstream protection if signal from the first upstream combined if signal at the first if splitter of the first radio unit ; and step 1313 c for converting the first upstream protection if signal into a first upstream protection digital signal and transmit it to a first protection interface . fig2 illustrates yet another exemplary method performed by an all outdoor radios system configured with a protection system and an xpic application using a wireless channel operating at a license - free 60 ghz band in accordance with the present invention . the method includes : step 1401 c for receiving a fourth downstream xpic if signal at a fourth if combiner of the fourth radio unit ; step 1402 c for receiving a fourth downstream protection if signal at the fourth if combiner of the fourth radio unit ; step 1403 c for combining the fourth downstream xpic if signal and the fourth downstream protection if signal , and generating a fourth downstream combined if signal at a fourth if combiner of the fourth radio unit ; step 1404 c for converting the fourth downstream combined if signal into a fourth 60 ghz rf signal , and amplifying the fourth 60 ghz rf signal at the fourth transceiver of the fourth radio unit ; step 1405 c for transmitting the fourth 60 ghz rf signal at the fourth antenna of the fourth radio unit ; step 1406 c for receiving the fourth 60 ghz rf signal at the third antenna of the third radio unit ; step 1407 c for amplifying the fourth 60 ghz rf signal , and converting the fourth 60 ghz rf signal into the third upstream combined if signal at the third transceiver of the third radio unit ; step 1408 c for extracting a third upstream xpic if signal from the third upstream combined if signal at the third if splitter of the third radio unit ; step 1409 c for transmitting the third upstream xpic if signal to a third demodulator of the third radio unit ; step 1410 c for receiving the fourth 60 ghz rf signal at the second antenna of the second radio unit ; step 1411 c for amplifying the fourth 60 ghz rf signal , and converting the fourth 60 ghz rf signal into the second upstream combined if signal at the second transceiver of the second radio unit ; step 1412 c for extracting the second upstream protection if signal from the second upstream combined if signal at the second if splitter of the second radio unit ; and step 1413 c for converting the second upstream protection if signal into a second upstream protection digital signal and transmit it to a second protection interface . it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the spirit or scope of the invention . thus , it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents . | 7 |
embodiments of the present invention comprise electronically controlled film transport methods and systems . there are multiple embodiments of the present invention . by way of introduction and example , one illustrative embodiment of the present invention provides a rolling loop motion picture projection system including a film transport system with an input drive assembly . in one embodiment , the input drive assembly includes a programmable servo driven input feed sprocket and variable speed input feed sprocket for feeding film into a film transport path between a stator and a rotor . the film transport system also includes an output drive assembly having a programmable servo driven output sprocket . the input drive assembly including the variable speed input feed sprocket and the output drive assemble are controlled by a controller . the variable speed input feed sprocket allows for film acceleration and deceleration within each film advance cycle . the rotor includes gaps that allow the formation of film loops within the gaps . the film loops that form within the rotor gaps are advanced by the rotor gaps towards an aperture where the film is registered on fixed registration pins for subsequent projection onto a screen . the variable speed input feed sprocket allows the film transport system to reliably project large format motion pictures without the expensive mechanical cam device to decelerate the film . the variable speed input feed sprocket also can allow film to be fed at a different rate onto the input registration pin during a film frame advance cycle , which can enable different film formats to be used with the projection system and re - align framing of misaligned film frames . in one embodiment , the film transport system includes an input registration pin and an output registration pin that can move in the pin &# 39 ; s axial direction , but cannot move up and down and sideways . this allows for the registration pins to be retracted during auto - film loading , film tail - out , rewinding operations , and during a sudden physical film failure . a controller controls the retraction of the registration pins . a film transport system with electronically controlled registration pins can be used in a film loop projection system or any other suitable electronically controlled film advance transport system . in one embodiment , the rotor center is positioned inline with the optical axis of the projection system projection lens and the input registration pin is located further away from the aperture than a convention film loop projection system in order to maintain stable and reliable positioning of the film in the projection aperture . in one embodiment , the projection system includes a single stator - based air jet system that uses air flow directing surfaces extending into the open space of the rotor to precisely apply air pressure onto the film at the time of initial film loop formation . this air jet system can reduce the amount of compressed air required to assist in film loop formation and to reduce the complexity of the compressed air system within the projection system . the above introduction is given to introduce the reader to the general subject matter of the application . by no means is the invention limited to such subject matter . illustrative embodiments are described below . referring to fig1 , an illustrative embodiment of a four - gap rolling loop film transport system 1 is illustrated schematically . this exemplary rolling film loop transport system 1 includes a film loop transport . as shown in fig1 - 3 the film loop transport includes a rotor 2 with four equally spaced peripheral gaps 9 , 19 , 29 , 39 . the film 10 may form loops in the gaps 9 , 19 , 29 , 39 , such as film loop 20 . in another embodiment , the film loop transport may be a linear loop transport as described in u . s . pat . nos . 5 , 341 , 182 and 5 , 633 , 696 , incorporated herein by this reference . mounted within close proximity to the outer circumference of rotor 2 are a number of stationary parts that confine film 10 to a predefined space and film transport path . these stationary parts may consist of an outer guide 4 , an inner guide 3 , an input stator segment 5 , an aperture block assembly 7 , and an output stator segment 8 . in one embodiment , an input drive assembly , an output drive assembly , and the rotor 2 advance the film 10 . the input drive assembly may include two sprockets — the constant speed input sprocket 12 and the variable speed input feed sprocket 13 and the output drive assembly may include a constant speed output sprocket 11 . other embodiments may use more or less sprockets . the sprockets 11 , 12 , 13 and rotor 2 each may be driven by a servo - controlled motor ( shown in fig4 ). each of these motors may include a positional feedback device ( shown in fig4 ) such as an encoder that provides information of the rotation of the sprockets 11 , 12 , 13 and rotor 2 . the film transport system 1 may include an aperture block assembly 7 that has an input registration pin 15 located at the input side of the projection aperture 6 , and an output registration pin 16 located at the output side of the projection aperture 6 . the input and output registration pins 15 , 16 act to properly position the film 10 in a stopped position while the frame image is being projected through the projection aperture 6 . in one embodiment , an air jet assembly 17 is built into the inner guide 3 to help to prevent the longitudinal bending of the film and assist with initial forming of the film loops in the rotor gaps 9 , 19 , 29 , 39 . fig4 is diagram of an illustrative control system 90 of the film transport system 1 for controlling certain aspects of the film transport system . the rotor 2 and sprockets 11 , 12 , 13 , shown in fig1 , are driven by a motor 100 , 101 , 102 , and 103 respectively , as shown in fig4 . in one embodiment , each of the motors 100 , 101 , 102 , and 103 is equipped with positional feedback sensors 110 , 111 , 112 , and 113 respectively , such as an encoder . each motor 100 , 101 , 102 , 103 is controlled by a motor drive 120 , 121 , 122 , and 123 respectively . the motor drives 120 , 121 , 122 , and 123 receive control signals from a film transport system controller 150 . the film transport system controller can receive the positional information from each of the motor drives 120 , 121 , 122 , and 123 via the positional feedback sensors 110 , 111 , 112 , and 113 and can determine and send control signals to the motor drives 120 , 121 , 122 , and 123 accordingly . the control system 90 may also include controlling solenoids 130 and 131 and valve 132 . the controlling solenoids 130 and 131 can control the movement and position ( retracted or engaged position ) of the input registration pin 15 and output registration pin 16 respectively , as shown in fig1 . the controlling solenoids 130 , 131 can be controlled by control signals received from the film transport controller 150 . the valve 132 can control compressed air to air jet assembly 17 , shown in fig1 . the valve can be controlled by control signals from the film transport system controller 150 . there are a number of other sensors and actuators in the projection system that may be connected to and controlled by the film transport controller 150 , but are not shown here to maintain simplicity . turning again to fig1 - 3 , in one embodiment , during a motion picture presentation where the film 10 is being advanced by the film transport system 1 , the film is first drawn into the film transport system from a film supply system ( not shown ) such as a reel unit or loop cabinet by the constant speed input sprocket 12 . the constant speed output sprocket 11 removes film from the projection aperture 6 at the same predetermined rate as the constant speed input sprocket 12 . film leaving the film transport is taken up by the film take - up system ( not shown ). in one embodiment , the rotor 2 moves a counter - clockwise direction and , as shown in fig1 , film 10 from film loop 20 in gap 29 is placed onto the input registration pin 15 through a perforation in the film . this is a critical moment in the film advance cycle because the sudden impact of the pin on the edge of a film perforation can cause considerable stress on the edge of the film 10 and can lead to premature wear and destructive failure of the film . when large format film is being transported the impact of the film on the pin becomes more damaging because of the larger film frame size and higher linear film speeds that occur when running at typical projection frames rates of 24 frames per second . in the time leading up to the point that the film 10 impacts the input registration pin 15 , the variable speed input feed sprocket 13 reduces the film &# 39 ; s 10 linear speed well below the linear film speed that the constant input sprocket 12 advances the film . this can avoid damaging the film 10 when it impacts the input registration pin 15 . with conventional large format rolling loop film transport systems , the film approaching the input registration pin ( s ) is intercepted by deceleration cam pins with each frame advance to reduce the film &# 39 ; s speed prior to impacting the input registration pin . the film transport system of one embodiment of the present invention uses the variable speed input feed sprocket 13 to control the film &# 39 ; s linear speed while maintaining contact with the film perforations throughout the film frame advance cycle . this is different then the conventional mechanical rolling loop film transport in which contact with the film perforation by the deceleration cam only occurs during the film deceleration before the film perforation engages onto the input registration pin ( s ). once the film 10 impacts the input registration pin 15 , the film 10 is constrained along its length between the input registration pin and the sprocket teeth of the variable speed input feed sprocket 13 . the film 10 is further constrained laterally along this length by the edges of the inner guide 4 , outer guide 3 , input stator segment 5 , aperture block assembly 7 , and rotor 2 . these constraints ensure that the additional film fed by the variable speed input feed sprocket 13 towards rotor 2 cause a new film loop to form in rotor gap 19 that is now in the correct position to receive the next film loop . during the moment of forming a new film loop in gap 19 pressurized air is directed laterally by the air jet assembly 17 towards the film loop to discourage and offset the tendency of the film to bend longitudinally . the film 10 moving away from the output registration pin 16 in loop 18 in rotor gap 39 collapses in size as the constant speed output sprocket 11 advances the film 10 out of the film transport 1 . in fig2 , rotor gap 29 with film loop 20 is swept across the projection aperture . integral with each rotor gap is a shutter ( not shown ) that blocks the light path through the film 10 as the rotor gap 29 moves across the projection aperture 6 . the variable speed input feed sprocket 13 then begins to increase the film &# 39 ; s 10 linear film speed as the new film loop 21 in gap 19 begins to increase in size . the film loop 18 in rotor gap 39 continues to decrease in size as rotor gap 39 moves towards the constant speed output sprocket 11 . in fig3 , the rotor gap 29 has passed the projection aperture 6 and laid the next film frame across the aperture . as film loop 20 moves across output registration pin 16 the film is lifted off the output registration pin 16 and the film at the trailing end of film loop 20 is placed onto the output registration pin 16 via a film perforation . the timing of loop 20 lifting the film 10 off the output registration pin 16 occurs as the film loop 18 in the rotor gap 39 becomes fully depleted allowing the constant speed output sprocket 11 to continue to advance the next film frame out of the film transport system 1 . the variable speed input feed sprocket 13 continues to increase the film &# 39 ; s linear speed as the new film loop 21 in gap 19 grows . the film &# 39 ; s 10 linear speed is then decreased as the film loop 19 approaches the input registration pin 15 . the variable speed input feed sprocket 13 , during a portion of one film frame advance cycle , advances the film 10 at a rate slower than the rate the constant speed input sprocket 12 advances the film 10 . on the remaining portion of the same film frame advance cycle , the variable speed input feed sprocket 13 advances the film 10 at a rate that is faster than the rate the constant speed input sprocket 12 advances film . the differences in the film advancing rates of these two sprockets will result in a small , but varying amount of excess film . this film forms a shallow , fluctuating film loop between these two sprockets . a loop gap cavity 14 between the outer guide 4 and the inner guide 3 may be included in the film transport system 1 to accommodate this fluctuating loop . in one embodiment , the average film advancing speed over time for the variable speed input feed sprocket 13 equals the constant film advancing speed of the constant speed input sprocket 12 . therefore , the maximum and minimum film loop size in the loop gap 14 is limited to what is needed for differences in film speed between the two sprockets that occur within a single frame advance cycle . the film transport system of one embodiment of the present invention has timing relationships between the rotating film advancing parts ( for example , the input feed sprocket 12 , the variable speed input feed sprocket 13 , the output sprocket 11 , and the rotor 2 ) that are interconnected electronically and controlled by software . this enables the timing to be easily adjusted when a projection system including the film transport system is in operation . in conventional film loop advancing systems , the relationship between the rotating film advancing parts are mechanically interconnected and are not easily adjusted , so that timing cannot be changed easily or at all when the projection system is in operation . the film transport system of one embodiment of the present invention provides the ability to adjust the variable speed input feed sprocket to maximize film steadiness of the film frame in the projection aperture . this may minimize film wear and extend print life . adjusting the variable speed input feed sprocket helps facilitate film loop formation in the rotor gap . fig5 , 6 and 7 , 8 and 9 illustrate three different film speed profiles associated with the variable speed input feed sprocket 13 to describe the effect these profiles can have on the film and its performance in the film transport system . fig5 , for a four gap , 70 mm 15 perforation projection system of one embodiment of the present invention , features two plots showing the cumulative distance in inches that the film is advanced for one 15 perforation film frame versus time in 1 / 18 th increments of one film frame advance cycle . plot 30 shows the amount of film that is advanced by the constant speed input sprocket 12 being constant at 67 . 32 inches per second . plot 31 shows the amount of film being advanced by the variable speed input feed sprocket 13 . in both cases , the amount of film that is advanced is the same at the end of one film frame advance . in the case of plot 31 , the film has traveled a greater distance in the middle portion of the last half of the frame advance cycle and has come to a gradual full stop prior to the end of the film frame advance cycle . fig6 depicts the instantaneous speeds of the two plots 30 and 31 of fig5 . plot 32 depicts the constant linear film speed of 67 . 32 inches per second associated with film moved by the constant speed input sprocket 12 . plot 33 reveals a wide variation in linear film speed of the film advanced by the variable speed input feed sprocket 13 over one film frame advance cycle . plot 33 has a maximum linear film speed of about 140 inches per second at mid cycle and a minimum of 0 inches per second at both the start and end of the frame advance cycle . in both cases , the average speed of the two plots 32 , 33 equals 67 . 32 inches per second . fig7 and 8 are similar to fig5 and 6 , but depict another possible variable speed input feed sprocket linear film speed profile . in this example , the linear film speed of the variable speed input feed sprocket 13 plot 37 at mid - cycle is reduced to about 100 inches per second , but is about 25 inches per second at the end of the cycle . plot 30 again shows the amount of film that is advanced by the constant speed input sprocket 12 being constant at 67 . 32 inches per second . there are advantages and disadvantages to both of the speed profiles illustrated in fig6 and 8 . plot 33 in fig6 has an advantage in that the film comes to a gradual complete stop before the film is laid onto registration pin 15 reducing the amount of the initial impact between the registration pin and the film perforation to a minimum . this speed profile minimizes film wear , but the disadvantage is that later in the film advance cycle the film is advanced before becoming fully seated against the input registration pin . this means that the film does not settle to a stable position until later . this contributes to increasing image unsteadiness in the projection aperture . there is also a high acceleration period followed by a high deceleration period in the film advance cycle . during the high acceleration period the film is pushed up against the input registration pin with more force that can cause the film perforation edge to become slightly deformed . during the deceleration period , the film perforation edge becomes less deformed . these distortions in the film perforation on the input registration pin also cause slight film frame shifts with respect to the projection aperture while the film image is being projected . these factors contribute to unsteadiness in the projected image . another disadvantage for the speed profile illustrated in fig6 is that the greater variation in sprocket speed requires the sprocket motor to accelerate and decelerate quickly , increasing the load on the sprocket servo drive motor . plot 37 in fig8 has an advantage in that the speed of the variable speed input feed sprocket is never 0 inches per second . this may make it easier to form film loops at the beginning of the film advance cycle , but has the disadvantage the film perforation initially impacts the input registration pin with greater force . this leads to film perforation wear over time that in turn and contributes to film bounce and unsteadiness of the image during projection . fig9 depicts another illustrative variable speed input feed sprocket linear film speed profile . in this example the linear film speed of the variable speed input feed sprocket plot 39 at the end of the film advance cycle goes negative for a brief moment causing the film to be pulled back a short distance . this action has been found to be particularly useful in improving the degree of certainty with which the film perforation properly engages onto the input registration pin . there are several factors that can lead to improper engagement of the film perforation onto the input registration pin . humidity effects film curl and film friction characteristics that in turn influences how film performs in the rotor / stator gap . another factor is any speed profile abnormalities in the variable speed input feed sprocket as a result of commanded high accelerations . the profile of the air jet from the air jet assembly 17 can influence the film in the rotor / stator gap . coatings on the film , such as photoguard , or whether the film has the emulsion facing inwards or outwards may also influence the performance of film in the rotor / stator gap . another influence on the film dynamics in the rotor / stator gap is created when the variable speed input feed sprocket pushes film into the rotor / stator gap causing the film to ripple in the gap . this film rippling or snaking effect can be explained when observing the behavior of the film in the rotor / stator film gap as the film loop is growing . as the film loop grows , the film is constrained along its length between the input registration pin 15 and by the sprocket teeth of the variable speed input feed sprocket 13 . the film is also constrained along its length by the edges of the inner guide 4 , outer guide 3 , input stator segment 5 , aperture block assembly 7 , and rotor 2 . although the film is constrained by various parts there is still a gap in this film transport path in the order of a few film thicknesses . this gap allows film splices to pass through the projection system film transport without any physical restrictions that could otherwise cause film breakage or damage . the disadvantage of this gap is that film can take on rippling formations between the rotor 2 surface and the input stator segment 5 surface . film snaking profiles can also effect the position of the film perforation that is meant to engage with the input registration pin 15 . the variable speed input feed sprocket speed profiles can be adjusted to deal with film perforation and registration pin engagement problems . in one embodiment , a speed profile may be a combination of the above speed profile embodiments . in one embodiment , the variable speed input feed sprocket speed may be changed while the projection system is running to deal with the passing of film splices , or films with different protective coatings or emulsion orientations . the speed profiles can also be adjusted to suit a particular film transport and a particular film format . in one embodiment , the speed profile for variable speed input feed sprocket 13 is controlled by the motor drive 123 , which receives control signals from the film transport system controller 150 . these control signals can be determined based on information received from the positional feedback sensor 113 and other feedback sensors 111 , 112 , 113 received by the film transport system controller 150 . the primary advantage is that the variable speed input feed sprocket 13 speed profile changes can be implemented with relatively simple software parameter changes to the motor drive 123 from the film transport system controller 150 . in one embodiment , the film transport system controller 150 can be updated by a user via a standard user interface ( not shown ). this can help to avoid the need to refit mechanical parts to achieve alternate speed profiles , as is generally the case with the mechanically controlled film advancing projection systems . testing can be carried out quickly and these changes can be easily implemented in the field . a further advantage of the film transport system of one embodiment of the present invention is the ability to advance the film by one film frame and one frame perforation within one film advance cycle as illustrated in fig1 . this feature is particularly useful when improper film splicing occurs and results in a film strip that becomes improperly registered , or shifted , some distance either to the right or left of the projection aperture . when this happens a portion of two adjacent frames are simultaneously projected onto the screen as illustrated by area 41 in fig1 a and area 43 in fig1 c . this may be highly objectionable to a viewing audience , and with conventional systems can literally be a show “ stopper ” since the film transport had to be stopped to correct the misalignment . this potential problem is simply addressed by the film transport system of one embodiment of the present invention by applying a new speed profile to each of the film advancing sprockets in the correct sequence such that a single frame of 14 or 16 perforations is advanced through the film transport . the new speed profile can be implemented while the film transport remains in operation thereby quickly overcoming the objectionable viewing condition . fig1 a illustrates a condition where a film is registered one perforation too soon and the frame n in projection aperture 6 features 14 perforations of frame n and one perforation of frame n − 1 and the film frame line 40 is in the gate . fig1 b illustrates the corrective adjustment in a series of frame advance cycles . the film advancing sequence to correct the problem starts with the constant speed input sprocket 12 and the variable speed input feed sprocket 13 advancing one 16 perforation film frame into the rotor 2 gap . frame 3 in fig1 b illustrates the one 16 perforation film frame being advanced . the next film frames advanced by these two sprockets are 15 perforation film frames as shown by frame 4 onwards . when the 16 perforation film frame advances past the output registration pin the speed profile of the constant speed output sprocket changes to advance the one 16 perforation film frame out of the film transport and then reverts back to advancing 15 perforation film frames . for illustrative purposes the amount of film advanced with in each frame advance in fig1 b is shown as being linear with time but there are a variety of other profiles that will achieve the same result . in a situation where a filmstrip is improperly registered one perforation too late as depicted in fig1 c , the frame in the projection aperture will feature 14 perforations of frame n and one perforation of frame n + 1 and frame line 42 will be in the aperture . this misalignment can be remedied by a speed profile routine stored in software that advances 16 perforations of film for 14 consecutive film advance cycles and then reverts back to the usual 15 perforations advanced per cycle . it is also possible to achieve the same result by retarding a single film advance by one film frame perforation . these examples represent the extremes of filmstrip misalignments ; misalignments between these two extremes can be remedied in essentially the same manner . another advantage of the film transport system of one embodiment of the present invention is that it is easy to change the film transport to advance other standard film formats that have a different perforation count per frame , such as 10 perforation , 70 mm or 8 perforation , 70 mm film formats . this may be done by simply changing the amount of film advanced in each film advance cycle by the constant speed input sprocket 12 , the constant speed output sprocket 11 , and the variable speed input feed sprocket 13 . for example , a frame of 70 mm film having 10 perforations could be implemented by adjusting the speed profile of the variable speed input feed sprocket and by reducing the speeds of the input and output sprockets to reflect the new linear film speed , in this case 44 . 88 inches per second . the rotor speed may not need to be changed since its rotational speed is generally related to the system frame rate of 24 frames per second regardless of the size of each frame . the three film advance sprockets 11 , 12 , 13 , and the rotor 2 can be given their respective appropriate speed profile for prolonged periods of time that would rewind the film from the take up spool to the supply spool through the film transport as a part of regular projection system operations . a feature of the film transport system of one embodiment of the present invention to allow this rewind capability is a registration pin or pins that can be moved out or retracted from the film transport path . in one embodiment , the registration pin &# 39 ; s up , down and sideways motion is not be permitted to ensure the function of holding the film frame steady in the projection aperture during film image projection . fig1 shows an illustrative design of a registration pin assembly with the features described above . fig1 a illustrates an input registration pin 15 , but is equally applicable to an output registration pin . the registration pin assembly 50 includes a pocket 60 within the upper surface plate 61 . plate 61 is positioned on top of the aperture block . in one embodiment , there are two pockets , one at the input registration pin 15 and one at the output registration pin 16 in the aperture block assembly 7 as shown in fig1 . the pocket 60 houses a slotted registration pin base frame 62 . at one end of the registration pin base frame 62 is a tip having a rectangular cross section which functions as the registration pin 15 . a hole 64 in upper surface plate 61 is collinear with pin 15 and permits passage of pin 15 into and out of the gap between aperture block assembly 7 and rotor 2 . in one embodiment , pin 15 does not move laterally when impacted by the film , as this will contribute to film image unsteadiness . a rectangular stud 65 that is integral with the bottom surface of pocket 60 is dimensioned to fit within the slot of the registration pin base frame 62 . a spring 63 has one end in contact with stud 65 and the other end in contact with the inner back wall of the slot of the registration pin base frame 62 . spring 63 biases registration pin base frame 62 in a retracted position so that the registration pin 15 does not extend into the gap between aperture block assembly 7 and rotor 2 . during normal projection system operation solenoid 130 is energized and urges registration pin base frame 62 towards rotor 2 against the bias of spring 63 . when rewinding film through the film transport system , or in the event of a film tail out or film crash , power to solenoid 130 is interrupted and pin 15 is automatically retracted fully within pocket 60 . fig1 b is an isometric view of the aperture block assembly with a registration pin assembly as viewed from the film transport path side . the retraction of the registration pins also allows auto - film loading of the film transport . auto loading may be defined , in one example , as the film transport system of the projection system being able to automatically thread film through the film transport path such that film appears at the output of the film transport system . as part of the auto - loading , the film transport system subsequently positions the start film frame in the projection aperture , sets the film loops , and then waits for the presentation start command to be given . the only manual actions are typically to place the film onto the film transport system input sprockets before initiating the auto - loading and to thread the film from the film transport system to the film take - up system after the film has been auto - threaded through the film transport system . an auto loading sequence involving the retraction of the registration pins according to one embodiment is as follows . referring to fig1 , the projectionist places the film so that the perforations are engaged on the sprocket teeth of sprocket 12 and 13 of film transport system 1 . the projectionist initiates the auto load command on the film transport system to start the sequence that automatically threads film through the film transport film transport path . rotor 2 moves to a predetermined position allowing the film to be passed into and around the rotor film transport path reliably while the input registration pin 15 and the output registration pin 16 are in the retracted position . the sprockets 12 and 13 advance a predetermined amount of film into the rotor 2 so the film 10 is just short of reaching sprocket 11 . to ensure partial film loops have not formed in any of the rotor gaps the film is pulled back a few frames by sprockets 12 and 13 . this action causes any partial film loops that may have formed in the rotor gaps to collapse . now film is advanced to and past output sprocket 11 by a few film frames . the sprocket motors at this time become free to rotate to allow the projectionist to easily pull film from the film transport to load it onto the take up spool . at this time , the projectionist can align the film frame line to a predetermined mark or the system can be designed so that a sensor detects the frame line and feeds this indication back to the control system . with the film frame line position established and film threaded onto the film supply and take - up system it is now possible that the projection system rotor 2 motor , sprocket 12 and 13 motors can be commanded to jog by the projectionist to get the film start frame to the start mark at the film transport input . the next sequence of getting the film start frame into the projection aperture 6 and setting up the film loops in the rotor gaps is initiated with another command by the projectionist . when given , the rotor 2 goes to a predefined position , sprocket 12 and 13 rotate to a predetermined position to allow the input registration pin 15 and the output registration pin 16 to engage into the appropriate film perforations . at this time , the registration pins 15 , 16 engage , the sprockets 12 , 13 and the rotor 2 become phase locked in synchronization with each other and advance the film creating a film loop in a rotor gap . the constant speed output sprocket 11 is held stationary once the registration pins are engaged and the film loop continues to be advanced past the input registration pin 15 , past the projection aperture 6 , until it just reaches the output registration pin 16 . at this moment the constant speed output sprocket 11 becomes locked in synchronization with input sprockets 12 and 13 and rotor 2 . the film transport system 1 continues to advance film frames until the pre - positioned start film frame is positioned in the film transport system aperture 6 . at this point the film transport system is now waiting for a presentation start command to be given . the sequence described above is one of a number of ways to achieve auto - film loading in the film transport of the present invention . an advantage of the auto - film loading feature can be that the film transport may no longer need film to be loaded and unloaded from the front of the projection system . this can eliminate the need for a conventional projection system transporter that moves the projection system back from the projection port window to allow the projectionist to perform film unthreading and threading operations . this may provide the option of being able to permanently position the projection system as close as possible to the projection port window in the projection booth . eliminating the need to move the projection system minimizes the projection system footprint in the projection booth and minimizes the size requirements of the projection booth . in one embodiment , the center of the rotor 2 may be in line with optical axis of the projection aperture 6 and the input registration pin 15 may be moved further away from the projection aperture than with a conventional film loop projection system using a deceleration cam . this allows the input registration pin 15 to protrude into the rotor beyond the rotor &# 39 ; s outer peripheral upper and lower edge of the rotor . this configuration better confines the film on the input registration pin than the situation of the input registration pin as described in conventional small rotor projection systems where the rotor center is offset with respect to projection lens and the curvature of the film support surface in the projection aperture is significantly larger than the radius of the rotor . another advantage with the input registration pin being located further away from the projection aperture in the film transport system of one embodiment of the present invention is that this allows more time for the film frame to settle into a stable position prior to the period the film frame is positioned in the projection aperture . this extra time is needed because of settling effects associated with the variable speed input feed sprocket advancing film onto the input registration pin . by improving the way the film is confined on the input registration pin and providing more time for the film to settle on the input registration pin helps contribute to a more steady film image in the projection aperture . fig1 shows an illustrative embodiment of the air jet assembly 17 of the film transport system . the air jet assembly 17 is located partially within the inner guide 3 near the point where film 10 is driven by variable speed input feed sprocket 13 towards the gap between the outer guide 4 and rotor 2 . fig1 shows the tip of air jet assembly 17 in more detail . the tip extends past the film entry point 70 and within the space defined by the outer circumference of rotor 2 . upper and lower plates define the outer circumference of rotor 2 and the gap between them is of sufficient width to accommodate the intrusion of the tip of air jet assembly 17 . the outer surface of air jet assembly tip 17 has a gently curved profile that guides the flow of air towards a precise location on newly forming film loop 21 . the flow of air on the film from the tip of the air jet assembly 17 provides lateral support for the film 10 against the tendency for longitudinal bending or buckling of the film 10 at two critical moments in the film loop forming phase : when film loops are first starting to grow , and when the trailing edge of rotor gaps make first contact with the edges of film 10 of the newly forming film loop . after these two events , the flow of air is stopped until the approach of the next rotor gap and the subsequent initiation of another new film loop . an advantage of the air jet assembly 17 is that airflow can be concentrated and brought to bear precisely where and when it is needed . this may be beneficial when variable speed input feed sprocket 13 is programmed with a speed profile such as profile 33 in fig6 where film loops are slower to initiate than is normally the case . the structure of an illustrative embodiment of the air jet assembly 17 is explained more fully with reference to fig1 and 15 . in fig1 , air jet assembly 17 is shown in profile and includes three main elements : inner guide 3 , outer air guide plate 71 , and inner air guide plate 72 . the three elements may be made of aluminum and machined to have a series of channels and pockets allowing air from a regulated air supply to flow through a valve ( not shown ) via the inner guide 3 and over both surfaces of the outer air guide plate 71 . the operation of the air valve can be synchronized with respect to the rotor position to provide a flow of air just before a rotor gap approaches the position where the film loop begins and until the position the new film loop has grown to a sufficiently stable size . the air valve can also be left on for the full period of the film frame advance in situations where improved film dynamics results in more reliable film transport . fig1 shows an exploded view of the parts describe above revealing the co - operating surfaces and pockets that define the route the air travels . the shape of both surfaces of the outer air guide plate 71 and the rate of air flow over these surfaces is designed to create an air flow condition which reproduces the well known coanda effect : the tendency of smoothly flowing fluids to stay attached to surfaces even when they undergo curvature . this effect makes it possible to precisely direct air flow towards the film loop during the film loop forming phase that overcomes the tendency of the film to experience longitudinal bending which occurs when the film is only supported at its edges during the loop forming process . while the above description contains many specifics , these specifics should not be construed as limitations on the scope of the invention , but merely as exemplifications of the disclosed embodiments . those skilled in the art will envision any other possible variations that are within the scope of the invention . for example , the film transport system described above is not limited to advancing film for projected images but can also be applied to advancing film to capture images as in a camera . additionally , the registration pin or pins of the type described in the film transport system that are controlled by a programmable controller may be used in conjunction with other film transports that are not film loop advancing transports , such as conventional 35 mm and 70 mm electronically controlled intermittent film sprocket film advancing systems . | 6 |
referring now in specific detail to the drawings , in which like reference numerals identify similar or identical elements throughout the several views , fig1 shows a first embodiment of the broadhead tool 10 of the present invention . the broadhead tool 10 has a generally cylindrical body portion 12 which comprises a hand grip for holding and using the tool . tool 10 is provided at a first end with a broadhead blade engaging means 14 . broadhead blade engaging means 14 essentially comprises an axial bore 20 having a plurality of radially directed slots 22 extending outwardly from bore 20 . bore 20 is of such diameter so as to accommodate the shank of a broadhead , and slots 22 are provided to accommodate the blades of the broadhead . the width of slots 22 is preferably such that the blades of the broadhead are frictionally engaged within slots 22 . extending axially from body portion 12 beyond blade engaging means 14 is a broadhead guide means 16 which serves to direct the broadhead towards the blade engaging means 14 while providing protection against injury to the user . broadhead guide means 16 comprises a shroud having a frusto - conical cross section which includes an internal taper 18 which corresponds in shape to the cross section of a broadhead to position the broadhead therein . broadhead guide means 16 extends a length which is sufficient to completely enclose the blades of the broadhead when the broadhead is positioned therein . this allows the user to handle the tool without the risk of potentially serious injury due to the razor sharp blades of the broadhead . flange 26 may be provided to form a gripping abutment surface for the user &# 39 ; s hand to prevent slippage of the tool in the direction of the blades . flange 26 provides further protection for the user in conjunction with broadhead guide means 16 , and may be provided with a hole 27 to facilitate hooking the tool onto a belt , jacket , or the like . as best seen in fig4 and 5 , body portion 12 is provided with a gripping surface 28 which gives the user a tighter grip on the tool during use . gripping surface 28 provides body portion 12 with a polygonal cross section and preferably provides a hexagonal cross section . alternately , the cross section of body portion 12 may be circular , and gripping may be enhanced through the provision of a knurled or raised surface , or through the addition of a sleeve member such as rubber or the like . the preferred cross section , however , is hexagonal , which facilitates the use of a tool such as a wrench or pliers in order to provide greater torque to the tool to remove the broadhead from the shaft of an arrow if necessary . fig2 and 3 further illustrate the blade engaging means of the tool 10 . as seen in fig2 central bore 20 is provided having three slots 22 to accommodate a broadhead having three blades . alternately , as seen in fig3 bore 20 includes four radially directed slots 22a to accommodate a broadhead having four blade members . fig4 illustrates the rear end 24 of tool 10 , which includes the means for engaging the shank of a broadhead having broken or missing blades . end wall 30 is provided with an axial bore 32 which extends into the body portion 12 and is of such a diameter so as to accommodate the shank of a broadhead . axially bore 32 may extend completely through body portion 12 and communicate with axial bore 20 of the blade engaging means . tab members 34 are provided and extend partially into axial bore 32 to engage the slots in the broadhead shank which are used to secure the blades of the broadhead . in use , the shank is inserted into axially bore 32 so that the slots in the shank align with at least one of the tab members 34 to securely hold the shank while the shaft is rotated to remove the shank . fig6 illustrates the preferred embodiment of the tool 40 of the present invention . tool 40 has a body portion 42 which has a polygonal cross section similar to that shown in fig1 . the polygonal cross section is preferably a hexagonal cross section , and forms the gripping portion 56 which facilitates handling of the tool . the hexagonal cross section allows for the use of a wrench or pliers to assist in rotation of the tool to remove a broadhead from the shaft of an arrow . gripping portion 56 ends in a flange member 50 which provides a gripping abutment surface to protect the user &# 39 ; s hand . extending axially from flange 50 is the broadhead guide means 46 which is generally cylindrical in shape and extends axially beyond blade engaging means 44 . broadhead guide means 46 comprises a shroud which is of such a length so as to completely enclose the broadhead during use . the broadhead guide means 46 may have a cylindrical cross section , but preferably has a frustoconical internal cross section which provides an internally tapered guide surface 48 which is of a shape which corresponds to the cross section of a broadhead . blade engagement means 44 comprises an axial bore 52 having a diameter which is sufficient to accommodate the shank of a broadhead , and includes outwardly directed radial slots 54 for accepting various broadhead blade configurations . slots 54 are preferably of a width which frictionally engages the blades of the broadhead . broadhead guide means 46 and flange 50 protect the user &# 39 ; s hand from potentially serious injury due to the razor sharp blades of the broadhead ; however , it is apparent that flange 50 may be eliminated without sacrificing the safety features of the broadhead guide means 46 . fig7 illustrates the blade engaging means 44 of the tool of the present invention . an axial bore 52 is provided having a plurality of slots 54 extending radially outward therefrom . the configuration of the slots shown in fig7 will accommodate broadheads having 2 , 3 , or 4 blade members . however , it is apparent that the device of the present invention may be constructed so as to accommodate broadheads having any number of blades . broadhead guide means 46 surrounds and extends beyond blade engagement means 44 , such that internal taper surface 48 extends inwardly towards the blade engagement means . fig8 illustrates a shank engagement means positioned at the second end 58 of tool 40 . end wall 62 is provided with an axial bore 60 which may extend through body portion 42 to communicate with axial bore 52 to create a central longitudinal bore . central bore 66 is best seen in fig1 . extending radially outwardly from bore 60 is at least one tab member 64 , which is preferably constructed of steel and which is provided to engage the slot in the shank of a broadhead having its blade members broken or missing . bore 60 is of a diameter sufficient to accommodate the shank of a broadhead , and once positioned therein , one of the slots is aligned with one of the tabs 64 to securely hold the shank while the shaft of the arrow is rotated to remove the shank therefrom . fig1 illustrates a typical broadhead 70 attached to the shaft of an arrow which may be removed by the tool of the present invention . in use , the broadhead is inserted into the broadhead guide means 46 so that the tip enters bore 52 of the blade engagement means 44 . the internally tapered surface 48 of guide means 46 directs the tip of the broadhead and the blades towards bore 52 and slots 54 . while holding tool 40 by gripping portion 56 , the user then aligns the tip of the broadhead with bore 52 and the blades of the broadhead with slots 54 and fully inserts the broadhead into the guide means 46 . the internal taper 48 is such so as to align with the taper of the blades so that there is no radial movement of the broadhead within the tool . the width of the slots is such that there is no rotational movement of the broadhead , so that the user may rotate the shaft of the arrow while securely holding the broadhead within the tool so that the shaft may be rotated to remove the broadhead from the shaft . once the broadhead is removed , a new broadhead may be inserted into the tool and the shaft rotated onto that broadhead to reassemble the arrow . the broadhead tool of the present invention is a device which quickly and efficiently removes broadheads from arrow shafts and which also may remove shanks of broadheads having broken blades from the shaft of an arrow while protecting the user from potentially serious injury by eliminating exposure of the razor blades and pointed tip of the broadhead . the device is lightweight and may easily be carried in a pocket or on a belt of a hunter or sportsman . while the invention has been particularly shown and described with reference to the preferred embodiments , it will be understood by those skilled in the art that various modifications and changes in form and detail may be made therein without departing from the scope and spirit of the invention . accordingly , modifications such as those suggested above , but not limited thereto , are to be considered within the scope of the invention . | 5 |
the present invention is best understood when read in connection with the drawings . fig1 a is a schematic diagram showing one embodiment of the prior art to which the system of the present invention pertains . referring now to fig1 a , the facility includes an lng - based liquefier ( 2 ) and a cryogenic asu ( 1 ). in this example , the cryogenic asu includes a higher pressure column ( 114 ), lower pressure column ( 116 ), and main exchanger ( 110 ). feed air 100 is compressed in 102 and dried in 104 to produce stream 108 . stream 108 is cooled in main exchanger 110 against returning gaseous product streams , to produce cooled air feed 112 . stream 112 is distilled in the double column system to produce liquid oxygen 158 , high pressure nitrogen gas ( stream 174 ) and low pressure nitrogen gas ( stream 180 ). the nitrogen gases 174 and 180 are warmed in main exchanger 110 to produce streams 176 and 182 . stream 182 is ultimately rejected to the atmosphere . stream 176 is processed in the lng - based liquefier ( 2 ) to create liquefied nitrogen product stream 188 and liquid nitrogen refrigerant stream 186 . liquid nitrogen refrigerant stream 186 is introduced into the distillation columns through valves 136 and 140 . refrigeration for lng - based liquefier is provided from lng stream 194 , which is vaporized and heated to produce stream 198 . in fig1 a , the only nitrogen feed to the lng - based liquefier is stream 176 , which originates from the higher pressure column 114 . fig1 b is a schematic diagram showing the basic concept of the present invention in relation to fig1 a . referring now to fig1 b , feed air 100 is compressed in 102 and dried in 104 to produce stream 108 . stream 108 is cooled in main exchanger 110 against returning gaseous product streams , to produce cooled air feed 112 . stream 112 is distilled in the double column system to produce liquid oxygen 158 , high pressure nitrogen gas ( stream 174 ) and low pressure nitrogen gas ( stream 180 ). the nitrogen gases 174 and 180 are warmed in main exchanger 110 to produce streams 176 and 182 . stream 182 is transformed utilizing a supplemental compressor and the associated heat exchange equipment ( referred to hereunder as the “ supplemental processing unit ” which is depicted as unit 3 in fig1 a ) to become stream 184 , then mixed with stream 176 , to form a feed to the lng - based liquefier ( 2 ). liquefied nitrogen product stream 188 and liquid nitrogen refrigerant stream 186 are produced within the lng - based liquefier . liquid nitrogen refrigerant stream 186 is introduced into the distillation columns through valves 136 and 140 . in contrast to fig1 a , the source of the nitrogen feed to the lng - based liquefier leaves the asu as two streams , 182 and 176 . as noted above , the term supplemental processing unit as used hereunder means the present invention &# 39 ; s supplemental compressor and the associated heat exchange equipment . it should be noted however that the term does not necessarily mean the supplemental compressor and the associated heat exchange equipment are contained in a single physical unit . the exact nature of the supplemental processing unit ( 3 ) is described in detail with reference to the embodiments of the invention depicted in fig3 b and 3 c . operation of fig1 b where , similar as shown in fig1 a , stream 182 is vented and not fed the supplemental processing unit ( 3 ), is preferred when the ratio of liquid nitrogen product to liquid oxygen product ( stream 188 / stream 158 ) is relatively low and hereafter is referred to as “ low production mode ”. when operating in this mode , it is appropriate to extract all of the nitrogen to be liquefied from the higher pressure column . operation as shown in fig1 b , hereafter referred to as “ high production mode ” is preferred when the ratio of liquid nitrogen product to liquid oxygen product ( stream 188 / stream 158 ) is relatively high . in such a case , so much nitrogen needs to be liquefied that it is appropriate to extract the nitrogen to be liquefied from both the higher pressure column and lower pressure column . in fig1 b , the supplemental processing unit ( 3 ) is inserted to transform the state of stream 184 relative to stream 182 so that it may be mixed with stream 176 prior to introduction to the lng - based liquefier . by doing so , the design and operation of the lng - based liquefier may be similar in both high and low production modes . in fact , the design of the lng - based liquefier can be exactly the same and the equipment simply operated at “ turn - down ” in the low production mode . fig2 is a schematic diagram identical to fig1 b in terms of showing the basic concept of the present invention , but differs slightly with respect to the configuration between the lng - based liquefier ( 2 ) and the asu ( 1 ). in particular , whereas liquefied nitrogen stream 186 is fed to the distillation column system in fig1 b , stream 186 is fed to the main heat exchanger in fig2 . referring now to fig2 , feed air 100 is compressed in 102 and dried in 104 to produce stream 108 . stream 108 is split into a first portion ( 208 ) and a second portion ( 230 ). stream 208 is cooled in 110 against returning gaseous product streams , to produce cooled air feed 212 . stream 230 is first cooled in 110 against returning gaseous product streams then liquefied to produce stream 232 . liquid air stream 232 is split and is introduced into the distillation columns through valves 236 and 240 . streams 212 and 232 are distilled in the double column system to produce liquid oxygen 158 , high pressure nitrogen gas ( stream 174 ) and low pressure nitrogen gas ( stream 180 ). the nitrogen gases 174 and 180 are warmed in the main exchanger 110 to produce streams 176 and 182 . liquid nitrogen refrigerant stream 186 is directed to the main exchanger where it is vaporized by indirect heat exchange with condensing stream 230 to form vapor nitrogen return stream 288 . in low production mode , stream 182 is vented and streams 288 and 176 are processed in the lng - based liquefier to create liquefied nitrogen product stream 188 and liquid nitrogen refrigerant stream 186 . in high production mode , stream 182 is transformed in the supplemental processing unit ( 3 ) to become stream 184 , then mixed with stream 176 . the mixed stream , plus stream 288 , are processed in the lng - based liquefier to create liquefied nitrogen product stream 188 and liquid nitrogen refrigerant stream 186 . the exact nature of the lng - based liquefier is not the focus of the present invention , however , how the liquefier integrates with the supplemental processing unit ( 3 ) is important to understand so an example of an lng - based liquefier ( unit 2 in fig2 ) is described in fig3 a . fig3 b and 3 c will give examples of the same lng - based liquefier with inclusion of different embodiments of the supplemental processing unit ( 3 ). referring to fig3 a , high pressure nitrogen vapor stream 176 is mixed with vapor nitrogen return stream 288 to form stream 330 , which is subsequently cooled in liquefier exchanger 304 to form stream 332 . stream 334 is compressed in a first auxiliary compressor ( hp cold compressor 308 ) to form stream 336 . stream 336 is cooled in liquefier exchanger 304 to make stream 338 , then is compressed in a second auxiliary compressor ( vhp cold compressor 310 ) to form stream 346 . stream 346 undergoes cooling and liquefaction in liquefier exchanger 304 to make stream 348 . liquefied stream 348 is further cooled in cooler 312 to form stream 350 . stream 350 is reduced in pressure across valve 314 and introduced to vessel 316 where the two phase fluid is separated to vapor stream 352 and liquid stream 356 . liquid stream 356 is split into two streams : stream 360 and stream 186 , which constitutes the liquid nitrogen refrigerant stream that is directed to the cryogenic asu . stream 360 is reduced in pressure across valve 318 and introduced to vessel 320 where the two phase fluid is separated to vapor stream 362 and liquid nitrogen product stream 188 . vapor streams 362 and 352 are warmed in cooler 312 to form streams 364 and 354 , respectively . stream 364 is further warmed in exchanger 304 to form gaseous nitrogen vent stream 366 from the lng - based liquefier . refrigeration for the lng - based liquefier is supplied by lng stream 194 , which is vaporized and or warmed in liquefier exchanger 304 to form stream 198 . in the strictest sense , the terms “ vaporized ” and “ condensed ” applies to streams that are below their critical pressure . often , the streams 346 ( the highest pressure nitrogen stream ) and 194 ( the lng supply ) are at pressures greater than critical . it is understood that these streams do not actually condense or vaporize . rather they undergo a change of state characterized by a high degree heat capacity . one of normal skill in the art will appreciate the similarities between possessing a high degree of heat capacity ( at supercritical conditions ) and possessing a latent heat ( at subcritical conditions ). referring now to fig3 b , in high production mode of operation , lower pressure nitrogen stream 182 is an additional source of nitrogen that ultimately needs to be liquefied . per the present invention , the supplemental processing unit ( 3 ) has been added to transform low pressure nitrogen stream 182 into a higher pressure nitrogen stream 184 . stream 182 is combined with warm , low pressure gaseous nitrogen vent stream 366 to form stream 370 . stream 370 is cooled in pre - cooling heat exchanger 322 to produce cooled nitrogen stream 372 . stream 372 is mixed with cold , low pressure gaseous nitrogen vent stream 386 from the lng - based liquefier to form stream 374 . stream 374 is compressed cold in the supplemental compressor ( lp compressor 306 ) to form stream 184 , then mixed with high pressure liquefier feed streams 288 and 176 to form stream 330 . the refrigeration for cooling stream 370 is provided by lng stream 394 , which is vaporized and / or warmed in precooling heat exchanger 322 to form stream 396 . operation of lng - based liquefier ( 2 ) in fig3 b is very similar to that described in fig3 a with some exceptions . as in fig3 a , stream 330 is cooled in liquefier exchanger 304 to form stream 332 . stream 334 is compressed in hp cold compressor 308 to form stream 336 . stream 336 is cooled in liquefier exchanger 304 to make stream 338 , is compressed in vhp cold compressor 310 to form stream 346 . stream 346 undergoes cooling and liquefaction in liquefier exchanger 304 to make stream 348 . as in fig3 a , liquefied stream 348 is further cooled in cooler 312 to form stream 350 . stream 350 is reduced in pressure across valve 314 and introduced to vessel 316 where the two phase fluid is separated to vapor stream 352 and liquid stream 356 . liquid stream 356 is split into two streams : stream 360 and stream 186 , which constitutes the liquid nitrogen refrigerant stream that is directed to the cryogenic asu . stream 360 is reduced in pressure across valve 318 and introduced to vessel 320 where the two phase fluid is separated to vapor stream 362 and liquid nitrogen product stream 188 . vapor streams 362 and 352 are warmed in cooler 312 to form streams 364 and 354 , respectively . fig3 b is different from fig3 a in that stream 364 , which is a low pressure nitrogen stream , need not be warmed and vented because the supplemental compressor ( lp cold compressor 306 ) exists . there are two possible ways to combine stream 364 with stream 182 . in the more thermodynamically preferred case , valve 380 is closed and valve 382 is open . in this event stream 364 flows through valve 382 to become gaseous nitrogen vent stream 386 from the lng - based liquefier , which is then blended with cold nitrogen feed stream 372 . in the less thermodynamically preferred case , valve 380 is open and valve 382 is closed . in this event stream 364 flows through valve 380 to become stream 384 , is warmed in heat exchanger 304 to become gaseous nitrogen vent stream 366 from the lng - based liquefier , then blended with warm nitrogen feed stream 182 . the more thermodynamically preferred option ( valve 380 closed ) would be employed if the cold valves 380 and 382 were incorporated into the liquefier at the design point ; the less thermodynamically preferred option ( valve 382 closed ) would be employed if the inclusion of the supplemental processing unit ( 3 ) was executed as a retrofit . in the latter event , valves 380 and 382 might not exist and line 382 would not be present . finally in fig3 b , and as in fig3 a , refrigeration for the lng - based liquefier is supplied by lng stream 194 , which is vaporized and or warmed in liquefier exchanger 304 to form stream 198 . as indicated above , the refrigeration to cool the lower pressure nitrogen in precooling heat exchanger 322 is by vaporizing and / or warming lng stream 394 . as an alternative , it is possible to extract a cold nitrogen stream from the cold or intermediate location of the liquefier heat exchanger 304 , warm that stream in exchanger 322 , then re - cool that stream in exchanger 304 . this might be done to eliminate the need to pipe lng to precooling heat exchanger 322 as shown by stream 394 in fig3 b . any suitable stream may be used as the source of the cold nitrogen gas , such as streams 332 , 338 , or 348 . referring now to fig3 c , a simpler supplemental processing unit might be employed . once again , in high production mode of operation lower pressure nitrogen stream 182 is an additional source of nitrogen that ultimately needs to be liquefied . per the present invention , the supplemental processing unit ( 3 ) has been added to transform low pressure nitrogen stream 182 into a higher pressure nitrogen stream 184 . stream 182 is combined with warm , low pressure nitrogen gaseous nitrogen vent stream 366 from the lng - based liquefier to form stream 370 . stream 370 is compressed in the supplemental compressor ( warm lp compressor 324 ), then cooled in aftercooler heat exchanger 326 ( typically using cooling water or glycol as the cooling medium ) to form stream 184 . stream 184 is subsequently mixed with high pressure liquefier feed streams 288 and 176 to form stream 330 . the operation of the lng - based liquefier is similar to that described in fig3 a , except stream 366 is not vented . as noted previously , the supplemental processing unit as depicted as unit ( 3 ) in fig3 b and 3 c does not necessarily refer to single physical unit . for example , the supplemental compressor can be contained in a housing with other compressors while the supplemental heat exchanger can be contained in a housing with other heat exchangers . it should also be noted that while the supplemental compressor and heat exchanger operate at above ambient temperature in fig3 c &# 39 ; s embodiment of the present invention , this equipment operates at below ambient temperatures in fig3 b &# 39 ; s embodiment and therefore must be insulated . a worked example has been prepared to demonstrate possible operating conditions associated with the present invention and clarify what is different and common between operating modes . three cases will be given : case 1 corresponds to low production mode operation without the supplemental processing unit ( 3 ) while cases 2 and 3 correspond to high production mode operation with the supplemental processing unit ( 3 ) in place . for this example , case 1 is depicted by the lng - based liquefier ( 2 ) of fig3 a ; cases 2 and 3 are depicted by the lng - based liquefier ( 2 ) and the supplemental processing unit ( 3 ) of fig3 b . for cases 2 and 3 , referring to fig3 b , valve 380 is closed and valve 382 is open . the cryogenic asu in shown in greater detail in fig4 and described below . referring to fig4 , atmospheric air 100 is compressed in the main air compressor 102 , purified in adsorbent bed 104 to remove impurities such as carbon dioxide and water , then divided into two fractions : stream 230 and stream 208 . stream 208 is cooled in main heat exchanger 110 to become stream 212 , the vapor feed air to the higher pressure column 114 . stream 230 is cooled to a temperature near that of stream 212 then at least partially condensed to form stream 232 , then eventually reduced in pressure across valves 236 and 240 and introduced to the higher pressure column 114 and lower pressure column 116 . the higher pressure column produces a nitrogen - enriched vapor from the top , stream 462 , and an oxygen - enriched stream , 450 , from the bottom . stream 462 is split into stream 174 and stream 464 . stream 174 is warmed in the main heat exchanger then passed , as stream 176 to the lng - based liquefier ( 2 ). stream 464 is condensed in reboiler - condenser 418 to form stream 466 . a portion of stream 466 is returned to the higher pressure column as reflux ( stream 468 ); the remainder , stream 470 , is eventually introduced to the lower pressure column as the top feed to that column through valve 472 . oxygen - enriched stream 450 is passed to the argon column &# 39 ; s reboiler - condenser 484 through valve 452 , and at least partially vaporized to form stream 456 , which is directed to the lower pressure column . the lower pressure column produces the oxygen from the bottom , which is withdrawn as liquid stream 158 , and a nitrogen - rich stream , 180 , from the top . nitrogen - rich stream 180 is warmed in main heat exchanger 110 to form stream 182 . a waste stream may be removed from the lower pressure column , as stream 490 , warmed in the main exchanger and ultimately discharged as stream 492 . boilup for the bottom of the lower pressure column is provided by reboiler - condenser 418 . a vapor flow is extracted from the lower pressure column as stream 478 and fed to argon column 482 . argon product is withdrawn from the top of this column as liquid stream 486 . bottom liquid stream 480 is returned to the lower pressure column . the reflux for the argon column is provided by indirect heat exchange with the vaporizing oxygen - enriched stream , which originates from the higher pressure column as stream 450 . liquid nitrogen refrigerant stream 186 is directed to the main exchanger where it is vaporized by indirect heat exchange with condensing stream 230 to form vapor nitrogen return stream 288 . in low production mode of operation ( case 1 ) stream 182 is vented to atmosphere from the asu ( as stream 486 ), stream 366 is vented to atmosphere from the lng - based liquefier , and the flow of streams 184 and 386 are zero . in high production mode ( cases 2 and 3 ) streams 182 ( as stream 488 ) and 386 are passed to the supplemental processing unit , and the flow of stream 366 is zero . for these particular case 2 and 3 examples , the flow of stream 176 ( originating from the higher pressure column ) is also zero . that is , in cases 2 and 3 , the entire portion of the high pressure nitrogen 462 from the high pressure column is condensed in reboiler / condenser [ 418 ] and used as reflux for the distillation column system such that , as between the boosted pressure nitrogen and the high pressure nitrogen , only the boosted pressure nitrogen is fed to the lng - based liquefier in high production mode . although this is not mandatory , it is a typical scenario in high production mode . the distinction between case 2 and 3 is the liquid nitrogen production in case 3 is higher . cases 1 - 3 are intended to illustrate how liquid production can be increased . several balance points can be gleaned from the table as indicated by notes 1 - 5 therein which are explained below : note 1 : the liquid oxygen production increases by 33 % in going from case 1 to case 2 ; liquid oxygen production is the same in case 2 and 3 . note 2 : the liquid nitrogen production increases 60 % in going from case 1 to case 2 ; liquid nitrogen production increases 140 % in going from case 1 to case 3 . note 3 : the high pressure nitrogen flow is sufficient to meet the liquid nitrogen production requirement in case 1 , but is zero in cases 2 and 3 . note 4 : even though the liquid oxygen production is significantly less in case 1 , the air flow to the asu is roughly the same for all three cases . this is an important feature . when one elects to produce nitrogen from the asu as high pressure nitrogen then the oxygen recovery declines . as a result , the use of the present invention allows one to use the same air compressor and same cryogenic asu for all three cases . note 5 : case 1 operates with no lp compressor ( the supplemental processing unit ( 3 ) is not needed ) in the description of fig4 , gaseous nitrogen stream 174 from the high pressure column that is warmed in the main heat exchanger and fed as stream 176 to the liquefier could alternatively be condensed in reboiler - condenser [ 418 ]. in this scenario , after being condensed in reboiler - condenser [ 418 ], the liquid nitrogen stream 174 would be vaporized and warmed in the main heat exchanger . finally , as can be appreciated by one skilled in the art , even though the supplemental compressor of the present invention is separate and distinct from the auxiliary compressor ( s ) for the lng - based liquefier , a common machine could drive both in high production mode . in this scenario , the machine installed for driving the auxiliary compressor ( s ) when the plant is built could contain a vacant pinion for eventually adding the supplemental compressor . alternately , the auxiliary compressor ( s ) and the supplemental compressor are driven by separate machines in high production mode . | 5 |
preferred embodiments of the present invention will be described in detail herein below with reference to the annexed drawings . in the drawings , the same or similar elements are denoted by the same reference numerals even though they are depicted in different drawings . further , in the following description , a detailed description of known functions and configurations incorporated herein will be omitted when it may obscure the subject matter of the present invention . the present invention is directed to a mac access control procedure and a mac access association procedure for processing qos traffic data required for a variety of household appliances when a wlan is applied to a home network . more specifically , the present invention classifies traffic data requiring a variety of qoss such as phones , video sets , game machines , etc ., into a plurality of classes . the traffic classes can be , for example , a periodic and delay sensitive traffic class , an irregular - and delay sensitive traffic class , and an irregular and delay insensitive class . the periodic - and delay sensitive traffic class periodically occurs according to a requested qos , and is sensitive to delay . the irregular and delay sensitive traffic class occurs irregularly , and is sensitive to delay . the irregular and delay insensitive class occurs irregularly , and is not sensitive to delay . fig1 is a block diagram illustrating a mac apparatus in accordance with a preferred embodiment of the present invention . referring to fig1 , the mac device 10 includes a controller 14 , which includes a plurality of mac modules 12 - 1 to 12 - k for processing qos traffic data corresponding to the aforementioned classes , a mac layer management entity ( mlme ) for controlling the mac modules 12 - 1 to 12 - k , and a station management entity ( sme ) for controlling overall functions of an access point ( ap ). the mac modules are connected to individual physical layer devices , and separately process radio frames received via the physical layer devices . the mac device 10 acts as an ap for supporting additional mac protocols to multiple mac areas according to service characteristics . the controller 14 acts as a single sme / mlme for integratedly controlling the mac modules . individual mac modules are operated by different mac protocols and are assigned different mac channels . for example , the first mac module 12 - 1 assigned an audio channel is operated by an mp ( multi - poll )- dcf protocol , the second mac module 12 - 2 is operated by an hcf or edcf protocol suitable for a video channel , the third mac module 12 - 3 is in charge of a game channel , and the fourth module 12 - 4 in charge of a control channel is operated by a dcf protocol . in accordance with a preferred embodiment of the present invention , an mp - dcf protocol , a dcf protocol , an edcf protocol , and an hcf protocol are used as the mac protocol , but it should be noted that the present invention is not limited to the aforementioned protocols . if other mac protocols are developed at a later time , they can also be applied to the present invention if needed . the number of mac modules can be increased or reduced according to communication environments . fig2 is a conceptual diagram illustrating a mac method in accordance with a preferred embodiment of the present invention . fig3 is a flow chart illustrating a mac method in accordance with a preferred embodiment of the present invention . for the convenience of description and better understanding of the present invention , it is assumed that the controller 14 includes four mac modules 12 - 1 to 12 - 4 operated by different mac protocols ( i . e ., mp - dcf , hcf , and dcf protocols ). referring to fig2 , the first mac module 12 - 1 provides a communication service associated with a voip phone 13 - 1 using the mp - dcf protocol over a predetermined channel 15 - 1 used for an audio service . the second mac module 12 - 2 communicates with a digital tv 13 - 2 using an hcf protocol over a predetermined channel 15 - 2 used for a video service . the third mac module 12 - 3 communicates with the game machine 13 - 3 using the dcf protocol over a predetermined channel 15 - 3 used for an entertainment service . the fourth mac module 12 - 4 provides a control channel using the dcf protocol . if a new terminal appears under the above condition , the new terminal receives a beacon message from the mac device over a basic control channel , and determines the presence of the neighboring mac device at step s 301 . the basic channel is an initial default channel for searching for the beacon message when different types of terminals enter a network . after receiving the beacon message , the terminal performs general authentication and association procedures with the mac device at step s 302 . more specifically , the terminal provides service type information required for the mac device at the authentication and association procedures at step s 302 , and the mac device registers service type information of a corresponding terminal at step s 303 . the mac device selects a mac module suitable for a corresponding service according to the terminal information and the service type information at step 304 , and transmits channel information assigned to the selected mac module to the terminal at step s 305 . upon receiving the channel information , the terminal transmits data to the mac device over a corresponding channel at step s 306 . for example , if the terminal is a video device , the mac device provides the terminal with information for a video channel assigned to the second mac module 12 - 2 , which is operated by hcf or edcf protocol . fig4 is a flow chart illustrating a network access process between terminals in a system in accordance with a preferred embodiment of the present invention . referring to fig4 , the terminal enters a network , and selects an access point ( ap ) by searching for a beacon signal over the basic channel at step s 401 . if the ap is selected , the terminal transmits a mac service request message including its service type information to a corresponding ap at step 402 . upon receiving the mac service request message , the ap provides corresponding terminal information to a mac module for managing a mac channel pre - assigned for a corresponding service according to the service type information included in the mac service request message and transmits corresponding mac channel information . the terminal receives the mac channel information transmitted from the ap at step s 403 . the terminal changes its communication channel from an initial basic channel to a newly assigned mac channel according to the mac channel information at step s 404 , and transmits data over the changed channel at step s 405 . as is apparent from the description above , the mac device according to the present invention includes an additional mac module for a control channel and a plurality of mac modules supporting qos traffic data of various classes according to individual classes , thereby improving scheduling complexity in a mac layer . additionally , the mac method according to the present invention classifies services according to traffic characteristics , such that it can easily schedule service and enhances qos reliability . further , the mac method according to the present invention advantageously overcomes a band limitation problem while using a conventional physical layer . the mac method accordance to the present invention can increase or reduce the number of mac modules according to a network environment . although a heterogeneous mac protocol may be developed at a later time , the mac method installs a corresponding protocol in the form of a mac module , such that it can easily accommodate the heterogeneous mac protocol . although preferred embodiments of the present invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions , and substitutions are possible , without departing from the scope and spirit of the present invention as disclosed in the accompanying claims . | 7 |
disclosed herein is an apparatus and methodology for reducing contamination associated with immersion lithography . generally speaking , wafer contamination is left behind near the wafer edge , and in a manner that such contamination is produced as a result of interaction of the immersion fluid with the topography between the wafer edge and the chuck . recent simulations have shown that reducing topography on the surface covered by the tool showerhead helps to maintain the meniscus , and to avoid bubble formation . thus , it is advantageous to artificially extend the wafer surface , so as to make the transition between the wafer and the chuck as flat as possible without sharp transitions . as is outlined in greater detail hereinafter , the exemplary embodiments herein maintain fluid meniscus integrity in the topography gap of a wafer chuck by introducing an internal fluid circulation path within the chuck . the circulation path includes the gap itself , thus flowing immersion fluid through the gap ( between the outer edge of the wafer and the chuck ) radially outwards , and maintaining the water level at same height as the wafer surface . moreover , the fluid level may be maintained at the same height as wafer surface with active or passive control of the fluid circulation path . it should be noted that any suitable fluid may be used for the fluid circulation path within the chuck , so long as it optically matches the immersion fluid of the lithography process and does not damage the surrounding surfaces of the wafer . referring initially to fig1 , there is shown a partial cross - sectional view of a portion of a chuck assembly 100 that may be used in conjunction with , for example , immersion lithography . as is shown , a wafer chuck 102 has a semiconductor wafer 104 held thereupon , with the wafer 104 depicted as having a thin layer of photoresist material 106 formed thereon . it will be noted that the relative dimensions of the chuck 102 , wafer 104 and resist layer 106 are not to scale and are depicted as such for illustrative purposes only . however , as is shown in fig1 , there exists a substantial topography at the outer edge of the wafer 104 as a result of the air gap 108 formed within the chuck 102 . accordingly , fig2 is a partial cross - sectional view of a chuck assembly 200 configured for immersion lithography , in accordance with an exemplary embodiment of the invention . as is shown , a wafer chuck 202 is modified to include an immersion fluid supply line 210 and an outer channel 204 that facilitates the outward flow of immersion fluid from the gap 108 , thus forming a liquid surface that extends from the edge of the wafer 104 top surface to the wafer chuck surface , thereby filling the air gap with the added fluid . while the outermost portion 206 of the chuck has a height that roughly correlates to the height of the wafer 104 , it will be noted that the intermediate portion ( lip ) 208 of the chuck between the gap 108 and the outer channel 204 has a height that is lower than the top of the outermost portion 206 and the wafer 104 . this allows fluid to travel over the top of the lip 208 , leading to a reduction in splashing and thus contamination . in addition to the outer channel 204 , a fluid circulation path is also formed within the chuck 202 . particularly , an inlet path 210 allows a pressurized source of fluid to flow into the bottom of the gap 108 , while a negative pressure return path 212 originates from a sidewall formed within the outer channel 204 . in an exemplary embodiment , the fluid used and circulated through the fluid circulation path has the same optical characteristics as that used for the immersion lithography , so as to avoid any changes in optical characteristics from any mixing therebetween . furthermore , in order to prevent optical fluid from entering beneath the surface of the wafer 104 where it contacts the chuck 202 , a seal 214 ( e . g ., an o - ring ) is positioned between the bottom of the wafer and the bottom of the gap 108 . as will be discussed in further detail hereinafter , a variety of seal shapes and materials may be implemented . fig3 illustrates an optional feature that may be introduced within the chuck assembly 200 of fig2 , for the purpose of eliminating waves as the chuck moves about . more specifically , a plurality of side grooves 216 is formed ( at periodic intervals ) within the lip 208 of the chuck 202 . thereby , an additional level of fluid level control is achieved since , in addition to flowing over the top of the lip , the optical fluid can also flow through each of the side grooves 216 . fig4 is a partial side cross - sectional view , taken along the lines 4 - 4 of fig3 , illustrating in further detail one of the grooves 216 formed in the lip 208 . referring now to fig5 , there is shown a partial cross - sectional view of a chuck assembly 500 configured for immersion lithography , in accordance with an alternative embodiment of the invention . as is shown , a wafer chuck 502 is modified to include an interior fluid circulation path . however , in contrast to the embodiment of fig2 through 5 , the interior fluid circulation path of the chuck 502 in fig5 is configured directly beneath the existing gap 108 . as such , when immersion fluid within the gap 108 is accelerated , it is caused to flow from the direction of the pressurized inlet path 510 , over a lip 508 beneath the gap 108 , to the return path 512 . moreover , the fluid level of the embodiment of fig5 is maintained through an active control approach in that a pressure sensor 504 is configured within the chuck 502 in order to sense the fluid pressure within the path . in this manner , the positive pressure of the inlet path 510 and the negative pressure of the return path 512 may be independently controlled to adjust for changes in pressure in the immersion fluid in the gap , thereby maintaining water level 110 and meniscus integrity of the passing immersion fluid . one particular advantage associated with the embodiment of fig5 is a simpler flow of fluid within the chuck 502 . as is the case with fig2 , the chuck 502 also includes a sealing ring 514 to prevent immersion fluid from coming between the bottom surface of the wafer 104 and the chuck 502 . in addition to active control , the fluid level within an immersion lithography chuck assembly can also be maintained through passive control means . for example , fig6 is partial cross - sectional view of a chuck assembly 600 configured for immersion lithography , in accordance with still another embodiment of the invention . as is shown , the passive control embodiment provides a modified wafer chuck 602 that incorporates a first water column ( i . e ., the existing gap 108 ) and a second column 604 formed at an outer location with respect to the radius of the chuck 602 . similar to the earlier embodiments , a fluid circulation path is once again provided within the chuck 602 for maintaining the integrity of the fluid meniscus 110 . the fluid circulation path , including inlet path 610 and return path 612 , is directed through the second column 604 , which further includes an overflow lip 608 . thus , fluid traveling in an outward direction will flow over the lip 608 and into the return path 612 of the second column 604 . the passive control of the fluid level in the gap 108 is achieved through the control of the second column 604 , since the gap 108 is fluidly connected to the second column 604 through passage 606 formed within the chuck 602 . in addition , a venturi tube 607 is formed at the bottom of the gap 108 , connecting the gap 108 to the inlet path 610 and thus allowing for the circulation of fluid through the gap 108 as well . as is the case with the embodiments of fig2 and 5 , the chuck 602 also includes a sealing ring 614 to prevent immersion fluid from coming between the bottom surface of the wafer 104 and the chuck 602 . accordingly , in operation of the passively controlled chuck assembly 600 , fluid passes by the first column ( i . e ., gap 108 ) and through the venturi tube 607 , which sucks fluid from the gap 108 . thereby , the excess fluid left over from the passing of the meniscus 110 over the gap 108 is removed from the gap 108 . thereafter , the excess fluid joins the inlet path 610 where it then flows over the lip 608 and into a drain ( i . e ., return path 612 ), thus maintaining the level of the fluid at the top surface of the chuck 602 . because the two columns ( gap 108 , second column 604 ) are connected ( e . g ., through passage 606 ) in zones of equal pressure at equal height , the fluid in the gap 108 will be maintained at the same level as that present in the second column 604 . it will be noted that the flow of fluid within the chuck 602 need not be continuous , and may instead be made to occur at selected locations along the circumference of the chuck 602 . thus configured , the passively controlled chuck assembly 600 allows for very fast control of fluid levels adjacent to the wafer 104 , by minimizing the topography that the meniscus 110 crosses in a stable manner . since the venturi tube 607 provides for circulation of immersion fluid through the chuck gap 108 , contamination of the fluid is less likely to accumulate , which in turn results in a smaller probability of contaminant particles being deposited on the surface of the wafer 104 . a second advantage of having a series of venturi tubes 607 and connecting passages 606 at a specified intervals is that they provide for a method to prevent undue increase in fluid pressure in the gap 108 during chuck acceleration . by way of further illustration , fig7 is a cross - sectional view of a chuck assembly 700 of the passive control type illustrated in fig6 , and depicts an exemplary two - piece construction embodiment of the same . as is shown , a first chuck section 702 a includes the interior plumbing for the chuck , as well as the surface to which the wafer 104 is held . in particular , the first chuck section 702 a includes the fluid inlet path 610 and return path 612 described above , as well as the venturi tubes 607 at the bottom of the gap 108 . plugs 704 may be inserted into the first chuck section 702 a to prevent the fluid from leaking outside the chuck . further , the first chuck section 702 a is removably attached ( e . g ., by means of bolts 706 ) to a second chuck section 702 b . the second chuck section 702 b , once attached , also serves to define a barrier between the first column ( gap 108 ) and the second column 604 for passive fluid level control . as can been seen , the second chuck section 702 b also includes the interior passage 606 so as to bring the first and second columns in fluid communication with one another , and achieve the passive control of the gap fluid . o - rings 708 may also be used to seal the first and second chuck sections together , as also shown in fig7 . it will be noted that the detailed exemplary embodiment of fig7 does not illustrate the sealing rings that prevent fluid from coming between the bottom of the wafer 104 and the first chuck section 702 a . fig8 is a top view of the chuck assembly 700 of fig7 . in addition to illustrating an exemplary fluid distribution path , fig8 also shows one possible example of the relative number and positioning of inlet and outlet ports in the first column 604 with respect to the inlet and return fluid paths 610 , 612 . an exemplary distribution of venturi tubes 607 within the gap 108 is further illustrated , although it will be appreciated that a different number and location of tubes can also be implemented . as stated earlier , and regardless of the particular chuck assembly embodiment utilized , it is desirable to prevent immersion fluid ( e . g ., water ) from getting beneath the wafer , between the bottom of the wafer and the chuck surface . more specifically , since there is vacuum holding down the wafer , the immersion fluid will have a tendency to seep towards the lower pressure . as such , it is advantageous to block this path by ( for example ) placing a sealing ring at the outer edge of the wafer support . to this end , several types and shapes of such a sealing ring are available , and from various materials . for example , fig9 ( a ) through 9 ( d ) illustrate various possible cross - sectional shapes for the sealing rings discussed above . in particular , the sealing ring may be of a delta shape as shown in fig9 ( a ), an x - shape as shown in fig9 ( b ); an o - ring as shown in fig9 ( c ); and a square ring as shown in fig9 ( d ). other cross - sectional shapes , however , are also contemplated . furthermore , the sealing rings may be made from any suitable material including , but not limited to : nitrile ( buna ), silicone , fluorosilicone , hydrogenated nitrile , fluorocarbon ( e . g ., viton ® by dupont ), neoprene , ethylene propylene , butyl , polyurethane , ethylene acrylic ( e . g ., vamac ® by dupont ), polyacrylate , and tetrafluoroethylene - propylene ( e . g ., aflas ® by asahi glass ). finally , fig1 depicts an alternate location of the sealing ring 902 with respect to the wafer edge support portion 904 of a chuck assembly . whereas the previously described embodiments illustrate the sealing ring positioned outside of the wafer edge support 904 ( with respect to the center of the wafer ), the sealing ring 902 in fig1 is disposed on the inside of the wafer edge support 904 . if the sealing ring 902 is located outside the wafer edge support , there is a small force present on the wafer ( due to the positive external seal pressure ) that could possible bend the wafer upwards and cause defocus errors near the edge of the wafer . although this condition is less likely with small overlap distances between the wafer edge and the wafer edge support , the inside placement of the sealing ring 902 with respect to the wafer edge support 904 would eliminate any such deflection . while the invention has been described with reference to a preferred embodiment or embodiments , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof . therefore , it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this invention , but that the invention will include all embodiments falling within the scope of the appended claims . | 6 |
fig1 depicts a typical application of the invention , namely an automatic roadside watering system , for purposes of illustrating the invention &# 39 ; s operation . specifically , the watering system comprises at least one sprinkler head 12 , a remotely operable valve 14 , water carrying conduit coupling the head 12 and the valve 14 providing water from a source ( not shown ) and a valve controller 18 . the valve controller 18 comprises a wind detector 20 and timing and switching elements referred to generally as a regulator 22 . power for operating the valve 14 and the controller 18 may be provided from a conventional power source 24 , such as a 24 volt a . c . power means , as is typically used in remotely operable automatic roadside watering systems . the regulator 22 as hereinafter explained , is operative as a switch controlling a gate operating solenoid ( not shown ) in the valve 14 . roadside watering systems , as illustrated , generally have at least one sprinkler head 12 located adjacent to or within watering range of a traffic area or roadway 26 . under normal relatively calm wind conditions , the pavement remains safely dry and thus protected as roadside vegetation is watered . however , windy conditions will cause water spray from the head 12 to be dispersed unless the water supply is turned off . a strong wind 28 , for example , blowing across watered vegetation 30 toward the roadway 26 tends to blow water on the pavement and into the path of on - coming vehicles 32 . the results of the water spray and accumulation on roadway 26 can create a hazard of slippery conditions and restricted visibility . under gusty conditions , wind gusts may carry only small amounts of water onto the pavement of roadway 26 . this is generally not so hazardous due to acceptable rates of evaporation preventing accumulation . the present invention provides means and discloses a method for sensing wind conditions and controlling the water regulating valve 14 minimizing the hazards created by dispersed spray . for example , in fig1 wind 30 blowing across the vegetation 30 toward the roadway 26 is sensed at wind detector 20 , which conveys a signal to regulator 22 indicating wind speed exceeding a pre - selected level . in response to the wind speed signal regulator 22 is activated to time the duration of the detector 20 signal . at the end of the first minimum pre - determined time delay of for example a few seconds in length , regulator 22 causes valve 14 to close , thereby shutting off water flow to head 12 thus preventing further spray dispersion . when detector 20 conveys a signal to regulator 22 indicating wind is below the selected threshold , a second pre - determined time delay is initiated . with valve 14 closed , water flow remains interrupted until the end of the second time delay , which may be several seconds . this prevents undesired oscillation between the water &# 34 ; on &# 34 ; and water &# 34 ; off &# 34 ; states should be signal of the wind detector 20 oscillates between states under gusty wind conditions . the periods of the first and second time delay may be variable or fixed . the delays may be reset to initial conditions each time the wind oscillates through the threshold level , or the periods may be permitted to accumulate so that the state of regulator 22 is changed only after the average wind speed over a selected period exceeds the threshold level . generally , a fixed minimum and variable maximum time delay is established before the state valve 14 may be changed . the wind detector 20 may be responsive to wind in only a selected direction or range of directions , or it may be sensitive to wind speed from all directions . in the latter case , a standard totalizing anemometer 184 ( fig2 b ) may be used as the wind speed sensing element of the wind detector 20 of fig1 . for example , wind detecting rotatably mounted arms 186 may be coupled to a rotor shaft 188 of a voltage generator 190 . the generator 140 may provide a voltage signal proportional to wind speed to a suitable threshold detector 192 which in turn provides appropriate control signals to regulator 22 . such a wind totalizing detector would find particular application where a protected area surrounds the spraying head 12 , as for example in a circular garden . a fountain pool or along the side or the center divider of a winding roadway , or where the valve controller 18 is operative to regulate a bank of sprinkler heads or the like on the periphery of an encircling protected area . in the application of a watering system along the border of a generally straight roadway , a directional sensor is preferred . fig2 depicts a valve controller 18 with a basic directionally sensitive wind detector 20 and regulator 22 . the wind detector 20 includes a moveable blade or vane 34 mechanically coupled to a two - position switch 36 through a linkage 38 . switch 36 is moveable between a first &# 34 ; high &# 34 ; position indicating high directional wind conditions and a second &# 34 ; off &# 34 ; position , to which switch 36 is normally biased under low or opposing wind conditions . a spring 40 provides bias to switch 36 the vane 34 which may be a flat plate vertically disposed and moveable in a generally vertical plane along the direction of the desired maximum wind sensitivity . to improve directional sensitivity , the vane 34 may be fabricated of a pair of flat plates 42 and 44 arranged to form a v - shape in a vertical view , as illustrated in fig2 a . the direction of maximum wind sensitivity is direction a , along the line bisecting the angle formed by the plates 42 and 44 . wind in direction a applies maximum pressure to vane 34 tending to displace vane 34 toward the &# 34 ; high &# 34 ; switch position . wind in direction b and c , offset from the bisecting line , also tends to displace vane 34 , although higher wind pressure is required on each of the plates 42 and 44 to effect displacement . wind in direction d applies virtually no pressure to plate 42 , thus still greater pressure is required on plate 44 for vane displacement . side winds , for example in direction e , apply pressure to the opposing sides of plates 42 and 44 , thus tending to cancel forces which would displace vane 34 toward the switch &# 34 ; high &# 34 ; position . backwinds , on the other hand , from direction f bias vane 34 toward the &# 34 ; off &# 34 ; switch position . the regulator portion 22 of controller 18 in fig2 comprises a first timer 46 , a second timer 48 , a trigger 50 and a relay 52 . the &# 34 ; high &# 34 ; terminal of switch 36 is connected to the input of timer 46 for coupling a positive voltage reference to the timer 46 upon closing of the &# 34 ; high &# 34 ; side switch 36 contact . the &# 34 ; off &# 34 ; terminal of switch 36 is connected to the input of timer 48 coupling a ground voltage reference to the timer 48 upon the the closing of the &# 34 ; off &# 34 ; switch 36 contacts . outputs of timers 46 and 48 are coupled to the input of trigger 50 . trigger 50 output drives the magnetic coil of relay 52 to activate and deactivate a solenoid ( not shown ) operating valve 14 ( fig1 .) specifically , timers 46 and 50 may be r - c timing circuits each having pre - selected charge characteristics which determine the selected delay periods . the timers 46 and 48 may be either separate units or elements of a unified network wherein single circuit elements serve multiple functions . the trigger 50 may for example be a voltage level sensitive transistor switch with a preselected input hysteresis . one well - known switch circuit is the schmidt trigger circuit , which may be coupled to a current switch in the conventional manner for driving the coil of relay 52 . the hysteresis characteristic of trigger 50 coupled to r - c type timers 46 and 48 determines minimum time delays between state changes of relay 52 . the desire to function may be achieved in other embodiments , however . for example , timers 46 and 48 may be digital timers and trigger 50 may be a bistable multivibrator . timers 46 and 48 may be operative to apply a trigger signal to trigger 50 only after fixed time delays following the change of state of switch 36 . the trigger signal might thereby cause trigger 50 to activate and deactivate relay 52 . the invention may be better understood by reference to fig3 which illustrates the operation of the invention employing r - c type time delays . fig3 is a set of timing diagrams . fig3 a is a graph of wind speed ; fig3 b indicates position of sensor switch 36 and therefore detector vane 34 ; fig3 c represents voltage at the input of trigger 50 ; and fig3 d represents the state of relay 52 . during the interval i , the wind component in the direction of interest is below threshold t ( fig3 a ), switch 36 is therefore in the &# 34 ; off &# 34 ; position ( fig3 b ), and the relay 52 is opened , permitting water flow ( fig3 d ). at the beginning of interval ii , the wind speed exceeds threshold t ( fig3 a ). the vane 34 senses the wind speed , activating switch 36 to the &# 34 ; high &# 34 ; state ( fig3 b ). timer 46 commences to operate , for example charging to a positive voltage at a pre - determined rate ( fig3 c ) until after a period δt 1 , a threshold x is attained causing trigger 50 to activate relay 52 to close ( fig3 d ), thereby cutting off water flow . at the beginning of interval iii , wind speed drops below threshold t ( fig3 a ), sensor switch 36 switches to &# 34 ; off &# 34 ; ( fig3 b ), and timer 48 commences to operate , i . e ., charging toward a ground or relatively negative voltage level threshold y ( fig3 c ). attaining threshold y causes trigger 50 to operate relay 52 thereby permitting resumption of water flow ( fig3 d ). during interval iv with water flow as during interval i , wind speed is shown to oscillate across threshold t ( fig3 a ) causing switch 36 to oscillate ( fig3 b ), and timers 46 and 48 to alternately commence timing cycle each time switch 36 changes state ( fig3 c ). in this embodiment , the timers 46 and 48 have a memory or accumulation feature . the sum of time periods of one state is subtracted from the sum of time periods of the opposite state such that if the ratio of &# 34 ; on &# 34 ; time to &# 34 ; off &# 34 ; time of switch 36 exceeds a certain value ( determined by the ratio of time delays ) the trigger 50 responds , causing relay 52 to change state . thus , even though the time between the last switch state change and the relay state change is less than a minimum time delay δt 1 or δt 2 ( as shown at interval v , fig3 b , 3c , and 3d ), the minimum time delay between relay state changes can never be less than the minimum tine delay . for example the events illustrated in interval iv and the beginning of interval v can never take place in a time period less than δt 1 . this combined memory feature of timer 46 and 48 , renders the regulator 22 responsive to the degree of wind gustiness , that is , the frequency of wind oscillation is taken into account in determining how quickly the valve 14 is shut off following a last previous state change of switch 36 . alternatively , timers 46 and 48 may be reset to initial conditions each time switch 36 changes state . thus , relay 52 would be precluded from changing state until a fixed minimum time after switch 36 changes state . intervals vi , vii , and viii illustrate the conditions where the minimum time between sensor switching and relay activation ( δt 2 ) is unaffected by the ratio of &# 34 ; on &# 34 ; time to &# 34 ; off &# 34 ; time . during interval vi , fig3 c shows the initiation of the delay period of timer 48 . during interval vii , the delay period of timer 46 is activated , eventually cancelling the accumulated time of timer 48 . during interval viii , the period of timer 48 runs full course , activating relay 52 ( fig3 d ) at the end of the delay period . fig4 illustrates one embodiment of a suitable directional wind sensor 20 , according to the present invention . the sensor 20 comprises a housing 54 , a moveable wind blade or vane 134 and a magnetic reed switch 136 . the vane 134 comprises a pair of blades 142 and 144 attached at roughly right angles along a generally vertically disposed shaft 102 . the shaft 102 is part of a linkage 138 which translates movement of the vane 134 to effect switch actuation . the linkage 138 comprises the shaft 102 , a generally horizontally disposed arm 104 , a horizontally disposed pivot axis 106 mounted to the housing 100 , and an elbow 108 linking shaft 102 and arm 104 and rotatably coupling to the shaft 102 and arm 104 at a generally orthogonal angle . a magnet 110 is mounted at the end of arm 104 so as to confront the reed switch 136 causing actuation of its interval relay contacts upon movement of the vane 134 . a coil spring 112 is wrapped around pivot axis 106 and enclosed at one end to elbow 108 . the opposite spring end is connected to a strap 114 wrapped around a rotatable pivot shaft 116 . the magnet 110 is moveable between a first position adjacent reed switch 136 and a second position spaced from the reed switch 136 in response to pivotal movement of the arm 104 about axis 106 . in operation , wind pressure on the faces of plates 142 and 144 causes translation of vane 134 between the first position and the second position , causing the magnet 110 to move to the reed switch 136 . the reed switch 136 closes in response to the magnetic forces for signaling a suitable sensor . spring 112 normally biases the vane 134 toward the direction of maximum wind sensitivity . the biasing level is set by tightening or loosening spring 112 with strap 114 by turning the shaft 116 . the vane 134 can be very light and carefully balanced on pivot axis 136 such that even light winds can effect a response . fig5 illustrates a suitable circuit of regulator 22 which could operate with the sensor 20 of fig4 . the following parts and values have been found to work adequately : ______________________________________part designation part designation or value______________________________________d1 - d4 power supply diode bridgec1 filter capacityc2 1000 mfd 15 v capacitorc3 2000 mfd 3 volt capacitord5 zener diode vr1 resistor 4 . 3kohmr2 resistor 5 . 1kohmr3 resistor 150kohmx1 transistor 2n222as1 switch spsts2 reed switchl1 magnetic coil proximate to s2 1200 ohmk1 relay dpdts3 reed switch ( wind sensor ) ______________________________________ voltage powering the circuit of fig5 is 24 volts a . c . the output of the circuit is in the form of valve solenoid - operative switching through relay k1 . the minimum time delays of the two - state circuit may range from a few seconds to as much as about 60 seconds . the minimum time delay before the water is switched off is typically on the order of one half of the minimum time delay before water is allowed to switch back on . for example the first time delay may be 10 - 12 seconds and the second time delay may be 20 - 30 seconds . as an added feature of the circuit of fig5 signal lights are provided to indicate the state of relay k1 . a red light indicates that valve 14 should be closed and a green light indicates that valve 14 should be opened . this provides simple means for monitoring proper function of the solenoid - controlled valve . the solenoid - controlled valve can thereby be monitored by observing the signal lights at the control station together with the system in operation . for example the absence of water flow when the green light is illuminated indicates a possible malfunction of valve 14 . various embodiments of this invention have been suggested and will be obvious in light of the present specification . it is therefore not intended that the invention be limited except as indicated in the appended claims . | 8 |
referring to fig1 through 8 , there are shown diagrammatic representations of modular units that are assembled to form one - story ( fig1 ), two - story ( fig2 ) and three - story ( fig3 ) buildings . fig4 depicts three slabs 20 hinged together to provide a three - side unit a , which when set up on a base slab 22 ( fig1 - 3 ) forms a sleeve - like module . in fig1 adjacent units a are interconnected by a single slab d ( fig7 ) to produce a one - story structure . outer and inner doors 24 and windows 26 can be formed in the side walls of units a . to complete the one - story structure of fig1 it would , of course , be necessary to seal off the open ends . to construct a two - story structure , four - sided units b ( fig5 ) comprising four hingedly - connected together slabs 28 are seated between the upper corners of adjacent spaced three - sided units a , and an end module is formed by adding a two - sided slab unit c ( fig6 ) comprising two hingedly connected slabs 30 . single slab d ( fig7 ) could be connected as shown in fig3 between the upper corners of the b units to complete the second level . the four - sided units b likewise have inner and outer doors 32 . at least one of the b units ( fig5 ) and one of the a units ( fig8 ) have formed openings 34 and 36 for a stairway entrance to the second level . the invention is directed to a method for making and assembling hingedly - connected slabs to selectively build modular buildings as diagrammatically depicted in fig1 through 8 . in fig9 and 10 , there is diagrammatically shown an on - site system for making the sleeve - like parallelogram modules in accordance with the principles of this invention . a plurality of closely - spaced longitudinally extending prestressed reinforcing wires 40 ( fig1 ) are connected between an end anchor 42 and a tensioning reel 44 . an extra wide paving machine 46 guided on rails 48 moves away from anchor 42 to pour a first layer and then returns to its starting position to lay a second layer . a parting agent is used to separate the two layers and openings 43 are box outs for stairwells , windows , doors , etc . novel hinge elements 50 ( fig1 ) are embedded at selected intervals transverse to the reinforcing wires 40 to permit the casted slabs to be folded into open - ended sleeve - like parallelogram modules 52 ( see fig1 and 12 ). one embodiment of the novel hinge element 50 is depicted in fig1 , and comprises an elongated metal strip 52 folded lengthwise into two equal portions to define hinge plates 51 and 53 ( fig1 ). notches 54 are provided along its longitudinal centerline to induce bending , and along its longitudinal edge are cut - outs 56 ( fig1 ) spaced apart an amount equal to the distance between reinforcing wires 40 for straddling these wires , which leaves access for cutting the reinforcing wires 40 between the slabs . tabs 58 are punched out along both sides of the folded portions of the strip 52 and are bent into a hook shape for anchoring in adjacent slabs to provide a hinging effect between slabs . fig1 depicts a parallelogram module 52 before it is set up . the two lower slabs 60 and 62 are extruded on the first pass of the paving machine and the two upper slabs 64 and 66 are extruded on the second pass . it is of course necessary to bend half of the two exterior hinge elements 50 -- 50 upwardly before the second pass . spacers ( not shown ) hold the opposite ends of the slabs in place during curing . when cured , the upper slabs comprising an end wall 64 and a side wall 66 are swung in the direction of the arrows from the solid line position of fig1 ( dotted line in fig1 shows intermediate position ) to the position of fig1 . fig1 shows the stacking and assembly of a parallelogram module 12 above and between two already set modular units . a jig or brace 70 is used to keep the module square while the square - shaped space 71 formed by the adjoining corners is filled with grout through a hole 73 in the shims 72 ( fig1 ). the hinge elements shown in fig1 are adapted to swing counterclockwise . the hinge element 68 in the upper layer is identical to hinge element 50 in the lower layer except hexagon - shaped cut - outs 69 are provided to accommodate the rods 40 instead of slots 56 used in hinge 50 . these cut - outs are sufficiently large to permit access for cutting reinforcing wires 40 . fig1 shows a parallelogram module 52 in its set - up position with its lower right corner grouted to the upper left corner of another parallelogram module . the shim 72 ( fig1 ) is disposed in the square - shaped gap 74 before filling it with grout . thus , the parallelogram modules bear on shims and the pumped grout without any overlap of the precast segments , i . e ., bearing forces are carried from upper walls to lower walls on the grout infill , which also fill the notches in supporting the floors . fig1 shows a front perspective view of a three - story building 80 constructed by assembling a plurality of parallelogram modules made and grouted together in accordance with the foregoing description . an end filler 82 fills the recess formed between the outside corner edges of adjacent slabs . the open ends are closed with a facade structure 84 which is manufactured off - site . these structures are self - supporting and contain mechanical equipment such as furnaces , boilers , air conditioning units , electric and gas meters , fuse boxes , fireplaces , closets , balconies , etc . site finishing is limited to an optional skim coating of concrete surfaces , dry walling the stud assemblies , underlayment , flooring , exposed wiring , plumbing connections to modules , painting , carpeting , and the hanging of pre - fit doors . there is shown in fig1 - 22 , another version of a parallelogram module which is formed in the same manner as described hereinbefore . the hinge element 90 is made of an elongated metal strip which is folded along its centerline into two equal portions to define a pair of hinge plates 92 and 94 . tabs 96 having hook ends 98 are cut transversely to its centerline , and are bent so that transverse reinforcing wires 100 interleave between alternate tabs that are separated by an acute angle to provide an alternate staggered arrangement . triangular shaped recesses 102 are formed at the ends of the longest pair of slabs 104 and 106 . the purpose of these recesses is to provide a means for gaining access to the longitudinally extending reinforcing wires 100 , which pass through the recesses 102 . as shown in fig2 , the ends of the reinforcing wires at the exterior hinges are of such a length to intertwine and thereby provide continuity to one - half the joints . many changes could be made in the above described modular building method without departure from the scope of the claims , it is intended that all matter contained in the above description shall be interpreted as illustrative and not in a limiting sense . | 4 |
although this invention is susceptible to embodiment in many different forms , preferred embodiments of the invention are shown . it should be understood , however , that the present disclosure is to be considered as an exemplification of the principles of this invention and is not intended to limit the invention to the embodiments illustrated . the growth medium of the present invention includes a water retention component admixed with soil . the water retention component is a water retaining short mineral wool fibers , vegetation , and polish or bran of a grain . the water retention component maintains water in the growth medium . plants having roots that extend into the growth medium can draw on this water and are thus sustained . alternatively , the growth medium can be an admixture of the water retention component nitrogen containing organic components and seeds that is applied to the ground . the growth medium can be made by admixing the water retention component and the soil in a conventional mixer that can cut the short mineral wool fibers and plant stalks . preferably , the growth medium is homogeneous . the growth medium can then be applied on top of the ground by spraying or spreading . preferably , the growth medium is made in situ by conventionally spraying or spreading the water retention component on top of the soil . the water retention component is then turned into the soil by a conventional farm implement such as a plow , harrow , tiller or the like to produce the growth medium . the depth of the soil into which the water retention component is mixed is selected to provide the desired thickness of the layer of growth medium . the growth medium can also include optional , preferably dry , components such as animal excrement , dead vegetative matter , plant seeds and the like . the water retention component includes at least one of short mineral wool fibers , and / or a water retaining vegative matter , e . g ., cut plant stalks ( such as corn , sugar cane and sunflower stalks ). the porosity of the soil , especially sand , is reduced by the water retention component and other ingredients , especially when the water retention component is cut mineral wool , vegetation matter and / or a grain polish . the reduction in porosity is presently believed to contribute to the water retaining capability of the growth medium . the short mineral wool fibers are of such a length that there is little entanglement of the fibers and the fibers can be admixed with the soil and other optional components of the growth medium . a collection of short mineral wool fibers is fluffy which contributes to the growth medium being relatively fluffy and having a low density . preferably , the fibers do not cause clumping of the growth medium that would require additional processing to break up the clumps . if clumps form , they do not adversely affect water retention or plant growth . representative of the mineral wool suitable for use herein are rock wool , glass wool and the like . the soil can be any soil that is capable or incapable of sustaining plant growth . a preferred soil that is incapable of sustaining plant growth is sand . the water retention components are present in the growth medium in an amount effective to increase the water retention of the soil . preferably , the ratio of the thickness of the water retention components to the thickness of the soil into which the water retention components are mixed is in the range of about 1 : 1 to about 1 : 10 , more preferably the thickness ratio is in the range of about 1 : 3 to 1 : 8 , prior to mixing . the preferred weight ratio of water retention components to soil is in the range of about 1 : 4 to about 1 : 50 , more preferably the weight ratio is in the range of about 1 : 12 to about 1 : 40 . preferably , the ratio of water retention component to soil is within at least one of the above ranges . the growth medium can be utilized with living members of the plantae kingdom . preferably , the plant is a vegetable , grain , or used for landscaping or to provide raw materials . the animal excrement that the growth medium can contain is selected to provide additional nutrients to the plant during growth and is selected to have a composition that does not adversely affect the growth of the plants . different plants have different nutritional requirements and the animal excrement can be utilized to provide some of these nutritional requirements . the excrement can be admixed with the water retention component , the soil or the growth medium . representative of the animal excrement that are suitable for use in the growth medium are chicken manure , cow manure , sewage sludge and the like . the dead vegetative matter of the growth medium can have been used to facilitate collection of the animal excrement . for example , the vegetative matter can have been spread on the ground of an animal pen . the animals pass excrement upon the vegetative matter and the excrement dries thereon . the vegetative matter having animal excrement is then collected and used in the growth medium . phosphates can be added to the vegetative matter and animal excrement . the vegetative matter can be cut with or without excrement to facilitate mixing with the remainder of the growth medium . the vegetative matter can be cut by the blades of the mixer . the vegetative matter can be utilized without having animal excrement thereon . the vegetative matter can be admixed with the water retention component , the soil or the growth medium . the vegetative matter could be composted earlier to contribute to the soil with slow release nitrogen rich organic matter which makes an excellent nutrient to the plant . this natural fertilizer produces better and healthier crops . the nitrogen rich natural organic vegetative matter can eliminate the use of chemical fertilizers which could be harmful to the soil . representative of the dead vegetative matter suitable for use in the growth medium are straw , hay , plant ( e . g . corn ) stalks , peat and the like . when the growth medium is produced in situ and the plant seeds with which the growth medium is to be sown are relatively small it is highly desirable to admix the water retention component with the seeds prior to application on top of the soil . the admixture can be applied using a jet air pump . alternatively , the seeds can be admixed with the soil or growth medium . representative vegetables include tomatoes , cucumbers , melons , legumes , potatoes lupin beans , chick peas and the like . representative grains include barley , wheat , soybean , corn and the like . representative landscaping plants include grasses , alfalfa , and the like . representative of plants used to provide raw materials include jute , cotton and the like . conventional chemical fertilizers , insecticides , herbicides and the like need not be applied to the plants during the growth of the plants since the growth medium mixture can furnish the soil with rich natural organic nutrients . a layer of growth medium of about 0 . 5 to about 5 centimeters ( cm ) thick can be used for many plants such as vegetables , grasses , grains and the like . roots of these plants will extend into the growth medium . some roots can extend through the growth medium into the soil below the growth medium to provide additional stability for the plant . offshoots of the roots extending into the soil can seek water and can turn upward toward the growth medium which has water . for larger plants such as shrubs , trees and the like , a thicker layer of growth medium is desired . alternatively , when the growth medium is an admixture of the water retention components and plant seeds , the growth medium can be applied on top of the soil without mixing the growth medium into soil . this alternative is especially useful in areas where it is difficult to mix the growth medium into the soil . preferably , this growth medium is applied at a thickness of in the range of about 0 . 5 to about 1 cm . experiments were conducted using growth mediums made from rice polish as the water retention component mixed with manure and sand from the northeastern desert of egypt close to mansoura as the soil . a control for each experiment was run using sand alone or sand admixed with a fertilizer . in one experiment , growth mediums 1 , 2 , 3 , 4 and were produced by admixing rice polish and sand in thickness ratios of 1 : 1 cm , 1 : 3 cm , 1 : 5 cm , 1 : 7 cm and 1 : 9 cm , respectively . control 1 was sand alone . equal amounts of water was introduced to each of the growth mediums and control 1 . the conditions to which the growth mediums and control 1 were exposed were identical . after a time period of three days , the growth mediums ranged from wet to humid to the touch with the growth mediums having the higher concentration of rice polish being wet and those having a lower concentration being humid . control 1 was dry to the touch . this experiment indicates that the growth medium retains water better than sand . in another experiment , growth mediums 6 , 7 and 8 were produced by admixing rice polish and sand in a thickness ratio of 1 : 3 cm , 1 : 5 cm and 1 : 7 cm , respectively , admixing 80 weight percent ( wt %) of the rice polish and sand admixture , 15 wt % straw and 5 wt % chicken excrement and seeds . a control 2 was produced by admixing sand , fertilizer and seeds . growth mediums 6 , 7 and 8 and control 2 were maintained outside under identical conditions . water was provided at the same time intervals to growth mediums 6 , 7 and 8 and control 2 . two samples of each of the growth mediums 6 , 7 and 8 were tested using water levels of one and two liters , respectively . both water levels resulted in good growth of the seeds . one sample of control 2 was treated with two liters of water and resulted in seed growth that was not good . the seed growth was about 2 . 5 times better for growth mediums 6 , 7 and 8 than for control 2 . representative of the seeds that were tested include tomatoes , chick peas , eggplant , wheat , soybean , corn , barley , lupin beans and jute . this experiment indicates that the growth medium can sustain superior plant growth . the growth medium can sustain plant growth for more than one growing season if conditions are favorable . the ability to obtain more than one planting using the growth medium enhances the cost effectiveness because the cost of purchasing and applying the growth medium can be spread over more than one growing season . it is possible that the infertile land can be converted permanently to fertile land by one application of the growth medium provided the land is well maintained and replanted . the unharvested portions of the plant can , when plowed back into the land , provide additional nitrogen to improve the land . reduced amounts of growth medium , as compared to the initially applied amount , can be added to the land in the future to further enhance water retention . the growth medium enables plants to be grown with less water . the ability to sustain plant growth using less water promotes water conservation and can enable plants to be grown in environments such as deserts having little water and therefore little ability to sustain plant growth . the growth medium can also be used in environments having little soil such as rocky environments . the method of making the growth medium in situ by applying the water retention components on top of the soil or mixing it into the soil provides an easy and economical way of making the growth medium . this invention has been described in terms of specific embodiments set forth in detail , but it should be understood that these are by way of illustration only and that the invention is not necessarily limited thereto . modifications and variations will be apparent from this disclosure and may be resorted to without departing from the spirit of this invention , as those skilled in the art will readily understand . accordingly , such variations and modifications of the disclosed products are considered to be within the purview and scope of this invention and the following claims . | 8 |
refer now to the drawings wherein depicted elements are , for the sake of clarity , not necessarily shown to scale and wherein like or similar elements are designated by the same reference numeral through the several views . referring to fig4 of the drawings , the reference numeral 400 generally designates a ti adc in accordance with a preferred embodiment of the present invention . adc 400 generally comprises adc branches 402 - 1 to 402 - m , divider 404 , multiplexer or mux 408 , and a mismatch estimation circuit 410 . each adc branch 402 - 1 to 402 - m also generally comprises ( respectively ) adc 410 - 1 to 410 - m , correction circuit 416 - 1 to 416 - m , and adjustable delay element or circuit 418 - 1 to 418 - m . additionally , each adc 410 - 1 to 410 - m generally comprises ( respectively ) a t / h circuit 410 - 1 to 410 - m and a sub - adc 414 - 1 to 414 - m . in operation , ti adc 400 converts analog input signal x ( t ) to a digital signal y [ n ]. to accomplish this , divider 402 divides a clock signal clk ( with a frequency of f s or period of t s ) into m clock signals ( each with a frequency of f s / m ) that are staggered by delay circuits 418 - 1 to 418 - m and provided to adcs 410 - 1 to 410 - m . this allows each of adcs 410 - 1 to 410 - m to convert the analog signal x ( t ) to digital signals x 1 ( k ) to x m ( k ). the gain and dc offset adjustments are applied to digital signals x 1 ( k ) to x m ( k ) by correction circuits 416 - 1 to 416 - m to generate digital signals y [ 1 ] to y [ m ], which can then be multiplexed by mux 408 to generate a digital signal y [ n ]. to generally ensure that signals y [ 0 ] to y [ m − 1 ] are matched , mismatch estimation circuit 410 calculates and compensates for gain mismatches , dc offset mismatches , timing skews , and bandwidth mismatches . the mismatch estimation circuit 410 is generally a digital signals processor ( dsp ) or dedicated hardware , which determines the gain mismatches , dc offset mismatches , timing skews , and bandwidth mismatches and which can provide adjustments for gain , dc offset , timing skew , and bandwidth to correction circuits 416 - 1 to 416 - m and t / h circuits 412 - 1 to 412 - m . a more complete explanation of the mismatch estimation circuit 410 can be found in co - pending u . s . patent application ser . no . 12 / 572 , 717 , which is entitled “ bandwidth mismatch estimation in time - interleaved analog - to - digital converters ,” and which is incorporated by reference for all purposes . turning now to fig5 , t / h circuits 412 - 1 to 412 - m ( hereinafter referred to as 412 for the sake of simplicity ) can be seen in greater detail . t / h circuit 412 generally comprises a bootstrap circuit 502 , a controller 504 , a sampling switch 51 ( which is typically an nmos transistor or nmos switch ), a sampling capacitor csample , and an output circuit 506 . in operation , the bootstrap circuit 502 controls the actuation and de - actuation of the sampling switch 51 based at least in part on a clock signal clkin ( which is received from a respective delay circuit 418 - 1 to 418 - m ) and a control voltage vcntl from controller 504 . generally , the mismatch estimation circuit 406 provides a control signal to the controller 504 ( which may be a digital - to - analog converter ( dac ) or charge pump ) to generate the control voltage vcntl . the control voltage vcntl , through the bootstrap circuit 502 , is able to control the gate voltage of the sampling switch s 1 to adjust the impedance or “ on ” resistance of the sampling switch s 1 when the sampling switch s 1 is actuated . looking to fig6 , the bootstrap circuit 502 can be seen in greater detail . when the clock signal clkin is logic low ( such as during a hold phase ), inverter 508 turns transistor q 1 ( which is typically an nmos transistor ) “ on ,” while passgate circuit ( which generally comprises transistors q 2 , q 3 , and q 5 ) maintains transistor q 4 ( which is generally a pmos transistor ) in an “ off ” state . assuming that signal clkz is logic high so that transistors q 8 and q 9 ( which are typically nmos transistors ) are in an “ on ” state and during this logic low period of clock signal clkin , supply voltage vdd charges the boost capacitor cboost . when clock signal clkin transitions to logic high , passgate circuit turns transistor q 4 “ on ,” while transistors q 1 is turned “ off .” at this point , a voltage is applied to the gate of sampling switch s 1 to turn it “ on .” this gate voltage for sampling switch s 1 is generated at least in part from the discharge of capacitor cboost , the input signal in ( which is applied through transistor q 6 ), and the control voltage vcntl ( which is applied through the passgate circuit and the skew circuit ( which generally comprises transistors q 7 and q 8 )). generally , this control voltage vcntl is applied to the source of transistor q 2 ( which is generally a pmos transistor ) and the gate of transistor q 7 ( which is generally an nmos transistor ) so as to adjust the gate voltage of sample switch s 1 . thus , the gate voltage of the sampling switch s 1 can be easily controlled by varying control voltage vcntl . additionally , because the sampling switch s 1 is generally a nmos switch operating in a linear region , variation of this gate voltage varies the “ on ” resistance of the sampling switch s 1 , which adjusts the filter characteristics ( and bandwidth ) of the filter created by the sampling switch s 1 , resistor r 1 , and sampling capacitor csample . to illustrate the operation to bootstrap circuit 502 and sampling switch s 1 , a graph depicting bandwidth of t / h circuit 412 versus “ on ” resistance for the sampling switch s 1 can be seen in fig7 . as can be seen , the bandwidth for t / h circuit 502 varies between about 2 . 956 ghz at for a vcntl dac code of zero to about 3 . 051 ghz for a vcntl dac code of 1023ω . thus , the bandwidths for multiple t / h circuits 412 ( such as 412 - 1 to 412 - m ) with nominal bandwidths of 3 ghz can be adjusted to match one another to between about 0 . 25 % and about 0 . 1 %. having thus described the present invention by reference to certain of its preferred embodiments , it is noted that the embodiments disclosed are illustrative rather than limiting in nature and that a wide range of variations , modifications , changes , and substitutions are contemplated in the foregoing disclosure and , in some instances , some features of the present invention may be employed without a corresponding use of the other features . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the scope of the invention . | 7 |
example embodiments of the present work exploit capabilities of the ldc1000 inductance - to - digital converter . this conventional measurement device is commercially available from texas instruments incorporated , and its corresponding datasheet is submitted herewith and incorporated herein by reference . the ldc1000 is designed for measurement of eddy current losses to support positional and proximity measurements . the present work recognizes that the ldc1000 may be used to obtain accurate , contactless measurements of a remote resistance as described in detail below . referencing fig1 , and as described in the datasheet , the ldc1000 makes a measurement of a “ virtual resistance ” rs ( d ) that is associated with eddy current losses in a metal target ( not shown in fig1 ) located at a distance apart from the ldc1000 . the ldc1000 controls the operation of voltage source vs , thereby producing an electromagnetic field e as a function of inductor 15 and capacitor 16 . the field e generates eddy currents in the aforementioned metal target , and the ldc1000 measures energy injected back into the inductor / capacitor arrangement 15 / 16 due to changes in the field e caused by the eddy currents . example embodiments of the present work utilize an inductor 17 and ( optionally ) a tuned capacitor 18 connected in parallel with the remote resistive element 11 that is to be measured without contact , to form a passive electrical circuit 19 . so , for example , the entire passive circuit 19 would be embedded in a high volume product instead of just the resistance 11 . in some embodiments , inductor 17 is the same construction as ( i . e ., identical to ) inductor 15 , and capacitor 18 is the same as capacitor 16 . the ldc1000 may be used in the same manner as described in the datasheet , but with the aforementioned metal target replaced by the passive circuit 19 as shown in fig1 . in conventional use of the ldc1000 , a “ proximity ” reading is produced by the ldc1000 &# 39 ; s graphical user interface ( gui ) companion software , and this reading corresponds to the aforementioned eddy current losses in the metal target . according to example embodiments of the present work , the proximity reading produced by the gui software correlates to the resistance of the resistive element 11 . fig2 diagrammatically illustrates an arrangement that supports contactless remote measurement of resistance according to example embodiments of the present work . the arrangement of fig2 maintains a predetermined positional relationship between the ldc1000 and the passive circuit 19 ( embedded in an enclosing material in some embodiments ). as shown , some embodiments use a variable spacer 20 ( e . g ., a polycarbonate material ) that maintains the ldc1000 and the passive circuit 19 separated by a selected spacer distance ( see also d in fig1 ), with the winding axes of the inductors 15 and 17 maintained in substantially coaxial alignment with one another , as shown generally by axis 21 . numerous suitable techniques and structures are conventionally available for use in effecting and maintaining the aforementioned predetermined positional relationship , and their application for such purposes is well within ordinary skill in the art . the ldc1000 is connected to a suitable computer 24 via a suitable connector 22 and cable 23 assembly . in some embodiments , the computer 24 is a desktop or laptop personal computer , and the cable / connector assembly 22 / 23 is a usb assembly . the ldc1000 is capable of providing its proximity reading to its companion gui software on the computer 24 . the variable spacer 20 permits collection of proximity readings for a plurality of known separation distances ( see d in fig1 ) between the ldc1000 inductor 15 and the inductor 17 of the passive circuit 19 . for a given distance and unknown resistance 11 , the proximity reading can be evaluated relative to corresponding test data , namely , proximity readings taken at the same distance for a plurality of different known resistances . by this evaluation , the resistance of the resistive element 11 may be determined ( or interpolated or inferred ). in some embodiments , the aforementioned test data is collected by providing a passive circuit having inductor 17 ( and optionally capacitor 18 ) connected in parallel with a variable resistance . with the ldc1000 and the passive circuit separated by a selected distance , proximity readings are taken for a plurality of different known resistances . the process may then be repeated for each of a plurality of different separation distances . fig3 diagrammatically illustrates an arrangement that supports test data collection according to example embodiments of the present work . in some embodiments , the arrangement of fig3 is the same as fig2 , except that a variable resistor 35 ( e . g ., a potentiometer in some embodiments ) replaces unknown resistance 11 in passive circuit 19 ( see fig1 and 2 ). the variable resistor 35 is arranged in parallel with inductor 17 ( and capacitor 18 in some embodiments ) to construct a “ test ” passive circuit for test data collection . this “ test ” passive circuit is designated generally by 19 ′ in fig3 . the variable resistor 35 can provide a plurality of known resistance values for use in test data collection . as shown in fig3 , the variable resistor 35 is removably connected into the passive circuit 19 ′ by suitably disconnectable jumper wires 39 , and is also removably connected to an ohm meter 38 by similar disconnectable jumper wires . this permits the variable resistor 35 to be removed from the “ test ” passive circuit 19 ′, then connected to the ohm meter 38 , then set to a desired resistance using the ohm meter 38 , then disconnected from the ohm meter 38 , and then reconnected into the passive circuit 19 ′ for a test measurement . for calibration purposes , some embodiments provide a “ calibration ” passive circuit that is constructed the same as the passive circuit 19 in the actual product whose resistance will be measured ( e . g ., configured as in fig1 and embedded in a high volume product ), but containing one of the aforementioned “ known ” resistance values ( e . g ., 10 k ohms +/− 1 %) in place of the unknown resistance 11 of fig1 . this “ calibration ” passive circuit is disposed to be nearly co - located with the passive circuit 19 ( see fig1 and 2 ) that is provided in the actual product and whose resistance 11 is unknown . measurements of the known resistance of the calibration circuit , which known resistance is also measured during the aforementioned test data collection , provides an opportunity to determine a calibration relationship to be applied between measurements of the unknown resistance and measurements of known resistances taken during test data collection . in this manner there may be effected reductions in the impacts of factors such as variability in coupling , nearby metal objects and , more generally , differences between operating conditions in effect during test data collection and operating conditions in effect during unknown resistance measurement . additional description of determining the calibration relationship appears further below . fig4 illustrates test data collection operations described above according to example embodiments of the present work . with the spacer distance set at 41 , and the resistance ( variable resistor ) set at 42 , a proximity reading is taken at 43 , and then recorded at 44 together with the spacer distance and resistance . as shown at 45 , the operations at 42 - 44 are repeated for a plurality of different ( known ) resistances . as shown at 46 , the operations at 41 - 45 are repeated for a plurality of spacer distances . after test data collection is completed , the information that has been recorded at 44 provides , for each of a plurality of spacer distances , a plurality of resistances and their respectively corresponding proximity readings . this information may be used to construct a suitable database ( db ) from which a resistance value may be obtained for a given combination of a proximity reading and a spacer distance . one example of such a database is shown graphically at 50 in fig5 , where each of the proximity versus resistance curves 51 corresponds to a respective one of the noted spacer distances . the leftmost curve corresponds to the largest noted spacer distance ( 146 mils in the fig5 example ), and the spacer distances decrease from left to right , with the rightmost curve corresponding to the smallest noted spacer distance ( 38 mils in the fig5 example ). for a given proximity reading taken at a given spacer distance , the information provided by the curves 51 may be used to determine the unknown resistance of the resistive element 11 . fig6 illustrates operations described above for obtaining a calibration relationship according to example embodiments of the present work . at 61 , a known resistance is set within a “ calibration ” passive circuit that is otherwise constructed ( e . g ., embedded in a product , etc .) the same as the passive circuit 19 containing the unknown resistance 11 ( see also fig1 and 2 ). the spacer distance is set at 62 . a proximity reading is taken at 63 , under operating conditions that approximate , as nearly as is practical , those in which proximity readings for the unknown resistance are taken . the proximity reading is used at 64 , together with the spacer distance , to obtain the corresponding resistance from the database produced by the operations of fig4 . at 65 , the known resistance , as set at 61 , and the database resistance obtained at 64 are used ( e . g ., compared ) to establish a calibration relationship for resistances measured at the current spacer distance , as set at 62 . as shown at 66 , the operations at 62 - 65 may be repeated to obtain calibration relationships for a plurality of spacer distances . fig7 illustrates operations described above for non - contact resistance measurement according to example embodiments of the present work . after setting the spacer distance at 71 , a proximity reading is taken at 72 . at 73 , the proximity reading and spacer distance are used to obtain a resistance from the database produced by the operations of fig4 . in some embodiments , the obtained resistance is then calibrated at 74 , using the calibration relationship produced by the operations of fig6 , to produce a calibrated resistance . some embodiments omit calibration , as shown by broken line . as shown at 75 , some embodiments repeat the operations at 71 - 74 for a plurality of spacer distances . at 76 , the desired resistance determination is made . in various embodiments , the determination at 76 is one of : simply a single database resistance value obtained using a singe proximity reading taken at a single spacer distance ; a single calibrated resistance value determined by calibrating a singe database resistance value obtained using a single proximity reading taken at a single spacer distance ; a result of combining ( e . g ., averaging ) a plurality of database resistance values respectively obtained using a plurality of proximity readings taken respectively at a plurality of spacer distances ; and a result of combining ( e . g ., averaging ) a plurality of calibrated resistance values determined respectively by calibrating a plurality of database resistance values respectively obtained using a plurality of proximity readings taken respectively at a plurality of spacer distances . in some embodiments that measure thermistor resistances , for each spacer distance used , each of the proximity readings described above relative to fig4 - 7 is taken at a plurality of different temperatures , thereby providing additional information indicative of relationships between proximity reading , thermistor resistance and temperature . the ldc1000 is further capable of providing an inductance measurement reading to the gui software on computer 24 ( see fig2 ), together with its aforementioned proximity reading . some embodiments use the inductance measurement to aid in normalizing the aforementioned resistance determinations as a function of spacer distance . as is evident from the foregoing , the present work provides simple , integrated , low cost non - contact resistance measurement . example embodiments can be implemented in harsh environments . other advantages include simple operation ; low cost measurement device ( e . g ., ldc1000 ); elimination of existing connectors in various products ; and enablement of new use - cases without requiring addition of connectors . although example embodiments of the present work have been described above in detail , this does not limit the scope of the work , which can be practiced in a variety of embodiments . | 6 |
it is to be understood that unless otherwise indicated this invention is not limited to specific reactants , reaction conditions , or the like , as such may vary . it is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting . as used in the specification and the appended claims , the singular forms “ a ,” “ an ” and “ the ” include plural referents unless the context clearly dictates otherwise . thus , for example , reference to “ a catalyst ” or “ a complex ” encompasses a combination or mixture of different catalysts or complexes as will as a single catalyst or complex , reference to “ a substituent ” includes a single substituent as well as two or more substituents that may or may not be the same , and the like . in this specification and in the claims that follow , reference will be made to a number of terms , which shall be defined to have the following meanings . the phrase “ having the formula ” or “ having the structure ” is not intended to be limiting and is used in the same way that the term “ comprising ” is commonly used . the term “ alkyl ” as used herein refers to a linear , branched , or cyclic saturated hydrocarbon group typically although not necessarily containing 1 to about 20 carbon atoms , preferably 1 to about 12 carbon atoms , such as methyl , ethyl , n - propyl , isopropyl , n - butyl , isobutyl , t - butyl , octyl , decyl , and the like , as well as cycloalkyl groups such as cyclopentyl , cyclohexyl and the like . generally , although again not necessarily , alkyl groups herein contain 1 to about 12 carbon atoms . the term “ lower alkyl ” intends an alkyl group of 1 to 6 carbon atoms , and the specific term “ cycloalkyl ” intends a cyclic alkyl group , typically having 4 to 8 , preferably 5 to 7 , carbon atoms . the term “ substituted alkyl ” refers to alkyl substituted with one or more substituent groups , and the terms “ heteroatom - containing alkyl ” and “ heteroalkyl ” refer to alkyl in which at least one carbon atom is replaced with a heteroatom . if not otherwise indicated , the terms “ alkyl ” and “ lower alkyl ” include linear , branched , cyclic , unsubstituted , substituted , and / or heteroatom - containing alkyl and lower alkyl , respectively . the term “ alkylene ” as used herein refers to a difunctional linear , branched , or cyclic alkyl group , where “ alkyl ” is as defined above . the term “ alkenyl ” as used herein refers to a linear , branched , or cyclic hydrocarbon group of 2 to about 20 carbon atoms containing at least one double bond , such as ethenyl , n - propenyl , isopropenyl , n - butenyl , isobutenyl , octenyl , decenyl , tetradecenyl , hexadecenyl , eicosenyl , tetracosenyl , and the like . preferred alkenyl groups herein contain 2 to about 12 carbon atoms . the term “ lower alkenyl ” intends an alkenyl group of 2 to 6 carbon atoms , and the specific term “ cycloalkenyl ” intends a cyclic alkenyl group , preferably having 5 to 8 carbon atoms . the term “ substituted alkenyl ” refers to alkenyl substituted with one or more substituent groups , and the terms “ heteroatom - containing alkenyl ” and “ heteroalkenyl ” refer to alkenyl in which at least one carbon atom is replaced with a heteroatom . if not otherwise indicated , the terms “ alkenyl ” and “ lower alkenyl ” include linear , branched , cyclic , unsubstituted , substituted , and / or heteroatom - containing alkenyl and lower alkenyl , respectively . the term “ alkenylene ” as used herein refers to a difunctional linear , branched , or cyclic alkenyl group , where “ alkenyl ” is as defined above . the term “ alkynyl ” as used herein refers to a linear or branched hydrocarbon group of 2 to about 20 carbon atoms containing at least one triple bond , such as ethynyl , n - propynyl , and the like . preferred alkynyl groups herein contain 2 to about 12 carbon atoms . the term “ lower alkynyl ” intends an alkynyl group of 2 to 6 carbon atoms . the term “ substituted alkynyl ” refers to alkynyl substituted with one or more substituent groups , and the terms “ heteroatom - containing alkynyl ” and “ heteroalkynyl ” refer to alkynyl in which at least one carbon atom is replaced with a heteroatom . if not otherwise indicated , the terms “ alkynyl ” and “ lower alkynyl ” include linear , branched , unsubstituted , substituted , and / or heteroatom - containing alkynyl and lower alkynyl , respectively . the term “ alkynylene ” as used herein refers to a difunctional alkynyl group , where “ alkynyl ” is as defined above . the term “ alkoxy ” as used herein intends an alkyl group bound through a single , terminal ether linkage ; that is , an “ alkoxy ” group may be represented as — o - alkyl where alkyl is as defined above . a “ lower alkoxy ” group intends an alkoxy group containing 1 to 6 carbon atoms . analogously , “ alkenyloxy ” and “ lower alkenyloxy ” respectively refer to an alkenyl and lower alkenyl group bound through a single , terminal ether linkage , and “ alkynyloxy ” and “ lower alkynyloxy ” respectively refer to an alkynyl and lower alkynyl group bound through a single , terminal ether linkage . the term “ aryl ,” as used herein and unless otherwise specified , refers to an aromatic substituent containing a single aromatic ring or multiple aromatic rings that are fused together , directly linked , or indirectly linked ( such that the different aromatic rings are bound to a common group such as a methylene or ethylene moiety ). preferred aryl groups contain 5 to 24 carbon atoms , and particularly preferred aryl groups contain 5 to 14 carbon atoms . exemplary aryl groups contain one aromatic ring or two fused or linked aromatic rings , e . g ., phenyl , naphthyl , biphenyl , diphenylether , diphenylamine , benzophenone , and the like . “ substituted aryl ” refers to an aryl moiety substituted with one or more substituent groups , and the terms “ heteroatom - containing aryl ” and “ heteroaryl ” refer to aryl substituent , in which at least one carbon atom is replaced with a heteroatom , as will be described in further detail infra . the term “ aryloxy ” as used herein refers to an aryl group bound through a single , terminal ether linkage , wherein “ aryl ” is as defined above . an “ aryloxy ” group may be represented as — o - aryl where aryl is as defined above . preferred aryloxy groups contain 5 to 20 carbon atoms , and particularly preferred aryloxy groups contain 5 to 14 carbon atoms . examples of aryloxy groups include , without limitation , phenoxy , o - halo - phenoxy , m - halo - phenoxy , p - halo - phenoxy , o - methoxy - phenoxy , m - methoxy - phenoxy , p - methoxy - phenoxy , 2 , 4 - dimethoxy - phenoxy , 3 , 4 , 5 - trimethoxy - phenoxy , and the like . the term “ alkaryl ” refers to an aryl group with an alkyl substituent , and the term “ aralkyl ” refers to an alkyl group with an aryl substituent , wherein “ aryl ” and “ alkyl ” are as defined above . preferred alkaryl and aralkyl groups contain 6 to 24 carbon atoms , and particularly preferred alkaryl and aralkyl groups contain 6 to 16 carbon atoms . alkaryl groups include , for example , p - methylphenyl , 2 , 4 - dimethylphenyl , p - cyclohexylphenyl , 2 , 7 - dimethylnaphthyl , 7 - cyclooctylnaphthyl , 3 - ethyl - cyclopenta - 1 , 4 - diene , and the like . examples of aralkyl groups include , without limitation , benzyl , 2 - phenyl - ethyl , 3 - phenyl - propyl , 4 - phenyl - butyl , 5 - phenyl - pentyl , 4 - phenylcyclohexyl , 4 - benzylcyclohexyl , 4 - phenylcyclohexylmethyl , 4 - benzylcyclohexylmethyl , and the like . the terms “ alkaryloxy ” and “ aralkyloxy ” refer to substituents of the formula — or wherein r is alkaryl or aralkyl , respectively , as just defined . the term “ acyl ” refers to substituents having the formula —( co )- alkyl , —( co )- aryl , or —( co )- aralkyl , and the term “ acyloxy ” refers to substituents having the formula — o ( co )- alkyl , — o ( co )- aryl , or — o ( co )- aralkyl , wherein “ alkyl ,” “ aryl , and “ aralkyl ” are as defined above . the term “ cyclic ” refers to alicyclic or aromatic substituents that may or may not be substituted and / or heteroatom containing , and that may be monocyclic , bicyclic , or polycyclic . the term “ alicyclic ” is used in the conventional sense to refer to an aliphatic cyclic moiety , as opposed to an aromatic cyclic moiety , and may be monocyclic , bicyclic , or polycyclic . the terms “ halo ” and “ halogen ” are used in the conventional sense to refer to a chloro , bromo , and fluoro or iodo substituent . “ hydrocarbyl ” refers to univalent hydrocarbyl radicals containing 1 to about 30 carbon atoms , preferably 1 to about 24 carbon atoms , most preferably 1 to about 12 carbon atoms , including linear , branched , cyclic , saturated , and unsaturated species , such as alkyl groups , alkenyl groups , aryl groups , and the like . the term “ lower hydrocarbyl ” intends a hydrocarbyl group of 1 to 6 carbon atoms , preferably 1 to 4 carbon atoms , and the term “ hydrocarbylene ” intends a divalent hydrocarbyl moiety containing 1 to about 30 carbon atoms , preferably 1 to about 24 carbon atoms , most preferably 1 to about 12 carbon atoms , including linear , branched , cyclic , saturated and unsaturated species . the term “ lower hydrocarbylene ” intends a hydrocarbylene group of 1 to 6 carbon atoms . “ substituted hydrocarbyl ” refers to hydrocarbyl substituted with one or more substituent groups , and the terms “ heteroatom - containing hydrocarbyl ” and “ heterohydrocarbyl ” refer to hydrocarbyl in which at least one carbon atom is replaced with a heteroatom . similarly , “ substituted hydrocarbylene ” refers to hydrocarbylene substituted with one or more substituent groups , and the terms “ heteroatom - containing hydrocarbylene ” and heterohydrocarbylene ” refer to hydrocarbylene in which at least one carbon atom is replaced with a heteroatom . unless otherwise indicated , the term “ hydrocarbyl ” and “ hydrocarbylene ” are to be interpreted as including substituted and / or heteroatom - containing hydrocarbyl and hydrocarbylene moieties , respectively . the term “ heteroatom - containing ” as in a “ heteroatom - containing hydrocarbyl group ” refers to a hydrocarbon molecule or a hydrocarbyl molecular fragment in which one or more carbon atoms is replaced with an atom other than carbon , e . g ., nitrogen , oxygen , sulfur , phosphorus or silicon , typically nitrogen , oxygen or sulfur . similarly , the term “ heteroalkyl ” refers to an alkyl substituent that is heteroatom - containing , the term “ heterocyclic ” refers to a cyclic substituent that is heteroatom - containing , the terms “ heteroaryl ” and heteroaromatic ” respectively refer to “ aryl ” and “ aromatic ” substituents that are heteroatom - containing , and the like . it should be noted that a “ heterocyclic ” group or compound may or may not be aromatic , and further that “ heterocycles ” may be monocyclic , bicyclic , or polycyclic as described above with respect to the term “ aryl .” by “ substituted ” as in “ substituted hydrocarbyl ,” “ substituted alkyl ,” “ substituted aryl ,” and the like , as alluded to in some of the aforementioned definitions , is meant that in the hydrocarbyl , alkyl , aryl , or other moiety , at least one hydrogen atom bound to a carbon ( or other ) atom is replaced with one or more non - hydrogen substituents . examples of such substituents include , without limitation : functional groups referred to herein as “ fn ,” such as halo , hydroxyl , sulfhydryl , c 1 - c 20 alkoxy , c 2 - c 20 alkenyloxy , c 2 - c 20 alkynyloxy , c 5 - c 24 aryloxy , c 6 - c 24 aralkyloxy , c 6 - c 24 alkaryloxy , acyl ( including c 2 - c 20 alkylcarbonyl (— co — alkyl ) and c 6 - c 24 arylcarbonyl (— co - aryl )), acyloxy (— o - acyl , including c 2 - c 20 alkylcarbonyloxy (— o — co - alkyl ) and c 6 - c 24 arylcarbonyloxy (— o — co - aryl )), c 2 - c 20 alkoxycarbonyl (—( co )— o - alkyl ), c 6 - c 24 aryloxycarbonyl (—( co )— o - aryl ), halocarbonyl (— co )— x where x is halo ), c 2 - c 20 alkylcarbonato (— o —( co )— o - alkyl ), c 6 - c 24 arylcarbonato (— o —( co )— o - aryl ), carboxy (— cooh ), carboxylato (— coo − ), carbamoyl (—( co )— nh 2 ), mono -( c 1 - c 20 alkyl )- substituted carbamoyl (—( co )— nh ( c 1 - c 20 alkyl )), di -( c 1 - c 20 alkyl )- substituted carbamoyl (—( co )— n ( c 1 - c 20 alkyl ) 2 ), mono -( c 5 - c 24 aryl )- substituted carbamoyl (—( co )— nh - aryl ), di -( c 5 - c 24 aryl )- substituted carbamoyl (—( co )— n ( c 5 - c 24 aryl ) 2 ), di - n —( c 1 - c 20 alkyl ), n —( c 5 - c 24 aryl )- substituted carbamoyl , thiocarbamoyl (—( cs )— nh 2 ), mono -( c 1 - c 20 alkyl )- substituted thiocarbamoyl (—( co )— nh ( c 1 - c 20 alkyl )), di -( c 1 - c 20 alkyl )- substituted thiocarbamoyl (—( co )— n ( c 1 - c 20 alkyl ) 2 ), mono -( c 5 - c 24 aryl )- substituted thiocarbamoyl (—( co )— nh - aryl ), di -( c 5 - c 24 aryl )- substituted thiocarbamoyl (—( co )— n ( c 5 - c 24 aryl ) 2 ), di - n —( c 1 - c 20 alkyl ), n —( c 5 - c 24 aryl )- substituted thiocarbamoyl , carbamido (— nh —( co )— nh 2 ), cyano (— c ≡ n ), cyanato (— o — c ≡ n ), thiocyanato (— s — c ≡ n ), isocyano (— n +≡ c − ), formyl (—( co )— h ), thioformyl (—( cs )— h ), amino (— nh 2 ), mono -( c 1 - c 20 alkyl )- substituted amino , di -( c 1 - c 20 alkyl )- substituted amino , mono -( c 5 - c 24 aryl )- substituted amino , di -( c 5 - c 24 aryl )- substituted amino , c 2 - c 20 alkylamido (— nh —( co )- alkyl ), c 6 - c 24 arylamido (— nh —( co )- aryl ), imino (— cr ═ nh where r = hydrogen , c 1 - c 20 alkyl , c 5 - c 24 aryl , c 6 - c 24 alkaryl , c 6 - c 24 aralkyl , etc . ), c 2 - c 20 alkylimino (— cr ═ n ( alkyl ), where r = hydrogen , c 1 - c 20 alkyl , c 5 - c 24 aryl , c 6 - c 24 alkaryl , c 6 - c 24 aralkyl , etc . ), arylimino (— cr ═ n ( aryl ), where r = hydrogen , c 1 - c 20 alkyl , c 5 - c 24 aryl , c 6 - c 24 alkaryl , c 6 - c 24 aralkyl , etc . ), nitro (— no 2 ), nitroso (— no ), sulfo (— so 2 — oh ), sulfonato (— so 2 — o − ), c 1 - c 20 alkylsulfanyl (— s - alkyl ; also termed “ alkylthio ”), c 5 - c 24 arylsulfanyl (— s - aryl ; also termed “ arylthio ”), c 1 - c 20 alkyldithio (— s — s - alkyl ), c 5 - c 24 aryldithio (— s — s - aryl ), c 1 - c 20 alkylsulfinyl (—( so )- alkyl ), c 5 - c 24 arylsulfinyl (—( so )- aryl ), c 1 - c 20 alkylsulfonyl (— so 2 - alkyl ), c 5 - c 24 arylsulfonyl (— so 2 - aryl ), boryl (— bh 2 ), borono (— b ( oh ) 2 ), boronato (— b ( or ) 2 where r is alkyl or other hydrocarbyl ), phosphono (— p ( o )( oh ) 2 ), phosphonato (— p ( o )( o ) 2 ), phosphinato (— p ( o )( o − ), phospho (— po 2 ), phosphino (— ph 2 ), silyl (— sir 3 wherein r is hydrogen or hydrocarbyl ), and silyloxy (— o - silyl ), and the hydrocarbyl moieties c 1 - c 20 alkyl ( preferably c 1 - c 12 alkyl , more preferably c 1 - c 6 alkyl ), c 2 - c 20 alkenyl ( preferably c 2 - c 12 alkenyl , more preferably c 2 - c 6 alkenyl ), c 2 - c 20 alkynyl ( preferably c 2 - c 12 alkynyl , more preferably c 2 - c 6 alkynyl ), c 5 - c 24 aryl ( preferably c 5 - c 14 aryl ), c 6 - c 24 alkaryl ( preferably c 6 - c 16 alkaryl ), and c 6 - c 24 aralkyl ( preferably c 6 - c 16 aralkyl ). in addition , the aforementioned functional groups may , if a particular group permits , be further substituted with one or more additional functional groups or with one or more hydrocarbyl moieties such as those specifically enumerated above . analogously , the above - mentioned hydrocarbyl moieties may be further substituted with one or more functional groups or additional hydrocarbyl moieties such as those specifically enumerated . in the molecular structures herein , the use of bold and dashed lines to denote particular conformation of groups follows the iupac convention . a bond indicated by a broken line indicates that the group in question is below the general plane of the molecule as drawn , and a bond indicated by a bold line indicates that the group at the position in question is above the general plane of the molecule as drawn . in one embodiment , then , the invention provides a group 8 transition metal complex having the structure of formula ( i ) the bonds indicated as dashed lines and designated as α and β represent single bonds or unsaturated ( e . g ., double ) bonds , with the proviso that α and β cannot both be unsaturated bonds ; r 1 and r 2 are independently selected from hydrogen , hydrocarbyl , substituted hydrocarbyl , heteroatom - containing hydrocarbyl , substituted heteroatom - containing hydrocarbyl , and functional groups ; q is an organic diradical , i . e ., a hydrocarbylene , substituted hydrocarbylene , heteroatom - containing hydrocarbylene , or substituted heteroatom - containing hydrocarbylene linker , and further wherein two or more substituents on adjacent atoms within q may be linked to form an additional cyclic group ; x 1 and x 2 are anionic ligands , and may be the same or different ; l 1 is a neutral electron donor ligand , and p is zero or 1 ; when α is a single bond , l 2 is selected from nr 7 r 8 , pr 7 r 8 , n ═ cr 7 r 8 , and r 7 c ═ nr 8 , where r 7 and r 8 are independently selected from substituted and / or heteroatom - containing c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 2 - c 20 alkynyl , and c 5 - c 24 aryl , or r 7 and r 8 can be taken together to form a heterocyclic ring ; when α is an unsaturated bond , e . g ., a double bond , l 2 is selected from nr 7 and pr 7 , where r 7 is as defined previously ; y and z are linkages independently selected from hydrocarbylene , substituted hydrocarbylene , heteroatom - containing hydrocarbylene , substituted heteroatom - containing hydrocarbylene , — o —, — s —, — nr 9 —, and — pr 9 —, wherein r 9 is selected from hydrocarbyl , substituted hydrocarbyl , heteroatom - containing hydrocarbyl , and substituted heteroatom - containing hydrocarbyl , and further wherein y and z , or l 2 and z , may represent adjacent atoms in an aromatic ring ; the metal center designated as m is a group 8 transition metal , preferably ruthenium or osmium . in a particularly preferred embodiment , m is ruthenium . r 1 and r 2 are independently selected from hydrogen , hydrocarbyl ( e . g ., c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 2 - c 20 alkynyl , c 5 - c 24 aryl , c 6 - c 24 alkaryl , c 6 - c 24 aralkyl , etc . ), substituted hydrocarbyl ( e . g ., substituted c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 2 - c 20 alkynyl , c 5 - c 24 aryl , c 6 - c 24 alkaryl , c 6 - c 24 aralkyl , etc . ), heteroatom - containing hydrocarbyl ( e . g ., heteroatom - containing c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 2 - c 20 alkynyl , c 5 - c 24 aryl , c 6 - c 24 alkaryl , c 6 - c 24 aralkyl , etc . ), substituted heteroatom - containing hydrocarbyl ( e . g ., substituted heteroatom - containing c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 2 - c 20 alkynyl , c 5 - c 24 aryl , c 6 - c 24 alkaryl , c 6 - c 24 aralkyl , etc . ), and functional groups . when r 1 and r 2 are aromatic , they are typically although not necessarily composed of one or two aromatic rings , which may or may not be substituted , e . g ., r 1 and r 2 may be phenyl , substituted phenyl , biphenyl , substituted biphenyl , or the like . in one preferred embodiment , r 1 and r 2 are the same and are each unsubstituted phenyl or phenyl substituted with up to three substituents selected from c 1 - c 20 alkyl , substituted c 1 - c 20 alkyl , c 1 - c 20 heteroalkyl , substituted c 1 - c 20 heteroalkyl , c 5 - c 24 aryl , substituted c 5 - c 24 aryl , c 5 - c 24 heteroaryl , c 6 - c 24 aralkyl , c 6 - c 24 alkaryl , and halide . preferably , any substituents present are hydrogen , c 1 - c 12 alkyl , c 1 - c 12 alkoxy , c 5 - c 14 aryl , substituted c 5 - c 14 aryl , or halide . more preferably , r 1 and r 2 are mesityl . in another preferred embodiment , r 1 and r 2 are independently selected from hydrogen , c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 2 - c 20 alkynyl , c 5 - c 24 substituted aryl , c 1 - c 20 functionalized alkyl , c 2 - c 20 functionalized alkenyl , c 2 - c 20 functionalized alkynyl , or c 5 - c 24 functionalized substituted aryl where the functional group ( s ) (“ fn ”) may independently be one or more or the following : c 1 - c 20 alkoxy , c 5 - c 24 aryloxy , halo , carboxy (— cooh ), acyl ( including c 2 - c 20 alkylcarbonyl (— co - alkyl ) and c 6 - c 24 arylcarbonyl (— co - aryl )), formyl (—( co )— h ), nitro (— no 2 ), cyano (— c ≡ n ), isocyano (— n + ≡ c − ), hydroxyl , acyloxy (— o - acyl , including c 2 - c 20 alkylcarbonyloxy (— o — co - alkyl ) and c 6 - c 24 arylcarbonyloxy (— o — co - aryl )), c 2 - c 20 alkoxycarbonyl (—( co )— o - alkyl ), c 6 - c 24 aryloxycarbonyl (—( co )— o - aryl ), c 1 - c 20 alkoxy - substituted c 1 - c 20 alkyl , c 1 - c 20 alkoxy - substituted c 5 - c 24 aryl , c 5 - c 24 aryloxy - substituted c 1 - c 20 alkyl , c 5 - c 24 aryloxy - substituted c 5 - c 24 aryl , amino (— nh 2 ), imino (— cr ═ nh where r = hydrogen , c 1 - c 20 alkyl , c 5 - c 24 aryl , c 6 - c 24 alkaryl , c 6 - c 24 aralkyl , etc . ), c 2 - c 20 alkylamido (— nh —( co )- alkyl ), c 6 - c 24 arylamido (— nh —( co )- aryl ), c 1 - c 20 alkylsulfanyl (— s - alkyl ; also termed “ alkylthio ”), c 5 - c 24 arylsulfanyl (— s - aryl ; also termed “ arylthio ”), c 1 - c 20 alkyldithio (— s — s - alkyl ), c 5 - c 24 aryldithio (— s — s - aryl ), carbamoyl (—( co )— nh 2 ); c 2 - c 20 alkylcarbamoyl , (—( co )— nh - alkyl ), c 6 - c 20 arylcarbamoyl (—( co )— nh - aryl ), silyl (— sir 3 wherein r is hydrogen or hydrocarbyl ), silyloxy (— o - silyl ), phosphino (— ph 2 ), phosphonato (— p ( o )( o − ) 2 ), boryl (— bh 2 ), borono (— b ( oh ) 2 ), or boronato (— b ( or ) 2 where r is alkyl or other hydrocarbyl ). q is typically selected from hydrocarbylene ( e . g ., c 1 - c 20 alkylene , c 2 - c 20 alkenylene , c 2 - c 20 alkynylene , c 5 - c 24 arylene , c 6 - c 24 alkarylene , or c 6 - c 24 aralkylene ), substituted hydrocarbylene ( e . g ., substituted c 1 - c 20 alkylene , c 2 - c 20 alkenylene , c 2 - c 20 alkynylene , c 5 - c 24 arylene , c 6 - c 24 alkarylene , or c 6 - c 24 aralkylene ), heteroatom - containing hydrocarbylene ( e . g ., c 1 - c 20 heteroalkylene , c 2 - c 20 heteroalkenylene , c 2 - c 20 heteroalkynylene , c 5 - c 24 heteroarylene , heteroatom - containing c 6 - c 24 aralkylene , or heteroatom - containing c 6 - c 24 alkarylene ), and substituted heteroatom - containing hydrocarbylene ( e . g ., substituted c 1 - c 20 heteroalkylene , substituted c 2 - c 20 heteroalkenylene , substituted c 2 - c 20 heteroalkynylene , substituted c 5 - c 24 heteroarylene , substituted heteroatom - containing c 6 - c 24 aralkylene , or substituted heteroatom - containing c 6 - c 24 alkarylene ), wherein , as noted elsewhere herein , two or more substituents on adjacent atoms within q may also be linked to form an additional cyclic structure , which may be similarly substituted to provide a fused polycyclic structure of two to about five cyclic groups . q is often , although again not necessarily , a two - atom linkage or a three - atom linkage . in a more preferred embodiment , q is a two - atom linkage having the structure — cr 3 r 4 — cr 5 r 6 — or — cr 3 ═ cr 5 —, preferably — r 3 r 4 — cr 5 r 6 —, wherein r 3 , r 4 , r 5 , and r 6 are independently selected from hydrogen , hydrocarbyl , substituted hydrocarbyl , heteroatom - containing hydrocarbyl , substituted heteroatom - containing hydrocarbyl , and functional groups . examples of functional groups here include carboxyl , c 1 - c 20 alkoxy , c 5 - c 24 aryloxy , c 2 - c 20 alkoxycarbonyl , c 5 - c 24 alkoxycarbonyl , c 2 - c 24 acyloxy , c 1 - c 20 alkylthio , c 5 - c 24 arylthio , c 1 - c 20 alkylsulfonyl , and c 1 - c 20 alkylsulfinyl , optionally substituted with one or more moieties selected from c 1 - c 12 alkyl , c 1 - c 12 alkoxy , c 5 - c 14 aryl , hydroxyl , sulfhydryl , formyl , and halide . r 3 , r 4 , r 5 , and r 6 are preferably independently selected from hydrogen , c 1 - c 12 alkyl , substituted c 1 - c 12 alkyl , c 1 - c 12 heteroalkyl , substituted c 1 - c 12 heteroalkyl , phenyl , and substituted phenyl . alternatively , any two of r 3 , r 4 , r 5 , and r 6 may be linked together to form a substituted or unsubstituted , saturated or unsaturated ring structure , e . g ., a c 4 - c 12 alicyclic group or a c 5 or c 6 aryl group , which may itself be substituted , e . g ., with linked or fused alicyclic or aromatic groups , or with other substituents . x 1 and x 2 are anionic ligands , and may be the same or different , or are linked together to form a cyclic group , typically although not necessarily a five - to eight - membered ring . in preferred embodiments , x 1 and x 2 are each independently hydrogen , halide , or one of the following groups : c 1 - c 20 alkyl , c 5 - c 24 aryl , c 1 - c 20 alkoxy , c 5 - c 24 aryloxy , c 2 - c 20 alkoxycarbonyl , c 6 - c 24 aryloxycarbonyl , c 2 - c 24 acyl , c 2 - c 24 acyloxy , c 1 - c 20 alkylsulfonato , c 5 - c 24 arylsulfonato , c 1 - c 20 alkylsulfanyl , c 5 - c 24 arylsulfanyl , c 1 - c 20 alkylsulfinyl , c 5 - c 24 arylsulfinyl , carboxyl , carboxylate , or triflate . optionally , x 1 and x 2 may be substituted with one or more moieties , if the x 1 and / or x 2 substituent permits , wherein the substituents are typically although not necessarily selected from c 1 - c 12 alkyl , c 1 - c 12 alkoxy , c 5 - c 24 aryl , and halide , which may , in turn , with the exception of halide , be further substituted with one or more groups selected from halide , c 1 - c 6 alkyl , c 1 - c 6 alkoxy , and phenyl . in more preferred embodiments , x 1 and x 2 are halide , benzoate , c 2 - c 6 acyl , c 2 - c 6 alkoxycarbonyl , c 1 - c 6 alkyl , phenoxy , c 1 - c 6 alkoxy , c 1 - c 6 alkylsulfanyl , aryl , or c 1 - c 6 alkylsulfonyl . in even more preferred embodiments , x 1 and x 2 are each halide , cf 3 co 2 , ch 3 co 2 , cfh 2 co 2 , ( ch 3 ) 3 co , ( cf 3 ) 2 ( ch 3 ) co , ( cf 3 )( ch 3 ) 2 co , pho , meo , eto , tosylate , mesylate , or trifluoromethane - sulfonate . in the most preferred embodiments , x 1 and x 2 are each chloride . l 1 is a neutral electron donor ligand which is coordinated to the metal center . l 1 may be heterocyclic , in which case it is generally selected from : nitrogen - containing heterocycles such as pyridine , bipyridine , pyridazine , pyrimidine , bipyridamine , pyrazine , 1 , 3 , 5 - triazine , 1 , 2 , 4 - triazine , 1 , 2 , 3 - triazine , pyrrole , 2h - pyrrole , 3h - pyrrole , pyrazole , 2h - imidazole , 1 , 2 , 3 - triazole , 1 , 2 , 4 - triazole , indole , 3h - indole , 1h - isoindole , cyclopenta ( b ) pyridine , indazole , quinoline , bisquinoline , isoquinoline , bisisoquinoline , cinnoline , quinazoline , naphthyridine , piperidine , piperazine , pyrrolidine , pyrazolidine , quinuclidine , imidazolidine , picolylimine , purine , benzimidazole , bisimidazole , phenazine , acridine , and carbazole ; oxygen - containing heterocycles such as 2h - pyran , 4h - pyran , 2 - pyrone , 4 - pyrone , 1 , 2 - dioxin , 1 , 3 - dioxin , oxepin , furan , 2h - 1 - benzopyran , coumarin , coumarone , chromene , chroman - 4 - one , isochromen - 1 - one , isochromen - 3 - one , xanthene , tetrahydrofuran , 1 , 4 - dioxan , and dibenzofuran ; and mixed heterocycles such as isoxazole , oxazole , thiazole , isothiazole , 1 , 2 , 3 - oxadiazole , 1 , 2 , 4 - oxadiazole , 1 , 3 , 4 - oxadiazole , 1 , 2 , 3 , 4 - oxatriazole , 1 , 2 , 3 , 5 - oxatriazole , 3h - 1 , 2 , 3 - dioxazole , 3h - 1 , 2 - oxathiole , 1 , 3 - oxathiole , 4h - 1 , 2 - oxazine , 2h - 1 , 3 - oxazine , 1 , 4 - oxazine , 1 , 2 , 5 - oxathiazine , o - isooxazine , phenoxazine , phenothiazine , pyrano [ 3 , 4 - b ] pyrrole , indoxazine , benzoxazole , anthranil , and morpholine . l 1 may also be an amine , an imine , a phosphine , an ether , or a thioether . preferably , l 1 is selected from pyridines , amines , phosphines , imines , ethers , thioethers , furans , and pyrans . when α is a single bond , l 2 is selected from nr 7 r 8 , pr 7 r 8 , n ═ cr 7 r 8 , and r 7 c ═ nr 8 , where r 7 and r 8 are independently selected from substituted and / or heteroatom - containing c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 2 - c 20 alkynyl , c 5 - c 24 aryl , or r 7 and r 8 taken together can form a cyclic group , e . g ., piperidyl ( including substituted piperidyl ). any functional groups present on l 1 , l 2 , r 7 , or r 8 will generally be selected from the fn groups set forth above . examples of preferred such catalysts are those wherein l 2 is nr 7 r 8 , having the structure of formula ( ii ) wherein q , r 1 , r 2 , r 7 , r 8 , x 1 , x 2 , l 1 , y , z , β , and p are as defined above . preferred r 7 and r 8 substituents in this embodiment are c 1 - c 12 alkyl or c 5 - c 12 aryl , e . g ., methyl , isopropyl , t - butyl , cyclohexyl , and phenyl , and preferred y groups are — ch 2 —, — ch 2 ch 2 — and substituted analogs thereof . other preferred catalysts , wherein l 2 is pr 7 r 8 , have the structure of formula ( iii ) wherein q , r 1 , r 2 , r 7 , r 8 , x 1 , x 2 , y , z , l 1 , β , and p are as defined above , preferred r 7 and r 8 substituents are c 1 - c 12 alkyl or c 5 - c 12 aryl , e . g ., phenyl , and preferred y groups are as set forth for complexes of formula ( ii ). particularly preferred catalytic complexes encompassed by formulae ( ii ) and ( iii ) include , but are not limited to , the following : l 2 and z can be linked through an unsaturated bond , i . e ., the dashed line indicating a bond at a may also represent a double bond or a bond linking adjacent atoms in an aromatic ring . when l 2 and z are linked through an unsaturated bond , l 2 is selected from nr 7 and pr 7 , and preferably is nr 7 where r 7 is as defined previously . it will be appreciated that when α represents an unsaturated bond , the complex may be contain an imine ligand ( i . e ., containing the moiety — z ═ nr 7 ), or may contain a pyridine ring in which n and z are adjacent atoms in a pyridyl group . examples of preferred such catalysts in which the complex contains a pyridine ring or an imine moiety are encompassed by structural formulae ( iv ) and ( v ), respectively : in formulae ( iv ) and ( v ), q , r 1 , r 2 , r 7 , r 8 , x 1 , x 2 , y , z , l 1 , β , and p are as defined above , preferred r 7 substituents are c 1 - c 12 alkyl or c 5 - c 12 aryl , e . g ., methyl , isopropyl , t - butyl , cyclohexyl , and phenyl , and preferred y groups are substituted or unsubstituted methylene or ethylene linkages . particularly preferred catalytic complexes encompassed by formulae ( iv ) and ( v ) include , but are not limited to , the following : y and z are linkages independently selected from hydrocarbylene ( e . g ., c 1 - c 20 alkylene , c 2 - c 20 alkenylene , c 2 - c 20 alkynylene , c 5 - c 24 arylene , c 6 - c 24 alkarylene , or c 6 - c 24 aralkylene ), substituted hydrocarbylene ( e . g ., substituted c 1 - c 20 alkylene , c 2 - c 20 alkenylene , c 2 - c 20 alkynylene , c 5 - c 24 arylene , c 6 - c 24 alkarylene , or c 6 - c 24 aralkylene ), heteroatom - containing hydrocarbylene ( e . g ., c 1 - c 20 heteroalkylene , c 2 - c 20 heteroalkenylene , c 2 - c 20 heteroalkynylene , c 5 - c 24 heteroarylene , heteroatom - containing c 6 - c 24 aralkylene , or heteroatom - containing c 6 - c 24 alkarylene ), substituted heteroatom - containing hydrocarbylene ( e . g ., substituted c 1 - c 20 heteroalkylene , substituted c 2 - c 20 heteroalkenylene , substituted c 2 - c 20 heteroalkynylene , substituted c 5 - c 24 heteroarylene , substituted heteroatom - containing c 6 - c 24 aralkylene , or substituted heteroatom - containing c 6 - c 24 alkarylene ), — o —, — s —, — nr 9 —, and — pr 9 —, wherein r 3 is selected from hydrogen , hydrocarbyl ( e . g ., c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 2 - c 20 alkynyl , c 5 - c 24 aryl , c 6 - c 24 alkaryl , c 6 - c 24 aralkyl , etc . ), substituted hydrocarbyl ( e . g ., substituted c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 2 - c 20 alkynyl , c 5 - c 24 aryl , c 6 - c 24 alkaryl , c 6 - c 24 aralkyl , etc . ), heteroatom - containing hydrocarbyl ( e . g ., heteroatom - containing c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 2 - c 20 alkynyl , c 5 - c 24 aryl , c 6 - c 24 alkaryl , c 6 - c 24 aralkyl , etc . ), and substituted heteroatom - containing hydrocarbyl ( e . g ., substituted heteroatom - containing c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 2 - c 20 alkynyl , c 5 - c 24 aryl , c 6 - c 24 alkaryl , c 6 - c 24 aralkyl , etc .). any functional groups present on z , y , and / or r 9 will generally be selected from the fn moieties above . organic diradicals that can serve as y and / or z include , by way of example , the following groups : methylene ( vi ), ethylene ( vii ), vinylene ( viii ), phenylene ( ix ), cyclohexylene ( x ), and naphthylenes ( xi ) and ( xii ). in one particularly preferred embodiment of the invention , m is ruthenium , q is ethylene ( ii ), x 1 and x 2 are chloride , and p is zero . in a more preferred embodiment , r 1 and r 2 are mesityl ( 2 , 4 , 6 - trimethylphenyl ). in an even more preferred embodiment of the invention , n is zero . exemplary catalysts of the invention are 2a and 2b , the molecular structures of which are provided above and in fig2 , wherein m is ruthenium , l 2 is substituted or unsubstituted pyridyl , r 1 and r 2 are mesityl ( 2 , 4 , 6 - trimethylphenyl ), q is ethylene ( ii ), x 1 and x 2 are chloride , y is ethylene ( ii ), m is 1 , and n and p are zero . these new catalysts can be prepared by reacting rucl 2 ( simes )( pcy 3 )( chph ) ( catalyst 1 ) and 2 -( 3 - butenyl ) pyridine in dichloromethane at 40 ° c . ( see example 1 ). it has surprisingly found that depending on the reaction time , catalyst 2a can be obtained either in pure form or as a mixture of isomers 2a and 2b . this finding was quite surprising , because the known ruthenium carbene olefin metathesis catalysts typically have a configuration like that of 2a , namely a c s symmetric square pyramidal geometry where the apical position is occupied by the carbene ligand , and the equatorial positions by two trans anionic ligands and two trans neutral electron donating ligands . in the case of 2b , the complex is of c 1 symmetry and contains two equatorial cis anionic ligands and two equatorial cis neutral electron donating ligands . x - ray structures were obtained for 2a and 2b ( see ortep diagrams in fig3 and 4 ). catalyst 2a can also be prepared by reaction of ( simes )( py ) 2 ( cl ) 2 ru ═ chph ( complex 3 ) with 1 . 5 equivalent of 2 -( 3 - butenyl )- pyridine in dichloromethane at room temperature for 30 minutes ( example 2 ). in addition , this method is amenable to the synthesis of complexes ( simes )( cl ) 2 ru ( ch ( ch 2 ) 2 — c , n - 2 -( 4 - me )- c 5 h 3 n ) and ru ( ch ( ch 2 ) 2 — c , n - 2 -( 6 - me )- c 5 h 3 n ), also shown in fig7 . the catalysts of the invention may be synthesized and used in catalyzing olefin metathesis reactions using the procedures described in the examples herein or variations thereof which will be apparent to one of skill in the art . another embodiment of the present invention is a method for the use of the present catalysts , including 2a and 2b , for the metathesis of olefins . surprisingly , both isomers exhibit large differences in olefin metathesis activity ( e . g ., in rcm and romp ). these activity differences enable tuning of the catalyst by simple isomerization of the complex in lieu of the strategies of the prior art , such as utilization of additives or complicated and time - consuming catalyst design involving ligand exchanges . the catalysts may be attached to a solid support ; as understood in the field of catalysis , suitable solid supports may be of synthetic , semi - synthetic , or naturally occurring materials , which may be organic or inorganic , e . g ., polymeric , ceramic , or metallic . attachment to the support will generally , although not necessarily , be covalent , and the covalent linkage may be direct or indirect , if indirect , typically between a functional group on a support surface and a ligand or substituent on the catalytic complex . the reactions are carried out under conditions normally used in olefin metathesis reactions catalyzed by the grubbs family of metathesis catalysts . see , e . g ., u . s . pat . nos . 5 , 312 , 940 , 5 , 342 , 909 , 5 , 831 , 108 , 5 , 969 , 170 , 6 , 111 , 121 , and 6 , 211 , 391 to grubbs et al . as indicated by the results in the examples , various modifications to the basic catalyst structures herein can increase or decrease latency period as desired . it is to be understood that while the invention has been described in conjunction with the preferred specific embodiments thereof , that the foregoing description as well as the examples that follow are intended to illustrate and not limit the scope of the invention . other aspects , advantages and modifications within the scope of the invention will be apparent to those skilled in the art to which the invention pertains . all patents , patent applications , and publications mentioned herein are hereby incorporated by reference in their entireties . a 250 ml round bottom schlenk flask equipped with a stir bar was charged with complex 1 , ( simes )( pcy 3 )( cl ) 2 ru ═ chph , ( 10 . 0 g ; 11 . 8 mmol ). the flask was capped , sparged with argon for 15 minutes , and charged with anhydrous ch 2 cl 2 ( 118 ml ) via cannula . 2 -( 3 - butenyl ) pyridine ( 2 . 4 g , 17 . 7 mmol ) was then added via syringe and the reaction mixture was heated to 40 ° c . for 5 - 6 hours . the reaction mixture was concentrated to dryness and the residue triturated with degassed , chilled methanol . the solid was collected on a frit and washed with chilled methanol ( 2 × 25 ml ) to give catalyst 2a , ( simes )( cl ) 2 ru ( ch ( ch 2 ) 2 — c , n - 2 - c 5 h 4 n )— c s , ( 5 . 6 g ; 9 . 4 mmol ) as a pale green solid upon drying . yield : 80 %. in the glove box a vial was charged with 2 -( 3 - butenyl ) pyridine ( 24 mg , 0 . 18 mmol ) and ch 2 cl 2 ( 2 ml ). complex 3 , ( simes )( py ) 2 ( cl ) 2 ru ═ chph , ( 86 mg ; 0 . 12 mmol ) was then added as a solid and the reaction allowed to stir at room temperature for 30 minutes . the volatiles were removed under vacuum and the residue triturated with hexanes . the solid was collected , washed with hexanes ( 2 × 1 ml ) and dried under vacuum to give catalyst 2a , ( simes )( cl ) 2 ru ( ch ( ch 2 ) 2 — c , n - 2 - c 5 h 4 n )— c s , ( 60 mg ; 0 . 10 mmol ) as a pale green solid upon drying . yield : 85 %. 1 h nmr ( cd 2 cl 2 ): δ 18 . 46 ( t , 3 j hh = 2 . 7 hz , 1h , ru ═ ch ), 7 . 64 ( d , 3 j hh = 4 . 8 hz , 1h , py ), 7 . 52 ( t , 3 j hh = 7 . 2 hz , 1h , py ), 7 . 14 ( d , 3 j hh = 7 . 8 hz , 1h , py ), 7 . 07 ( s , 4h , mes ), 6 . 99 ( t , 3 j hh = 6 . 9 hz , 1h , py ), 4 . 09 ( s , 4h , simes ), 3 . 55 ( t , 3 j hh = 5 . 7 hz , 2h , ch 2 - py ), 2 . 50 ( s , 12h , mes - ch 3 ), 2 . 41 ( s , 6h , mes - ch 3 ), 1 . 70 ( m , 2h , ru ═ ch — ch 2 ). 13 c { 1 h } nmr ( cd 2 cl 2 ): δ 339 . 18 ( ru ═ chch2 ), 216 . 52 ( ru — c ( n ) 2 ), 162 . 64 , 158 . 34 , 149 . 54 , 138 . 96 , 138 . 83 , 136 . 96 , 129 . 60 , 124 . 51 , 121 . 82 , 54 . 45 , 51 . 92 , 34 . 30 , 21 . 32 , 19 . 58 . in the glove box , a 0 . 1 m solution of catalyst 2a in cd 2 cl 2 was prepared and transferred to an nmr tube , which was capped and taken out of the glove box . the nmr tube was left in an oil bath at 40 ° c . and the reaction was monitored by 1 h nmr spectroscopy . the ratio of 2b to 2a in the mixture was 30 / 70 after 24 hours ; 60 / 40 after 48 hours ; 70 / 30 after 72 hours ; and 78 / 22 after 96 hours . in the glove box , a 0 . 1 m solution of catalyst 2b in cd 2 cl 2 was prepared and transferred to an nmr tube , which was capped and taken out of the glove box . the nmr tube was left in an oil bath at 40 ° c . and the reaction was monitored by 1 h nmr spectroscopy . the ratio of 2b to 2a in the mixture was 83 / 17 after 24 hours . 1 h nmr spectroscopy also showed that the isomerization of 2b was accompanied with some catalyst decomposition , making it complicated to analyze the reaction mixture beyond 24 hours . in the glove box , a flask was charged with 2 -( 3 - butenyl )- 4 - methylpyridine ( 40 mg , 0 . 27 mmol ) and ch 2 cl 2 ( 5 ml ). complex 3 , ( simes )( py ) 2 ( cl ) 2 ru ═ chph , ( 114 mg ; 0 . 16 mmol ) was then added as a solid and the reaction allowed to stir at room temperature for 30 minutes . the volatiles were removed under vacuum and the residue was redissolved in c 6 h 6 ( 1 ml ) and precipitated with pentane ( 10 ml ). the solid was collected , washed with pentane ( 3 × 5 ml ) and dried under vacuum to give catalyst 4 , ( simes )( cl ) 2 ru ( ch ( ch 2 ) 2 — c , n - 2 -( 4 - me )- c 5 h 3 n )— c s , ( 80 mg ; 0 . 13 mmol ) as a light brown solid upon drying . yield : 84 %. 1 h nmr ( cd 2 cl 2 ): δ 18 . 44 ( t , 3 j hh = 3 . 3 hz , 1h , ru ═ ch ), 7 . 42 ( d , 3 j hh = 5 . 7 hz , 1h , py ), 7 . 02 ( s , 4h , mes ), 6 . 95 ( s , 1h , py ), 6 . 80 ( d , 3 j hh = 4 . 2 hz , 1h , py ), 4 . 06 ( s , 4h , simes ), 3 . 46 ( t , 3 j hh = 6 . 0 hz , 2h , ch 2 — py ), 2 . 45 ( s , 12h , mes - ch 3 ), 2 . 37 ( s , 6h , mes - ch 3 ), 2 . 27 ( s , 3h , py - ch 3 ), 1 . 66 ( m , 2h , ru ═ ch — ch 2 ). 13 c { 1 h } nmr ( cd 2 cl 2 ): δ 339 . 16 ( ru ═ chch2 ), 216 . 91 ( ru — c ( n ) 2 ), 161 . 97 , 148 . 96 , 148 . 87 , 138 . 99 , 138 . 83 , 129 . 63 , 125 . 43 , 122 . 98 , 54 . 62 , 51 . 95 , 34 . 13 , 21 . 35 , 21 . 01 , 19 . 64 . in the glove box , a flask was charged with 2 -( 3 - butenyl )- 6 - methylpyridine ( 50 mg , 0 . 34 mmol ) and ch 2 cl 2 ( 5 ml ). complex 3 , ( simes )( py ) 2 ( cl ) 2 ru ═ chph , ( 98 mg ; 0 . 14 mmol ) was then added as a solid and the reaction allowed to stir at room temperature for 30 minutes . the volatiles were removed under vacuum and the residue was redissolved in c 6 h 6 ( 1 ml ) and precipitated with pentane ( 10 ml ). the solid was collected , washed with pentane ( 3 × 5 ml ) and dried under vacuum to give catalyst 5 , ( simes )( cl ) 2 ru ( ch ( ch 2 ) 2 — c , n - 2 -( 6 - me )- c 5 h 3 n )— c s , ( 57 mg ; 0 . 094 mmol ) as a light brown solid upon drying . yield : 69 %. 1 h nmr ( cd 2 cl 2 ): δ 18 . 33 ( t , 3 j hh = 3 . 6 hz , 1h , ru ═ ch ), 7 . 34 ( t , 3 j hh = 7 . 5 hz , 1h , py ), 7 . 03 ( s , 4h , mes ), 6 . 97 ( d , 3 j hh = 7 . 8 hz , 1h , py ), 6 . 75 ( d , 3 j hh = 7 . 8 hz , 1h , py ), 4 . 05 ( m , 4h , simes ), 2 . 91 ( m , 4h , ru ═ ch — ch 2 — ch 2 — py ), 2 . 61 ( br s , 6h , mes - ch 3 ), 2 . 37 ( s , 6h , mes - ch 3 ), 2 . 31 ( br s , 6h , mes - ch 3 ), 2 . 01 ( s , 3h , py - ch 3 ). 13 c { 1 h } nmr ( cd 2 cl 2 ): δ 343 . 54 ( ru ═ chch2 ), 218 . 21 ( ru — c ( n ) 2 ), 160 . 62 , 160 . 55 , 140 . 45 , 139 . 29 , 138 . 73 , 137 . 88 , 136 . 65 , 129 . 79 , 128 . 82 , 123 . 03 , 122 . 13 , 52 . 04 , 51 . 24 , 34 . 66 , 32 . 20 , 22 . 86 , 21 . 76 , 21 . 34 , 20 . 37 , 18 . 51 . it should be noted that the 1 h nmr spectra for catalysts 2a , 4 and 5 are consistent with complexes of c s symmetry , where the resonances for each of the para methyl groups of the mesityl rings , the ortho methyl groups of the same rings and the ethylene bridge of the simes ligand appear as singlets [ the 1 h nmr singlets described are consistent with a c s symmetry and free rotation of the simes ligand around the ru — c bond ( on the nmr time - scale )]. the alkylidene proton resonances near 18 ppm appear as triplets due to coupling to the methylene protons ( 3 j hh = 2 . 7 - 3 . 6 hz ). a 220 ml round bottom schlenk flask equipped with a stir bar was charged with complex 1 , ( simes )( pcy 3 )( cl ) 2 ru ═ chph , ( 5 . 0 g ; 5 . 9 mmol ). the flask was capped , sparged with argon for 15 minutes , and charged with anhydrous ch 2 cl 2 ( 60 ml ) via cannula . 2 -( 3 - butenyl ) pyridine ( 1 . 2 g , 8 . 9 mmol ) was then added via syringe and the reaction mixture was heated to 40 ° c . for 3 - 4 days . the reaction mixture was concentrated to dryness and the residue triturated with degassed , chilled methanol ( 15 ml ). the solid was collected on a frit and washed with methanol ( 2 × 10 ml ) to give catalyst 2b , ( simes )( cl ) 2 ru ( ch ( ch 2 ) 2 — c , n - 2 - c 5 h 4 n )— c 1 , ( 1 . 3 g ; 2 . 2 mmol ) as an orange - brown solid upon drying . yield : 37 %. 1 h nmr ( cd 2 cl 2 ): δ 19 . 14 ( t , 3 j hh = 3 . 3 hz , 1h , ru ═ ch ), 7 . 54 ( d , 3 j hh = 7 . 8 hz , 1h , py ), 7 . 49 ( t , 3 j hh = 5 . 1 hz , 1h , py ), 7 . 25 ( s , 1h , mes ), 7 . 06 ( s , 1h , mes ), 7 . 03 ( d , 3 j hh = 7 . 8 hz , 1h , py ), 6 . 90 ( s , 1h , mes ), 6 . 88 ( s , 1h , mes ), 6 . 81 ( t , 3 j hh = 6 . 6 hz , 1h , py ), 4 . 15 ( m , 2h , simes ), 3 . 90 ( m , 2h , simes ), 3 . 00 ( m , 2h , ch 2 — py ), 2 . 88 ( s , 3h , mes - ch 3 ), 2 . 69 ( s , 3h , mes - ch 3 ), 2 . 40 ( s , 3h , mes - ch 3 ), 2 . 34 ( s , 3h , mes - ch 3 ), 1 . 96 ( s , 3h , mes - ch 3 ), 1 . 78 ( m , 1h , ru ═ ch — ch 2 ), 1 . 45 ( s , 3h , mes - ch 3 ), 1 . 21 ( m , 1h , ru ═ ch — ch 2 ). 13 c { 1 h } nmr ( cd 2 cl 2 ): δ 319 . 04 ( ru ═ chch2 ), 218 . 94 ( ru — c ( n ) 2 ), 161 . 71 , 154 . 02 , 139 . 51 , 138 . 94 , 138 . 32 , 137 . 90 , 135 . 57 , 134 . 97 , 132 . 96 , 130 . 26 , 129 . 53 , 129 . 34 , 129 . 16 , 128 . 65 , 122 . 94 , 120 . 00 , 50 . 54 , 49 . 23 , 34 . 87 , 20 . 52 , 20 . 27 , 19 . 25 , 18 . 92 , 18 . 39 , 17 . 56 . catalyst 2b appears as a ruthenium carbene of c 1 symmetry , displaying six nonequivalent methyl groups on the mesityl rings , four nonequivalent protons on the ethylene bridge of the simes ligand and 4 nonequivalent protons on the ethylene bridge of the pyridyl ligand in the 1 h nmr spectrum . the carbene resonance of 2b also appears as a triplet ( 619 . 14 ppm ; 3 j hh = 3 . 3 hz ). pure isolated 2a , dissolved in cd 2 cl 2 ( 0 . 1 m ), is slowly converted to a 22 : 78 mixture of 2a : 2b at 40 ° c . over the course of 96 hours and pure isolated 2b forms a similar mixture under the same conditions . it may therefore be concluded that 2a and 2b are isomers in equilibrium where 2b is the thermodynamically favored species and k eq = 0 . 28 . attempts to measure the kinetics of the approach to equilibrium were hampered by a decomposition process concurrent with the 2a 2b isomerization process . crystals suitable for x - ray analysis were obtained for catalysts 2a and 2b ( ortep views of 2a and 2b are shown in fig9 and 10 , respectively ). both complexes display square pyramidal geometries , where the chloride , pyridine and nhc ligands occupy the equatorial positions and the alkylidene occupies the axial position . in 2a , the chloride ligands are trans one to another [ cl ( 1 )- ru ( 1 )- cl ( 2 )= 164 . 41 ( 1 )] as are the neutral ligands [ c ( 1 )- ru ( 1 )- n ( 3 )= 170 . 21 ( 4 )]. this geometry is typical for ruthenium olefin metathesis catalysts and is consistent with the 1 h nmr spectrum of 2a . on the other hand , 2b possesses cis chloride ligands ( cl ( 1 )- ru ( 1 )- cl ( 2 )= 85 . 93 ( 2 )) and cis neutral ligands ( c ( 1 )- ru ( 1 )- n ( 3 )= 98 . 04 ( 8 )), which explain the c 1 symmetry deduced from the spectroscopic data . this type of ligand arrangement is relatively rare for ruthenium carbene complexes , although it has been observed in a few cases [ ruthenium complexes containing chelating bisphosphine ligands and cis chlorides have been described : see , e . g ., hansen et al . ( 1999 ) angew . chem ., int . ed . 38 , 1273 - 1276 ; hansen et al . ( 1999 ) chem . eur . j . 5 , 557 - 566 ; volland et al . ( 2001 ) organomet . chem . 617 , 288 - 291 ; nieczypor et al . ( 2001 ). j . organomet . chem . 625 , 58 - 66 ; priihs et al . ( 2004 ) organometallics 23 , 280 - 287 ; slugovc et al . ( 2004 ) organometallics , 23 , 3622 - 3626 . a related complex with cis neutral ligands and cis anionic pentafluorophenoxide ligands has been reported : see conrad et al . ( 2003 ) organometallics 22 , 3634 - 3636 ; a related vinylcarbene ruthenium complex containing cis chlorides has also been reported : see trnka et al . ( 2001 ) organometallics 20 , 3845 - 3847 ]. the ru ( 1 )- n ( 3 ) distance of 2 . 1355 ( 9 ) å in 2a is significantly longer than that of 2 . 098 ( 2 ) å in 2b , due to the trans influence of the nhc ligand . similarly , the ru ( 1 )- cl ( 2 ) distance in 2b ( 2 . 3883 ( 6 ) å ) is longer than that in 2a ( 2 . 3662 ( 3 ) å ). in the glove box , a flask was charged with ( 4 - pentenyl ) diphenyl phosphine ( 49 mg , 0 . 19 mmol ) and ch 2 cl 2 ( 5 ml ). catalyst 3 , rucl 2 ( simes )( py ) 2 ( chph ), ( 127 mg ; 0 . 17 mmol ) was then added as a solid and the reaction allowed to stir at room temperature for 30 minutes . the volatiles were removed under vacuum and the residue was washed with pentane ( 2 × 2 ml ). the solid was redissolved in ch 2 cl 2 ( 5 ml ) and heated to 40 ° c . for 12 h , after which volatiles were removed under vacuum . the solid was purified by column chromatography ( 5 % et 2 o / pentane , then 25 % et 2 o / pentane ) and dried under vacuum to give catalyst 6 . ( 59 mg ; 0 . 082 mmol ) as a light brown solid upon drying . yield : 47 %. 1 h nmr ( cd 2 cl 2 ): δ 18 . 60 ( td , 3 j hh = 6 . 3 hz , 3 j ph = 1 . 8 hz , 1h , ru ═ ch ), 7 . 30 ( m , 2h , pph 2 ), 7 . 18 ( m , 4h , pph 2 ), 6 . 97 ( s , 4h , mes ), 6 . 89 ( m , 4h , pph 2 ), 4 . 07 ( m , 4h , simes ), 2 . 79 ( q , 3 j hh = 6 . 3 hz , 2h , ru ═ ch — ch 2 — ch 2 ), 2 . 53 ( s , 6h , mes - ch 3 ), 2 . 39 ( s , 6h , mes - ch 3 ), 2 . 35 ( s , 6h , mes - ch 3 ), 2 . 30 ( m , 2h , ch 2 — ch 2 — pph 2 ), 1 . 53 ( m , 2h , ch 2 — ch 2 — ch 2 — pph 2 ). 31 p { 1 h } nmr ( cd 2 cl 2 ): δ 45 . 49 . in the glove box , a flask was charged with catalyst 3 , rucl 2 ( simes )( py ) 2 ( chph ), ( 154 . 7 mg ; 0 . 21 mmol ) and ch 2 cl 2 ( 5 ml ). ( 2 , 2 - dimethyl - pent - 4 - enylidene )- phenyl - amine ( 60 mg , 0 . 32 mmol ) was then added via syringe and the reaction allowed to stir at room temperature for 15 minutes . the volatiles were removed under vacuum and the residue was washed with pentane ( 2 × 2 ml ). the solid was redissolved in c 6 h 6 ( 2 ml ) and precipitated with pentane ( 20 ml ). the solid was collected , washed with pentane ( 3 × 5 ml ) and dried under vacuum to give catalyst 7 ( 115 . 6 mg ; 0 . 18 mmol ) as an olive green solid upon drying . yield : 83 %. 1 h nmr ( cd 2 cl 2 ): δ 18 . 80 ( t , 3 j hh = 5 . 4 hz , 1h , ru ═ ch ), 7 . 64 ( s , 1h , c (═ n ) h ), 7 . 2 - 6 . 9 ( m , 9h , ar — h ), 4 . 01 ( s , 4h , simes ), 3 . 02 ( d , 3 j hh = 5 . 4 hz , 2h , ru ═ ch — ch 2 — cme 2 ), 2 . 5 - 2 . 3 ( m , 18h , mes - ch 3 ), 1 . 07 ( s , 6h , cme 2 ). 13 c { 1 h } nmr ( cd 2 cl 2 ): δ 345 . 10 ( ru ═ chch2 ), 218 . 03 ( ru — c ( n ) 2 ), 176 . 96 ( ru — n ═ c ), 149 . 63 , 138 . 81 , 129 . 82 , 129 . 40 , 127 . 12 , 122 . 48 , 64 . 30 , 51 . 82 , 42 . 69 , 26 . 89 , 21 . 46 , 19 . 28 . in the glove box , a flask was charged with catalyst 3 , rucl 2 ( simes )( py ) 2 ( chph ), ( 191 . 5 mg ; 0 . 26 mmol ) and ch 2 cl 2 ( 5 ml ). ( 2 , 2 - dimethyl - pent - 4 - enylidene )- cyclohexyl - amine ( 74 mg , 0 . 38 mmol ) was then added via syringe and the reaction allowed to stir at room temperature for 15 minutes . the volatiles were removed under vacuum and the residue was washed with pentane ( 2 × 2 ml ). the solid was redissolved in c 6 h 6 ( 2 ml ) and precipitated with pentane ( 20 ml ). the solid was collected , washed with pentane ( 3 × 5 ml ) and dried under vacuum to give catalyst 8 ( 146 . 1 mg ; 0 . 22 mmol ) as an olive green solid upon drying . yield : 84 %. 1 h nmr ( cd 2 cl 2 ): δ 18 . 56 ( t , 3 j hh = 5 . 4 hz , 1h , ru ═ ch ), 7 . 41 ( s , 3 j hh = 5 . 4 hz , 1h , c (═ n ) h ), 7 . 00 ( br s , 4h , mes ), 4 . 00 ( br s , 4h , simes ), 2 . 96 ( d , 3 j hh = 5 . 7 hz , 2h , ru ═ ch — ch 2 — cme 2 ), 2 . 7 - 2 . 2 ( br m , 12h , mes - ch 3 ), 2 . 34 ( s , 6h , mes - ch 3 ), 1 . 7 - 0 . 8 ( m , 11h , cy ), 0 . 91 ( s , 6h , cme 2 ). in the glove box , a flask was charged with catalyst 3 , rucl 2 ( simes )( py ) 2 ( chph ) ( 239 mg ; 0 . 33 mmol ) and ch 2 cl 2 ( 5 ml ). ( 2 , 2 - dimethyl - pent - 4 - enylidene )- isopropyl - amine ( 76 mg , 0 . 38 mmol ) was then added via syringe and the reaction allowed to stir at room temperature for 15 minutes . the volatiles were removed under vacuum , the residue was redissolved in c 6 h 6 ( 2 ml ) and precipitated with pentane ( 20 ml ). the solid was collected , washed with pentane ( 3 × 5 ml ) and dried under vacuum to give catalyst 3 ( 162 mg ; 0 . 26 mmol ) as a pale green solid upon drying . yield : 80 %. 1 h nmr ( cd 2 cl 2 ): δ 18 . 58 ( t , 3 j hh = 5 . 4 hz , 1h , ru ═ ch ), 7 . 41 ( d , 3 j hh = 1 . 5 hz , 1h , c (═ n ) h ), 6 . 99 ( s , 4h , mes ), 4 . 02 ( br s , 4h , simes ), 3 . 32 ( sept . d , j hh = 6 . 6 , 1 . 5 hz , 1h , nch ( ch 3 ) 2 ), 2 . 96 ( d , 3 j hh = 5 . 4 hz , 2h , ru ═ ch — ch 2 — cme 2 ), 2 . 42 ( br s , 12h , mes - ch 3 ), 2 . 34 ( s , 6h , mes - ch 3 ), 0 . 92 ( s , 6h , cme 2 ). 0 . 90 ( d , 3 j hh = 6 . 9 hz , 6h , nch ( ch 3 ) 2 ). 13 c { 1 h } nmr ( cd 2 cl 2 ): δ 345 . 17 ( ru ═ chch2 ), 219 . 54 ( ru — c ( n ) 2 ) 173 . 68 , 138 . 91 , 129 . 74 , 64 . 21 , 60 . 78 , 51 . 60 , 42 . 51 , 26 . 96 , 22 . 47 , 21 . 36 , 19 . 36 ( br ). in the glove box , a flask was charged with catalyst 3 , rucl 2 ( simes )( py ) 2 ( chph ) ( 188 mg ; 0 . 26 mmol ) and ch 2 cl 2 ( 5 ml ). ( 2 , 2 - dimethyl - pent - 4 - enylidene )- tert - butyl - amine ( 56 mg , 0 . 34 mmol ) was then added via syringe and the reaction allowed to stir at room temperature for 15 minutes . the volatiles were removed under vacuum , the residue was redissolved in c 6 h 6 ( 2 ml ) and precipitated with pentane ( 20 ml ). the solid was collected , washed with pentane ( 3 × 5 ml ) and dried under vacuum to give catalyst 10 ( 91 mg ; 0 . 14 mmol ) as pale green solid upon drying . yield : 56 %. 1 h nmr ( cd 2 cl 2 ): δ 18 . 37 ( t , 3 j hh = 5 . 7 hz , 1h , ru ═ ch ), 7 . 43 ( s , 1h , c (═ n ) h ), 7 . 04 - 6 . 94 ( m , 4h , mes ), 4 . 10 - 3 . 86 ( m , 4h , simes ), 3 . 08 ( d , 3 j hh = 5 . 4 hz , 2h , ru ═ ch — ch 2 — cme 2 ), 2 . 59 ( br s , 6h , mes - ch 3 ), 2 . 34 ( s , 6h , mes - ch 3 ), 2 . 26 ( br s , 6h , mes - ch 3 ), 1 . 0 ( s , 9h , ncme 3 ), 0 . 91 ( s , 6h , cme 2 ). 13 c { 1 h } nmr ( cd 2 cl 2 ): δ 345 . 22 ( ru ═ chch2 ), 219 . 82 ( ru — c ( n ) 2 ), 172 . 97 , 139 . 83 , 139 . 13 , 138 . 55 , 137 . 92 , 136 . 09 , 129 . 83 , 129 . 74 , 64 . 05 , 63 . 66 , 51 . 75 , 51 . 27 , 43 . 02 , 25 . 89 , 26 . 77 , 21 . 37 , 20 . 21 , 18 . 58 . in the glove box , a flask was charged with catalyst 3 , rucl 2 ( simes )( py ) 2 ( chph ) ( 143 mg ; 0 . 20 mmol ) and ch 2 cl 2 ( 5 ml ). ( 2 , 2 - dimethyl - pent - 4 - enylidene )- methyl - amine ( 30 mg , 0 . 24 mmol ) was then added via syringe and the reaction allowed to stir at room temperature for 30 minutes . the volatiles were removed under vacuum , the residue was redissolved in c 6 h 6 ( 2 ml ) and precipitated with pentane ( 20 ml ). the solid was collected , washed with pentane ( 3 × 5 ml ) and dried under vacuum to give catalyst 11 ( 93 mg ; 0 . 16 mmol ) as a green - brown solid upon drying . yield : 84 %. 1 h nmr ( cd 2 cl 2 ): δ 18 . 80 ( t , 3 j hh = 5 . 1 hz , 1h , ru ═ ch ), 7 . 42 ( m , 1h , c (═ n ) h ), 7 . 00 ( br s , 4h , mes ), 4 . 05 ( s , 4h , simes ), 2 . 73 ( d , 4 j hh = 1 . 2 hz , 3h , c ═ nme ), 2 . 69 ( d , 3 j hh = 5 . 1 hz , 2h , ru ═ ch — ch 2 — cme 2 ), 2 . 41 ( s , 12h , mes - ch 3 ), 2 . 34 ( s , 6h , mes - ch 3 ), 0 . 93 ( s , 6h , cme 2 ). 13 c { 1 h } nmr ( cd 2 cl 2 ): δ 342 . 54 ( ru ═ chch2 ), 218 . 93 ( ru — c ( n ) 2 ), 175 . 29 , 139 . 04 , 138 . 87 , 136 . 52 , 129 . 61 , 64 . 46 , 51 . 85 , 46 . 76 , 41 . 83 , 26 . 88 , 21 . 37 , 19 . 56 . in the glove box , a flask was charged with catalyst 3 , rucl 2 ( simes )( pcy 3 )( chph ) ( 5 . 0 g ; 5 . 9 mmol ) and ch 2 cl 2 ( 60 ml ). ortho -( n , n )- dimethylaminostyrene ( 1 . 7 g ; 11 . 8 mmol ; 2 equiv ), prepared according to a literature procedure ( see j . chem . soc . 1958 , 2302 ), was added and the reaction mixture was stirred at 40 ° c . for 24 hours under inert atmosphere . the volatiles were removed under vacuum , the residue was triturated with methanol ( 10 ml ) and the solid collected on a fitted glass filtration funnel . the solid was then washed with additional methanol ( 2 × 10 ml ) and hexanes ( 2 × 10 ml ) before it was dried under vacuum to give catalyst 12 ( 2 . 8 g ; 4 . 6 mmol ) as a green solid . yield : 78 %. 1 h nmr ( cd 2 cl 2 ): δ 16 . 85 ( s , 1h , ru ═ ch ), 7 . 58 ( t , 1h , ar ), 7 . 22 ( d , 1h , ar ), 7 . 10 ( t , 1h , ar ), 7 . 08 ( s , 4h , mes ), 6 . 82 ( d , 1h , ar ), 4 . 10 ( br s , 4h , ch 2 ch 2 ), 2 . 50 ( s , 6h , mes - ch 3 ), 2 . 48 ( s , 12h , mes - ch 3 ), 2 . 40 ( s , 6h , nme 2 ). the ring - closing metathesis of diethyldiallyl malonate was used as a test reaction to compare the activity of the different catalysts . for the comparison of catalysts 1 , 2a , 2b and 12 : 1 mol % of catalyst was added to a 0 . 1 m solution of diethyldiallyl malonate in dichloromethane and the reaction was allowed to proceed at 25 ° c . and was monitored by gas - chromatography ( fig1 ). as shown in fig1 , 2a is much slower than 1 (& lt ; 20 % conversion after 100 min versus ˜ 100 % conversion , respectively , under the conditions used ), 2b is much slower than 2a (& lt ; 2 % conversion after 100 min under the conditions used ), and 12 is much slower than 2b . the ring - closing metathesis of diethyldiallyl malonate was used as a test reaction to compare the activity of catalysts 2a , 4 and 5 . in the dry box , 2 . 5 mol % of catalyst ( 0 . 0052 mmol ) was dissolved in c 6 d 6 ( 0 . 65 ml ) in an nmr tube fitted with a teflon septum screw - cap . the resulting solution was allowed to equilibrate in the nmr probe at 40 ° c . diethyldiallyl malonate ( 50 μl , 0 . 207 mmol , 0 . 30 m ) was injected into the nmr tube neat and the reaction was monitored by 1 h nmr spectroscopy ( fig1 ). the olefinic resonances integrals of the product relative to that of the starting material were measured with the residual protio solvent peak used as an internal standard . as shown in fig1 , 2a and 4 show similar reactivity in rcm , but 5 proved to initiate faster than 2a and 4 , presumably due to steric crowding of the ortho methyl group on the pyridine ligand . as in example 16 , the ring - closing metathesis of diethyldiallyl malonate was used as a test reaction to compare the activity of catalysts 2a , 7 and 8 . in the dry box , 2 . 5 mol % of catalyst ( 0 . 0052 mmol ) was dissolved in c 6 d 6 ( 0 . 65 ml ) in an nmr tube fitted with a teflon septum screw - cap . the resulting solution was allowed to equilibrate in the nmr probe at 40 ° c . diethyldiallyl malonate ( 50 μl , 0 . 207 mmol , 0 . 30 m ) was injected into the nmr tube neat and the reaction was monitored by 1 h nmr spectroscopy ( fig1 ). the olefinic resonances integrals of the product relative to that of the starting material were measured with the residual protio solvent peak used as an internal standard . as shown in fig1 , catalyst 7 is faster than 2a in rcm , while 8 is slower than 2a . the foregoing test reaction was then re - run to compare catalysts 7 , 8 , 9 , 10 , and 11 , with the results given in fig1 . as in example 16 , the ring - closing metathesis of diethyldiallyl malonate was used as a test reaction to compare the activity of catalysts 6 and 8 . in the dry box , 2 . 5 mol % of catalyst ( 0 . 0052 mmol ) was dissolved in c 6 d 6 ( 0 . 65 ml ) in an nmr tube fitted with a teflon septum screw - cap . the resulting solution was allowed to equilibrate in the nmr probe at 60 ° c . diethyldiallyl malonate ( 50 μl , 0 . 207 mmol , 0 . 30 m ) was injected into the nmr tube neat and the reaction was monitored by 1 h nmr spectroscopy ( fig1 ). the olefinic resonances integrals of the product relative to that of the starting material were measured with the residual protio solvent peak used as an internal standard . dicyclopentadiene containing 3 . 5 % of tricyclopentadiene ( 100 g ) was polymerized by addition of catalyst ( monomer / catalyst = 30 , 000 : 1 mole : mole ) at 30 ° c . the polymerization exotherms for the polymerization catalyzed by catalysts 2a and 2b were measured and are shown in fig1 . in the same way that catalyst 2b is much slower that 2a in rcm , 2b also initiates the romp of dcpd more slowly than 2a . a romp of dcpd using 2a reaches its exotherm within 3 minutes , while the same polymerization catalyzed by 2b requires more than 25 minutes . while not intending to be bound by theoretical considerations , the difference in reactivity between 2a and 2b may be due to the fact that the pyridine ligand in 2a is trans to the strongly σ - donating nhc ligand and therefore dissociates to give the active 14 - electron species much faster than in 2b . the difference in activity between 2a and 2b may be purely due to a disparity in initiation rates and does not give any clues regarding the conformation of the metallocyclobutane metathesis intermediates . in other words , the fact that 2a is a faster catalyst than 2b does not imply that the olefin approaching the 14 - electron species must necessarily bind trans to the nhc ligand [ see , e . g ., trnka , t . m . ; day , m . w . ; grubbs , r . h . organometallics 2001 , 20 , 3845 - 3847 for a discussion on the conformation of olefin metathesis intermediates ]. substitution on the pyridine ring has a much less dramatic effect on catalytic activity . in the romp of dcpd , a reaction less sensitive to small reactivity differences , the three complexes 2a , 4 and 5 were found to have similar catalytic properties . a further romp was run to compare catalysts 2a , 2b , and 12 , with the results given in fig1 . dicyclopentadiene containing 3 . 5 % of tricyclopentadiene ( 100 g ) was polymerized by addition of catalyst ( monomer / catalyst = 40 , 000 : 1 mole : mole ) at 30 ° c . the polymerization exotherms for the polymerization catalyzed by mixtures of catalysts 2a and 2b at various ratios of the catalysts were measured and are shown in fig1 . as shown in fig1 , the slow isomerization process and large activity difference between catalysts 2a and 2b allows for this catalytic system to be tuned by partially isomerizing 2a to a 2a : 2b mixture with the desired initiation rate . indeed , the use of varying 2a : 2b mixtures for the romp of dcpd allowed for the control of the times to exotherm as shown in fig1 . dicyclopentadiene containing 3 . 5 % of tricyclopentadiene ( 100 g ) was polymerized by addition of catalyst ( monomer / catalyst = 40 , 000 : 1 mole : mole ) at 30 ° c . the polymerization exotherms for the polymerization catalyzed by catalysts 2a , ru ( ph - im ) and ru ( cy - im ) were measured and are shown in fig1 . as noted in rcm , catalyst 7 is faster than 2a , while 8 is slower than 2a . the same trend was observed in the romp of dcpd . these results show that the catalysts that contain an imine ligand ru ( r - im ) ( where r is for instance an alkyl or aryl group ) can easily be tuned by varying the steric and electronic properties of the r group on the imine . | 2 |
the flow control mechanism as a whole is shown in the drawings and is identified by reference character 10 . mechanism 10 includes as one of its elements a housing or valve housing 12 . housing 12 forms about an opening 14 which passes therethrough from the top portion 16 of housing 12 to the bottom portion 18 thereof . an external threaded portion 20 of housing 12 allows the threading insertion of housing 12 within a pump fitting internally threaded to accept the same . housing 12 is of rigid construction using a material such as stainless steel to effect this chracteristic . internally threaded portion 22 accepts threaded fittings of conduits , tubes , pipes and the like to further transport the fluid being pumped to a desired location . as shown , fluids would normally travel through opening 14 at the bottom portion 18 to the opening at the top portion 16 of housing 12 . the housing further includes a first chamber 24 which may be created from the internal walls of opening 14 . as depicted in fig1 the first chamber 24 is within first slidable member 26 which may also be fashioned of stainless steel . in other words , in the basic embodiment of the invention , housing 12 and first slidable member 26 may be integrally formed . first chamber 24 communicates with opening 14 . fig3 indicates that top portion 16 may have a hexagonal configuration 28 to permit turning of the housing with a similarly shaped wrench . gasket space 30 may house seal forming items associated with the aforesaid conduits and fittings . funnel portion 32 of opening 14 affords reduction in the diameter opening 14 as desired . a first seat 34 positions within housing opening 14 adjacent to first slidable member 26 which includes a circular recess 36 . a restricted passage communicates with first chamber 24 and housing opening 14 . for liquid chromatography applications the seat may be constructed of ruby or sapphire . the same materials may be employed to form first plug 40 , which may externalize in a spherical object confined to first chamber 24 . first plug or ball 40 is adapted to occupy first seat 34 and close the restricted passage 38 therethrough under fluid pressure in the direction from top portion 16 to the bottom portion 18 of housing 12 . thus , a first valve 44 is formed by first plug 40 to check the flow of fluid in one direction since first plug 40 will only close first seat 34 . filter means 44 positions snuggly beneath first seat 34 and first slidable member 26 . the presence of particulate matter in the vicinity of first seat 34 and first plug 40 , such as solvent impurities , dust , metallic particles from the pump piston , burrs , chips from conduits and seals , will greatly impair the working of the first valve 42 . the filter means 44 includes a pressure deformable section 46 which fits tightly within housing opening 14 beneath first seat 34 and first slidable member 26 . pressure deformable section may be constructed of teflon , kel - f , and other like plastics . a passage 48 cuts through the central portion of pressure deformable section 46 , thus communicating with the housing opening 14 . the bottom face 50 of pressure deformable section 46 may protrude from housing opening 14 below the bottom fact 52 of housing 12 , fig1 and 2 . a relatively rigid filter element 54 positions within the passage 48 of the pressure deformable section of filter means 44 . the rigid filter element 54 could be sized a little larger than the passage 48 and forced into place under pressure . for example , rigid filter element 59 may be formed of sintered stainless steel , ceramic and other similar materials filtering particles of about two microns for liquid chromatography applications . metallic powders exhibit relatively poor fatique life and will not withstand repeated reverse bending . therefore , filter element 54 occupies only a portion of passage 48 leaving a gap 56 within passage 48 between the upper portion of filter element 54 and the upper portion of pressure deformable section 46 . the placement of the mechanism 10 in a pump head will create pressure on the bottom face 52 of filter means 44 , shown by directional arrows on fig1 . deformable section 46 will cold flow onto the bottom face 52 of housing 12 into area 58 , shown in phantom on fig1 . first slidable member 26 , first seat 34 will move upwardly into a tighter fit within housing opening 14 . deformable member will also very tightly seal the wall of housing opening 14 against leakage of fluid therebetween . filter element 54 will tend to fill gap 56 but will not be strained thereby . the mechanism may also include first washer 60 composed of teflon , kel - f or other like material . washer 60 bears on first slidable member 26 which is somewhat rigid . a second valve 62 may be added to mechanism 10 to provide a double check valve operation . in this regard , second valve 62 includes second seat 64 , second chamber 66 , second slidable member 68 and second plug 20 . a second washer 72 may be placed within housing opening 14 to bear on second slidable member 68 . in operation , valves 42 and 62 separated by washers 72 and 60 and filter means 44 form a unit which may be placed within housing opening 14 . pressure deformable section 46 may protrude from the housing at this time . the exertion of pressure on the bottom faces 50 and 52 of filter means 44 and housing 12 may come about as a result of the threading engagement of externally threaded portion 20 in a pump head . deformable section 46 and washers 72 and 60 prevent leakage of fluid between the wall of opening 14 and the extremities of those elements . internally threaded portion 22 would be connected to conduits and the like leading to a particular outlet . fluid enters passage 48 , passes through filter element 54 with the removal of extraneous particulate matter . the fluid continues through restricted passage 38 first chamber 24 and the center of washer 60 . at this point the fluid enters second valve 62 via the restricted passage of second seat 64 . after flowing through second chamber 66 and the center of washer 60 , the fluid passes from housing opening 14 to its delivery point . fluid pressure in the opposite direction will not result in fluid flow because of the seating of first and second plugs 40 and 70 in seats 34 and 64 . while in the foregoing specification embodiments of the invention have been set forth in considerable detail for purposes of making a complete disclosure of the invention , it will be apparent to those skilled in the art that numerous changes may be made in such details without departing from the spirit and principles of the invention . | 8 |
referring initially to fig1 a , a block diagram of an embodiment of a location determination system 100 - 1 is shown . the location determination system 100 allows wireless devices 120 to find their geographic location or be located by remote entities by using satellites 152 ( e . g ., glonass , gps , galileo , egnos , globalstar , iridium ) and / or base stations 112 , 124 ( e . g ., cellular phone base station , a wireless local area network , a wireless wide area network , satellite phone , satellite internet , or any other device that can be uniquely recognized and communicate with the wireless device 120 ). cooperative base stations 112 are coupled to an almanac processor 122 by way of a wide area network ( wan ) 110 in this embodiment , but other embodiments could use a local area network ( lan ). the almanac processor 122 accesses a base station database 144 to tailor or customize an almanac according to the estimated location of the wireless device 120 . a wireless device 120 can communicate with any number of devices to provide location information . in this embodiment , the wireless device 120 is a cellular phone that may have any number or combination of communication modes ( e . g ., gsm , cdma , tdma , wcdma , ofdm , gprs , ev - do , wifi , bluetooth , wimax , 802 . xx , uwb , satellite , etc .) to transfer voice and / or data with cellular , satellite , wireless data , and / or mesh networks by way of their base stations 112 , 124 . the wireless device 120 in other embodiments could be a tracking device , a child or parolee monitor , navigational device , wireless pager , wireless computer , pda , asset tag , etc . the supported communication modes for each wireless device 120 are stored in a device capability database 140 that includes information to help in determining an uncertainty factor for each location or distance measurement made by a particular wireless device 120 operating in any number of communication modes . this embodiment shows cooperative base stations 112 , uncooperative base stations 124 and a satellite location beacon 152 that could each have different communication modes . for example , cellular base stations 112 , 124 might support tdma and gsm , a satellite base station might support only cdma , or another satellite base station might support only tdma . base stations 112 , 124 are defined herein to allow some sort of data and / or voice transport . base stations 112 , 124 are often affiliated with some entity ( e . g ., cellular or wifi service provider ) such that only subscribers or subscribers to another system with a roaming agreement can communicate with the base station 112 , 124 to pass data and / or voice traffic . the base stations 112 , 124 may be connected to a wan or lan to get a tailored almanac , but only cooperative base stations 112 provide a tailored almanac . the various base stations 112 , 124 may have any number of or combination of communication modes ( e . g ., gsm , cdma , tdma , wcdma , ofdm , gprs , ev - do , wifi , bluetooth , wimax , 802 . xx , uwb , satellite , etc .) to transfer voice and / or data with cellular , satellite , wireless data , and / or mesh networks . there are cooperative and uncooperative base stations 112 , 124 . an cooperative base station 112 is one that allows data and / or voice communication with the wireless device 120 . in one example , voice communication can be supported by voice over ip ( voip ). uncooperative base stations 124 may not allow data and / or voice traffic , but do provide information useful in determining a location of the wireless device . uncooperative base stations 124 provide some type of identifier and can often be used for ranging , which is a process where the distance between the base station 124 and the wireless device 120 is determined . the identifier in the case of a wifi base station 124 , for example , includes a station identifier and mac address . also , some uncooperative base stations 124 allow ranging measurements , received signal strength indications and beacon signaling capabilities that can all be used to determine distance . the base station database 144 stores the identifier information that can be used to uniquely identify each base station in that class of base stations . for example , each wifi base station could include a mac address as identifier information . as another example , a cdma base station identifier could include sid , nid and base id or sid , msc id and base id . characteristics of the base station 112 , 124 could be used in uniquely identifying the base station 112 , 124 . for example , if two base stations had the same station identifier , but only one supported a particular communication standard , the two could be uniquely identified . typically , a wireless device 120 would support a subset of the various communication modes . also stored in the base station database 144 is location information that is determined for each base station 112 , 124 by performing surveys of the area with the wireless devices . in one embodiment , wireless devices 120 can be used to determine the location of each base station 112 , 124 , thereafter the location is reported back to the almanac processor 112 . the location information from various wireless devices 120 for each base station 112 , 124 is aggregated by the almanac processor 112 to update the base station database . as more location data points are gathered , they are weighted according to the accuracy of the location information provided by the wireless device 120 and used to resolve the location of the base station with ever increasing accuracy . the accuracy of each wireless device 120 could be stored in the device capability database 140 , which could have different accuracies for the various ways that a wireless device 120 could gather the information . any uncertainty that the wireless device 120 could have in knowing its location could also be reflected in the accuracy weighting for the base station database 144 . various types of location beacons could be used by the wireless device 120 to aid in the location determination . this embodiment uses a satellite location beacon 152 , but pseudolites and terrestrial beacon systems such as loran could also be used . the more location references , generally , the better the location of the wireless device 120 can be determined . this embodiment shows the almanac processor 122 separate from the cooperative base stations 112 , but each cooperative base station 112 or a class of cooperative base stations 112 could have an almanac processor 112 and / or databases 140 , 144 in other embodiments . some embodiments could integrate the almanac processor 122 into the wireless device 120 . the base station and / or device capability databases 144 , 140 could also be in the wireless device 120 and updated periodically . referring next to fig1 b , another embodiment of the location determination system 100 - 2 is shown . in some embodiments , the base station database 144 is centrally located , but the base station database 144 is distributed regionally or in portions relevant to each cooperative base station 112 or a class of cooperative base stations 112 as a local almanac 158 in the present embodiment . for example , a first base station 112 - 1 , may store a portion of the base station database 114 for its footprint and all adjacent base station footprints in a first local almanac 158 - 1 . as another example , the first local almanac 158 - 1 may contain the base station database for all or select set of cdma base stations . in yet another example , the first almanac 158 - 1 may not be geographically organized but contain the base stations which are part of a particular service provider network . as the centrally - located base station database 144 is updated , those changes are propagated to the various local almanacs 158 that might use the new information . this embodiment does not use a satellite location beacon 152 or other type of location beacon , but has one or more communication satellites base stations 154 for use in voice and / or data communication . this embodiment of the communication satellite base station 154 could , but does not , have a local almanac 158 and / or databases 140 , 144 . the communication satellite base station 154 relies upon the almanac processor 122 to produce tailored almanacs . a satellite ground station 160 communicates with the almanac processor 122 by way of the wan 110 . referring next to fig1 c , yet another embodiment of the location determination system 100 - 3 is shown . in this embodiment , a cooperative base station 112 is coupled to a local area network ( lan ) that is coupled to an almanac processor 122 and device capability and base station databases 140 , 144 . the information in the device capability and base station databases 140 , 144 could be periodically updated or reconciled with remote master versions of these databases using a wan or the like . the satellite base station 154 in this embodiment also includes an almanac processor 122 and device capability and base station databases 140 , 144 , even though that level of detail is not shown in the figure . with reference to fig2 a and 2b , diagrams of embodiments of a single - cell location system 200 are shown . a cooperative base station 112 has a cell footprint 204 in which it can communicate with the wireless device 120 . fig2 a shows the uncooperative wireless base station 124 within that cell footprint 204 . on occasion , the wireless device 120 is barely within the cell footprint 204 to communicate with the cooperative base station 112 , but has the ability to communicate with uncooperative base stations 124 outside this cell footprint as shown in fig2 b . a cell buffer zone 208 would include uncooperative base stations 124 outside the range of the cooperative base station 112 , but possibly within range of a wireless device 120 within range of the cooperative base station 112 . an uncooperative base station footprint 212 is shown for a base station 124 outside the cell footprint , but within communication range of the wireless device 120 . including this base station 124 in the cell buffer zone 208 accommodates this scenario . in this embodiment , the wireless device 120 is in communication range of a single cooperative base station 112 . in the cell footprint 204 of the cooperative base station 112 , there are eleven uncooperative base stations 124 . the cell buffer zone 208 has two more uncooperative base stations 124 . when the almanac processor 122 receives a request for a tailored almanac , information for the thirteen possible uncooperative base stations are included . in one embodiment , the cooperative base station 112 may determine a range to the wireless device 120 and the almanac processor 122 could cull the list of thirteen to those that might fall within an annular ring around the cooperative base station 112 . the ring would be as thick as the range of the wireless device 120 when talking to the various uncooperative base stations 124 in a particular mode plus some error factor from determining the range to the cooperative base station 112 . for example , the wireless device 120 may have a range from the cooperative base station 112 of fifty measurement units with an error factor of ten percent . in one communication mode , the range from the wireless device 120 is fifteen units . in this example , the annular ring would begin at a radius of thirty and extend to seventy measurement units . any base station 112 , 124 understanding that communication mode and within that annular footprint would be included in the tailored almanac . of course , if the annular ring extended beyond the cell buffer zone 208 the radius of the ring would be curtailed appropriately . as the wireless device 120 may have different modes of communication to the various types of base stations , the thickness could be different for each type of base station communication mode . further , the wireless device 120 may receive almanac information on other cooperative base stations 112 that the wireless device 120 was unaware of . in another embodiment , the almanac processor 122 might cull the number of base stations 112 , 124 included in the tailored almanac . in some cases , the density of base stations 112 , 124 is so great that including additional base stations 112 , 124 that are in close proximity would be of little aid in resolving the location of the wireless device 120 . in some embodiments , the almanac processor 122 might exclude base stations 112 , 124 that don &# 39 ; t have any way to uniquely identify them . for example , if two base stations had the same station identifier and did not provide any other codes to uniquely identify them , they both could be excluded from the tailored almanac . often times , other identifiers in the communication protocol can be combined with identifiers to create a unique identifier that distinguishes the base stations 112 , 124 . in some cases , two or more base stations 112 , 124 that cannot be uniquely identified are so geographically separate that a unique identifier can be formulated by knowing the geographic location of interest such that they could still be used . only one would be included in any tailored almanac . referring next to fig3 a and 3b , diagrams of embodiments of a cell sector location system 300 are shown . this embodiment has six cell sectors 304 for a cooperative base station 112 , but other embodiments could have any number of cell sectors . the wireless devices 120 in the cell footprint 204 are divided among the cell sectors 304 such that the base station 112 knows which cell sector ( s ) 304 communicates with a particular wireless device 120 . the cell sector ( s ) that might have the wireless device 120 are forwarded to the almanac processor 122 . any base stations 112 , 124 within the cell sector ( s ) 304 are forwarded to the cooperative base station 112 for relay to the wireless device 120 . in the embodiment of fig3 a , a single cell sector 304 can communicate with the wireless device 120 . the almanac processor 122 would include those base stations 112 , 124 in that sector 304 along with those in a sector buffer zone 308 . the embodiment of fig3 b shows the wireless device 120 close to the edge between two cell sectors 304 such that both can receive communication . the almanac processor 122 could provide the base stations 112 , 124 in those two cell sectors 304 and a sector ( s ) buffer zone 308 around them to any wireless device 120 within or nearby that area . with reference to fig4 , a diagram of an embodiment of an overlapping cell location system 400 is shown . in this embodiment , two cooperative base stations 112 can communicate with the wireless device 120 such that the overlap in the cell footprints 204 is presumed to be the location of the wireless device 120 . the almanac processor 122 would query the device capability and base station databases 140 , 144 to determine how to tailor an almanac for this overlapping region 404 . a portion of the cell buffer zone 208 that overlaps the cell buffer zone 208 of the other cell footprint 204 and cell buffer zone 208 ( and vice - versa ) would also be analyzed for base stations 112 , 124 to include in any tailored almanac . referring next to fig5 , a diagram of an embodiment of a trilateration cell system 500 is shown . in this embodiment , the wireless device 120 can communicate with three or more cooperative base stations 112 - 1 , 112 - 2 , 112 - 3 that are geographically separate . a general location of the wireless device 120 is determined by analyzing ranging information gathered by or from a number of cooperative base stations 112 . time of arrival ( toa ) readings from one cooperative base station 112 reduces the general location to a ring around that base station 112 . two cooperative base stations 112 generating time difference of arrival ( tdoa ) ranging readings reduce the location to a hyperbole . three or more can resolve the general location even further . in this embodiment , time of arrival and / or time difference of arrival measurements are used in the trilateration process . however small the area becomes , a buffer around that area is determined to compensate for the error in the determination and address the range of the wireless device 120 to base stations 112 , 124 . the almanac processor 122 gathers information for the base stations 112 , 124 likely to be in communication range for each communication mode supported by the wireless device 120 . with reference to fig6 , a diagram of an embodiment of a hybrid trilateration system 600 is shown . this embodiment shows trilateration with different types of communication modes . the wireless device 120 receives ranging information from a satellite location beacon 152 and communicates with two cooperative base stations 112 - 1 , 112 - 2 . between the three 152 , 112 - 1 , 112 - 2 , the general location can be trilaterated and forwarded to one of the cooperative base stations 112 in exchange for a tailored almanac . referring next to fig7 , a diagram of an embodiment of an angular ranging system 700 is shown . the cooperative base stations 112 in this embodiment can estimate the angle of arrival ( aoa ) and distance to the wireless device . this ability allows determining a general location with a single cooperative base station 112 . where the cooperative base station 112 can only determine aoa and not range , two cooperative base stations 112 - 1 , 112 - 2 can determine a general location . the above embodiments do not rely upon uncooperative base stations 124 to find an initial location estimate , but request a tailored almanac from cooperative base stations 112 for refined location estimations . some embodiments could report the base stations 112 , 124 and location beacons seen and any ranging estimates to those as part of a location request . the almanac processor 112 could take this information and determine a location using the device capability , mode of operation and base station databases 140 , 144 . in this embodiment , the initial gathering of location information is done without the benefit of a tailored almanac . where the almanac processor 122 determines a more accurate location is required , a tailored almanac could be produced that indicates additional base stations 112 , 124 that are likely within range of the wireless device 120 . with reference to fig8 , a flow diagram of an embodiment of a process for locating a position of a wireless device 120 that has native location functions 800 is shown . the wireless device 120 could trilaterate to cooperative base stations 112 or satellite or ground location beacons to determine a general location in step 804 . in step 808 , the wireless device 120 reports the location estimate and requests a tailored almanac . some wireless devices may store a base almanac of base stations 112 , 124 that is updated as new tailored almanacs are received . in this embodiment , the location estimate could be further refined outside the wireless device in step 812 . for example , the cooperative base station 112 may have some location information from time of arrival or time difference of arrival . the general location is forwarded to the almanac processor 112 . in step 816 , the almanac processor 112 tailors an almanac by finding all base stations 112 , 124 that might be close enough to use in determining a location of the wireless device 120 . this takes into account all the modes of communication of the wireless device 120 that are compatible with the various base stations 112 , 124 , the likely range in those modes , and the likely location of the wireless device 120 . that tailored almanac is sent over the wan 110 to the cooperative base station 112 and relayed to the wireless device in step 820 . in step 824 , further location information is gathered by the wireless device 120 . this location information uses the tailored almanac and could involve uncooperative base stations 124 as well as cooperative base stations 112 . in this embodiment , the wireless device 120 analyzes the location information to refine the location estimate in step 828 . the location estimate is reported to an cooperative base station in step 832 . during the process of determining a location , the wireless device 120 may have location information for the base stations 112 , 124 in the tailored almanac or those not in the almanac yet . in step 836 , this location information together with the almanac - related information such as the identifications of the observed base stations is reported to an cooperative base station 112 and forwarded to the almanac processor 122 for updating the base station database 144 . referring next to fig9 , a flow diagram of another embodiment of a process 900 for locating a position of a wireless device 120 that has limited location functions is shown . some wireless devices have limited ability to independently determine their location . this embodiment relies on other parts of the location determination system 100 to analyze location information . in step 908 , the wireless device 120 requests a tailored almanac . the location is estimated by the various cooperative base stations 112 in step 912 . that location estimate is passed to the almanac processor 122 for tailoring of almanac information in step 816 . in step 820 , the tailored almanac is sent to the wireless device 120 . step 824 gathers further location information using the tailored almanac to find uncooperative base stations 124 . in step 916 , the gathered location information is forwarded to the cooperative base station 112 . step 928 refines the location estimate using the location information . the refinement may be performed in the cooperative base station 112 , the almanac processor 122 or any other location in communication with the cooperative base station 112 . any additional information gathered by the wireless device 120 is forwarded to the almanac processor 122 to refine the base station database 144 . with reference to fig1 , a diagram of an embodiment of system 1000 that gathers location information from uncooperative base stations 124 is shown . once the tailored almanac is received by the wireless device 120 , it attempts to locate those base stations listed in the almanac . shown in the embodiment of fig1 is a dual - mode wireless device 120 that supports two communication modes . one communication mode has a first footprint 1012 - 1 and the second has a larger footprint 1012 - 2 . the tailored almanac would have all base stations 112 , 124 in the first footprint 1012 - 1 that use the first communication mode and all base stations 112 , 124 in the second footprint 1012 - 2 that use the second communication mode . in some embodiments , the almanac processor could perform a motion estimation for the wireless device 120 such that footprints 1012 are adjusted for the likely position of the wireless device 120 when the tailored almanac would be used . other embodiments , could just expand the footprint according the likely speed or maximum speed of the wireless device 120 should it travel in any direction . in yet other embodiments , a history of handoffs between various base stations can be used to tailor the almanac information . referring next to fig1 , a flow diagram of an embodiment of a process 1100 for gathering location information from base stations 112 , 124 is shown . the process 1100 begins in step 1104 where the wireless device 120 checks for base stations 112 , 124 in the tailored almanac . this could be done by randomly choosing base stations in the almanac 112 , 124 . in some embodiments , the base stations 112 , 124 could be pre - randomized so that the wireless device 120 could take them in order . in another embodiment , the almanac processor 122 could choose another scheme for organizing the base stations 112 , 124 to quickly find one . for example , they may be organized by communication mode and footprint 1012 size . the footprint of the almanac is more quickly covered by using communication modes with larger range . once one base station 112 , 124 in the almanac is found in step 1108 , it may be possible to exclude some of the base stations 112 , 124 in the almanac . after running through the various base stations 112 , 124 to find those in range of the wireless device 120 , the distance to each is estimated in step 1112 . uncooperative base stations 124 still give some information even though data communication is not possible . they will identify themselves , which indicates the wireless device 120 is close enough to communicate . some uncooperative base stations 124 will indicate signal strength of a received signal . other uncooperative base stations 124 will acknowledge a message and that propagation time can be correlated to a distance traveled . the signal strength of a signal from the uncooperative base station 124 can intimate distance when the initial or expected signal strength can be determined . in some embodiments , the wireless device 120 gathers information on base stations 112 , 124 not included in the almanac in step 1116 . often the base stations 112 , 124 self identify themselves . if resources are available , in step 1120 ranging may be performed to the unlisted base stations 112 , 124 for later report - back to the almanac processor . in other embodiments , the footprint of the base station or the overlaps of more than one footprint can be analyzed to determine the general location of the wireless device 120 . with reference to fig1 , a diagram of another embodiment of system 1200 that gathers location information from uncooperative base stations 124 is shown . the depicted uncooperative base stations 124 are those identified in a tailored almanac as likely to be in communication range . in this embodiment , three uncooperative base stations 124 - 1 , 124 - 4 , 124 - 5 operate in a first communication mode with first communication footprints 1212 - 1 , 1212 - 4 , 1212 - 5 ; two uncooperative base stations 124 - 2 , 124 - 6 operate in a second communication mode with second communication footprints 1212 - 2 , 1212 - 6 ; and one uncooperative base station 124 - 3 operates in a third communication mode with a third communication footprint 1212 - 3 . the current position of the wireless device 120 only allows communication with three uncooperative base stations 124 - 2 , 124 - 3 , 124 - 4 . even without ranging measurements , this can narrow down the location of the wireless device 120 , but with ranging measurements , a very precise location can be determined . the above description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the disclosure . various modifications to these embodiments will be readily apparent to those skilled in the art , and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the disclosure . thus , the disclosure is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein . | 6 |
with reference to fig1 - 7 , the numeral 10 designates a housing assembly 10 including a housing 12 , having a flat front surface 14 , a side surface 16 , a flat top surface 18 , and a rear surface 20 . the front surface 14 is larger in diameter than the rear surface 20 , and is the outer surface of flange 22 located around the front of housing interior 23 ( fig8 ). as also shown in fig8 , housing interior 23 has an interior side surface 24 , an interior top surface 26 , and an interior rear surface 28 . housing 12 also has opposite shoulders 30 each having a pin bore 32 . two cover stops 34 protrude from the interior side surface 24 of the housing 12 ( fig8 ). a lock bore 36 is located towards the bottom of interior side surface 24 to receive a conventional lock unit ( not shown ). as shown in fig7 , rear surface 20 of housing 12 has a rectangular - shaped opening 38 . lugs 40 reside on opposite sides of rear opening 38 , and hydrant mounting holes 42 are located above and below rear opening 38 . housing 12 is of a cast construction and may be made of any metal or alloy . in the preferred embodiment , housing 12 is made of cast aluminum . all of the features described above are integrated into the casting . pin bores 32 may be drilled to achieve a specific tolerance , and lock bore 36 , lugs 40 and mounting holes 42 may be tapped to achieve specific threads . with reference to fig1 - 7 , the housing assembly 10 also includes a cover 44 . cover 44 may include a domed portion 46 , which helps to accommodate certain models of hydrants . alternatively , cover 44 may be flat , without domed portion 46 , depending upon the specific hydrant used . cover 44 has a lock bore 48 positioned to be in alignment with lock bore 36 on housing 12 when the cover 44 is affixed to the housing 12 . cover 44 also includes a flat hinge portion 50 . as shown in fig1 - 13 , hinge portion 50 has a side surface 52 with a slot 54 . cover 44 is of a cast construction and may be made of any metal or alloy . to prevent potential galvanic corrosion , cover 44 should be made of the same material as the housing 12 . in the preferred embodiment , cover 44 is made of cast aluminum . all of the features described above are integrated into the casting . slot 54 may be milled to achieve a specific tolerance . cover 44 attaches to housing 12 and is retained by pins 56 . as shown in fig9 , pins 56 extend through pin bores 32 on housing 12 . pins 56 also extend through slot 54 of cover 44 ( fig1 - 13 ). in fig1 , cover 44 is locked in the upright or open position . specifically , the hinge portion 50 of cover 44 cantilevers about pin 56 and pushes against interior top surface 26 of housing 12 . to close the cover 44 , the cover 44 must first be pulled away from housing 12 , as shown in fig1 . pulling the cover 44 away from the housing 12 causes the slot 54 of cover 44 to slide with respect to the pin 56 . when the cover 44 is fully retracted from the housing 12 , it will pivot about pin 56 , as shown in fig1 . interior top surface 26 is contoured such that the hinge portion 50 of cover 44 can freely pivot without interfering with the housing 12 . cover 44 can then pivot about pin 56 until reaching the closed position , as shown in fig1 . cover 44 will press against cover stops 34 inside the housing 12 when the cover 44 is in the closed position . a locking device ( not shown ) can then be inserted into lock bore 48 of cover 44 to engage with lock bore 36 of housing 12 to lock cover 44 in the closed position . locking may be necessary to prevent unauthorized access to the hydrant mounted inside the housing assembly 10 . housing assembly 10 can be used with tilt - up concrete wall construction , as shown in fig1 . in tilt - up construction , a pre - cast concrete panel 58 is inserted into a groove 60 in concrete base 62 . a cable 64 is secured to panel 58 and is used to raise panel 58 into position . after all panels 58 are raised , a cap ( not shown ) is secured to the top ends of the raised panels . a hole 66 is drilled into concrete panel 58 to allow for installation of the housing assembly 10 . hole 66 typically is placed a specific height from the ground . as such , hole 66 can be drilled prior to the panel being installed or into an existing panel already installed . housing assembly 10 may also be used with poured concrete walls , as shown in fig1 . poured concrete wall 68 may be drilled to form hole 70 , which accommodates the housing assembly 10 . in either types of construction , the housing assembly 10 can be easily installed with a single drilling operation . as shown in fig1 - 18 , drill 72 can be used to drill concrete wall 74 to create mounting hole 76 . mounting hole 76 is slightly larger in diameter than the diameter of rear surface 20 of housing 12 , but smaller than the diameter of flange 22 of housing 12 . because the housing assembly 10 is of a round configuration , the wall 74 only needs to be drilled to accommodate the housing assembly 10 . unlike the prior art , no chiseling or chipping is required as there are no sharp corners to be made . after the hole 76 has been drilled in wall 74 ( or the holes 66 in panels 58 ), the housing assembly 10 is inserted inside hole 76 such that the flange 22 is flush against the wall 74 , as shown in fig1 and 19 . with reference to fig2 , securing plates 78 may be attached to the rear surface 20 of the housing 12 such that the housing assembly 10 is securely mounted within wall 74 . securing plates 78 are of a length substantially larger than the diameter of hole 76 . threaded rods 80 screw into the mounting holes 42 in the rear surface 20 of housing 12 . securing plates 78 have centrally located holes 82 that are sized to fit over threaded rods 80 . nuts 84 secure to the ends of threaded rods 80 to tighten the securing plates 78 against wall 74 . once installed into a wall , a hydrant 86 ( fig2 ) can then be mounted inside the housing assembly 10 . specifically , the hydrant 86 is inserted through the front of the housing assembly 10 such that the hydrant mounts against the interior rear surface 28 of the housing 12 . the hydrant 86 is secured to the housing assembly 10 through attachment to lugs 40 , which may be tapped to facilitate bolts . the plumbing ( not shown ) associated with the hydrant 86 extends out the rear side 20 of the housing assembly 10 through rear opening 38 . whereas the invention has been shown and described in connection with the preferred embodiments thereof , it will be understood that many modifications , substitutions , and additions may be made which are within the intended broad scope of the following claims . from the foregoing , it can be seen that the present invention accomplishes at least all of the stated objectives . | 8 |
in fig1 is shown an inventive means for carrying out a method of the invention , the means essentially comprising a sensor 1 , a filter 2 , an input stage 3 , and a control unit 4 . the sensor 1 , which is preferably a piezo - electric sensor , is secured to an internal combustion engine to sense the vibrations of the internal combustion engine and convert them into an electrical sensor signal ss . other vibration sensors may , of course , be used instead . connected at the output of the sensor 1 is an amplifier 8 for matching and amplifying the sensor signal ss . the amplified signal ss is fed into the filter 2 which is composed of a first band - pass filter 21 , a knocking band - pass filter 23 , and a switchover means 22 . the switchover means 22 connects the sensor signal ss either through to the knocking band - pass filter 23 or to the first band - pass filter 21 , and is driven by a switchover signal on lead su connected from the control unit 4 . the first band - pass filter 21 has a center frequency f k corresponding to a frequency which is indicative of ignition and generates a filter signal sf from the sensor signal ss . the spectrum of the filter signal ss is characteristic for a normal combustion in an internal combustion engine . the knocking band - pass filter 23 has a center frequency f k corresponding to a frequency which is indicative of knocking and filters out a knocking signal sk from the sensor signal ss , the knocking signal sk being characteristic for high - speed knocking or for knocking due to pre - mature ignition . either the filter signal sf or the knocking signal sk are transmitted to the input stage 3 depending upon the position of the switch 22 . the input stage 3 includes a full wave rectifier 31 , a switch 32 and an integrator 33 . the rectifier 31 generates a rectified signal sg , also referred to as a dc signal , from either the filter signal sf or from the knocking signal sk and supplies the rectified signal sg to the switch 32 . the switch 32 switches the rectified signal sg to the integrator 33 only when a switching signal ssc is generated by the control unit 4 and transmitted to close the switch 32 . when the integrator 33 receives the rectified signal sg , it integrates the through - connected rectified signal sg and thereby produces an input signal se which is supplied to the control unit 4 . the integrator 33 includes a reset input which is driven by a reset signal sr which also comes from the control unit 4 . the control unit 4 in the illustrated embodiment is a program - controlled processor system comprising a central processor unit 42 , a read - only memory 43 , a read / write memory 44 , a timer 47 , an analog - to - digital converter 41 , and an input / output unit 45 . all subunits of the control unit 4 are connected to one another by a system bus 46 . in addition to having a system clock generator , the time generator 47 also includes a timer which is set proceeding from the processor 42 to establish ignition measuring windows and knocking measuring windows . the system software is stored in the read - only memory ( rom ) 43 . the read / write memory 44 ( ram ) serves to store current data . the control unit 4 is utilized not only for checking knocking and ignition events in the internal combustion engine but is mainly used for control of the internal combustion engine itself . accordingly , the input / output unit 45 of the control means 4 has a greater number of control inputs and outputs then is required simply for performing the present method , the additional inputs and outputs being indicated by broken line arrows in fig1 . among other things , the control unit 4 acts as a motor controller and also interprets the rpm of the internal combustion engine and , in particular , an idling rpm signal no . the control unit 4 controls a plurality of injection load circuits 7 , only one of which is shown . the illustrated injection load circuit 7 includes , for example , a switching transistor q for switching an injection valve 50 on and off . the input / output unit 45 also drives a warning lamp 5 for fault indication . the warning lamp 5 can be a simple dashboard indicator , or can be a more sophisticated diagnostic tool which reads out the contents of a fault memory 6 to accurately reflect the performance of the engine . the fault memory 6 is connected to the input / output unit 45 and includes separate memory locations for each cylinder of the internal combustion engine . with every identified fault signal sfl , the memory location in the fault memory 6 which is allocated to the effected cylinder having a faulty combustion is incremented . the fault memory 6 is designed as a random access memory ( ram ) having a refresh cycle in order to permanently receive the stored data . referring now to fig2 a through 2h , the signal curves which occur in an exemplary embodiment of the apparatus are shown on a plurality of time graphs . in the chronological range wherein a combustion occurs in the internal combustion engine and a high pressure prevails in the cylinder , the sensor signal ss shown in fig2 a has an elevated signal amplitude that is noticeably distinguished from the other noises ( vibrations ) of the internal combustion engine . when the sensor signal ss is filtered , an allocated filter signal sf , as shown in fig2 b , or for the alternate switch position a knocking signal sk , as shown in fig2 c , is retrieved . each of the illustrated signals sf and sk exhibit a region of elevated signal amplitude . as may be seen by comparing the signals of fig2 b and 2c , the elevated signal amplitude of the knocking signal sk , which indicates an engine knock , occurs somewhat chronologically later than the elevated amplitude region of the filtered signal sf , which signifies the combustion event . accordingly , the filter signal sf has an ignition measure window tz allocated to it during which significant signal amplitudes of the filter signal sf appear . the ignition measuring window tz extends from a point in time of firing through about 10 degrees of rotation of the crank shaft angle . a knocking measuring window tk during which characteristic signal amplitudes of the knocking signal sk appear is situated following nearly immediately thereupon and is of a duration characteristic of engine knocking . in fig2 d is shown the signal sg produced at the output of the rectifier 31 . as shown , only the rectified signals sg in the measuring windows tz and tk are connected to the integrator 33 as the result of the switching signal ssc shown in fig2 f which causes the switch 32 to close . the first curve sga is being the rectified portion of the filter signal sf falling in the first measuring window tz of fig2 b . the third curve sgc is the rectified filter signal sf in the second ignition measuring window tz of fig2 b . the third curve sgc has a substantially lower amplitude than the first curve sga as the result of a failed ignition in the cylinder during the second window tz . the signal sgb is the rectified knocking signal sk which occurs in the first knocking window tk of fig2 c . the fourth signal curve sgd is the rectified knocking signal sk of the second knocking window tk and has a lower amplitude as the result of the absence of knocking . the signals of fig2 d are integrated by the integrator 33 to produce the input signals se shown in fig2 e . a threshold level a is exceeded when the area under the curves is greater than a predetermined value , thereby indicating ignition in the window tz and knocking in the window tk . fig2 f and 2g show the curves of the switching signal ssc that is transmitted to the switch 32 by the control unit 4 and the reset signal sr that is transmitted to the integrator 33 by the control unit 4 . fig2 h shows an identified fault signal sfl for transmittal to the memory 6 . the program steps for checking the internal combustion and the knocking of the internal combustion engine are shown generally in fig3 . after the program is started at least block 50 , the control unit 4 first interrogates whether the internal combustion engine is running at the low idle speed by determining whether the low idle signal no is present at least block 52 . when the idle speed signal no is not present indicating that the motor is not idling , the control unit 4 removes the switchover signal su from the switch 22 via its input / output unit 45 wherewith the switchover unit 22 switches the sensor signal ss to the knocking band - pass filter 23 in the filter 2 so that the filter 23 is on at block 54 . further , the processor 42 sets the timer 47 which starts the knocking measuring window tk at block 56 . immediately thereupon , the control unit 4 outputs the switch signal ssc for switching on , or closing , the switch 32 at block 58 . further processing and evaluation of the knocking signal sk by the control unit 4 within the knocking measuring window tk is carried out by transfer to a known subprogram knock , at block 60 . when the low idle speed signal no is present at block 52 , indicating that the internal combustion engine is idling , the control unit 4 forwards the switchover signal su to the switchover means 22 in the filter 2 at block 62 so that the sensor signal ss is switched to the band - pass filter 21 to derive the filter signal sf . immediately thereupon , the processor 42 sets the time generator 47 to start the ignition measuring window tz at block 64 and outputs the switching signal ssc which turns on , or closes , the switch 32 at block 66 . the rectified signal sg from the rectifier 31 is now applied to the integrator 33 , and at the beginning of the ignition measuring window tz , the integrator 33 begins to integrate up the rectified signal sg to form the input signal se . the input signal se , samples of which are shown if fig2 e , is forwarded to the analog - to - digital convertor 41 of the control unit 4 shown if fig1 . the control unit 4 samples the input signal se at equidistant chronological spacings for the duration of the ignition measuring window tz and compares , at block 68 , every sampled value of the input signal se to a defined reference value a ( shown in fig2 e ). when the control unit 4 finds that the value of the input signal se is higher than the reference value a at some point during the ignition measuring window tz , a normal combustion has occurred . the control unit 4 retracts the switching signal ssc so that the switch 32 is opened , or turned off , as indicated by block 70 in fig3 . immediately thereupon , the control unit 4 outputs the reset signal sr to the integrator 33 which is reset at block 72 in response thereto and the program returns to the start step at block 74 . when , by contrast , the sampled value of the input signal se from the integrator 33 remains below the reference value a during the entire duration of the ignition measuring window tz , as shown for example in the second window tz of fig2 e , a regular combustion has not occurred . the decision is made at block 76 that the window tz has ended . in response thereto , the control unit 4 calculates the faulty signal sfl as a binary data word which it outputs to the fault memory 6 at block 78 . the memory location in the fault memory 6 which is allocated to the effected cylinder having a faulty combustion is then internally incremented . the control unit 4 drives , or turns on , the warning lamp 5 at block 80 , preferably when a plurality of fault signals sfl have been identified or when a malfunction of at least one cylinder of the internal combustion engine has been identified . to avoid further injection into the cylinder having faulty combustion , the control unit 4 switches off the respective injection load circuit 7 at block 82 for the effected cylinder via the allocated control channel . injection of further fuel despite faulty combustion in the effected cylinder is thus reliably avoided . a wash - out , or flooding , with the resulting motor damage and an additional environmental pollution due to incomplete combustion of the fuel and damage to the exhaust catalyst are thereby avoided . after the expiration of the ignition measuring window tz and after identification of a fault signal sfl , the control unit 4 opens the switch 32 and resets the integrator 33 as before . for function checking of a cylinder whose allocated injection load circuit 7 has been shut - off by the control unit 4 , the control unit 4 executes an intermediate injection after the expiration of a defined injection pause . the control unit 4 switches the injection load circuit on and , after ignition has occurred , checks whether a regular combustion has occurred in the cylinder , for example , by using the steps of fig3 . the injection for the affected cylinder is again shut - off when the control unit 4 subsequently identifies a fault signal sfl . otherwise , the cylinder is again fully used . although other modifications and changes may be suggested by those skilled in the art , it is the intention of the inventors to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of their contribution to the art . | 8 |
single layers ( 2 ) enclose the aggregate ( 1 ) single layers ( 2 ) with small mesh width as template for the defined position of the aggregate ( 1 ) single layers ( 2 ) ensure the compression tension capacity of the member 3 - dimensional tying or interweaving ( 3 , 4 ) perform as fixation for the single layers ( 2 ) and ensure the shear capacity of the member ( see fig1 ) the thickness of the 3 - dimensional mat system can be defined and adjusted precisely , i . e . for abrasive overlays h mat = 10 to 100 mm 3 - dimensional mat system with integrated aggregate ( 1 ) allow in addition the integration of cable channels , heating systems etc . ( see fig7 ) the type and the strength capacity of the material can be composed arbitrarily ( preferably high strength and normal strength steel ) single layers ( 2 ) in expanded metal single layers ( 2 ) in welded or woven meshes fabrication of a 3 - dimensional mat system by interweaving without additional interconnecting elements general remark : the material stiffness can be adjusted by all different types of aggregate ( 1 ), as different types can be combined . type of aggregate : standard ( coarse , stone chips , sand etc . light - and heavyweight hollow core ( works as displacement core ) spec . gravity : extends from extreme light - weight ( hollow ) to heavy - weight shape : arbitrary ( ball , disc , cubic etc .) size : arbitrary ( regulation of dead load and spacing of the single layers ( 2 )) positioning : arbitrary formation and positioning in the horizontal layer of prefabricated 3 - dimensional mat system with integrated aggregate ( 1 ) ( see . fig4 ). vertical positioning of aggregate ( 1 ) by sieving effect of the 3 - dimensional mat system during slurry infiltration ( see fig2 ) aggregate ( 1 ) as hollow core , light - weight → minimization of member dead - load aggregate ( 1 ) as normal - weight → reduction of the fine particles and the shrinkage of the member , increasing of material stiffness aggregate ( 1 ) as heavy - weight → i . e . steel or lead for maximization of member dead load , radiation protection and sound insulation by the member arbitrary shape round shape will fit into the meshes of the single layers ( 2 )= template ( fig4 ) discs and cubic shapes for impervious structures additional density rings might be added if needed , in order to minimize the soaking of the infiltrating liquid ( see fig8 ) performing as a spacer of the single layers ( 2 ) a ) prefabricated 3 - dimensional mat system with integrated aggregate ( 1 ) ( fig1 . 1 ). = aggregate ( 1 ) is positioned between the single layers ( 2 ) before slurry infiltration precise positioning of aggregate ( 1 ) in the horizontal layer regulates the load dispersion like a beam grid and the dead load of the member variants of positioning in the horizontal layer i ) multiaxial beam grid → maximal load capacity of the member ( fig4 ) ii ) diagonal beam grid → minimization of dead load of the member by using hollow aggregate ( 1 ) ( grains ), maximization of dead load of the member by using lead aggregate ( 1 ) ( see fig4 ) precise positioning of aggregate ( 1 ) in 3 dimensions controls the stiffness of the member as well as the load bearing capacity , the deflection , the energy absorption and the dead load b ) prefabricated 3 - dimensional mat system without integrated aggregate ( 1 ) ( fig2 ) = the aggregate ( 1 ) will be sieved into the defined position during slurry infiltration sieving and positioning of aggregate ( 1 ) by variation of the mesh width of the single layers ( 2 ) a 1 ) concrete beam , consisting of the 3 - dimensional mat system a 2 ) concrete beam , consisting of the 3 - dimensional mat system and additional conventional rebars b ) wall members with staggered arrangement and variation of the size of aggregate ( 1 ) advantage : high material stiffness by positioning coarse aggregate ( 1 ) in the compression zone of the member , high bearing load and abrasion resistance minimization of crack width by positioning fine aggregate ( 1 ) in the tension zone of the member crack propagation adjusted by mesh width of the single layers ( 2 ), cracks develop at each mesh node c ) abrasive resistant overlays with staggered arrangement and variation of the size of aggregate ( 1 ) example : 3 - dimensional mat system for filtration of aggregate ( 1 ), performing as sieve advantage : high material stiffness by positioning coarse aggregate ( 1 ) near the surface of the overlay ( compression zone ), results in a high bearing load capacity and high abrasion resistance low material stiffness by positioning fine aggregate ( 1 ) near the bottom part of the overlay ( compression zone ), results in a minimization of the crack propagation and in an increase of durability = long term behavior advantages of the 3 - dimensional mat system for staggered arrangement , positioning and variation of aggregate technical advantages : • 3 - dimensional control of load bearing and deflection of cement bonded members by precise positioning of the 3 - dimensional mat system and the aggregate ( 1 ) • precise positioning of the aggregate ( 1 ) in the horizontal layer ( beam grid see fig4 ) • precise positioning of the aggregate ( 1 ) in 3 dimensions over the cross section of the member ( see fig1 . 1 ) • system without joints by monolithic splicing of the mats • minimization of the concrete embedment =& gt ; the complete height of the cross section can be taken into account for static analysis , =& gt ; minimization of the member thickness =& gt ; no additional spacer for the single layers ( 2 ) necessary =& gt ; cost reduction • 3 - dimensional load bearing capacity • high effectiveness because of maximum distance of single layers ( 2 ) to the neutral axis • precise alignment of single layers , performing as reinforcement • 3 - dimensional interconnection of the mat system increases the shear load capacity of the member • steel volume fraction can be adjusted precisely between 0 . 5 and 15 . 0 % of volume • installation of the 3 - dimensional mat system in defined parts of the member , i . e . only near the member surface • large variety of mat systems possible i . e . with integrated heating wires , prestress of single layers ( 2 ), confinement of structural members • characteristics extremely ductile , high bearing load capacity , minimization of crack development , minimization of inconsistency in material performance by variation and positioning of aggregate ( 1 ), 3 - dimensional structural performance of the mat system • crack width & lt ;& lt ; 0 . 03 mm during service limit state ( conventional concrete w ≧ 0 . 20 mm ) • multifunctional composite material by multiple layer set - up =& gt ; superimposing of a variety of characteristics by one material ( i . e . sound protection , insulation , electric and thermal conductivity , impact resistance etc .) economic advantages : • cost reduction and optimization by variation of the aggregate ( 1 ) • minimization of the construction work by a simplified placing of the prefabricated 3 - dimensional mat system • monolithic continuous system with high load capacity =& gt ; no cost intensive joints necessary • multifunctional material , which covers a variety of performances =& gt ; no cost intensive additional materials necessary • integration of hollow aggregate ( 1 ) as displacement core =& gt ; minimization of dead weight =& gt ; minimization of cost of transport =& gt ; enlargement of precasted structural members = acceleration of the erection of the structure =& gt ; minimization of duration of the construction • simplified elementation =& gt ; sectional system with quality assurance , no specialists for the execution necessary • no embodiment of the single layers ( 2 ) necessary =& gt ; minimization of thickness =& gt ; minimization of dead weight =& gt ; small transporters and cranes the difference in existing methods is , that defined single layers of the 3 - dimensional mat system can be prestressed especially in extremely thin concrete members . the prestressing allows an increase of the member span and crack - free structure . a ) eccentric prestress by prestressing defined single layers ( 2 ) consisting of high strength or equivalent material ( see fig3 . 1 ) b ) center prestress by prestressing either all single layers ( 2 ) or defined layers by keeping the symmetry to the center axis ( see fig3 . 2 ) restoration , retrofit and damp proofing of existing structures as well the production of new structures with long term behavior are important projects for the future . besides the economic advantages the improved characteristics of the composite material , like high load bearing capacity , durability , energy absorption , impact resistance , electrical thermal conductivity , density against fluids , high plasticity and crack control open a large spectrum of applications . preferred applications of the composite material ( mat system + concrete with positioning and variation of aggregate ) are abrasive and impervious overlays , blast barriers , precast elements , arbitrary profiles and shapes . the utilization of the thermal conductivity of the 3 - dimensional mat system ensures a heatable material . this heating effect can be activated in members or areas , which are supposed to be free of ice and snow . ( see table 1 . 2 ) a special monolithic splicing of the 3 - dimensional mat system has been developed , which allows structures free of joints . in addition , the deformation of the 3 - dimensional mat system in combination with a monolithic splicing of the mats are the foundation for a simplified sectional system ( fig5 ), consisting of standard -, angle - and edge - elements . this simplified system ensures an execution with constant high quality and does not require specialized workers . in addition , precast members will be part of the application . based on the flexibility of the 3 - dimensional mat system the precast members can be produced in arbitrary shapes ( tubes , cylindric tanks and any other typical structural profiles ). the prestressing of high loaded thin members allow slim and crack free structures . in addition structures with high energy absorption such as blast barriers , earthquake resistant structures , safes and bunkers , can be created by defined spatial positioning of the aggregate ( 1 ). the material characteristics open up a wide spread field of applications : table 1 . 2 spectrum of applications of the 3 - dimensional mat system with staggered arrangement and positioning of aggregate ( 1 ) application overlays highway and airport pavements , bridge deck overlays , runways , coastal environment , stilling pools , settlement poinds , gas stations , industry floor slabs , loading areas etc . energy absorption ( blast ) military shelters , safety rooms , safes , refuse bunkers , bullet - proof and blast barriers , plastic hinge connections , retrofit of existing structures etc . precast structures tubes , thin facade plates , sacrifice formwork , structural profiles heatable areas runways , ramps , bridges , car - wash , pipes , housing others precast panels , any profile shapes , containers for liquids , tubes , chimneys , radiation absorber , tunnel shells , thin panels , confinement , prestressed and composite structures , sound insulation members etc . [ lit . 1 ] deutscher ausschuβ für stahlbeton : dafstb - richtlinie für umgang mit wassergefährdenden stoffen , 1996 ( germany ) [ lit . 2 ] hauser , s . : ducon ein innovativer hochleistungsbeton , beton - u . stahlbetonbau , february + march 1999 ( germany ) high concrete stiffness ( e c & gt ; 50 , 000 n / mm 2 ) small concrete stiffness ( e c & lt ; 30 , 000 n / mm 2 ) high concrete stiffness ( e c & gt ; 50 , 000 n / mm 2 ) small concrete stiffness ( e c & lt ; 30 , 000 n / mm 2 ) | 4 |
a component mounting board inspecting apparatus of a preferred embodiment of the present invention will be described with reference to the drawings . fig1 is a schematic functional block diagram of a component mounting board inspecting apparatus of a preferred embodiment of the present invention . fig2 shows a flowchart showing a procedure to set a solder bridge inspection point in a preferred embodiment of the present invention . fig3 is a plan view partially showing an electrode pad array having a short pad - to - pad distance , for the purpose of explaining the setting of a solder bridge inspection point . referring now to fig1 , a description will be given of a component mounting board inspecting apparatus 11 of a preferred embodiment of the present invention . in fig1 , reference numeral 11 indicates this component mounting board inspecting apparatus . the component mounting board inspecting apparatus 11 can be broadly classified into an image capturing unit ( a ) and an image processor ( b ). a component mounting board ( a so - called bare board ) bb , on which cream solder s to be inspected is not printed , is situated on a table 12 . the image capturing unit ( a ) is composed of a first illuminating unit 13 a for irradiating a predetermined irradiation light to the component mounting board bb , along the normal to the bottom surface of the component mounting board bb ; a second illuminating unit 13 b for irradiating predetermined irradiation light to the component mounting board bb , in the direction in which a predetermined angle is formed with the normal , and irradiating from the surroundings of the component mounting board bb ; a third illuminating unit 13 c for irradiating the component mounting board bb with irradiation light making a further greater angle than the predetermined angle to the normal of the second illuminating unit 13 b ; and a camera 15 disposed in the normal to the bottom surface of the component mounting board bb . the camera 15 captures , as an image , the reflected light from the surface of the component mounting board bb , which is derived from the irradiation light emitted from at least one selected from the first illuminating unit 13 a , the second illuminating unit 13 b , and the third illuminating unit 13 c . an analog signal outputted from the camera 15 is subjected to ad conversion by an analog / digital ( ad ) converter 16 for converting to a digital signal , and the digital signal is inputted to the image processor ( b ). the image processor ( b ) includes a binarizer 17 , a binarized image storage unit 18 , a position coordinate acquiring unit 19 , a near distance measuring unit 20 , and a comparator 21 for comparing a near distance with a threshold value . fetched as characteristic values of the component mounting board bb are the area and the position ( x - y coordinates ) of each electrode pad on the component mounting board bb . therefore , the respective characteristic values are detected in association with the area and the position of a region on the image formed by the location where there is irradiation light having an intensity at least equal to or higher than a predetermined level . the first illuminating unit 13 a may be any one that is constructed such that illumination is irradiated uniformly from above the normal of the component mounting board bb to the component mounting board bb around approximately the center of the component mounting board bb . the second illuminating unit 13 b may be any one that is constructed to irradiate light from obliquely above the component mounting board bb and have its reflected light enter the camera 15 . the third illuminating unit 13 c is preferably constructed to irradiate inspection light to the component mounting board bb from the direction in which there is formed a greater angle than the angle defined between the normal direction of the component mounting board bb of the second illuminating unit 13 b and the above - mentioned obliquely - above direction . although the angle thereof is not particularly limited , it is preferably constructed to irradiate from obliquely above , which is as horizontal as possible to the component mounting board bb . the first illuminating unit 13 a , the second illuminating unit 13 b and the third illuminating unit 13 c can be driven independently or simultaneously , and depending on the type of the component mounting board bb to be inspected , any one of these units is usable . a controller 14 is disposed to control the illuminating units 13 a , 13 b and 13 c . on the other hand , the camera 15 is preferably disposed substantially above the component mounting board bb , such that the central optical axis of the camera 15 is arranged on the normal line of substantially the center of the component mounting board bb . the camera 15 is also preferably a camera that can capture the reflected light from the component mounting board bb as image information . for example , a ccd camera is usable . in the component mounting board inspecting apparatus 11 , the illuminating units and the camera 15 move integrally to underneath the controller 14 , and a large number of points to be inspected , for example , as many as 4000 points , are sequentially scanned under a predetermined program . then , the analog information outputted from the camera 15 is inputted , via the ad converter 16 for converting to digital information , to the image processor ( b ) for executing a predetermined image processing . based on the digital signal from the ad converter 16 , the image processor ( b ) selects and extracts the reflected light indicating a reflected light intensity exceeding a predetermined reference value , from the reflected lights reflected from the surface of the component mounting board bb , and then creates an image indicating the location of the component mounting board bb , from which the reflected light indicating the reflected light intensity exceeding the predetermined reference value is generated . specifically , the image processor ( b ) includes the binarizer 17 for executing binarization by applying a predetermined threshold value to inputted digital information ; the binarized image storage unit 18 for creating and storing an image based on the binarized data obtained from the binarizer 17 ; the position coordinate acquiring unit 19 for acquiring the position ( x - y coordinates ) data of each electrode pad from the binarized image data stored in the binarized image storage unit 18 ; the near distance measuring unit 20 for measuring a pad - to - pad distance ( a near distance ) of adjacent electrode pads from the position ( x - y coordinates ) data of each electrode pad ; and the between near distance and threshold comparator 21 for comparing the measured pad - to - pad distance with a threshold value manually initialized by an operator , etc . the initialized threshold value is the distance that can be judged as being susceptible to a solder bridge of the pad - to - pad distance d of each electrode pad formed on the component mounting board bb . for example , based on the background information that the pad - to - pad distance d of the electrode pads 1 a , 1 b , 1 c , . . . , which mount the bga - type ic and the qfp - type ic as shown in fig5 , is considerably short , and the pad - to - pad distance is as short as about 500 μm , as above described , the value of 500 μm is initialized as a threshold value . the operation of the component mounting board inspecting apparatus 11 will be described next with reference to fig2 and fig3 . first , the component mounting board ( bare board ) bb , in which cream solder is not printed on electrode pads , etc ., is situated and secured to the table 12 . then , the irradiation light from any one of the illuminating units , for example , the second illuminating unit 13 b , is irradiated sequentially from obliquely above to the respective electrode pads of the component mounting board bb . then , the binarizer 17 binarizes their respective images , and their binarized images are written in the binarized image storage unit 18 ( step s 1 ). subsequently , the position coordinate acquiring unit 19 captures the coordinates in the x - axis direction and the y - axis direction of the respective electrode pads ( step s 2 ), and the near distance measuring unit 20 measures the side coordinates of the respective electrode pads , that is , the pad - to - pad distance of adjacent electrode pads . the between near distance and threshold comparator 21 compares the pad - to - pad distance ( the near distance ) measured by the near distance measuring unit 20 with a previously initialized threshold value , for example , 500 μm ( step s 4 ). when the pad - to - pad distance is shorter than the threshold value , a solder bridge inspection point pb , at which solder bridge inspection is executed , ( the hatching area ) is created ( step s 5 ). if the pad - to - pad distance is equal or larger than the threshold value , the solder bridge inspection point pb , at which solder bridge inspection is executed , is not created , and only an inspection point pa is created ( step s 6 ). when creating the solder bridge inspection point pb , as shown in fig3 , the solder bridge inspection point pb is created only on the right side of the respective electrode pads 1 a , 1 b , 1 c , . . . and on the upper side of the respective electrode pads 1 d , 1 e , f , . . . . it is set such that an operator will be informed by speech generation of a “ solder bridge defect on the right side ,” and a “ solder bridge defect on the upper side ” at each inspection point . herein , the pad - to - pad distance d is shorter than the threshold value . thus , by virtue of the automatic setting of the solder - bridge inspection point in the component mounting board inspecting apparatus 11 , the component mounting board bb , in which cream solder is printed on each electrode pad , is situated on the table 12 , and the image capturing unit ( a ) is moved sequentially as above described , and then the camera 15 captures the image under illumination of any one of the illuminating units . when a portion smaller than the threshold value of the pad - to - pad distance d is detected , the solder bridge inspection point pb is expanded automatically between the pads , and it is detectable whether the solder bridge sb is generated or not , as shown in fig7 . if the solder bridge sb is detected , the cream solder portion thereof may be colored red , for example , in order to let an operator easily recognize this on the image indicator . therefore , according to the example of the embodiment of a component mounting board inspecting apparatus of the present invention , the inspection point for the solder bridge may be automatically set and , as a result , the operator may output a desirable inspection result without spending time or requiring an effort for manually setting the point . though a preferred embodiment of the present invention has been described herein in its preferred form through examples of preferred embodiments thereof with a certain degree of particularity , the present invention should not be construed as to be limited to such examples of preferred embodiments presented herein , so that various modifications , variations , combinations , and sub - combinations as well as different applications thereof are possible without departing from the scope of this invention . for example , though reference has been made in the preferred embodiments to a camera to work as an imaging device , many other types of imaging apparatuses or devices may be used , such as imaging elements or other elements that would function to capture light for imaging purposes or capturing signals and / or information for similar purposes . | 6 |
the process of this invention utilizing the chemical demulsifier as described above provides improvement over prior art techniques . the present process utilizes as a chemical demulsifier a polyoxyethylene - containing polyol without the necessity of further reacting such a polyol with polycarboxylic acid to achieve good results as in the process of prior art reference h or extending the molecular weight of the polyol to extremely high values as is required in prior art reference g which is also very expensive . as the following examples will show , contrary to prior art references c and f , standard hydrophilic nonionic surfactants of the alkylphenol ethoxylate or sorbitan class do not function well as demulsifiers for bitumen emulsions ( see examples via and vie ). also , as the examples will show , contrary to reference b , pluronic type surfactants of structure ## str4 ## having 20 to 30 % eo content do not function as demulsifiers for bitumen systems as they do with other crude oil systems ( see example vik ). also , as the following examples will show , prior art reference e is mistaken when it states that in general pluronic type surfactants may be used as chemical demulsifiers independent of molecular weight and ethylene oxide content . the actual range of effective range demulsifiers of the pluronic type was surprisingly found to be much more narrow as evidenced by the negative results obtained in example vib , vid , and vik . also , in contrast to a statement in prior art reference f limiting useful pluronic demulsifiers to those having hlb values of 10 to 18 , the only active pluronic demulsifier we found for bitumen emulsions had an hlb of 22 ( see example vic ). this pluronic demulsifier is not within the scope of this invention but is presented here to point out the fruitlessness of relying on prior art references in this area due to the unique nature of the bitumen o / w emulsions . also , the prior art only mentions standard polyalkyleneoxy block co - polymers as potential demulsifiers when they have the pluronic structure ( i . e . the chemical structure shown in the summary of the invention where x is 2 and n is 1 ). it was surprisingly found that structures based on higher functionality initiators with x = 4 , for example ( see example vig ) and / or those with several alternating hydrophobic and hydrophilic blocks ( n = 3 , example vii ) function well as chemical demulsifiers for bitumen emulsions . the polyol demulsifiers of this invention are made by alkoxylation of an initiator of the desired functionality having active hydrogens for the alkoxylation reaction . many initiators are known to those skilled in the art . illustrative of acceptable initiators are trimethylolpropane and glycerine , for example , if a functionality of three ( 3 ) is desired and sucrose , sorbitol , pentaerythritol and mannitol , for example , if a higher functionality is desired . many common glycols , such as propylene glycol , may be used if a diol is desired . in this invention , these initiators may be used as such or already alkoxylated to a low molecular weight usually not exceeding 500 . the produced bitumen emulsions may be treated by the process of our invention in a conventional manner , for example , in a conventional horizontal treater operated , for example , from about 25 ° to 120 ° c . and , preferably , from about 50 ° to 90 ° c . at atmospheric or slightly higher pressures . the concentration of the chemical demulsifier described above used in treating the bitumen in water emulsions may range from about 1 to 200 parts per million and , preferably , from about 10 to 100 parts per million with the optional addition of an organic diluent and / or inorganic salt as well as standard flocculants and mechanical or electrical means of demulsification . the following examples describe more fully the present process . however , these examples are given for illustration and are not intended to limit the invention . preparation of low molecular weight pentaerythritol polyol with propyleneoxy and ethyleneoxy blocks a 5 - gallon pressure reactor equipped with mechanical stirrer was charged with 3 lb . of pentaerythritol 24 - molar propoxylate and 14 g koh . water was removed by vacuum treatment at 100 °- 110 ° c . followed by addition of 4 lb . propylene oxide at 115 °- 120 ° c . this product had an hydroxyl number of 88 . 2 . three pounds of this material was charged to a 5 - gallon pressure reactor and treated with 7 pounds ethylene oxide at 115 ° c . the final product had a molecular weight of 8400 , basis the hydroxyl number and contained 70 % ethylene oxide , by weight . preparation of high molecular weight pentaerythritol polyol with propyleneoxy and ethyleneoxy block four pounds of the product of example i was charged to a 5 - gallon pressure reactor , contents purged with n 2 , and treated with 8 pounds ethylene oxide at 120 ° c . the product had a molecular weight , basis the hydroxyl number of 18 , 900 and contained 90 % by weight ethylene oxide . preparation of low molecular weight sucrose polyol with propyleneoxy and ethyleneoxy block a 5 - gallon pressure reactor equipped with mechanical stirrer was charged with 3 pounds sucrose 8 - molar propoxylate and 8 g potassium hydroxide . the mixture was vacuum stripped for one hour at 120 ° c ., nitrogen purged and treated with 3 pounds propylene oxide at 110 °- 125 ° c . followed by treatment with 12 pounds ethylene oxide at 125 ° c . the product had a molecular weight of 4 , 900 , basis the hydroxyl number and contained 66 . 7 % ethylene oxide . preparation of sucrose polyol with alternating blocks of propyleneoxy and ethyleneoxy units to 5 pounds of the product of example iii in a 5 - gallon pressure reactor were added successively at 125 ° c ., 4 g koh ( h 2 o subsequently removed in vacuum ), 3 pounds propylene oxide , and 12 pounds ethylene oxide . to 5 pounds of this product were added 1 . 5 pounds propylene oxide and then 6 pounds ethylene oxide at 135 ° c . the final product had a molecular weight , basis the hydroxyl number of 30 , 000 and contained 79 weight percent ethylene oxide . using the alkoxylation methods described in examples i - iv , sorbitol 174 - molar propoxylate was treated with 85 moles ethylene oxide to prepare a product of about 14 , 000 molecular weight hydroxyl number = 24 . 5 having 26 . 6 weight percent ethylene oxide content . ( a ) a 1 % solution of each chemical was prepared ( in h 2 o or in toluene ). ( b ) 100 ml of fresh , hot bitumen emulsion of known bitumen content obtained by in situ steam flooding in tar sand pattern located at ft . mcmurray , alberta , canada was poured into a sample bottle . ( c ) 50 parts ( volume ) of wizard lake crude was added as diluent to 100 parts bitumen contained in the emulsion . ( d ) chemical was added to the diluted emulsion at the following concentrations : 10 , 20 , 30 , 50 , 75 and 100 ppm . ( e ) contents of the bottles were mixed and placed in an oven at 180 °- 200 ° f . for a 24 hour period . ( f ) bs & amp ; w determinations were made on the oil layer and for some systems the oil content in the water layer was estimated by the following method : ( i ) a series of color standards were prepared by dissolving 750 , 500 , 250 , 200 , 150 , 100 , 75 , 50 and 25 ppm by weight of bitumen directly in 1 , 1 , 1 - trichloroethane . ( ii ) 5 ml of the water layer in a sample bottle was transferred to a separatory funnel . ( iii ) the water aliquot was extracted with 25 ml of 1 , 1 , 1 - trichloroethane and the extract filtered to remove solids . ( iv ) the extracted solvent was compared as to color with the prepared standards in identically sized vials ( dilution of the extract with more solvent was used if necessary ). from this comparison the original oil content of the water was estimated . with each emulsion , a blank was also run in which no chemical agent was introduced . similar results were obtained from all these blanks ; namely , the sample consisted of a thin upper layer consisting mainly of diluent ( sometimes containing substantial water ), a broad middle layer consisting of unbroken emulsion , and a small ( sometimes non - existent ) dark water layer containing particles or chunks of solid bitumen and clay . specific test results are summarized in the following table . examples vig and vii are illustrative of demulsifiers falling within the scope of the invention . table__________________________________________________________________________example videmulsifier testing treatedemulsion candidate % bitumen % bs & amp ; w in oilexample vi demulsifier * in emulsion ( ppm chemical used ) middle phase water phase__________________________________________________________________________a surfonic ® n - 400 12 - 16 15 ( 100 ) large -- b pluronic ® l - 77 12 - 16 layer mainly diluent contains clay -- and oilc pluronic f - 127 12 - 16 5 ( 20 , 50 ) small , stable very little interface oil presentd pluronic f - 88 22 35 ( 100 ) wide muddye tween ® 20 24 layer mainly diluent very large dark , muddyf product of ex . i 32 21 ( 30 ), 19 ( 50 ) wide muddyg product of ex . ii 24 5 ( 20 , 50 ) small muddy , contains bitumenh product of ex . iii 38 layer mainly diluent large light , muddyi product of ex . iv 22 6 - 7 ( 30 - 100 ) small muddy , about 1 % oil presentj product of ex . v 22 layer mainly diluent very wide dark , muddyk surfonic pe - 2525 24 layer mainly diluent wide dark , muddy contains solid bitumen__________________________________________________________________________ * sulfonic n400 = nonylphenol 40molar ethoxylate ; pluronic l77 = 2050 mw ppg ethoxylated to final % eo of 70 %; pluronic f127 = 4000 mw ppg ethoxylated to final % eo of 70 %; pluronic f88 = 2250 mw ppg ethoxylated to final % eo of 80 %; tween 20 = sorbitan monolaurate 20molar ethoxylate ; surfonic pe2525 = 1875 mw ppg ethoxylated to final % eo of 25 %. | 2 |
referring now to the drawings in general and fig1 in particular , it will be understood that the illustrations are for the purpose of describing a preferred embodiment of the invention and are not intended to limit the invention thereto . as best seen in fig1 in a typical service station , an automobile 100 is shown being fueled from a gasoline dispenser 10 . a spout 2 of nozzle 4 is shown inserted into a filler pipe 102 of a fuel tank 104 during the refueling of the automobile 100 . a fuel delivery hose 6 is connected at one end to the nozzle 4 , and at its other end to the fuel dispenser 10 . in the case of a vapor recovery - equipped fuel dispenser , as shown by the cutaway view of the interior of the fuel delivery hose 6 , a fuel delivery passageway 8 is formed within the fuel delivery hose 6 for distributing gasoline pumped from an underground storage tank 12 to the nozzle 2 . gasoline is typically pumped by a delivery pump system 16 located within tank 12 . the fuel delivery passageway 8 is typically annular within the delivery hose 6 and tubular from within the fluid dispenser 10 to the tank 12 . the fuel delivery hose 6 typically includes a tubular vapor recovery passageway 14 for transferring fuel vapors expelled from the vehicle &# 39 ; s fuel tank 104 to the underground storage tank 12 during the refueling of the vehicle 100 . a vapor recovery pump 28 provides a vacuum in the vapor recovery passageway 14 for removing fuel vapor during a refueling operation . the vapor recovery system using the pump 28 may be any suitable system such as those shown in u . s . pat . nos . 5 , 040 , 577 to pope , 5 , 195 , 564 to spalding , or 5 , 333 , 655 to bergamini el al . in addition , the invention is useful on dispensers that are not vapor recovery dispensers . the fuel delivery passageway 8 typically includes a control valve 22 , a positive displacement flow meter 24 and fuel filter 20 . the fuel dispenser 10 also includes a control system 26 operatively associated with the control valve 22 , flow meter 24 and the fuel pump 16 . th e control system 26 includes memory 30 ( see fig2 ) for accessing and storing data and program information necessary for operation . in the preferred embodiment , the flow meter 24 drives a pulser ( not shown ) that provides a volume signal 34 , such meter / pulser devices have been used for years to show the volume of fuel dispensed , and more recently to determine a derived vapor recovery volume , as per the patents noted above . the volume signal 34 is typically a series of volumetric pulses , each of which is representative of a predetermined volume of fuel delivered over the delivery path to the vehicle . turning now to fig2 the preferred embodiment employs a fuel flow meter 24 which produces a fuel volume signal 34 by generating a digital transition for a given specific volume through the fuel flow meter 24 . the output of the fuel flow meter 24 is fed to the control system 26 . the control system 26 may count transitions in the fuel volume signal 34 over a fixed increment of time to yield a numerical value directly proportional to the flow rate of fuel through the fuel passageway 8 . preferably , the fixed time increment is 250 milliseconds ( ms ). alternatively , the control system 26 measures the period of time between the transitions of the fuel volume signal 34 to yield a numerical value inversely proportional to a flow rate through the fuel passageway 8 . with either method of determining flow rate , the control system 26 calculates flow rate throughout each fueling operation . in operation , the control system 26 monitors fuel flow rate over a series of cycles . each cycle generally includes a plurality of fueling operations and is typically defined by a predetermined amount of fuel being delivered . preferably , the first cycle is defined as being ten thousand ( 10 , 000 ) gallons of product , while the second and any additional cycles are five thousand ( 5 , 000 ) gallons of product . the controller 26 stores the maximum flow rate recorded for each cycle and compares the maximum flow rates with subsequent cycles to determine when the maximum flow rate for the latter cycle drops from the first cycle by a predetermined amount from a first cycle thereby indicating an unclean filter . maximum delivery rate drops between successive cycles may also be used to determine a filter is unclean . preferably , a drop in the flow rate of two gallons per minute or more will be used to indicate the filter is sufficiently unclean to require changing . if the drop between the first and second cycles is not greater than the predetermined amount indicative of an unclean filter , the controller monitors flow rates and records a maximum flow rate during a third cycle . the maximum flow rates for the first and third cycles are compared and if the third cycle maximum flow rate has dropped by the predetermined amount from the first cycle maximum flow rate , indicating an unclean filter , the control system recognizes that the filter is unclean and needs changing . the control system 26 provides a filter status sensor signal 36 to an output device 40 once an unclean filter is detected . the output device 40 may be an audio and / or visual output device in the dispenser , at a central site controller or other remote location , among others . whatever the embodiment , it is important that the filter status signal 36 alert the service station operator or other service provider that the filter 20 needs to be changed . the flow chart of fig3 a - 3d outlines the operation of the preferred embodiment . the control system 26 begins ( block 100 ) by initializing , and preferably resetting , values ( block 102 ) stored in various memory locations which store values indicative of the maximum flow rate occurring during a respective cycle . the control system 26 initially awaits the beginning of a new fueling operation ( block 104 ). when a new fueling operation begins , pulses arc received from the flow meter 24 ( block 106 ) and the control system 26 determines the current flow rate ( block 108 ). as noted , the flow rate may be determined by counting the number of pulses , which represent a known volume of fuel , occurring within a defined unit of time , preferably 250 ms . alternatively , the period of time between volume pulses can be used as a measure of the inverse of the flow rate , permitting computation of the flow rate . the control system 26 next compares the current flow rate with a first maximum flow rate value stored in a first memory location in the memory 30 ( block 110 ). the control system 26 determines if the current flow rate is greater than the first maximum flow rate value stored in memory ( block 112 ). if the current flow rate is greater than the maximum flow rate value , the stored maximum flow rate value is replaced with the current flow rate . initially , the maximum flow rate values are reset to zero and the first measured current flow rate will usually be greater than the maximum flow rate value . if the current flow rate is not greater than the maximum flow rate value , the control system 26 determines if the first cycle has come to an end ( block 116 ). the first cycle may be defined as a predefined number of gallons being delivered or a set amount of time . if it is not the end of the first cycle , the control system 26 determines if the fueling operation is at an end ( block 118 ). if the fueling operation is not at an end , the control system 26 continues to receive pulses from the flow meter ( block 106 ), determine the current flow rate ( block 108 ), compare the current flow rate with the maximum flow rate value stored in memory ( block 110 ) and replace the first maximum flow rate value if the current flow rate value is greater than the maximum flow rate value ( blocks 112 and 114 ). if the end of fueling operation has occurred , the control system awaits the beginning of a new fueling operation ( block 104 ), wherein the process is repeated until the end of the first cycle ( block 116 ). notably , whether or not a cycle ends during a fueling operation is a matter of design choice . assuming that the first cycle ends during a fueling operation , the control system continues to receive pulses from the flow meter ( block 120 ) and determine current flow rates ( block 122 ). at this point , the control system is operating in a second cycle . notably , the control system 26 compares the current flow rates with a second maximum flow rate value stored in a memory location in memory 30 . the controller next determines if the current flow rate is greater than the second maximum flow rate value stored in memory ( block 126 ). if the current flow rate is greater than the second maximum flow rate value , the second maximum flow rate value stored in memory is replaced with the current flow rate ( block 128 ). if the current flow rate is less than the second maximum flow rate value , the control system does not replace the stored , maximum flow rate value . subsequently , the control system 26 determines if the second cycle has come to an end ( block 130 ). if the second cycle is not an end , the control system 26 determines if the current fueling operation is at an end ( block 132 ). if the operation is not at an end , the control system repeats the process for the second cycle by receiving pulses ( block 120 ), determining current flow rates ( block 122 ), comparing current flow rates with the second maximum flow rate value ( block 124 ) and updating the maximum flow rate value accordingly ( blocks 126 and 128 ) until the second cycle ends . if fueling operation is at an end , but the second cycle is not , the control system 26 awaits the beginning of a new fueling operation ( block 134 ) wherein the process of updating the maximum flow rate value is repeated until the end of the second cycle . at the end of the second cycle , the control system 26 compares the first and second maximum flow rate values ( block 136 ) to determine if the second maximum flow rate value has decreased from the first maximum flow rate value by a predefined amount ( block 138 ) indicative of a flow rate decrease associated with an unclean filter . if the maximum flow rate value for the second cycle is lower by the predefined amount , the control system 26 activates a filter status signal ( block 140 ) to alert the appropriate machinery or personnel that the fuel filter needs replacing . once the filter is replaced , the process returns to the beginning ( block 100 ) wherein the maximum flow rate values for the first and second cycles are reset and the process begins anew . if the maximum flow rate value for the second cycle has not decreased from the maximum flow rate value of the first cycle by the predefined amount , a third cycle begins ( block 144 ) wherein the control system 26 continues to receive pulses from the flow meter 24 . the control system 26 , as done in the earlier cycles , determines current flow rates ( block 146 ) and compares the current flow rates with a third maximum flow rate value ( block 148 ). the control system 26 determines if the current flow rate is greater than the third maximum flow rate value ( block 150 ) and replaces the third flow rate value with the current flow rate ( block 152 ) as necessary . if the current flow rate is not greater than the third maximum flow rate value , the maximum flow rate value is not stored and memory is not changed . the control system 26 next determines if the end of the third cycle has occurred ( block 154 ). if it is not the end of the third cycle , the control system determines if it is the end of the current fueling operation ( block 156 ). if it is the end of the fueling operation , the control system 26 awaits the beginning of a new fueling operation ( block 158 ). if it is not the end of the fueling operation , the control system 26 continues to receive pulses from the meter ( block 144 ), determine current flow rates 146 , compare the current flow rates with the third maximum flow rate value ( block 148 ) and update the latter as necessary ( blocks 150 and 152 ). at the end of the third cycle ( block 154 ), the control system 26 compares the first and third maximum flow rate values stored in memory ( block 160 ) and determines if the third maximum flow rate value is less than the first maximum flow rate value by more than the predefined amount indicative of an unclean filter ( block 162 ). if the third maximum flow rate value is less than the first maximum flow rate value by the predefined amount , the control system 26 activates the filter status signal 36 to indicate that the filter 20 needs to be replaced . at this point , the control system 26 reverts back to the beginning ( blocks 100 and 166 ) and resets the maximum flow rate values stored in memory and the process begins anew . if the third maximum flow rate value is not less than the first maximum flow rate value by the predefined amount , the process repeats itself for a fourth cycle ( block 168 ). the control system 26 during the fourth cycle will determine and compare current flow rates with a fourth maximum flow rate value until the cycle ends wherein a comparison is made to see if the latest maximum flow rate value stored in memory is less than the first maximum flow rate by the predefined amount . the process will repeat itself until filter replacement is required . alternatively , the control system 26 may compare the maximum flow rate values during the cycles with a fixed minimum flow rate indicative of an unclean filter . thus , instead of comparing maximum flow rates recorded during different cycles , the maximum flow rate for each cycle is compared with the minimum acceptable maximum flow rate value . certain modifications and improvements will occur to those skilled in the art upon reading of the foregoing description . it should be understood that all such modifications and improvements have been deleted herein for the sake of conciseness and readability but are properly in the scope of the following claims . for example , other flow rate maxima for the various cycles can be used , such as maximum averages or the like . also , the notion of fixed &# 34 ; cycles &# 34 ; need not be used -- the system may use any concept of later fuelings being capable of generating only slower fuelings than earlier fuelings . it is useful to consider a maximum rate during earlier and later periods ( or cycles ) to avoid any particular slow later fueling caused by , for example , a customer who chooses to fuel slowly , from giving a false reading of a clogged filter . | 1 |
although a broad range of temperatures , including temperatures of from about 0 ° c . to about 35 ° c ., may be employed to effect the process , particularly in the case of chocolate , as long as such are below the pour point of the chocolate , it has been discovered that the process may be carried out at ambient , i . e ., normal room temperature , and at temperatures below tempering temperatures . hence , the process may be carried out wherein the material has a temperature on the order of from about 27 ° c . down to about 20 ° c . in such preferred embodiments of the process of the present invention , therefore , external means for heating and / or cooling the chocolate during the process are avoided , the process being carried out without additional heating and / or cooling of the material to be processed . however , for precise temperature control , the use of external heating or cooling means is not excluded , as long as the material being extruded is in a substantially non - pourable state . thus , the temperature of the material during extrusion may be a temperature up to the pour point of the material , which may be up to about 35 ° c . depending on the composition of the material , particularly the amount and type of fat , or fat and fat fraction and / or fat - substitute present , higher temperatures being enabled to be employed when the confectionery material contains higher proportions of high melting fat , or fat fraction and / or fat - substitute components . should it be desired to carry out the process at temperatures lower or higher than ambient temperature , cooling means , provided such as by jacketing an extruder means , may be employed , as may heating means , when higher temperatures are desired . also , as indicated above , extruding the material at temperatures of from about 20 ° c . to about 27 ° c . provides substantial advantage , but plain chocolate may also be processed , for example , within temperature ranges of from about 10 ° c . to 34 ° c ., or from about 15 ° c . to about 32 ° c ., but more preferably from about 18 ° c . to 30 ° c ., and most preferably from about 20 ° c . to about 27 ° c . milk chocolates , including white chocolate , also may be processed at temperatures of from about 10 ° c . to about 30 ° c ., or from about 15 ° c . to about 28 ° c ., more preferably from about 18 ° c . to about 27 ° c . and most preferably from about 20 ° c . to about 26 ° c . although the fat - containing confectionery material may be fed into the barrel of an extruder in a liquid or pourable paste form , which would thereby require subsequent cooling to effect a non - pourable form for flow constriction , plasticizing and non - pourable extrusion , preferably , the material is fed into the extruder in a non - pourable solid or semi - solid form . most advantageously , the present invention enables the material to be processed to be previously maintained in a granular form , particularly buttons , and it has been discovered that when in granular form , the granular nature of the material has been found to be at least substantially , if not entirely , lost during extrusion to give an essentially uniform material . in practice of the present invention , plasticization is generated by a differential pressure across the zone of convergence which is provided by a flow constriction . the zone of convergence may be formed by a flow constriction which may be a narrowing of the cross - sectional area of an extrusion conduit , and most conveniently , such may be provided in association with the configuration an extrusion die integral with the output end of an extruder . the zone of convergence may be effected with any of a variety of extrusion means including but not limited to , for example , ram extruders , constant pressure extruders , single and twin screw extruders , or extrusion means such as a davenport extrusion rheometer or a conform machine , operating under controlled pressures and rates . as will be appreciated , such apparati may provide for continuous or batch operation . as indicated above , the extrusion process requires a constriction of the flow of processed material in a zone of convergence . hence , the material deforms before the outlet of the extruder device . the convergence ratio should be greater than 1 . 5 , the convergence ratio being defined as the ratio of the cross - sectional area prior to flow constriction to the area of minimum flow constriction , which , in the case of a die providing such , is the inlet cross - sectional area to the minimum cross - sectional area of the extrusion outlet die for a simple cylindrical extrusion geometry . a wide range of extrusion pressures may be employed , with the caveat that the pressure employed , in combination with the material temperature , does not cause the material to become pourable . pressures employed may range from about 1 bar to about 1000 bars , preferably from about 5 bars to about 500 bars and most preferably from about 5 bars to about 250 bars . as will be appreciated , the extrusion pressure applied and generated is partially dependent on the convergence ratio , the extrusion temperature and the confectionery composition , and it has been found that for a given die configuration and material composition , the extrusion rate is weakly dependent upon the extrusion pressure . in practice of the present invention , it will be found that the flow rate of the chocolate extruded through the extruder die will depend , primarily on extrusion pressure , temperature , die configuration and material formulation . extrusion rates may vary from 0 . 1 cm / sec to in excess of 1 m / sec , for instance . the sectional geometry of the die may be of a square or profiled form , the configuration employed also being affected if such is to be employed as the flow constriction device to provide the zone of convergence . advantageously , the die has a flared or conically shaped entry portion fitted in the extrusion barrel , with a product inlet portion to outlet portion angle , with respect to a longitudinal axis of the extruder , of from about 10 ° to about 90 °, preferably from 30 ° to about 60 °, and most preferably from about 40 ° to 50 °. the extrusion die shapes provide for preparing solid or hollowed profiled products , e . g ., bars , rods , spirals , twists , springs , hollow sections such as tubes and more complex shapes such as the letters of the alphabet , as well as thin films having a thickness which may be as little as 100 microns . the dimensions of the die depend on a desired size of the extruded product , and extruded products may be cut at the die with such as a flying cutter or rotary knife . two or more fat - based materials may be co - extruded in accordance with the process of the present invention , and the fat - containing confectionery material may be co - extruded with other food materials , such as ice creams , fondants , etc ., such being advantageous when the fat - containing confectionery material is extruded in a hollow or tubular form . hence , in such embodiments , a multi - orifice die and / or associated equipment , as are known to those skilled in the art , may be employed . advantageously , the flow constriction plasticizing zone of convergence aspect of the present invention also may be integrated with a mold to provide an integral injection molding process , in which case , the final shape of the product conforms to that of the mold , e . g ., hollow shells , such as &# 34 ; easter eggs &# 34 ;, and other solid shapes . in contrast to other injection molding processes , cooling means and equipment are not essential , and the molded product can be packaged directly . the injection molding therefore is easy to control , and significantly less losses of material , as compared with conventional injection molding using a molten material , advantageously are realized . injection molding thus is effected at the processing temperatures described above , and the material , e . g ., chocolate , is extruded through a flow constriction which forms the injection nozzle of the molding machine . although the temperature of the mold may differ from that of the temperature of the extruded material , it is conveniently approximately the same as the extrusion temperature within the ranges hereinabove described for the extrusion process . in one injection - molding embodiment , the chocolate may flow within channels of the mold and subsequently flow through a narrow gate , e . g ., from 100 and 500 microns , into a mold . the chocolate extrudes into the mold as a flexible filament of semi - solid chocolate . as the extrusion continues , the mold progressively fills with chocolate until all of the mold is filled . at this point , the pressure within the mold is sufficient to allow the full consolidation of the chocolate to occur . when this point has been reached , no further flow occurs and the extrusion pressure can be released . at this point , the mold can be opened and the injection - molded entities removed from the mold either mechanically or , for example , with the aid of vacuum means known to those skilled in the art . the injection molding process may also include multi - feed injection into molds using different components in each feed . in addition , the process may be used for coating centers which are positioned in the empty mold before injection molding . the injection molding process may , if desired , be fully automated . the products of the present invention maintain good organoleptic properties and , significantly , they retain their shape and advantageously have an initial flexibility or plasticity after extrusion which may persist for up to several hours before being lost , particularly when the temperature of the extruded products are maintained at a temperature which approximates its extrusion temperature . the flexibility may last or be maintained , for example , for up to 4 hours although such lasts or is maintained for up to 2 hours and more often for from 5 minutes to 1 hour . owing to the flexibility or plasticity of the extrudate , physical manipulation or plastic deformation of the extrudate is possible before the flexibility or plasticity is lost , e . g ., bending , tying into knots , downstream of the die enabling more complex forms of finished products to be achieved . the following examples and description of the accompanying drawing figures are presented to illustrate the present invention further and are meant to be non - limiting . fig1 - 5 illustrate extruded product pressure profiles and flow rates of the process of the present inventions carried out in accordance with examples set forth below . fig6 and 7 illustrate an extruder embodiment for carrying out the process of examples 1 - 4 below . fig8 - 10 illustrate further embodiments of an extruder embodiment which may be employed in carrying out the present invention . set milk chocolate buttons are fed into the barrel of a davenport extrusion rheometer , the barrel having been modified in order to provide a side - mounted pressure transducer immediately above the extrusion die as shown in fig6 and 7 , which illustrate a barrel 10 , piston 11 , pressure transducer 12 , extrusion die 13 of length l , cross - section d and entry angle φ , and a retaining nut 14 . the barrel of the extruder for carrying out the example has a diameter of 19 . 5 mm . two batches of buttons are processed . the chocolate buttons of each batch are equilibrated at a temperature of about 24 ° c ., and are forced at a pressure of about 50 bars through the die , which has a circular cross - section of 4 mm diameter and 8 mm length and a 45 ° entry angle . smooth continuous extrusions , which have flow rates of about 16 mm / sec are obtained , the time evolution of the pressure profile during extrusion being illustrated in fig1 and 2 . as will be seen , after an initial yield pressure is reached , the extrusion pressure drops to an essentially constant value . on the cessation of flow ( after 180 seconds in fig1 ), there is a relaxation of the extrusion pressure . a solid non - pourable , rod - shaped product is obtained which retains its shape , but which is flexible for 30 minutes , during which period it can be bent or even twisted into knots before hardening , if desired . a procedure similar to that described in example 1 is followed , except that the button material extrusion temperature is about 28 ° c . the profile and rate results for two samples are shown in the accompanying fig3 and 4 . a procedure similar to that described in example 1 is followed , except that the button material extrusion temperature is about 18 ° c . the profile and rate results are shown in fig5 . using a hydraulically - driven piston at an essentially constant pressure , it is found that a mass of chocolate extruded through a 4 mm diameter circular orifice with output flow rates of between 1 cm / sec and 100 cm / sec exhibits weak dependence on the differential pressure across the die characterized by a logarithmic - linear relationship when extruding . using the procedure described in example 4 , a chocolate is extruded through a 4 mm die at various temperatures . the following pressures produce similar rates of output : ______________________________________ start - up flowtemperature pressure pressure ° c . bar bar______________________________________20 500 47024 200 18027 50 40______________________________________ a procedure similar to that described in example 4 is followed except that the orifice is replaced by a slit with dimensions of 1 mm × 20 mm . a solid , non - pourable flexible thin ribbon of chocolate is produced at flow rates of from 1 cm / sec to 100 cm / sec . a florin hydraulically driven ram extruder , such as illustrated in fig8 comprises a barrel 15 , a hydraulically driven ram 16 , feed opening 17 , extrusion die 18 having a cross - section of 4 mm diameter and an internal barrel diameter of 25 mm . chocolate buttons having a temperature of about 23 ° c . are dropped in the feed opening 17 followed by hydraulically advancing the ram at a pressure of about 80 bars , and semi - continuous solid non - pourable rods 19 of about 4 mm diameter are produced which retain their shape and have an initial flexibility which lasted for about 40 minutes . a florin extruder , such as that illustrated in fig8 but having a centered &# 34 ; torpedo &# 34 ; 20 positioned in the barrel , is illustrated in fig9 . the same procedure is followed as in example 7 , but instead of producing rods , solid non - pourable hollow tubular sections 21 are produced having an outer diameter of about 10 mm and an internal diameter of about 6 mm . co - extrusion with fondant may be carried out by using a &# 34 ; torpedo &# 34 ; provided with a longitudinal channel through which the fondant flows to give a chocolate coated fondant . a florin ram extruder , such as that illustrated in fig8 but whose die has a cross - section of 5 mm diameter , is adapted to form the injection nozzle of a molding machine , such as illustrated in fig1 . the injection molding of the chocolate is carried out in a manner so that the temperature of both the extruder and the mold is about 25 ° c ., and a pressure of about 80 bars is applied by the ram , and the split mold is clamped using hydraulic pressure . semi - continuous rods 22 flow within the channels 23 and then through the gates 24 , each having a width of about 200 microns , into the hollow spherical molds 25 , each having a diameter of about 12 mm . the chocolate extrudes into each mold as a flexible filament of semi - solid chocolate . as the extrusion continues , the mold progressively fills with chocolate until all of the mold is filled . at this stage , the pressure within the mold is sufficient to allow full consolidation of the chocolate to occur . when this point has been reached , no further flow occurs , and the extrusion pressure is released . the mold then is opened , and the injection molded chocolate entities are removed from the mold . unlike most other injection molding processes , it is not necessary to cool the product immediately after the injection molding , and the product is enabled to be packaged directly . as is clear from the foregoing , various modifications of the present invention may be made without departure from the spirit and scope of the disclosure , and the invention may be practiced suitably in the absence of elements and / or process steps not specifically disclosed herein . | 0 |
referring now more particularly to fig1 which illustrates the typical viscosity characteristic of a portland cement and water mixture . the viscosity measurements were taken using a conventional brookfield viscometer of the rv type with a number four spindle at a number 20 speed and at a factor of 100 . a type ii portland cement was used in a 3 to 1 portland to water by volume mix . the reading values are merely a relative indication used to plot the characteristic curve . the curve would be substantially identical in characteristic for any portland cement to water ratio which would permit the cement to gel . as indicated on the time reference , the machine was consecutively recycled for a twelve minute &# 34 ; on &# 34 ; period and then for a five minute &# 34 ; off &# 34 ; period . each time the machine was turned on the measurement would rise to a higher level than the preceding cycle and descend to a relatively constant level substantially higher than the constant level reached in the preceding cycle . this characteristic is typical of a conventional cement and water mixture which can be classified as being nonthixotropic . to be truly thixotropic the readings should be substantially repeatable , cycle to cycle , i . e ., repetitive cycles should exhibit hysteresis . a hysteresis plot would appear as a loop with the area of the loop representing the degree of thixotropy . conventional cement base paints and commercially available latex formulated paints are either nonthixotropic or essentially newtonian , i . e ., exhibiting a substantially flat viscosity characteristic curve . it was discovered in accordance with the present invention that a composition of portland cement and water can be made to respond in a truly thixotropic manner by the addition of presized inorganic filler particles below a predetermined minimum proportion by weight to the portland cement . the ratio of presized filler particles to portland cement must satisfy the following relationship : p / 2 ≦ f where f is the minimum requirement by weight of the presized inorganic filler particles and p is the weight of the portland cement . as indicated by the above formula the minimum quantity of presized inorganic filler particles must represent at least 50 % of the weight of the portland cement to provide thixotropy to the composition . additional filler particles may be added as desired and such need not be presized . however , to formulate an acceptable cement base paint composition a sufficient quantity of portland cement must be included so that the composition is not portland deficient , i . e ., there should be enough portland to permit the composition to cure . the importanc of the minimum relationship of p / 2 ≦ f for formulating a thixotropic cement base paint is demonstrated in fig2 . a similar composition of 60 grams portland cement , 60 grams water and presized inorganic filler particles of below the maximum size of 60 microns is standard for each curve with the concentration of the presized filler particles varied . upon reaching a concentration satisfying the above relationship , the composition becomes thixotropic . it should , however , be understood , as indicated hereinbelow , that the size of the inorganic filler particles f must be below a critical predetermined maximum size of about 50 microns and preferably below 44 microns . this is demonstrated in fig3 showing a family of viscosity curves for a composition of 60 grams portland cement , 30 grams of inorganic filler particles and 60 grams water with the maximum size of the filler particles varied . thixotropy is substantially obtained at a 50 micron maximum particle size level with a 44 micron maximum particle size level or below being truly thixotropic . the particle sizes were determined by passing the filler particles through standard sieve size screens and eliminating the trapped particles . accordingly , a standard no . 300 sieve will pass a maximum particle size of 50 microns and a no . 325 sieve will pass a maximum particle size of 44 microns . as shown in fig3 a 74 micron size particle ( no . 200 sieve ) or larger is nonthixotropic . any conventional inorganic filler material preferably a mineral filler and most preferably silica ( silicon dioxide ) may be used for the presized inorganic filler particles . silica particles with a crystalline structure is preferred over the non - crystalline amorphous structure only from a cost standpoint . natural sand which has been presized in accordance with the present invention is the preferred choice . other conventional inorganic filler particles include calcium carbonate , calcium sulfate , calcium metasilicate , magnesium silicate , alumina , zinc oxide , barium sulfate , mica and synthetic inorganic particles such as &# 34 ; zeeospheres &# 34 ; a trademark product of zealand industries of st . paul , minnesota usa . the amount of water added to form a cement base paint slurry of acceptable consistency is of course important for the intended application . to be acceptable as a paint composition , the slurry should have an average viscosity of between 3 , 000 to 8000 cps ( centipoises ). the preferred volumetric relationship between the dry mixed material of portland cement and presized inorganic filler particles and the water content should be about 1 part water to 1 . 5 parts of the total dry mixture . the same volumetric relationship should exist even if a coloring agent or pigment is added to the dry mixture . any coloring agent may be added to the dry mixture of portland cement and inorganic filler particles . the portland cement is preferably a white portland cement . coloring agents or pigments contemplated for use in formulating a cement base paint in accordance with the present invention include colored as well as white pigments . suitable pigments include any water soluble paint pigment such as titanium dioxide , zinc oxide , barium sulfate ( barytes ), clay mica , calcium carbonate ( whiting ), silica , ultramarine blues , chromium oxides , carbon black , iron oxides , magnesium silicate ( talc ), aluminum silicate , diatamaceous silica , chrome green , iron blues , iron salts of nitroso compounds , and any of the food and / or drug and cosmetic lake colors and the like in various combinations and preparations depending on the end use for which the paint is designed . the present invention contemplates the use of the cement base paint as hereinbefore defined as a stand alone product or in combination with any conventional water base paint preferably of latex formulation . in the latter respect the conventional paint operates as the pigment for the slurry formed between the portland cement , presized inorganic filler particles and water . a reduced concentration of water can be used based upon the viscosity of the latex paint formulation and the texture desired for the combined paint product . the preferred range is between a 1 : 1 volumetric ratio and a 1 : 2 ratio of latex paint to a cement base paint slurry of portland cement , presized inorganic filler particles and water . the cement base paint slurry gives the conventional latex paint formulation the property of thixotropy . suitable commercially available polymeric latex paint formulations generally contain by way of non - limiting example from about 40 to 60 weight percent of latex polymers formed from natural rubber , styrenebutadiene copolymer , butadiene - acrylonitrile copolymers , polyvinyl chloride , polyvinyl acetate , copolymers of vinylidene chloride and acrylonitrile , polytetrafluoroethylene , ethylacrylate - methacrylate copolymers , butadiene - styrene - acrylonitrile copolymers , isobutyleneisoprene copolymers , acrylonitrilebutylacrylate - methacrylic acid copolymers , styrene - butyl acrylateacrylic acid copolymers , copolymers of styrene , acrylonitrile , octyl acrylate and methacrylic acid , copolymers of methyl methacrylate , ethyl acrylate and ammonium methacrylate . the conventional latex paint includes a pigment . accordingly , it is unnecessary to add further pigment . the following is a list of typical commercially available latex brand paints which have been tested in combination with the cement base slurry of the present invention to demonstrate that thixotropy can be established in a latex formulated paint independent of formulation : 3 . latex flat wall finish manufactured by pratt and lambert paint co . 5 . wall satin latex interior flat manufactured by regal paint co . 9 . exterior acrylic latex satin finish manufactured by sears roebuck & amp ; co . although cement and presized inorganic filler particles may be added directly to a latex formulated paint it is preferred in accordance with the present invention that a cement base paint slurry of portland cement , presized inorganic filler particles and water first be formed as explained heretofore . the property of thixotropy apparently also results in substantially increased coverage during application using the cement base paint composition of the present invention when formulated with or without the addition of a latex paint . the yield is approximately two and one - half times the coverage on a comparison basis between the cement base paint composition and a conventional cement base paint and between the cement base latex paint composition of the present invention compared to an equivalent volume of conventional latex paint . | 2 |
first , preferred embodiments of the audio signal processing method and apparatus of the present invention will be explained . note that the gist of the present invention resides in the processing for repairing anomaly of an audio signal — not the recording of the audio signal . similarly , processing of a video signals is not its gist . accordingly , so far as they do not particularly relate to the present invention , the recording of an audio signal and the processing of a video signal will not be referred to . however , the present invention is not limited to only an audio signal reproducing apparatus . the present invention can also be applied to a digital video signal recording and / or reproducing apparatus using the audio signal processing method and apparatus of the present invention and an audio signal and / or video signal recording and / or reproducing apparatus using the audio signal processing method and apparatus of the present invention . as a first embodiment of use of the audio signal processing apparatus of the present invention , a first example of a hi - fi video apparatus will be explained by referring to fig1 to fig8 . fig1 is a view of the configuration of a hi - fi video apparatus according to the first embodiment of the present invention , while fig2 is a schematic view of tape running and a rotary head of the hi - fi video apparatus illustrated in fig1 . the hi - fi video apparatus 1 has a rotary head controller 11 , a head switch 12 , a track skip detector 13 , an fm demodulator 14 , a waveform connector 15 , a rotary head drum 16 with rotary heads a 1 and a 2 and b 1 and b 2 mounted thereon , a fixed head 17 , a not illustrated rotation drive controller of the rotary head drum 16 , a not illustrated running drive controller of a magnetic tape 18 , a not illustrated audio signal reproducing apparatus , and a not illustrated video signal reproducing apparatus . the rotation drive controller of the rotary head drum 16 , the running drive controller of the magnetic tape 18 , the audio signal reproducing apparatus , and the video signal reproducing apparatus are not directly related to the present invention , so the illustration was omitted , but they are similar to those in the well known apparatuses . the hi - fi video apparatus 1 records an audio signal and a video signal on the magnetic tape 18 and reproduces the audio signal and the video signal recorded on the magnetic tape 18 by helical scanning using the rotary head drum 16 with the rotary heads a 1 , a 2 , b 1 , and b 2 . fig3 is a view of a track structure of the tape recording surface in the hi - fi video apparatus . a pair of rotary heads a 1 and a 2 and a pair of rotary heads b 1 and b 2 shown in fig1 are arranged , as shown in fig2 , at positions rotationally symmetric with respect to a center o of the rotary head drum 16 , that is , facing positions 180 degrees apart , at the rotary head drum 16 . the rotary heads a 1 and a 2 are arranged at adjacent positions and have azimuth angles reverse to each other . also , the rotary heads b 1 and b 2 are similarly arranged at adjacent positions and have azimuth angles reverse to each other . the rotary heads a 1 and b 2 and the rotary heads a 2 and b 1 are given the same azimuth angles . this arrangement is called a double azimuth type . as will be explained later , such a configuration is employed at the time of high speed reproduction so that the reproduction head scans the recorded track at a different azimuth angle from that at the time of recording . the rotary head controller 11 , head switch 12 , track skip detector 13 , fm demodulator 14 , and the waveform connector 15 will be briefly explained next . the rotary head controller 11 controls a not illustrated drive system so as to rotate the rotary head drum 16 at a designated speed . at the same time , it generates a rotary head pulse s 11 whenever the rotary heads al and b 1 pass an origin c illustrated in fig2 and outputs it to the head switch 12 . the track skip detector 13 compares the signal levels of the signals obtained from the rotary heads a 1 , a 2 , b 1 , and b 2 to monitor if the rotary head having the maximum signal level changes from the rotary head a 1 to a 2 , from the rotary head a 2 to a 1 , from the rotary head b 1 to b 2 , or from the rotary head b 2 to b 1 . where it detects a change of the rotary heads , it concludes there was a track skip , generates a track skip pulse s 13 at that time , and outputs the track skip pulse to the head switch 12 and the waveform connector 15 . the head switch 12 receives as its inputs the detection signals of the rotary heads a 1 , a 2 , b 1 , and b 2 and selects one of the detection signals of the rotary heads a 1 , a 2 , b 1 , and b 2 in accordance with the rotary head pulse s 11 from the rotary head controller 11 and the track skip pulse s 13 from the track skip detector 13 . the rotary head pulse s 11 output from the rotary head controller 11 is the signal detecting the passage of the rotary head drum 16 through the position c , so indicates one revolution of the rotary head drum 16 . it is also the signal for discriminating the positions of the pair of rotary heads a 1 and a 2 and the pair of rotary heads b 1 and b 2 . on the other hand , the track skip pulse s 13 detected at the track skip detector 13 is a signal indicating that the rotary heads a 1 and a 2 or the rotary heads b 1 and b 2 skipped a track in the magnetic tape 18 . accordingly , the head switch 12 switches between the rotary heads an and b by the rotary head pulse s 11 from the rotary head controller 11 and switches between the rotary heads 1 and 2 by the track skip pulse s 13 from the track skip detector 13 . note that , the rotary head a indicates the rotary heads a 1 and a 2 , and similarly the rotary head b indicates the rotary heads b 1 and b 2 . further , the rotary head 1 indicates the rotary heads a 1 and b 1 , and the rotary head 2 indicates the rotary heads a 2 and b 2 . the fm demodulator 14 demodulates the audio signal selected at the head switch 12 and inputs the same to the waveform connector 15 . the waveform connector 15 smoothly connects the signal fm demodulated at the fm demodulator 14 while maintaining the continuity and outputs the same as the repaired audio signal to deal with the anomalous state such as the discontinuity of the signal or skip or noise from the timing based on the track skip pulse s 13 detected at the track skip detector 13 . details of the high speed reproduction operation of the hi - fi video apparatus 1 will be explained next . fig3 is a view of the track structure of the tape recording surface of the magnetic tape 18 of a hi - fi video apparatus . fig4 is a view of the trace of the head at the time of high speed reproduction of the video hi - fi audio track of the magnetic tape 18 illustrated in fig3 . fig5 is a view of the track structure of the magnetic tape 18 and the head trace at the time of high speed reproduction . symbols r 1 to r 7 shown in fig5 are track numbers attached for convenience for the explanation of the present embodiment , while symbols q 1 to q 7 are scanning numbers attached for convenience for the explanation of the present embodiment the track skip detector detects the time of occurrence of a track skip indicated by a mark o at the time of high speed reproduction as shown in fig4 and fig5 , generates a track skip pulse s 13 at that time , and outputs the track skip pulse s 13 to the head switch 12 and the waveform connector 15 . the principle of generation the track skip pulse s 13 in the track skip detector 13 will be explained next . in the helical scanning of the hi - fi video tape shown in fig3 , as partially indicated by hatching in the track , the recording azimuth angles of the adjoining tracks are different . in the case of for example a vhs hi - fi video , an angle of + 30 degrees is given for every track . when head scanning over a plurality of tracks as shown in fig4 and fig5 , the azimuth angle of the recording surface becomes reverse at the time when the track skip indicated by the mark o occurs , the angle of the head in use loses compatibility , and the other head forming the pair becomes compatible . due to this , the magnitudes of the output levels of the paired ( a 1 and a 2 and b 1 and b 2 ) heads are switched with each other . fig6 is a flow chart of the processing of the track skip detector 13 . the track skip detector 13 follows the above principle of detection and refers to the rotary head pulse s 11 from the rotary head controller 11 to judge whether the rotary heads a 1 and a 2 are located at the tape surface of the magnetic tape 18 or the rotary heads b 1 and b 2 are located at the tape surface of the magnetic tape 18 ( s 1 ). when the rotary heads a 1 and a 2 are located at the tape surface of the magnetic tape 18 , it compares the signal levels of the rotary heads a 1 and a 2 . when detecting that they are replaced with heads outputting signals having a larger level ( s 2 , s 4 : s 2 , s 4 ), it generates the track skip pulse s 13 ( s 5 ). similarly , when the rotary heads b 1 and b 2 are located on the tape surface of the magnetic tape 18 , it compares the signal levels of the rotary heads b 1 and b 2 . when detecting that they are replaced with heads outputting signals having a larger level ( s 6 to s 8 ), it generates the track skip pulse s 13 ( s 5 ) fig7 a to 7 c are graphs showing the rotary head switch operation . the track skip pulse s 13 may be a single pulse in the head switch 12 as illustrated in fig7 b . however , the waveform connector 15 explained later requires the time when the track skip was generated . therefore , the track skip pulse s 13 to be given to the head switch 12 is made a one - pulse signal as illustrated in fig7 b . on the other hand , as the track skip pulse s 13 to be given to the waveform connector 15 , other than the one - pulse signal , the track skip generation time is informed . alternatively , only a one - pulse signal is given to the waveform connector 15 and the time when receiving the track skip pulse s 13 is stored in the waveform connector 15 . in the present embodiment , as will be explained later by referring to fig9 and fig1 , the case is illustrated where , when one pulse of the track skip pulse s 13 is supplied from the track skip detector 13 to the waveform connector 15 , a buffer controller 1551 in the waveform connector 15 sets the position anomaly flag indicating that time in a signal buffer 152 . the rotary head switch 12 receives as its input the rotary head pulse s 11 output from the rotary head controller 11 and the track skip pulse s 13 output from the track skip detector 13 and switches the detection signals of the reproduction heads a 1 , a 2 , b 1 , and b 2 . at the time of recording , as illustrated in fig7 a , the data is recorded by azimuth angles alternating for every track by using the rotary heads a 1 and b 1 having reverse azimuths located at facing positions . namely , as illustrated in fig5 , the audio signal is recorded on a track r 1 by the rotary head a 1 with a positive azimuth ( for example + 30 degrees ), and audio signal is recorded on a track r 2 by the rotary head b 1 with a negative azimuth ( for example − 30 degrees ). the audio signal is then alternately recorded in a similar way to that described above . note that an explanation of the recording of the video signal is omitted . at the time of normal reproduction of the recorded audio signal , in the same way as the time of recording explained above by referring to fig7 a , the data is reproduced by azimuth angles alternating for every track by using the rotary heads a 1 and b 1 having the reverse azimuths located at facing positions . at the time of recording in the hi - fi video apparatus 1 of the present embodiment , the operation at the time of normal reproduction is similar to the operation of the usual well known hi - fi video apparatus . at the time of high speed reproduction , as illustrated in fig7 b , the rotary head controller 11 generates the rotary head pulse s 11 at the time when the reproduction head trace returns to the lowermost end and the track skip detector 13 generates the track skip pulse s 13 at the position of the track skip given the mark o in fig5 . fig7 c is a graph of the head switch operation in the head switch 12 . fig8 is a flow chart of the rotary head switch operation in the head switch 12 . the rotary heads “ a ” and “ b ” in the head switch 12 are switched at the timing of generation of the rotary head pulse s 11 output from the rotary head controller 11 , while the rotary heads “ 1 ” and “ 2 ” in the head switch 12 are switched matching with the timing of the generation of the track skip pulse s 13 in the track skip detector 13 . for example , as exemplified in fig7 c , the head switch first uses the rotary heads ( a 1 , b 1 ) ( step 11 in fig8 ). in a scanning period q 1 , it scans the r 1 track ( positive azimuth ) by the rotary head a 1 ( positive azimuth ). when the rotary head a 1 finishes scanning the r 1 track and shifts to the r 2 track , the head switch 12 switches the rotary head a 1 to the rotary head b 1 ( step 13 ) matching with the reception of the rotary head pulse s 11 from the rotary head controller 11 ( fig8 , step 12 ). in a scanning period q 2 , the scanning of the r 2 track ( negative azimuth ) is started by the rotary head b 1 ( negative azimuth ), but a skip to an r 3 track ( positive azimuth ) occurs in the middle . the head switch 12 switches the use of the rotary heads ( a 1 , b 1 ) to the use of the rotary heads ( a 2 , b 2 ) ( step 15 ) at the time of generation of the track skip pulse s 13 from the track skip detector 13 ( step 15 ) and scans the remainder of the r 3 track ( positive azimuth ) by the rotary head b 2 ( positive azimuth ). in a scanning period q 3 , an r 4 track ( negative azimuth ) is scanned by the rotary head a 2 ( negative azimuth ). in a scanning period q 4 , an r 5 track ( positive azimuth ) is scanned by the rotary head b 2 ( positive azimuth ). in a scanning period q 5 , an r 6 track ( negative azimuth ) is scanned by the rotary head a 2 ( negative azimuth ), a switch is made to the use of the rotary heads ( a 1 , b 1 ) matching with the generation of the track skip pulse s 13 , and an r 7 track ( positive azimuth ) is scanned by the rotary head a 1 ( positive azimuth ). the head switch 12 repeats the above operations . note that , along with the switching of the rotary heads in the head switch 12 , a pulse - like noise is sometimes generated . this noise is one of the anomalous signals of the present invention . due to the above operation , the head switch 12 transmits the detection signals of the rotary heads a 1 , a 2 , b 1 , and b 2 compatible with the operation ( scanning ) of the rotary heads a 1 , a 2 , b 1 , and b 2 at the time of high speed reproduction to the fm demodulator 14 . the fm demodulator 14 demodulates the audio signals transmitted from the head switch 12 by a well known method . the waveform connector 15 of the first embodiment of the audio signal processing method of the present invention will be explained by referring to fig9 to fig1 and fig1 to fig1 . fig9 is a view of the configuration of the waveform connector 15 . fig1 is a view of the processing of the signal buffer 152 . fig1 is a flow chart of the processing of a signal processor 155 . fig1 to fig1 are views of the waveforms of the signals processed at the waveform connector . the waveform connector 15 is a waveform connector utilizing the track skip pulse s 13 generated in the track skip detector 13 . the track skip time becomes clear from the track skip pulse s 13 , so the waveform connector 15 connects the waveform by utilizing this . the waveform connector 15 illustrated in fig9 has an a / d converter 151 , a signal buffer 152 , a d / a converter 154 , and a signal processor 155 . when the audio signal is input in a digital format , the a / d converter 151 and the d / a converter 154 are unnecessary . the a / d converter 151 converts an analog audio signal s 14 demodulated at the fm demodulator 14 shown in fig1 to a digital audio signal . as illustrated in fig1 , the signal buffer 152 comprises a for example 16 - bit signal buffer and a 1 - bit anomaly flag located at a position corresponding to the position of the audio signal to be stored . the content of the signal buffer 152 is shifted rightward every sampling time . new data is added to the input position and the data at the output position is output . the audio signal stored in the signal buffer 152 is stored in time series , so the storage position of the audio signal corresponds to the time . the output position and the processing center position do not vary , but the input position varies in accordance with the time discrepancy due the processing of the signal processor . the d / a converter 154 converts the digital audio signal output from the signal buffer 152 to an analog audio signal . the signal processor 155 illustrated in fig9 has a buffer controller 1551 , an anomaly deleter 1552 , a waveform connector 1553 , a pseudo waveform generator 1554 , a time discrepancy storage 1555 , and a pseudo waveform detector 1556 . the signal processor . 155 monitors the existence of generation of the track skip pulse s 13 and performs a series of processing of anomalous segment deletion , waveform connection , and pseudo waveform insertion when an anomalous state arises in the waveform due to the generation of the track skip pulse s 13 . the buffer controller 1551 concludes that there is an anomaly in the waveform of the audio signal when there is a reception of the track skip pulse s 13 and sets the anomaly flag portion in the signal buffer 152 corresponding to that time at “ 1 ”. fig1 is a waveform diagram of an audio signal s 141 output from the a / d converter 151 to the signal processor 155 . assume that an anomalous portion exists in a period t . the period t indicates the center time of the processing of the signal buffer 152 . the buffer controller 1551 further exchanges the audio signal processed in the waveform connector 1553 , pseudo waveform generator 1554 , time discrepancy storage 1555 , and pseudo waveform detector 1556 with the signal buffer 152 to shift and replace the data in the signal buffer 152 along with the series of processing . the anomaly deleter 1552 deletes the signal of the anomalous portion . fig1 is a signal waveform diagram of the case where the anomalous portion is deleted from the signal waveform illustrated in fig1 by the anomaly deleter 1552 . w represents a deletion time width ( deleted segment length ), ts represents a deletion start time , and te represents a deletion end time . details of the deletion time width ( deleted segment length ) w , deletion start time ts , and deletion end time te will be explained later . the deleted segment length w may be set longer than the maximum time length of the shot noise . it is set at for example 20 ms in the case of shot noise , and while is set at for example 5 ms in the case of discontinuity or signal skip . the waveform connector 1553 overlaps and connects the waveform before and after the deleted segment illustrated in fig1 to give a maximum similarity . the similarity is evaluated according to a mutual correlation coefficient . the waveform of the input audio signal is defined as f ( t ) and the waveform in the forward direction of the deleted segment is represented by the following equation 1 . f a ( t ) = { f ( t ) ( t ≦ t s ) 0 ( t & gt ; t s ) , ( 1 ) the waveform in back of the deleted segment is represented by the following equation 2 . f b ( t ) = { 0 ( t & lt ; t e ) f ( t ) ( t ≧ t e ) , ( 2 ) as illustrated in fig1 , when superposed on each other by exactly a length p , the mutual correlation coefficient of the superposed portions becomes as shown in the following equation 3 . r ( p ) = ∫ 0 p f a ( t + t s - p ) f b ( t + t e ) ⅆ t ∫ 0 p f a 2 ( t + t s - p ) ⅆ t ∫ 0 p f b 2 ( t + t e ) ⅆ t ( 3 ) this processing corresponds to calculation of the correlation by shifting the waveform in back of the deleted segment forward by exactly a length ( p + w ). that is calculated within a range of p min ≦ p ≦ p max . the time difference p giving the maximum correlation coefficient is determined as an overlap segment length p . here , the search range of p is made about the same degree as one pitch period of the speech or music ( audio signal ). for example , p min = 4 ms and p max = 20 ms are set . after the overlap segment length is determined , as shown in fig1 , the front and back waveform are superposed over the segment p and cross faded . g ( t ) = { f a ( t ) ( t ≦ t q ) { ( t s - t ) f a ( t ) + ( t - t q ) f b ( t + w ) } / p ( t q & lt ; t & lt ; t s ) f b ( t + w ) ( t ≧ t s ) ( 5 ) 1 . sound having periodicity in the waveform like speech ( vowels ) or music usually has the maximum correlation in that period or a whole multiple of the same , so can be connected while maintaining the periodicity . 2 . even if not a periodic waveform , it can be connected by the portion having the highest correlation , that is , similar in waveform . 3 . due to the cross fading , it can be smoothly connected without discontinuity in the waveform . according to the above processing , the waveform is shortened by ( w + p ) time for each anomaly . therefore , if left as it is , the discrepancy between the original sound and the processed sound will accumulate . therefore , the cumulative time discrepancy from the point of time of start of the processing is stored in the time discrepancy storage 1555 . when the waveform is shortened by a constant value or more , a short pseudo waveform is prepared in the pseudo waveform generator 1554 and inserted to thereby stretch the total length . as shown at step 31 of fig1 , first , at the start of the processing , the time discrepancy storage 1555 resets the cumulative time discrepancy stored . the time discrepancy storage 1555 subtracts ( x + p ) from the cumulative time discrepancy stored at step 38 whenever the anomaly processing is carried out at steps 33 to 37 . when the time discrepancy storage 1555 detects that the cumulative time discrepancy exceeds a set value during the processing ( step 39 ), the pseudo waveform detector 1556 , the pseudo waveform generator 1554 , and the waveform connector 1553 perform the pseudo waveform detection processing , pseudo waveform generation processing , and the pseudo waveform insertion processing shown at steps 40 to 42 . this set value may be for example 0 second . in that case , the waveform is always stretched in the initial processing and the signal is adjusted to maintain a slightly longer time than the original sound . the pseudo waveform generation and insertion processing will be explained below . an example of the waveform after the waveform connection processing is shown in fig1 . first , a waveform having a length 1 is taken in the front of the frontmost portion tq of the connection point , and the mutual correlation coefficient with the waveform further in front from that by a length 1 is calculated . r ( l ) = ∫ 0 l g ( t + t q - l ) g ( t + t q - 2 l ) ⅆ t ∫ 0 l g 2 ( t + t q - l ) ⅆ t ∫ 0 l g 2 ( t + t q - 2 l ) ⅆ t ( 6 ) this is calculated over a segment of 1 min ÷ 1 ≦ 1 max . the 1 which becomes the maximum is determined as the pseudo waveform time length l . here , the search range of the length 1 is made about the same degree as one pitch period of speech or music in the same way as the waveform connection portion . for example , 1 min is made 4 ms and 1 max made 20 ms . after the pseudo waveform time length l is determined , as shown in fig1 , the waveform is divided at the time t 1 = tq − l . the back waveform is moved back by exactly l . when the front waveform is ga ( t ) and the back waveform after the movement is ga ( t ), they can be represented as follows by using g ( t ) of equation 5 . g a ( t ) = { g ( t ) ( t ≦ t l ) , 0 ( t & gt ; t l ) , ( 8 ) g b ( t ) = { 0 ( t ≦ t q ) , g ( t - w ) ( t & gt ; t q ) , ( 9 ) finally , as shown in fig1 , a pseudo waveform prepared by cross fading the waveform on the two sides shown in equation 10 is inserted in the segment t 1 & lt ; t & lt ; tq which becomes empty by the above processing , f ( t ) = { g a ( t ) ( t ≦ t l ) , { ( t q - t ) g a ( t ) + ( t - t l ) g b ( t ) } / l ( t l & lt ; t & lt ; t q ) , g b ( t ) ( t ≧ t q ) , ( 10 ) 1 . sound having periodicity in waveform like speech ( vowels ) or music has the maximum correlation in a whole multiple of the period , so the waveform is stretched while maintaining the periodicity . 2 . even if not a periodic waveform , it can be connected by the portion having the highest correlation , that is , similar in waveform . 3 . due to the cross fading , it can be smoothly connected without discontinuity in the waveform . the time discrepancy storage 1555 stores the shortened time from the start of the processing and the cumulative time of the extension . the series of operation of the waveform connector 15 will be explained next by referring to fig1 . step 31 : before storing the audio signal in the signal buffer 152 , as the initial operation , the buffer controller 1551 in the signal processor 155 resets the cumulative time discrepancy storage data . step 32 : the analog audio signal s 14 illustrated in fig1 demodulated in the fm demodulator 14 is converted to a digital audio signal in the a / d converter 151 . the converted digital audio signal s 151 is successively stored in the signal buffer 152 every sample time . the signal buffer 152 is configured by a ring buffer or fifo . the digital data is given from its output end to the d / a converter 154 every sample time and output as an output audio signal s 15 . step 33 : the buffer controller 1551 decides that an anomalous state occurred when receiving a track skip pulse s 13 , sets the anomaly flag at the position corresponding to that time in the signal buffer 152 ( fig1 ), and proceeds to the processing of step 35 and the following steps . when it does not receive the track skip pulse s 13 , the operation routine shifts to the processing of step 34 . step 34 : when there is no anomaly , the buffer controller 1551 does nothing in that case , the audio signal successively stored in the signal buffer 152 is successively output to the d / a converter 154 after a predetermined time . step 35 : when an anomalous state is detected at the buffer controller 1551 , the anomaly deleter 1552 deletes the data of the anomalous portion in the vicinity of the time t in fig1 described above . namely , when the anomalous state is detected , the anomaly deleter 1552 deletes the signal before and after the processing center time as illustrated in fig1 . the noise , data loss , or the like to be eliminated by the present invention is instantaneous shot noise or discontinuity , so the deleted segment may be made for example about 5 ms . steps 36 to 37 : when the anomalous data is deleted , the waveform connector 1553 connects the signal before and after the deleted segment in cooperation with the pseudo waveform detector 1556 and the pseudo waveform generator 1554 . the pseudo waveform detector 1556 searches for a similar portion by shifting the waveform data in back of the deletion portion as illustrated in fig1 and overlaps and adds it so that the parts of the waveform before and after the deleted portion resemble each other the most . the pseudo waveform generator 1554 detects the similar waveform of the data stored in the signal buffer 152 by utilizing the pseudo waveform detector 1556 again in order to compensate for the portion shortened in the total length of the data by the processing of the anomaly deleter 1552 and the waveform connector 1553 , generates the pseudo waveform for stretching the waveform , and inserts the generated waveform data into the portion deleted by the anomaly deleter 1552 . step 38 : the time discrepancy storage 1555 adds and stores the time length of the shortening / extension of the waveform by the anomaly deleter 1552 , waveform connector 1553 , and the pseudo waveform generator 1554 . step 39 : the time discrepancy storage 1555 decides whether or not the time discrepancy is within a constant value . when it is within the constant value , the operation routine shifts to the processing of step 34 . steps 40 to 42 : when the time discrepancy exceeds the constant value , the above processing is repeated . namely , the similar waveform detector 1556 evaluates the similarity of the waveform at a different time in the signal buffer 152 as explained above . since the time discrepancy storage 1555 manages the amount of data of the audio signal in the deleted segment as time , so disconnection or overlap of the audio signal is eliminated . the above waveform connector 15 is able to delete the noise segment for shot noise superposed on the signal , signal skip , discontinuity , etc ., smoothly connect the waveform before and after the deletion , and limit the time discrepancy from the original signal to the smallest level by inserting a pseudo waveform into the signal . namely , the waveform connector 15 of the present embodiment can delete noise derived from shot noise or discontinuity of the audio signal without distorting the normal portion , smoothly interpolate the discontinuous portion , and reduce incongruity in sound . further , the hi - fi video apparatus 1 of the embodiment of the present invention illustrated in fig1 generates an audio signal compensated for discontinuity even in the case where there is a discontinuity of the audio signal due to a track skip at the time of high speed reproduction or switching of the rotary head sat the head switch 12 and as a result can reproduce an audio signal without concern as to discontinuity . a second example of the hi - fi video apparatus of the present invention will be explained by referring to fig1 to fig2 . the hi - fi video apparatus 1 a of the second example has a rotary head controller 11 , head switch 12 , track skip detector 13 , fm demodulator 14 , waveform connector 15 a , a rotary head drum 16 illustrated in fig2 , a fixed head 17 illustrated in fig2 , a not illustrated rotation drive controller of the rotary head drum 16 , a not illustrated running drive controller of the magnetic tape 18 , a not illustrated audio signal reproducing apparatus , and a not illustrated video signal reproducing apparatus . the hi - fi video apparatus 1 a illustrated in fig1 has a similar configuration to that of the hi - fi video apparatus 1 illustrated in fig1 , but the track skip pulse s 13 is not output from the track skip detector 13 to the waveform connector 15 an and the configuration of the waveform connector 15 a is different from that of fig9 as illustrated in fig2 . the other portions are similar to those of the hi - fi video apparatus 1 of fig1 , however . accordingly , the following description will be made focusing on portions different from the first example . the waveform connector 15 a will be explained by referring to fig2 . the waveform connector 15 a has an a / d converter 151 , signal buffer 152 , d / a converter 154 , signal processor 155 a , and anomaly detector 156 . when the audio signal is input in a digital form , the a / d converter 151 and the d / a converter 154 are unnecessary . the waveform connector 15 a does not use a track skip pulse s 13 generated in the track skip detector 13 unlike the waveform connector 15 of fig9 . for this reason , the anomaly detector 156 is provided in the waveform connector 15 a , and the processing of the signal processor 155 a is slightly different from the processing of the signal processor 155 illustrated in fig9 . fig2 is a view of the configuration of the anomaly detector 156 . the anomaly detector 156 has a high pass filter 1561 , a power detector 1562 , a mean value calculator 1563 , and a power comparator 1564 . the anomaly to be eliminated by the present invention is short time shot noise or signal loss , short time signal skip ( so - called sound skip ), or discontinuity due to track skip , the switching of the rotary heads , etc . at the time of detection of an anomaly , the fact that a high frequency component is instantaneously largely generated due to the nature of the shot noise or skip is utilized . for example , in speech or music , the component up to about 10 khz at most is dominant , but in contrast , in shot noise , a component up to near the nyquist frequency is instantaneously generated . the high pass filter 1561 passes the high frequency component of an audio signal s 151 output from the a / d converter 151 therethrough . the power detector 1562 calculates the power of the signal passed through the high pass filter 1561 , that is , the square of the signal passed through the high pass filter 1561 . the mean value calculator 1563 calculates the mean value of the power over for example past 50 ms of the audio signal of the high frequency component . the power comparator 1564 compares the mean value of the power calculated at the mean value calculator 1563 and the power of the audio signal calculated at the power detector 1562 . when the power value is larger than the mean power value , the time is detected as the time of generation of instantaneous noise or a skip . fig1 illustrates an example of a waveform having an anomalous portion due to the disturbance of the waveform on the periphery of the time t . when the audio signal behaves as in the period t of fig1 , the value deviates from the mean value of the audio signal , so the anomalous state can be detected at the power comparator 1564 . the anomalous state detected at the anomaly detector 156 is notified to the signal buffer 152 illustrated in fig1 . the signal buffer 152 sets the anomaly flag in the corresponding data . the signal buffer 152 is similar to the signal buffer 152 explained above . namely , as illustrated in fig1 , it comprises for example a 16 - bit signal buffer and a 1 - bit anomaly flag . the content of the signal buffer 152 is shifted rightward every sample time . new data is added to the input position and the data at the output position is output . the output position and the processing center position do not vary , but the input position varies in accordance with the time discrepancy due the processing of the signal processor . in the present example , the anomaly flag is set in accordance with not the track skip pulse s 13 , but the detection of the anomaly detector 156 . the signal processor 155 a illustrated in fig2 has a buffer controller 1551 a , anomaly deleter 1552 , waveform connector 1553 , pseudo waveform generator 1554 , time discrepancy storage 1555 , and pseudo waveform detector 1556 . the signal processor 155 monitors the anomaly flag stored in the signal buffer 152 by the anomaly detector 156 , performs no operation where the anomaly flag is “ 0 ” ( where there is no anomaly ), and performs a series of processing of anomalous segment deletion , waveform connection , and pseudo waveform insertion where the anomaly flag is “ 1 ” ( where there is an anomaly ). fig2 is a flow chart of the processing of the signal processor 155 a . the buffer controller 1551 a monitors the anomaly flag at the processing center for the data stored in the signal buffer 152 illustrated in fig1 . namely , the track skip pulse s 13 is not input to the buffer controller 1551 a , so the set state of the anomaly flag set by the anomaly detector 156 is achieved by the buffer controller 1551 a . accordingly , the decision of the anomaly by the buffer controller 1551 a of step 33 a in fig2 becomes the monitoring of the set state of the anomaly flag of the signal buffer 152 . the buffer controller 1551 a further shifts and replaces the data in the buffer along with the series of processing for the signal with the waveform shown in fig1 to fig1 . the anomaly deleter 1552 , waveform connector 1553 , pseudo waveform generator 1554 , and time discrepancy storage 1555 perform similar processing to that explained above by referring to fig9 . as explained above , the waveform connector 15 of fig9 and the waveform connector 15 a of fig2 are different in only the method of detection of the anomalous state . accordingly , the waveform connector 15 a of fig2 can perform similar waveform connection processing to that of the waveform connector 15 of fig9 . as a result , the hi - fi video apparatus 1 a illustrated in fig1 , similar to the hi - fi video apparatus 1 of fig1 , can perform signal processing to eliminate anomalous due to track skip , switching of the rotary heads , or the like . namely , the hi - fi video apparatus 1 a using the waveform connector 15 a illustrated in fig1 generates an audio signal compensated for anomaly even when there is an anomaly of the audio signal due to track skip at the time of high speed reproduction and the switching of the rotary heads in the head switch 12 and as a result can reproduce an audio signal without concern as to anomaly . the method of detection of the anomalous portion in the waveform connectors 15 and 15 a is not limited to the examples explained above . other various methods can be employed . for example , in the same way as a track skip being detected at the track skip detector 13 and a track skip pulse s 13 being output to the waveform connector 15 , a signal indicating an anomalous state in the apparatus using the waveform connector 15 from that apparatus and an auxiliary signal can be input to for example the buffer controller 1551 of the signal processor 155 illustrated in fig9 . as such an auxiliary signal , use can be made of for example an error correction code used at the time of reproduction of a cd etc . by this , the time of generation of the anomaly becomes clear , and the processing in the waveform connector 15 becomes possible . the waveform connectors 15 and 15 a can be applied to not only a hi - fi video apparatus , but also various other apparatuses handling audio signals . as such apparatuses , there are for example cd audio signal players , md players , dvd players , cellular phones , 8 mm video apparatuses , and audio signal communication devices . when the present invention is applied to such apparatuses , even if there is noise or skips due to scratches or dust on the magnetic tape , noise or skips due to scratches or dust on the magnetic disk , noise or skips due to scratches or dust on the optical disk , noise or skips due to scratches or dust on the analog record disk , noise or signal loss occurring in the air or apparatus , etc ., the influence of them can be eliminated and the incongruity in sound can be reduced . further , the present invention is not limited to the hi - fi video apparatuses explained above and can be applied to the signal processing of an anomaly caused when reproducing an audio signal recorded on a magnetic tape or a rotary recording medium such as a magnetic disk . as another embodiment of the present invention , a digital video signal recording and / or reproducing apparatus will be explained . the explanation of the processing in the hi - fi video apparatuses also applies to a digital video signal recording and / or reproducing apparatus , but a hi - fi video apparatus and digital video signal recording and / or reproducing apparatus have the following differences . 1 . a digital video signal recording and / or reproducing apparatus is controlled to follow a track by a dynamic tracking head even at the time of high speed reproduction , so skips occur also in units of tracks . 2 . a digital video signal recording and / or reproducing apparatus can easily judge a track skip since an id is recorded at the track head . fig2 is a view of the configuration of a digital video signal recording and / or reproducing apparatus 2 taking into account the above conditions . the digital video signal recording and / or reproducing apparatus 2 has a not illustrated rotary drum with rotary heads an and b mounted thereon , a digital signal demultiplexer 21 , a track skip detector 22 , and a waveform connector 23 . fig2 is a view of the track structure of the recording surface of a consumer - use digital video tape , and fig2 is a view of the head scanning trace at the time of high speed reproduction . in this example , the tracks are read skipping one out of three tracks . the rotary heads an and b are arranged facing each other at 180 degrees in the same way as illustrated in fig2 , but the digital video signal recording and / or reproducing apparatus is controlled to scan along a track by a not illustrated auto tracking control mechanism . the digital signal demultiplexer 21 reads a recording signal comprised by insert and track information ( iti ), an audio signal , a video signal , and a sub code and demultiplexes the same as the digital data . the digital signal demultiplexer 21 transmits the video signal to a not illustrated usual video processor and transmits the audio signal to the waveform connector 23 . the digital signal demultiplexer 21 inputs the head signal to the track skip detector 22 . the track skip detector 22 detects the id number of the track from the head signal , compares the same with the id number of the track reproduced immediately before that , and determines the existence of a track skip . the track skip detector 22 sets “ 0 ” when the id numbers continue , while sets “ 1 ” when they do not continue , and transmits a track skip pulse s 22 to the waveform connector 23 . the waveform connector 23 has a similar configuration to that of the waveform connector 15 illustrated in fig9 as illustrated in fig2 . the waveform connector 23 is configured by a signal buffer 231 and a signal processor 232 . the signal processor 232 is configured by a buffer controller 2321 , an anomaly deleter 2322 , a waveform connector 2323 , a pseudo waveform generator 2324 , a time discrepancy storage 2325 , and a pseudo waveform detector 2326 . the signal buffer 231 of the waveform connector 23 corresponds to the signal buffer 152 of the waveform connector 15 . the signal processor 232 of the waveform connector 23 corresponds to the signal processor 155 of the waveform connector 15 . the buffer controller 2321 , anomaly deleter 2322 , waveform connector 2323 , pseudo waveform generator 2324 , time discrepancy storage 2325 , and pseudo waveform detector 2326 correspond to the buffer controller 1551 , anomaly deleter 1552 , waveform connector 1553 , pseudo waveform generator 1554 , time discrepancy storage 1555 , and pseudo waveform detector 1556 . note that the digital video signal recording and / or reproducing apparatus 2 performs digital signal processing , so the a / d converter 151 and the d / a converter 154 are not provided . the signal buffer 231 receives as input a digital audio signal s 21 a detected and demultiplexed at the digital signal demultiplexer 21 . the buffer controller 2321 performs processing equivalent to the decision processing at step 33 of fig1 when the track skip pulse s 22 is “ 1 ”. the buffer controller 2321 , anomaly deleter 2322 , waveform connector 2323 , pseudo waveform generator 2324 , time discrepancy storage 2325 , and pseudo waveform detector 2326 perform similar processing to that of the buffer controller 1551 , anomaly deleter 1552 , waveform connector 1553 , pseudo waveform generator 1554 , time discrepancy storage 1555 , and pseudo waveform detector 1556 explained above . as explained above , the digital video signal recording and / or reproducing apparatus 2 can repair an audio signal having an anomaly due to a track skip or the like even in the case of high speed reproduction in the same way as a hi - fi video apparatus . the present invention can also be easily applied to an 8 mm video apparatus . the track structure of an 8 mm video tape is shown in fig2 . an audio signal is digitally recorded on the magnetic tape by a rotary head as a pcm audio signal . an fm modulated analog signal ( in the same way as a hi - fi signal ) is recorded multiplexed on the video signal . when the 8 mm video apparatus uses an fm audio signal using a dynamic tracking head , the processing is the same as in a hi - fi video apparatus . further , when the 8 mm video apparatus uses a pcm audio track using the dynamic tracking head , a similar configuration to that of the case of the digital video apparatus is employed . in this way , the 8 mm video apparatus can utilize the audio signal of a pcm or fm track at the time of high speed reproduction . the data skip in the case of a magnetic disk apparatus has the following characteristic features unlike a track skip in a hi - fi video apparatus or a digital video signal recording and / or reproducing apparatus explained above . 1 . the random accessibility of the data is high , so a skip due to limitations of physical arrangement of the tracks on a tape does not occur . 2 . rather , at the time of high speed reproduction , there are data segments which are intentionally not read so as to keep the data within the readable speed . fig2 is a view of the hardware configuration of a magnetic disk apparatus taking into account the above circumstances . the magnetic disk apparatus 3 has an address controller 31 , a fixed disk drive 32 , and a waveform connector 33 . the fixed disk drive 32 stores the audio signal and the video signals as digital data . at the time of reproduction , the data is read according to the address designated by the address controller 31 and input to the waveform connector 33 . the address controller 31 compares the reproduction speed designated by the user and the reading speed of the fixed disk , determines the data read segments and the nonread segments so as to be within the range of the read speed , and designates the read addresses to the fixed data drive 32 accordingly . further , it generates a data skip signal at the end of continuous read segments ( immediately before a nonread segment ) and inputs the same to the waveform connector 33 . fig2 is a graph of the operation timing of the magnetic disk apparatus 3 . for convenience , assume that successive recording data ( fig2 a ) given numbers d 1 to d 15 are recorded in the fixed disk drive 32 . at the time of reproduction , assume that the address controller determines the read segments and the nonread segments as illustrated in fig2 b . at that time , the data actually read from the fixed disk drive 32 become as illustrated in fig2 c , and discontinuity of data occurs between d 5 and d 8 and between d 12 and d 15 . the data skip signal generated by the address controller 31 detecting such discontinuity becomes as shown in fig2 d . the waveform connector 33 has the equivalent circuit configuration to the waveform connector 23 illustrated in fig2 . accordingly , the waveform connector 33 receiving the data skip signal from the address controller 31 performs repair processing similar to that explained above for the audio signal input from the fixed disk drive 32 . as explained above , the present invention is not limited to the high speed reproduction of an audio signal recorded on a recording medium like a magnetic tape and can be applied to also the high speed reproduction of an audio signal recorded on a random access type recording medium such as a magnetic disk and an optical disk . further , the present invention is not limited to the embodiments explained above . the present invention can be applied to various other types of audio signal processing apparatuses . as such audio signal processing apparatuses , there are the compact disk players , md players , dvd players , etc . the present invention can not only be applied to apparatuses such as hi - fi video apparatuses , digital video signal recording and / or reproducing apparatuses , 8 mm video apparatuses , and magnetic disk apparatuses , but also can use elements configuring these apparatuses alone . for example , the waveform connectors 15 , 23 , and 33 shown in the various embodiments are not limited to the waveform connection of the audio signals explained above , but can also be applied to other signal processing . summarizing the effects of the present invention , the audio signal processing method and the audio signal processing apparatus of the present invention delete the audio signal in the noise segment due to shot noise superposed on the signal , signal skip , and discontinuity and smoothly connect the waveform before and after the deletion . particularly , it can keep the time discrepancy from the original audio signal to a minimum level by inserting a pseudo waveform into the signal . the audio signal processing apparatuses such as hi - fi video apparatuses , digital video signal recording and / or reproducing apparatuses , 8 mm video apparatuses , and magnetic disk apparatuses can reproduce a high quality audio signal with little incongruity by eliminating the influence of the sound skip ( skip ) occurring at the time of high speed reproduction , the noise at the switching of the heads , etc . as a result , for example , in a hi - fi video apparatus , even when trying to save time while fully viewing and listening to the content by reproduction at 1 . 2 × speed , a high quality audio signal can be reproduced . in a magnetic disk apparatus , it becomes possible to obtain a greater margin in the access time and therefore perform time division processing with other tasks without exceeding the limit of the access time . | 7 |
the present invention provides a process for fabricating continuous lengths of superconductor . the superconductors made in accordance with the subject invention are preferably composed of one or more thin , high - temperature superconducting layers between metallic substrates . with reference to fig1 an apparatus 1 for the continuous fabrication of long lengths of superconductor is schematically illustrated . a first metallic substrate ribbon 10 is fed through apparatus 1 , while a second separate metallic substrate ribbon 12 is simultaneously fed through the apparatus 1 at the same speed as the first ribbon 10 . the substrate ribbons are long continuous strands . the ribbons are preferably silver or silver alloys ( e . g ., silver 90 - 95 %/ palladium 5 - 10 %), although other materials may be used within the spirit of the invention . the ribbons may be supplied by any conventional mechanism , for example , conveyers 14 , used for continuously feeding long strands of materials . the first ribbon 10 and the second ribbon 12 are simultaneously fed past a structure 16 for depositing a superconductor precursor powder 18 , preferably the bismuth - based , thallium - based , or yttrium - based families of high temperature oxide superconductor precursor powders , onto the respective ribbons . the precursor powder 18 may be deposited onto the respective ribbons by spray drying or it may be deposited by direct brush application of a powder slurry in a volatile liquid such as butanol . in the preferred embodiment , a suspension of the aerosol precursor powder 18 is stored within a pump assembly 20 . conventional mechanisms are used to force the precursor powder 18 from the pump assembly 20 . the superconductor precursor powder 18 is forced through the pump assembly 20 to a pair of spray nozzles 22 , 24 . preferably , the spray nozzles 22 , 24 operate at 120 khz to produce 18 um diameter droplets of the superconductor precursor powder 18 . the droplets are deposited on the first and second metallic substrate ribbons 10 , 12 as they pass below the respective spray nozzles 22 , 24 . the superconductor precursor powder 18 is applied to the substrate ribbons 10 , 12 to permit the formation of a continuous coating of the superconducting material thereon after fabrication of the superconductor is completed . preferably , the resulting superconductor should have at least a 10 micron layer of the superconducting material after fabrication is completed . the use of suspensions of aerosol superconductor precursor powder 18 has at least two advantages . first , the high homogeneity and small particle size of aerosol powders permits the preparation of thin coatings which are dimensionally and compositionally uniform . additionally , high reactivity aerosol powders lead to shorter heat treatment times which permit continuous rather than batch fabrication processing . after the precursor powder 18 is deposited on the first and second ribbons 10 , 12 , the ribbons move continuously into a low temperature furnace 26 where the precursor powder 18 is dried and surface contaminants are removed from the precursor powder 18 . during this step the precursor powder will bond to respective substrate ribbons . once the superconductor precursor powder 18 has been appropriately deposited on the respective first and second metallic substrate ribbons 10 , 12 , and the ribbons have been appropriately heated , the first ribbon 10 and the second ribbon 12 are overlaid to form a mechanical bound layered superconductor 28 composed of a superconducting layer encased within the first and second metallic substrate ribbons . formation of the layered superconductor 28 is achieved by rolling or pressing the layers with sufficient force to create a bound superconducting layer 28 . the rolling or pressing is done by conventional structures 30 . preferably , the edges of the first substrate ribbon 10 and the second substrate ribbon 12 are left bare during the deposition step to facilitate the formation of the layered superconductor 28 . as a result , the layers of the layered superconductor 28 are bound together by both substrate to substrate bonding and powder to powder bonding . if desirable , the edges of the layered superconductor 28 can be folded , or otherwise dressed , to provide a good mechanical bond and to prevent free passage of air borne contaminants . finally , the layered superconductor 28 is heat treated to create the desired superconductor . specifically , the heat treatment converts the superconductor precursor powder to its superconducting phase . the layered superconductor 28 is heat treated by passing the same through an appropriate furnace 32 . after the layered superconductor 28 is heat treated , the process is completed by rolling 34 the layered superconductor 28 to form a highly textured superconducting core . the preferred embodiment discussed above , permits the continuous fabrication of long lengths superconductor . that is , feeding , depositing , heating , rolling / pressing , heating , and rolling occur without the need to cut the continuous strands of the first and second ribbons 10 , 12 , until the process is completed . each of these variables is also considered when determining the processing rate for the superconductor . if , however , the heat treatment step requires too much time to make continuous fabrication of the superconductor feasible , the layered superconductor can be formed in pieces and wound about mandrels . the wound layered superconductor are then heat treated by convention methods to convert the superconductor precursor powder to its superconducting phases . by way of this method 1 kilometer lengths of the superconductor can be manufactured . in alternate embodiments , the second ribbon can be bare . in such an embodiment , the bare second ribbon is combined with the first coated ribbon in the manner discussed above to form a substrate — superconducting powder — substrate layered superconductor . whether the second ribbon is coated or bare , the edges of the superconductor can be folded or otherwise dressed to provide a good mechanical bond and to prevent free passage of air borne contaminants . additionally , multi - layer geometries can be fabricated by co - rolling several coated ribbons and superconductors having a single substrate ribbon are possible . the process disclosed above results in a smooth interface between the superconducting material and the metal substrate . metallographic examinations were made of polished cross sections comparing a superconducting oxide / metal superconductor made in accordance with the subject invention and a superconducting oxide / metal superconductor made in accordance with a powder - in - tube method . the superconductor made in accordance with the present invention had a smooth interface between the superconducting material and the substrate when compared to the superconductor made in accordance with the powder - in - tube method . this results in a superconductor having exceptional electrical characteristics , an absence of non - superconducting materials at the interface , and better dimensional stability . having described the preferred embodiment of the present invention , it will appear to those of ordinary skill in the art that various modifications may be made to the disclosed embodiment , and that such modifications are intended to be within the scope of the present invention . | 8 |
fig1 illustrates one embodiment of an activity tracking system 8 , including a physical - activity tracking device 10 , referred to as a “ tracker 10 .” the below description details a number of innovative physical and / or functional features implemented in the tracker 10 , including a “ pinch ” or “ dual touch ” feature that provides comprehensive interaction capabilities between the tracker 10 and its user , while simultaneously providing robust rejection of “ false ” inputs . the tracker 10 further provides an advantageous clipping mechanism — not shown in fig1 — that provides a secure yet easily manipulated engagement mechanism for coupling to a body - worn carrier . of course , these advantages are non - limiting examples of the numerous advantages provided by the tracker 10 and overall system 8 . in more detail , the tracker 10 includes a communication interface 12 and a processing circuit 14 that includes or is otherwise associated with storage 16 . in an example case , the storage 16 comprises a non - transitory computer - readable medium storing a computer program 18 , physical activity data (“ pad ”) 20 , and one or more items of configuration data 22 . the tracker 10 additionally includes a display 24 configured to display various items of information , such as tracker status or operational information , mode information , battery charge information , one or more items of pad 20 or data derived therefore , etc . further , the tracker 10 includes a touch circuit 26 and at least two touch sensors 28 - a and 28 - b , which are used in “ dual - touch ” or “ pinch ” related processing as taught herein . still further , the tracker 10 includes a motion sensor 30 , such as a multi - axis accelerometer , and an altimeter or barometer 32 . here and elsewhere in this disclosure , recitation of a feature or item in the singular sense shall be understood as meaning “ one or more ” of such features or items unless otherwise noted . for example , the communication interface 12 may comprise one or more communication interfaces , e . g ., supporting different wireless communication technologies . in another example , the processing circuit 14 comprises one or more processing circuits , such as one or more microprocessors , microcontrollers , digital signal processors ( dsps ), field programmable gate arrays ( fpgas ), complex programmable logic devices ( cplds ), application specific integrated circuits ( asics ), or other digital processing circuitry . similarly , the storage 16 may be wholly or partly integrated with the processing circuit 14 , or communicatively coupled thereto , and may comprise more than one storage element or device , e . g ., such as two or more types of memory . examples include sram configured as working memory for the processing circuit 14 and eeprom or flash memory configured as non - volatile , persistent storage for the computer program 18 , the pad 20 and any configuration data 22 . in at least one such embodiment , the processing circuit 14 is configured to carry out the processing and supporting algorithms disclosed herein , based at least in part on its execution of computer program instructions comprising the computer program 18 , which instructions may be held in working memory for execution . fig1 serves as a non - limiting example implementation of the tracker 10 . broadly , the processing circuit 14 may be implemented using fixed circuitry , programmed circuitry , or some mix thereof . continuing with a top - level description of fig1 , one sees a communication device 40 , which may also be referred to as a “ personal computing device ” or pcd . in the example illustration , the communication device 40 includes a communication interface 42 , along with a processing circuit 44 . the processing circuit 44 is associated with storage 46 , which stores a computer program 48 — also referred to as an “ app 48 ” or “ application 48 ”— and further stores pad 50 and , possibly , one or more items of configuration data 52 . the pad 50 may be a full or partial copy of the pad 20 stored in the tracker 10 , or may be a historical aggregation of pad 20 as transferred from the tracker 10 to the communication device 40 in any number of past transfer events , or may be data derived from one or more items of pad 20 transferred from the tracker 10 . for example , the pad 50 may include accumulations or averages of pedometer data , as obtained from the tracker &# 39 ; s monitoring and processing of data from the motion sensor 30 . additionally or alternatively , the pad 50 may include accumulations or averages of barometric or elevation change data . in a non - limiting example , the app 48 is configured to obtain and process the pad 20 at triggered and / or scheduled times , and to accumulate or otherwise process and aggregate the pad 20 , to form the pad 50 . thus , the pad 50 may comprise various items of pad 20 transferred in from the tracker 10 and then aggregated or otherwise processed by the app 48 in terms of discrete physical activity events — e . g ., a run or a workout — or in temporal terms , such as steps taken per day , per week , etc . in at least some embodiments , the communication device 40 comprises a smartphone or an electronic tablet having both local and wide - area wireless communication capabilities . for example , the communication interface 42 includes a bluetooth radio interface for communicatively coupling to the tracker 10 . other radio access technologies ( rats ) may be used to couple the tracker 10 to the communication device 40 , such as near field communication ( nfc ) links , zigbee , ultra wideband ( uwb ). in other examples , inductive or optical coupling interfaces provide the local communication link between the tracker 10 and the communication device 10 . non - limiting examples of the communication device 40 include an apple iphone or ipad device , or a samsung galaxy phone or tablet . in an example of wide - area connectivity , the communication device 40 includes a cellular radio modem for communications toward an access network 54 . by way of non - limiting example , the access network 54 comprises a public land mobile network ( plmn ), such as a long term evolution ( lte ) radio access network ( ran ) supported by an evolved packet core ( epc ). in any case , the access network 54 communicatively links the communication device 40 through the internet 56 to an online computer system 60 . more particularly , the access network 54 and internet 56 communicatively link the app 48 to the online computer system 60 , thereby allowing the app 48 to transfer pad 50 from the communication device 40 to the online computer system 60 , e . g ., for storage in or linking to a user account corresponding to the user / owner of the communication device 40 . in this regard , it shall be understood that different trackers 10 generally are purchased and used by different users , e . g ., an individual user owns and wears a given tracker 10 , to track her physical activity . thus , while fig1 illustrates one tracker 10 and one communication device 40 , the overall system 8 may be considered as including any number of trackers 10 and associated apps 48 running in respective ones of the users &# 39 ; corresponding communication devices 40 . correspondingly , the online computer system 60 is configured to communicate with a potentially large plurality of communication devices 40 and / or trackers 10 . more particularly , the online computer system 60 is configured to manage account data for a potentially large number of ( tracker users ), including storing and processing pad 50 received for individual ones of those users , and , optionally , for providing individualized feedback to such users . user feedback includes , for example , statistical and / or graphical analyses of the user &# 39 ; s pad 50 , historical pad data , e . g ., tracked over one or more intervals of time . additionally or alternatively , the online computer system 60 uses the pad 50 received for a given user to determine personalized health , fitness and / or lifestyle recommendations to the user . such recommendations include , for example , recommended activities , diet or food recommendations , exercise equipment recommendations , etc . in the illustrated example , the online computer system 60 includes network ( nw ) interface circuitry 62 , which in at least some embodiments provides web server functionality , e . g ., for use by the app 48 in some of its embodiments and / or for browser - based access via the communication devices 40 or personal computers ( not shown ). the online computer system 60 further includes a processing circuit 64 — e . g ., any one or more microprocessor - based circuits — and associated storage 66 . the storage 66 comprises one or more types of non - transitory computer readable medium and in an example configuration provides storage for a computer program 68 , the execution of which configures the online computer system 60 according to the teachings herein . the storage 66 further stores user accounts 70 , including user - specific pad 72 . the pad 72 in a given user account 70 comprises , for example , comprises a full or partial copy of the pad 50 stored in the user &# 39 ; s corresponding communication device 40 , or comprises data derived or otherwise aggregated therefrom , e . g ., accumulated data , averaged data , data representing activity levels over time , etc . thus , it will be appreciated that the pad 72 for each user account 70 comprises pad 50 collected from the respective user &# 39 ; s communication device 40 and / or data derived therefrom . in turn , the pad 50 for a given user comprises pad 20 collected from the user &# 39 ; s tracker 10 and / or data derived therefrom . fig1 further illustrates that the tracker 10 , as a wearable electronic device , may be configured for detachably integrating with a bracelet 80 , for convenient wearability . further , the tracker 10 may be associated with a charging station 90 . to better understand example attributes of the tracker 10 , the bracelet 80 and the charging station 90 , fig2 - 4 provide several perspective views of the tracker 10 in one or more embodiments . fig2 in particular illustrates that the display 24 of the tracker 10 may be mounted behind a transparent region 100 in an upper surface of a tracker housing 102 , such that illuminated portions of the display 24 are visible through the tracker housing 102 . in some embodiments , the transparent region 100 is tinted or otherwise treated so that it exhibits an opaque appearance but does not prevent impair legibility of the display 24 when the display 24 is illuminated . further , particularly where the transparency of the tracker housing 102 is not discernable in the absence of back illumination , all or at least the top half of the tracker housing 102 may be transparent . in any case , it will be appreciated that the example tracker housing 102 includes opposing exterior top and exterior bottom surfaces , opposing exterior side surfaces along the long axis of the tracker housing 102 , and opposing exterior end surfaces along the short axis of the tracker housing . in this regard , fig2 also illustrates an example , advantageous positioning of the touch sensor 28 - a along one of the side surfaces defined by the long - axis of the tracker 10 . the region of the exterior surface overlaying the touch sensor 28 - a thus functions as a corresponding touch point 104 - a . it will be appreciated that in this embodiment the other touch sensor 28 - b is positioned within the interior of the tracker housing 102 such that its corresponding touch point 104 - b is symmetrically positioned on the opposing exterior surface of the tracker housing 102 , such as seen in fig3 and 4 . the use of underlying touch sensors 28 - a and 28 - b avoids the need for openings in the tracker housing 102 — i . e ., the touch sensors 28 - a and 28 - b are operative to sense touch through the tracker housing 102 and can thus be located inside the housing . further , by physically separating the touch points 104 - a and 104 - b — e . g ., by positioning them on opposing sides or ends of the tracker housing 102 — the touch interface of the tracker 10 is essentially insusceptible to accidental activation by the user . instead , to make a control input to the tracker 10 via the tracker &# 39 ; s touch interface , the user must simultaneously touch the two physically separated touch points 104 - a and 104 - b on the exterior of the tracker housing 102 . a “ pinching ” gesture , e . g ., involving the user &# 39 ; s thumb and forefinger , represents a convenient control gesture for simultaneously contacting two touch points 104 - a and 104 - b having significant physical separation , whether such separation is achieved by spacing the touch points 104 - a and 104 - b at separate locations on the same surface , or is achieved by locating the touch points 104 - a and 104 - b on opposing exterior surfaces of the tracker housing 102 . thus , the dual - touch input required by the tracker 10 is also referred to as a “ pinch ” input , and , likewise , a detected dual - touch event may also be referred to as a “ pinch event .” however , unless otherwise noted the terms “ pinch ” and “ pinch event ” are not meant to imply that the tracker 10 performs pressure or force sensing at the touch points 104 - a and 104 - b . further , it should be understood that one or more embodiments contemplated herein maintain physical separation of the touch points 104 - a and 104 - b without necessarily locating them on opposing sides or surfaces of the tracker housing 102 . thus , while opposing - surface positioning of the touch points 104 - a and 104 - b is preferred for some tracker form factors , it is also contemplated herein to simply provide sufficient physical separation between the touch points 104 - a and 104 - b to effectively eliminate the possibility of accidental simultaneous contact by the user with both touch points 104 - a and 104 - b . it is also contemplated that there may be more than two touch points 104 , where the “ 104 ” designation is used generically to refer to any one or more touch points 104 implemented via corresponding touch sensors 28 . for example , there may be a first touch point 104 that is common to two or more other touch points 104 . the user thus inputs different commands depending on which touch - point pairing she chooses , from among the possible pairings . a set of three such touch points 104 in that configuration yield two distinct pairings while a set of four touch points 104 with one being common to the other three yields three distinct pairings . regardless , in a non - limiting example of the contemplated touch sensing , the touch sensors 28 - a and 28 - b are implemented as a pair of electrodes , with each electrode positioned underneath the exterior surface of the tracker housing 102 at a respective one of the touch points . correspondingly , the touch circuit 26 comprises sensing circuitry configured to sense a change in capacitance between the electrode pair , such as occurs when the user simultaneously contacts the exterior surface of the tracker housing 102 at the two touch points 104 corresponding to the electrode pair . in a non - limiting example , the touch circuit 26 comprises an mpr031epr2 integrated circuit ( ic ). the mpr031epr2 ic is a proximity capacitive touch sensor controller from freescale semiconductor , inc ., and it is configured to “ drive ” an attached electrode pair and correspondingly sense changes in capacitance between the electrodes . in addition to illustrating the touch sensor 28 - b and its corresponding touch point 104 - b on the depicted side of the tracker housing 102 , fig3 depicts a mechanical clip assembly 110 . the clip assembly 110 is implemented on a bottom side of the tracker housing 102 and enables the tracker 10 to be clipped to a user &# 39 ; s clothing , for example . fig4 illustrates additional bottom - side features of the tracker 10 . the illustrated features include a number of charging contacts 122 , along with magnetic attachment points 124 that removably “ attach ” the tracker 10 to a charging station , such as the example charging station 90 shown in fig5 . one also sees that the various structural elements of the clip assembly 110 surround but do not cover or otherwise block access to the contacts 122 and attachment points 124 . the charging station 90 includes electrical contacts 92 that mate with and correspond to the electrical contacts 122 on the bottom side of the tracker housing 102 . the charging station 90 further includes attachment contacts 94 to magnetically couple to the magnetic contacts 124 on the bottom side of the tracker housing 102 . more particularly , in an example embodiment , the tracker housing 102 is configured to mount or otherwise snap into a receptacle portion 82 of a bracelet 80 , such as shown in fig6 and 7 . correspondingly , the body portion of the charging station 90 that carries the contacts 92 and 94 is dimensioned for encirclement by the bracelet 80 . in more detail , the tracker housing 102 is contoured and dimensioned to complement the size and shape of the receptacle portion 82 of the bracelet 80 , such that it at least partially seats into the receptacle portion 82 . the receptacle portion 82 may include within it mating features 84 - a and 84 - b that are configured to mate with engaging surfaces or elements of the clip assembly 110 on the bottom of the tracker housing 102 . further in this embodiment , the touch sensors 28 - a and 28 - b are positioned within the interior of the tracker housing 102 so that the corresponding touch points 104 - a and 104 - b are accessible along the side surfaces of the tracker 10 when it is fully seated into the receptacle portion of the bracelet 82 . as noted , the charging station 90 is dimensioned so that the bracelet 80 can slip over or around the body of the charging station 90 at the point where the electrical and magnetic contacts 92 and 94 of the charging station 90 are located . this configuration allows the tracker 10 to be mounted in the bracelet 80 , thereby forming a tracker / bracelet assembly , which in turn mounts to the charging station 90 . it will be understood that the open bottom of the receptacle portion 82 , as seen in fig6 , leaves the electrical and magnetic contacts 122 and 124 of the tracker 10 exposed , for coupling to the electrical and magnetic contacts 92 and 94 of the charging station 90 . thus , the bracelet 80 serves as a carrier for the tracker 10 and not only provides an aesthetic mechanism for wearing but further facilitates mounting the tracker 10 to the charging station 90 , for charging . fig8 illustrates a more detailed example embodiment of the tracker 10 . with simultaneous reference to fig1 , the communication interface 12 may comprise a bluetooth interface 202 , such as may be implemented using a da14580 - 01una ic from dialog semiconductor . the processing circuit 14 may be implemented using an ultra - low power processor , such as an stm32l processor provided by stmicroelectronics and targeted for use in so called “ wearable ” applications . further , one sees that the storage 16 may be implemented using an eeprom device 206 and that the touch circuit 26 and touch sensors 28 - a and 28 - b may be implemented using a touch - sensing ic coupled to a corresponding pair of electrodes 210 and 212 . additionally , the display 24 may be implemented as an oled display unit 214 , along with the motion sensor 30 being implemented as a low - power mems - type accelerometer , such as an adxl362 ic from analog devices . similarly , the altimeter 32 may be implemented using a low - power barometric sensor 216 , such as a mems - based pressure sensor like the lps331ap ic from stmicroelectronics . in an advantageous alternative used in one or more other embodiments of the tracker 10 , the motion sensor 30 and the altimeter 32 are implemented together in a low - power asic . the tracker 10 in the illustrated example includes further miscellaneous circuits or items , including a lithium - polymer ( li - po ) battery 220 , along with a charging circuit 222 and a protection circuit 224 that couples the li - po battery 220 to one or more dc / dc converters and associated control logic 226 and 228 , for powering the oled display 214 and the processing circuit 214 and its associated circuitry , such as reset circuit 230 and a motor driver 232 and motor 234 ( to provide the tracker 10 with a vibrate function ). regardless of its implementation details and the specific component types used in the tracker 10 , the tracker 10 in at least some embodiments is configured to provide a relatively rich set of capabilities and to operate in various modes that provide power savings and intuitive user operation . in a “ deep sleep ” mode of the tracker 10 , all sensors are off , and the tracker 10 operates in its lowest possible power state . in at least one embodiment , the communication interface 12 shown in fig1 implements a serial communication interface using the electrical contacts 122 provided on the bottom of the tracker housing 102 . correspondingly , the processing circuit 14 places the tracker 10 in the deep sleep mode in response to receiving a defined command via the serial interface . additionally or alternatively , the processing circuit 14 places the tracker 10 in the deep sleep mode in response to receiving the deep sleep command via a bluetooth or other wireless interface implemented via communication interface 12 . the processing circuit 14 exits the deep sleep mode responsive to detecting that the tracker 10 has been placed on the charging station 90 . for example , the tracker 10 transitions from the deep sleep mode to a “ normal ” mode in response to being placed on the charging station 90 . if while in normal mode the tracker 10 is not “ connected ” to a user &# 39 ; s communication device 40 , the tracker 10 advertises its presence via the communication interface 12 , e . g ., it sends periodic bluetooth or other personal area network signaling . the current “ step count ” for the day may be included in the advertising data . here , “ step count ” is the number of steps taken by the user , as computed by the tracker 10 based on detecting or otherwise processing output signaling from the motion sensor 30 . the tracker 10 may further store stride length information for the user as part of the configuration data 22 , for use in more accurately computing steps or determining corresponding distances traveled . the configuration data 22 also may include factory - installed data , such as a password or other “ key ” that must be received from any communication device 40 attempting to pair with or otherwise communicate with the tracker 10 . even if not used to authenticate all communications , the password or other stored key may be required for key operations , such as updating firmware , etc . of course , the password - based authentication may be transparent to the user . for example , the user purchases a tracker 10 that contains a factory - loaded password . when the user registers her tracker 10 with the online computer system 60 , the online computer system 60 maps the serial number of the tracker 10 to the preloaded password and sends that password to the instance of the app 48 that is installed in the user &# 39 ; s communication device 40 . in another embodiment , the password in the tracker 10 is initially set to 0 ( zero ). when an instance of the app 48 running on the user &# 39 ; s communication device 40 wants to pair with the tracker 10 , it uses the default password to make initial contact and then generates a new password , e . g ., via a random number generator function , and the provides it to the tracker 10 as the new password . the tracker 10 replaces the default password with the new password . performing a device reset on the tracker 10 resets to the tracker 10 to the default password , which allows the user a convenient recovery mechanism and allows the tracker 10 to be paired with a new communication device 40 . additional aspects of the tracker &# 39 ; s operation in one or more embodiments are detailed in fig9 , which depicts a method 900 that is implemented , e . g ., by the processing circuit 14 based on its execution of stored computer program instructions from the computer program 18 held in the storage 16 . it will be appreciated that the “ start ” and “ end ” labels in the illustrated flow do not preclude the possibility of looping or otherwise repeatedly performing the depicted processing , nor the possibility that the depicted processing is performed in conjunction with other operations , or as part of an overall processing routine . processing according to the example flow diagram begins with “ monitoring ” the touch interface of the tracker 10 ( block 902 ). here , monitoring may be passive , in the sense that a low power touch ic 208 , such as shown in fig8 , is configured to detect the change in capacitance resulting from a dual - touch event . upon detecting a dual - touch (“ pinch ”) event ( yes from block 904 ), the tracker 10 starts a “ pinch ” timer ( block 906 ) that times the duration of the pinch event . the tracker 10 further determines whether or not it is mounted on the charging station 90 ( block 908 ). the determination can be made based upon the processing circuit 14 sensing the presence of an input charging voltage , or it can be sensed , e . g ., using a discrete input signal that is pulled high or low when the tracker 10 is mounted to the charging station 90 , e . g ., sensed as a consequence of magnetic or electrical coupling with the charging station 90 . if the tracker 10 determines that it is on the charging station 90 ( yes from block 908 ), it displays the current battery level ( block 910 ). displaying the battery level may be a timed operation , e . g ., the level is displayed for five seconds by default . however , the tracker 10 senses whether the user &# 39 ; s pinch continues ( block 912 ). if the pinch persists for 10 seconds ( yes from block 914 ), the tracker performs reset processing ( block 916 ) as described below . in at least one embodiment of reset processing , the user performs a device reset by placing the tracker 10 on the charging station 90 , with the charging station plugged into an appropriate source of mains power . the user then simultaneously touches both touch sensors 28 - a and 28 - b and holds that contact for ten ( 10 ) seconds . in other words , the user performs a “ dual touch ” or “ pinch ” operation of ten seconds in duration . here , a “ dual touch ” or “ pinch ” operation means that the user simultaneously touches the tracker housing 102 at the two touch points on the exterior of the tracker housing 102 corresponding to the touch sensors 28 - a and 28 - b . at the ten - second mark , the tracker 10 displays the phrase “ reset ?” or some equivalent reset prompt for the user . if the user then releases the pinch within five ( 5 ) seconds after the tracker 10 displays the reset prompt , the tracker 10 performs the reset operation . otherwise , the reset operation is not performed , and the tracker 10 in one or more embodiments displays a corresponding message to the user . broadly , when the tracker 10 is operating in its “ normal ” mode and is placed on the charging station 90 , it cycles through a set of battery level icons or values on its display 24 , e . g ., 0 %, 25 %, 50 %, 75 %, 100 % . . . , for ten seconds . further , when the tracker 10 is on the charging station 90 and reaches a full charge , it uses its display 24 to display a 100 % charge battery level reading or icon . and , as noted , the tracker 10 displays its current charge state for five seconds if the user pinches the tracker 10 while it is charging . the tracker 10 may also display a charging animation to inform the user that charging is underway . also , as noted , if the pinch persists for ten seconds while the tracker 10 is charging , the tracker 10 will prompt to see if the user wishes to perform a device reset . as for the behavior of the tracker 10 when it is pinched while not being charged (“ no ” from block 908 ), processing continues with displaying the current primary metric , e . g ., the current day &# 39 ; s step count ( block 918 ). such processing may be based on displaying the current primary metric on a timed basis , e . g ., for a default period and then shutting the display 14 off unless the pinch persists ( block 920 ). if the pinch is released before the pinch timer reaches three seconds ( see blocks 920 and 922 ), the tracker 10 performs its normal - mode short - pinch processing ( block 924 ). in one implementation , the primary metric display at block 918 lasts three seconds and , if the pinch is released before the pinch timer reaches the three - second mark , the tracker 10 performs short - pinch processing by displaying the time of day for five seconds and then turning off . conversely , if the pinch persists for at least three seconds ( yes from block 922 ), the tracker 10 performs its normal - mode long - pinch processing ( 926 ). in an example case , if the pinch is held for more than three seconds , the tracker 10 uses its display 24 to continuously cycle through all of its defined primary metrics , with each metric displaying in turn for one second . if the user releases the pinch while the tracker 10 is cycling through the primary metrics in this manner , the tracker 10 will continue to display the last displayed metric for a further three seconds and then turn off . further , the method 900 may be extended to include a flight mode . assuming that a pinch event has occurred and assuming that the tracker 10 is not on - charger ( no from block 908 ) and is in its normal operating mode , the tracker 10 uses its pinch timer to detect whether or not the detected pinch persists for thirty ( 30 ) seconds . if so , the tracker 10 enters an “ airplane ” mode in which it turns off radio communications . if the tracker 10 detects another thirty - second pinch while in the airplane mode , the tracker 10 exits the airplane mode and returns to its normal mode of operation . the tracker 10 in at least one embodiment uses its display 24 to inform the user of its entry into and exit from the airplane mode . fig1 illustrates that the clip assembly 110 in one or more embodiments includes an external clip 300 and a stem assembly 302 that anchors the external clip 300 to an internal spring 304 , as seen in the cutaway views provided in fig1 and 12 . as seen in these latter two figures , the stem assembly 302 may comprise multiple parts and it may be fabricated from steel or other metal , or from plastic ( such as a fiber - reinforced plastic ), or from some mix of materials . for example , in fig1 , one sees that the stem assembly 302 includes first and second body members 310 and an inner retaining member 312 . in one example configuration , the body members 310 are a fiber - reinforced plastic material and the inner retaining member 312 is steel or another metal . use of plastics or other non - conductive materials for the body members 310 and / or the inner retaining member 312 provides , for example , enhanced protection against electrostatic discharge ( esd ) for the tracker &# 39 ; s internal circuitry . fig1 illustrates an embodiment of the clip assembly 110 in more detail , where the assembly is shown divorced from the tracker 10 for improved clarity . again , one sees the external clip 300 , which is joined to the internal spring 304 via the stem assembly 302 . it will be appreciated that internal features within the tracker housing 102 fixedly retain the internal spring 304 and / or stem assembly 302 for the proper operation of the clip assembly 110 . fig1 a and 14b provide an example of such operation . fig1 a illustrates the tracker 10 in a side view and one sees that the clip assembly 110 is in its closed position . it will be appreciated that the clip assembly 110 may be resiliently biased into its closed position via the spring force created by its construction . in particular , note that a retaining post or feature 320 within the interior of the tracker housing 102 prevents the internal spring 304 from moving downward in sympathy with the external clip 300 , as clothing or some other item 322 is slid in between the bottom side of the tracker housing 102 and the external clip 300 . this arrangement provides for a degree of movement by the stem assembly 302 , which allows the clip assembly 110 to clip to items 322 of a wider range of thicknesses , while not compromising the spring force ( clipping strength ) of the clip assembly 110 . notably , modifications and other embodiments of the disclosed invention ( s ) will come to mind to one skilled in the art having the benefit of the teachings presented in the foregoing descriptions and the associated drawings . for example , the dual - touch event timings used herein for differentiating between control actions , and other dual - touch timing values may be varied from the values given herein . it is recognized herein that the disclosed configuration of an electronic device for tracking physical activity particularly benefits from the dual - touch circuitry and related operation , e . g ., in view of the device &# 39 ; s intended use on or in close proximity to a user &# 39 ; s body , in view of which portions of the device &# 39 ; s housing are accessible when worn by the user and in view of the need for robust and reliable control in wearable device usage scenarios . however , it shall be understood that the teachings herein apply to other type of electronic devices or apparatuses . thus , the use of dual touch points on an exterior housing and the implementation of corresponding touch detection circuitry and control algorithms supporting dual - touch control may find advantageous use in a broad range of electronic devices or apparatus having varied uses or purposes . the teachings herein are therefore not limited to wearable electronic devices used for tracking the physical activity of a user . in general , it is to be understood that the invention ( s ) is / are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of this disclosure . although specific terms may be employed herein , they are used in a generic and descriptive sense only and not for purposes of limitation . notably , modifications and other embodiments of the disclosed invention ( s ) will come to mind to one skilled in the art having the benefit of the teachings presented in the foregoing descriptions and the associated drawings . therefore , it is to be understood that the invention ( s ) is / are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of this disclosure . although specific terms may be employed herein , they are used in a generic and descriptive sense only and not for purposes of limitation . | 6 |
referring to fig1 a plurality of information providers 1 a to 1 n are connected to a broadcaster 2 having the function of transmitting the data received from the information provider to a plurality of data receivers 4 a to 4 m through a broadcasting channel 3 . in the following an information provider may also be referenced as &# 34 ; calling terminal &# 34 ; and a data receiver as &# 34 ; called terminal &# 34 ;. the broadcaster 2 is a specific unit having the function of collecting and transmitting the data received from the information providers . however , the broadcaster may also transmit data originated by itself , acting in this case as an information provider . an improved selective distribution mechanism ensuring n × m unidirectional connections over a broadcasting channel between n information providers and m data receivers is provided . data is structured as digitally encoded packets having either data for transfer or information for various control purposes , as it will be described in further detail . a state - of - the - art data receiver in a unidirectional broadcasting system is provided with the following characteristics : a ) it includes a non - volatile memory used to store a list of the information providers from which the data receiver is authorized to receive information : the information provider table ( ipt ). the list includes the following data : & lt ; information -- provider -- id & gt ; is a unique identifier of the source of data ( information provider ); & lt ; ip -- timeout & gt ; identifies the timeout after which the information received by the information provider is removed from the data receiver storage memory . b ) it is identified by a unique identifier & lt ; unique -- identifier & gt ;, representing a permanent attribute . this identifier preferably is assigned by the manufacturer and is the address of the data receiver . selective transmission is achieved by establishing a connection between an information provider , and a specific data receiver being identified by a unique identifier . each information provider may concurrently transmit , in time division , different messages or data arranged in packets to a data receiver , or to different data receivers or groups of data receivers . once a connection is established , it is possible to transmit data from the information provider to the connected data receiver ( s ). a connection is terminated either as the result of a specific command issued by the calling terminal or automatically after a given connection timeout . the method herein described makes use of a &# 34 ; packet oriented &# 34 ; transmission protocol , where the generic packet has , preferably , a fixed length and a structure as depicted in fig2 . in such a protocol , the data file is divided into a sequence of blocks and each block is divided into packet units of data to be sent to the data receiver . then the data receiver rebuilds the complete data file re - assembling the packet units of data into blocks and then the blocks into the original file . in the following the symbol &# 34 ;::=&# 34 ; means &# 34 ; is composed by &# 34 ;. & lt ; packet -- address & gt ; identifies univocally each data file transmitted over the broadcasting system by a specific information provider ; & lt ; information -- provider -- id & gt ; identifies the information provider or the source of information ; & lt ; conversation -- id & gt ; identifies the data file sent by the specified information provider , such a data file will be de - assembled in data packets during the transmission from the information provider to the data receiver ( s ). for every value of & lt ; information -- provider -- id & gt ;, the & lt ; conversation -- id & gt ; is increased at each transmission of different data field and is cyclic , i . e . after having reached a maximum value it restarts from the initial value . the maximum value is to be defined in order to prevent interference between different data file . & lt ; packet -- type & gt ; is an identifier , specifying the type of the packet as indicated in the following ; & lt ; continuity -- index & gt ; which is a progressive cyclic index of the packet which indicates whether a packet is being re - transmitted . this allows the decoder of any called terminal to recognize a newly received packet as a copy of a previously received packet ; & lt ; checksum & gt ; which is an error checking code that allows detection of errors in the packet . this code can be implemented as a cyclic redundancy code ( crc ) applied to the & lt ; data & gt ; field . the other fields of the packet (& lt ; packet -- address & gt ;, & lt ; continuity -- index & gt ;, & lt ; packet -- type & gt ;) can be protected with error detection and correction policies for example ( hamming code 8 / 4 ). & lt ; packet -- code & gt ; which identifies the beginning of the & lt ; packet & gt ; for synchronization purposes . a preferred list of values assumed by & lt ; packet -- type & gt ; with the related & lt ; data & gt ; field structure is hereinafter described . this list contains all the information which the present invention needs to improve the state - of - the - art unidirectional broadcasting system . cr connection request packet . it establishes a connection between a calling terminal and the called terminal ( s ). establishing a connection means that the called terminal marks as available to the user all the packets carrying a & lt ; packet -- address & gt ; equal to the one contained in cr packet . the & lt ; data & gt ; field is so structured : where & lt ; receiver -- address -- id & gt ; identifies the address of the called terminal and & lt ; connection -- duration & gt ; identifies the timeout after which the data received associated to the & lt ; packet -- address & gt ; are swapped out from the main memory to the storage memory to improve the system capability . dr disconnection request packet . it activates the swap - out process for the data received identified by the & lt ; packet -- address & gt ;; at the same time it marks as available to the user all the packets carrying such & lt ; packet -- address & gt ; if not already done . the & lt ; data & gt ; field is so structured : dt starting data packet . since the data file is disassembled into blocks , this packet identifies the start of a block of data packets . in fact , to reduce the protocol overhead , it can be useful to send a sequence of data packets to form a block . the structure of the block is such that the first data packet only conveys the block length , whereas the following packets convey data only . the & lt ; data & gt ; field of this packet is so structured : & lt ; block -- number & gt ; is the number of the block of the data file ; & lt ; block -- len & gt ; is the size in byte of the block ; & lt ; data -- unit & gt ; represents the starting packet unit of data of the block ; df non - starting data packet . this packet conveys only data . a number of df packets ( up to the length specified in the dt packet ) follows a dt packet . the & lt ; data & gt ; field of the packet is so structured : & lt ; data -- unit & gt ; represents a packet unit of data of the block & lt ; block number & gt ; identified in the previously received dt packet . dv vital information packet . this packet transfers the information necessary to reassemble the data block to form a higher level entity ( i . e . a data file ). the & lt ; data & gt ; field of this packet is so structured : & lt ; data & gt ;:=& lt ; total -- blocks -- in -- file & gt ;& lt ; file -- len & gt ;& lt ; file -- val 13 code & gt ;& lt ; file -- name & gt ; & lt ; total -- blocks -- in -- file & gt ; is the total number of blocks into which the file was disassembled . & lt ; file -- len & gt ; is the size in bytes of the file ; & lt ; file -- val -- code & gt ; is a code that allows to verify the completeness and correctness of the data file received ; & lt ; file -- name & gt ; is the name of the data file or a data file identifier . ts time stamp packet . this packet is used to distribute a central clock for adapter synchronization purposes . in addition to the above other state - of - the - art packet types are used , for instance to manage groups of data receivers . hereinafter only the part referring to the new improvement with respect to the prior art methods will be described , with reference to the previously defined packet structure and types and to fig3 . at start time , the data receiver is in an idle state 300 . when a packet is received , test 310 is performed to determine the type of the packet . if a cr or a dr & lt ; packet -- type & gt ; value is received the & lt ; packet -- address & gt ; field of the packet is retrieved to be compared with a list of packet addresses which are maintained by the data receiver : the packet address stored table ( past ). each entry of past is formed by a field (& lt ; packet -- address -- stored ) and a pointer to a file (& lt ; received -- file & gt ;). each & lt ; packet -- address -- stored & gt ; assumes one of three different values : true when a cr or dr packet including such & lt ; packet -- address & gt ; has been received , comprising a & lt ; receiver -- address -- id & gt ; which matches the data receiver & lt ; unique -- identifier & gt ;; false when a cr or dr packet including such & lt ; packet -- address & gt ; has been received , comprising a & lt ; receiver -- address -- id & gt ; which does not match the data receiver & lt ; unique -- identifier & gt ; unknown when no cr or dr packet including such & lt ; packet -- address & gt ; has been received and the packet comes from a friend information provider , i . e . the & lt ; information -- provider -- id & gt ; part of the & lt ; packet -- address & gt ; is included in the information provider table ( ipt ) of the data receiver . then , each & lt ; packet -- address -- stored & gt ; is associated , by the pointer , to a file & lt ; received -- file & gt ; which will be used by the data receiver to store each data packet identified by such & lt ; packet -- address & gt ;. if no corresponding & lt ; packet -- address -- stored & gt ; exists and the information provider is a friend one , a new entry is added to the list with unknown value and associated to a new empty & lt ; received -- file & gt ;, as further described . in step 320 a test is performed to check if the & lt ; receiver -- address -- id & gt ; carried by the packet in the & lt ; data & gt ; field matches the data receiver identifier & lt ; unique -- identifier & gt ;. if so the control passes to step 330 , wherein the value of the & lt ; packet -- address -- stored & gt ; corresponding to the & lt ; packet -- address & gt ; is checked . then , if the value is true , the data receiver discards the packet in step 332 ; consequently the process returns to the idle state 300 . if a false or unknown value is retrieved , the control is passed to step 334 , wherein the value of the & lt ; packet -- address -- stored & gt ; corresponding to the received & lt ; packet -- address & gt ; is changed to true , thus validating the & lt ; packet -- address & gt ; as actually addressed to the specific receiver . in step 336 the pointed & lt ; received -- file & gt ;, if any , becomes available to the user ; therefore , the process returns to the idle state 300 . coming back to step 320 , if the match is unsuccessful , in step 340 the & lt ; packet -- address -- stored & gt ; corresponding to the received & lt ; packet -- address & gt ; is flagged as false and in step 342 the associated & lt ; received -- file & gt ;, if any , is discarded . if the type of the packet value is other than ` cr ` or ` dr `, then from test 310 the process passes to step 350 , wherein the & lt ; packet -- address & gt ; included in the received packet is retrieved and compared with past in the data receiver . if the value of the corresponding & lt ; packet -- address -- stored & gt ; is true , in step 352 the packet is stored in the pointed & lt ; received -- file & gt ; and made available to the user in step 358 ; then the process returns to idle state 300 . if the value is false , in step 356 , the packet is discarded without any other activity and the process return in the idle state 300 . if the value is unknown , in step 354 the packet is stored in the pointed & lt ; received -- file & gt ; but the packet , as the rest of the file , is not made available to the user , remaining &# 34 ; sub - judice &# 34 ; until it will be determined whether the file was directed or not to such data receiver . finally the process returns to the idle state 300 . then , if in step 350 no & lt ; packet -- address -- stored & gt ; corresponding to the & lt ; packet -- address & gt ; is found in past , in step 360 it is tested if the information provider is a friend one ; if so , in step 362 a new entry is added with an unknown value and having the associated pointer pointing to a new empty & lt ; received -- file & gt ;, then the control passes to step 354 . if the result of the test 360 is no , then the control passes to step 356 . referring now to fig4 the process to rebuild a data file will be disclosed . when data packets ( dt , df , dv ) are received , they are assembled into data blocks 430 . each data block is made up of a dt packet 410 with a sequence of df packets 420 so that the total block length ( in bytes ) reaches the one conveyed by dt packet , and the data blocks are written into a data file (& lt ; received -- file & gt ;) 400 , corresponding to the one identified by the & lt ; packet -- address & gt ; conveyed by the packets . preferably , a validation bit 440 is added to each data packet ( dt , df ) 410 , 420 received , showing if the packet has been properly received , testing the & lt ; checksum & gt ; value conveyed by each packet . the & lt ; received -- file & gt ; maintains the visibility attribute of the data blocks , i . e . if the data blocks have the corresponding & lt ; packet -- address -- stored & gt ; value equal to unknown , the & lt ; received -- file & gt ; will be hidden to the user . to reach this goal , many well known alternatives can be adopted ranging from simply vary the file attributes to more complex techniques like data encryption . each & lt ; received -- file & gt ; is stored into a temporary directory . when all the data blocks have been received and the total length (& lt ; file -- len & gt ;) of the & lt ; received -- file & gt ; is reached or a timeout is lapsed , the completed & lt ; received -- file & gt ; is renamed with the value carried by the dv packet and moved to the user directory , thus making it available to the user ( including the corrupted data ). retransmissions , if any , of the same data have the same value of & lt ; packet -- address & gt ; so it is possible to setup suitable merging policies among different data blocks . for instance , in a preferred embodiment , during a retransmission of a data file only the data packets dt and df corresponding to the ones which have been lost or corrupted during a previous transmission ( i . e . data packet stored having the validation bit equal to false ) are managed . then if the retransmitted packet data corresponds to a lost data packet this is added to the & lt ; received -- file & gt ;, while if such a data packet corresponds to a corrupted data packet this replaces the corrupted one into the & lt ; received -- file & gt ;. any & lt ; received -- file & gt ; with & lt ; packet -- address -- stored & gt ; equal to unknown remains hidden until a retransmission of the same data file occurs : in this case if a cr or dr packet is received and the conveyed & lt ; packet -- address & gt ; is validated , as previously disclosed , then the corresponding & lt ; packet -- address -- stored & gt ; is set to true and the visibility attribute of the & lt ; received -- file & gt ; is modified accordingly . preferably , when a cr packet is received the & lt ; received -- file & gt ; corresponding to the & lt ; packet -- address & gt ; conveyed by the packet is swapped into the main memory , to improve the capability of the process while the data block are being collected , and it will be swapped out to the disk storage , when one of the following conditions occurs : a dr packet with the same & lt ; packet -- address & gt ; is received ; the timeout , carried in the & lt ; connection -- duration & gt ; field of the cr packet , is lapsed ; a new cr packet has to be received and the main memory has no more space available for storing the new & lt ; received -- file & gt ;. in the preferred embodiment n & lt ; received -- files & gt ; can be stored at the same time in the main memory with a fifo algorithm managing the in / out procedure for each & lt ; received -- file & gt ;. preferably , a garbage collection routine has to be setup to delete each unknown & lt ; received -- file & gt ; which is older than the defined parameter & lt ; ip -- timeout & gt ; contained in the ipt . in this way each different information provider is provided with a different timeout , depending on the type of the data sent over the broadcasting channel | 7 |
a common problem faced in transferring numeric data over networks , for example database or sensor information transmitted using xml , is that numeric data stored in a binary floating - point format must be sent out as text , either ascii or unicode . methods of converting data stored in binary floating point format to text are well known in the art . the precision with which a binary floating point value can be represented is determined by the storage type . e . g . 7 decimal digits for a single - precision value , and 15 digits for a double - precision value . a well known standard for binary floating point arithmetic is the ieee 754 standard . a common approach to converting binary floating point values to text is via the “ f ” format supported by languages such as fortran and c . the “ f ” format , e . g . “% 0 . 8f ” as used in standard i / o libraries used with the c language provides spurious precision in some cases , for example representing the value 45 . 67 as “ 45 . 67000000 ”; and provides too little precision in other cases , for example representing 4 . 567 × 10 − 7 as “ 0 . 00000045 .” since standard ascii characters occupy one byte of storage and unicode characters require two bytes of storage , character strings in this application are discussed in terms of character length rather than bytes . for values stored in single - precision floating point , using scientific notation , where numbers are expressed in text in the form “[−] m . nnnnnne [+−] xx ” where the length of the string of n &# 39 ; s is specified by the precision and xx is the exponent , “% 0 . 6e ” avoids truncating significant digits , and produces only as many characters as is appropriate for a single - precision floating point storage type . for values stored in double - precision format , “% 0 . 14e ” achieves the same result . for example , using “% 0 . 6e ” produces “ 4 . 567000e + 01 ” for 4 . 567 stored as a single - precision number , and using “% 0 . 14c ” produces “ 4 . 56700000000000e - 07 ” for 4 . 567 × 10 − 7 stored as a double - precision number . while positive single - precision floating point numbers are used as examples , the present invention is equally applicable to positive and negative values , and to multiple precision formats . the present invention makes use of uncertainty information associated with a value to drive the number - to - text conversion process . uncertainty of a value is different from the finite precision which results from the choice of storage type , e . g . 7 digits for a single - precision floating point value and 15 digits for a double - precision floating point value . uncertainty arises from limitations in measurement components and method . it is nearly always greater than the uncertainty introduced by conversion to a floating - point format . for example , while a temperature value may be stored as a single - precision floating point value allowing up to 7 digits of precision , the combination of the temperature sensor used and the conversion process for quantizing the temperature sensor value may result in an uncertainty of 0 . 1 degrees c . uncertainty information is sometimes available from the context ( e . g . local knowledge of the transducer or environment ) and sometimes available explicitly ( e . g . it is a required element in data records conforming to the ieee 1451 . 2 standard ). converting the floating point value 45 . 67 to text using a standard scientific “% 0 . 6e ” format produces a 12 character string “ 4 . 567000e + 01 ”. the present invention makes use of the uncertainty associated with the value to be converted , according to the following steps : step 1 : using the uncertainty associated with the value to be converted , provide only as many mantissa digits as are meaningful , rounding off at the last meaningful digit . for example , if the uncertainty associated with the value 45 . 67 is 0 . 1 , the converted text is “ 4 . 57e + 01 ” which is 8 characters in length , a substantial savings over the 12 characters generated by a standard “% 0 . 6e ” format . because the result is driven by the uncertainty , precision in the converted value is not concealed . note that this step may save computing time as well as transmission time . all subsequent steps in the process spend computing time to save transmission time , which is usually a good tradeoff . a user or organization wishing to preserve more precision and willing to spend more space and time could round to { fraction ( 1 / 10 )} of the uncertainty , { fraction ( 1 / 100 ,)} etc . similarly , one wishing to compress more aggressively and willing to sacrifice precision could round at 10 × the uncertainty , etc this is equivalent to scaling the uncertainty by a factor of 10 n where n is an integer . suppose that the value in question has x significant digits and the storage type used for the value has y significant digits . scaling by x ( i . e . rounding at 10 x ) would remove all the significance , and scaling by x - y would pretend that the entire value was significant . the preferred range for scaling by n is therefore from x - y to x . as an example , assume a quantity has 4 significant digits ( x = 4 ) and the storage type provides for 7 digits ( y = 7 ). scaling the uncertainty by a factor of x - y , 4 − 7 =− 3 , would return all 7 digits . while rounding is traditionally discussed in terms of whole - digit values , e . g . rounding 4 . 56 to 4 . 6 , rounding to other values is equally valid mathematically . for example , a value might be 98 . 765 plus or minus 6 . 23 . in that case the value 98 . 765 is rounded to the nearest 6 . 23 , displaying 99 . 68 . a first embodiment of this step converts only as many digits as are needed for the specified uncertainty , rounding off the last meaningful digit . a second embodiment of this step uses standard number - to - text libraries , such as those provided by the c language stdio library . for example , the stdio function sprintf is first used to convert the value to a string using the “ e ” format to produce a string with the full precision available for the storage type used . using the uncertainty associated with the value , the mantissa portion of the text string s rounded and truncated to the required length . step 2 : truncate trailing mantissa digits if they are zero . for example , if the value 45 . 67 were converted according to step 1 with an uncertainty of 0 . 001 , the string “ 4 . 5670e + 01 ” would result . this step would send “ 4 . 567e + 01 ” instead . step 3 : if all digits to the right of the decimal point have been truncated , truncate the decimal point . steps 1 through 4 produce character strings which will be recognized as valid numeric values by a wide range of standard software . such software includes applications such as spreadsheets and databases . the following steps achieve additional savings at the cost of requiring the receiving software to recognize and deal with possibly nonstandard formats . applications communicating using xml typically have an opportunity to manipulate the results of xml parsing , allowing the following steps to be used : step 5 : always provide the sign of the exponent ( some conversion libraries suppress the sign if it is “+”) but omit the exponent character , “ e ” or “ e ” depending on the library or formatting string used . this saves a character when the exponent is negative and avoids ambiguities with later steps . this step produces “ 4 . 567 + 1 ” for 45 . 67 and “ 4 . 567 − 7 ” for 4 . 567 × 10 − 7 . step 6 : if the exponent is zero , omit both it and its sign . step 7 : normalize by 10 . shift the decimal point to the front of the string by dividing the mantissa by 10 and adding 1 to the exponent , then re - applying step 6 . knowing that we now have a leading decimal point , we can now suppress it , leaving a mantissa which is effectively an integer . the exponent is already an integer . the value 45 . 67 thus becomes “ 456730 2 ”. step 8 : represent both mantissa and exponent in hexadecimal , using approximately ⅝ as many characters . as an alternative , a larger radix could be used . for example , a base 62 encoding using the character ranges “ 0 ”- “ 9 ”, “ a ”- “ z ”, and “ a ”-“ z ” would reduce the width of numbers on average to 16 % of their original ( decimal radix ) size . applying these steps to the value 12 . 34 with uncertainty 0 . 001 produces the following : “ 1 . 234000e + 01 ” 12 characters “%. 6e ” format “ 1 . 2340e + 01 ” 10 characters step 1 “ 1 . 234e + 01 ” 9 characters step 2 “ 1 . 234e + 01 ” 9 characters step 3 “ 1 . 234e + 1 ” 8 characters step 4 “ 1 . 234 + 1 ” 7 characters step 5 “ 1234 + 1 ” 7 characters step 6 “ 1234 + 2 ” 6 characters step 7 “ 4d2 + 2 ” 5 characters step 8 these steps in accordance with the present invention can provide significant savings . assume that noise and rounding errors have provided a value such as 4 . 00000043819 . if the uncertainty associated with this value is 0 . 00001 , then applying the specified steps results in the string “ 4 + 1 ”. note that while the examples given have been in terms of positive numbers , negative numbers are processed by dealing with their absolute value and prepending a minus sign to the resulting character string . the foregoing detailed description of the present invention is provided for the purpose of illustration and is not intended to be exhaustive or to limit the invention to the precise embodiments disclosed . accordingly the scope of the present invention is defined by the appended claims . | 6 |
the subject matter of the present invention is described with specificity herein to meet statutory requirements . however , the description itself is not intended to limit the scope of this patent . rather , the inventors have contemplated that the claimed subject matter might also be embodied in other ways , to include different steps or combinations of steps similar to the ones described in this document , in conjunction with other present or future technologies . moreover , although the terms “ step ” and / or “ block ” may be used herein to connote different elements of methods employed , the terms should not be interpreted as implying any particular order among or between various steps herein disclosed unless and except when the order of individual steps is explicitly described . turning now to fig1 a - 1f , there are depicted therein a number of views of different connector leads that may encounter unwanted , damaging rapid charge or discharge upon connection . leads of such connectors typically fashion a conductive path purely from conductive materials , such as metals or alloys of copper , silver , tin , lead , etc . fig1 c shows a pin lead 161 and a mating pin hole lead 162 . when pin 161 is electrically coupled to a first electrical polarity component , such as a battery , and pin hole lead 162 is electrically coupled to a second electrical polarity component , such as a computerized device , the insertion of pin lead 161 into pin hole lead 162 results in a rapid inrush of charge into the computerized controller that may erode or damage connector surfaces and / or electrical components such as those within the computer controller . a charge flows between a first polarity component and a second polarity component when there is a charge differential between the first and second component . “ polarity ” therefore refers to a difference in charge potential that results in charge flow . under high charge capacity conditions , there may be several severe undesirable effects , as discussed more fully below when a conductive lead , such as pin lead 161 , gets close to a conductive pin hole lead 162 . even when a connector application has relatively low charge capacity , and uses an esd design , there still may be a negative effect from rapid inrush of charge . consider for example , a typical substantially rectangular connector , such as universal serial bus ( usb ) connectors , depicted in fig1 a and fig1 b . typically , plug 170 shown in fig1 a has a substantially rectangular grounding shield 132 , and an insulating guide 134 physically adjacent to finger pads 131 , 133 , 135 , and 137 . a mating receptacle 160 is shown in fig1 a having a substantially rectangular grounding shield 142 , an insulating guide 144 , and finger springs 141 , 143 , 145 and 147 . the finger pads 131 , 133 , 135 , 137 , and finger springs 141 , 143 , 145 , and 147 in the usb leads are typically coupled to electronics components , such as a battery , power supply , line drivers , transistors , memory chips , etc ., which may suffer degradation from rapid inrush of charge . coupling , attaching , or joining leads to components is typically performed by forming a solder joint between the conductive material of a connector lead and the conductive material of a component , such as a circuit board , computer , computer board , battery , or a component lead therefrom . other means of joining include making screw terminal connection , forming a pressure connection , forming a twist - on connection , forming a crimp connection , etc . when a receptacle 160 is mated to a plug 170 , the contacts formed are illustrated in fig1 b . the ground shield 132 makes electrical contact with shield springs 151 providing an esd charge path for a static charge differential between receptacle device and plug device . for example , a usb device may include : a computer , a laptop , an mp3 player , a docking station , a hub , a card reader , a flash drive , an external hard drive , a web cam , a speaker , an infrared adapter , an 802 . 11 adapter , an audio interface , a mouse , a keyboard , a trackball , a game controller , a gadget ( e . g . for heating slippers , gloves , beverages , etc . ), and a charger . upon insertion , the four finger pads 131 , 133 , 135 , and 137 make electrical contact respectively with the four finger springs 141 , 143 , 145 , and 147 . as shown in fig1 b , a typical finger spring , such as finger spring 141 , makes physical metal to metal contact with finger pad 131 . as shown in fig1 a , the outer mating connection lead pairs 137 and 147 ( typically vbus ); and 131 and 141 ( typically gnd ), make contact forming a power supply circuit . a circuit is closed once the two pairs of leads have both made electrical contact . a charge differential necessarily exists in many such applications , such as when a usb receptacle 160 is coupled to a passive component . therefore the charge may be rapidly discharged from a powered receptacle or jack 160 to a passive component , such as a usb flash drive , which is coupled to plug 170 . when the second pair of mating leads makes contact , the components attached to the leads may be at least incrementally degraded by a sudden rush of charge . by way of illustration , where the effect may be relatively severe , there is shown in fig1 d - 1f various views of a conventional barrel connector lead 110 and a mating barrel plug lead 120 that are amenable to a hobby or robotic vehicle application , such as that shown in fig9 . fig1 d presents a plan view of a barrel receptacle lead 110 and a plan view of a barrel plug lead 120 . fig1 e presents a cross - sectional view of the connectors of fig1 d generally taken along the plane 1 e - 1 e in the direction of the arrows . this cross - sectional view shows that barrel plug lead 120 is fashioned of conductive material , and has a conductive interface 122 capable of forming a solder joint with a lead from an electrical component . plug lead shaft 124 inserts into receptacle lead cavity 114 . the cross - sectional view of conventional lead 110 shows that lead 110 is fashioned of conductive material , and has a conductive interface 112 capable of forming a solder joint with a lead from an electrical component . receptacle lead 110 also has receptacle cavity 114 for receiving barrel plug lead 120 to make an electrical contact between receptacle lead 110 and plug lead 120 . conductive interfaces , such as conductive interfaces 112 and 122 also shown in fig1 f , are typically available in 3 . 5 mm , 4 mm , 5 . 5 mm , 6 . 5 mm and 8 mm diameter channels . in fig9 , a charged battery 701 is illustrated being connected to an electronic speed controller ( esc ) 702 . an esc is a device that controls the speed of a motor using electronic components , such as mosfets , random access memory ( ram ), capacitors , resistors , and an imbedded microprocessor running firmware and / or software . an esc typically controls the timing and duration of pulses that apply power to a motor to control direction of rotation , speed of rotation , and acceleration of a rotor that is engaged with the motor . an input capacitor 750 is typically sized for the esc 702 based on the battery 701 and current requirements . in a typical application input capacitor 750 is 1 . 6 millifarads for a relatively high capacity battery at 50 volts ; though voltages as high as 90 volts are also common . in this application , when connector leads 710 and 720 are of conventional type , such as lead 110 , and connector leads 730 and 740 are of conventional type such as lead 120 , rapid charge flow can have negative effects . first of all , if there is a charge differential between the battery 701 and the esc 702 , then an esd charge flow will result when a first lead 710 begins to connect with lead 730 . after lead 730 is seated into lead 710 , the static charge differential is equalized . secondly , when lead 720 is subsequently about to be connected to a mating lead 740 , there may be unwanted effects of a hot - swap connection . for example one or more of the following may occur : a sound similar to a gunshot , a current that momentarily exceeds the capacity of components ( such as capacitor 750 ), a current that causes the material of a component to melt , a current that causes degradation of components such as capacitor 750 , destruction of components ( such as capacitor 750 ), fouling of one or more leads , melting of one or more leads , etc . turning now to fig2 a - 2d , and fig3 , there are shown several views of an improved barrel receptacle lead 210 and a mating lead 120 . a resistive member 216 is physically coupled to a conductive member 211 to form a connector lead that protrudes from the conductive member 211 in the direction of a mating connection . the physical coupling shown in fig3 is the physical insertion of resistive member 216 into a channel 238 designed to conform to the exterior region of resistive member 216 so as to provide electrical contact between 216 and 211 . retaining groove 226 on resistive member 216 mates to retaining ring 236 to keep the resistive member in place as a plug shaft 124 ( fig2 b ) is inserted first into the physically coupled combination of 216 and 211 , and removed again . retaining ring 236 has a profile 237 with two right angles to match the profile of retaining groove 226 . the profile of one or more of groove 226 or ring 236 could alternatively make use of a differently shaped profile 237 ; alternatively using an elliptical shape , triangular shape , etc . in the embodiment shown , the foot 246 of resistive member 216 mates to the seat 247 of conductive member 211 at a right angle to the exterior . other embodiments provide a tapered angle , such as 45 degrees . in the embodiment shown in fig3 , the resistive member is retained by retaining ring 236 . means of retention include one or more of the means shown in fig3 , mechanical retention by an exterior insulator 218 as shown in fig2 b , compression connection , screw connection , conductive adhesive , plating , etc . the interior diameter of resistive member 216 after insertion is approximately equal to the interior diameter of channel 214 to provide substantially constant contact between plug shaft 124 ( fig2 b ) and plug receptacle 210 ( fig2 a ) upon insertion . in some embodiments , a resistive member , such as resistive members 216 ( fig2 b ), 316 ( fig4 b ), 416 ( fig5 b ), 524 ( fig6 b ), or 849 ( fig1 b ), may be formed from a low resistance acetal homopolymer ( pom ), such as ultraform ® n2320 c bk120 q600 , manufactured by basf corporation or an equivalent . embodiments form the resistive member from any material that exhibits desirable dissipative properties such as ceramic material , semiconductor material , polymeric material , etc . fig2 a shows an improved barrel receptacle lead 210 having resistive member 216 , and a mating conventional plug connector 120 . fig2 b is a cross - sectional view of the leads in fig2 a , taken along the plane 2 b - 2 b , in the direction of the arrows . as shown in fig2 b , conductive member 211 has a conductive interface 212 that can be joined to an electrical component , such as component 701 ( fig9 ), or 702 ( fig9 ), e . g . through a solder joint , to form a current carrying path in an electrical device . other conductive interfaces , such as metallic leads , or other types of conductive joints are contemplated in embodiments of the improved connector lead . fig2 b also shows an optional ( not shown in fig2 a ) exterior insulating jacket in the form of an insulating “ shrink - tube ” sheath 218 that encompasses an exterior region of conductive member 211 to prevent inadvertent conductor - to - conductor contact , and in the embodiment of fig2 b , to aid retention of resistive member 216 . fig2 c depicts an end view of the improved barrel receptacle 210 showing the conductive interface 212 . fig2 a shows a plan - view of the improved barrel receptacle 210 . fig3 shows the sheath 218 prior to assembly in which it has not yet contracted due to the application of heat . fig2 d is a cross - sectional view of an alternative embodiment of the leads in fig2 a , taken along the plane 2 b - 2 b , in the direction of the arrows . as shown in fig2 d , the diameter of shaft 124 indicated by distance 296 is chosen to provide constant electrical contact with the conductive member 211 , so that distance 296 is approximately equal to the diameter of channel 214 . in the embodiment depicted in fig2 d , the opening of resistive member 216 at the end of the resistive member which first receives shaft 124 upon insertion has slightly larger diameter indicated by distance 297 . the diameter of resistive member 216 tapers from a diameter of distance 297 at one end of the resistive member to a diameter substantially equal to distance 296 at location 298 within the resistive member . in some embodiments distance 297 is approximately 1 mm larger than distance 296 . in some embodiments the outer diameter of barrel 210 is increased slightly , especially in the region surrounding the resistive member 216 , increasing the thickness of the shell of conductive member 211 . in some embodiments a portion of the resistive member 216 of about 1 mm length has diameter approximately equal to distance 296 . returning to the example shown in fig9 , consider how an improved connector lead , such as lead 210 , improves performance of the connector upon connection . a lead , such as lead 210 , is coupled to a component , such as battery 701 , by soldering to it lead 703 so that lead 710 is of an improved type , such as lead 210 . a second connector lead , such as lead 120 , is soldered to lead 704 , so that lead 730 is of a conventional type such as lead 120 , thus electrically joining lead 730 to esc 702 . the first connection illustrates how the improved connector resists and dissipates esd . as connector lead 710 is connected to mating connector lead 730 , connector lead 710 initially provides a charge dissipation path from plug shaft 124 through resistive member 216 , through conductive member 211 from esc 702 to battery 701 . thus the resistive member serves to dissipate charge , and to divert the sudden rush of charge by heating the resistive member slightly rather than injecting a sudden esd inrush of charge that may degrade electrical components within the esc such as , capacitors , processor chips , line drivers , ram , etc . when a plug shaft 124 ( fig2 b ) on lead 730 is subsequently further inserted into connector 710 , the shaft 124 ( fig2 b ) begins to make contact with channel 214 ( fig2 b ) within improved connector 710 thereby providing a bypass , current carrying conductive path from lead 703 through conductive member 211 to shaft 124 of plug 730 to lead 705 from the battery 701 to the esc 702 . after having achieved electrical connection of lead 703 to lead 705 , an improved connector lead 720 , such as lead type 210 , further protects connectors 720 and 740 as well as the components such as capacitor 750 within a device , such as esc 702 . improved connector 720 , of a type such as lead 210 , is joined to lead 704 through a solder joint . a conventional plug lead 740 , of a type such as lead 120 is joined to lead 706 through a solder joint . when improved connector lead 720 , is mated to conventional connector lead 740 , connector lead 720 initially provides a charge dissipation path from battery lead 704 through conductive member 211 , through resistive member 216 , through conductive plug 120 to lead 706 from battery 701 to esc 702 . when connector lead 740 is further inserted into connector lead 720 , connector 720 subsequently provides a bypass , current carrying , conductive path around the resistive member 216 from lead 704 through conductive member 211 through plug lead 740 to lead 706 from battery 701 to esc 702 . when an electrical bypass path is provided , much of the charge flows through the bypass path , thus substantially bypassing the resistive member . this improvement in the second pair of connectors to be mated provides enhanced performance even for the case in which the prior electrical connection between lead 703 and lead 705 had been made using conventional leads . continuing with the embodiment of fig2 a - 2c and fig3 , in the application of fig9 , fig8 presents an equivalent circuit for the initial resistance upon insertion of plug 730 into receptacle 710 , after plug 740 has been fully inserted into receptacle 720 . for the purpose modeling the current flow of the equivalent circuit , the situation may be modeled as two ideal switches 710 ′ and 720 ′ of fig8 that close simultaneously with corresponding idealized connectors 730 ′ and 740 ′. resistor 610 models the initial resistance encountered in the entire circuit from idealized battery 701 ′ to idealized capacitor 750 ′ when the resistive member 216 of the second connector begins to make contact with the second mating connector 740 . assume that for a short time , the resistance r ohms approximates a constant resistance level provided by the resistive member . assume further that the electrical device 702 may be modeled simply as having the value of the input capacitor 750 of c farads . the current through the resistor 610 as a function of time may be derived as shown , for example in pp . 186 - 188 of nilsson , “ electric circuits ,” addison - wesley , of reading massachusetts , © 1983 , to be current i through resistor 610 for idealized battery 701 ′ of voltage v , as follows : this equation may be used to advantage in sizing the resistance value r of the resistive member 216 . if it is desired to dissipate most ( 5 time constants ) of the charge flow in a target dissipation time of 16 ms , for a capacitor of 1 . 6 millifarads , then a resistance value of about 2 ohms should be used . the resistance is considered to be matched to the input capacitance when it is approximately equal to 0 . 003 times the reciprocal of the capacitance . this gives a decay time of approximately 15 milliseconds to reach the 5 time constant limit , when the current has dropped below 1 % of its maximum value . the resistance is considered approximately matched to the input capacitance when it is within a factor of 1000 above or below the matched value ( either a thousand times larger , or a thousand times smaller than the matched value ). the resistance value is tightly matched to the input capacitance when it is within a factor of 10 above or below the matched value ( either ten times larger or ten times smaller than the matched value ). in some embodiments the resistance is bounded by a factor of the capacitance , in other words , at least the dissipation time is bounded so that it is not large enough to be cumbersome to the person attaching the connector . for example , if it is desired to have the 5 time constant decay time less than 15 seconds , then the resistance is loosely bounded by the capacitance when it is chosen to be less than 3 times the reciprocal of the capacitance . the resistance is tightly bounded by the capacitance when it is chosen to be less than 0 . 03 times the reciprocal of the capacitance . for example , in an exemplary usb application , the maximum input capacitance is 10 microfarads , and the minimum is 1 microfarad . therefore a resistance is tightly bounded by the maximum input capacitance when it is chosen to be less than 3 , 000 ohms . the resistance is tightly matched to a capacitance of 10 microfarads when it is chosen to be between 30 ohms and 3 , 000 ohms . turning now to fig4 a - 4c , there are depicted therein various views of an improved slot receptacle connector 310 and a mating tab connector 320 . fig4 a shows a plan view of improved slot receptacle 310 having conductive tab interface 312 at one end and resistive member 316 inserted into the opposite end . fig4 a also depicts mating tab connector 320 with tab conductors 345 and 335 . fig4 b shows a cross - sectional view of the leads in fig4 a taken along the plane 4 b - 4 b of fig4 a in the direction of the arrows . a rectangular resistive member 316 physically couples to conductive member 314 . an optional ( not shown in fig3 a ) insulating jacket 318 surrounds an exterior region of the connector 310 . fig4 c presents an end view of improved slot receptacle connector 310 . turning now to fig5 a - 5d , there are depicted therein alternative embodiments of an improved barrel receptacle connector 410 and mating plug 120 . fig5 a shows a plan view of the improved barrel receptacle 410 having conductive member 411 physically coupled to conductive ring 414 through three resistive members 416 . for each resistive member 416 , ribbed receiving slots in the conductive ring 414 and in the slots of conductive member 411 receive resistive member 416 during a compressive insertion of conductive ring 414 onto an assembly of conductive member 411 and the three resistive members 416 . the ribs are fashioned to grip the resistive member 416 and prevent ring 414 from decoupling from barrel receptacle 410 . the gap between conductive ring 414 and conductive member 411 is chosen to be large enough to prevent sparking around resistive members 416 . fig5 c shows the electrical interface 412 of connector lead 410 , and also shows the circular arrangement of the resistive members 416 used to connect conductive ring 414 to conductive member 411 . conductive ring 414 is a conductive member that is coupled to one or more resistive members and protrudes in the direction intended for mating the connector to form a front portion of connector lead 410 . embodiments replace one or two of the three resistive members 416 with insulating members , so that charge dissipates , upon connection through as little as a single resistive member 416 . fig5 b shows a cross - sectional view of the leads shown in fig5 a taken generally along the plane 5 b - 5 b of fig5 a , in the direction of the arrows . fig5 b shows electrical interface 412 , and channels 423 and 421 . when mating connector 120 is connected to improved barrel connector 410 , initially the conductive plug shaft 124 makes contact with conductive member 414 providing a charge carrying path from conductive interface 122 through shaft 124 , through conductive ring 414 , through one or more resistive members 416 , to conductive member 411 , and thus to conductive interface 412 . when shaft 124 is further inserted , making contact with channel 421 , a conductive bypass path around one or more resistive members is provided from conductive interface 122 through shaft 124 to conductive member 411 and conductive interface 412 . fig5 d presents an alternative configuration of improved barrel receptacle lead 410 . in fig5 d , the alternative configuration of resistive member 416 still couples physically to conductive ring 414 and to conductive member 411 . in some embodiments , exterior surface 587 of conductive ring 414 has retaining ribs to mechanically couple to interior surface 586 of resistive member 416 and so to prevent ring 414 from decoupling from resistive member 416 . similarly , in some embodiments an exterior region 597 of conductive member 411 has ribs to mechanically couple to an interior surface 596 of resistive member 416 to prevent resistive member 416 from decoupling from conductive member 411 . other embodiments of mechanical coupling are contemplated such as one or more retaining rings , smooth surface contact adhesion , screw connection , conductive adhesive , plating , etc . turning now to fig6 a , fig6 b , and fig7 , there are depicted therein various views of an improved pin lead 520 and a mating pin hole lead 510 . fig6 a shows a plan view of mating pin hole lead 510 and of improved pin lead 520 with resistive member 524 and conductive member 511 . fig7 is an end view of pin hole lead 510 . fig6 b shows a cross - sectional view of the leads shown in fig6 a taken along the plane 6 b - 6 b of fig6 a , in the direction of the arrows . the cross - section of lead 520 illustrates a conductive connecting protrusion 522 for physically coupling the conductive member 511 of the pin lead 520 to resistive member 524 . embodiments of the pin lead 520 form threads on the protrusion 522 , and provide mating threads on the resistive member 524 . embodiments provide ribs on protrusion 522 , and mating retention rings on resistive member 524 to couple resistive member 524 to the protrusion 522 of the pin conductive member 511 . embodiments provide a conductive adhesive to couple conductive member 511 to resistive member 524 , applying the adhesive at least to protrusion 522 . the conductive member 511 , or a lead coupled thereto , is typically inserted into a conductive through - hole on a circuit - board and coupled additionally to one or more other electrical components , such as resistors , capacitors , integrated circuits , etc . alternatively , a conductive cable lead is electrically coupled to conductive member 511 , and bound together with similar cable leads that are likewise coupled to additional connectors and electrical components . when an improved pin lead 520 is inserted into a pin hole lead 510 , the resistive member 524 enters channel 514 providing a charge dissipation path from conductive member 511 through resistive member 524 to conductive member 510 . as the improved pin lead is further inserted , a current - carrying bypass path is provided from conductive member 511 to pin hole lead 510 substantially bypassing resistive member 524 . in some embodiments , improved pin connector leads , such as lead 520 , or others , described herein are gathered into arrays , and used as improved pins in available connector bodies , such as d - shell connectors , substantially rectangular connectors , and compressive circular connectors that are commonly used for electronics applications . an improved array of pin connector leads , such as lead 520 , are mated with a conventional mating array of pin hole connector leads , such as lead 510 . these arrays may be provided with a circular , substantially rectangular , or d - shell conductive electrical grounding shield to provide a mechanical guide and esd protection when mating the arrays . such an improved array , may alternatively replace the material of conductive electrical grounding shield 842 with an insulator of the same shape , such as plastic , since an esd solution has been incorporated into each pair of pin lead 520 and mating pin hole lead 510 . embodiments of the guides are further discussed below . in another variation , the connector improvement is incorporated into the pin hole lead , and a conventional pin lead is used . in variations the connector leads are barrel leads , slot leads , finger spring leads , or finger pad leads . optionally an insulating guide is used to align the leads upon insertion in addition to a conductive guide as also discussed further herein below . fig1 a - 10c present views of an improved finger spring lead , such as lead 847 , for use in embodiments of an improved connector , such as receptacle 810 . a representative perspective view of plug 170 is shown in fig1 a . a representative perspective view of improved receptacle 810 is shown in fig1 a . improved finger spring 847 is constructed of conductive member 841 physically coupled to resistive member 849 , as shown in area 10 c of fig1 b , and also in fig1 c , which is an enlarged fragmentary perspective view of area 10 c . a protrusion 881 having jagged edges is inserted into a mating slot of resistive member 849 . embodiments of the slot in resistive member 849 include ribs to retain the resistive member after insertion . other methods of physically coupling are also contemplated . the conductive member 841 is coupled to an electrical component , for example , by soldering into a through - hole of a circuit board the end of member 841 that is remote from resistive member 849 . the mating finger pad 131 is coupled to an electrical component similarly by soldering the end of 131 that is remote from mating connector 810 into a through - hole on a circuit board . the improved finger spring 847 is shown in fig1 b . as plug 170 is inserted into receptacle 810 , an outer substantially rectangular guide 132 is inserted into an exterior substantially rectangular guide 842 , causing contact between shield 132 and guide 851 . in some embodiments guide 851 is a metallic grounding spring . in other embodiments it is simply a spring or a piece of plastic . in some embodiments guides 132 and 842 are conductive shields . in other embodiments , one or more of 132 and 842 are constructed of insulating material , as an esd solution has been incorporated into each lead of the connection . in some embodiments , an inner insulating guide 844 encompasses an exterior side of a finger spring 847 . the insulating guides 844 and 134 serve to align lead 847 and lead 131 . the guides are formed , for example from molded plastic . when guide 842 or 132 are conductive , they are formed for example , by taking a sheet of conductive material , such as metal , stamping a pattern out of the metal , and folding the result into a substantially rectangular shell . the folded shell forming shield 842 is fastened to insulator 844 with screws . insulator 134 is fastened to shield 132 with screws . as plug 170 is partially inserted into receptacle 810 , resistive member 849 initially contacts finger pad 831 providing a charge dissipation path from the component coupled to finger pad 831 through resistive member 849 to conductive member 841 , and thus to the component electrically coupled to member 841 . when plug 170 is further inserted into receptacle 810 , conductive member 841 makes physical contact with finger pad 831 , thus providing a bypass conductive path around resistive member 849 from the component attached to pad 831 to the component attached to member 841 . this bypass path carries current during normal operation after connection is complete . in a similar manner , at approximately the same time finger pads 133 , 135 , and 137 make contact with finger springs 845 , 843 and 861 respectively . in other embodiments , the finger pads , such as finger pad 131 , are replaced with finger pads that have resistive members forming the tip , and conventional mating finger springs , such as lead 141 , are used to form an improved connection . turning now to fig1 , there is presented in 1100 an exemplary process for providing a charge dissipation path used during connection of an electrical device . this process will be described in relation to exemplary application depicted in fig9 , using an improved barrel receptacle , such as lead 210 , and a conventional plug 120 . at 1110 , a resistive member , such as resistive member 216 , is physically coupled to a conductive member , such as conductive member 211 , to form a first lead , such as lead 210 . the physical coupling method used could be physical compression , adhesion , insertion , or screw - type . at 1120 , the improved connector 210 is joined to a component , such as a battery 701 by forming a solder joint between lead 703 so that receptacle 710 is an improved receptacle lead , such as lead 210 . a mating connector , such as lead 120 is joined to a component 702 , such as an esc by forming a solder joint between lead 705 and conductive interface 122 . if desired , a piece of insulating shrink tube 249 is cut to cover lead 703 and connector lead 710 , and heat is applied to shrink tube 249 to form an insulating jacket , such as jacket 218 . excess shrink tube is trimmed away , especially that which might obstruct the opening of the connector lead 710 . if desired , a second resistive member , such as resistive member 216 , is coupled to a second conductive member , such as conductive member 211 , to form a second improved barrel receptacle , such as lead 210 . alternatively a conventional receptacle 110 is used . at 1160 , second receptacle , such as lead 210 , is joined to lead 704 by forming a solder joint to conductive interface 212 , so that receptacle 720 is an improved lead , such as lead 210 . at 1170 , a mating lead , such as lead 120 , is joined through a solder joint to a lead 706 and thus joined to a device such as esc 702 and to a component such as capacitor 750 . a piece of shrink tube is installed for lead 720 as described above . if desired , an insulating guide , such as guide 844 , is physically mounted to leads 703 and 704 to hold the leads at a fixed separating distance during connection , and an insulating guide , such as guide 134 , is physically mounted to leads 705 and 706 to hold the leads at approximately the same fixed separating distance during connection . if desired , the insulating guide 844 is surrounded by a second chassis ground shield , such as shield 842 , and insulating guide 134 is surrounded by a second chassis ground shield , such as shield 132 . at 1195 , second lead 720 is connected to lead 740 . at 1190 first lead 710 is connected to lead 730 . embodiments of steps 1190 and 1195 occur in reverse order . embodiments of steps 1190 and 1195 occur at approximately the same time . the description here covers variations in this process including , for example , switching components so that barrel 210 is attached to lead 705 and plug 120 is attached to lead 703 , using any improved lead plug and mating lead receptacle , or using any improved connector assembly that includes an improved lead . the present invention has been described in relation to particular embodiments , which are intended in all respects to be illustrative rather than restrictive . alternative embodiments will become apparent to those of ordinary skill in the art to which the present invention pertains without departing from its scope . from the foregoing , it will be seen that this invention is one well adapted to attain all the ends and objects set forth above , together with other advantages which are obvious and inherent to the system and method . it will be understood that certain features and subcombinations are of utility and may be employed without reference to other features and subcombinations . this is contemplated by and is within the scope of the claims . | 7 |
a preferred embodiment of the present invention will be described herein below with reference to the accompanying drawings . for the purpose of clarity , well - known functions or constructions are not described in detail as they would obscure the invention in unnecessary detail . fig1 illustrates a network for an inter - msc soft hand - off ( imsho ) applied to the present invention . in fig1 the two routers 8 , which are interfaced with their respective global communication interconnection networks ( gcins ), are provided to the existing cdma network and connected to each other over a trunk , thus enabling the communication between two base station subsystems ( bsss ) each belonging to a different mobile switching center ( msc ). the bss includes a global communication interconnection network ( gcin ) 2 , a local communication intercommunication network ( lcin ) 3 , a bts ( base station transceiver system ) communication intercommunication network ( bcin ) 6 , a call control processor ( ccp ) 5 , a bts control processor ( bcp ) 7 , and a transcoder & amp ; selector bank ( tsb ) 4 . the two routers 8 are interfacing each other over an unchannelized e 1 or t 1 trunk . fig2 illustrates a block diagram of the router in accordance with the present invention . as shown in fig2 the router 8 includes a router main control board assembly ( rmca ) 8 a , a router channel card assembly ( rcca ) 8 b and a pcm interface e 1 board assembly ( piea ) 8 c . the rmca 8 a performs the u_link ( rs - 422 ) interfacing function , the high - level data link control formatting / deformatting function , and the packet routing function . the rcca 8 b performs the crc ( cyclic redundancy check ) function and the data transmission function . the piea 8 c performs the trunk interfacing function and the clock processing function . a multi - link communication path is provided between the routers 8 , and each router examines in real time whether each path has an obstacle in relation to the other router , to transmit the packet data over the available link only . each router can be interfaced with several other routers . the link configuration information for determining the router link among the routers is received from a base station modulator ( bsm ) 1 . using the link configuration information from the bsm , it is possible to perform the routing function of the packet data . a description will be made of the data configuration and the management of the imsho . the link configuration connected between the routers 8 is divided into a network id ( identification ) and a link id . this link configuration information is managed as static data in the base station modulator ( bsm ) 1 and provided to a router 8 to perform the packet router function , and the configuration information is updated each time the router 8 is initialized . further , if a hand - off occurs between the two cells each belonging to a different network id , the ccp 5 of the anchor side consults the neighbor data . if the hand - off type between the two cells is set so that the communication path is formed through the router 8 the ccp 5 performs the imsho process . by adding the hand - off type to the neighbor data , the ccp 5 determines whether to perform the imsho process or an imhho ( inter - msc hard hand - off ) process . meanwhile , the router 8 constantly monitors the state of the link to determine whether the link is available . when all the links connected to the router 8 of the other network are unavailable , this information is provided to the ccp 5 so that even though the hand - off type is set to the imsho the ccp 5 can perform the inter - msc hard hand - off ( imhho ). fig3 shows a graph illustration where the mobile station 11 travels from the present anchor cell to the adjacent target cell , thus requiring the imsho . a description will be now made of the procedure for performing the imsho function with reference to fig3 . when the mobile station ( ms ) 11 travels to the adjacent cell during a call connection , a transcoding selector bank ( tsb ) 4 sends a hand - off request message to the ccp 5 depending on a pilot included in a candidate set , upon receipt of a pilot strength measurement message ( psmm ). upon the receipt of the hand - off request , the ccp 5 consults the neighbor list data to send an imsho request message to the ccp 5 , if the adjacent cell is set to the imsho hand - off type and the link between the routers having the network id of the target cell is available . upon the receipt of the imsho request message , the target ccp 5 sends the information about the traffic channel element ( tce ) id received from the target bcp 7 and the hand - off allocation information to the anchor ccp 5 , which has requested the imsho hand - off . the anchor ccp 5 informs the anchor tsb 4 that the tce of the target side is allocated , and the anchor tsb 4 performs the time sync process between the anchor tce and the target tce and then transmits a hand - off direction message ( hdm ) to the mobile station 11 . further , the anchor tsb 4 performs a mobile station acquisition process and then receives a hand - off completion message ( hcm ) from the mobile station , then provides the received hcm to the ccp 5 to complete the imsho process . fig4 shows a procedure for performing the imsho function in accordance with the present invention . as shown in fig4 a mobile station ( ms ) of the anchor side transmits a “ pilot strength measurement message ” ( psmm ) to a transcoder & amp ; selector bank ( tsb ) of the anchor side , in step s 1 . the tsb of the anchor side then transmits a “ hand - off request message ” to a call control processor ( ccp ) of the anchor side , in step s 2 . the ccp of the anchor side then transmits an “ imsho request message ” to a ccp of the target side , in step s 3 . the ccp of the target side then transmits the “ hand - off request message ” to a bts control processor ( bcp ) of the target side , in step s 4 . the bcp of the target side then transmits a “ tce allocation request message ” to a channel element ( ce ) of the target side , in step s 5 . the ce of the target side then transmits a “ tce allocation response message ” to the bcp of the target side , in step s 6 . the bcp of the target side then transmits a “ hand - off allocation response message ” to the ccp of the target side , in step s 7 . the ccp of the target side then transmits an “ imsho allocation response message ” to the ccp of the anchor side , in step s 8 . the ccp of the anchor side then transmits a “ hand - off allocation response message ” to the tsb of the anchor side , in step s 9 . the tsb of the anchor side then transmits a “ soft hand - off operation message ” to the ce of the anchor side , in step s 10 . the ce of the anchor side then transmits a “ response control message ” to the tsb of the anchor side , in step s 11 . the tsb of the anchor side then transmits a “ time sync message ” to the ce of the target side in step s 12 . the ce of the target side transmits the “ time sync message ” to the tsb of the anchor side , in step s 13 . the ce of the target side then transmits a “ time sync completion message ” to the bcp of the target side , in step s 14 . the ce of the anchor side then transmits a “ soft hand - off active message ” to the bcp of the anchor side in step s 15 . the tsb of the anchor side then transmits a “ hand - off direction message ” ( hdm ) to the mobile station of the anchor side , in step s 16 . the tsb of the anchor side then transmits a “ mobile station reception message ” to the ce of the target side , in step s 17 . the ce of the target side transmits a “ mobile station reception response message ” to the tsb of the anchor side , in step s 18 . the mobile station of the anchor side then transmits a “ hand - off completion message ” ( hcm ) to the tsb of the anchor side , in step s 19 . the tsb of the anchor side then transmits a “ hand - off notice message ” to the ccp of the anchor side , in step s 20 . as described above , the invention performs the soft hand - off between the cells each belonging to a different mobile switching center by using a router . therefore , it is possible to maintain a stable call connection for a roaming mobile station , thus enhancing the service quality of the system . while the invention has been shown and described with reference to a certain preferred embodiment thereof , it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and the scope of the invention as defined by the appended claims . | 7 |
turning now to the drawings , and referring first to fig1 , an enclosure 10 is illustrated on which a multi - latch compatible system 12 is installed . the enclosure may be any suitable type and size . in the illustrated embodiment , for example , the enclosure may house an industrial motor control center . the enclosure generally includes a shell 14 which , in the illustrated embodiment , is divided into compartments 16 , each having a corresponding door 18 . the doors 18 may be opened and closed to gain access to an interior volume 20 . it should be noted that the present techniques are in no way limited , however , to any particular enclosure type or style . the invention will find application with enclosures made of conventional sheet metal , but may also be used with fiberglass enclosures , plastic enclosures , and so forth . the multi - latch compatible system described below may also be suitable for enclosures with a single door or with multiple doors and compartments . similarly , the system may be used with enclosures designed to house both power electronic components , with or without data ( e . g ., computer ) components , or with data components alone . finally , the enclosure may be of a sealed type , or may be vented and unsealed , as desired . in the embodiment illustrated , enclosure 10 further includes a wireway 22 over which a door 24 may be closed . as will be appreciated by those skilled in the art , electrical system components are typically disposed within the interior volume 20 of the compartments , while power and communication wiring may be routed through the wireway . in the embodiment illustrated in fig1 , each door , such as open door 26 , is provided with latches that interface with the multi - latch compatible system 12 to hold the doors closed . as described in greater detail below , door 26 , for example , is provided with pin - type latches 28 . other doors may be provided with plate - type latches 30 . many such latches are known and are commercially available . in general , the present system permits multiple different types of latches to be provided on the doors , while all interfacing with the same multi - latch compatible system 12 installed in the enclosure shell . as shown in fig1 , and as described in greater detail below , the system 12 generally includes a rail structure 32 that may be installed as an insert in the enclosure shell . the rail structure itself will include surfaces , apertures , and mechanical structures for receiving and interfacing with multiple different latch types . in the illustrated embodiment , for example , the rail structure has a rail 34 through which apertures are formed . behind these apertures 36 , the rail 34 has openings ( described below ) for receiving pin - type latches . a plate or rail 38 is also included in the rail structure for interfacing with plate - type latches . it may also be noted that in the illustrated embodiment , extensions 40 are provided on the rail structure ( described in greater detail below ) for accommodating latches for the wireway door 24 . all of the latches may thus be accommodated by a single assembly fixed within the enclosure shell . fig2 illustrates an exemplary configuration of the system of fig1 for accommodating a pin - type latching device . as shown in fig2 , the rail structure 32 of the system includes a front plate 42 through which apertures 36 are formed . behind plate 42 , and accessible through aperture 36 , rail 34 presents an aperture 44 designed to receive the pin of a pin - type latch . in the illustrated embodiment , the aperture 44 has a central portion 46 flanked by elongated wings 48 . as will be appreciated by those skilled in the art and familiar with pin - type latches used in industry , an exemplary pin - type latch as shown in fig2 has a central pin or shank 50 designed to be loaded in tension when the enclosure is closed . the pin in the illustrated embodiment receives a roll pin 52 near its extremity . the roll pin is loaded , when latched , in double shear against a rear surface of the rail 34 . a spring 54 is disposed around the pin 50 between the outer surface of the enclosure door ( as shown in dashed lines in fig2 ) and a head 56 of the pin . to latch the door , then , the pin is rotated such that the roll pin 52 aligns with wings 48 of the aperture 44 , and the spring is depressed to permit the roll pin to clear the rail 34 . the pin is then rotated to block the roll pin 52 behind the rail 34 . it should also be noted that the roll pin may be lodged within recesses formed in the rail to aid in retaining the roll pin in position behind the rail 34 against the force of spring 54 . also , a seal ( not shown ) may be provided on the pin at a point where the pin penetrates through the door of the enclosure . fig3 shows the same system used with a plate - type latch mechanism . as shown in fig3 , the plate - type latch 30 includes a generally z - shaped plate 58 that presents a tongue or extension 60 for latching the door . a pin or bolt 62 is secured to the latch plate and has a shank 64 , one or more sides of which presents a flat 66 . an aperture in the latch plate receives the shank of the pin , with the flat 66 mating with a corresponding flat in the latch plate . at an outer end , the pin has a head 68 , and at an opposite end a threaded tip ( no shown ) on which a fastener 70 is secured . the latch plate will typically abut a shoulder ( not specifically shown in fig3 ) on the pin to securely hold the latch plate in position on the pin once the fastener is anchored onto the end of the pin . as in the previous arrangement , a seal may be provided on the pin at a point where the pin will traverse a door of the enclosure . for closing the arrangement of fig3 , the tongue 60 of the latch plate will be positioned in a vertical orientation such that the latch plate will freely traverse the aperture 36 in front plate 42 . once the door is closed and the plate is past the rear surface of front plate 42 , the pin may be rotated to secure the latch plate extension 60 behind the side plate 38 ( as shown in dashed lines in fig3 ). fig4 illustrates a portion of the multi - latch compatible system 12 embodied as an insert to be secured within the shell of an enclosure . as mentioned above , the insert generally forms a rail structure 32 that may span several compartments of a multi - compartment enclosure . the rail structure illustrated is formed of a main rail 72 which may be made of sheet metal that is stamped and bent to form the front plate 42 . apertures 36 are also punched or cut into the main rail prior to bending . the main rail thus presents a side panel 74 which may be provided with rungs 76 or similar structures that aid in supporting other components , shelves , and so forth ( not shown ), within the enclosure . as illustrated in fig4 , the bent front plate 42 thus presents a series of apertures 36 , seen from the rear in fig4 . the rail 34 designed to accommodate the pin - type latch mechanisms is , in the illustrated embodiment , added as a separate component . in the present embodiment this rail also is stamped from sheet metal and apertures 36 are cut at the time of formation of the rail . tabs 78 are provided at locations of the rungs 76 of the main rail 72 . these tabs permit the rail 34 to be welded to the main rail 72 during assembly , or attached by means of fasteners ( e . g ., screws , bolts or rivets ). various other rails and structures may be provided in the system . for example , in the illustrated embodiment , a stiffening member 80 is also welded to the side panel 74 of the mail rail 72 . such members may further facilitate securement of panels , shelves , and other structures ( not shown ) within the enclosure . fig5 and 6 are additional views of the rail structure both before and after installation in an enclosure . both views illustrate the main rail 72 described above , with its side panel 74 . the rungs 76 are again shown as they may be disposed within the enclosure for supporting internal components . the illustrated views of fig5 and 6 also show the extension 40 which is provided as part of rail 34 , and may in the illustrated embodiment facilitate latching of a wireway door . fig7 and 8 illustrate the foregoing multi - latch compatible system in place for holding a door closed on an enclosure with both a pin - type latch mechanism and a plate - type mechanism , respectively . as shown in fig7 , once latched , the pin 50 of mechanism 28 extends through the aperture 44 in rail 34 . the pin is illustrated as it would rotated to cause roll pin 52 to abut a rear surface of the rail 34 . it should also be noted that both the pin and the accompanying roll pin may be freely inserted through aperture 36 in the plate 38 . the biasing spring 54 then holds the pin in tension and the roll pin in double shear . a flange of the front door 26 abuts the front surface of plate 38 as shown . where desired , a seal or gasket ( not shown ) may be provided , such as between the plate 38 and the flange of door 26 . as illustrated in fig8 , when a latch plate - type latch is employed , rail 34 generally does not come into play . rather , the tongue 60 of the latch plate 58 is rotated behind the plate 38 of the rail structure and abuts the rear plate to hold the assembly tightly in engagement . again , a flange of door 26 then abuts the front surface of plate 38 , where a gasket may be provided , where desired . seals , o - rings , or other compression members may also be provided between the head 68 of the latch pin 62 and a front surface of the door 36 . while only certain features of the invention have been illustrated and described herein , many modifications and changes will occur to those skilled in the art . it is , therefore , to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention . | 4 |
the present invention will become clear from the following description of the preferred embodiment with reference to the accompanying drawings . fig1 is an external view of a fundus camera . on a base 1 containing a circuit board and electrical components , a stage 2 is mounted in a horizontally movable manner . on the stage 2 , a main unit 3 is mounted in a vertically movable manner . on the base 1 , a chinrest 4 for holding the chin of a subject s and a headrest 5 are provided . an examiner who wants to take a photograph operates a joystick 6 , which is provided on the stage 2 , to adjust the positional relationship between the main unit 3 and the subject &# 39 ; s eye e . fig2 is a diagram of the optical system and the electrical system in the fundus camera 3 . in front of the subject &# 39 ; s eye e , an objective lens 11 , an apertured mirror 12 , a photographic diaphragm 13 disposed in the aperture of the apertured mirror 12 , a focus lens 14 which is movable along the optical axis , a photographic lens 15 , and an optical - path branching prism 16 are sequentially disposed . in the reflecting direction of the optical - path branching prism 16 , a lens 17 , a mirror 18 , a lens 19 , a color separation prism 20 , and image pickup elements 21 r , 21 b , and 21 g are provided . the color separation prism 20 directs infrared light and red light toward the image pickup element 21 r , blue light toward the image pickup element 21 b , and green light toward the image pickup element 21 g , thus forming a fundus photographing unit . in the transmission direction of the optical - path branching prism 16 , a liquid crystal display ( lcd ) 22 functioning as an internal fixation target and a backlight unit 23 are disposed to form an internal fixation target presenting unit . in the incident direction of the apertured mirror 12 , a relay lens 24 , a diaphragm 25 having a ring aperture , a stroboscopic light source 26 for emitting flashes , a wavelength selection filter 27 for blocking visible light and transmitting infrared light , which can be freely inserted into and removed from the optical path , a condenser lens 28 , and an observation light source 29 , such as a halogen lamp , for emitting fixed light including visible light and infrared light , are disposed . these components , together with the apertured mirror 12 and the objective lens 11 , form a fundus illuminator . on both sides of the photographic diaphragm 13 , end faces of fibers 30 a and 30 b are disposed . light sources 31 a and 31 b are disposed on an end face opposite to the photographic diaphragm 13 . the end face at which the photographic diaphragm 13 is provided functions as a mark for adjusting the working distance . the mark is disposed at a position at which an image reflected from the cornea can be substantially conjugate to the fundus er when the distance between the objective lens 11 and the cornea of the subject &# 39 ; s eye e is appropriate . the outputs of the image pickup elements 21 r , 21 b , and 21 g are connected to an image control circuit 42 via a signal amplifier circuit 41 for amplifying electrical signals . a television monitor 43 , an image recorder 44 , and a controller 45 with a memory 45 a are connected to the image control circuit 42 . the image recorder 44 is a drive for writing images to and reading images from a recording medium d , such as an mo ( magneto - optical disk ), an md ( mini disk ), a dvd - ram ( digital versatile disk - random access memory ), a vcr ( videocassette recorder ) tape , or a hard disk , which can store and maintain information without an external power supply . the lcd 22 , the observation light source 29 , a photographic switch 36 , an operation unit 47 for specifying the position at which the fixation target is presented , a stroboscopic flash controller 48 for controlling the stroboscopic light source 26 , a light control unit 49 for controlling the light intensity of the observation light , the light control unit 49 including switches 49 a and 49 b and a display unit 49 c , and a detector switch 50 for detecting the position of the main unit 3 , are connected to the controller 45 . in the lcd 22 , cells which can control the transmission and blocking of light are arranged in the form of matrix . the lcd 22 functions as a fixation target when the backlight unit 23 is observed through a light transmitting portion of the lcd 22 . the backlight unit 23 includes a plurality of leds ( light emitting diodes ). the position of the light transmitting portion of the lcd 22 , that is , the fixation target , is controlled by the operation unit 47 for specifying the position at which the fixation target is presented . in other words , the examiner who wants to take a photograph operates four switches 47 a , 47 b , 47 c , and 47 d of the operation unit 47 to lead the subject &# 39 ; s visual axis to an arbitrary position . the light transmitting portion of the lcd 22 is presented at a position where the center of the line between the optical disk and the macula lutea becomes substantially the center of the screen when the subject &# 39 ; s eye e is fixed on the fixation target . it is assumed that the subject &# 39 ; s eye e under examination is the left eye and a photograph is taken using the fundus camera . the examiner who wants to take a photograph asks the subject s to sit in front of the fundus camera and to position his or her chin on the chinrest 4 and his or her forehead against the headrest 5 . the examiner operates the joystick 6 to position the main unit 3 in front of the subject &# 39 ; s eye e . fig3 shows a position detector . the height of an upper portion 1 a of the base 1 differs in the horizontal direction . due to the difference in height , the detector switch 50 is turned on and off . thus , it is possible to detect the position of the main unit 3 , that is , it is possible to detect whether the main unit is at the left or at the light , and hence it can be detected whether the subject &# 39 ; s eye e is the left eye or the right eye . in other words , when the controller 45 detects , for example , that the main unit 3 is at the position of the left eye using the detector switch 50 , the controller 45 presents a fixation target for capturing an image of the left eye . when the examiner observes the subject &# 39 ; s eye e , a light beam emitted from the observation light source 29 is focused by the condenser lens 28 , and the wavelength selection filter 27 disposed in the optical path only transmits infrared light . the transmitted light passes through the stroboscopic light source 26 , the diaphragm 25 , and the relay lens 24 , and the light is reflected to the left by the peripheral mirror portion of the apertured mirror 12 . the reflected light passes through the objective lens 11 and the pupil ep of the subject &# 39 ; s eye e and illuminates the fundus er . an image of the fundus er , which is illuminated by infrared light , again passes through the objective lens 11 , the photographic diaphragm 13 , the focus lens 14 , and the photographic lens 15 and is reflected upward by the optical - path branching prism 16 . the reflected image passes through the lens 17 and is reflected to the left by the mirror 18 , and the reflected image enters the color separation prism 20 through the lens 19 . the image is formed at the image pickup element 21 r for the red and infrared light and is converted into an electrical signal . the signal passes through the signal amplifier circuit 41 and is amplified by a predetermined factor . the amplified signal is input to the image control circuit 42 and displayed on the television monitor 43 . fig4 illustrates the apertured mirror 12 viewed from the objective lens 11 . light emitted from the light sources 31 a and 31 b enters the fibers 30 a and 30 b , and the end face at which the photographic diaphragm 13 is provided is illuminated with this light . an image of this end face is formed by the objective lens 11 substantially at the midpoint between the apex of the cornea ec of the subject &# 39 ; s eye e and the center of the corneal curvature . if the working distance between the subject &# 39 ; s eye e and the objective lens 11 is appropriate , an image of the marks reflected from the cornea , which is formed by the fibers 30 a and 30 b , is formed substantially conjugate to the fundus er . in other words , the image reflected from the cornea passes through the objective lens 11 , the photographic diaphragm 13 , the focus lens 14 , and the photographic lens 15 and is reflected upward by the optical - path branching prism 16 . the reflected image is formed in the vicinity of the lens 17 , and the image is reflected to the left by the mirror 18 . similar to the image of the fundus , this image reflected from the cornea is formed at the image pickup element 21 r through the lens 19 . fig5 a shows an image of the fundus ( fundus image ) er ′ in which reflected images ra and rb , formed by the cornea ec , of the marks are displayed on the television monitor 43 . the controller 45 displays reference marks lma and lmb for alignment , which are stored in the memory 45 a and which are used to take a photograph of the left eye on the television monitor 43 . the center of the reference marks lma and lmb is decentered to the right with respect to the center of the fundus image er ′ by approximately six degrees . having observed the fundus image er ′ and the images reflected from the cornea ra and rb , the examiner operates the joystick 6 so that the reflected images ra and rb are placed inside the reference marks lma and lmb and the contrast of the reflected images ra and rb is maximized . after confirming that the photographic range , positions , and focusing are satisfactory , the examiner operates the photographic switch 36 and captures a still image . the controller 45 detects that the photographic switch 36 is operated and emits light from the stroboscopic light source 26 via the stroboscopic flash controller 48 . the light emitted from the stroboscopic light source 26 passes through the ring aperture of the diaphragm 25 and the relay lens 24 and is reflected to the left by the peripheral mirror portion of the apertured mirror 12 . the reflected light passes through the objective lens 11 and the pupil ep of the subject &# 39 ; s eye e , and the fundus er is illuminated with this light . the illuminated fundus image er ′ again passes through the objective lens 11 , the photographic diaphragm 13 , the focus lens 14 , and the photographic lens 15 , and the image er ′ is reflected upward by the optical - path branching prism 16 , which is disposed in the optical path . the reflected image er ′ passes through the lens 17 and is reflected to the left by the mirror 18 . the image er ′ passes through the lens 19 and enters the color separation prism 20 . the image is formed at the image pickup elements 21 r , 21 b , and 21 gb and converted into an electrical signal . the signal is amplified by the signal amplifier circuit 41 by a predetermined factor , and the amplified signal is input to the image control circuit 42 . using the amplified signal and presentation position information for the fixation target , the image recorder 44 records a color fundus image in the recording medium d , and the recorded image is displayed on the television monitor 43 . in order to capture an image when the subject &# 39 ; s eye e under examination is the right eye , the examiner operates the joystick 6 and moves the main unit 3 including the optical system to be in front of the right eye . accordingly , the detector switch 50 for detecting whether the left eye or the right eye is to be examined is turned off . having detected that the detector switch 50 has been turned off , the controller 45 presents a fixation target for the right eye and displays reference marks rma and rmb for right - eye alignment , which are stored in the memory 45 a , on the television monitor 43 . as shown in fig5 b , the center of the reference marks rma and rmb is decentered to the left with respect to the center of the fundus image er by approximately six degrees . as described above , the fundus er is illuminated with infrared light emitted from the observation light source 29 . the illuminated fundus image er ′ and the reflected images of the marks ra and rb , which are formed by illuminating the cornea ec by the light sources 31 a and 31 b , are displayed on the television monitor 43 . as described above with reference to fig5 b , the examiner operates the joystick 6 to position the main unit 3 in accordance with the subject &# 39 ; s eye e so that the reflected images ra and rb can be symmetrically placed inside the reference marks rma and rmb and the contrast of the reflected images ra and rb can be maximized . after confirming that the photographic range , positions , and focusing are satisfactory , the examiner operates the photographic switch 36 and captures a still image . having detected that the photographic switch 36 is operated , the controller 45 controls the stroboscopic light source 26 to emit light so that the fundus er can be illuminated with visible light . the illuminated fundus image er ′ again passes through the objective lens 11 , the photographic diaphragm 13 , the focus lens 14 , and the photographic lens 15 and is reflected upward by the optical - path branching prism 16 . the reflected light passes through the lens 17 and is reflected to the left by the mirror 18 . the reflected light enters the color separation prism 20 , and an image is formed at the image pickup elements 21 r , 21 b , and 21 b . the image is converted into an electrical signal , and the electrical signal is amplified by the signal amplifier circuit 41 by a predetermined factor . the amplified signal passes through the image control circuit 42 and is recorded by the image recorder 44 as a color fundus image in the recording medium d . the image is displayed on the television monitor 44 , and the image capturing process is terminated . while the present invention has been described with reference to what are presently considered to be the preferred embodiments , it is to be understood that the invention is not limited to the disclosed embodiments . on the contrary , the invention is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims . the scope of the following claims is to be accorded the broadest interpretation so as to encompass all such modifications and equivalent structures and functions . | 0 |
referring now to fig1 and 2 , there is shown a towed farm implement 10 configured as a mowing machine , which is drawn over a field during its operation by an undepicted towing vehicle , e . g ., an agricultural tractor , and can be transported on the roadway between periods of operation . the invention is specifically employable in the case of machines 10 that are longitudinally transportable on the roadway and have a transport width no greater than three meters . the machine 10 , described below in greater detail , is adapted for being positioned on a trailer 22 ( fig3 ). the machine 10 can also be designed as a tiller / cultivator , as a planter as a harvester , or the like . the machine 10 includes a main frame 12 supported on ground wheels 14 for being towed across a field by a draft tongue 16 . when viewed in the direction of advance , the frame 12 extends over the entire width of the machine 10 and has the shape of an inverted “ u ”, with the tools 18 , e . g ., a cutter bar , being supported from the frame 12 in the open space of the “ u ”. opposite sides of the frame 12 are defined by upright legs 24 , and a wheel arm 30 is pivotally mounted to the lower end of each leg 24 , as at a joint 34 , for being adjusted vertically by an adjustment mechanism 32 , and mounted to each wheel arm 30 is one of the wheels 14 . the adjustment mechanism 32 is designed as a simply functioning hydraulic actuator , which is pivotably engaged at one end with the arm 24 and at the other end with the wheel arm 30 . when the adjustment mechanism 32 is charged with hydraulic fluid or the charge is released , the wheel arm 30 pivots vertically and thus changes the position of the wheel 14 in relation to the frame 12 , which results in a change of the frame &# 39 ; s distance above the ground surface contacted by the wheels 14 . the tongue 16 represents the connection between the frame 12 and the towing vehicle , and engages the frame 12 via a joint 26 so as to be horizontally pivotable . while the joint 26 can be located on the side of the frame 12 , its preferred location is in the middle of the frame . the length of the tongue 16 is dimensioned such that it projects appreciably beyond the side edge of the frame 12 when it is positioned transversely to the normal working direction of the machine 10 . this permits the machine 10 to be towed endwise behind the towing vehicle by the draft tongue 16 . provided between the tongue 16 and the frame 12 is a hydraulically actuated adjustment mechanism 28 that is operated from the driver &# 39 ; s seat of the towing vehicle . by means of such a known adjustment mechanism 28 , the machine 10 can be variably positioned in relation to the towing vehicle . with regard to a possible embodiment form of the adjustment mechanism , reference may be made to u . s . pat . no . 5 , 642 , 607 , granted jul . 1 , 1997 . the tools 18 in this embodiment are configured as a cutter bar with several rotating mower blades . the position of the tools 18 during operation of the machine 10 is adapted in each case to the variable harvesting conditions . within an operating range , the tools 18 can be progressively adjusted between a position directly on the ground and a position in which the tools assume a height above the ground , e . g ., of 0 . 4 m . the implement 10 , thus far described , is conventional . shown in fig1 and 2 is a first embodiment of a lift mechanism 20 comprising a swinging arm 36 and an auxiliary wheel 38 mounted to each end of the frame 12 . it is the job of the lift mechanism 20 to elevate the implement 10 a sufficient distance above the ground for being loaded onto the trailer 22 . each swinging arm 36 is designed similarly to the wheel arm 30 and is articulately joined at a lower end of the associated frame leg 24 , rotationally bears the auxiliary wheel 38 at its trailing end , and is connected in between to an adjustment mechanism 40 . the swinging arms 36 are connected at the joint 34 on the outside of the leg 24 . depending upon the position and the size of the wheel 14 , the swinging arm 36 is laterally offset in order to achieve sufficient clearance for a vertical pivoting movement . however , such an offset can be avoided when the wheel 14 is of narrow design or is laterally offset inwardly . while not an absolute necessity , provision is made in this embodiment for the swinging arm 36 to extend to the rear appreciably beyond the wheel arm 30 . the further the swinging arm 36 projects out beyond the wheel arm 30 , the greater is the transport lift range achievable with it . the auxiliary wheel 38 is made smaller than the wheel 14 , since it is required only for the purpose of loading the machine 10 onto the trailer 22 , and is not subjected to the stresses of rough operation in the field . each auxiliary wheel 38 is provided as closely as possible to the projecting end of the swinging arm 36 . unlike the wheel 14 , the auxiliary wheel 38 does not need not be a rubber tire but can instead be fashioned as a steel wheel . in one case , wherein the machine 10 is not driven over the trailer 22 but is merely lifted to a height above the latter , it is sufficient for the swinging arm 36 to be equipped with a foot instead of an auxiliary wheel 38 , with the machine 10 then being supported on the ground by the foot . the adjustment mechanism 40 is designed as a hydraulic actuator , which in each case is pivotably engaged at one end to the leg 24 of the frame 12 , and at the other end to the swinging arm 36 . in this embodiment , the adjustment mechanism 40 is double - acting , ensuring that the auxiliary wheel 38 can be pivoted far enough upward that it does not roll on the ground in an inoperative state . if this criterion does not matter , a single - acting adjustment mechanism 40 is sufficient . alternatively , a single - acting adjustment mechanism 40 could be used that is adjusted , for example , by means of hydraulic fluid in one direction and by means of a spring or the like in the other direction . this adjustment mechanism 40 , like the adjustment mechanism 28 for the wheel 14 , is charged with a pressure medium by an undepicted hydraulic system comprising a pump , line , valves , and other known system components . a withdrawal or retraction of the adjustment mechanism 40 causes the swinging arm 36 of the auxiliary wheel 38 to pivot upward until the auxiliary wheel 38 lifts off the ground . an extension of the adjustment mechanism 40 results in the swinging arm 36 and the auxiliary wheel 38 being pivoted downward , or in the clockwise direction as seen in the drawing , and in fact until the wheel 14 lifts off the ground and the frame 12 achieves the required clearance above the ground . the lift mechanism 20 is provided on each side of the frame 12 , i . e ., on each leg 24 . referring now to fig3 it can be seen that the trailer 22 comprises a platform 42 , an axle 44 and wheels 46 . the length of the platform 42 is such that on the one hand it is possible for the machine 10 to be lowered onto it , while on the other hand , it can fit between the auxiliary wheels 38 . the platform , 42 is provided with various depressions , hollows , etc ., that make it possible for the machine 10 to be lowered onto it such that its position does not shift during transport . locking devices , as already known , can also be provided as necessary . the depicted trailer 22 has only a single axle 44 , equipped with two wheels 46 , which is located in the middle of the platform 42 . in order for the platform 42 to have an essentially horizontal orientation while the machine 10 is loaded , undepicted supports or the like can be provided . alternatively , two axles 44 can be provided in place of the single axle 44 . if the lift mechanism 20 is sufficient for an adequate lift height , the machine 10 can also be set onto the platform 42 when the latter is tilted , wherein the placement of the machine 10 will then force the platform 42 into a horizontal position . the wheels 46 are rotationally mounted on the axle 44 and are kept as small as possible in order that the lift range of the lift mechanism 20 need not be made too large . one proceeds from the assumption that the trailer 22 is so positioned that the machine 10 can be driven onto it transversely to its longitudinal extension . furthermore , the machine 10 is located behind a towing machine in an elevated position , in which the adjustment mechanism 32 of the wheel 14 is fully extended and the frame 12 is at the upper limit of its operating range . in order to load the machine 10 onto the trailer 22 , it must be maneuvered onto the platform 42 transversely to the longitudinal direction of the latter and the adjustment mechanism 40 is actuated such that it extends outward . as a result of the extension of the adjustment mechanism 40 , the auxiliary wheels 38 touch the ground , and when the adjustment mechanism 40 extends still further , lift the frame 12 still higher . the actuation of the adjustment mechanism 40 is continued until the frame 12 or the tools 18 assume a position above the ground corresponding to the maximal height of the trailer 22 . subsequently , the machine 10 is advanced still further onto the trailer 22 until the trailer 22 or its platform 42 is positioned between the auxiliary wheels 38 , and the wheels 14 and / or the tools 18 are above the platform 42 . then the adjustment mechanisms 40 are released , so that the frame 12 descends until it rests on the platform 42 . then the adjustment mechanisms 40 are retracted still further until they are lifted off of the ground . in the event locking mechanisms are provided between the machine 10 and the trailer 22 , they are then engaged . finally , the adjustment mechanism 28 of the hitch 16 is actuated , so that the machine 10 together with the trailer 22 is pivoted horizontally around the joint 26 and ultimately comes to rest longitudinally behind the towing vehicle . a second embodiment of the invention of the invention is described below , with reference to fig4 through 7 . the lift mechanism 20 according to this embodiment has a swinging arm 30 ′ for the wheel 40 , which has a curved segment 48 on its free end , i . e ., the end remote from the leg 24 , which , proceeding from the wheel arm 30 ′, ranges counterclockwise through nearly 90 ° with a constant radius about the joint 34 between the arm 30 ′ and the leg 24 . the connection of the curved segment 48 to the remainder of the arm 30 ′ can be in one piece as a forged part , or can be detachable by means of a bolted connection . the curved segment 48 is provided with radially extending lower and upper bored holes 50 and 52 , respectively , these holes been shown only in fig4 . as can also be seen in fig4 a further lifting arm 36 ′ is shown connected for movement with the wheel arm 30 ′ through the agency of a locking bolt 54 , here shown inserted in the lower bored hole 50 , so that the lifting arm 36 ′ is moved together with the wheel arm 30 ′ when the latter is swung by the adjustment mechanism 32 . the lifting arm 36 ′ is constructed of parallel , spaced straps defining an intervening open space in which the curved segment 48 of the arm 30 ′ fits , with the straps being on the opposite sides of the leg 24 and vertically pivotable at the joint 34 . the locking bolt 54 can be designed in the simplest form as a mechanical closure actuated , e . g ., by means of a pull cable . in the illustrated embodiment , the locking bolt 54 is designed as a remotely actuated hydraulic cylinder , which is connected to an undepicted manner to a hydraulic system of the towing vehicle or the machine 10 . the locking bolt 54 is located between the straps of the swinging arm 36 and includes a cylinder 56 and a piston rod 58 displaceable therein . the locking bolt 54 extends in the direction of the swinging arm 36 in such a way that the piston rod 58 moves radially towards the curved segment 48 and can therefore enter the lower or the upper bored holes 50 and 52 . accordingly , the rod 58 of the double - acting locking bolt 54 can be selectively inserted in one or the other of the opposite end portions of the curved segment 48 so as to join both swinging arms 30 ′ and 36 ′ positively together in different positions and thereby ensure a common movement . the illustrations in fig5 through 7 will now be discussed . in the configuration depicted in fig5 the locking bolt piston 58 is located in the upper bored hole 52 and , because the swinging arm 30 ′ is in an upper position , the swinging arm 36 ′ is also in an upper position , in which the auxiliary wheel 38 does not touch the ground . in this configuration , the machine 10 can be operated in the field . in the configuration depicted in fig6 the locking bolt piston 58 is located in the lower bored hole 50 , but the adjustment mechanism 32 has pivoted the swinging arm 30 ′ downward . because , as in the first embodiment , the swinging arm 36 ′ is appreciably longer than the wheel arm 30 ′, the auxiliary wheel 38 describes a greater arc and comes to rest on the ground after a short movement of the swinging arm 30 . when the adjustment mechanism 32 pivots the swinging arm 30 still further , the swinging arm 36 ′ with the auxiliary wheel 38 lifts the machine 10 until the maximal adjustment reach of the adjustment mechanism 32 is reached . in this fully lifted position of the machine 10 , a free space exists between the wheels 14 and the ground that is sufficient for positioning the machine 10 over the trailer 22 , as depicted in fig7 . because , as shown in fig3 the wheels 46 of the trailer 22 are located in the middle part of the trailer , it is sufficient when the machine 10 is raised to a height in which its wheels 14 reach thee height of the platform 42 . for transport , the machine 10 , as shown in fig6 is driven up to the trailer 22 with a lateral offset relative to the towing vehicle , the adjustment mechanism 32 is actuated , further extension is carried out until the wheels 14 and the tool 18 are above the platform 42 , the machine 10 is lowered until the auxiliary wheels 38 lift off of the ground and the hitch 16 pivots on the joint 26 until it extends in the longitudinal direction of the trailer 22 and therefore the machine 10 as well . optionally , the machine 10 can be secured on the trailer 22 in case this should be necessary . having described the preferred embodiment , it will become apparent that various modifications can be made without departing from the scope of the invention as defined in the accompanying claims . | 0 |
fig1 shows a functional block diagram of a first exemplary embodiment of a data processing system 100 that is able to restore a set of current parameters and / or values according to this invention . it should be appreciated that the data processing system 100 shown in fig1 is an image output system . however , it should be appreciated that this is illustrative only , and any other suitable data processing system could be used in place of the illustrated image output system to implement the data processing system 100 . as shown in fig1 , the data processing system 100 includes a logic unit 110 , a memory 120 and one or more controllers 130 , 140 , 150 , 160 , 170 and 180 , interconnected by one or more control and / or data busses and / or application programming interfaces 190 . the number and type of controllers 130 , 140 , 150 , 160 , 170 and 180 may vary or change dependent on the device and / or apparatus used to implement the data processing system 100 . in general , the data processing system 100 represents any known or later - developed data processing system , such as a computer , a copier , a printer , a scanner , a facsimile machine , a telecommunication system , a display system and so forth . each of the controllers 130 , 140 , 150 , 160 , 170 and 180 controls at least one corresponding unit 120 , 142 , 152 , 162 , 172 and 182 , respectively , of the data processing system 100 . for example , in the specific embodiment shown in fig1 , a memory controller 130 controls a memory 120 . a printer controller 140 controls a printer 142 , while a scanner controller 150 controls a scanner 152 . an input / output ( i / o ) controller 160 controls an i / o interface 162 . a display controller 170 controls a display device 172 , while a paper feeder controller 180 controls a paper feeder 182 and so forth . during operation of the data processing system 100 , various applications 122 stored in the memory 120 are executed by the logic unit 110 to control the data processing system 100 and various ones of the controllers 130 , 140 , 150 , 160 , 170 and 180 to perform the specific tasks required to operate the corresponding devices 120 , 142 , 152 , 162 , 172 and 182 . the applications 122 may rely on various parameters and / or values 124 stored in the memory 120 during operation of the logic unit 110 and / or the controllers 130 , 140 , 150 , 160 , 170 and 180 . as an example , the parameters and / or values 124 may provide one or more of the controllers 130 , 140 , 150 , 160 , 170 or 180 with a mode of operation with respect to the corresponding device 120 , 142 , 152 , 162 , 172 or 182 . in another example , the parameters and / or values 124 may provide one or more of the controllers 130 , 140 , 150 , 160 , 170 or 180 with operational parameters that optimizes the functional features of the device 120 , 142 , 152 , 162 , 172 and 182 . the parameters and / or values 124 may be defined and stored into the memory 120 of the data processing system 100 at the factory or may be stored into the memory 120 by personnel during installation set - up and / or servicing of the data processing system 100 . in many instances , after the parameters and / or values 124 have been defined and stored into the memory 120 , one or more of these parameters and / or values 124 may need to be modified for various reasons . for example , adding new hardware or features to the data processing system 100 may require various ones of the parameters and / or values 124 to be modified to accommodate the new hardware or features . in another example , diagnostic tests are performed on the data processing system 100 to determine whether one or more of the corresponding units 120 , 142 , 152 , 162 , 172 and / or 182 in the data processing system 100 are malfunctioning and / or requires servicing and / or optimization . in these instances , various ones of the parameters and / or values 124 may be modified to be better suited for the diagnostics or optimization . in various exemplary embodiments , a restore parameters and / or values circuit , routine or application 112 duplicates and stores a set of one or more of the currently stored parameters and / or values 124 , that is , a duplicate set of one or more of the parameters and / or values 126 , a set of one or more memory locations that is different from the one or more memory locations that store the currently - stored parameters and / or values 124 in the memory 120 . in various exemplary embodiments , the restore parameters and / or values circuit , routine or application 12 is implemented using an asic , a digital signal processor ( dsp ), a micro - processor or micro - controller , a hardware electronic or logic circuit , such as a discrete element circuit , a programmable logic device , such as a pld , pla , fpga or pal , a routine , subroutine or independent application executable by the logic unit 110 and stored in the memory 120 or some other memory device , or the like . in various exemplary embodiments , the restore parameters and / or values circuit , routine or application 112 is a routine , subroutine or independent application that when invoked or activated by the logic unit 110 , performs various operations described herein . the memory 120 may be implemented using non - volatile memory and / or volatile memory or a combination of the two . in various exemplary embodiments , the current parameters and / or values 124 may be stored in non - volatile memory and the duplicate parameters and / or values 126 , may be stored in volatile memory . in contrast , in various other exemplary embodiments , the current parameters and / or values 124 may be stored in volatile memory and the duplicate parameters and / or values 126 may be stored in non - volatile memory . in yet other various exemplary embodiments , both the current parameters and / or values 124 and the duplicate parameters and / or values 126 may be stored in non - volatile memory , or both may be stored in volatile memory . in various exemplary embodiments , the stored one or more current parameters and / or values 124 are duplicated prior to the one or more current parameters and / or values 124 being accessed by a user . in various exemplary embodiments , prior to accessing the one or more current parameters and / or values 124 , the user , for example , activates the restore parameters and / or values circuit , routine or application 112 , which prompts the user through , for example , a user interface , which ones of the current parameters and / or values 124 the user is to access . once the user indicates the set of one or more of the current parameters and / or values 124 that are to be accessed , the restore parameters and / or values circuit , routine or application 112 requests , for example , the memory controller 130 to allocate memory space to store a duplicate set 126 of at least the indicated set of one or more of the current parameters and / or values 124 . it should be appreciated that the indicated set of one or more of the current parameters or values 124 may be only a portion of , or may be all of , the current parameters and / or values 124 . once the memory controller 130 has allocated the requested memory space in the memory 120 , the restore parameters and / or values circuit , routine or application 112 controls the memory controller 130 to store the duplicate set of at least the indicated current set of one or more of the parameters and / or values 112 in the memory space allocated to the duplicate set of parameters and / or values 126 . the memory space may be allocated in the memory 120 or in some other memory device of the data processing system 100 . the restore parameters and / or values circuit , routine or application 126 retains the one or more addresses of the one or more memory locations allocated to the duplicate set of parameters and / or values 126 . the user then accesses the currently - stored parameters and / or values 124 and may modify one or more of the currently - stored parameters and / or values 124 for various reasons . if the user should erroneously change one or more of the current parameters and / or values 124 , the user may require the values of at least some of the current parameters and / or values 124 to be placed back to their previous parameters and / or values . in various exemplary embodiments , the user at least causes the restore parameters and / or values circuit , routine or application 112 to restore at least the erroneously modified ones of the current parameters and / or values 124 with the corresponding ones of the duplicate parameters and / or values 126 . when activated , the restore parameters and / or values circuit , routine or application 112 “ looks up ” the corresponding one or more memory locations and retrieves the corresponding one or more of the duplicate parameters and / or values 126 from those memory locations . the restore parameters and / or values circuit , routine or application 112 then replaces the at least the one or more erroneously modified ones of the current parameters and / or values 126 with the corresponding one or more duplicate parameters and / or values 126 . as a result , the restore parameters and / or values circuit , routine or application 12 restores these ones of the current parameters and / or values to their previous parameters and / or values . the user may then re - access the restored parameters and / or values 124 or the user may exit the data processing system 100 . fig2 shows a functional block diagram of a second exemplary embodiment of an apparatus 200 that is able to restore current parameters and / or values according to this invention . as shown in fig2 , the apparatus 200 includes a logic unit 210 , a memory 220 , a display 230 , an input / output ( i / o ) interface 240 , and a restore parameters and / or values circuit , routine or application 250 , interconnected by one or more control and / or data busses and / or application programming interfaces 260 . the apparatus 200 generally corresponds to any known or later - developed device that the systems , apparati and methods according to this invention are usable with . the apparatus 200 may correspond , for example , to test equipment , stationary or portable computers , personal digital assistants ( pdas ), cellular phones and the like . in various exemplary embodiments , the i / o interface 240 of the apparatus 200 may be coupled to an i / o interface 410 of a remote system 400 through a link 300 which provides a communication channel between the apparatus 200 and the remote system 400 . in various exemplary embodiments , the restore parameters and / or values circuit , routine or application 250 accesses a set of one or more of the current parameters and / or values 420 stored in the remote system 400 to create a duplicate set of those one or more parameters and / or values 222 , and stores that duplicate set 222 to one or more memory locations of the memory 220 of the apparatus 200 . in various exemplary embodiments , before the user accesses one or more current parameters and / or values 420 stored in the remote system 400 , the user executes the restore parameters and / or values circuit , routine or application 250 . in response , the restore parameters and / or values circuit , routine or application 250 prompts the user , for example , through a user interface displayed using the display 230 , to identify or select a particular set of one or more stored parameters and / or values stored at the remote system 400 the user wishes to access . once the user indicates the particular set of one or more parameters and / or values 420 to be accessed , the restore parameters and / or values circuit , routine or application 250 causes the apparatus 200 to communicate with the remote system 400 to move a copy of the specified set of the stored one or more parameters and / or values 420 to the apparatus 200 . on receiving the specified set , which forms the duplicate set of one or more parameters and / or values 222 , the restore parameters and / or values circuit , routine or application 250 stores the duplicate set of one or more parameters and / or values 222 in the memory 220 . the user may then proceed to modify various ones of the parameters and / or values 420 of the system 400 to perform , for example , diagnostics or optimization . for example , the user may use the apparatus 200 to issue commands to the remote system 400 that modify the one or more current parameters and / or values 420 . should the user err while altering one or more of the parameters and / or values 420 of the remote system 400 , at least some of the parameters and / or values 420 may have to be reconfigured or reset to place the remote system 400 back into a known configuration . accordingly , the user may execute the restore parameters and / or values circuit , routine or application 250 of the apparatus 200 . the restore parameters and / or values circuit , routine or application 250 then retrieves the stored duplicate set of one or more of the parameters and / or values 222 from the memory 220 and instructs the remote system 400 to replace at least some of the modified current parameters and / or values 420 accessed by the user with one or more of the duplicate one or more of parameters and / or values 222 . once the at least some of the accessed set of the stored parameters and / or values 420 have been replaced with the corresponding ones of the duplicate parameters and / or values 222 , the user may re - access those replaced parameters and / or values or the personnel may terminate the operation . fig3 is a flowchart outlining one exemplary embodiment of a method for storing duplicate parameters and / or values according to this invention . as shown in fig3 , operation begins in step s 100 , and continues to step s 110 , where a memory containing the current parameters and / or values is accessed . next , in step s 120 , one or more memory locations of the current parameters and / or values are determined . the memory location or locations of all the parameters and / or values may be determined . alternatively , the memory location or locations for only a portion of the parameters and / or values to be accessed may be determined . then , in step s 130 , a duplicate set of one or more of the parameters and / or values from the determined memory location or locations is created . operation then continues to step s 140 . in step s 140 , one or more memory locations are allocated to contain the duplicate set of the one or more of the parameters and / or values . in one exemplary embodiment , the memory location may be in the same physical memory . in various other exemplary embodiments , the memory location may be in a different physical memory . next , in step s 150 , the duplicate set of the one or more parameters and / or values are stored in the allocated one or more memory locations . then , in step s 160 , one or more memory addresses of the one or more memory locations in which the duplicate set of the one or more parameters and / or values are stored are retained . operation then continues to step s 170 . in step s 170 , a determination is made whether a parameter and / or value altering the operation has been terminated . if so , operation jumps directly to step s 190 . otherwise , the operation continues to step s 180 , where a determination is made whether a predetermined amount of time had passed since the duplicate set of the one or more parameters and / or values were stored in the one or more memory locations . if the predetermined amount of time had passed , operation continues to step s 190 . otherwise , operation returns to step s 110 to repeat the operation . in step s 190 , the one or more memory locations for the duplicate set of the one or more parameters and / or values are relinquished and that memory space is reallocated . operation then continues to step s 200 , where operation of the method terminates . in various exemplary embodiments , step s 170 may be omitted , and no reset takes place . in various exemplary embodiments , the step s 180 may be omitted , and no time out takes place . in various exemplary embodiments , the current and the duplicate parameters and / or values may be in the same memory , such as memory 120 , as shown in fig1 . in alternative embodiments , the current and the duplicate parameters and / or values may be in different memories , such as the memory in the system 400 and the memory 220 of apparatus 200 , respectively , as shown in fig2 . fig4 is a flowchart outlining one exemplary embodiment of a method for replacing one or more current parameters and / or values with one or more corresponding duplicate parameters and / or values according to this invention . operation of the method begins in step s 300 , and continues to step 5310 , where one or more memory locations of a memory in which the one or more duplicate parameters and / or values are stored are determined . then , in step s 320 , one or more memory locations of the current parameters and / or values to be replaced are determined . next , in step s 330 , the one or more current parameters and / or values are replaced with the one or more corresponding duplicate parameters and / or values . operation then continues to step s 340 , where operation of the method terminates . as shown in fig1 and 2 , the memory can be implemented using any appropriate combination of alterable volatile or nonvolatile memory . the alterable memory , whether volatile or nonvolatile , can be implemented using any one or more of static or dynamic ram . the alterable memory can also be a floppy disk and disk drive , a writeable or rewriteable optical disk and disk drive , a hard drive , a flash memory or the like . as shown in fig2 , the link 410 can be any known or later - developed device or system for connecting the remote system 400 to the apparatus 200 , including a wired connection , a wireless connection , a connection over a wide area network , a local area network or a storage area network , a connection over an intranet , a connection over an extranet , a connection over the internet , or a connection over any other distributed processing network or system . in general , the link can be any known or later - developed connection system or structure usable to connect the apparatus 200 to the remote system 400 . as shown in fig1 and 2 , the system 100 and the apparatus 200 are , in various exemplary embodiments , implemented using a programmed general purpose computer . however , the system 100 and the apparatus 200 can also be implemented using a special purpose computer , a programmed microprocessor or microcontroller and peripheral integrated circuit elements , an asic or other integrated circuit , a digital signal processor , a hardwired electronic or logic circuit such as a discrete element circuit , a programmable logic device such as a pld , pla , fpga or pal , or the like . in general , any device , capable of implementing a finite state machine that is in turn capable of implementing the flowcharts shown in fig3 and / or 4 , can be used . while the invention has been described in conjunction with specific embodiments outlined above , it is evident that many alternatives , modifications and variations will be apparent to those skilled in the art . accordingly , the preferred embodiments of the invention , as set forth above , are intended to be illustrative , not limiting . various changes may be made without departing from the spirit and scope of the invention . | 6 |
one essential component of the present invention is the novel block copolymer composition . the novel block copolymer composition comprises a high molecular weight styrenic block copolymer elastomer combined with a lower molecular weight polymer , preferably a diblock polymer . preferably , the styrenic block copolymer elastomer has an apparent molecular weight in the range of 250 , 000 to 800 , 000 if said copolymer is a linear polymer , or in the range of 500 , 000 to 1 , 500 , 000 if said copolymer is a branched or star - shaped polymer . most preferably the styrenic block copolymer elastomer constituents are selected from the group consisting of wherein a represents the polymer block substantially made of an aromatic vinyl compound , typically a polystyrene block ; b represents a polymer block substantially made of a conjugated diene , typically a polybutadiene block , p is 0 or 1 and x is the residue of a coupling agent . these preferred styrenic block copolymer elastomer constituents are selected from a larger group of styrenic block copolymers , that all may be used in the compositions of the present invention , consisting of those of the formulae ( b ) p -( a - b ) 2 x ; or ( b ) p - a ( b - a ) n -( b ) p , ( linear sbc1 ) wherein a , b , p and x have the meaning set out above , n is an integer greater than or equal to 1 , and m is an integer greater than 2 . the expression “ substantially made ” as used herein means that the polymer block referenced consists primarily of the indicated monomer to such an extent that the essential character of the polymer block is preserved . in the case of the a block “ substantially made ” means that sufficient aromatic vinyl compound is used , for instance at least 50 % by weight , to provide a hard block a having a glass transition temperature of greater than 25 ° c . in the case of the block b the expression “ substantially made ” means that sufficient conjugated diene is used , for instance at least 70 % by weight , to provide an elastomer block having a glass transition temperature below 25 ° c . the content of the aromatic vinyl compound comprising the a block in the styrenic block copolymer is from 10 to 50 % by weight , preferably from 15 to 40 % by weight . the vinyl aromatic compound may be selected from compounds having 8 to 18 carbon atoms per molecule . for instance , some representative examples thereof include : styrene ; 1 - vinylnaphthalene ; 4 - methylstyrene ; 3 , 5 - diethylstyrene ; 4 - propylstyrene ; 2 , 4 , 6 - trimethylstyrene ; 4 - phenylstyrene ; 2 - ethyl , 4 - benzylstyrene ; 2 , 3 , 4 , 5 - tetraethylstyrene ; 3 - ethyl - 1 - vinylnaphthalene ; alpha - methylstyrene , and the like . preferred examples comprise 4 - methylstyrene , styrene and mixtures thereof , styrene being most preferred . compounds that may be copolymerized and form part of the a block ( s ) maybe selected from the conjugated dienes hereafter , and other anionically polymerizable , ethylenically unsaturated compounds , such as vinylcyclohexane , methylmethacrylate and the like . most preferably each polymer block a is a polystyrene block . block b is preferably made from butadiene , isoprene or mixtures thereof . conjugated dienes that can be used , preferably having from 4 to 12 carbon atoms per molecule , further include 2 , 3 - dimethyl - 1 , 3 - butadiene , piperylene , 3 - butyl - 1 , 3 - octadiene , phenyl - 1 , 3 - butadiene , and the like . said block ( s ) may also comprise other monomers , such as the vinyl aromatic compounds mentioned herein above . most preferably block b is a polybutadiene block . as is known , butadiene ( and other conjugated dienes ) may polymerize in 1 , 4 - addition manner and / or 1 , 2 - addition manner . the latter results in pendant vinyl groups . it is known in the art to use styrenic block copolymers having relatively high vinyl content , e . g . up to 70 % and higher ( based on the conjugated diene ) by polymerizing the conjugated diene monomer in the presence of a polar cosolvent and / or at a relatively cool polymerization temperature . in producing the polymer block ( b ) under ordinary conditions a vinyl content of less than 25 % is obtained . both high vinyl and ordinary vinyl styrenic block copolymers may be used . the block copolymer elastomer and the second block copolymer may be used in relative amounts of 15 to 70 % by weight ( sbc1 and / or sbc2 ) and 85 to 30 % by weight ( d1 ), respectively , but preferably in relative amounts 20 to 50 % by weight ( sbc1 and / or sbc2 ) and 80 to 50 % by weight ( d1 ). one of ordinary skill in the art will understand that the performance of the pressure sensitive adhesive compositions will vary and that the optimal performance for any application will be found by varying the relative amounts within the aforementioned range . depending on their method of preparation , these block copolymers are known to comprise diblock copolymers of formula a - b in various amounts . indeed , in coupling reactions , the diblock copolymers of formula a - b have the same molecular weight as the arms in the coupled polymer . the co - produced diblock copolymer of formula a - b may be the second block copolymer ( d1 ) component of the polymer composition , provided it has an apparent molecular weight in the range of from 10 , 000 to 250 , 000 and is present in an amount in the range of 85 to 30 % by weight basis the polymer composition . this is the preferred embodiment . on the other hand , the second block copolymer ( d1 ) may be a separate polymer , selected from the polymers mentioned herein before . the second block copolymer ( d1 ) may also be a diblock copolymer produced independent of the preparation of the block copolymer elastomer ( sbc1 and / or sbc2 ). the polymer composition that has been found to be most suitable for the present application is a high molecular weight styrene - butadiene - styrene coupled block copolymer with a large amount of diblock , with the following characteristics : 1 . styrene content in the range of 25 - 40 %, preferably about 30 % by weight ; 2 . diblock molecular weight 180 , 000 - 215 , 000 , preferably about 200 , 000 ; 3 . diblock content 70 - 85 %, preferably 80 % by weight ( which corresponds with a coupling efficiency of 15 - 30 , preferably 20 %); and 4 . having a linear structure ( manufactured with a difunctional coupling agent ), having an apparent molecular weight ( sbs ) of 30 , 000 - 40 , 000 // 300 , 000 - 350 , 000 // 30 , 000 - 40 , 000 , preferably 36 , 000 - 328 , 000 - 36 , 000 . the term “ apparent molecular weight ”, as used throughout the present specification , means the molecular weight , as measured by gel permeation chromatography ( gpc ), relative to commercially available poly ( styrene ) calibration standards ( according to astm d6474 - 99 ). one skilled in the art can readily convert “ apparent ” molecular weight to “ real ” or “ true ” molecular weight according to known compositionally dependent conversions . alternately , in the case of coupled block copolymers having styrene endblocks , one may calculate the true or real molecular weight from the polystyrene content as measured by 1h nmr and the styrene endblock molecular weights as measured by gpc . for example , a styrene / butadiene block copolymer having the structure ( a - b ) 2 x with apparent molecular weight of ( 36 , 000 - 164 , 000 ) 2 x and 30 % weight bound styrene will have a real molecular weight of ( 36 , 000 - 84 , 000 ) 2 x . one of the components used in the adhesives and sealants of the present invention is a tackifying resin . tackifying resins include both a block compatible resins and b block compatible resins . the a block compatible resin may be selected from the group consisting of coumarone - indene resin , polyindene resin , poly ( methyl indene ) resin , polystyrene resin , vinyltoluene - alphamethylstyrene resin , alphamethylstyrene resin and polyphenylene ether , in particular poly ( 2 , 6 - dimethyl - 1 , 4 - phenylene ether ). such resins are e . g . sold under the trademarks “ hercures ”, “ endex ”, “ kristalex ”, “ nevchem ” and “ piccotex ”. resins compatible with the b block maybe selected from the group consisting of compatible c 5 hydrocarbon resins , hydrogenated c 5 hydrocarbon resins , styrenated c 5 resins , c 5 / c 9 resins , styrenated terpene resins , fully hydrogenated or partially hydrogenated c 9 hydrocarbon resins , rosin esters , rosin derivatives and mixtures thereof . these resins are sold under the trademarks “ regalite ”, “ regalrez ”, “ escorez ”, “ wingtack ” and “ arkon ”. the amount of tackifier varies from about 0 to about 700 parts by weight per hundred parts by weight block copolymer , preferably about 100 to about 700 parts by weight per hundred parts block copolymer . in the present invention , in which the amount of block copolymer is from 10 to 45 parts by weight , the preferred amount of tackifier corresponds to 40 to 70 parts by weight , and the most preferred amount is from 45 to 60 parts by weight . another one of the components used in the adhesives of the present invention is an extending oil . especially preferred are the types of oils that are compatible with the b blocks . while oils of higher aromatic content are satisfactory , those petroleum - based white oils having less than 50 % aromatic content are preferred . such oils include both paraffinic and naphthenic oils . the oils should additionally have low volatility , preferably having an initial boiling point above about 500 ° f . examples of alternative extending oils which maybe used in the present invention are oligomers of randomly or sequentially polymerized styrene and conjugated diene , oligomers of conjugated diene , such as butadiene or isoprene , liquid polybutene - 1 , and ethylene - propylene - diene rubber , all having a number average molecular weight in the range from 300 to 35 , 000 , preferable less than about 25 , 000 molecular weight . the amount of oil employed varies from about 0 to about 400 parts by weight per hundred parts by weight block copolymer , preferably about 10 to about 400 parts by weight per hundred parts block copolymer . in the present invention , in which the amount of block copolymer is from 10 to 45 parts by weight , the preferred amount of extending oil corresponds to 5 to 40 parts by weight , and the most preferred amount is from 10 to 30 parts by weight . another one of the components used in the adhesives of the present invention is an ester - type plasticizer . especially preferred are organic ester plasticizers typically employed in poly ( vinyl chloride ) ( pvc ) flexibilization . these plasticizers may be compatible with either the a blocks or the b blocks . examples of plasticizers useful in the present invention are dioctyl phthalate ( dop ), di - 2 - ethylhexyl phthalate ( dehp ), diisononyl phthalate ( dinp ), diisodecyl phthalate ( didp ), and butyl benzyl phthalate ( bbp ). the preferred plasticizer is butyl benzyl phthalate and is obtainable as santicizer 160 from ferro corp . the amount of ester - type plasticizer varies from 0 to 150 parts by weight per 100 parts by weight of the block copolymer . in the present invention , in which the amount of block copolymer is from 10 to 45 , the preferred amount of plasticizer corresponds to 0 to 15 parts by weight , and the most preferred amount is from 5 to 15 parts by weight . various types of fillers and pigments can be included in the adhesive or sealant formulations to color the adhesive , increase stiffness and reduce cost . suitable fillers include organic compounds such as carbon black and hydrocarbon waxes and inorganic minerals such as calcium carbonate , clay , talc , silica , zinc oxide , titanium dioxide and the like . the amount of filler usually is in the range of 0 to 30 % weight based on the polymer portion of the formulation , depending on the type of filler used and the application for which the adhesive is intended . the compositions of the present invention maybe modified further with the addition of other polymers in particular polyolefins such an polyethylenes and polypropylenes , reinforcements , antioxidants , stabilizers , fire retardants , anti blocking agents , lubricants and other rubber and plastic compounding ingredients without departing from the scope of this invention . such components are disclosed in various patents including u . s . pat . no . 3 , 239 , 478 ; and u . s . pat . no 5 , 777 , 043 , the disclosures of which are incorporated by reference . regarding the relative amounts of the various ingredients , this will depend in part upon the particular end use and on the particular block copolymer that is selected for the particular end use . table a below shows some notional compositions that are included in the present invention . the amounts are expressed in parts by weight . table a composition , application ingredients parts by weight adhesive block copolymer 100 composition tackifying resin 25 to 300 extending oil 0 to 200 hot melt adhesive block copolymer 100 ( preferred range ) composition tackifying resin 75 to 200 a block resin 0 to 50 extending oil 0 to 150 solvent based adhesive block copolymer 100 ( excluding solvent ) composition tackifying resin 25 to 300 oil 0 to 100 pressure sensitive adhesive block copolymer 100 composition styrene / isoprene block 25 to 300 copolymer tackifying resin 50 to 500 oil 0 to 200 construction adhesive or block copolymer 100 sealant ( excluding solvent ) composition tackifying resin 0 to 200 a block resin 0 to 200 calcium carbonate 100 to 800 if the adhesive composition is to be applied from solvent solution , the organic portion of the formulation will be dissolved in a solvent or blend of solvents . aromatic hydrocarbon solvents such as toluene , xylene or shell cyclo sol 53 are suitable . aliphatic hydrocarbon solvents such as hexane , naphtha or mineral spirits may also be used . if desired , a solvent blend consisting of a hydrocarbon solvent with a polar solvent can be used . suitable polar solvents include esters such as isopropyl acetate , ketones such as methyl isobutyl ketone , and alcohols such as isopropyl alcohol . the amount of polar solvent used depends on the particular polar solvent chosen and on the structure of the particular polymer used in the formulation . usually , the amount of polar solvent used is between 0 and 50 % wt in the solvent blend . alternatively , the adhesive composition may be applied as a hot melt . various methods of melt mixing are known and any method that produces a homogeneous composition without significant degradation is suitable . typically , all components are combined and mixed in suitable mixing equipment like a sigma - blade mixer or a twin screw extruder at temperatures ranging from 130 to 200 ° c . until a homogeneous composition is obtained , usually less than 3 hours . the hot melt adhesive composition can then be applied to the appropriate substrate using a variety of methods including spray coating , film extrusion , multi - line extrusion , multi - dot extrusion and the like . the pressure sensitive adhesives of the present invention must have aggressive tack and good peel and shear strength . importantly , the adhesives must also have excellent high temperature strength . typically , the high temperature strength is measured as the shear adhesion failure temperature ( saft , astm d4498 ). the adhesives of the present invention typically are characterized by saft values greater than 60 ° c . preferably , the saft value is greater than 70 ° c ., more preferably greater than 80 ° c ., and most preferably greater than 90 ° c . the adhesive compositions of the present invention are useful for pressure sensitive labels and decals . a wide variety of materials are useful as label and decal stocks and any paper or film material with suitable printability , cuttability , stiffness and adhesive coatability is satisfactory . typical label and decal stocks include paper , polyolefin films including polyethylene , polypropylene and ethylene - propylene copolymers , polyester films , plasticized poly ( vinyl chloride ) films , and the like . plasticized poly ( vinyl chloride ) films are especially preferred as a decal stock . the following examples are provided to illustrate the present invention . the examples are not intended to limit the scope of the present invention and they should not be so interpreted . amounts are in weight parts or weight percentages unless otherwise indicated . the test methods used in the examples are american society for testing materials ( astm ) test methods , and the following specific methods were used : rolling ball tack astm d - 3121 polyken probe tack astm d - 2979 loop tack astm d - 6195 180 ° peel astm d - 903 holding power astm d - 6463 saft astm d - 4498 melt viscosity astm d - 3236 polymer a represents the block copolymer composition of the present invention . polymer a is a mixture of a coupled , linear triblock copolymer having the structure ( a - b ) 2 x and a diblock copolymer component having the structure a - b . in both the triblock and diblock copolymer components , a is a polystyrene block having an apparent molecular weight of 36 , 000 . because gpc with polystyrene standards was used to measure the molecular weights , the true molecular weight of the a block is equal to the apparent molecular weight . in both the triblock and diblock copolymer components , b is a polybutadiene block having a vinyl content of about 10 mol % and an apparent molecular weight of 164 , 000 . the true molecular weight of the b block is 84 , 000 . because the triblock component is a coupled polymer it has a structure of apparent molecular weight 36 , 000 - 328 , 000 - 36 , 000 while the corresponding structure of the diblock component is 36 , 000 - 164 , 000 . the overall styrene content is about 30 % by weight . the triblock component makes up 20 % by weight of the block copolymer composition with the remainder ( 80 %) being the diblock component . comparative polymer 1 is a coupled , linear block copolymer composition having 22 % by weight of a triblock component ( a - b ) 2 x and 78 % by weight of a diblock component a - b . the a block of each component is a polystyrene block having a true molecular weight of 16 , 100 . the b block of each component is a polybutadiene block having a vinyl content of about 10 mol % and a true molecular weight of 36 , 000 . the overall styrene content is about 31 % by weight . comparative polymer 2 is a coupled , linear block copolymer composition having 84 % by weight of a triblock component ( a - b ) 2 x and 16 % by weight of a diblock component a - b . the a block of each component is a polystyrene block having a true molecular weight of 16 , 100 . the b block of each component is a polybutadiene block having a vinyl content of about 10 mol % and a true molecular weight of 35 , 800 . the overall styrene content is about 31 % by weight . comparative polymer 3 is a coupled , linear block copolymer composition having 82 % by weight of a triblock component ( a - b ) 2 x and 18 % by weight of a diblock component a - b . the a block of each component is a polystyrene block having a true molecular weight of 15 , 500 . the b block of each component is a polyisoprene block having a vinyl content of about 6 mol % and a true molecular weight of 55 , 000 . the overall styrene content is about 22 % by weight . adhesive formulations i - iii were made according to the listing of ingredients in table b . adhesives ranging in block copolymer content from 20 - 40 parts by weight exhibited the desired cohesive failure during room temperature 180 ° peel tests and excellent high temperature performance as shown by the saft results . table b adhesive formulation c1 c2 c3 i ii iii composition , pbw comparative polymer 1 40 . 0 30 . 0 20 . 0 0 0 0 polymer a 0 0 0 40 . 0 30 . 0 20 . 0 wingtack 86 50 . 0 50 . 0 50 . 0 50 . 0 50 . 0 50 . 0 shellflex 371 10 . 0 20 . 0 30 . 0 10 . 0 20 . 0 30 . 0 irganox 1010 0 . 5 0 . 5 0 . 5 0 . 5 0 . 5 0 . 5 properties rolling ball tack , cm 3 . 2 0 . 8 0 . 7 3 1 . 3 0 . 8 polyken probe tack , kg 0 . 69 0 . 53 0 . 45 0 . 27 0 . 43 0 . 36 loop tack , oz / in 139 vsc 115 vsc 72 sc 124 vsc 100 vsc 67 c 180 ° peel , pli 5 . 1 c 3 . 7 c 2 . 6 c 3 . 6 c 3 . 1 c 3 . 6 c hp to steel ( 1 × 1 , 2 kg ), min & gt ; 5000 & gt ; 5000 & gt ; 5000 & gt ; 5000 & gt ; 5000 & gt ; 5000 saft to mylar ( 1 × 1 , 0 . 5 kg ), ° c . 90 80 70 122 97 82 c indicates cohesive failure , or splitting , of the adhesive layer . sc indicates slight cohesive failure . vsc indicates very slight cohesive failure . the comparative formulations c1 - c3 were made from comparative polymer 1 which has a low coupling efficiency but also relatively low molecular weight . the resulting high temperature performance ( saft ) is significantly less than the inventive formulations at all block copolymer composition contents . adhesive formulations iv - vi were made according to the listing of ingredients in table c . the formulations were made by blending a highly coupled , but relatively low molecular weight block copolymer composition , comparative polymer 2 , with polymer a . blends containing up to 40 % of comparative polymer 2 ( iv - vi ) retained both good high temperature performance ( saft ) and in 180 ° peel tests failed in the desired cohesive mode . higher levels of comparative polymer - 2 ( c4 - c5 ), including comparative polymer 2 alone ( c6 ), did not yield the desired cohesive failure mode of the adhesive in peel tests . table c adhesive formulation iv v vi c4 c5 c6 composition , pbw polymer a 30 . 0 24 . 0 18 . 0 12 . 0 6 . 0 comparative polymer 2 6 . 0 12 . 0 18 . 0 24 . 0 30 . 0 wingtack 86 50 . 0 50 . 0 50 . 0 50 . 0 50 . 0 50 . 0 shellflex 371 20 . 0 20 . 0 20 . 0 20 . 0 20 . 0 20 . 0 irganox 1010 0 . 5 0 . 5 0 . 5 0 . 5 0 . 5 0 . 5 overall coupling efficiency , % 20 33 46 58 71 84 properties on 1 mil mylar 180 ° peel , pli 3 . 3 c 6 . 1 c 8 . 0 c 3 . 8 3 . 5 3 . 7 hp to steel ( 1 × 1 , 2 kg ), min & gt ; 5000 & gt ; 5000 & gt ; 5000 & gt ; 5000 & gt ; 5000 & gt ; 5000 saft to mylar ( 1 × 1 , 0 . 5 kg ), ° c . 94 96 97 96 99 98 c indicates cohesive failure , or splitting , of the adhesive layer . adhesive formulations vii and viii were made according to the listing of table d . the adhesive formulations contained relatively low amounts of polymer a . at block copolymer composition levels as low as 11 % good high temperature results ( saft ) and the desired cohesive failure during 180 ° peel tests were exhibited . the inventive compositions were compared to formulations containing comparative polymer 3 having a high level of triblock component and relatively low molecular weight . while the desired cohesive failure was observed in comparative formulations c7 and c8 , the high temperature performance ( saft ) was significantly poorer than that of the inventive formulations ( vii and viii ) at equivalent block copolymer composition contents . table d adhesive formulations c7 c8 vii viii composition , pbw comparative 11 15 0 0 polymer 3 polymer a 0 0 11 15 escorez 5600 64 64 64 64 tufflo 6056 25 21 25 21 irganox 1010 0 . 25 0 . 25 0 . 25 0 . 25 properties rolling ball tack , cm & gt ; 30 & gt ; 30 & gt ; 30 & gt ; 30 polyken probe 1 . 29 1 . 85 1 . 34 1 . 43 tack , kg looptack , oz / in 166 c 209 c 217 c 207 c 180 ° peel , pli 4 . 7 c 5 . 7 c 4 . 5 c 5 . 4 c hp to steel & gt ; 6000 & gt ; 6000 & gt ; 6000 & gt ; 6000 ( 1 × 1 , 2 kg ), min saft ( 1 × 1 0 . 5 kg ), 63 68 71 76 ° c . melt viscosity , cps @ 300 ° f . 1 , 100 2 , 600 6 , 200 34 , 000 @ 265 ° f . 2 , 400 6 , 200 44 , 000 300 , 000 c indicates cohesive failure , or splitting , of the adhesive layer . adhesive formulations ix - xii were made according to the listing of ingredients in table e . in this example , inventive formulations were made comprising santicizer 160 , an ester - type plasticizer . surprisingly , the adhesives maintained excellent tack , peel , holding power and saft results at plasticizer levels up to 15 % by weight . the saft value for the comparative formulation , c7 , made with comparative polymer 1 becomes marginal when the concentration of the ester - type plasticizer reaches only 5 % by weight . table e ix x xi xii c9 composition , pbw polymer a 25 25 25 25 0 comparative polymer 1 0 0 0 0 25 escorez 5600 60 60 60 60 60 tufflo 6056 15 10 5 0 10 santicizer 160 5 10 15 5 irganox 1010 0 . 25 0 . 25 0 . 25 0 . 25 0 . 25 psa properties melt vis @ 177 ° c ., 190 140 120 95 pa . s rolling ball tack , cm & gt ; 30 10 & gt ; 30 & gt ; 30 & gt ; 30 polyken probe tack , kg 1 . 06 c 1 . 00 c 1 . 00 c 0 . 86 c 1 . 16 c loop tack , oz / in 290 c 310 c 260 c 210 c 210 c 180 ° peel , pli 6 . 5 c 6 . 5 c 6 . 4 c 7 . 4 c 5 . 2 c hp to steel ( 1 × 1 , 2 kg ), & gt ; 6000 & gt ; 6000 310 100 1450 min saft ( 1 × 1 , 0 . 5 kg ), 87 c 76 c 69 c 64 c 61 c ° c . c indicates cohesive failure , or splitting , of the adhesive layer . | 2 |
aspects of the present invention provide for a method that has an algorithm that is used to perform rendering of images from data . the data is obtained from various methods , such as ct and mr scans of medical patients , as a non - limiting example . the method provided has two basic premises . the first premise is to construct disjointed segments of a ray . the second premise is to render each disjointed segment according to its contents . aspects of the present invention allow for an efficient method of constructing segments for analysis . additionally , embodiments use spatial coherence to enhance the sorting of the segments and determine which volumes are active in each segment . multi - reduced path octree structures are used to enhance ( speed up ) rendering by skipping empty regions of every volume . the algorithm of the present invention is purely software based without any hardware acceleration . the algorithm can achieve similar performance to those using hardware acceleration , such as those used with modern graphical processing units ( gpus ). an exemplary embodiment of the present invention achieves a similar goal with different methods . in an exemplary method of the present invention , a software based method is provided that uses a ray - casting algorithm and therefore does not depend on any graphics hardware , to provide a quick and accurate fused rendering from multiple data volumes . by utilizing separate space leaping structures for different volumes and intelligent ray segment processing , the algorithm can achieve similar performance compared to using the high end graphics hardware . in an exemplary embodiment , the present invention uses ray casting as one method to directly visualize datasets with three spatial dimensions ( x , y , z for example ). these dimensions are hereinafter are called a triple . a hypothetical ray is cast from a virtual camera ( point of view ) inside the scene ( volume to be rendered ) and traverses scalar voxel values of a dataset . these scalar values are obtained ( fetched ) by a method ( hereinafter called “ sampling ”), wherein at every sample location a trilinear interpolation of eight corner values that each voxel possesses is performed . once the trilinear interpolated values are determined , a classification is calculated via lookup tables , also known as transfer functions , which assign an opacity , alpha and color ( r , g , b ) to the interpolated value . this interpolation and classification is performed for every valid sampling position along the ray until the ray is fully traversed . there are two directions to composite ( accumulate ) the scalar values : front - to - back and back - to - front . the result of the accumulation is a final pixel that will be depicted on the viewing screen , based upon the data set . the process is continued for each portion of the data set until a final pixel set is created . the final pixel set is then displayed . the fusion renderer of the present invention is based on a ray - casting algorithm . in order to handle multiple volumes , the following features are used to maintain correctness and efficiency . in an aspect of the present invention , an efficient method for constructing disjointed segments is provided . additionally , an aspect of the present invention provides for spatial coherence to speed up the sorting of these segments and determining which volumes are active in each segment . each disjoint segment is treated independently and a leader volume is used to guide the whole sampling process for a segment that is introduced to ensure correctness . multi - reduced path octree structures are used to speed up the rendering by skipping empty regions of every volume . for multi - volume rendering , if data points are each sampled along the ray for every volume , it is a very time consuming and consequently cost prohibitive operation . along a ray , however , there may be only a portion of the ray that needs to be rendered in fused mode — these are the overlapping regions of volumes . even in the overlapping region not every volume is active , therefore the rays are pre - processed before the actual sampling and compositing occurs . the result of the preprocessing are several disjoint ray segments which have the information of whether there are one , two or more volumes active . before the casting of the ray starts , each ray is tested against the volume boundaries , clipping planes and crop boxes for every volume in the scene . if the ray doesn &# 39 ; t intersect with a volume , this volume is deemed as inactive for this ray . if the ray does intersect with a volume , the starting point and end point of this ray in the eye space with regard to this volume is recorded in a triple ( p , v n , s / e ) where p is the z position in the eye space , v n is which volume it belongs to and s / e decides whether this is a starting or ending point . after this analysis is performed for all the volumes , all the triples are put into an array and sorted according to their z position in the eye space . sorting occurs in the z position as it is desirable to determine the sample order for the later front to back or back to front compositing . the sorted list is used to break the ray into several segments and the volumes involved in each segment is determined using the sorted triplet list . the example in fig1 is used to demonstrate how to determine which volumes are active for each segment . in fig1 , four volumes are active for this ray ( intersect with the ray ). they are named v 1 , v 2 , v 3 and v 4 . each volume has a start and end point for this ray and therefore there are 8 triplets ( p 2 , v 1 , e ), ( p 3 , v 1 , s ) . . . ( p 8 , v 4 , e ). after the data is sorted against the position , the order of the list becomes ( p 1 , v 1 s ), ( p 5 , v 3 , s ), ( p 3 , v 2 , s ), ( p 2 , v 1 , e ), ( p 7 v 4 , s ), ( p 4 , v 2 , e ), ( p 6 , v 3 , e ) and ( p 8 , v 4 , e ). from these points , there are 7 segments : segment one is from ( p 1 , v 1 , s ) to ( p 5 , v 3 , s ). segment 2 is from ( p 5 , v 3 , s ) to ( p 3 , v 2 , s ) . . . . segment 7 is from ( p 6 , v 3 , e ) to ( p 8 , v 4 , e ). this is shown in fig2 . for each segment , it is determined which volume is active in this segment . for each segment starting point , it is noted whether the third element of the triplet is an s or an e . if it is an s , the volume number is added which is the second element of the triplet to the active volume list . if it is an e , the corresponding volume is dropped from the active volume list . for the first segment , since the third element of the segment starting point ( p 1 , v 1 , s ) is an s , v 1 is added to the active volume list for this segment . for the second segment , the third element of the segment starting point ( p 5 , v 3 , s ) is an s , v 3 is added to the active volume list and therefore v 1 and v 3 are active . similarly for the third segment it is determined if v 1 , v 2 and v 3 are active . for segment # 4 , the third element of the segment starting point ( p 2 , v 1 , e ) is an e and the corresponding volume v 1 is dropped out of the active volume list and therefore only v 2 and v 3 are active for this segment . similarly for segment # 5 , v 2 , v 3 and v 4 are active . for segment # 6 , v 3 and v 4 are active and for segment # 7 , only v 4 is active . sorting can be speeded up ( enhanced ) and active volume determination process by using the corresponding information from the neighboring ray that is cast before this one . for example , assume that information is already obtained for the ray in fig1 . the next ray is then to be determined that is adjacent to the one previously evaluated . because of the spatial coherence , it is very likely that the order of the starting and ending points and the volume activeness would be very similar if not the same as the previous ray . therefore , after calculating the new ray &# 39 ; s intersection points with the volumes and constructing the triplets using these points , the points are put in the same order as the previous ray . it is then determined whether the order is preserved . using the example of fig1 , it queries whether the order p 8 & gt ;= p 6 & gt ;= p 4 & gt ;= p 7 & gt ;= p 2 & gt ;= p 3 & gt ;= p 5 & gt ;= p 1 is still true or not . if it is , there is no need to sort or determine the volume activeness of each segment because the information can be reused from the previous ray . if it is not true , the data is sorted and the active volume list is determined in each segment , as before . because of the spatial coherence , the difference of the order should not be significant and therefore the sorting should be faster than if the points are put in a random order . after the ray is broken down into different segments and the active volume list is generated for each segment , each segment is sampled to get the accumulated result for this ray . every segment is handled one at a time and each volume has its own distance between two samples , which is defined as the sampleunit . to treat the boundary of two segments correctly , the previous segment has to record the sample position of the last samples . the sampleunits are added to the positions as the starting sample positions for the new segment with regard to different volumes . this is to ensure that all the samples for a volume have the same sampling distance and therefore the same sampling rate . 2 . only one volume is active for the segment ( single volume sampling ) for the first case , nothing has to be done and analysis proceeds to the next segment . for the second case , it is the same as the single volume rendering . since only one volume is active the sampling order is of no concern for different volumes and therefore sampling this segment should be as fast as standard raycast . for the third case , multiple volumes are handled . since multiple volumes can be arbitrarily oriented and have arbitrary sampling distance , the samples are composited from different volumes in the correct world / camera coordinate . in order to perform this function , an algorithm has been determined where the volume is identified with the smallest sample unit as the leader volume . the sampling of this volume is used as the main control loop . after each sample of this volume , it is checked whether there are samples from other volumes that fall in between this sample and the next sample for the leader volume . if yes , the samples are sampled and composited . otherwise , the process proceeds to the next sample of the leader volume . as illustrated from the example described in fig3 , this method has one potential drawback . all the samples between the two neighboring samples of the leader volume are not necessarily in the correct order . the samples need to be sorted and then composited to the frame buffer . alternatively , it can be assumed that they are all at the position of the leader volume and then use alpha correction to get the correct value for compositing . equation 1 describes the alpha correction . as the sampling rate difference between the correct position and the position that is used should be small , a first order of the taylor series is used to calculate the alpha correction as shown in equation 2 . when the leader has reached the segments end , sampling may have been missed in the last valid positions of the other volumes . this is a last check which concludes the rendering of a multi volume segment by finishing the “ leftovers ”. the fourth case is actually a special case for case two . samples are tested to see if they may fall in this segment by using the method described before : recording the last sample positions of the previous segment and add the sampleunits to the positions as the new starting positions . if any starting positions for any volumes fall into this segment , they are sampled them . space leaping is relied on and early ray termination to speed up multi - volume fused volume rendering . for every volume , one reduced path octree associated with it . each octree needs only less than one tenth of the original volume . any samples along a ray are tested against its associated octree to determine whether it belongs to an “ empty ” region and if so no interpolation or compositing is needed . only the samples of the “ active ” volume need to be tested . those non - empty samples will be accumulated . during processing of a segment , the accumulated alpha value of the ray are tested against the pre - specified alpha threshold . if it exceeds the threshold , the sampling and accumulation will stop for this segment and any segments after this will be discarded . also the casting for this ray is finished . the fused volume renderer can evaluate multiple datasets with different size , resolution , orientation as inputs and render them in one scene ( without the usual resampling by other published renderers ). the renderer is also able to handle each volume &# 39 ; s cut plane , crop box , shading , sampling rate independently . the renderer is purely software based without any hardware acceleration . the method can reach interactive performance of more than 20 fps for 512 × 512 output image size and 9 - 10 fps for 1 k × 1 k output image size on an over the shelf pc platform . the algorithm was tested on a dell precision 690 workstation with two 3 . 0 ghz and 4 mb l2 cache dual core intel xeon processor 5160 processor , 4 gb of ddr2 667 mhz sdram . the tested datasets are two ct datasets and one pet dataset . the two ct datasets are the same data with different transfer function . the sizes of the ct datasets are 512 × 512 × 225 and the size of the pet dataset is 128 × 128 × 227 . the transfer function used for ct1 is to reveal the soft tissue while the transfer function used for ct2 is to reveal the translucent bone structure . the transfer function used for pet dataset is to reveal areas of radionuclear uptake . the following table shows the average interactive and definitive performance of the renderer with 512 × 512 and 1 k × 1 k output window size . fig4 and 5 show the resulting image with all three volumes fused together and all three volumes separated . in the foregoing specification , the invention has been described with reference to specific exemplary embodiments thereof . it will , however , be evident that various modifications and changes may be made thereunto without departing from the broader spirit and scope of the invention as set forth in the appended claims . the specification and drawings are accordingly to be regarded in an illustrative rather than in a restrictive sense . | 6 |
in order to facilitate the understanding of the present invention , prior to the disclosure of an embodiment of the present invention , explanation will be made of an example of a general ks interface network which is employed to increase the processing capability in a multiprocessor system , with reference to fig1 by way of example . fig1 shows a general system configuration for key processing in which four central processing units cpu0 through cpu3 have access to a single main storage ms in common . referring to fig1 the units cpu0 through cpu3 include key storages ks0 through ks3 , respectively . each of the key storages ks0 through ks3 stores therein key information with respect to the single ms . since the key storages ks0 through ks3 are required to have the same content for the protection bit , when a central processing unit issues an ssk request , respective contents of the key storages must be updated in an interlocking manner . such an updating operation is also required for an insert - storage - key ( hereinafter referred to as &# 34 ; isk &# 34 ;) request . as is well known , the key information includes information concerned with a so - called address transformation involving the translating of logical addresses into real addresses and is given by a reference bit . in more detail , the reference bit takes the level &# 34 ; 1 &# 34 ; when a corresponding block is subjected to a read or write operation . the key information includes a change bit . the change bit is set when data is stored in the ms . each cpu updates only the change bit and the reference bit in a ks corresponding to the cpu when accessing the ms . accordingly , the contents of individual ks &# 39 ; s provided correspondingly for individual cpus are different from one another . in the case where a plurality of cpus simultaneously issue ssk ( or isk ) requests , since there is a possibility that the requests indicate the same address , the requests must be processed serially . for this reason , a priority has to be determined among the requests from the cpus . in fig1 a reference numeral 200 designates a key request priority determining unit for determining the above priority . the unit 200 generates priority data and a command . the priority among the requests generated in the central processing units cpu0 through cpu3 is determined by the key request priority determining unit 200 , and then an accepted request is sent from the unit 200 to each of the units cpu0 through cpu3 to update the key storages ks0 through ks3 included respectively in the units cpu0 through cpu3 . further , the priority among requests which are issued for the units cpu0 through cpu3 to the ms , is determined by an ms request priority determining unit 100 , but the parallel processing is carried out for different banks of the ms . accordingly , the priority determination is made only for a bank , for which the requests conflict with each other . as shown in fig1 in such a multiple information processing system there is provided a key request priority determining unit 200 for common use , in order to determine the priority among key access requests which are simultaneously generated in a plurality of cpus . that is , an exclusive unit for determining the priority is required . further , it is required in the system to take into consideration the capacity of the interface which depends upon the number of central processing units . that is , when the number of central processing units is extensively increased , substantial and extensive changes are required in the interface disadvantageously . the present inventors have overcome the above difficulties by applying to the connection among multiple ks &# 39 ; s the conception of a ring structure which is disclosed in the above - referenced copending u . s . application ser . no . 136 , 492 . fig2 and 3 show an embodiment of the present invention in which four central processing units cpu0 through cpu3 are connected to a main storage ms , that is , have a common ms , and the central processing units cpu0 through cpu3 each includes a key storage . accordingly , the number of central processing units can be varied at any desired time in compliance with needs based on the system scale . fig2 shows a transfer system for key information , such as address and key data , and fig3 shows a transfer system for a priority determining signal . in fig2 and 3 , the central processing units cpu0 through cpu3 have the same structure and therefore only the structure of the unit cpu0 is shown in detail . further , those parts which are not essential to the present invention are omitted in fig2 and 3 . refer to the above - referenced copending u . s . application for the input / output devices , for example . reference is made first to fig2 . when a key - write instruction ssk request is generated in an instruction unit ( iu ) 2 the iu 2 issues a key access request from a key request generator provided therein as shown in fig3 described later . when a flip - flop ff - b is set , so that the cpu 0 receives an instruction for processing with a priority , i . e ., priority determining signal , iu 2 sets an order ( o ), address ( a ) and data ( d ) included in the request in registers 3 , 8 and 13 , respectively . in fig2 reference numeral 3 designates an order register , 8 an address register , and 13 a data register . the term &# 34 ; order &# 34 ; means information obtained by coding various requests for the ms and ks . in this case , the ssk operation is coded , and this coded information is set in the register 3 . the order , address and data , which are set in the registers 3 , 8 and 13 , are sent through select gates 20 , 21 and 22 to registers 4 , 9 and 14 , respectively , and set therein , in order to update the key storage ks1 provided in the unit cpu0 . an example of the circuit configuration of the select gate is shown in fig4 . since the order set in the register 4 indicates the ssk processing , the ssk processing is performed for the key storage ks1 . a write address and data to be written are given by the registers 9 and 14 , respectively . as mentioned above , the registers 4 , 9 and 14 can perform the read / write operation for the key storage . on the other hand , in order to perform the ssk processing for kss included in the other central processing units cpu1 through cpu3 , the order , address and data which are set in the registers 3 , 8 and 13 , are applied through select gates 23 , 24 and 25 to information transmitting registers 5 , 10 and 15 , respectively , to be set therein , and then applied on interface lines if 01 through if 30 for connecting the units cpu0 through cpu3 in cascade in a circular path . the order , address and data on the ring - like interface lines are fetched by the units cpu1 , cpu2 and cpu3 in the order described , to update respective ks &# 39 ; s of the units cpu1 , cpu2 , and cpu3 , and then return to the unit cpu0 . the order , address and data which have returned back to the unit cpu0 are set in , or latch , information receiving registers 6 , 11 and 16 , respectively . as mentioned previously , in the case where the unit cpu0 has issued the ssk request , the request is stored in the instruction registers 3 , 8 and 13 . when the order , address and data latch the information receiving registers 6 , 11 , and 16 , a judging circuit formed of a coincidence circuit such as a comparator circuit 30 , which is provided in each of the units cpu0 through cpu3 , compares the contents of the registers 3 , 8 and 13 with the contents of the register 6 , 11 and 16 and causes the ssk processing to terminate when the former contents coincide with the latter contents . the judging circuit is the same as that disclosed in the above - referenced copending u . s . application is provided in each central processing unit . the input and output ports of each cpu are preferable to have a latch function . next , explanation will be made of the ssk processing in the central processing unit cpu0 in the case where other central processing units than the unit cpu0 issue the ssk request . like the above - mentioned case , when the request is issued by one of the units cpu1 through cpu3 , an order , address and data are applied on the interface lines . the order , address and data on the interface line if 30 between the units cpu3 and cpu0 are set in the information receiving registers 6 , 11 and 16 of the unit cpu0 , respectively . the contents of the registers 6 , 11 and 16 are sent through the select gates 20 , 21 and 22 to the ks read / write registers 4 , 9 and 14 , respectively , to be set therein and to perform the ssk processing for the key storage ks1 . in order to transfer the ssk request to the succeeding unit cpu1 , the order , address and data in the information receiving registers 6 , 11 and 16 of the unit cpu0 are sent through the select gates 23 , 24 and 25 to the information sending or transmitting registers 5 , 10 and 15 to be set therein , and then are sent to the unit cpu1 through the interface line if 01 between the units cpu0 and cpu1 . as mentioned above , the signals are transferred in a single direction on the interface lines , which connect a plurality of central processing units so as to be arranged a ring - like structure , through the information transmitting and receiving registers . fig4 shows an example of the select gates . in the foregoing description , the ssk processing has been explained . the isk processing is approximately the same as the ssk processing , but differs from the ssk processing in that the key data read out of respective key storages of the central processing units are sent to that central processing unit which has issued the isk request . accordingly , when the reference bit of corresponding key data in the key storage of a central processing unit takes the level &# 34 ; 1 &# 34 ;, the corresponding key data is reflected in the key data read out of that central processing unit which has issued the isk request . in more detail , in the isk processing performed in one of the other central processing units than that central processing unit which has issued the isk request , key data read out of the ks is set in a ks data register 18 . the content of the register 18 and that content of the register 16 , which has been sent through the ring - like interface lines , are subjected to an or operation by the select gate 25 , the output of which is set in the information transmitting register 15 to be applied on the ring - like interface line if . in this case , the select gate 25 selects the input from the ks data register 18 and that from the receiving register 16 , simultaneously . the final operation of the isk processing in the central processing unit which has issued the isk request , is to perform an or operation for the key data read out of the ks of the above central processing unit and the key data read out of other central processing units , and then to send the result of the above operation to the instruction unit 2 . in more detail , when the central processing unit cpu0 issues the isk request , the key data read out of the key storage 1 i . e ., ks0 of the unit cpu0 , is set in the ks data register 18 , and the key data sent from the unit cpu3 is set in the receiving register 16 . the content of the register 18 and the content of the register 16 are sent through the select gate 26 to a fetch data setting register 19 to be set therein , and then sent to the instruction unit 2 . incidentally , reference numerals 7 , 12 and 17 designate order , address and data registers used in the fetch and store operations for the ms , respectively . these registers have no direct connection with the present invention , and therefore further explanation thereof is omitted . a signal indicating the termination of the ssk and isk processing is used as a key processing termination signal in a priority determining circuit , which will be described later . reference is made next to fig3 which shows a priority circuit for determining the priority in key processing among the central processing units , prior to the transmission and reception of an order , address and data used in the key processing . although fig3 shows the details of only the cpu 0 , the other cpus 1 , 2 and 3 have the same circuit arrangement as that of cpu 0 . the priority determining signal which circulates between the ring - like connected central processing units sequentially , is initiated in a predetermined central processing unit , when the system is initialized ( in the usual case , when a reset signal is generated ). the priority determining signal initiated in the predetermined central processing unit circulates on the ring - like interface lines ifp 01 , ifp 12 , ifp 23 and ifp 30 . the priority determining signal exists only in one of the central processing units at a time and is present for a predetermined period . the priority is given to a central processing unit which has caught the above priority signal , that is , held a one - machine - cycle pulse . fig5 is a time chart showing the above operation , and shows the case where a priority determining signal is initiated in the unit cpu0 . in fig3 a cpu n0 generator constantly generates the identification number of that cpu with a timing as seen in fig5 . accordingly , cpu 0 generates 0 ( binary &# 34 ; 00 &# 34 ;), cpu 1 generates 1 (&# 34 ; 01 &# 34 ;), cpu 2 generates 2 (&# 34 ; 10 &# 34 ;) and cpu 3 generates 3 (&# 34 ; 11 &# 34 ;), respectively , at sequential times . a decoder d provides an output &# 34 ; on &# 34 ; when cpu n0 is 0 . at this time , only the output of the decoder d in the cpu 0 becomes &# 34 ; on &# 34 ; and the outputs of decoders d in the other cpus do not become &# 34 ; on &# 34 ;. when the system is initialized and consequently a reset signal is generated by a reset circuit in the cpu 0 , a pulse produced by differentiating the trailing edge of the reset signal from the reset circuit is applied to an and gate a1 for anding the pulse and the output of cpu n0 0 . since the other cpus have no outputs &# 34 ; on &# 34 ; at their decoders d at this time , the and gates a1 of the other cpus are not enabled . thus , since the number 0 of only cpu 0 issues , the and gate a1 for cpu 0 is enabled . the output of the gate a1 turns an or gate or on , and then sets a transmitting / receiving flip - flop ff - a . the flip - flop ff - a is connected to the unit cpu1 through a interface line ifp 01 which is a part of the circular path , and the output of the flip - flop ff - a sets the flip - flop ff - a of the subsequent unit cpu1 through the gates a5 , a2 and or of the unit cpu1 . similarly , the output of the flip - flop ff - a of the unit cpu1 sets respective flip - flops ff - a of the units cpu2 and cpu3 through interface lines ifp 12 and ifp 23 . the output of the flip - flop ff - a of the unit cpu3 is supplied to the unit cpu0 through an interface line ifp 30 . the above signal supplied to the unit cpuo is inputted to an and gate a5 . the other input part of the and gate a5 is connected to a multiprocessor - configuration indicating bit of a known configuration register cfr and the above bit takes an on - state when the system has a multiprocessor configuration . accordingly , the and gate a5 turns on , and an and gate a2 turns on when the key access request is not issued . thus , the flip - flop ff - a of the unit cpu0 is again set . in other words , the flip - flop ff - a again sends the priority determining signal to the succeeding unit cpu1 , and the priority determining signal circulates around the circular path in this way so long as no key access request issues . when a key access request issues in a cpu , its key request generator ( which is constituted by logic in the iu 2 of fig2 ) generates a signal &# 34 ; 1 &# 34 ;. fig5 indicates the case where cpu 0 issued a key access request as labeled by key access request therein . in the cpu 0 , if the key request generator generates a logical &# 34 ; 1 &# 34 ; signal , the and gate a2 is disabled through an inverter i 1 . at that time , when the priority determining signal circulates from cpu 3 to cpu 0 and is then applied to the and gate a4 through the and gate a5 , the and gate a4 turns on to set the flip - flop ff - b . in response to setting of the flip - flop ff - b , the set signal of flip - flop ff - b is applied to iu 2 of cpu 0 ( in fig2 ). the iu 2 then sets an order ( 0 ), address ( a ) and data ( d ) in the registers 3 , 8 and 13 , respectively as previously stated , to thereby start the execution of key - processing ( accessing ) for the ks 1 . during turning - on of the ff - b in cpu 0 the order , address and data set in the register 3 , 8 and 13 are applied to the cpus 1 to 3 through the ring - like ( circular - path ) interfaces if 01 , if 12 and if 23 , as stated above to execute accessing to the key storage in each of cpus 1 to 3 as similarly as in the cpu 0 . the time required for key - processing to all cpus can be predetermined to be substantially constant , and a termination signal from a key processing termination signal generator in a cpu which has issued a key access request is applied to the and gate a 3 . when the and gate a 3 receives both the termination signal and the set output of the flip - flop ff - b it turns on , thereby to set the flip - flop ff - a . the flip - flop ff - b is reset by the termination signal . when the flip - flop ff - a is set , the priority determining signal begins to circulate through the cpus again as indicated in fig5 . thus , the collision for the priority can be avoided when a plurality of central processing units simultaneously issue key access requests . in the transfer system for the priority determining signal shown in fig3 the priority - determining - signal initiating circuit may be provided in each central processing unit for the purpose of standardization . it is needless to say that the above circuit may be provided only in a specified cpu . the circuit configuration shown in fig2 and 3 only illustrates one embodiment of the present invention . for example , it is possible to employ , as the address interface lines ifs shown in fig2 address interface lines for cancelling a store in a buffer storage , which is provided in a data processing system disclosed in the above - referenced u . s . application ser . no . 136 , 492 ( based upon a japanese patent application no . 41118 / 1979 ). since the frequency of key access request is usually lower than the frequency of buffer cancel request , the processing capability for buffer cancel is not lowered when the address interface lines for buffer cancel are further employed as the address interface lines ifs . when interface lines are employed both for buffer cancel and for key - access - request transfer , the number of interface lines is reduced , and therefore it is possible to design a system of high cost performance . | 6 |
as discussed in the summary of the subject matter section , the presently disclosed subject matter is generally concerned with certain noise aspects of mounted capacitor devices and related technology and manufacturing and / or mounting methodology . more particularly , the presently disclosed subject matter is concerned with improved designs for certain capacitor components and component assemblies associated with the implementation of surface mountable devices , and particularly as relates to providing low noise capacitors and related methodologies . selected combinations of aspects of the disclosed technology correspond to a plurality of different embodiments of the presently disclosed subject matter . it should be noted that each of the exemplary embodiments presented and discussed herein should not insinuate limitations of the presently disclosed subject matter . features or steps illustrated or described as part of one embodiment may be used in combination with aspects of another embodiment to yield yet further embodiments . in additional , certain features may be interchanged with similar devices or features not expressly mentioned which perform the same or similar function . reference will now be made in detail to exemplary presently preferred embodiments , and for which fig1 illustrates a schematic view of an exemplary presently - devised test arrangement generally 10 , for testing of either prior art devices or devices constructed and / or mounted in accordance with the presently disclosed technology . such a capacitor device generally 12 may be surface mounted or otherwise positioned relative to a substrate generally 14 such as a printed circuit board . in the arrangement devised , copper supports generally 16 are provided on respective sides of board 14 and may be energized during testing as represented by the indicated lead wires , and as will be understood by those of ordinary skill in the art from the illustrations of present fig1 . a high - precision microphone generally 18 may be mounted a given distance generally 20 from the substrate 14 . in an exemplary arrangement , a 2 mm distance may be practiced relative to substrate 14 , which may comprise a 100 × 40 × 1 . 5 mm pcb . the surface mounted device generally 12 to be tested may include various case sizes , such as 0201 through 1206 . the device to be tested may be , for example , solder reflowed to pads in the center of the substrate . use of the copper brackets 16 facilitate repeatable placements of test substrates , with the microphone positioned on the opposite side of the substrate from that where the device to be tested is mounted . a foam enclosure ( not shown ) may be provided around the entire arrangement to reduce stray noise . with such an arrangement , the noise floor may be approximately about − 6 db , over a frequency range of interest of about 1 to 10 khz . in an exemplary arrangement , a brüel & amp ; kjær ½ ″ microphone and preamp were used in conjunction with a brüel & amp ; kjær photon + signal analyzer . an hp 33120a function generator was used in conjunction with a krohn - hite model 7500 amplifier used to energize the test item with a 1 - 5 khz swept sine wave ; 3 . 15 vac ; 3 . 15 vdc ; 0 . 1 s sweep rate . most high cv capacitors tested had a 6 . 3v rating so test waveforms were set up to operate between 25 % and 75 % of 6 . 3 volts ( about 1 . 6 to 4 . 7v ). while various set - up arrangements may be practiced , those of ordinary skill in the art will appreciate that such microphone geometry and placement provides an effective arrangement for capacitor electro - mechanical noise testing , as represented by the concentric half - circle vibration waves illustrated in fig1 , emanating from both the tested device 12 and the board 14 . as otherwise discussed herein , present fig2 a , 2 b , 2 c , and 2 d are various perspective and cross - sectional views of prior art multi - layer ceramic capacitor ( mlcc ) devices , such as shown by fig2 and 3 of commonly owned u . s . pat . no . 7 , 352 , 563 . such a mlcc may have , for example , a ni — sn plating over a thick film cu termination , in conjunction with a main body having interdigitated or interlaced plural sets of electrode structures 22 and 24 of opposite polarity , as will be understood by those of ordinary skill in the art . fig3 is a graph of comparative sound pressure testing resulting from use of a testing arrangement as represented by present fig1 , performed on existing mlcc devices such as represented by present fig2 a through 2d . it graphs sound pressure level ( spl ) ( in dbs ) versus applied frequencies ( in hz ). the noise floor is what &# 39 ; s represented by an empty test chamber . as shown , a representative peak occurs per this testing at 49 . 3 db , within the tested frequency range of between 1 to 9 khz . a corresponding figure of merit indication is made out by the area under the spl curve and in this instance amounts to about 2 . 0 pa · hz . the essentially same testing arrangement is used in conjunction with exemplary embodiments of the presently disclosed subject matter , as otherwise discussed herein . fig4 a and 4b are simple schematic representations of aspects of mounting mlcc devices on printed circuit boards ( pcbs ), in accordance with presently disclosed subject matter , and which contribute to reductions in electro - mechanical noise from such combinations . as represented , a representative presently disclosed mlcc device generally 26 is received ( mounted and / or supported ) relative to a supporting substrate generally 28 ( such as a pcb ). fig4 a represents technological approaches which provide a dampening aspect in such combination as between device 26 and substrate 28 . fig4 b represents resulting force reductions which can otherwise cause mechanical forces and resulting noise in the supporting substrate . as schematically shown by such embodiments , there is a reduction in the supportive / connective footprint as between the device 26 and substrate 28 , resulting in particularized arrangements of reduced vibration force transmission between the two . fig5 a is a cross - sectional view of an exemplary first embodiment of the presently disclosed subject matter , involving compliant termination technology , for relatively reducing electro - mechanical noise . fig5 b is a graph of testing resulting from use of a testing arrangement as represented by present fig1 , performed on the presently disclosed exemplary embodiment such as represented by present fig5 a , and comparing such results with results for a prior art thick cu film terminated device , such as represented in prior art present fig2 d . in contrast to the thick film copper termination of prior art fig2 d , the presently disclosed fig5 a exemplary embodiment has an ag - polymer termination over a relatively thinner cu layer ( or “ flashing ”). such more compliant polymer termination acts as “ cushion ” and dampens against the coupling of vibrations between the capacitor device and the pcb . while ag - polymer is shown as a specific example , it is to be understood by those of ordinary skill in the art from the complete disclosure herewith that more generally conductive polymer or polymer may be practiced rather than being restricted to only ag - polymer . as shown by present fig5 b , test results for the presently disclosed embodiment of present fig5 a are represented by the right side datapoints , and compare with the left side datapoints from the prior art device ( of fig2 d ). a reduction of about 6 db is achieved . since the db axis is logarithmic , the reduction represented is on the order of magnitude of cutting the transmitted sound ( spl or noise ) by half . the thick film copper termination prior art embodiment ( fig2 d ) has about a 120 gpa modulus while the presently disclosed subject matter exemplary embodiment of fig5 a has a less than 5 gpa modulus . such exemplary embodiments for testing purposes involved 0805 10 microfarad mlcc devices . thus , the compliant termination presently disclosed embodiment is shown to have a significant noise reduction over the prior art embodiment . fig6 a and 6b are perspective and cross - sectional views , respectively , of another exemplary embodiment of the presently disclosed subject matter , involving molded packaging technology , for relatively reducing electro - mechanical noise . fig6 c is a graph of testing resulting from use of a testing arrangement as represented by present fig1 , performed on the presently disclosed exemplary embodiment such as represented by present fig6 a and 6b . the subject molded package embodiment involves use of a lead frame to decouple capacitor distortion from the pcb . the length of the wire path and the respective top and end attachment points as shown provide such decoupling . also , a polymer coating helps to dampen device noise . further , a so - called a - case package mounts as lga ( land grid array ) style package on 0805 solder pads . fig6 c graphical represents test results between a standard 0805 mlcc device ( of the style as presented by present prior art fig2 d ) versus an 0805 a - case sample , using the molded packaging technology presently disclosed , for a 22 microfarad device . as shown , the presently disclosed technology provides anywhere from a 12 to 28 db reduction in the peak spl , thus representing significant improvement over the prior art . fig6 d through 6f show conceptual cross - section views of three respective different exemplary embodiments of capacitors and solder pads on mounting substrates . fig6 d is a multilayer ceramic capacitor device on corresponding mounting pads , that is , an 0402 mlc mounts on pads designed for an 0402 device , 0603 mlc on 0603 pads , and so forth . fig6 e shows a given mlc capacitor inserted in a molded device that is physically larger than mlc itself , such that the molded device mounts on solder pads designed for that case - size molded part . per eia industry standards , r - and n - case size molded devices mount on 0805 solder pads , a - case molded parts mount on 1206 solder pads , and b - case molded devices mount on 1210 pads , and so forth . in particular , such industry standard mounting allows solder fillets to form on the ends of the molded devices , as shown conceptually in fig6 e . however , if molded devices are mounted on solder pads designed for one case size smaller chip , as shown conceptually in fig6 f , then solder fillets on the end of the molded device are substantially eliminated . in other words , r - and n - case size molded devices would be mounted on 0603 pads , a - case devices on 0805 pads and b - case devices on 1206 - pads , and so forth . as shown graphically in fig6 g , it is possible to compare the acoustic output as peak sound pressure level , in db , of a typical 0603 mlc with capacitance in the range of 2 . 2 to 22 μf mounted on 0603 mounting pads ; an a - case molded device containing mlc inserts of the same range of values molded on industry standard 1206 mounting pads ; and those a - case devices mounted on smaller 0805 pads that eliminate solder - end fillets . the acoustic output of a - case molded devices is reduced relative to the bare mlc inserts , and furthermore the acoustic output of the molded device mounted on solder pads that eliminate the solder - end fillets is reduced relative to the molded device mounted with solder fillets . as shown graphically in fig6 g , it is possible to compare the acoustic output as peak sound pressure level , in db , of a typical 0402 mlc with capacitance in the range of 0 . 1 to 10 μf mounted on 0402 mounting pads ; an r - case molded device containing mlc inserts of the same range of values molded on industry standard 0805 mounting pads ; and those r - case devices mounted on smaller 0603 pads that eliminate solder - end fillets . the acoustic output of r - case molded devices is reduced relative to the bare mlc inserts , and furthermore the acoustic output of the molded device mounted on solder pads that eliminate the solder - end fillets is reduced relative to the molded device mounted with solder fillets . table 1 lists several examples of industry standard molded devices and mlc &# 39 ; s and non - standard land - grid - array ( lga ) mount pad geometries that minimize solder - end fillets to reduce acoustic output . fig7 a is a representative example of an 8 - terminal mlcc device in accordance with the prior art device designs of present fig2 a through 2d . fig7 b is a perspective view of another exemplary embodiment of the presently disclosed subject matter , involving side terminal technology , for relatively reducing electro - mechanical noise . fig7 c is a graph of testing resulting from use of a testing arrangement as represented by present fig1 , performed on the presently disclosed exemplary embodiment such as represented by present fig7 b , and comparing results from such testing with testing on a prior art embodiment such as shown by present fig7 a . the side terminal exemplary embodiment utilizes reduction functionality and subject matter such as represented generally by present fig4 b , with a relatively reduced coupling footprint . again , reduction of about 6 db is shown by the comparative test results of present fig7 c . fig8 a through 8c are perspective and component side elevational and board side elevational views , respectively , of another exemplary embodiment of the presently disclosed subject matter , involving pre - mounted mlcc transposer technology , for relatively reducing electro - mechanical noise . fig8 d is a graph of testing resulting from use of a testing arrangement as represented by present fig1 , performed on the presently disclosed exemplary embodiment such as represented by present fig8 a through 8c , and compared with a prior art mlcc embodiment such as the design of present fig2 d . again , an 0805 size device is used for some of the comparison datapoints , while ( as shown ) 0603 size embodiments are utilized in some instances . the term “ transposer ” is used because literally the location of the mounting pads is transposed for a given case size mlcc to pads for smaller case sized devices . this results in a reduction in the effective bonding area , a decrease of the span between mounting pads , reduction of the lga - type solder fillet , and an increase in the mlcc device stand - off . for example , fig8 b illustrates from the component side , an 0603 footprint generally for the capacitor mounting pad generally 30 as used with solder mask 32 for mounting on representative substrate 34 . however , fig8 c , illustrating from the board ( or substrate ) side , shows that the transposer mounting pad generally 36 results in an 0201 footprint ( generally dotted line area 38 ). thus , the electronic industries alliance ( eia ) mounting size is transposed by such embodiments . note that eia case size codes as discussed herein are with reference to inches . the following table 2 reflects the various reductions in effective bonding areas which may be achieved with practice of such presently disclosed subject matter . further , fig8 d represents graphical illustration of the significant peak spl data reductions ( on the order of 12 to 20 db ) achieved by such presently disclosed devices relative to prior art mlcc devices . such fig8 d graph also represents 60 to 90 % reductions in the figure of merit ( fom ) data . present fig9 is a graph of comparative sound pressure level testing resulting from use of a testing arrangement as represented by present fig1 , performed on presently disclosed mlcc devices pre - mounted on a substrate such as represented by present fig8 a through 8c . as shown , the peak spl shown over the 1 to 9 khz range is about 23 . 8 db , which is far less than the 49 . 3 db peak spl show in the graph of present fig3 . likewise , the figure of merit is reduced to an area determination of about 0 . 4 pa · hz , down from the about 2 . 0 pa · hz datapoint obtained in conjunction with fig3 testing . comparison testing summaries relative to such fig3 graph for the four different exemplary embodiments of presently disclosed subject matter is set forth in the following table 3 . the following table 4 summarizes the relative efficacy of presently disclosed embodiments of electro - mechanical noise ( peak spl ) reduction relative to size adjustment and cost factors . such comparative aspects may tend to indicate selection of one particular presently disclosed embodiment over another for a particular application or set of user needs / criteria . while the presently disclosed subject matter has been described in detail with respect to specific embodiments thereof , it will be appreciated that those skilled in the art , upon attaining an understanding of the foregoing may readily adapt the presently disclosed technology for alterations or additions to , variations of , and / or equivalents to such embodiments . accordingly , the scope of the present disclosure is by way of example rather than by way of limitation , and the subject disclosure does not preclude inclusion of such modifications , variations , and / or additions to the presently disclosed subject matter as would be readily apparent to one of ordinary skill in the art . | 8 |
before explaining at least one embodiment of the present invention in detail , it is to be understood that the invention is not limited in its application to the details of construction and to the arrangements of the components set forth in the following description or illustrated in the drawings . the invention is capable of other embodiments and of being practiced and carried out in various ways . also , it is to be understood that the phraseology and terminology employed herein are for the purpose of description and should not be regarded as limiting . as previously mentioned , the present invention can serve many purposes , including : the management and bioremediation of contaminated sites , the detection of microorganisms in terrestrial and extra - terrestrial environments , the risk assessment of microorganisms introduced into natural environments , and the search for novel microorganisms , enzymes and / or compounds applicable to biotechnology . the present invention provides both a monitoring tool and an analysis strategy or method . these allow for the automated , rapid and simultaneous determination of many key bioremediation parameters and the identification of microbial communities indigenous to natural soil and water environments , and the discovery of microorganisms of potential value for use in biotechnology . the present invention for the first time allows for the cultivation , selective enrichment and comprehensive biochemical characterization of microorganisms in their natural environments . its technology : ( a ) combines the following tools / approaches : solid - phase sampling techniques , in situ enrichment and biochemical screening , use of electron donor / acceptor pairs , isotope labeling and massive parallel screening with automated analysis , ( b ) makes use of in situ microcosm arrays in conjunction with culture - independent microbial community analysis to obtain a comprehensive picture of microbial communities , ( c ) can provide data for hundreds or even thousands of hypothetical environmental scenarios , thereby allowing one to determine quickly and in an automated fashion the likely rates of environmental change induced by these perturbations , ( d ) is suitable for linking specific microbes to observed reactions by using computer - assisted subtractive profiling techniques , ( e ) is fully compatible with existing robotic systems , thereby allowing for rapid and fully automated analysis using chemical , physical , biological , genomic and proteomic analysis techniques , ( f ) allows one to determine how non - native microorganisms will cope in natural environments when confronted with physical , biological and / or chemical stressors , ( g ) can be optimized for exclusive in situ applications , ex situ applications , or a combination of the two , and ( h ) allows for proteomic approaches to be used for rapid and fully automated analysis ( e . g ., matrix assisted laser desorption / ionization time - of - flight mass spectrometry ( maldi - tof ms ) and protein sequencing of enzymatic digests using tandem mass spectrometry ( ms / ms )). one embodiment of the present invention takes the form of an in situ microcosm array ( isma ) sampler or testing device 1 . as shown in fig1 - 4 , its principal components include : a housing or container 10 having a fluid inlet 12 and outlet 14 , a plurality of capillary microcosms 16 situated within this housing , with these capillaries 16 making up what is referred to as a microcosm array , each of these capillaries 16 having an inlet 18 and outlet 20 that are configured so as to allow for fluid flow through the capillaries 16 , each of these capillaries contains a filtration material 22 that is selected for its ability to foster microorganism collection in the individual capillaries , upper 24 and lower 26 valve plates having openings 28 that are configured to be alignable with the capillary inlets 18 and outlets 20 , a pneumatic cylinder 30 with coupling means 32 and an assortment of springs 34 serves to enable these valves to be moved laterally so as to open or close the capillaries &# 39 ; inlets 18 and outlets 20 , gasketing pads 36 , 38 serve to prevent leakage from these openings , a pump 40 is connected to the container &# 39 ; s inlet 14 and is sized so that it can draw fluid from the environment surrounding the container 16 and push it through the container &# 39 ; s inlet 12 and through the capillaries 16 , a collecting device or a bladder 42 is connected to the pump &# 39 ; s outlet and is used to collect the flow through the container 16 , a check valve 44 connected between the pump 40 and bladder 42 prevents backflow of fluid through the container 16 , a weight 46 serves to provide ballast for suspending via an umbilical cable 48 the sampler 1 down a suitably drilled well that extends into the region of interest . the initial isma prototype samplers of the present invention were based on commercially available 96 - position ( 8 × 12 ) microtiter plate format ( e . g ., wheaton scientific products ); similar 384 , 1536 ( or more ) plate formats could have been used . each well or “ microenvironment ” of the initial prototype samplers consisted of a teflon block with 96 drill holes representing individual microcosm capillaries ( 1 . 12 ml ; 0 . 295 inch [ diameter ]× 1 inch [ length ]). the inclusion into the isma sampler 1 of a pump 40 , closure mechanism valve plates 24 , 26 , and semi - permeable membranes allows one to first inoculate and then incubate the device in the environment without removing ( and potentially harming ) the resident microbes from their natural environment . pump configurations other than those shown in the drawings include , but are not limited to , multi - channel pumps and pump arrays that deliver fluids to the inlet of one or more individual microcosm capillaries . the isma sampler 1 of the present invention can be equipped with a collecting device or a bladder 42 . fluid flowing through the array exits the container and is collected in the bladder . displacement of air from the collection device may be desirable , and can be achieved by inclusion in the collection device of a bleed valve allowing air to escape via a piece of tubing rising along the umbilical cable to a location some distance above the fluid intake . as the fluid flows through the device , microorganisms and chemicals can be trapped in the capillary microcosms 16 . when the collection device is full , a float can trip power to the pump and actuate the valve plates 24 , 26 of the closure mechanism , thereby sealing the array . immediately , or after an additional incubation period in batch mode , the device 1 can be removed from the environment for further analysis . the isma sampler 1 of the present invention can be designed for reuse . for this purpose , the invention can be equipped with a means allowing for rapid exchange of microtiter plates . exchangeable microtiter plates can be manufactured to allow for long - term storage prior to use . for this purpose , the content of customized microtiter plates can be lyophilized and vacuum sealed . breaking of the vacuum and rehydration of the microtiter content will ready the device for testing . microtiter contents include , but are not limited to , a means for containing a specified test substance , a test compound , and a test organelle or microorganism . the isma sampler 1 of the present invention can be equipped with a means for capturing microorganisms and chemicals of interest . such a means can be chosen from the group comprised of sorption , precipitation , sedimentation , coagulation , filtration , straining , extraction , chromatography , affinity separation , size exclusion separation , passive attachment to presented surfaces , and active attachment to presented surfaces . the isma sampler 1 of the present invention can be equipped with microfluidic systems allowing for delivery of small liquid volumes and defined quantities of organelles to the test chamber prior to physical and / or chemical containment of the captured specimens via barriers that are either non - permeable , semi - permeable or completely permeable for chemical compounds . this aspect allows one , for example , to culture uncultivated or “ non - culturable ” bacteria to numbers sufficiently large to perform biochemical characterization and identification . this sampler also may be adapted for studying the fate of either beneficial or hazardous chemical agents in natural environments . in this application , the sampler 1 is modified to reflect as closely as possible within each test compartment or microcosm the physical , chemical and biological environment of interest ( e . g ., flow - through cells equipped with local sediment etc .). test chemicals are included in the sampler prior to its deployment and diffuse from within the sampler into the ambient fluid . following interaction with the local environment , all chemicals are captured in the bladder . this sampler also may be adapted for studying the fate of either beneficial or hazardous biological agents in natural environments . in this application , the sampler 1 is modified to reflect as closely as possible within each test compartment or microcosm the physical , chemical and biological environment of interest ( e . g ., flow - through cells equipped with local sediment etc .). test organisms are inoculated into the sampler prior to its deployment and the sampler is incubated in situ allowing for interaction of the test organisms or species with the environment without allowing for its release . modification of the sampler &# 39 ; s closure valve plates 24 , 26 allows for sequential opening and closing of its microcosm compartments . real - time and monitoring equipment ( ph , eh , temperature , do , etc .) can be added to the sampler 1 to increase functionality and to trigger reactions at specific points in time selected by changes in the target environment ( e . g ., heavy rainfall events ). use of radio frequency signaling and remote controls can replace the standard umbilical cord 48 that is used to communicate with the sampler 1 , and to determine the chemical change occurring during incubation . it should be noted that the design of the device can be altered to allow deployment of the device in environments featuring extreme conditions including , but not limited to , extreme ph , temperature , pressure , radiation , gravity conditions different from that of planet earth , etc . additionally , many types of microfluidics , filters , sorbent materials , semi - permeable membranes and alternative closure mechanisms may be integrated into the sampler to separate in time its inoculation from the incubation period that allows chemical change to take place within the sampler 1 . it should further be noted that the method and device can be used for bioprospecting and environmental monitoring in any fluid - containing environment including , but not limited to , subsurface environments , surface environments , saturated environments in space , and macroorganisms dead or alive . optical and / or electrical detection systems may be incorporated in the microfluidic configurations of the sampler 1 to seal individual microcosms as soon as a single cell has been delivered to the microcosms , thereby greatly increasing the success rate of isolating novel microorganisms . for example , optical sensors detecting the entry of individual microorganisms into the device , can trigger translation of the valve plates to move from the “ open ” position into the “ closed ” position . different surfaces can be presented in the “ closed ” to position . if the presented surface is impermeable to the microorganism and the flow of water , complete confinement is achieved . if the presented surface is a semi - permeable membrane , water can continue to flow through the device whereas the microorganism is held in confinement . the present invention &# 39 ; s approach for the identification of microorganisms involves looking for gene expression products ( i . e ., proteins ) as well as for their characteristic dna sequences . for example , ribosomal proteins are used as biomarkers to identify microorganisms by maldi tof ms . for the rapid automated detection of specific microorganisms by maldi tof ms , individual microcosms can be configured to support only the growth of specific microorganisms . this is achieved by including in the microcosm chemicals that foster the growth of the target microorganism while suppressing the growth and survival of non - target microorganisms . for example , a combination of selective substrates and antibiotics can serve for this purpose . this type of selective culturing , a common strategy in the microbiology laboratory , is now being performed in situ . by doing so , growth of specific microorganisms and expression of key biomolecules can be achieved . selective in situ culturing of specific microorganisms then allows for direct detection and identification of these biological agents by mass spectrometry . it makes unnecessary the need for extensive sample preparation and cleanup because of the enhanced signal - to - noise characteristics of the enriched sample . this in situ cultivation technique can also be used to determine the metabolic and catabolic activity of microorganisms in situ . for this purpose , the presented chemicals can contain isotopic labels such as isotopes of carbon - 12 ( e . g ., 13 c , 14 c ). use of the invention in conjunction with sip and nonculture - dependent microbial community profiling tools is another important application . the advantages of this process are illustrated in fig5 a - 5c as applied to the bioremediation of saturated subsurface environments containing uranimum . conventional microbial community analysis produces a picture as shown in fig5 a ; the technique detects the presence of all bacteria ; however , it does not provide information on their metabolic activity . the use of isotope - labeled nutrients can reveal which of the detected microorganisms are metabolically active ( right half of the community shown in fig5 a ). use of the isma sampler 1 allows for the determination of 96 or more community profiles determined under various environmental conditions ( e . g ., a screening study in which uranium is being presented at various concentrations ), see fig5 b . computational analysis of the resulting data using subtractive community profiling allows one to identify important pollutant - transforming microorganisms within the large group of active microorganisms ( not all metabolically active bacteria are partaking in the bioremediation process ). environmental conditions in the sampler allow for the selective enrichment of pollutant - degrading bacteria ; some of these may be detected for the first time , see fig5 c . under appropriate conditions , a poorly represented population may be enriched to a level allowing for maldi tof ms - based detection / identification . to discern which of the potentially relevant microorganisms detectable at a given site are performing a desired reaction , sip methods may be used . stable isotopes are used as chemical reporters to help to discriminate metabolically active bacteria from dormant or dead community members and from those performing functions unrelated to desired bioremediation or biostimulation . isotope labeled substrates ( e . g ., 13 c - labeled acetate ) may be used as chemical reporters of biotransformation activity in a miniaturized , field - deployable , down - well isma . as previously mentioned , each of these devices holds different , physically separated test environments , “ test wells ” or capillary microcosms . the method of the present invention begins with placing a suitably configured isma in the environment to be examined ( e . g ., a contaminated , underground site which is accessed by a monitoring well ). once the isma has been lowered into a monitoring well to the desired depth , it is triggered from the surface via an electrical signal conducted by a wire ( or via other means such as a programmed build - in mechanism ). triggering of the device exposes each of the “ test wells ” to the flow of groundwater . microorganisms suspended in the groundwater attach themselves to the presented surfaces and become trapped in the device . additional free - living microbes become trapped once the device receives the signal to close again . some of the test wells may include the contaminant of concern . individual test wells may also contain , as previously mentioned , one stable - isotope labeled nutrient for determining its effect on microbial growth and activity . the now closed device is incubated in situ to allow for growth of microorganisms on the labeled substrates . during this incubation period , all bacteria directly or indirectly involved in the utilization of isotope - labeled electron donors become enriched in isotope - labeled dna . following retrieval of the tool from the well , microorganisms are collected from the device and their isotope - labeled , higher - density dna is separated from background dna by density - gradient centrifugation . this higher - density dna ( and the non - labeled dna ) is then analyzed using known molecular techniques . oligonucleotide microarrays serve to identify / enumerate target - specific organisms whereas clone libraries may be used to identify novel , uncultured microorganisms . the device may , ideally , be used in conjunction with commercially available robotics for automated extraction of dna . the extent of microbially induced corrosion of metals / radionucliudes may be measured optically by scanning a metal surface placed within the isma with a laser ; alternatively , contaminant biotransformation may be detected biochemically via addition of a dye / reporter or electrochemically via measurement of electrical resistance . measurements can be performed real time in situ or post - deployment via analysis of the capillary content , the bladder content , and sorbent materials that were integrated in the device and had an opportunity to chemically interact with fluid drawn into the device . if uranium is the contaminant of concern , analysis of an uranium - coated surface allows for determining the extent of uranium reduction and the calculation of pollutant removal rates occurring under in situ conditions . as previously mentioned , test wells of the device also may be equipped with a matrix allowing for the slow , continuous release of chemicals ( e . g ., external carbon and energy sources ; other nutrients ; conditioning agents such as ph or redox agents ). the matrix may be a polymer or a membrane vesicle containing the nutrient in question . diffusion characteristics of the matrix / membrane are selected to achieve different nutrient levels in each of the test wells if desired . presented nutrients may be added in solid , liquid or gaseous state . energy sources may be presented in the presence and absence of pollutant coating . some of the test wells may be configured for continuous flow - through operation in situ . flow through the device may be passive or active . in active devices , a small pump 40 facilitates groundwater movement whereas tubing of various length and configuration is used to prevent the effluent of one test well from becoming the influent of another . fig6 shows one possible configuration of a 96 - well microtiter plate configured for environmental monitoring and bioprospecting at a hypothetical site containing groundwater contaminated with fuel hydrocarbons from a point source , and dibenzofuran , and the pyrethroid degradate 3 - phenoxybenzoic acid ( 3 - pob ) from non - point sources . the 96 microcosm capillaries are aligned in parallel in 12 columns (“ a ” through “ l ”) and 8 rows (“ i ” through “ viii ”). in the microtiter plate customized for this site , all capillaries contain a webbing material for capturing microorganisms . near the inlet in the front half of each microcosm capillary , the webbing material contains noble agar beads serving as an inert diffusive matrix . near the outlet in the back half of each microcosm capillary , the webbing material contains sorbent beads to which contaminants can sorb . capillary ai does not contain any test substances or microorganisms . when the isma is deployed in flow - through mode in the contaminated aquifer , chemical conditions reported for microcosm ai by real - time sensors are reflective of ambient groundwater quality . similarly , chemical analysis of the sorbent beads contained in microcosm ai will yield a time - integrated measure of the contaminant mass that passed through the microcosm during deployment in local groundwater . following capture of microorganisms in the isma during flow - through mode , the valve plates are translated to close the device . real - time sensing data for microcosm ai , now incubated in batch mode , will inform on the kinetics of pollutant degradation under ambient conditions ( intrinsic bioremediation rate ; loss of contaminants as a function of time ). if the groundwater passing through microcosm ai is anaerobic ( isma deployment location 1 ; immediately downgradient of the leaking fuel tank ), biodegradation of fuel hydrocarbons will be slow and incomplete . in order to accelerate the biodegradation process , a number of electron acceptors can be considered . rapid , simultaneous screening of common electron acceptor compounds is achieved within the isma in microcosms in row “ i ” ( bi through ii ). individual electron acceptor compounds presented in these microcosms reflect a redox gradient ranging from highly oxidizing to more reducing conditions : bi , oxygen releasing formulation ( a ); ci , nitrate ( b ); di , nitrite ( c ); ei , manganese oxide ( mno 2 ) ( d ); fi , iron ( fe ( iii ) ) ( e ); gi , uranium ( u ( vi ) ) ( f ); hi , chromium ( cr ( vi ) ) ( g ); and ii , sulfate ( h ). by incubating the isma in batch mode with these electron acceptors present in excess concentrations relative to the contaminants , real - time sensors from microcosms bi through ii will directly report on the results of this screening study of biodegradation of fuel hydrocarbons under a variety of redox conditions . once the optimal redox conditions have been identified , it is of interest to determine what dosage is needed . assuming that pollutant turnover was most rapid in the microcosm bi containing oxygen - releasing formulation ( a ), the optimal dosage of this “ nutrient ” can be inferred by comparing the degradation rates obtained in microcosms containing 5 - fold ( ji ), 10 - fold ( ki ), and 50 - fold ( li ) higher levels of oxygen - releasing formulation relative to microcosm bi . thus , data obtained with the top row of microcosms already has yielded estimates of intrinsic and enhanced biodegradation rates , and resulted in the identification of the most favorable redox conditions , as well as the optimal dosage of electron acceptors . other nutrients and conditions can be screened in a similar fashion . the effectiveness of chemical treatment for the cleanup of groundwater at the fuel spill site is investigated using second - row microcosms aii through fii . the removal of hydrocarbons by fenton &# 39 ; s reagent ( m ) and potassium permanganate ( n ) is evaluated . in the configuration shown , microcosm aii and bii are covered with an inert membrane filter that allows liquid to flow through the capillaries whereas the entry of microorganisms is prevented . sequential incubation of these microcosms in flow - through and batch mode allows for a direct in situ comparison of the two oxidation agents or chemical treatment strategies . microcosms cii and dii are not sealed with an inert membrane but are otherwise identical to aii and dii , respectively . direct comparison of chemical data from these two pairs of microcosms allows one to evaluate whether biotransformation and chemical oxidation processes can occur simultaneously . for site assessment purposes , identical isma samplers will be deployed at various locations at a given site . for the hypothetical site discussed here , deployment location 2 is far downgradient of the release site , outside of the hydrocarbon contaminant plume . in this location , groundwater is expected to be aerobic and will contain only contaminants from non - point sources . in this case , these are represented by 3 - phenoxybenzoic acid and dibenzofuran . seeding of the isma sampler with viable microorganisms ( hydrated or lyophilized ) is useful for evaluating bioaugmentation and environmental risk assessment of pathogenic and non - pathogenic microorganisms . the customized isma sampler considered here , has been seeded with 10 million microorganisms of a particular kind per microcosm ( eii through hii ): eii , escherichia coli o157 : h7 , a pathogen ( o ); fii , sphingomonas wittichii rw1 , a dibenzofuran - degrading bacterium ( p ); gii , pseudomonas pseudoakaligenes strain pob310 , a 3 - phenoxybenzoate - degrading microorganism ( q ); and hii , pseudomonas sp . strain b13 - d5 , a genetically engineered microorganism ( r ) specifically designed to degrade 3 - phenoxybenzoic acid rapidly and completely . one way of evaluating the survival of these microbes in the target environment , is to enumerate culturable cells following deployment , incubation , and retrieval of the isma sampler . the effect of environmental conditions on the survival of seeded microorganisms can be evaluated by comparing microbial counts obtained for identical microcosms incubated in different locations , e . g . the survivability of the pathogenic e . coli strain at deployment locations 1 and 2 can be assessed by comparing the two viable counts obtained for microcosm eii . strain rw1 is a naturally occurring bacterium capable of utilizing dibenzofuran as a carbon and energy source . its detection in the dibenzofuran - contaminated aquifer could indicate an intrinsic bioremediation potential for this chemical at the site . one detection technique for the microorganism is the use of strain - specific pcr primers and probes . alternatively , the bacterium can be detected by mass spectrometry . however , if strain rw1 is present in site groundwater , its environmental density will be orders of magnitude lower than required for this task . the isma compartment iii is configured to overcome this limitation . microcosm iii contains the selective substrate dibenzofuran ( s ). during in situ incubation of microcosm iii in batch mode in aerobic groundwater , strain rw1 is allowed to increase in density from non - detectable to detectable levels by growing at the expense of dibenzofuran . the presence of dibenzofuran serves two purposes . first , it allows the target bacterium ( rw1 ) to grow to levels sufficiently high for detection by mass spectrometry (& gt ; 10 ^ 7 cells total per microcosm ); second , it increases the expression of dioxin dioxygenase , a characteristic enzyme serving as the target for mass spectrometric identification of rw1 . the combined effect of in situ growth of rw1 and induction of high levels of dioxin dioxygenase in cells of rw1 is an enhanced signal - to - noise ratio during mass spectrometric analysis ( in situ biomarker amplification ): levels of dioxin dioxygenase are high relative to the background of non - target proteins contained in the mixture of environmental microorganisms . under starvation conditions , microorganisms may divide several times to form ultra - microbacteria ; in these instances , viable cell counts indicate bacterial growth ( proliferation ) whereas , in actuality , the local bacterial population is on the brink of extinction . the isma can assist in distinguishing between true microbial growth and the starvation effect described above . this goal is achieved with microcosm jii that contains the microorganism rw1 ( p ) and a stable isotope labeled ( 13 c - containing ) analog of dibenzofuran ( s ). following incubation of the microcosm in situ , its content can be analyzed by mass spectrometry . successful in situ growth of strain rw1 will be revealed by the detection of a mixture of light ( non - labeled ) and heavy ( isotope - labeled ) peptides of the dioxin dioxygenase ; the ratio of heavy isotopes - to - low isotopes detected by mass spectrometry informs about the rate of 13 c - dibenzofuran uptake in situ , a measurement that cannot be obtained in field tests because the massive injection of isotope - labeled compounds is cost - prohibitive and faces regulatory obstacles . microcosm kii can be used to illustrate the benefit of data normalization achievable by incorporation of standard microcosms into the isma sampler . microcosm kii is identical to jii but sealed with an inert semi - permeable membrane that excludes the entry of indigenous groundwater microorganisms . this microcosm can serve as a benchmark for metabolic activity at the sampling location . for example , when isma samplers are deployed year - round in the shallow aquifer of deployment location 2 , the turnover of 13 c - dibenzofuran and assimilation of 13 c will undergo seasonal fluctuation as a result of subtle changes in water temperature . the direct comparison of datasets obtained with identically configured ismas deployed at different points in space and time can be achieved via normalizing the results using the readouts from standard microcosms such as kii . by doing so , results for the microcosms in row “ i ” obtained over the course of the year may collapse into a single value . if they do not , this may indicate a relative loss of hydrocarbon degradatation activity in the aquifer . following deployment and retrieval of the isma sampler , the microbial community of each capillary microcosm can be analyzed using culture - independent techniques such as dna extraction , amplification of the 16s rna genes , separation of amplification products by denaturing gradient gel electrophoresis ( dgge ), and sequencing of bands followed by phylogenetic sequence analysis . linking microbial function and phylogeny is an important goal . subtractive community profiling , i . e ., eliminating irrelevant information from large datasets by subtracting multiple datasets from each other , represents one possible way of identifying within a large number of microorganisms the ones that are responsible for a biochemical process of interest ( fig5 a - c ). another approach to achieve this goal is the use of stable isotope probing . the isma technology greatly enhances the utility of this technique for three reasons . one , it facilitates inexpensive sip analysis by minimizing the volume of liquid required to be spiked with expensive isotope labeled compounds . two , it allows for batch incubation which increases the labeling efficiency dramatically when compared to labeling in open systems . three , it avoids the regulatory hurdles associated with injecting isotope - labeled compounds into target environments during field tests . the utility of the isma technology for use with sip is illustrated by microcosm aiii and biii . microcosm aiii is identical to microcosm iii except for the fact that the dibenzofuran contained therein is labeled with 13 c . following use of the isma sampler in deployment location 2 , culture - independent microbial community analysis of microcosm iii will yield a large number of dna sequences some of which may correspond to naturally occurring dibenzofuran - degrading microorganisms . these cannot easily be distinguished from the large background of other bacteria , however . analysis of microcosm aiii by sip will aid in their identification . following in situ deployment of the isma sampler , dna is being extracted from microcosm aiii . the obtained dna is spun in a cesium chloride density gradient to separate 12 c - dna from 13 c - dna . analysis of 13 c - dna by pcr , dgge and dna sequencing will reveal the identity of microorganisms involved in the turnover of dibenzofuran . assuming that a sequence corresponding to a single 13 c - labeled microorganism is detected , and that its dna sequence information is different from that of rw1 , then a novel microorganism capable of metabolizing dibenzofuran has been discovered with the isma technology . if the 13 c - labeled metabolites detectable in microcosm aiii are different from those reported for strain rw1 , then a novel biochemical process has been detected , whereas the metabolite itself may represent a novel natural product of potential commercial value . similarly , detection of significant fungal growth in microcosm biii ( containing 13 c - labeled sucrose ; t ) and concurrent lack of detection of 13 c - labeled dna corresponding to gram - positive bacteria can reveal the presence of a fungal natural product suitable for the treatment of gram - positive infections in animals and humans . replicates of individual test systems can be distributed randomly within the 12 × 8 microtiter format . analysis of replicate systems informs about the precision of the experimental data obtained . replicates shown in fig6 include : for ai - ciii to liii , for row i - rows iv , vi and viii , for row ii - rows v and vii . the test systems disclosed herein will report on intrinsic ( bioremediation ) biocorrosion potential and rates . computational analysis of the resultant data sets using subtractive profiling adds a hitherto unattained discriminatory power to the analysis of both microbial community composition and function in subsurface environments . the technology of the present invention uses various proven techniques and technologies in a novel and non - obvious way to achieve the desired goal : the rapid automated analysis of field samples for microbial community composition , degradative potential , and degradative activity under prevalent conditions and under those conditions that may be created in situ to accelerate the bioremediation process . techniques / technologies incorporated in the present invention include : 1 ) down - well tools for sampling for monitoring wells 2 ) microtiter - plate testing and fully automated analysis 3 ) slow - release compounds for continuous release of microbial nutrients 4 ) membrane technology for delivery of nutrients 5 ) micro fluidics 6 ) laser detection of microbially - induced corrosion 7 ) automated dna extraction 8 ) isotope labeling of microorganisms 9 ) density gradient analysis for separation of high - density labeled dna 10 ) microbial community analysis using microarrays and bioinformatics 11 ) subtractive community profiling for identification of relevant microorganisms 12 ) sorbent materials that can be analyzed to determine the chemical composition of fluid in the individual test compartments . the usefulness of the present invention &# 39 ; s analytical methods can be further aided by : ( a ) development of mass spectrometric techniques for the identification of microorganisms in mixed cultures , and ( b ) the generation of microorganism - identification database software and search algorithms for interpreting maldi tof mass spectra of ribosomal biomarkers and microorganisms . speed and ease of analysis for the present invention is achieved by replacing molecular - genetic analyses with other more convenient measurement techniques suitable for discerning isotope distributions ( e . g ., use of maldi - tof ms and to bioinformatics database searches for automated microorganism identification ). sample processing uses commercially available robotics ( e . g ., amersham biosciences robotics ) and tools for rapid sample cleanup and processing ( e . g ., gyrolab maldi sp1 etc .) in conjunction with enzymatic digestion steps ( e . g ., trypsin digestion ). central laboratory facilities are recommended for analyzing samplers deployed in situ . this allows for automated analysis and for a high degree of standardization . standardized analysis in turn improves measurement precision and allows one to determine the systematic biases of the technique ( due to “ bottle effects ”) that may limit measurement accuracy . once identified , these biases can be accounted and corrected for thus enabling one to predict — with high accuracy and precision — the environmental change to be observed following engineering interventions . proof - of - concept experiments with components of the testing device of the present invention have demonstrated that : 1 . informative microbial community data can be obtained with nonculture - dependent tools using analysis of conventional groundwater samples and bioremediation microcosms . 2 . the screening of electron acceptors and donors in microcosms adds discriminatory / predictive power for microbial community profiling . 3 integration of stable isotope - labeled electron donor compounds into the microcosm design aids in the identification of metabolically active microorganisms . 4 . adaptations of mass spectrometric analysis of microorganism - specific proteins can be used to identify microorganisms in environmental mixed cultures directly without the need for time and labor intensive separation techniques . 5 . adaptation of microorganism - identification algorithms contained in the existing protein - identification database software allows for the analysis of mixed cultures . although the foregoing disclosure relates to preferred embodiments of the invention , it is understood that these details have been given for the purposes of clarification only . various changes and modifications of the invention will be apparent , to one having ordinary skill in the art , without departing from the spirit and scope of the invention . | 6 |
the present invention is now discussed in detail with regard to the drawing figures that were briefly described above . unless otherwise indicated , like parts and processes are referred to with like reference numerals . referring fig1 depicted therein is a block diagram illustrating a system arrangement where by one or more common communication agents are provided in accordance with a preferred embodiment of the present invention . in particular , a common communication agent 104 acts as a mediator or interface between non - standard data and a network management or monitoring system . non - standard data may originate from a variety of sources such as non - snmp ( non - standard network management protocol ) devices or networks , other non - standard network management systems , log files , systems processes , etc . the number of common communication agents that may be included within a particular data processing environment may depend on performance requirements and business needs thereof . a common communication agent provided in accordance with the present invention may be independent of the network technologies , protocols , operating systems , or applications it interfaces with . the complexity and nature of common communication agent 104 as provided by the present invention depends on several factors including business needs , performance requirements , etc ., and hence can be made very generic or very specific according to underlying network technologies , applications , etc . common communication agent 104 is modular and flexible to accommodate modern technologies and protocols . accordingly , non - standard networks , devices , systems , and processes 102 may generate and communicate data ( e . g ., operational type data , etc .) related to the same to a common communication agent 104 provided in accordance with the present invention . common communication agent 104 converts or otherwise translates non - standard data into a standardized format ( standardized data ) and then transmits that standardized data to a network management or monitoring system 106 for appropriate review and management thereof . as such , the present invention allows a common communications platform to be provided to allow a network management or monitoring system to monitor heterogeneous networks that may embody multiple technologies , system , processes , protocols , and other computing systems based upon a multitude of computing parameters . it should be noted that the same common communication agent can connect and be coupled to a variety of communication protocols and technologies at the same time and convert data it receives into a standard data . referring now to fig2 depicted therein is a block diagram further illustrating a network data management system and one that incorporates one or more common communications agents like common communications agent 104 and its modules in accordance with a preferred embodiment of the present invention . in particular , non - standard networks , devices , systems , and processes 102 generate and communicate operational type data via various protocols and processes which are received by corresponding communications modules such as an internet protocol ( ip ) communications module , an x . 25 communications protocol module , a tty communications module , a log - process monitoring module , and a host of other communication type modules as illustrated as modules 108 . each particular communications module 108 is configured to communicate with a corresponding system network resources ( e . g ., computing platforms , peripheral devices , etc .) that generates operational related data such as processing statistics and other application related processing statistics , etc . each communication module 108 is a modular component of common communication agent 104 that establishes connectivity with a non - standard network , device , system , process , etc . there may be multiple instances of communication modules 108 in a particular common communication agent arrangement according to the present invention . each such instance of a communication module potentially connects to different communication protocols or technologies . as shown in fig2 the x . 25 communication module would establish connectivity with x . 25 networks and devices , while the internet protocol ( ip ) communication module would establish communications with ip networks , devices and processes . additionally , the log / processing monitoring module 108 could be used to monitor processes and / or logs on various network systems . each communication module acts as an interface between an interpretation / extraction module 110 to which it attaches and the non - standard data about which they communicate . interpretation / extraction module 110 takes as inputs the non - standard data received from the communications modules 108 that attach to it . interpretation / extraction module 110 can parse such non - standard data or particular data that may be used for network management purposes ( e . g ., management data ). additionally , interpretation / extraction module 110 may incorporate business and / or system rules , filters , correlation logic , rate logic , persist logic , etc . which can be applied to data received from communication modules 108 . for example , interpretation / extraction module 110 may be configured with logic to examine and parse non - standard data for particular strings of text / data and to extract the same when found . interpretation / extraction module performs a useful function to filter out unnecessary data from source systems 102 from which network management data ( in non - standard form ) originates and which passes through communication modules 108 . hence interpretation / extraction module 110 can reduce traffic and improve system performance of network management systems . it is important to note however , that a common communication agent provided in accordance with the present invention does not require the implementation of such rules and filters , and an organization implementing a common communications agent in accordance with the present invention may choose not to implement parsers , rules functions , etc . in any case , interpretation / extraction module 110 acts as an interface between a standard interface module 112 and communication modules 108 . there may be multiple instances of the interpretation / extraction module 110 , each of which having its own attached communication modules 108 . such multiple interpretation / extraction modules 110 may then be coupled with one or more multiple standard interface modules 112 . after management data has been extracted from the source data received via communication modules 108 , such management data may then be passed on to standard interface module 112 . the standard interface module 112 is the module where non - standard data is converted into standardized data and ultimately passed to a network management / monitoring system . like other modules within a common communication agent provided in accordance with the present invention , there can be multiple instances of a standard interface module 112 , whereby each such module may receive data from different interpretation / rules modules 110 . standard interface module 112 takes the data generated and transmitted from the interpretations / extraction module 110 and converts such data into standardized data having a standard format such as one provided in accordance with snmp ( simple network management protocol ), cmip , idl ( interface definition language such as cobra ), etc . a standard interface module provided in accordance with the present invention is flexible enough to convert data from the interpretation / extraction module 110 into a format that may be defined by the organization implementing the present invention . referring now to fig3 depicted therein is a block diagram of an automatic data processing system that may be used to implement and execute the aforementioned and describe modules making up a common communication agent according to a preferred embodiment of the present invention . in particular , automatic data processing system 302 includes a processor arrangement 304 having one or more processors , a data storage system 306 having one or more storage facilities such as magnetic disks , optical disks , etc . and an i / o facility 308 configured to communicate across multiple network platforms and via multiple network protocols . the arrangement and structure of automatic data processing system 302 will be immediately understood by those skilled in the art . the aforementioned and discussed modules that make up a common communication agent according to a preferred embodiment of the present invention , may be implemented as software routines and programs which are stored within data storage subsystem 306 and which are executed by processor arrangement 304 . automatic data processing system 302 may be implemented using a computing system such as one similar or like a sun sparc 1000 or ultra 2 system manufactured and marketed by sun microsystems inc . if a sun micro systems machine is used to implement automatic data processing system 302 , the same may be outfitted to operate in accordance with the solaris operating system version 2 . 51 . the modules described above with regard to fig1 and 2 may be implemented as computer software modules written in c , c ++ and unix shell scripts . it is important to note , that although automatic data processing system 302 is illustrated as a computing system , the same may be implemented as a distributed processing system coupled via a data communications network . in such a case , one or more processors , maintained by one or more corresponding computing systems may be called upon to execute individual modules making up a common communication agent according to a preferred embodiment of the present invention . the paragraphs that follow illustrate the operations carried out within a common communications agent provided in accordance with a preferred embodiment of the present invention to facilitate centralized processing to standardize data for network resource management and monitoring . as described above with regard to the structures shown in fig1 - 3 , the operations described below may be implemented within a computing environment ( e . g ., on one or more processing units , in a distributed computing environment , etc .) as computer software subsystems which facilitate corresponding operations . the implementation and operation of such software subsystems will be immediately understood by those skilled in the art of computer programming and networking technologies after careful review of the comments found below . referring now to fig4 a , depicted therein is the start of a flowchart that illustrates the operations of a common communication agent provided in accordance with a preferred embodiment of the present invention . such a common communication agent will consolidate data and messages received from systems of variant network topologies and protocols and transport that data via a interpretation / extraction module to be standardized by a standard interface module which will format such data into a data stream that may be processed and recognized by a network management / monitoring system . in particular , processing starts at s 4 - 1 , and immediately proceeds to step s 4 - 2 . at step s 4 - 2 , communication modules receive operational data ( e . g ., cpu statistics , application statistics , etc .) from corresponding systems and networks resources based upon particular protocols and network topologies , etc . processing then proceeds to step s 4 - 3 , where communications modules will communicate operational data to an interpretations / extraction module for parsing , data correlation , etc based on defined rules , etc ., to realize extracted management data ( e . g ., cpu statistics , application run - times statistics , etc ). next , at step 84 - 4 , interpretation / extraction modules will transmit / communicate extracted management data to a standard interface module or modules for appropriate processing as described above . at step s 4 - 5 , standard interface module will receive extracted management data from one or more interpretation / extraction modules and will generate standardized data based thereon and , possibly , based on a standard protocol ( e . g ., the ip protocol , etc .). next , at step s 4 - 6 , the standard interface modules will transmit standardized data to a management / monitoring system for network management / monitoring processing . thus , having fully described the present invention by way of example with reference to the attached drawings figures , it will be readily appreciated that many changes and modifications may be made to the invention and to any of the exemplary embodiments shown and / or described herein without departing from the spirit or scope of the invention , which is defined in the appended claims . | 7 |
the present invention resides , in a catalyst for purification of oil raw material with the use of a metalocomplex of general formula ( cu ii cl ) 2 o ( l 1 ) 2 - 4 ( l 2 ) 1 - 4 , wherein l 1 is amino alcohol of the general formula n ( r 1 )( r 2 )( r 3 )( oh ) 1 - 3 , wherein r 1 = c 2 h 4 , r 2 = h , c 2 h 4 , c 2 h 5 , c 2 h 5 , r 3 = h , c 2 h 4 , c n h 2n + 1 , wherein n = 2 - 17 , l 2 is acetonitryl or the above mentioned alcohol . the metal complex is synthesized in acetonitryl or alcohol starting from cucl and aminoalcohol at 45 - 50 ° c . in air . the catalyst actively oxidizes mercaptans and hydrogen sulfide with oxygen of air at temperature 22 - 120 ° c . and at atmospheric pressure . the objective of the present invention can not be achieved if at least one of the above mentioned components of catalytic complex are not used or the conditions of synthesis are not complied with , for example : if instead of copper chloride cucl2 is used or another salt is used ( nitrate , sulfate , stearate , etc .) if amino alcohol is not used , the complex is not active ; if as a solvent acetylnitryl or alcohol is not used , the activity of catalyst is reduced . for example , if acetylnitryl is replaced with chloroform , the activity of catalyst is reduced three times . therefore , the present invention resides in a catalyst of oxidating alkali - free demercaptanization of oil , gas condensate or oil fraction based on a metalocomplex of the above mentioned composition . 100 ml of saturated solution of cucl in acetonitryl ( the solution contains 8 g of cucl ) is introduced into a flat - bottom container of 200 ml at room temperature , and heated to 45 - 50 ° c . with continuous steering by a magnetic stirrer , slowly ( in 30 - 40 min ) from a peeped 20 ml of solution of monoethanolamine in acetonenitryl is introduced into the container ( solution is prepared by mixing of 17 ml of monoethanolamine and 100 ml of acetonitryl ). the precipitated substance of blue - green color is separated from a mother solution on a filter , dried on air and then in a drying cabinet at 100 - 105 ° c . the obtained dry complex contains 9 . 2 - 9 . 5 g . before testing the solid catalyst is comminuted in a porcelain dish . this way , catalyst a is produced . catalyst b and c were produced analogously , but instead of monoethanolamine , dimethylamineethanol ethanol and three ethanolamine were utilized 20 ml of aminoalcohol atmer 163 which is a mixture of isomers with the composition rn ( ch 2 ch 2 oh ) 2 , where r = c n h 2n + 1 n = 16 - 17 and 20 ml isobutanol is introduced into a flat bottom container . during mixing and heating to 45 - 50 ° c . in air , slowly 10 g cucl is added . as a result , a dark - brown dense liquid is produced . before testing , the obtained liquid complex d is dissolved in an excessive quantity of isobutanol to concentration cu ( ii ) 1 - 1 . 5 %. catalyst e and f are produced analogously , but instead of isobutanol , butanol and isopropanol were added . 20 ml of triethanolamine and 10 ml of pentanol are introduced into a flat bottom container . during heating and mixing to 50 - 55 ° c ., slowly 12 g cucl is added . as a result , a dark - green dense liquid is formed . before testing the obtained liquid complex h is dissolved in an excessive quantity of pentanol to concentration cu ( ii ) 1 . 15 %. a reactor with a magnetic stirrer is utilized , which is formed as a four - neck flat - bottom container with volume of 350 ml , composed of molybdenum glass and provided with swdlwfmroe , a system of air and oxygen supply and a glass pipe for taking samples a kerosene fraction with a content of mercaptide sulfer 80 ppm , a batch of catalyst a ( ratio of raw material to catalyst is 62000 ml / g ) and teflon magnetic stirrer were are introduced . the reaction time was four hours . during this time the content of sulfur was reduced to 30 ppm . the samples were taken with interval of 0 . 5 hour . the process was conducted as in example 2 but instead of kerosene , fuel oil from gas condensate was used , which contained 1200 ppm of mercaptide sulfur ( a gas condensate was used which was distilled in interval 56 - 354 ° c . with density 0 . 77 g / cm 3 and content of moisture 0 . 04 % mass ). the ratio of raw material to catalyst was 7000 ml / g . the temperature of reaction was 120 ° c . in 1 hour the concentration of sulfur was reduced to 590 ppm . liquid complex d is dissolved in an excessive quantity of isobutanol to concentration cu ( ii ) 1 %. into the reactor described in example 4 , fuel oil was introduced with content of mercaptide sulfur 1200 ppm . the ratio of raw material to solution of catalyst 2000 ml / ml . temperature of reaction was 100 ° c . in two hours the concentration of sulfur reduced to 550 ppm . with increase of concentration of liquid complex in isobutanol to cu ( ii ) 1 . 5 %, with the same conditions in 2 hours the concentration of sulfur reduced to 450 ppm . examples 7 - 8 show that it is not possible to keep the objects of the present invention if parameters of catalyst deviate from the parameters in accordance with the present invention . synthesis of the complex is performed as in example 1 but instead acetonitryl , chloroform is utilized . during with the process of purification of kerosene in accordance with fig2 the content of mercaptan sulfur is reduced to 60 ppm . synthesis of the complex is performed as in example 1 , but the reaction solution is not heated . when the purification is performed with example 2 , the content of mercaptide sulfur is reduced to 40 ppm . it will be understood that each of the elements described above , or two or more together , may also find a useful application in other types of substances and methods differing from the type described above . while the invention has been illustrated and described as embodied in catalyst and method for alkali - free purification of oil raw material from mercaptans , it is not intended to be limited to the details shown , since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , be applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention . what is claimed as new and desired to be protected by letters patent is set forth in the appended claims . | 1 |
referring now to fig4 , the industrial control system 1 includes a data port 28 configured to facilitate bi - directional access to the removable storage device 30 , preferably including non - volatile memory . that is , as previously described , the industrial controller 2 is configured to utilize the removable storage device 30 as a medium on which to store backups of the program that the industrial control system 1 executes and hardware information , such as module type and module manufacturer information . in this regard , it is contemplated that the industrial controller 2 may be compatible with programs such as contrologix or controlflash , commercial available from rockwell automation . beyond storing operational programs and hardware data , the removable storage device 30 may also store individual programmable data for each module in the industrial control system 1 . therefore , the industrial controller 2 can access the programmable data stored on the removable storage device 30 and use that information to automatically reconfigure devices 12 within the industrial control system 1 . alternatively , it is contemplated that the desired programmable data may be stored remotely from the industrial controller 2 , such as on a file server 27 that is accessible by the industrial controller 2 over an intranet or the internet 28 . as will be described , this process may be utilized to facilitate cloning of a given industrial control system 2 or to automatically reconfigure a replacement module that has been inserted into the industrial control system 1 to properly operate as an replacement for the prior device 12 . in particular , as will be described , the industrial controller 2 is configured to automatically identify and maintain the components of the industrial control system 1 based on all three fundamental characteristics for each component in the industrial control system 1 . that is , unlike prior art system such as those described with respect to fig1 - 3 , individual programmable data 20 including configuration data 18 and firmware 19 can be backed up onto the removable storage device 30 . by enabling the programmable data 20 to be included on the removable storage device 30 , as will be described , industrial controllers can be configured to automatically access the programmable data 20 and use this information to automatically reconfigure replacement modules or build a clone of a given industrial control system . in this regard , the process of reconfiguring a replacement device or building a clone of a given industrial control system is not only further facilitated but may even be automated so that human interaction with the industrial control system by a programmer utilizing specialized software may be reduced or , in some cases , even a eliminated . referring now to fig5 , the industrial controller 2 is in communication with each device 12 a , 12 b , 12 c , 12 d in the industrial control system 1 . in this regard , the industrial controller 2 requests identity information from each individual device 12 a , 12 b , 12 c , 12 d in the industrial control system 1 . when received by the industrial controller 2 , the identity information is processed by a processor 37 to compile a device list 38 that is stored in a system memory 40 of the industrial controller 12 . the device list 38 is a list that includes device identity information 39 and associated in programmable data 41 communicated by each device 12 a , 12 b , 12 c , 12 d . for example , when a given device 12 a in the industrial control system 1 receives a request from the industrial controller 2 for identity information , the device 12 a responds by communicating that it is a device having “ identity a ” and includes programmable data such as a firmware version of “ version 3 ”. upon receipt , the processor 37 integrates the information 39 , 41 communicated by the device 12 a into the device list 38 . therefore , each entry in the device list 38 includes the module identity 39 , such as module type and manufacturer information , and corresponding programmable data 41 , for example , a firmware version . when the removable storage medium 30 is engaged with the industrial controller 2 , the information in the device list 38 is compared against a list 42 of desired information stored on the removable storage medium 30 . in this regard , for example , the industrial controller 2 can immediately identify that the device 12 c having “ identity a ” and firmware “ version 2 ” is incorrect because the list 42 of desired characteristics stored on the removable storage medium 30 indicates that a device having “ identity a ” should have firmware “ version 3 ”. therefore , as will be described with respect to fig5 , the industrial controller 2 can transmit the desired firmware “ version 3 ” from the removable storage device 30 to device 12 c to replace incorrect firmware “ version 2 ” residing thereon . referring now to fig6 , a process for supervising and maintaining programmable data across a plurality of devices in an industrial control system 43 begins when the industrial controller is powered 44 . the industrial controller then determines whether it is currently configured to update its software automatically 46 . in this regard , the software of the industrial controller may include an operating program , a control program , and / or configuration data . if so 48 , the industrial controller automatically loads the most recent software currently available 50 and then continues its power - on sequence by loading a communications program 52 . on the other hand , if the industrial controller is not configured to automatically update its software 54 , the update sequence 50 is bypassed and the industrial controller continues by loading the communication program 52 . once capable of communication with other components within the industrial control system by loading the communications program 52 , the industrial controller requests identity information from each device in the industrial control system 56 . when this information is received for a given device , the industrial controller determines whether that device is approved for updates 58 . this may be done by accessing a list of device identities currently approved for updates or , update approval information may be simply embedded in or associated with the identity information received from the device 56 . if the device is not approved for updates 60 , the industrial controller discontinues the update process for that devices and continues by determining whether other devices are approved for updates 58 . when a device is identified that is approved for updates 62 , the industrial controller then determines whether that devices is set for exact matching of programmable data 64 . if the device is not set for exact matching of programmable data 66 , the industrial controller again discontinues the update process for that devices and continues by determining whether other devices are approved for updates 58 and set for exact matching 64 . once a device that is set for exact matching of programmable data is identified 68 , the industrial controller determines whether the current device programmable data associated with the identity information transmitted by the device matches a desired programmable data associated with the particular devices identity 70 . it is contemplated that this information may be stored on the removable storage device and randomly accessed by the industrial controller or may be preloaded from the removable storage device as part of the software update 50 . alternatively , it is contemplated that the desired programmable data may be stored remotely from the industrial controller , such as on a file server that is accessible by the industrial controller over an intranet or the internet . if the current programmable data matches the stored programmable data 72 , no further action with respect to that device is required and the industrial controller simply continues with its iterative and periodic requests for identity information from each device 56 . on the other hand , if the current programmable data does not match the stored programmable data for that particular device , the industrial controller automatically accesses the desired programmable data and sends that programmable data to the particular device 76 . the programmable data may include configuration data as well as firmware or a combination thereof . in either case , the device responds by replacing previous programmable data with the current programmable data sent by the industrial controller 76 . it is contemplated that a reconfiguration package or firmware kit may be pushed from the industrial controller to the device requiring updating . this package may including a self - executing program that , upon receipt at the device , is automatically executed to update the programmable data 76 . alternatively , an update , for example a firmware update , may be sent to the device and , in response , the device may execute a self - update procedure to install the firmware update , for example , by copying an image of the firmware update into memory . it is contemplated that this firmware supervisor process 78 for checking and maintaining programmable data across the devices of the industrial control system 78 may be iteratively and periodically performed . that is , the industrial controller may be configured to repeatedly work through the loops within the firmware supervisor process 78 to continuously check whether the current programmable data of each device matches the desired programmable data . accordingly , it is possible to immediately and automatically update the programmable data of a replacement device engaged with the industrial control system without the need for a programmer to utilize a separate computer system to manually perform such a process . in this regard , “ headless ” updates can be performed . furthermore , it is contemplated , that this updating and maintenance process may be performed during operation of the industrial control system , whereby replacement devices may be automatically updated without the industrial control system being required to be shut down . accordingly , the devices may be “ hot swappable .” alternatively , rather than performing the device checking and update process 78 iteratively and periodically , it may be performed upon occurrence of a specific event . for example , the process 78 may be initiated in response to a system power on event , an industrial controller power on event , a device replacement event , a device power on event , a removable memory engagement event , a communications loss event , a memory failure event , expiration of a time limit , or user initiation such as by a pushbutton or the like . therefore , a system and method for collecting and storing programmable data for each device in an industrial control system is created . this stored programmable data can then be utilized to automatically match programmable data of a given device in the industrial control system based on the identity of that device . accordingly , an industrial control system may be effectively and efficiently cloned or replacement devices engaged with the industrial control system can be automatically updated without requiring a user or programmer to manually reconfigure the programmable data . the present invention has been described in terms of the preferred embodiments , and it should be appreciated that many equivalents , alternatives , variations , and modifications , aside from those expressly stated , are possible and within the scope of the invention . therefore , the invention should not be limited to a particular described embodiment . | 6 |
as used in this specification roller means a temperature excursion travelling through the reactor which may indicate an increased likelihood of a decomp occurring . the present invention will be described in the context of fig5 which shows a tubular reactor 1 , having an inlet 2 , injection point 3 , an outlet 4 , and a number of thermocouples 5 connected a microprocessor 6 . microprocessor 6 is a part of a process control system controlling the reaction process . polyethylene was originally produced industrially using a high pressure process . although the process has been modified over time it essentially comprises compressing ethylene to a high enough pressure so that it becomes a supercritical fluid . typically the pressures range from about 80 to 310 mpa ( e . g . about 11 , 500 psi to about 45 , 000 psi ) preferably from about 200 to 300 mpa ( about 30 , 000 psi to about 43 , 500 psi ) and the temperature ranges from 130 ° c . to 350 ° c ., typically from 150 ° c . to 340 ° c . the supercritical ethylene together with one or more of initiators , chain transfer agent and optional comonomers are fed to a high pressure reactor . the reactor may be a tubular reactor . tubular reactors may have a length from about 200 m to about 1500 m , and a diameter from about 20 mm to about 100 mm . thermocouples are along the length of the reactor typically spaced at a distance from 5 to 15 , preferably 8 to 12 , most preferably from 8 to 11 meters . generally there may be from 100 and 350 thermocouples , typically from 120 to 300 thermocouples spaced along the length of the reactor . the spacing of the thermocouples may not always be uniform along the length of the reactor . generally there are a number of injection points spaced along the tubular reactor where additional components such as initiators , chain transfer agents , and monomers ( preferably cold monomers ), may be added to the reactor . the design and operation of tubular reactors is illustrated by a number of patents including for example u . s . pat . no . 3 , 334 , 081 issued aug . 1 , 1967 to madgwick et al , assigned to union carbide corporation ; u . s . pat . no . 3 , 399 , 185 issued aug . 27 , 1968 to schappert assigned to koppers company , inc ., u . s . pat . no . 3 , 917 , 577 issued nov . 4 , 1975 to trieschmann et al . assigned to badische anilin & amp ; soda - fabrik aktiengesellschaft ; and u . s . pat . no . 4 , 135 , 044 issued jan . 16 , 1979 to beals assigned to exxon research & amp ; engineering co . generally the initiator , or mixture of initiators , is injected into the reactor in amounts from 100 to about 500 ppm , preferably from about 125 to 425 , ( based on the weight of the reactants ). the initiator ( s ) may be selected from the group consisting of oxygen , peroxides , persulphates , perborates , percarbonates , nitriles , and sulphides ( methyl vinyl sulphide ). some free radical initiators can be selected from the list given in ehrlich , p ., et al ., fundamentals of the free - radical polymerization of ethylene , advances in polymer science , vol . 7 , pp . 386 - 448 , ( 1970 ). non - limiting examples of some free radical producing substances include oxygen ( air ); peroxide compounds such as hydrogen peroxide , decanoyl peroxide , t - butyl peroxy neodecanoate , t - butyl peroxypivalate , 3 , 5 , 5 - trimethyl hexanoyl peroxide , diethyl peroxide , t - butyl peroxy - 2 - ethyl hexanoate , t - butyl peroxy isobutyrate , benzoyl peroxide , t - butyl peroxy acetate , t - butyl peroxy benzoate , di - t - butyl peroxide , and 1 , 1 , 3 , 3 - tetramethyl butyl hydroperoxide ; alkali metal persulfates , perborates and percarbonates ; and azo compounds such as azo bis isobutyronitrite . typically initiators are selected from the group consisting oxygen ( air ) and organic peroxides . generally a chain transfer agent ( sometimes referred to as a telogen or a modifier ) is also present in the reactants . the chain transfer agent may be added at one or more points along the tubular reactor . some chain transfer agents include the saturated aliphatic aldehydes , such as formaldehyde , acetaldehyde and the like , the saturated aliphatic ketones , such as acetone , diethyl ketone , diamyl ketone , and the like , the saturated aliphatic alcohols , such as methanol , ethanol , propanol , and the like , paraffins or cycloparafins such as pentane , hexane , cyclohexane , and the like , aromatic compounds such as toluene , diethylbenzene , xylene , and the like , and other compounds which act as chain terminating agents such as carbon tetrachloride , chloroform , etc . the chain transfer agent may be used in amounts from about 0 . 20 to 2 , preferably from 0 . 24 to 1 mole percent based on the total ethylene feed to the reactor . the feed may be entirely ethylene or may be a mixture of ethylene and one or more comonomers . typically the comonomers , if present are present in amounts of less than about 20 weight %, preferably less than 10 weight %, typically for copolymers without a functional group less than 5 weight %, based on the total weight of the feed . some comonomers that may be copolymerized with ethylene under high pressure conditions include : olefins such as propylene , butene - 1 , cis - butene - 2 , trans - butene - 2 , isobutylene , 3 , 3 ,- dimethylbutene - 1 , hexane - 1 , 4 - methylpentene - 1 , and octene - 1 ; c 3 - 6 ethylenically unsaturated carboxylic acids including methacrylic acid , crotonic acid , maleic acid , methyl hydroxy , maleate , itaconic acid ; c 1 - 6 , preferably c 1 - 4 alkyl esters of c 3 - 6 ethylenically unsaturated carboxylic acids including : acrylic - type esters such as methyl acrylate , ethyl acrylate , n - butyl acrylate , t - butyl acrylate , 2 - ethylhexyl acrylate , methyl methacrylate , n - butyl methacrylate , t - butyl methacrylate , cyclohexyl methacrylate , 2 - ethylhexyl methacrylate ; amides of c 3 - 6 ethylenically unsaturated carboxylic acids such as dimethylacrylamide , n - isopropylacrylamide , n - t - butylacrylamide , n - phenylacrylamide , diacetone acrylamide , methacrylamide , n - phenylmethacrylamide , n - ethylmaleimide , and vinyl esters such as vinyl acetate , vinyl butyrate , vinyl pivalate , vinyl ethers such as vinyl methyl ether , vinyl n - butyl ether ; vinyl phenyl ether , vinyl beta - hydroxy - ethyl ether , and vinyl dimethylamino - ethyl ether . haloolefins such as vinyl fluoride , vinylidene fluoride , tetrafluoroethylene , vinyl chloride , vinylidene chloride , tetrachloroethylene , and chlorotrifluoroethylene ; glycidyl methacrylate , beta - hydroxethyl methacrylate , beta - hydroxpropyl methacrylate , 3 - hydroxy - 4 - carbo - methoxyphenyl methacrylate , n , n - dimethylaminoethyl methacrylate , t - butylaminoethyl methacrylate , 2 -( 1 - aziridinyl ) ethyl methacrylate , diethyl fumarate , diethyl maleate , and methyl crotonate ; acrylonitrile , fumaronitrile , and maleic anhydride ; and other compounds such as allyl alcohol . the ethylene and comonomer , preferably a c 4 - 6 alpha olefin , initiator and chain transfer agent are pressurized to the required pressure and are fed to the reactor , typically at several injection points . when the reactor has reached steady state conditions after startup or a grade change then sufficient temperature readings are taken over a period of time of not less than thirty seconds and generally not more than about 10 minutes , preferably not more than 5 minutes , through the thermocouples to establish the mean temperature , standard deviation , and moving range for each thermocouple for that given time period . the raw data for a given period may or may not then be divided into shorter time sequences ( say 30 second periods ) to establish initial limits . typically there would be not less than 30 , preferably not less than 60 thermocouples along the length of the tubular reactor . ( i ) these readings are compared to the mean temperature for that thermocouple is between three and six , times the standard deviation in temperature ( 3δ to 6δ ) for that thermocouple . typically the mean temperature plus three to six times the standard deviation in temperature for the thermocouple is taken as the upper control limit for that thermocouple . similarly the mean temperature minus three times the standard deviation for temperature for that thermocouple is taken as the lower control limit for that thermocouple , and ( ii ) the absolute temperature differences between subsequent readings for a given thermocouple ( i . e . t i − t i − 1 ( the moving range the temperature difference between the current temperature for the thermocouple and the prior measured temperature ) are calculated and compared to a predetermined maximum temperature difference threshold ( δt ). care needs to be taken in selecting the temperature difference against which the moving range is compared . if it is set too high the process will not detect conditions leading to a decomposition . if it is set too low the roller detector will give false positive results . typically the ( δt will be between 0 . 5 and 1 . 3 , preferably between 0 . 7 and 1 ° c . if the control limits for both ( i ) and ( ii ) are not met on 2 or more adjacent thermocouples then that data set is used to recalculate the mean temperature and the standard deviation for each thermocouple . this provides a thirty second recalculation for a rolling calculation for the mean temperature and the standard deviation of the reaction . if both conditions ( i ) and ( ii ) are met but it appears there is a statistical movement in the direction of increasing the likelihood of a decomposition the reactor conditions ( e . g . temperatures , initiator feed rate , cooling water temperature , pressure etc .) may be adjusted . care needs to be taken in deciding if reactor conditions need to be adjusted as this may result in a change in polymer properties . if the control limits for both ( i ) and ( ii ) are met on 2 or more typically 4 , preferably 5 or more , preferably closely spaced ( in some instances adjacent ) thermocouples then there is a greater than 85 , preferably greater than 90 % probability that conditions leading to an increased likelihood of a decomp exist . steps are immediately taken to reduce the rate of reaction . for example the coolant temperature could be increased , or the inlet temperature of the reactants could be increased by not less than 5 ° c ., preferably not less than 10 ° c . or the reactor peak temperatures decreased . in order to implement the present invention it is necessary to have the output from the thermocouples connected to a high speed central processing unit ( e . g . computer ) programmed to calculate the mean temperature and the standard deviation and calculate the temperature control limits for each thermocouple and additionally to calculate the absolute temperature difference between sequential measurements and to compare those measurements to those control limits over two or more thermocouples . as noted above this is calculated at a frequency of not less than 10 times , typically from 10 to 100 , preferably form 15 to 80 per second for a given time interval ( e . g . from 30 seconds to 5 minutes ). at a frequency of 15 measurements per second for a 30 second interval there would be 450 data points for each thermocouple . while the above is described in terms of numbers the calculations may be normalized . the present invention will now be illustrated by the following non limiting example . about a 2 year sample of data from nova chemicals &# 39 ; high pressure polyethylene plant was analyzed for “ rollers ”. spectral analysis of the process was not sensitive enough discriminate between rollers ( temperature excursions ) and changes in operating conditions ( e . g . feed conditions ) to provide reliable data relative to rollers . the individual control chart on its own was also not sensitive enough to provide a good indicator of the presence of a “ roller ”. however , a combination of the individual control chart ( mean temperature and mean temperature plus three standard deviations together with a moving range control chart taken over 2 or more thermocouples provided a good method of detecting the presence of these rollers . that is when both sets of control limits are exceeded . fig1 is a table of plant data compared to the calculations of the present invention showing when rollers had been observed by the plant ( shaded areas ) and where they were calculated based on the present invention . the value at the bottom right of the table is the average accuracy of the predictive method of the present invention . — 85 %. fig1 shows the validation of the process of the present invention . however this is likely a minimum because it is calculated using individual thermocouples and it does not discount situation where multiple rollers occurred in the same data set , or the fact that at least 3 other thermocouples detected a roller . fig2 , 3 , and 4 , illustrate the types of events which may be detected by the present invention . fig2 : shows a series of high speed process temperature measurements showing a typical “ roller ” event . the chart lines are for different spaced apart thermocouples . fig3 : shows the high speed process temperature measurements for 1 thermocouple from fig1 . note the temperature excursion above the upper control limit ( ucl ) for this thermocouple . this show one of the conditions for detection of a roller having been met . fig4 : shows the moving range values for the same thermocouple from fig3 . note the upper control limit excursions . this shows the second condition has been met . | 2 |
considering the drawings , wherein like reference numerals denote like parts throughout the various drawing figures , reference numeral 10 as shown in fig1 is directed to the loading station according to the present invention . in its essence , the loading station 10 includes a support 2 , to which the following are mounted : a thrombin processing unit 4 , a clotting and adhesive proteins processing unit 6 , and a dispensing manifold 8 . each unit 4 , 6 has a separate dispensing line 16 a , 16 b to the dispensing manifold 8 as shown in fig1 , to maintain sequestration of each component of the biological glue . the outlet 12 connected to the thrombin processing unit 4 leads into a reserve vessel 14 , whereby pressure from a thrombin syringe 7 causes thrombin to enter the reserve vessel 14 . rods 1 suspend support 2 . hooks 3 support the thrombin processing unit 4 , the clotting and adhesive proteins processing unit 6 , and reserve vessel 14 . clips 5 support the dispensing manifold 8 . the dispensing manifold 8 is preferably oriented to load a plurality of syringe pair assemblies 20 ( fig1 b ) with components of the biological glue . fig2 depicts four such syringe pair assemblies 20 , but it is also observed from fig2 that additional assemblies 20 may be present . the syringe pair assembly 20 is pictured in fig1 a , 13 b . the assembly 20 includes two syringes ( dispensing means ) 22 a , 22 b ; a barrel - holding frame 24 ; and a plunger connector 26 . a fitting 18 is also present , the fitting 18 adapted to frictionally hold the syringe pair assembly 20 together and link to the dispensing manifold 8 via tubing 9 . the barrel - holding frame 24 includes a spring - based plastic retaining member 28 ; in fig1 b , the retaining member 28 secures the barrel - holding frame 24 to the fitting 18 . the spring 27 is shown as a resilient leaf ( fig1 b ) integral with frame 24 and leading to the retainer 28 . the assembly 20 is housed inside a membrane 30 , particularly during loading . the membrane 30 is preferably flexible plastic , formed with a gathered ( doubled - over ) portion 32 about the assembly 20 . the gathered portion 32 is formed by creating pleats 36 using “ accordion ”- type folds in the membrane 30 , with a first layer 30 a ( fig1 ) of the membrane 30 proximate the syringe pair assembly 20 ( fig4 , 12 ) and an outer layer 30 b which moves from an overlying position ( relative to the first layer 30 a ) to a coextensive position after loading a syringe pair assembly 20 , one with clotting proteins and the other with thrombin . one end of the membrane 30 is sealed over the tubing 9 that connects to the dispensing line 16 a , 16 b via dispensing manifold 8 . the other end of the membrane 30 is also closed and is deployed about the syringe plungers 38 a , 38 b , to allow an operator to grasp and extend the plunger end during filling of the syringe pair assembly 20 without exposure to ambient conditions . downward force , shown by the arrow a in fig6 , while grasping the plunger end and the membrane 30 allows the pleats 36 of the gathered portion 32 to expand while always encasing the now - fully extended assembly 20 ( fig5 , 14 ). the plunger end of the membrane 30 will be opened ( fig1 ) in an operatory to allow access to the filled syringe pair assembly 20 during a surgical procedure . as shown in fig1 , a free end 37 of the membrane 30 shows the membrane as formed from the parts 37 a , 37 b , sealed together but separable ( by peeling apart ) to expose plunger connector 26 of the loaded syringe pair . thus , the loaded syringe pair is maintained sterile until actual use in surgery . the procedure for loading the assemblies 20 with thrombin and adhesive and clotting proteins is shown in fig6 – 11 . before loading , all assemblies 20 are encased in membranes 30 and attached to the dispensing manifold 8 using the fittings 18 . the assembly 20 located furthest from the end of the dispensing manifold 8 is preferably drawing on the dispensing lines 16 a , 16 b by extending the syringe plungers ( fig6 ) to fill the dispensing lines 16 a , 16 b and dispensing manifold 8 . it is then preferably returned to its original contracted position ( fig7 ) after having expelled excess air . beginning from the opposite end , each assembly 20 is successively extended to fill the syringe barrels 34 a , 34 b with the appropriate amounts of thrombin and clotting and adhesive proteins ( fig8 – 11 ). after all assemblies 20 are loaded , each assembly 20 and its associated membrane 30 may then be removed from the dispensing manifold 8 by heat sealing or crimping tubing 9 and severing at the crimp or heat seal , or upstream at the juncture 11 of the tubing 9 with the manifold 8 . to remove assembly 20 from membrane 30 , spring 27 is depressed toward syringes 22 a , 22 b to release retaining member 28 from mating catch on fitting 18 . syringes 22 a , 22 b are twisted and pulled away from fitting 18 , allowing assembly 20 to reside loose within membrane 30 . membrane 30 is then peeled apart , as described earlier , to remove assembly 20 . once filled and removed , the assembly 20 may be fitted with an outlet coupling 40 , shown in fig2 a . the retaining member 28 latches to a catch 42 on coupling 40 ( fig2 ). as shown in fig2 b and 22c , the outlet coupling 40 equips each syringe 22 a , 22 b with a separate exit path 44 a , 44 b , such that the thrombin and the adhesive and clotting proteins may exit separately as lines or dots from ports 46 a , 46 b in the outlet coupling 40 , thereby preventing clogging of the outlet coupling 40 . a recessed threaded area 48 is located proximate the ports 46 a , 46 b of the outlet coupling 40 to support a dispensing attachment . the recessed female threaded area 48 of the outlet coupling 40 may receive any of a variety of dispensing attachments having a threaded end 49 ; examples of attachments are shown in fig1 – 21 , 23 – 27 . the spray nozzle 50 shown in fig2 , 24 may be combined with lengthening attachments , shown in fig2 – 27 . these lengthening attachments are preferably constructed with an external cylindrical shroud 63 which overlies intermediate sleeves 65 that support a central internal helical path 54 to enhance admixture of the thrombin and the adhesive clotting proteins . mixing of the thrombin with the adhesive and clotting proteins occurs within the chosen attachment and is dispensed out the spray end 52 of the spray nozzle 50 for precise placement . the spray nozzle 50 is comprised of a barrel 51 having tactile enhancing , longitudinally extending peripheral ribs 53 . the end 52 includes a flow diverter 55 and a restrictor orifice body 57 having an orifice 59 . the body 57 is press - fit into bore 61 of nozzle 50 or attached by other means . fig1 depicts a dispensing apparatus 60 adapted to receive the syringe pair assembly 20 . in this embodiment , the outlet coupling 40 connects to the dispensing apparatus 60 by registering a clasp 42 present on the underside of the outlet coupling 40 with a pivot 62 ( fig1 ). the syringe pair assembly 20 is inserted into the outlet coupling 40 and the frame 24 is removed . fig2 , 29 depict a heating apparatus 70 , which includes a plurality of elongated arctuate indentations 72 , each shaped with projecting saddles 73 to receive a syringe pair assembly 20 and to ensconce a large portion of each syringe &# 39 ; s barrel . the heating apparatus 70 contains resistive heating elements 74 to maintain the assemblies 20 at a constant temperature for heat transfer through indentations 72 and saddles 73 . the power cord 76 is connected to a power supply 78 , which in turn plugs into an electrical supply outlet . a sensor and microcontroller 76 optimize temperature . compatible dispensing assemblies include , but are not limited to , the spraying apparatus 60 of fig1 and the basic syringe setup depicted in fig2 , 21 . thus , the prepared biological glue is readily available for use during the medical procedure . moreover , having thus described the invention , it should be apparent that numerous structural modifications and adaptations may be resorted to without departing from the scope and fair meaning of the instant invention as set forth hereinabove and as described hereinbelow by the claims . | 0 |
the invention will be further detailedly illustrated in connection with specific embodiments . however , the invention is not limited to the following embodiments . the lipases used in the embodiments of the invention are described in the following table 1 . to a sealed vessel dihydro isoquinoline methyl formate ( 756 . 8 g , 4 mol ), ethanol ( 7 l ) and 10 % pd / c catalyst ( 60 g ) were added , and h 2 ( 3 mpa ) was continuously introduced into the vessel after the air in the vessel was replaced with h 2 , then the reaction mixture was heated to 65 ° c . and stirred for 24 hours . when analysis indicated the completion of the reaction , the catalyst was recycled by filtering , and the filtrate was concentrated under reduced pressure to get 749 . 6 g oily compound of tetrahydroisoquinoline methyl formate ( hereinafter known as compound 3e - 1 ), and the purity of the compound was 95 % and the yield was 98 %. 1 h nmr ( cdcl 3 , 400 mhz , δ ppm ): 1 . 35 ( s , 3h , ch 3 ), 2 . 03 - 2 . 21 ( brs , 1h ), 2 . 68 - 2 . 74 ( m , 2h ), 2 . 98 - 3 . 01 ( t , j = 5 . 9 hz , 2h ), 4 . 54 ( s , 1h ), 7 . 02 - 7 . 40 ( m , 4h , arh ). to a sealed vessel dihydro isoquinoline ethyl formate ( 812 . 9 g , 4 mol ), ethanol ( 7 l ) and 10 % pd / c catalyst ( 60 g ) were added , and h 2 ( 3 mpa ) was continuously introduced into the vessel after the air in the vessel was replaced with h 2 , then the reaction mixture was heated to 65 ° c . and stirred for 24 hours . when analysis indicated the completion of the reaction , the catalyst was recycled by filtering , and the filtrate was concentrated under reduced pressure to get 804 . 58 g oily compound of tetrahydroisoquinoline ethyl formate ( hereinafter known as compound 3e - 2 ), and the purity of the compound was 96 % and the yield was 98 %. 1 h nmr ( cdcl 3 , 400 mhz , δ ppm ): 1 . 28 - 1 . 37 ( t , 3h , — ch 2 — ch 3 ), 2 . 01 - 2 . 27 ( br s , 1h , nh ), 2 . 78 - 2 . 84 ( m , 2h , ch 2 ), 3 . 03 - 3 . 33 ( m , 2h , ch 2 ), 4 . 19 - 4 . 24 ( m , 2h , — ch 2 — ch 3 ), 4 . 71 ( s , 1h , ch ), 7 . 11 - 7 . 35 ( m , 4h , arh ). to a sealed vessel dihydro isoquinoline isopropyl formate ( 869 . 0 g , 4 mol ), ethanol ( 7 l ) and 10 % pd / c catalyst ( 60 g ) were added , and h 2 ( 3 mpa ) was continuously introduced into the vessel after the air in the vessel was replaced with h 2 , then the reaction mixture was heated to 65 ° c . and stirred for 24 hours . when analysis indicated the completion of the reaction , the catalyst was recycled by filtering , and the filtrate was concentrated under reduced pressure to get 914 . 57 g oily compound of tetrahydroisoquinoline isopropyl formate ( hereinafter known as compound 3e - 3 ), and the purity of the compound was 94 % and the yield was 98 %. 1 h nmr ( cdcl 3 , 400 mhz , δ ppm ): 1 . 28 - 1 . 35 ( t , 3h × 2 , ch 3 ), 2 . 03 - 2 . 22 ( br s , 1h , nh ), 2 . 67 - 2 . 69 ( m , 2h , ch 2 ), 2 . 83 - 2 . 93 ( m , 2h , ch 2 ), 4 . 31 - 4 . 54 ( m , 1h , — ch — ch 3 ), 4 . 74 ( s , 1h , ch ), 7 . 02 - 7 . 32 ( m , 4h , arh ). to a sealed vessel dihydro isoquinoline tertbutyl formate ( 925 . 2 g , 4 mol ), ethanol ( 7 l ) and 10 % pd / c catalyst ( 60 g ) were added , and h 2 ( 3 mpa ) was continuously introduced into the vessel after the air in the vessel was replaced with h 2 , then the reaction mixture is heated to 65 ° c . and stirred for 24 hours . when analysis indicated the completion of the reaction , the catalyst was recycled by filtering , and the filtrate was concentrated under reduced pressure to get 895 . 91 g oily compound of tetrahydroisoquinoline tertbutyl formate ( hereinafter known as compound 3e - 4 ), and the purity of the compound was 96 % and the yield was 96 %. 1 h nmr ( cdcl 3 , 400 mhz , δ ppm ): 1 . 48 ( s , 9h , ch 3 ), 2 . 10 - 2 . 35 ( br s , 1h , nh ), 2 . 61 - 2 . 84 ( m , 2h , ch 2 ), 2 . 97 - 3 . 08 ( m , 2h , ch 2 ), 3 . 08 ( s , 3h , ch 3 ), 4 . 78 ( s , 1h , ch ), 7 . 12 - 7 . 43 ( m , 4h , arh ). to a sealed vessel dihydro isoquinoline p - methoxyphenyl formate ( 1170 . 2 g , 4 mol ), ethanol ( 7 l ) and 10 % pd / c catalyst ( 60 g ) were added , and h 2 ( 3 mpa ) was continuously introduced into the vessel after the air in the vessel was replaced with h 2 , then the reaction mixture was heated to 65 ° c . and stirred for 24 hours . when analysis indicated the completion of the reaction , the catalyst was recycled by filtering , and the filtrate was concentrated under reduced pressure to get 1131 . 13 g solid compound of tetrahydroisoquinoline p - methoxyphenyl formate ( hereinafter known as compound 3e - 5 ), and the purity of the compound was 93 % and the yield was 96 %. 1 h nmr ( cdcl 3 , 400 mhz , δ ppm ): 2 . 04 - 2 . 35 ( br s , 1h , nh ), 2 . 66 - 2 . 74 ( m , 2h , ch 2 ), 2 . 87 - 3 . 02 ( m , 2h , ch 2 ), 3 . 08 ( s , 3h , ch 3 ), 4 . 76 ( s , 1h , ch ), 7 . 02 - 7 . 13 ( m , 4h , arh ), 7 . 20 - 7 . 31 ( m , 2h , arh ), 8 . 16 - 8 . 28 ( m , 2h , arh ). to a sealed vessel dihydro isoquinoline methyl formate ( 756 . 8 g , 4 mol ), ethanol ( 7 l ) and raney nickel catalyst ( 60 g ) were added , and h 2 ( 3 mpa ) was continuously introduced into the vessel after the air in the vessel was replaced with h 2 , then the reaction mixture was stirred at 25 - 30 ° c . for 10 - 12 hours . when hplc analysis indicated the completion of the reaction , the catalyst was recycled by filtering , and the filtrate was concentrated under reduced pressure to get 726 . 6 g oily compound of tetrahydroisoquinoline methyl formate ( compound 3e - 1 , the purity was 95 . 5 %, and the yield was 95 %), and this compound can be directly used in the next step without further purification . to a sealed vessel dihydro isoquinoline ethyl formate ( 812 . 9 g , 4 mol ), ethanol ( 7 l ) and raney nickel catalyst ( 60 g ) were added , and h 2 ( 3 mpa ) was continuously introduced into the vessel after the air in the vessel was replaced with h 2 , then the reaction mixture was stirred at 25 - 30 ° c . for 10 - 12 hours . when hplc analysis indicated the completion of the reaction , the catalyst was recycled by filtering , and the filtrate was concentrated under reduced pressure to get 788 . 2 g oily compound of tetrahydroisoquinoline ethyl formate ( compound 3e - 2 , the purity was 96 . 8 % and the yield was 96 %), and this compound can be directly used in the next step without further purification . to a sealed vessel dihydro isoquinoline isopropyl formate ( 869 . 0 g , 4 mol ), ethanol ( 7 l ) and raney nickel catalyst ( 60 g ) were added , and h 2 ( 3 mpa ) was continuously introduced into the vessel after the air in the vessel was replaced with h 2 , then the reaction mixture was stirred at 25 - 30 ° c . for 10 - 12 hours . when hplc analysis indicated the completion of the reaction , the catalyst was recycled by filtering , and the filtrate was concentrated under reduced pressure to get 859 . 9 g oily compound of tetrahydroisoquinoline isopropyl formate ( compound 3e - 3 , the purity was 95 . 4 % and the yield was 98 %), and this compound can be directly used in the next step without further purification . to a sealed vessel dihydro isoquinoline tertbutyl formate ( 925 . 2 g , 4 mol ), ethanol ( 7 l ) and raney nickel catalyst ( 60 g ) were added , and h 2 ( 3 mpa ) was continuously introduced into the vessel after the air in the vessel was replaced with h 2 , then the reaction mixture was stirred at 25 - 30 ° c . for 10 - 12 hours . when hplc analysis indicated the completion of the reaction , the catalyst was recycled by filtering , and the filtrate was concentrated under reduced pressure to get 895 . 9 g oily compound of tetrahydroisoquinoline tertbutyl formate ( compound 3e - 4 , the purity was 96 . 6 % and the yield was 96 %), and this compound can be directly used in the next step without further purification . to a sealed vessel dihydro isoquinoline p - methoxylphenyl formate ( 1170 . 2 g , 4 mol ), ethanol ( 7 l ) and raney nickel catalyst ( 60 g ) were added , and h 2 , ( 3 mpa ) was continuously introduced into the vessel after the air in the vessel was replaced with h 2 , then the reaction mixture was stirred at 25 - 30 ° c . for 10 - 12 hours . when hplc analysis indicated the completion of the reaction , the catalyst was recycled by filtering , and the filtrate was concentrated under reduced pressure to get 1131 . 13 g solid compound of tetrahydroisoquinoline p - methoxylphenyl formate ( compound 3e - 5 , the purity was 95 . 5 % and yield was 95 %), and this compound can be directly used in the next step without further purification . wherein r represents alkyl , such as methyl , ethyl , isopropyl and tert - butyl . to a sealed reactor tetrahydroisoquinoline methyl formate ( 19 . 1 mg , 0 . 1 mmol ), 2 ml of 1 - hexyl - 3 - methylimidazolium hexafluorophosphate and 8 ml of tertiary butanol were added , and ammonia gas ( 340 mg , 20 mmol ) or ammonium carbamate ( 1560 mg , 20 mmol ) was added and stirred evenly , subsequently 10 mg of an enzyme was added to start the reaction in water bath at 40 ° c . in a constant temperature vibrator with hplc monitoring the reaction . 12 hours later , the monitoring result was listed in the table 2 , including the types of the used enzymes , the corresponding conversion and optical purity . to a sealed reactor tetrahydroisoquinoline methyl formate ( 19 . 1 mg , 0 . 1 mmol ), 2 ml of 1 - hexyl - 3 - methylimidazolium hexafluorophosphate , 8 ml of tertiary butanol and tetrabutyl ammonium hydroxide ( 2 . 59 mg , 0 . 01 mmol ) were added , and ammonia gas ( 340 mg , 20 mmol ) or ammonium carbamate ( 1560 mg , 20 mmol ) was added and stirred evenly , subsequently 10 mg of an enzyme was added to start the reaction in water bath at 40 ° c . in a constant temperature vibrator with hplc monitoring the reaction . 12 hours later , the monitoring result was listed in the table 3 , including : the types of the used enzymes , the corresponding conversion and optical purity . to a sealed reactor tetrahydroisoquinoline methyl formate ( 19 . 1 mg , 0 . 1 mmol ), 2 ml of 1 - hexyl - 3 - methylimidazolium hexafluorophosphate , 8 ml of tertiary butanol and ammonium formate ( 1266 . 3 mg , 20 mmol ) were added , and triethylamine ( 2032 . 5 mg , 20 . 1 mmol ), or imidazole ( 1380 . 8 mg , 20 . 1 mmol ), or pyridine ( 1589 . 9 mg , 20 . 1 mmol ), or tetrabutyl ammonium hydroxide ( 5215 . 3 mg , 20 . 1 mmol ) was added optionally and stirred evenly , and 10 mg of an enzyme was added to start the reaction in water bath at 40 ° c . in a constant temperature vibrator with hplc monitoring the reaction . 12 hour later , the monitoring result was listed in the table 4 : including the types of the used enzymes , the corresponding conversion and optical purity . to a sealed reactor tetrahydroisoquinoline methyl formate ( 19 . 1 mg , 0 . 1 mmol ), 2 ml of 1 - hexyl - 3 - methylimidazolium hexafluorophosphate , 8 ml of tertiary butanol and ammonium acetate ( 1547 . 7 mg , 20 mmol ) were added , triethylamine ( 2032 . 5 mg , 20 . 1 mmol ), or imidazole ( 1380 . 8 mg , 20 . 1 mmol ), or pyridine ( 1589 . 9 mg , 20 . 1 mmol ), or tetrabutyl ammonium hydroxide ( 5215 . 3 mg , 20 . 1 mmol ) was optionally added and stirred evenly , and 10 mg of an enzyme was added to start the reaction in water bath at 40 ° c . in a constant temperature vibrator with hplc monitoring the reaction . 12 hours later , the monitoring result was listed in the table 5 , including the types of the used enzymes , the corresponding conversion and optical purity . to a sealed reactor tetrahydroisoquinoline methyl formate ( 19 . 1 mg , 0 . 1 mmol ), 2 ml of 1 - hexyl - 3 - methylimidazolium hexafluorophosphate , 8 ml of tertiary butanol , and ammonium chloride ( 1075 . 4 mg , 20 mmol ) were added , and triethylamine ( 2032 . 5 mg , 20 . 1 mmol ), or imidazole ( 1380 . 8 mg , 20 . 1 mmol ), or pyridine ( 1589 . 9 mg , 20 . 1 mmol ), or tetrabutyl ammonium hydroxide ( 5215 . 3 mg , 20 . 1 mmol ) was optionally added and stirred evenly , and 10 mg of enzyme was added to start the reaction in water bath at 40 ° c . in a constant temperature vibrator with hplc monitoring the reaction . 12 hours later , the monitoring result was listed in the table 6 , including the types of the used enzymes , the corresponding conversion and optical purity . to a sealed reactor tetrahydroisoquinoline methyl formate ( 19 . 1 mg , 0 . 1 mmol ), 1 - hexyl - 3 - methylimidazolium hexafluorophosphate ( 2 ml ), and 8 ml of diisopropyl ether ester ( 8 ml ), or dioxane ( 8 ml ), or tetrahydrofuran ( 8 ml ), or isopropanol ( 8 ml ), or methyl tert - butyl ether ( 8 ml ) were added , and tetrabutyl ammonium hydroxide ( 2 . 59 mg , 0 . 01 mmol ) and ammonium carbamate ( 1560 mg , 20 mmol ) were added and stirred evenly , subsequently 10 mg of an enzyme was added to start the reaction in water bath in a constant temperature vibrator at 3 ° c ., 10 ° c ., 25 ° c ., 50 ° c . respectively , with hplc monitoring the reaction . 12 hours later , the monitoring result was listed in the table 7 , including the types of the used enzymes , the corresponding conversion and optical purity . to a sealed reactor tetrahydroisoquinoline methyl formate ( 19 . 1 mg , 0 . 1 mmol ), 1 - hexyl - 3 - methylimidazolium hexafluorophosphate ( 2 ml ), tertiary butanol ( 8 ml ) and tetrabutyl ammonium hydroxide ( 2 . 59 mg , 0 . 01 mmol ) were added , and ammonium carbamate ( 1560 mg , 20 mmol ) was added and stirred evenly ; subsequently 10 mg of an enzyme was added to start the reaction in water bath in a constant temperature vibrator at 3 ° c ., 10 ° c ., 25 ° c ., 50 ° c . respectively , with hplc monitoring the reaction . 12 hours later , the monitoring result was listed in the table 8 , including the types of the used enzymes , the corresponding conversion and optical purity . to a sealed reactor racemic tetrahydroisoquinoline methyl formate ( 19 . 1 mg , 0 . 1 mmol ), or ethyl formate ( 20 . 5 mg , 0 . 1 mmol ), or isopropyl formate ( 21 . 98 mg , 0 . 1 mmol ), or tert - butyl formate ( 23 . 33 mg , 0 . 1 mmol ), 2 ml of 1 - hexyl - 3 - methylimidazolium hexafluorophosphate , 8 ml of tertiary butanol , and tetrabutyl ammonium hydroxide ( 2 . 59 mg , 0 . 01 mmol ) were added , and ammonium carbamate ( 1560 mg , 20 mmol ) was added and stirred evenly ; subsequently 10 mg of an enzyme was added to start the reaction in water bath at 40 ° c . in a constant temperature vibrator , with hplc monitoring the reaction . 24 hours later , the monitoring result was listed in the table 9 , including the types of the used enzymes , the corresponding conversion and optical purity . to a sealed reactor tetrahydroisoquinoline methyl formate ( 191 . 3 g , 1 mol ), 0 . 5 l of 1 - hexyl - 3 - methylimidazolium hexafluorophosphate , 2 l of tertiary butanol and tetrabutyl ammonium hydroxide ( 25 . 9 g , 0 . 1 mol ) were added and stirred evenly , and ammonium carbamate ( 117 g , 1 . 5 mol ) was added and stirred evenly , subsequently 10 g of an enzyme ( novo 51032 ) was added to start the reaction under stirring in water bath at 40 ° c . in a constant temperature stirrer , with hplc monitoring the reaction . 24 hours later , the conversion was 99 . 6 % and the reaction was ended , the enzyme was recycled by filtering and returned to the reactor . in repeated batch reactions , to the reactor tetrahydroisoquinoline methyl formate ( 191 . 3 g , 1 mol ), 0 . 5 l of 1 - hexyl - 3 - methylimidazolium hexafluorophosphate . 2 l of tertiary butanol and tetrabutyl ammonium hydroxide ( 25 . 9 g , 0 . 1 mol ) were added respectively and stirred evenly , and ammonium carbamate ( 117 g , 1 . 5 mol ) was added to perform the next batch reaction , the reaction was repeated continuously for 5 times , and the conversion of each batch is more than 99 %. the post treatment for single batch reaction : 3 m hydrochloric acid ( 1 l ) was dropwise added to the reaction mixture liquid under stirring and the temperature was kept at 20 - 25 ° c . during addition . when the addition was completed , the 1 - hexyl - 3 - methylimidazolium hexafluorophosphate and tertiary butanol were in the upper layer and the product and other components were in the lower layer of water phase after standing and layering of the solution . ( 1 ) the processing method for the organic layer : the upper layer of 1 - hexyl - 3 - methylimidazolium hexafluorophosphate and tertiary butanol was separated and washed with saturated sodium bicarbonate ( 100 ml ) and saturated salt water ( 2 × 50 ml ) respectively . the washing liquid was incorporated into the lower layer of water phase . the organic phase was dried over anhydrous sodium sulfate and distilled to recycle tertiary butanol , and the residual 1 - hexyl - 3 - methylimidazolium hexafluorophosphate was recycled for use in a next batch reaction . ( 2 ) the processing method for the water layer : the water phase was neutralized with saturated sodium bicarbonate to neutrality , then the resulting solution was extracted with ethyl acetate ( 3 × 200 ml ), dried by anhydrous sodium sulfate and concentrated to get the residue . finally , the residue was recrystallized by 95 % ethanol ( 1000 ml ) to get 146 . 2 g white solid of compound 14 , wherein the separation yield was 83 % and ee value was 99 . 3 %. 1 h nmr ( cdcl 3 , 400 mhz , δ ppm ): 2 . 03 ( brs , 1h ), 2 . 63 - 2 . 70 ( m , 1h ), 2 . 74 - 2 . 81 ( m , 1h ), 2 . 98 ( t , j = 5 . 9 hz , 2h ), 4 . 34 ( s , 1h ), 6 . 97 ( brs , 2h ), 7 . 00 - 7 . 02 ( m , 1h ), 7 . 09 - 7 . 11 ( m , 2h ), 7 . 40 - 7 . 44 ( m , 1h ). to a sealed reactor tetrahydroisoquinoline tertbutyl formate ( 233 . 3 g , 1 mol ), 0 . 5 l of 1 - hexyl - 3 - methylimidazolium hexafluorophosphate , 2 l of tertiary butanol and tetrabutyl ammonium hydroxide ( 12 . 95 g , 0 . 05 mol ) were added and stirred evenly , and ammonium carbamate ( 117 g , 1 . 5 mol ) was added and stirred evenly , subsequently 10 g of an enzyme ( novo 51032 ) was added to start the reaction under stirring in water bath at 40 ° c . in a constant stirrer , with hplc monitoring the reaction . 24 hours later , the conversion is 99 . 7 %, and the reaction was ended . finally , the enzyme was recycled by filtering and returned to the reactor . in repeated batch reactions , to the reactor tetrahydroisoquinoline methyl formate ( 233 . 3 g , 1 mol ), 0 . 5 l of 1 - hexyl - 3 - methylimidazolium hexafluorophosphate , 2 l of tertiary butanol and tetrabutyl ammonium hydroxide ( 12 . 95 g , 0 . 05 mol ) were respectively added and stirred evenly ; and ammonium carbamate ( 117 g , 1 . 5 mol ) was added to perform a next batch reaction , the reaction was repeated continuously for 5 times , and the conversion of each batch was more than 99 %. the post treatment for single batch reaction : 3m hydrochloric acid ( 1 l ) was dropwise added to the reaction mixture liquid under stirring and the temperature was kept at 20 - 25 ° c . during addition . when the addition was completed , the 1 - hexyl - 3 - methylimidazolium hexafluorophosphate and tertiary butanol were in the upper layer and the product and other components were in the lower layer of water phase after standing and layering of the solution . ( 1 ) the processing method for the organic layer : the upper layer of 1 - hexyl - 3 - methylimidazolium hexafluorophosphate and tertiary butanol was separated and washed with saturated sodium bicarbonate ( 100 ml ) and saturated salt water ( 2 × 50 ml ) respectively . the washing liquid was incorporated into the lower layer of water phase . the organic phase was dried over anhydrous sodium sulfate and distilled to recycle tertiary butanol , and the residual 1 - hexyl - 3 - methylimidazolium hexafluorophosphate was recycled for use in a next batch reaction . ( 2 ) the processing method for the water layer : the water phase was neutralized with saturated sodium bicarbonate to neutrality , then the resulting solution was extracted with ethyl acetate ( 3 × 200 ml ), dried by anhydrous sodium sulfate and concentrated to get the residue . finally , the residue was recrystallized by 95 % ethanol ( 1000 ml ) to get 163 . 9 g white solid of compound 14 , wherein the separation yield was 93 % and ee value was 99 . 2 %, and the melt point was 178 - 180 ° c . 1 h nmr ( cdcl 3 , 400 mhz , δ ppm ): 2 . 03 ( brs , 1h ), 2 . 63 - 2 . 70 ( m , 1h ), 2 . 74 - 2 . 81 ( m , 1h ), 2 . 98 ( t , j = 5 . 9 hz , 2h ), 4 . 34 ( s , 1h ), 6 . 97 ( brs , 2h ), 7 . 00 - 7 . 02 ( m , 1h ), 7 . 09 - 7 . 11 ( m , 2h ), 7 . 40 - 7 . 44 ( m , 1h ). to a reactor the compound 14 ( 4 . 4 g , 25 mmol , 1 . 1 eq ), triethylamine ( 3 . 78 g , 5 . 22 ml , 37 . 5 mmol , 1 . 5 eq ), and dichloromethane ( 124 ml ) were added and cooled to 0 ° c . in ice bath . benzoyl chloride ( 3 . 86 g , 27 . 47 mmol , 1 . 1 eq ) was added dropwise to the mixture under stirring , and the temperature was kept at 0 ° c . during addition . when the addition was completed , the reaction mixture was stirred at 20 - 25 ° c . for 6 - 8 hours . when hplc analysis indicated the completion of the reaction , the reaction was quenched with water ( 16 l ) and the mixture was stirred for further 30 mins . the organic layer was separated , and washed with saturated sodium bicarbonate , 0 . 5n hcl and salt water respectively , dried over anhydrous sodium sulfate , and concentrated under reduced pressure to get the residue . finally , the residue was recrystallized with ethanol to get the compound 16 ( 6 . 59 g , yield was 96 %, the purity was 99 % and ee value was 99 . 2 %). 1 h nmr ( cdcl 3 , 400 mhz , δ ppm ): 2 . 97 - 3 . 09 ( m , 2h ), 3 . 89 - 4 . 02 ( m , 2h ), 5 . 95 ( s , 1h ), 7 . 08 ( brs , 2h ), 7 . 40 - 7 . 51 ( m , 3h ), 7 . 56 - 7 . 64 ( m , 2h ), 7 . 78 - 7 . 98 ( m , 4h ). to a sealed reactor the compound 16 ( 5 . 6 g , 20 mmol ), anhydrous methanol ( 200 ml ) and 5 % ruthenium catalyst ru / c ( 0 . 5 g ) were added , and h 2 ( 3 mpa ) was continuously introduced to the reactor after the air in the reactor was replaced with h 2 . the mixture was heated to 90 - 95 ° c . and stirred for 16 - 18 hours . when the analysis indicated the completion of the reaction , the catalyst was recycled by filtering . the filtrate was concentrated under reduced pressure and the residue was recrystallized with the mixed solvent of ethanol and n - hexane in a volume ratio of 1 : 3 to get 4 . 58 g light yellow solid of compound 17 , wherein the yield is 86 %, melt point is 125 - 127 ° c . and ee value is more than 99 %. 1 h nmr ( cdcl 3 , 400 mhz , δ ppm ): 2 . 68 - 2 . 76 ( m , 1h ), 2 . 88 - 3 . 01 ( m , 3h ), 3 . 17 - 3 . 47 ( m , 1h ), 3 . 89 - 4 . 21 ( m , 1h ), 4 . 90 - 5 . 15 ( m , 1h ), 6 . 91 - 7 . 17 ( m , 2h ), 7 . 56 - 7 . 64 ( m , 3h ), 7 . 72 - 8 . 01 ( m , 4h ). to a reactor the compound 17 ( 2 . 7 g , 10 mmol ), toluene ( 30 ml ) and 50 % sodium hydroxide solution ( 1 . 84 g , 23 mmol ) were added and stirred evenly , and chloroacetyl chloride ( 1 . 4 g , 12 mmol ) was added dropwise , then after the addition the reaction mixture was stirred at room temperature for 3 hours . when hplc analysis indicated the completion of the reaction , benzyl triethyl ammonium chloride ( 22 . 7 mg , 0 . 1 mmol ) was added and the resulting mixture was heated to 80 ° c . and the reaction was performed for 1 - 2 hours until hplc analysis indicating the completion of the reaction . the insoluble substance was filtered out and the toluene layer was washed with water and saturated salt water in sequence , dried over anhydrous magnesium sulfate , and concentrated under reduced pressure to get the crude product , finally the crude product was recrystallized with anhydrous ethanol to get 2 . 73 g pure solid of ( r )- benzoyl praziquantel , i . e ., the compound 19 , wherein the yield of the compound 19 was 89 %, the melt point was 128 - 130 ° c . and ee value was more than 99 %. 1 h nmr ( cdcl 3 , 400 mhz , δ ppm ): 2 . 49 - 2 . 53 ( m , 1h , ch 2 ), 2 . 74 - 2 . 70 ( m , 1h , ch 2 ), 2 . 88 - 2 . 78 ( m , 2h , ch 2 ), 3 . 26 ( d , 1h , ch 2 ), 4 . 21 ( d , 1h , ch 2 ), 4 . 37 ( dd , 1h , ch 2 ), 4 . 82 - 4 . 76 ( m , 1h , ch 2 ), 4 . 97 ( dd , 1h , ch ), 7 . 12 ( d , 2h , ar — h ), 7 . 26 - 7 . 19 ( m , 3h , ar — h ), 7 . 32 ( d , 2h , ar — h ), 7 . 68 ( d , 2h , ar — h ). to a reactor the compound 17 ( 2 . 7 g , 10 mmol ), ethyl acetate ( 30 ml ) and potassium tert - butoxide ( 2 . 58 g , 23 mmol ) were added and stirred evenly , and chloroacetyl chloride ( 1 . 4 g , 12 mmol ) was added dropwise , then after the addition the reaction mixture was stirred at room temperature for 3 hours . when hplc analysis indicated the completion of the reaction , benzyl triethyl ammonium chloride ( 22 . 7 mg , 0 . 1 mmol ) was added and the resulting mixture was heated to reflux and the reaction was performed for 4 - 5 hours until hplc analysis indicating the completion of the reaction . the insoluble substance was filtered out and the ethyl acetate layer was washed with water and saturated salt water in sequence , dried over anhydrous magnesium sulfate , and concentrated under reduced pressure to get the crude product , finally the crude product was recrystallized with anhydrous ethanol to get 2 . 39 g pure solid of ( r )- benzoyl praziquantel , i . e ., the compound 19 , wherein the yield of the compound 19 was 78 %, the melt point was 128 - 130 ° c . and ee value was more than 99 %. 1 h nmr ( cdcl 3 , 400 mhz , δ ppm ): 2 . 49 - 2 . 53 ( m , 1h , ch 2 ), 2 . 74 - 2 . 70 ( m , 1h , ch 2 ), 2 . 88 - 2 . 78 ( m , 2h , ch 2 ), 3 . 26 ( d , 1h , ch 2 ), 4 . 21 ( d , 1h , ch 2 ), 4 . 37 ( dd , 1h , ch 2 ), 4 . 82 - 4 . 76 ( m , 1h , ch 2 ), 4 . 97 ( dd , 1h , ch ), 7 . 12 ( d , 2h , ar — h ), 7 . 26 - 7 . 19 ( m , 3h , ar — h ), 7 . 32 ( d , 2h , ar — h ), 7 . 68 ( d , 2h , ar — h ). to a reactor the compound 17 ( 5 . 4 g , 20 mmol ), dichloromethane ( 50 ml ) and anhydrous potassium carbonate ( 6 . 5 g , 46 mmol ) were added and stirred evenly , and chloroacetyl chloride ( 2 . 8 g , 24 mmol ) was added dropwise , then after the addition the reaction mixture heated to 40 - 45 ° c . and stirred for 5 - 6 hours . when hplc analysis indicated the completion of the reaction , benzyl triethyl ammonium chloride ( 45 . 4 mg , 0 . 2 mmol ) was added and the resulting mixture was heated to reflux and the reaction was performed for 10 - 12 hours until hplc analysis indicating the completion of the reaction . the insoluble substance was filtered out and the dichloromethane layer was washed with water and saturated salt water in sequence , dried over anhydrous magnesium sulfate , and concentrated under reduced pressure to get the crude product , finally the crude product was recrystallized with anhydrous ethanol to get 4 . 9 g pure solid of ( r )- benzoyl praziquantel , i . e ., the compound 19 , wherein the yield of the compound 19 was 80 %, the melt point was 128 - 130 ° c . and ee value was more than 99 %. 1 h nmr ( cdcl 3 , 400 mhz , δ ppm ): 2 . 49 - 2 . 53 ( m , 1h , ch 2 ), 2 . 74 - 2 . 70 ( m , 1h , ch 2 ), 2 . 88 - 2 . 78 ( m , 2h , ch 2 ), 3 . 26 ( d , 1h , ch 2 ), 4 . 21 ( d , 1h , ch 2 ), 4 . 37 ( dd , 1h , ch 2 ), 4 . 82 - 4 . 76 ( m , 1h , ch 2 ), 4 . 97 ( dd , 1h , ch ), 7 . 12 ( d , 2h , ar — h ), 7 . 26 - 7 . 19 ( m , 3h , ar — h ), 7 . 32 ( d , 2h , ar — h ), 7 . 68 ( d , 2h , ar — h ). to a reactor , the compound 19 ( 15 . 32 g , 50 mmol , 1 eq . ), phosphoric acid ( 80 ml ) were added and stirred at 120 ° c . for 3 hours . when hplc indicated the completion of the reaction , the mixture was cooled to 0 ° c . and poured into crushed ice water ( 300 ml ) and adjusted ph = 12 with 10 % sodium hydroxide . the water layer was extracted with dichloromethane ( 3 × 5 ml ). the organic layers were incorporated together and dried , concentrated to get the crude product , and the crude product was recrystallized with toluene to get 8 . 9 g light yellow solid of the intermediate r -(−)- pzqa , wherein the yield of the intermediate was 88 . 1 %, the melt point is 122 - 123 ° c . and ee value was 99 . 1 %. 1 h nmr ( cdcl 3 , 400 mhz , δ ppm ): 1 . 76 ( bs , 1h ), 2 . 64 - 3 . 02 ( m , 4h ), 3 . 49 ( d , j = 17 . 6 , 1h ), 3 . 61 ( d , 1h ), 3 . 67 ( ddd , 1h ), 4 . 69 - 4 . 85 ( m , 2h ), 7 . 04 - 7 . 20 ( m , 4h ). to a reactor , the compound 19 ( 15 . 32 g , 50 mmol , 1 eq . ), ethanol ( 130 ml ) and hydrochloric acid ( 1 m , 600 ml ) were added and heated to reflux and stirred for 28 - 30 hours . when hplc indicated the completion of the reaction , the mixture was cooled to 0 ° c . and extracted with ethyl acetate ( 3 × 50 ml ) and adjusted ph = 12 with 10 % sodium hydroxide . the water layer was extracted with dichloromethane ( 3 × 50 ml ). the organic layers were incorporated together and washed with salt water , dried with anhydrous sodium sulfate , and concentrated to get the crude product , and the crude product was recrystallized with toluene to get 9 . 4 g light yellow solid of the intermediate r -(−)- pzqa , wherein the yield of the intermediate was 93 %, the melt point is 122 - 123 ° c . and ee value was 99 . 4 %. 1 h nmr ( cdcl 3 , 400 mhz , δ ppm ): 1 . 76 ( bs , 1h ), 2 . 64 - 3 . 02 ( m , 4h ), 3 . 49 ( d , j = 17 . 6 , 1h ), 3 . 61 ( d , 1h ), 3 . 67 ( ddd , 1h ), 4 . 69 - 4 . 85 ( m , 2h ), 7 . 04 - 7 . 20 ( m , 4h ). to a reactor the intermediate r -(−)- praziquantel amine ( 5 . 05 g , 25 mmol , 1 eq . ), triethylamine ( 3 . 78 g , 5 . 22 ml , 37 . 5 mmol , 1 . 5 eq .) and dichloromethane ( 124 ml ) were added and cooled in ice bath to 0 ° c . cyclohexanecarboxylic acid chloride ( 4 . 05 g , 3 . 69 ml , 27 . 47 mmol , 1 . 1 eq .) was added dropwise to the mixture under stirring and the temperature was kept at 0 ° c . during addition . after the addition , the resulting mixture was stirred at 20 - 25 ° c . for 16 hours . when hplc analysis indicated the completion of the reaction , the reaction was quenched with water ( 16 ml ), and the solution was stirred for further 30 mins . the organic layer was separated and washed with saturated sodium carbonate , 0 . 5 n hcl and salt water , dried over anhydrous sodium sulfate and concentrated to get the residue . the residue was recrystallized with the mixed solvent of acetone / n - hexane ( 55 ml , l / l , v / v ) to get 7 . 42 g colorless crystal of ( r )- praziquantel , wherein the yield of ( r )- praziquantel was 95 %, the purity was 99 . 2 % and the melt point was 113 - 115 ° c . 1 h nmr ( dmso - d 6 , 400 mhz , δ ppm ): 1 . 21 - 1 . 96 ( m , 10h , 5 × ch 2 ), 2 . 45 - 2 . 50 ( m , 1h , ch ), 2 . 78 - 3 . 05 ( m , 4h , ch 2 ), 4 . 10 ( d , 1h , ch 2 ), 4 . 48 ( d , 1h , ch 2 ), 4 . 79 - 4 . 85 ( m , 2h , ch 2 ), 5 . 20 ( d , 1h , ch ), 7 . 12 - 7 . 30 ( m , 4h , ar — h ). the above embodiments are given for illustrating the technical concept or features of the invention , and this is intended to enable a person skilled in the art to appreciate the content of the invention and further implement it , and the protecting scope of the invention can not be limited hereby . also , any equivalent variations or modifications made according to the spirit of the invention should be covered within the protecting scope of the invention . | 2 |
referring to fig1 there is shown a construction of an optical system employing a reflection type photoelectric switch in accordance with a first embodiment of this invention . the switch includes a housing 1 , a printed circuit board 2 carrying a light emitting element 3 such as a light emitting diode and a light receiving element 4 such as a photodiode which are mounted on the board 2 . the light emitting element 3 may employ a single light emitting diode having a ga al as hetero conjunction shown in fig2 ( a ) and a spectrum characteristic wherein different wavelength lights are emitted as shown in fig2 ( b ). if desired , a pair of light emitting diodes respectively emitting different wavelength rays closely mounted on a single base may be employed instead of the single chip of fig2 ( a ) so as to project a substantially single light beam through a single lens . exemplarily , the light emitting diode may be the diode which simultaneously emits a strong red radiation at 660 nm and a weak infrared radiation at 880 nm as a substantially single light beam . a pair of converging lenses 5 and 6 are respectively disposed corresponding to the light emitting and receiving elements 3 and 4 . the converging lens 5 guides the radiation emitted from the emitting element 3 to a retroreflector 7 positioned apart from the main body of the photoelectric switch by a predetermined interval . the reflector 7 is designed to absorb only one of the radiations , e . g . red light , and reflect only another radiation , e . g . infrared , or vice versa . the reflector 7 in this embodiment employs a single mold consisting of combination of corner cubes made of acrylic resins mixed with dyes which absorbs red light and passes infrared rays , and is designated to have spectrum characteristics wherein red rays at 700 nm are reflected at a substantially zero rate but infrared rays at wavelengths longer than 800 nm are reflected at 90 % or higher rate as shown in fig3 . the converging lens 6 disposed on a front wall of the photoelectric switch converges the reflected rays from the reflector to the light receiving element 4 . the light receiving element 4 employs a color sensor separating rays having different wavelengths to generate signals . exemplarily , the sensor is constructed to have a pair of photo diodes each having different conjunction depth in a single chip as shown in fig4 ( a ) to discriminate color by utilizing the difference between the respective spectrum characteristics of the diodes . the diodes are represented by an equivalent circuit having a pair of photodiodes pd - a and pd - b as shown in fig4 ( b ) which respectively response curves pd - a and pd - b shown in fig4 ( c ). referring to fig5 and detection circuit section in this embodiment will be described hereinafter . the outputs of the pair of photodiodes pd - a and pd - b are applied to non - inverting amplifiers 10 and 11 which respectively amplify the outputs from the photodiodes at the same amplifying rate . the output from the amplifier 10 is applied to an adder 12 connected to a voltage source 13 . the adder 12 sums a minute voltage level v off of the source 13 and the output from the amplifier 10 , and its output is applied to a inverting input terminal of an operational amplifier representing a comparator 14 . the output from the amplifier 11 is applied to non - inverting input terminals of the respective operation amplifiers representing comparators 14 and 15 as comparing means . the comparator 14 compares the output from the amplifier 10 added by the minute voltage v off with the output from the amplifier 11 , and the voltage source 13 is disposed to fix a comparison output to a low &# 34 ; l &# 34 ; level when both outputs from amplifiers 10 and 11 are equal . the comparator 15 at its inverting input terminal is connected with a reference voltage source 16 providing a reference voltage v ref to compare the voltage v ref with an input voltage thereof . the outputs from comparators 14 and 15 are applied to and circuit 17 to apply their logic product to output circuit 18 which is designed to produce a object detection signal when its output is a low &# 34 ; l &# 34 ; level . the light emitting diode employed in the light emitting element 3 generates the spectrums represented by the graph of fig2 ( b ), that is , color rays and infrared rays , which are radiated through the lens 5 to the retroreflector 7 remote from the main body of the photoelectric switch . the reflector 7 absorbs red rays and reflects only infrared rays in a same direction . accordingly , only infrared rays are applied to the light receiving element 4 through converging lens 6 . the operation states at the respective portions of the photoelectric switch are represented by the following table 1 : table 1______________________________________ ( iii ) ( i ) ( ii ) object having no object ordinary mirror surface exists object exists exists______________________________________relative pd - a 1 0 2photo - diode pd - b 5 0 1currentvaluescom - 14 h l lparator 15 h l hand output h l lswitch output non exist exist______________________________________ when there is no object to block the light path ( i ), the photodiode pd - a produces a relatively low level photo - current while the photodiode pd - b produces a high level photo - current since the photodiodes pd - a and pd - b of the light receiving element 4 have the response curves shown in fig4 ( c ). the table 1 expresses the respective relative values of photo - currents as &# 34 ; 1 &# 34 ; and &# 34 ; 5 &# 34 ; when there is no object . the signals corresponding to such photo - currents are amplified by non - inverting amplifiers 10 and 11 for application to the comparators 14 and 15 . in this occasion , the output of amplifier 11 is large , so that comparator 14 is a high &# 34 ; h &# 34 ; level . the comparator 15 also produces a high &# 34 ; h &# 34 ; level since a signal larger than a determined threshold level v ref . thus , and circuit 17 produces a high &# 34 ; h &# 34 ; level and output circuit 18 does not produce any object detection signal . when an ordinal object 8 to be detected blocks the light path between the photoelectric switch and the reflector 7 ( ii ), neither red rays nor infrared rays are applied to the light receiving element 4 . as expressed in table 1 , the photo currents of the photodiodes pd - a and pd - b are zero , and the comparator 15 produces a &# 34 ; l &# 34 ; level . the comparator 14 also produces a &# 34 ; l &# 34 ; level since the non - reversible input terminal of comparator 14 is supplied with the minute voltage v off of the voltage source 13 by adder 12 . thus , the output of and circuit 17 becomes a &# 34 ; l &# 34 ; level , so that an object detection signal is produced through output circuit 18 . when an object 8 having a mirror surface blocks the light path but reflects rays by the mirror surface ( iii ), the rays having spectrums shown in fig2 ( b ) are applied to the light receiving element 4 through converging lens 6 as they are . the respective photodiodes pd - a and pd - b of the element 4 have spectrum characteristics shown in fig4 ( c ), so that the reflective values of photocurrents of the photodiodes pd - a and pd - b are exemplarily expressed as &# 34 ; 2 &# 34 ; and &# 34 ; 1 &# 34 ; shown in table 1 . these photocurrents are amplified as they are to be compared one after another by the comparators 14 and 15 . the comparator 14 is &# 34 ; l &# 34 ; because the output from the diode pd - a is large , while the comparator 15 becomes &# 34 ; h &# 34 ; because the input to the non - inverting input terminal of comparator 15 is higher than the reference voltage v ref . thus , the logic product from and circuit 18 becomes &# 34 ; l &# 34 ;, and an object detection signal is produced . the adder 12 and the and circuit 17 are employed in this embodiment , but detection signals may be produced by only one of them whether or not the object to be detected has any mirror surface . referring to fig6 ( a ) through 6 ( c ), there is shown a light receiving element modified from the element 4 of the above - mentioned first embodiment . as shown in fig6 ( a ), the light receiving element is constructed to have a pair of photodiodes pd - a and pd - b disposed in a single chip at different light receiving areas . further , thin interference filters 21a and 21b having different characteristics are disposed on the respective light receiving areas so as to provide different spectrum characteristics . the equivalent circuit of the element of fig6 ( a ) is represented by the circuit of fig6 ( b ) likewise fig2 ( b ), and the respective spectrum characteristics follow the transparency characteristics of the filters 21a and 21b shown by the ecurves pd - a and pd - b of fig6 ( c ). the receiving element of this embodiment is applied to the element 4 and the photoelectric switch of the first embodiment , any object can be detected whether or not the object has a mirror surface as described in the first embodiment . referring to fig7 there is shown a circuit diagram of a photoelectric switch as a second embodiment of this invention , in which a light emitting element 3 emits light pulses to avoid affection by external light and improve the detection efficiency through the light emitting diode 3 continuously emits light in the first embodiment . in this embodiment , the light emitting element 3 emits pulsating rays by signals from an oscillation circuit 22 . capacitors c1 and c2 are respectively connected between photodiodes pd - a and pd - b and amplifiers 10 and 11 , so that only a . c . components of the outputs from the diode pd - a and pd - b are applied to the amplifiers 10 and 11 and further applied to comparators 14 and 15 through capacitor c3 including adder 12 or capacitor c4 . moreover , output from and circuit 17 is applied to integral circuit 23 to apply its output to output circuit 18 after holding it for a predetermined interval . as shown in fig8 if the light signals are emitted from the light emitting diode 3 as illustrated in fig8 ( a ) when there is no object to be detected ( i ), an ordinary object 8 blocks the light path ( ii ) or an object 8 having a mirror surface blocks the light path ( iii ), the respective photodiodes pd - a and pd - b of the light receiving element 4 produce outputs shown in fig8 ( b ) and 8 ( c ) which are amplified by amplifiers 10 and 11 as photo - converted electric signals to be compared by comparators 14 and 15 , so that output signals shown in fig8 ( d ) and 8 ( e ) are produced from the comparators 14 and 15 . thus , the logic product of the output signals shown in fig8 ( f ) is obtained from and circuit 17 . the and circuit 17 produces output at &# 34 ; h &# 34 ; level when any object does not exist or at &# 34 ; l &# 34 ; level when it exists whether or not mirror surface . the output from circuit 17 is held for a predetermined interval by integral circuit 23 for application to output circuit 18 which generates output signals shown in fig8 ( g ) according to non - existance or existance of the object to be detected . though the retroreflector 7 in the first embodiment is constituted with combination of corner cubes made of acrylic resins absorbing red light , the reflector 7 may be replaced with a reflector in which an infrared filter 25 passing infrared rays only but blocking red light is applied on a front wall of a unit 24 of combination with transparent corner cubes , if desired , as shown in fig9 . it should be understood that the above description is merely illustrative of this invention and that may changes and modifications are available from the scope of the appended claims . | 6 |
in terms of greater detail , the portable fire pit of the invention comprises a structure that may be stored or transported in collapsed condition . when it is desired to use the fire pit , it may be carried to the location of use , and unfolded and extended into condition of use , whether that use be merely for building a fire in the portable fire pit for purposes of warmth and aesthetic values , or for grilling food to be consumed in addition to the aesthetic values that are projected by the portable fire pit in use . structurally , the portable fire pit is designated generally by the numeral 2 , and comprises front and rear metallic wall panels 3 and 4 , respectively , each of the metal wall panels being foraminous in nature by the provision of a multiplicity of series of holes spaced on one inch centers , the holes being approximately 1 / 4 of an inch in diameter . only a few of the many holes are illustrated , the positions of the remaining holes being shown by lines marking the centers of the holes . it is important to note that alternate rows of the holes are offset by approximately one - half the distance between adjacent holes . each of the metal wall panels 3 and 4 is approximately 18 - 1 / 4 inches wide in a horizontal dimension , and approximately 18 inches high in a vertical dimension perpendicular to the horizontal dimension . each of the metal wall panels is preferably formed from sixteen gauge low carbon cold rolled steel and is formed with a peripheral flange 6 circumscribing its outer edges on all four sides and projecting perpendicularly from the associated plate approximately one and one - half inches to thereby define a shallow pan structure , the bottom of which is formed by the associated foraminous front or rear metal wall panel 3 or 4 , respectively . in the interest of brevity in this description , it should be noted that both the front and rear wall panels 3 and 4 , including the circumscribing flange 6 , are substantially identical in structure and , accordingly , only one of these front and rear metal wall panels will be described herein in detail , it being understood that whatever structures or qualities are attributed to one are also attributable to the other . each of the front and rear metal wall panels is provided with a pair of legs 7 that are generally v - shaped in configuration , formed from strap metal , and provided with flanges 8 extending in opposite directions and welded to the lower peripheral flanges 9 of the front and rear metal wall panels adjacent each of the vertical peripheral side edge flanges 11 and 12 as illustrated in fig2 and 3 . it should be noted that each of the leg structures projects from the panel flange 9 to which it is welded by about 2 - 3 / 4 inches , each of the legs of the pair associated with each of the metal wall panels being positioned on the lower peripheral flange 9 substantially flush with the foraminous metal wall panels 3 and 4 . on the top peripheral flange 13 of each of the front and rear wall panels 3 and 4 there is provided a handle designated generally by the numeral 14 and including a grip portion , leg members , and laterally extending flange portions that are suitably welded to the top peripheral flange medianly between the vertical peripheral flanges 11 and 12 , and adjacent the free edge 15 of the peripheral flange remote from the foraminous front and rear metal wall panels . because of the positioning of the pairs of legs 7 on each of the front and rear metal wall panels , and because of the positioning of the handles 14 on the front and rear metal wall panels , when the two front and rear metal wall panels are in folded or closely confronting position , as illustrated in fig5 the pairs of legs will be spaced laterally from one another to lend stability to the structure so that it may freely stand on a flat supporting surface while the handles 14 will be more closely spaced to one another , thus permitting the two handles to be grasped by one hand so that the portable fire pit may be picked up and transported to its storage location . welded to the bottom of the shallow pan formed by each of the front and rear metal wall panels and the peripheral flange formed thereabout , are a pair of support brackets designated generally by the numeral 19 . each of the support brackets is welded symmetrically with respect to a plane parallel to the vertical side peripheral flanges 11 and 12 , and spaced therefrom about 1 - 7 / 8 inches . the support brackets 19 are spaced upwardly from the lower peripheral flange 9 approximately 11 - 3 / 4 inches , and at that dimension provide an inwardly protecting ash grate or grill support flange 21 , the other leg of the l - shaped bracket lying flat against the inside surface of the metal wall panel with which it is associated and being spot - welded thereto so as to provide a rigid support bracket for supporting an ash grate on which fuel to be burned may selectively be supported when the portable fire pit is in use as a barbecue grill fueled , for instance , by charcoal briquettes . for a purpose which will hereinafter be explained , each of the vertical peripheral flanges 11 and 12 ( fig2 , 4 and 5 is provided with an elongated series of five apertures 22 having a diameter of about 0 . 213 inches and centered approximately 0 . 406 &# 34 ; from the free edge of the peripheral flanges with all of the apertures lying in a common plane . formed in the lower peripheral flanges 9 of each of the front and rear wall panels are a pair of laterally spaced apertures 23 ( fig2 ) spaced approximately 9 - 1 / 2 inches apart and lying equidistant on opposite sides of a median plane between the peripheral flanges 11 and 12 . as with the apertures 22 , the apertures 23 are spaced nearer the free edge of the flange 9 than they are to the foraminous front and rear metal wall plates or panels , and serve to receive appropriate fasteners as will be explained . as indicated above , when the two front and rear metal wall panels , each constituting a shallow dish - shaped structure , are placed in confronting relationship as illustrated in fig1 and 5 , they constitute mirror images of one another , and when the free edges of the peripheral flanges 9 are closely opposed , form a shallow enclosure within which auxiliary equipment as will hereinafter be described and forming a part of the portable fire pit may be stored when the structure is in collapsed storable condition . however , to eliminate the necessity of dissassembly of the structure in order to effect a collapsed condition thereof , the portable fire pit designated generally by the numeral 2 is also provided with left and right side metallic wall panels 24 and 26 , respectively . each of these left and right metal wall panels are identical to one another , and also constitute mirror images of each other when in confronting position . referring to fig1 through 4 , inclusive , it will there be seen that the left metal wall panel 24 is formed as a composite from two substantially identical sub - panels 27 and 28 pivotally joined along adjacent vertical edges by an elongated piano - type hinge 29 . the opposite vertical side edges of the sub - panels 27 and 28 are provided with apertures along their edges that correspond in spacing to the apertures 22 formed in the peripheral flanges 11 and 12 of the front and rear metal wall panels . these corresponding apertures and appropriate cap screws or rivets form a means by which the sub - panel 27 , for instance , may be pivotally mounted by a hinge 31 to the confronting edge portion of the peripheral flange portion 12 so as to thus pivotally join the foldably collapsible composite left side wall 24 to the rear metal wall panel 4 . in like manner , the opposite longitudinal and vertical edge portion of the sub - panel 28 is pivotally mounted to the peripheral flange 11 of the front metal wall panel 3 by a hinge 32 ( fig1 and 2 ) similar to the hinge 31 , thus enabling the left side composite wall panel 24 to be folded as illustrated in fig1 and 2 , or to be extended as illustrated in fig3 whereby the sub - panels 27 and 28 lie in a common plane as illustrated to form the left foldably collapsible wall panel 24 . in like manner , the opposing sub - panels 33 and 34 that make up the right side foldable wall panel 26 , are also joined to one another by a medianly positioned piano - type hinge 29 , with opposite vertical edges of the sub - panels being pivotally connected to the associated peripheral flanges 11 and 12 by hinges 35 and 36 , respectively , similar to the hinges 31 and 32 . it will thus be seen that with the front and rear metal wall panels 3 and 4 pivotally connected to the composite left and right foldable side wall panels 24 and 26 , the portable fire pit may be unfolded or extended from the position illustrated in fig5 to the successive positions illustrated in fig2 and 3 . in fig2 it will be seen that the portable fire pit is only partially extended , while in fig3 it is seen that the portable fire pit is completely extended to form a generally box - like or cubiform structure having foraminous front , rear , left and right side walls . thus , without more , the structure described above , defines foraminous walls about a space which , without more , can be utilized to constitute a fire pit or foraminous enclosure within which a fire can be maintained , the legs 7 resting on a suitable support surface , such as the ground , or on a concrete slab . in such form , the enclosure constitutes an article of manufacture usable in the condition illustrated in fig3 for the purpose stated . however , it is preferred that the portable fire pit of the invention be provided with auxiliary structures that make the portable fire pit more widely usable , for instance , in backyard patios or open congregation areas where a group of people might assemble for supper , conviviality and comradery . accordingly , in one preferred form , the structure as illustrated in fig1 through 7 , is provided with an ash collector and retention pan designated generally by the numeral 37 and illustrated in plan in fig1 . the ash collector and retention pan is nominally about one inch in depth , having a bottom wall 38 , surrounded peripherally by a flange 39 . in the embodiment illustrated in fig1 through 7 , the ash collector and retention pan 37 is pivotally hinged to the lower peripheral flange 9 of the front metal wall panel 3 , as illustrated in fig6 by hinge 41 , one leaf of which is spot welded to the underside surface of the bottom 38 of the pan , while the opposite leaf of the hinge is spot welded to the peripheral flange 9 on its inner surface . while spot welding is preferred , other means may be utilized to retain these elements in assembled condition . as illustrated in fig7 when the ashes have been disposed of after use and it is desired to collapse the portable fire pit , the ash pan 37 may be pivoted upwardly so that it lies parallel to the foraminated front metal wall panel 3 as illustrated . as illustrated in fig1 , the ash pan 37 is preferably substantially square in its configuration , being formed from 14 gauge low carbon cold rolled steel , including the peripheral flange 39 . formed on the upper edge of the peripheral flange 39 are inwardly projecting flanges 42 forming handles which may be grasped by a user to tilt the ash pan to raise it into its elevated position as illustrated in fig7 . it will thus be seen that when the ash pan 37 is deployed horizontally within the enclosure as illustrated in fig3 the lateral edges of the ash pan are supported on the inwardly projecting lower flanges 9 of the front and rear metal wall panels and the substantially similar flanges formed on the bottom edges of the left and right wall panels 24 and 26 . in this position , the rectilinear rigid configuration of the ash collector pan functions to retain the foraminous walls of the surrounding structure in its extended form . to emphasize the rigidity between the ash collector pan 37 and the foraminous surrounding walls of the portable fire pit , suitable apertures 43 are formed in the bottom plate 38 of the ash pan 37 , and when the ash pan is deployed into its horizontal position resting on the inwardly projecting lower flanges of the front , rear and foldable left and right side metal wall panels of the portable fire pit , suitable bolts 44 are inserted through the apertures 43 , and secured by suitable wing nuts 46 . the use of wing nuts is preferred because it facilitates detachment of the ash pan from the underlying flanges of the side wall structure , and in the embodiment illustrated in fig6 and 7 , enables the ash pan , after removal of the bolts 44 to be tilted into its vertical position in preparation for collapse of the structure for storage purposes . also provided in the bottom 38 of the ash pan as illustrated in fig1 , are a multiplicity of slots formed in the bottom 38 adjacent each of the peripheral edges . thus , referring to fig1 , it will be seen that associated with the front and rear edges of the pan there shown , there are provided two elongated slots 47 and 48 lying in a common plane and equally spaced from the associated peripheral flange 39 of the ash pan . additionally , the slots 47 and 48 , are spaced symmetrically on opposite sides of a median plane that extends medianly through the handles 42 . in like manner , associated with the opposite edge of the ash pan as illustrated in fig1 , two additional slots 49 and 51 are provided , both also lying in a common plane parallel to the plane of the associated and adjacent peripheral flange 39 , and parallel to the plane of the slots 47 and 48 . the slots 49 and 51 are equally spaced on opposite sides of a vertical plane passing medianly through the handles 42 on opposite edges of the ash pan . again referring to fig1 , it will be noted that the ash pan bottom 38 is also provided with two sets of elongated slots formed adjacent the side edges of the ash pan . one such set includes elongated slots 52 , 53 and 54 , the slots being spaced apart laterally at different distances , and the individual slots being of different lengths . it should be noted that these slots 52 - 54 are also spaced inwardly from the associated peripheral flange 39 of the ash pan , and lie in a common plane perpendicular to the plane of the slots 47 - 48 and 49 / 51 . referring to the upper edge of the ash pan as illustrated in fig1 , it will be seen that the second group or set of aligned and elongated slots 56 , 57 and 58 provided in the bottom 38 of the ash pan slots have essentially the same length and the same spacing as the slots 52 , 53 and 54 , but are reversed in their orientation . stated in other words , the slot 56 is equivalent to the slot 52 , the slot 57 is equivalent to the slot 53 , and the slot 58 is equivalent to the slot 54 . in addition to the slots described above , two additional slots 61 and 62 are formed in the bottom , these two slots being aligned with each other as illustrated , and being spaced closer to the left rear edge of the pan as illustrated in fig1 than to the right front edge of the pan as illustrated in fig1 . also , the slot 61 is formed in the bottom 38 inboard from the slots 57 and 58 , and substantially spaced medianly therebetween . on the other hand , the slot 62 is in a plane common to the slot 61 that lies parallel to the edge flange 39 and to the plane of the slots 47 and 48 , and lies inboard of the perpendicularly oriented slots 52 and 53 as shown . the purpose of these slots 61 and 62 will be described hereinafter . the purpose of the groups of slots arranged in association with the front and rear edges of the ash pan 38 is to enable the detachable mounting of a set of two metallic heat deflector plates as illustrated in fig2 where the heat deflector plate is designated generally by the numeral 63 , and to accommodate a set of two metallic heat deflector plates as illustrated in fig1 , each of which is designated generally by the numeral 64 . referring first to the heat deflector plate 63 as illustrated in fig2 , it will be noted that this plate is elongated in a horizontal dimension , generally having a length approximately twice its height , and is provided with a pair of projecting tab portions 66 and 67 that extend beyond the bottom edge 68 of the heat deflector plate . appropriate apertures 69 are formed in a multiplicity of elongated and parallel series vertically spaced as shown so as to provide a multiplicity of apertures in the heat deflector plate . additionally , associated with the left and right edges 71 and 72 , respectively , are a pair of slots 73 and 74 . the slots 73 and 74 extend substantially half way through the height of the plate 63 . two such plates 63 are provided , each being a mirror image of the other , one such plate , such as the plate 63 , being adapted to be mounted on the ash collector pan 38 by insertion of the tab projections 66 and 67 into the elongated slots 47 and 48 formed adjacent the left rear edge of the ash pan as illustrated in fig1 . the second plate of the set is identical to the plate 63 and is mounted so that its tab projections 66 and 67 penetrate the elongated slots 49 and 51 associated with the right front edge of the ash pan as illustrated in fig1 . the set of two heat deflector plates 64 , one of which is illustrated in fig1 , are also formed from 13 gauge low carbon cold rolled steel as are the plates 63 , and like the plates 63 , two such plates 64 are provided but in the interest of brevity in this description and in the drawings , only one of each of the plates is illustrated in fig1 . it is to be understood that two of each of the plates 63 and 64 , each being a mirror image of its corresponding mate , are provided in this invention . referring to the heat deflector plate 64 as illustrated in fig1 , it will be seen that this plate also is provided with a lower edge 76 from which project first , second and third tab projections 77 , 78 and 79 , respectively , each of the projections 77 and 79 being provided additionally with an aperture 80 near its bottom edge for a purpose which will hereinafter be explained . additionally , the heat deflector plate 64 is provided with a left edge 81 , a right edge 82 , a top edge 83 and a plurality of apertures 84 arranged in a plurality of spaced elongated series parallel to each other and which extend for substantially the length and width of the plate . formed in the plate commencing at the lower edge 76 are a pair of slots 86 and 87 , each of the slots being adjacent associated end edges of the plate , and each of the slots terminating medianly half - way through the height of the plate . it is important to note that as compared with the plate 63 as illustrated in fig2 , the slots 73 and 74 in that plate extend from the top edge 70 downwardly to a median plane through the plate . it is also important to note that when the plates 63 are mounted on the ash pan bottom 38 , the projecting tabs 66 and 67 extend through the apertures 47 - 48 and 49 / 51 to the maximum extent so that the lower edges 68 of the plates 63 rest on the inner surface of the bottom 38 of the ash collector pan . in like mariner , when the tab projection 77 , 78 and 79 are inserted into the correspondingly positioned elongated slots 52 , 53 and 54 , ( and elongated slots 56 , 57 , and 58 ) the bottom edges 76 of the plates 64 impinge on the inner surface of the bottom 38 of the ash pan , and the plates 64 extend perpendicular to the plates 63 . additionally , the slots 86 and 87 in the deflector plates 64 coincide with the slots 73 and 74 in the plates 63 and extend below such slots to engage the body of the plates 63 , causing the plates 63 and 64 to be detachably interlocked one with the other to form a four - sided heat deflecting fence or shield spaced inwardly from the outer foraminous walls of the portable fire pit , thus providing an air space between the back sides of the heat deflector plates and the inner surfaces of the side walls around the interior of the cubicle as illustrated in fig1 . this assembly is also illustrated in assembled form in plan in fig1 , and in front elevation in fig1 . to detachably retain the assembled heat deflector shield plates secured within the portable fire pit , it will be noted that the projecting tabs 77 and 79 of heat shield plates 84 ( fig1 ) are provided with apertures 80 , project below the bottom surface of the bottom 38 of the ash pan , ( fig1 ) and are detachably locked to the bottom 38 by a quick release fastener designated generally by the numeral 88 ( fig1 and 16 ), which includes a looped end 89 through which a finger may be extended to withdraw the straight shank 91 from the aperture 80 through which it penetrates . it will thus be seen that with the heat deflector plate 63 and 64 arranged on and secured to the ash pan 37 as described above , and with the ash pan per se being secured by the bolts 44 to the inwardly extending flanges of the front , rear and side walls of the portable fire pit when in extended position as illustrated in fig3 the interconnection of the ash pan 37 with the side walls of the portable fire pit rigidify the entire structure so as to eliminate any possibility that the structure may be inadvertently or intentionally collapsed during use . additionally , as previously stated , the deflector plates 63 and 64 arranged as illustrated in fig1 in plan , provide an air space 92 on all sides of the assembled ash pan and heat deflector plates , thus minimizing the more intense heat that is generated within the confines of the heat deflector plates from being transmitted to the outer foraminous walls of the portable fire pit , thus preventing such walls from being degraded through warpage . it should be understood that the tolerances between the outer enclosing foraminous cubicle formed by the foraminous walls of the portable fire pit and the ash pan and detachably secured heat deflector plates 63 and 64 are such as to permit expansion and contraction of the metal parts without imposing stress on any part . with the heat deflector structure thus assembled on the ash pan , a fuel support grate 93 may be lowered from above onto the inwardly projecting upper leg 21 of the support bracket 19 welded to the inner surface of each of the front and rear metal wall panels 3 and 4 as illustrated in fig4 . the grill 93 is preferably itself foraminous , and may be formed as is common from stainless steel , or chrome - plated cold rolled steel , having an outer perimeter frame that fits within the interior confines of the cubicle space defined by the foraminous side walls of the portable fire pit , with cross braces or rods arranged in parallelism between side members of the perimeter frame so that as fuel placed on the support grate or ash grill , as it might be called , and continues to burn , ashes that are formed fall through the ash grate and onto the ash collector and retention pan 37 as previously described . additionally , where it is desired to cook or grill food , a cooking grill 94 is provided detachably supported on the top inwardly projecting flanges of the front and rear wall panels , the cooking grill being constructed similarly to the ash grate , yet having parallel bars that form the grill that are spaced sufficiently wide to permit the passage of the handles 14 on opposite front and rear metal wall panels as illustrated in fig4 to thus retain the grill on the structure and spaced above the fuel or ash grate 93 sufficiently to enable cooking of food , such as the hot dogs 96 , on the cooking grill obviously , where it is desirable that the transverse rods that form the cooking grill need to be more closely spaced than would permit the passage of the handles 14 between the rods , suitable opposed notches ( not shown ) may be provided in the cooking grill to accommodate the handles 14 . in the embodiment of the invention illustrated in fig8 through 12 , the difference in structure is the manner in which the ash pan 37 is retained in the bottom portion of the portable fire pit structure , so that it may be more easily manipulated in order to give access with greater facility to the heap of ashes 95 that have been collected thereon as illustrated in fig8 - 10 . referring therefore to fig1 , which shows the generally rectangular or square configuration of the ash collector and retention pan 37 , in this embodiment , the dimensions are slightly altered to permit the ash pan to be lowered through the extended side walls of the portable fire pit , and rest on the lower flanges of the front and rear side wall panels . dimensionally , the ash pan 37 rests on the flanges 9 as illustrated in fig8 and its position thereon is immobilized by a lock mechanism designated generally by the numeral 97 . as indicated previously , the ash pan 37 is provided with a bottom 38 and a peripheral flange 39 that gives the ash pan some depth to retain the ashes that fall therein , and which is now used in conjunction with the lock mechanism 97 to immobilize the ash pan once it is placed in the lower portion of the portable fire pit . thus , as illustrated in fig8 and 12 , the lock mechanism 97 includes a stop plate 98 constituting a flange projecting perpendicularly and integrally from a mounting plate 99 that is securely mounted on a pin shaft 101 for rotation therewith , such rotation effected by a handle 102 . in the position illustrated in fig8 and 12 , the edge of the stop plate 98 abuts the flange 39 of the ash pan and retains it against lateral movement . the stop plate 98 is provided with an aperture having a serrated inner periphery that may be pressed onto the outer periphery of the shaft 101 to lock the mounting plate 99 onto the rotatable pin shaft 101 . the rotatable pin shaft 101 penetrates through an aperture in the lower portion of the front or rear wall panels , preferably the rear wall panel , and includes a bearing member 103 one end of which is welded to the handle 102 and the opposite end of which bears rotatably against the outer surface of the rear wall panel 4 . in most instances , one such lock mechanism has been found to be sufficient , but two such lock mechanisms are preferred to eliminate any possibility of the ash pan 37 shifting within the structure once the lock mechanisms have been placed in the locking attitude illustrated in fig8 and 12 . after use of the portable fire pit , when it is desired to fold the structure for storage or transport , the grills 93 and 94 are removed to provide access to the interior of the structure , and the heat deflector shield plates are removed from the ash pan . the handles 102 of the lock mechanisms are now rotated to re - orient the stop plates 98 so that they are now in a horizontal position and lie in a common plane above the ash pan 37 . with the lock plates so re - positioned , the ash pan may now be moved to the left as indicated by the arrow a illustrated in fig9 thus enabling the right edge of the ash pan to drop to the ground or other surface as illustrated by arrow b in fig1 . the ash pan , with its right edge now resting on the ground or other surface , is now moved to the right as illustrated by arrow c in fig1 , so that the left end or edge of the ash pan may now drop to the ground as illustrated by arrow d and rest in that position , while the remainder of the portable fire pit is lifted away from the ash pan . the ash pan may now be cleaned by removal and disposal of the ashes in whatever way is appropriate . preferably , the ashes are placed in a fire proof container and disposed of by placement in a waste receptacle of the type that is provided in most national forest areas and state parks and camping grounds and beach areas , or even in a residential garbage container . to fold or collapse the portable fire pit of the embodiment illustrated in fig4 - 7 wherein the ash pan is pivotally mounted to the front wall panel 3 by hinge 41 , after removal of the ashes from the ash pan , the heat deflector plates are lain flat on the ash pan and the ash pan is pivoted upwardly into the position illustrated in fig7 wherein the ash pan lies parallel to the front wall panel 3 , and the heat deflector plates lie in the space between the ash pan and the front wall 3 of the structure . in this position , the support flanges 21 ( fig4 ) penetrate through slots 61 and 62 formed in the bottom of the ash pan . next , the grills 93 and 94 are lowered edgewise through the open top of the still extended portable fire pit , and placed in parallel relationship with the rear wall panel 4 , actually resting on the inside surface of the lower flange 9 and the inside surface of the associated wall panel 4 . the composite hinged left and right side walls of the structure are now caused to pivot inwardly as illustrated in fig2 until the front and rear metal wall panels are placed in closely spaced opposing position as illustrated in fig5 with all of the pertinent equipment enclosed within the now collapsed structure . with the embodiment of the invention illustrated in fig8 - 12 , the ash pan , not being pivoted to the front wall panel 3 as in fig7 is , after removal of the ashes , lowered edge first through the extended open top of the structure until the short slots 61 and 62 in the ash pan come into registry with the support flanges 21 of brackets 19 welded to the inside surface of either the front or rear wall panel 3 or 4 . when the slots 61 and 62 are placed in registry with the ash grate support flanges 21 , the support flanges penetrate the slots 61 and 62 , and the ash pan thus lies suspended on the inwardly projecting flanges 21 of the ash grate brackets . the heat deflector plates 63 and 64 and the grills 93 and 94 are supported on the bottom flange 9 of the opposing rear wall panel 4 . the lock pins 88 ( fig1 ) and the wing nuts 46 and bolts 44 , ( fig2 ) having previously been removed , are stored in an appropriate container for future re - use . with all of the pertinent equipment thus stored in a parallel relationship within the extended condition of the portable fire pit the hinged and pivoted left and right side walls 24 and 26 , respectively , may now be collapsed inwardly as illustrated in fig2 and ultimately placed in the relationship illustrated in fig5 wherein all of the equipment is contained within the confines of the front and rear wall panels of the portable fire pit . the collapsed structure may now be placed in a container , or may be banded with an appropriate strap to prevent its inadvertent extension until it is desired to use the structure again as a fire pit . thus , it may remain in storage in the condition illustrated in fig5 for an indefinite period , until it is desired to re - establish the fire pit in its extended attitude illustrated in fig3 . thus , to extend the portable fire pit for use from the collapsed condition illustrated in fig5 to the extended condition illustrated in fig3 all that is required is that the front and rear wall panels 3 and 4 be separated from each other , thus causing the pivoted and hinged left and right side wall panels 24 and 26 to extend themselves into the position illustrated in fig3 whereupon the cooking grill and the fuel support grate or grill may be removed from the interior of the structure , the heat deflection plates 63 and 64 may be removed from the interior of the structure , and the ash pan 37 reoriented so that it now lies on the lower flanges of the front and rear side wall panels and the left and right side wall panels , and either locked in place with the bolts and wing nuts illustrated in fig2 , or retained in an immobile position with the alternate structure illustrated in fig8 - 12 . in either case , the ash pan is immobilized , and thereafter , the pairs of heat deflector plates 63 and 64 may be mounted on the ash pan , it being noted that the heat deflector plates 63 are first mounted in the slots 47 - 48 and 49 / 51 which correlate with the front and rear wall panels 3 and 4 , respectively , of the portable fire pit . thereafter , the pair of plates 64 are lowered into position so that the slots 86 and 87 coincide with the slots 73 and 74 of the perpendicularly related heat deflector plates 63 , the slots 86 and 87 dropping below the slots 73 and 74 in order to lock the four sides of the heat deflector assembly into an integrated or composite structure within which the nucleus of a fire may be contained and which functions to shield the side walls 3 , 4 , 24 and 26 from the direct heat radiated from the core of the fire . it will of course be understood that when the portable fire pit is used in the manner just described to provide a fire within the enclosure that is contained within the cubicle formed by the heat deflector plates 63 and 64 , the ash grate or grill 93 that may be supported on the support brackets 19 may be used as a spark arrestor rather than a fuel support grate and supported on the top of the fire pit in place of the grill 94 . alternatively , the grill 93 may be removed from the assembly , and food to be cooked may be supported on the grill 94 supported on the top surface of the portable fire pit . alternatively , the grill 93 may support fuel , such as briquettes of the type that are commonly used for outdoor barbecues ( fig4 ), whereupon the ash from such briquettes , as they are consumed , will fall into the ash pan 37 . in this alternative , the grill 94 is utilized for cooking food to be barbecued . having thus described the invention , what is believed to be new and novel , and sought to be protected by letters patent of the united states is as follows . | 8 |
a detailed description of a preferred embodiment of the invention is provided below . while the invention is described in conjunction with that preferred embodiment , it should be understood that the invention is not limited to any one embodiment . on the contrary , the scope of the invention is limited only by the appended claims and the invention encompasses numerous alternatives , modifications and equivalents . for the purpose of example , numerous specific details are set forth in the following description in order to provide a thorough understanding of the present invention . the present invention may be practiced according to the claims without some or all of these specific details . for the purpose of clarity , technical material that is known in the technical fields related to the invention has not been described in detail so that the present invention is not unnecessarily obscured . [ 0032 ] fig1 is a schematic diagram illustrating a system used in one embodiment to alert users to dynamic content of interest at the time of the alert ( also referred to herein as an “ item of current interest ”). the system 100 includes at least one alerting user 102 who accesses dynamic content associated with a uniform resource locator ( url ), determines the content is of current interest , and sends an alert indicating that the url is of current interest , as described more fully below . the system 100 also includes at least one participant 104 . in one embodiment , participant 104 provides an indication of the participant &# 39 ; s interests and receives a list of urls providing the location of dynamic content , such as web content on the world wide web , that may be of interest to the participant at the time of the alert , as described more fully below . both the alerting user 102 and the participant 104 are connected to a web server 105 via the internet . web server 105 is a computer system configured to present web pages and other web browser readable file , and to receive data from users , via the world wide web . web server 105 is connected to an application server 106 and is configured to provide data to and receive data and instructions from application server 106 . application server 106 is configured to perform the application logic functions described more fully below . in one embodiment , the functions performed by the application server , as described more fully below , are divided among two or more computers so as to optimize the distribution of work load among the computers and to minimize the time the system takes to respond to inputs and queries from users . when an alert has been received and is being processed , as described more fully below , the application server 106 comprises an alert software object 108 used to store data relating to and perform certain processing with respect to an alert , as described more fully below . the alert software object 108 uses data provided in an alert sent by alerting user 102 , along with data retrieved from database 110 associated with the application server 106 , to process the alert . certain of the data that results from the processing performed by alert software object 108 is then stored in database 110 . in one embodiment , database 110 is stored in memory in application server 106 . in one embodiment , database 110 is stored in a separate structure , such as a database server , connected , either directly or through a communication link , with application server 106 . in one embodiment , when a request from a participant for a list of urls for items of current interest is received , the application server 106 comprises a hot list software object 112 used to store certain data concerning and perform certain operations with respect to the request from the participant and the response thereto . in one embodiment , the hot list object 112 comprises an interest category array 114 . in one embodiment , the interest category array 114 is comprised of one or more interest category objects , each of which stores data relating to one interest category identified in the participant &# 39 ; s request as being of interest to the participant . in one embodiment , the hot list object 112 comprises a hot token array 116 . the hot token array 116 is comprised of a hot token object for each url of current interest in the database for the category or categories indicated in the participant &# 39 ; s request . as indicated in fig1 an alert sent by an alerting user includes , in one embodiment , at least the url of the web content considered by the alerting user to be of current interest . in one embodiment an alert may also include an interest selection , meaning a category or subject area to which the alerting user believes the web content relates , and / or a caption in which the alerting user may provide text indicating what the alerting user believes to be of current interest in the web content . [ 0036 ] fig2 a is a series of three screen shots showing three different states of an alert submission display 200 used in one embodiment . one view is comprised of blank alert submission display 202 . blank alert submission display 202 includes a submission button 204 used to submit an alert with respect to the url of the web content currently being accessed by the alerting user . blank alert submission display 202 also includes an interest category selection area 206 . in one embodiment , as illustrated in fig2 a , the interest category selection area 206 is configured as a pull down menu activated by selecting the downward arrow on the right side of interest category selection area 206 . blank alert submission display 202 also includes a caption area 208 in which an alerting user may enter text associated with the alert , such as text indicating why the alerting user believes the url to be of current interest . as shown in interest category selection display 212 , when the downward arrow button on the right side of interest category selection area 206 is selected , a pull down menu 214 is presented , and an alerting user may select one of the interest categories listed in the pull down menu 214 in the manner well known in the art . as shown in the completed alert submission display 222 of fig2 a , the interest category selected by the alerting user is shown in the interest category selection area 206 . in the example shown in fig2 a , the category selected is “ nature ”. in addition , the caption entered by the alerting user , the comment “ rhino !” in the example shown in fig2 a , appears in the caption area 208 of the alert submission display . as noted above , the alerting party posts the alert to the application server via the internet and the web server by selecting the submission button 204 . [ 0037 ] fig2 b is an illustration of the data structure used in one embodiment for alerts submitted by an alerting user . the alert includes an alerter_id field 240 in which data identifying the alerting user is provided . the alert also includes a url field 242 in which the url of the web content or other electronic resource being accessed by the alerting user when the alert was sent is stored . the alert also includes an interest selection field 244 in which the interest category selected by the alerting user , if any , is provided . finally , the alert includes a caption field 246 in which the caption entered by the alerting user , if any , is provided . [ 0038 ] fig3 is a flow chart illustrating a process used in one embodiment to alert users of items of current interest . the process begins in step 302 in which an alert indicating that an item is of current interest is received . next , in step 304 , the alert is processed . finally , in step 306 , the alert is disseminated to one or more participants , as described more fully below . [ 0039 ] fig4 is a flow chart illustrating a process used in one embodiment to receive an alert , as in step 302 of fig3 . the process begins with step 402 in which a transmission comprising an alert is received from an alerting user . as noted above , in one embodiment an alert includes at least the url of the web content being accessed by the alerting user at the time the alert was sent . in one embodiment , as described above , the alert also includes data indicating the identity of the alerting user . in addition , as noted above , the alert may include , at the option of the alerting user , an interest selection and / or a caption for the alert . the process shown in fig4 continues with step 404 in which a new alert software object is created at the application server , such as application server 106 of fig1 . next , in step 406 , the data provided in the alert is stored in the alert object . in step 408 , a time stamp indicating the time when the alert was received is stored in the alert object . finally , in step 410 , an alert_id , which uniquely identifies the alert and distinguishes the alert and its associated object from other alerts and their associated objects , is obtained and stored in the alert object . [ 0040 ] fig5 is an illustration of the data structure used in one embodiment for the alert object . data field 502 is used to store the alert_id described above . data field 504 is used to store the time stamp described above . data fields 506 - 512 are used to store the alerter_id , url , interest selection , and caption described above , respectively . alert intensity field 514 is used to store a number indicating the intensity or weight to be afforded to the incoming alert . the alert intensity is determined as described below . the alert object also stores properties retrieved from various database tables , described more fully below . for example , the alert object includes a last_time field 516 used to store data retrieved from the database indicating the time of the most recent prior alert . the alert object also includes an last_rank field 518 used to store a numerical ranking retrieved from the database that indicates the overall level or degree of current interest of an item as indicated by all of the alerts that have been submitted with respect to a url during the current period of activity with respect to the url through the most recent prior alert . the alert object also includes a last_weight field 520 used to store data retrieved from a database table , as described below , that represents the number of prior alerts received for the url in the interest category indicated by the current alert , as described more fully below . the alert object also includes a last_intensity_sum field 522 in which the sum of the intensities of all prior alerts for the url during the current period of activity with respect to the url , which sum is retrieved from a database table described more fully below , is stored . finally , the alert object includes a last_normal_time field 524 used to store the time , retrieved from a database table as described more fully below , when the last normalization calculation was performed . [ 0041 ] fig6 is a flowchart illustrating a process used in one embodiment to process an alert , as in step 304 of fig3 . the process begins with step 602 in which the intensity of the alert is determined . the term intensity as used herein refers to the weight or value to be assigned to a particular alert regarding an item . in one embodiment , the intensity is a value between 0 and 1 . in one embodiment , the value assigned for the intensity is higher if the alerting user selects an interest category for the alert than it would have been if the same alerting party had not selected an interest category . in one embodiment , the intensity value is higher if the alerting party provides a caption for the alert than it would have been if the alerting party had not provided a caption . in one embodiment , the intensity of an alert is increased if it is determined that the alerting party is a party that has provided particularly relevant or helpful alerts in the past , or is trusted for some other reason , such as expertise , academic credentials , or reputation within a particular community of interest . in one embodiment , the intensity of an alert is decreased if it is determined that the alerting party has provided unhelpful or erroneous alerts in the past , or if it is determined that the alerting party cannot be trusted as much as other alerting parties for other reasons , such as reputation in the relevant community . in one embodiment , it is possible to provide both an active alert by selecting an alert button and to provide a passive alert by merely accessing a url with respect to which an alerting party previously submitted an active alert . in one embodiment , an active alert is assigned a higher intensity value than a passive alert . for example , a passive alert may be arbitrarily assigned a baseline intensity value of 0 . 3 and an active alert a baseline intensity value of 0 . 5 . for an active alert , 0 . 1 could be added for each of the following conditions that is satisfied by the alert : an interest category selection was included in the alert ; a caption was included in the alert ; and / or the source of the alert is particularly trusted . conversely , 0 . 1 could be subtracted from the intensity of an alert from a source known to be unreliable . alternatively , alerts from sources known to be unreliable may be blocked and not assigned any intensity value . the process illustrated in fig6 continues with step 604 in which data values for the alert object data fields described above that are not included in the alert transmission received from the alerting party are retrieved from the database . next , in step 606 , the intensity sum for the url , which is the sum of the intensity values for all of the alerts with respect to the url , is updated . next , in step 608 , the intensity rank for the url is updated to reflect the new alert . in step 610 , the interest weight value , which represents the number of alerts for a particular url in which a particular category of interest was indicated , is updated . finally , in step 612 , the updated data values are stored to the database . [ 0045 ] fig7 is an illustration of six database tables 700 used in one embodiment to store data concerning alerts received with respect to items of current interest associated with urls . the database tables 700 include an interest_id table 702 used to provide a unique identifier , labeled interest_id in fig7 for each interest category , denominated interest_cat in fig7 . database tables 700 also include a url_id table 704 used to provide a unique identifier , labeled url_id in fig7 for each url . database tables 700 also include an interests table 706 used to store the interest weight , denominated weight in fig7 for each interest category with respect to which an alert has been submitted for a url . as noted above , in one embodiment , the weight is the total number of alerts received within a given interest category for a url . for example , if five alerts indicating the interest category people and three alerts indicating the interest category nature have been submitted for a url , there will be two entries for the url in the interest table , one for each interest category . the weight in the entry for the category people would be “ 5 ” and the weight for the url in the category nature would be “ 3 ”. the database tables 700 also include a rank , table 708 used to store a rank value for each url associated with an item of current interest , a time stamp when the rank was last calculated , and a data entity denominated num_alert in fig7 which represents the total number of alerts submitted for the url . the database tables 700 also include a comments table 710 used to store any comment submitted with an alert and to associate each comment with the corresponding url . finally , the database table 700 include a normalize table 712 used to store the sum of the intensities of the alerts submitted for a url ( intensity_sum ) and a time stamp indicating when the last normalization was performed . [ 0049 ] fig8 a is a flowchart illustrating a process used in one embodiment to update the intensity sum for a url , as in step 606 of fig6 . the process begins with step 802 in which the current intensity sum is retrieved from the database , as in step 604 of fig6 . if there is no existing record for the url in the normalize table ( i . e ., the alert being processed is the first alert for the url ), a url_id is assigned for the url , a record for the url is created in the normalize table , and the retrieved current intensity sum is set to zero . next , in step 804 , the intensity sum is incremented by the amount of the intensity of the current alert . for example , if the previous intensity sum was 4 . 7 and the intensity for the current alert was 0 . 5 , the intensity sum would be incremented to the value of 4 . 7 + 0 . 5 = 5 . 2 . finally , in step 806 , the intensity sum time stamp stored in normalize table 712 shown in fig7 ( which is the same as the last_normal_time stored in field 524 of fig5 ) is updated to the time stamp of the current alert . in one embodiment , the intensity sum is updated , and a normalization is performed as described more fully below , each time a new alert is received for a url . in such an embodiment , the time stamp stored in the normalize table 712 of fig7 will be the same as the time stamp stored in the rank table 708 of fig7 as both the rank and the intensity sum are updated each time an alert is received . [ 0050 ] fig8 b is a flowchart illustrating a process used in one embodiment to update the intensity rank for a url to reflect the intensity of the current alert . the process begins with step 822 in which the current intensity rank is retrieved from the database , as in step 604 of fig6 . as shown in fig7 in one embodiment , this value is retrieved from the rank table 708 . if there is no entry in the rank table for the url , i . e ., the alert being processed is the first alert for the url , a record in the rank table is created for the url ( identified by the url_id assigned to the url ) and the current intensity rank is set to zero . next , in step 824 , the intensity rank is updated to reflect the intensity of the current alert . in one embodiment , if the current alert has been received within a predetermined time interval τ after the last alert for the url , the updated intensity rank is a function of the last rank and the intensity of the current alert in accordance with the following formula : where k is the maximum intensity value , which as noted above is one in one embodiment , r is the last rank , r ′ is the updated rank , and i alert is the intensity value for the current alert . restating the formula to reflect the fact that in one embodiment , the maximum intensity level k = 1 , the formula becomes : if an alert is the first alert received for a url , the last rank is considered to be zero ( r = 0 ) and the above formula results in the new rank being equal to the intensity value for the current alert . for example , if the intensity value for the current alert is 0 . 5 , the updated heat rank r ′=( 1 − 0 )* 0 . 5 + 0 = 0 . 5 . if a subsequent alert of intensity 0 . 6 is received , the formula results in the updated intensity rank being calculated as follows : as the example illustrates , so long as additional alerts are received within the time interval each incoming alert will cause the intensity rank for the url to increase until the intensity rank approaches the maximum intensity value k ( in the example , the rank would approach k = 1 ). the speed with which the intensity rank for a particular url approaches the maximum value k depends on the intensity value of the incoming alerts and the frequency with which alerts are received . in one embodiment , if the predetermined time interval τ referred to above has expired between the last alert and the current alert , the updated intensity rank is calculated by a modified formula which reduces the updated intensity rank in accordance with an exponential decay function that effectively adjusts the updated intensity rank downward to account for the passage of time between the last alert and the current alert . all other things being equal , this adjustment would result in a site that received alerts more frequently to have a higher rank than a site that received alerts separated by more than the predetermined time interval . to determine the updated intensity rank as adjusted for the passage of time , the following formula is used in one embodiment : in this formula , k , r , and i alert are the same as above , a is the weight assigned to the decay function ( a higher value for a will result in a greater amount of decay per unit time ), δt is the amount of time that has elapsed between the current alert and the previous alert , and τ is the predetermined time interval referred to above . in one embodiment , the updated intensity rank is normalized by multiplying the updated intensity rank by two factors . the first factor is a low frequency enhancement factor designed to enhance the intensity rank of urls with respect to which alerts are received relatively less frequently relative to the intensity rank of urls regarding which alerts are received more frequently . the purpose of this enhancement factor is to ensure that sites that are of current interest only from time to time are not masked by the intensity ranking calculated for sites that are of current interest more frequently . in one embodiment , the low frequency enhancement factor is the time of the current alert minus the time of the last update to the intensity rank . the second factor by which the updated intensity rank is multiplied is a low volume enhancement factor the purpose of this factor is to ensure that the intensity rank of urls that are of current interest only to a smaller community of users will not be overshadowed by the intensity rank of urls that are of current interest to a large community . in one embodiment , the low volume enhancement factor is the inverse of the intensity sum for the url . accordingly , in one embodiment , the normalized intensity rank is determined by the following formula : once the intensity rank has been updated and normalized , the process shown in fig8 b continues with step 826 in which the time stamps for the normalization and intensity rank tables are updated to the time stamp of the current alert . [ 0064 ] fig8 c is a flowchart illustrating a process used in one embodiment to update the interest category weight for a url with respect to the interest category indicated in an alert . the process begins with step 842 in which the database is queried to determine if a record exists for the url for the interest category indicated in the alert . in step 844 , it is determined whether the query performed in step 842 identified an existing database table entry for the url for the interest category indicated in the alert ( i . e ., whether a prior alert indicated the same interest category for the url ). if it is determined in step 844 that a database entry does not exist for the interest category with respect to the url , the process proceeds to step 846 in which a record in the interest table is created for the url with respect to the interest category of the alert . the process then proceeds to step 850 in which the weight value is incremented for the url with respect to the interest category by increasing the value from zero to one for the new record . if it is determined in step 844 that there is an existing record for the interest category for the alert with respect to the alert url , the process proceeds to step 848 in which the weight value stored in the record is retrieved . the process then continues to step 850 in which the retrieved weight is incremented by one to reflect the current alert . for example , if the retrieve weight were 7 , the weight would be incremented to 8 in step 850 to reflect the current alert . [ 0066 ] fig9 is a flowchart illustrating a process used in one embodiment to purge records for urls that are determined to be no longer of current interest by calculating a time decayed intensity rank at intervals , even if no new alert has been received , and purging from the database the records for a url if the time decayed intensity rank is below a prescribed threshold . the process shown in fig9 begins with step 902 in which the intensity rank for a url is retrieved . in one embodiment , the intensity rank is retrieved and process shown in fig9 is performed , at a predetermined arbitrary time interval τ . the process shown in fig9 continues with step 904 in which an intensity rank adjusted for time decay is calculated for the url . in one embodiment , the time decayed intensity rank is determined by the following formula : as can be seen from the above formula , the time decayed intensity rank decays exponentially over time if no new alerts are received . if it is determined in step 906 of the process shown in fig9 that the time decayed intensity rank is below the intensity rank threshold , the process proceeds to step 908 in which the record for the url is deleted . if it is determined in step 906 that the time decayed intensity rank is not below the intensity rank threshold , the process proceeds to step 910 in which the intensity rank as stored in the database is left unchanged . [ 0075 ] fig1 is a flowchart illustrating a process used in one embodiment to disseminate an alert to a participant , as in step 306 of fig3 . the process begins with step 1002 in which a request containing interest category filter selections made by the participant is received . next , in step 1004 , a hot list software object is created at the application server , as shown in fig1 and described above . then , in step 1006 , an array of interest categories , such as the interest category array 114 described above with respect to fig1 is created within the hot list object . next , in step 1008 , a list of hot urls responsive to the request is built . finally , in step 1010 , the list of hot urls responsive to the request is sent to the participant . [ 0076 ] fig1 shows an exemplary participant display 1100 used in one embodiment to disseminate alert information to a participant . the display 1100 includes a url entry and display area 1102 . the url for the web content or other electronic resource currently being accessed by the participant is displayed in the url entry and display area 1102 , and the participant may enter the url for the web content or other electronic resource the participant wishes to access manually in the url entry and display area 1102 , as in the url or address field for a world wide web browser . the display 1100 also includes a content display area 1104 in which the web or other content for the url listed in url entry and display area 1102 is displayed . for example , if the url is the url of web content accessed via the internet , the web content associated with the url will be displayed in url display area 1104 . the display 1100 also includes an interest category filter selection area 1106 in which interest categories are listed along with a check box for each category listed . the participant selects the check box for each interest category for which the participant would like urls of current interest to be included in the participant &# 39 ; s hot list . in one embodiment , filter selection area 1106 includes for each category a sensitivity entry area ( not shown in fig1 ) to be used to provide an indication of the participant &# 39 ; s degree or level of interest . for example , in one embodiment a participant may enter a whole number from 1 to 5 , with 1 indicating the lowest level of sensitivity ( e . g ., the participant does not want to receive a notification regarding a url in the category unless a significant number of alerts have been received regarding the url , or only when the intensity rank for the url exceeds a predetermined , relatively high threshold ) and 5 representing the highest level of sensitivity ( e . g ., the participant wants to receive a notification even if there has only been one or relatively few alerts concerning a url , or if one or more alerts have been received but the intensity rank for the url is relatively low ). in one embodiment , a request is sent to the application server automatically at predetermined intervals . the request contains the interest categories that are in the selected state at the time the request is sent . in one embodiment , the display 1100 includes a submit button ( not shown in fig1 ) that , when selected , causes a request containing the interest categories selected by the participant at the time to be posted to the application server via the internet . the display 1100 also includes a hot list display area 1108 in which the hot list of urls returned by the system to the participant in response to a request is presented . as shown in fig1 , in one embodiment , each url is represented by a hypertext link that , when selected , causes the url of the listed cite to appear in the url entry and display area 1102 and the content associated with the url to be displayed in the url display area 1104 . in one embodiment , the display 1100 is modified to include an alert submission display area such as the alert submission display shown in fig2 a . this would permit a participant to send an active alert to the application server if the participant encounters a url of current interest . [ 0082 ] fig1 is a flowchart illustrating a process used in one embodiment to build a list of hot urls responsive to a request , as in step 1008 of fig1 . the process begins with step 1202 in which all urls of current interest within the categories indicated in the request are found . next , in step 1204 , a “ hot token ” object is created in a hot token array within the hot list object for each url found in step 1202 , as described above with respect to hot token array 116 shown in fig1 . each hot token object holds the url_id , the weight for the url with respect to the interest category indicated in the request , the sum of the weight values for each category associated with the url in the database , and the intensity rank ( rank ) for the url . next , in step 1206 , a list rank is determined for each url retrieved in response to the request . in one embodiment , a list rank value is calculated for each url and is used to determine the list rank ( or the order in which the responsive urls will be placed to determine which urls will be provided ). in one embodiment , an initial list rank value is calculated for each url based on the interest category weight ( s ) for the url with respect to the interest category or categories in the request , along with the interest weight for any interest category or categories that are associated with the url in the database but which are not among the categories indicated in the request . in one embodiment , the initial list rank value “ v ” of a url number “ n ” ( v n ) is calculated according to the following formula : f k = = interest weight for url for each request category f m = interest weight for each category associated with url in database for example , if at the time of the request there had been ten alerts submitted for a particular url and three of the alerts were associated with a first category , two with a second category and five with a third category , and if a request were received that included among the request categories the first and third categories , the initial list rank value “ v ” for url number “ n ” calculated in accordance with the above formula would be as follows : v n = 3 + 5 3 + 2 + 5 ≈ 0 . 74 it should be noted that the use of the square root of the weight for each category tends to give relatively greater effect to the weight of interest categories associated with the url by a minority of alerting users because using the square root reduces the net effect of the greater weight value associated with interest categories indicated by the majority of alerting users . as with the normalization of the intensity rank described above , this has the effect of giving more visibility to matters of interest to a relatively smaller community . in an embodiment in which the participant indicates a level of sensitivity with respect to each selected interest category , as described above , the formula for the initial list rank value is modified to take into consideration the sensitivity “ s ” indicated for each category of interest . in one embodiment , the initial list rank value formula is modified as follows : f k = = interest weight for url for each request category f m = interest weight for each category associated with url in database s m = sensitivity indicated for request category corresponding to interest category “ m ”, if any ( s m = 1 for interest categories not in request ). for example , in the example described above , assume the participant indicated a sensitivity level of 1 with respect to the first category and 5 with respect to the third category , the initial list rank value would be calculated as follows : v n = 1 * 3 + 5 * 5 1 * 3 + 1 * 2 + 5 * 5 ≈ 0 . 83 ( as noted above , the sensitivity level s m used for the second category , having weight “ 2 ” in the denominator , is set at “ 1 ” because in the example the participant did not select that category .) the initial list rank value determined by this calculation ( 0 . 83 ) is greater than the initial list rank value found in the above calculation of an initial list rank value in an embodiment in which sensitivity levels are not assigned or considered ( 0 . 74 ). this illustrates the effect of assigning sensitivity levels . the initial list rank value determined in the second calculation , which takes into account a sensitivity level for each category , is higher than it would have been found to be without regard to sensitivity because the participant indicated a higher sensitivity for one of the categories with respect to which alerts had been received for the url . in this way , high - sensitivity users are more likely to become aware of and access a url with respect to which one or more alerts have been received in a category for which the user has indicated a high sensitivity . if such a high - sensitivity users chose to send alerts of their own with respect to the url , such activity would increase the intensity rank for the url ( as described above ) and would tend to propagate the original alert or alerts to lower - sensitivity users ( because the intensity rank is factored into the final list rank used to identify the final list of urls to be provided to a participant , as described below ). if such lower - sensitivity users were to send even more alerts , the original alerts would be further propagated to even lower - sensitivity users , and so on . in one embodiment , the initial list rank value determined by the interest category weights , as described above , is used along with the intensity rank for the url to calculate a final list rank value for the url . in one embodiment , the final list rank value for url number “ n ” is calculated in accordance with the following formula : in the above equation , the weight factor α determines the relative weight afforded to the intensity rank for the url and the initial list rank calculated based on the interest category weights as described above . if the value for α is selected to be 1 , the final list rank would be equal to the intensity rank for the url and the initial list rank would not factor into the final list rank at all . therefore , a higher weight factor will tend to increase the influence of the intensity rank for the url and decrease the effect of the initial list rank . stated another way , a low weight factor tends to give more effect to the extent to which the interest categories associated with the url in the database match the interest categories indicated in the request from the participant . conversely , a higher weight factor tends to give greater effect to the overall popularity of the url as measured by the intensity rank . once the list rank for each retrieved url has been calculated in step 1206 , in step 1208 the retrieved urls are sorted by list rank . then , in step 1210 , the top ten urls by list rank are selected as the hot list of urls to be sent to the participant in response to the request . the number ten is an arbitrary number and either a fewer number or greater number of urls may be included . although the foregoing invention has been described in some detail for purposes of clarity of understanding , it will be apparent that certain changes and modifications may be practiced within the scope of the appended claims . it should be noted that there are many alternative ways of implementing both the process and apparatus of the present invention . accordingly , the present embodiments are to be considered as illustrative and not restrictive , and the invention is not to be limited to the details given herein , but may be modified within the scope and equivalents of the appended claims . | 8 |
the present invention is particularly useful in conjunction with the conventional testing of men for an antigen level indicator of prostate cancer , and specifically for the testing of the psa level in men . typically , a man going to a physician for a general physical and not complaining of any prostate related symptoms , is tested for his psa level by his physician by sending a blood sample to a laboratory . if the results of the test show a psa level of 3 ng / ml or less , no further action is normally indicated by the physician . however , for a test result of 4 ng / ml or greater , a physician will normally recommend that a biopsy be performed to determine if there is prostate cancer . in accordance with the present invention , instead of proceeding directly to the biopsy , the physician will prescribe an anti - inflammatory for the patient or an anti - inflammatory in combination with an antibiotic for the patient . a list of suitable anti - inflammatories , the dosage of each and the period for which the anti - inflammatory should be administered is set forth below in table i . table i nsaid dose diclofenac 100 - 200 mg / day in divided doses etodolac 600 - 1200 mg / day in divided doses fenoprofen 600 - 2400 mg / day in divided doses ibuprofen 1 . 2 - 3 . 2 grams / day in divided doses indomethacin 50 - 200 mg / day in divided doses ketoprofen 200 - 300 mg / day in divided doses mefenamic acid 500 - 1000 mg / day in divided doses meloxicam 7 . 5 - 15 mg / day nambumetone 1 - 2 grams / day naproxen 500 - 1500 mg / day in divided doses oxaprozin 1200 - 1800 mg / day piroxicam 20 mg / day sulindac 150 - 400 mg / day in divided doses tolmetin sodium 600 - 1800 mg / day in divided doses celecoxib 100 - 800 mg / day in divided doses rofecoxib 25 - 100 mg / day the above - listed dosage for each of the drugs should be administered for 2 to 6 weeks and preferably 4 weeks before retesting . after taking the anti - inflammatory for 2 - 6 weeks , if the cause of the elevated psa level is not prostate cancer , but rather an inflammation of the prostate , the psa level will be reduced preferably to normal levels when retesting is performed after the 2 - 6 weeks . this reduction in the psa level will indicate to the physician that the cause for the elevated psa level was not prostate cancer and will eliminate the need for a biopsy for that patient . each of the anti - inflammatory agents described above in the present invention can be used in combination with the antibiotics in parenteral or topical administration . in this invention , the anti - inflammatory and antibiotic are administered in combination separately or as one single combined pharmaceutical composition via parenteral or oral means . preferably the anti - inflammatory and antibiotic are administered orally as a single combined pharmaceutical composition . the anti - inflammatory and antibiotic compositions are generally administered in accordance with the current physician &# 39 ; s desk reference ( pdr ). ( medical economics co . inc . of oradell , n . j . 07649 53 edition , 1999 ). quinolones : nalidixic acid 2 grams / day in divided doses for 2 to 6 weeks and preferably 4 weeks floroquinolones norfloxacin 400 mg twice / day for 2 to 6 weeks and preferably 4 weeks ciprofloxacin 250 to 500 mg twice / day for 2 to 6 weeks and preferably 4 weeks ofloxacin 200 to 400 mg twice / day for 2 to 6 weeks and preferably 4 weeks lomefloxacin 400 mg daily for 2 to 6 weeks and preferably 4 weeks levofloxacin 250 to 500 mg daily for 2 to 6 weeks and preferably 4 weeks tetracyclines doxycycline 100 to 150 mg twice / day for 2 to 6 weeks and preferably 4 weeks minocycline 100 mg twice / day for 2 to 6 weeks and preferably 4 weeks combinations trimethoprin 160 mg and sulfamethoxazole 800 mg twice / day for 2 to 6 weeks and preferably 4 weeks the anti - inflammatory and antibiotic may be compounded into a single dosage form suitable for oral or parenteral administration . a tablet or capsule or caplets are particularly convenient forms for oral administration . such compositions useful in the present invention are typically formulated with conventional pharmaceutical excipients , e . g ., spray dried lactose and magnesium stearate into tablets or capsules for oral administration . one or more of the active substances , with or without additional types of active agents , can be worked into tablets or dragee cores by being mixed with solid , pulverulent carrier substances , such as sodium citrate , calcium carbonate or dicalcium phosphate , and binders such as polyvinyl pyrrolidone , gelatin or cellulose derivatives , possibly by adding also lubricants such a magnesium stearate , sodium lauryl sulfate , “ carbowax ” or polyethylene glycols . of course , taste - improving substances can be added in the case of oral administration forms . as further forms of administration , one can use plug capsules , e . g . hard gelatin , as well as closed softgelatin capsules comprising a softener or plasticizer , e . g . glycerine . the plug capsules contain the active substance preferably in the form of a granulate , e . g . in mixtures with fillers , such as lactose , saccharose , mannitol , starches such as potato starch or amylopectin , cellulose derivatives or highly dispersed silicic acids . in soft gelatin capsules , the active substance is preferably dissolved or suspended in suitable liquids , such as vegetable oils or liquid polyethylene glycols . the active ingredient components used in accordance with the present invention may also be formulated into twice a day , once - a - day or even longer sustained release composition by conventional techniques well known in the art . in place of oral administration , the active compounds may be administered parenterally . in such case , one can use a solution of the active substance , e . g ., in sesame oil or olive oil . while the invention has been described and illustrated with reference to certain particular embodiments thereof , those skilled in the art will appreciate that various changes , modifications and substitutions can be made therein without departing from the spirit and scope of the invention . for example , effective dosages other than the particular dosages as set forth herein above may be applicable as a consequence of variations in the responsiveness of the subject being treated for any of the indications for the compounds of the invention indicated above . likewise , the specific pharmacological responses observed may vary according to and depending upon the particular active compound selected or whether there are present pharmaceutical carriers , as well as the type of formulation and mode of administration employed , and such expected variations or differences in the results are contemplated in accordance with the objects and practices of the present invention . it is intended , therefore , that the invention be defined by the scope of the claims which follow and that such claims be interpreted as broadly as is reasonable . it is understood that the embodiments described hereinabove are merely illustrative and are not intended to limit the scope of the invention . it is realized that various changes , alterations , rearrangements and modifications can be made by those skilled in the art without substantially departing from the spirit and scope of the present invention . | 0 |
the invention relates to trmd polypeptides and polynucleotides as described in greater detail below . in particular , the invention relates to polypeptides and polynucleotides of a trmd of streptococcus pneumoniae , that is related by amino acid sequence homology to b . subtilis trmd polypeptide . the invention relates especially to trmd having a nucleotide and amino acid sequences set out in table 1 as seq id no : 1 and seq id no : 2 respectively . note that sequences recited in the sequence listing below as “ dna ” represent an exemplification of the invention , since those of ordinary skill will recognize that such sequences can be usefully employed in polynucleotides in general , including ribopolynucleotides . a deposit comprising a streptococcus pneumoniae 0100993 strain has been deposited with the national collections of industrial and marine bacteria ltd . ( herein “ ncimb ”), 23 st . machar drive , aberdeen ab2 1ry , scotland on apr . 11 , 1996 and assigned deposit number 40794 . the deposit was described as streptococcus pneumoniae 0100993 on deposit . on apr . 17 , 1996 a streptococcus pneumoniae 0100993 dna library in e . coli was similarly deposited with the ncimb and assigned deposit number 40800 . the streptococcus pneumoniae strain deposit is referred to herein as “ the deposited strain ” or as “ the dna of the deposited strain .” the deposited strain comprises a full length trmd gene . the sequence of the polynucleotides comprised in the deposited strain , as well as the amino acid sequence of any polypeptide encoded thereby , are controlling in the event of any conflict with any description of sequences herein . the deposit of the deposited strain has been made under the terms of the budapest treaty on the international recognition of the deposit of micro - oganism for purposes of patent procedure . the deposited strain will be irrevocably and without restriction or condition released to the public upon the issuance of a patent . the deposited strain is provided merely as convenience to those of skill in the art and is not an admission that a deposit is required for enablement , such as that required under 35 u . s . c . § 112 . a license may be required to make , use or sell the deposited strain , and compounds derived therefrom , and no such license is hereby granted . in one aspect of the invention there is provided an isolated nucleic acid molecule encoding a mature polypeptide expressible by the streptococcus pneumoniae 0100993 stain , which polypeptide is comprised in the deposited strain . further provided by the invention are trmd polynucleotide sequences in the deposited strain , such as dna and rna , and amino acid sequences encoded thereby . also provided by the invention are trmd polypeptide and polynucleotide sequences isolated from the deposited strain . trmd polypeptide of the invention is substantially phylogenetically related to other proteins of the trmd ( trna methyl transferases ) family . in one aspect of the invention there are provided polypeptides of streptococcus pneumoniae referred to herein as “ trmd ” and “ trmd polypeptides ” as well as biologically , diagnostically , prophylactically , clinically or therapeutically useful variants thereof and compositions comprising the same . among the particularly preferred embodiments of the invention are variants of trmd polypeptide encoded by naturally occurring alleles of a trmd gene . the present invention further provides for an isolated polypeptide that : ( a ) comprises or consists of an amino acid sequence that has at least 95 % identity , most preferably at least 97 - 99 % or exact identity , to that of seq id no : 2 over the entire length of seq id no : 2 ; ( b ) a polypeptide encoded by an isolated polynucleotide comprising or consisting of a polynucleotide sequence that has at least 95 % identity , even more preferably at least 97 - 99 % or exact identity to seq id no : 1 over the entire length of seq id no : 1 ; ( c ) a polypeptide encoded by an isolated polynucleotide comprising or consisting of a polynucleotide sequence encoding a polypeptide that has at least 95 % identity , even more preferably at least 97 - 99 % or exact idenitity , to the amino acid sequence of seq id no : 2 , over the entire length of seq id no : 2 . the polypeptides of the invention included a polypeptide of table 1 [ seq id no : 2 ] ( in particular a mature polypeptide ) as well as polypeptides and fragments , particularly those that has a biological activity of trmd , and also those that have a least 95 % identity to a polypeptide of table 1 [ seq id no : 2 ] and also include portions of such polypeptides with such portion of the polypeptide generally comprising at least 30 amino acids and more preferably at least 50 amino acids . the invention also includes a polypeptide consisting of or comprising a polypeptide of the formula : wherein , at the amino terminus , x is hydrogen , a metal or any other moiety described herein for modified polypeptides , and at the carboxyl terminus , y is hydrogen , a metal or any other moiety described herein for modified polypeptides , r 1 and r 3 are any amino acid residue or modified amino acid residue , m is an integer between 1 and 1000 or zero , n is an integer 1 and 1000 or zero , and r 2 is an amino acid sequence of the invention , particularly an amino acid sequence selected from table 1 or modified forms thereof . in the formula above , r 2 is oriented so that its amino terminal amino acid residue is at the left , covalently bound to r 1 , and its carboxy terminal amino acid residue is at the right , covalently bound to r 3 . any stretch of amino acid residues denoted by either r 1 or r 3 , wh m and / or n is greater than 1 , may be either a heteropolymer or a homopolymer , preferably a heteropolymer . other preferred embodiments of the invention are provided where m is an integer between 1 and 50 , 100 or 500 , and n is an integer between 1 and 50 , 100 , or 500 . it is most preferred that a polypeptide of the invention is derived from streptococcus pneumoniae , however , it may preferably be obtained from other organisms of the same taxonomic genus . a polypeptide of the invention may also be obtained , for example , from organisms of the same taxonomic family or order . a fragment is a variant polypeptide having an amino acid sequence that is entirely the same as part but not all of any amino acid sequence of any polypeptide of the invention . as with trmd polypeptides , may be “ free standing ,” or comprised within a larger polypeptide of which they form a part or region , most preferably as a single continuous region in a single larger polypeptide . preferred fragments include , for example , truncation polypeptide having a portion of an amino acid sequence of table 1 [ seq id no : 2 ], or of variants thereof , such as a continuous series of residues that includes an amino - and / or carboxyl - terminal amino acid sequence . degradation forms of the polypeptides of the invention produced by or in a host cell , particularly a streptococcus pneumoniae , are also preferred . further preferred are fragments characterized by structural or functional attributes such as fragments that comprise alpha - helix and alpha - helix forming regions , beta - sheet and beta - sheet - forming regions , turn and turn - forming regions , coil and coil - forming regions , hydrophilic regions , hydrophobic regions , alpha amphipathic regions , beta amphipathic regions , flexible regions , surface - forming regions , substrate binding region , and high antigenic index regions . further preferred fragments include an isolated polypeptide comprising an amino acid sequence having at least 15 , 20 , 30 , 40 , 50 or 100 contiguous amino acids from the amino acid sequence of seq id no : 2 , or an isolated polypeptide comprising an amino acid sequence having at least 15 , 20 , 30 , 40 , 50 or 100 contiguous amino acids truncated or deleted from the amino acid sequence of seq id no : 2 . fragments of the polypeptides of the invention may be employed for producing the corresponding full - length polypeptide by peptide synthiesis ; therefore , these variants may be employed as intermediates for producing the full polypeptides of the invention . it is an object of the invention to provide polynucleotides that encode trmd polypeptides , particularly polynucleotides that encode a polypeptide herein designated trmd . in a particularly preferred embodiment of the invention the polynucleotide comprises a region encoding trmd polypeptides comprising a sequence set out in table 1 [ seq id no : 1 ] that includes a full length gene , or a variant thereof . the applicants believe that this full length gene is essential to the growth and / or survival of an organism that possesses it , such as streptococcus pneumoniae . as a further aspect of the invention there are provided isolated nucleic acid molecules encoding and / or expressing trmd polypeptides and polnucleotides , partcularly streptococcus pneumoniae trmd polypeptides and polynucleotides , including , for example , unprocessed rnas , ribozyme rnas , mrnas , cdnas , genonic dnas , b - and z - dnas . further embodiment of the invention include biologically , diagnostically , prohylactically , clinically or therapeutically useful polynucleotides and polypeptides , and variants thereof , and compositions comprising the same . another aspect of the invention relates to isolated polynucleotides , including at least one full length gene , that encodes a trmd polypeptide having a deduced amino acid sequence of table 1 [ seq id no : 2 ] and polynucleotides closely related thereto and variants thereof . in another particularly preferred embodiment of the invention there is a trmd polypeptide from streptococcus pneumoniae comprising or consisting of an amino acid sequence of table 1 [ seq id no : 2 ], or a variant thereof . using the invention provided herein , such as a polynucleotide sequence set out in table 1 [ seq id no : 1 ], a polynucleotide of the invention encoding trmd polypeptide may be obtained using standard cloning and screening methods , such as those for cloning and sequencing chromosomal dna fragments from bacteria using streptococcus pneumoniae 0100993 cells as starting material , followed by obtaining a full length clone . for example , to obtain a polynucleotide sequence of the invention , such as a polynucleotide sequence given in table 1 [ seq id no : 1 ], typically a library of clones of chromosomal dna of streptococcus pneumoniae 0100993 in e . coli or some other suitable host is probed with a radiolabeled oligonucleotide , preferably a 17 - mer or longer , derived from a partial sequence . clones carrying dna identical to that of the probe can then be distinguished using stringent hybridization conditions . by sequencing the individual clones thus identified by hybridization with sequencing primers designed from the original polypeptide or polynucleotide sequence it is then possible to extend the polynucleotide sequence in both directions to determine a full length gene sequence . conveniently , such sequencing is performed , for example , using denatured double stranded dna prepared from a plasmid clone . suitable techniques are described by maniatis , t ., fritsch , e . f . and sambrook et al ., molecular cloning , a laboratory manual , 2nd ed . ; cold spring harbor laboratory press , cold spring harbor , n . y . ( 1989 ). ( see in particular screening by hybridization 1 . 90 and sequencing denatured double - stranded dna templates 13 . 70 ). direct genornic dna sequencing may also be performed to obtain a full length gene sequence . illustrative of the invention , each polynucleotide set out in table 1 [ seq id no : 1 ] was discovered in a dna library derivied from streptococcus pneumoniae 0100993 . moreover , each dna sequence set out in tale 1 [ seq id no : 1 ] contains an open reading frame encoding a protein having about the number of amino acid residues set forth in table 1 [ seq id no : 2 ] with a deduced molecular weight that can be calulated using amino acid residue molecular weight values well known to those skilled in the art . the polynucleotide of seq id no : 1 , between nucleotide number 1 and the stop codon that begins at nucleotide number 718 of seq id no : 1 , encodes the polypeptide of seq id no : 2 . in a further aspect , the present invention provides for an isolated polynucleotide comprising or consisting of : ( a ) a polynuclectide sequence that has at least 95 % identity , even more preferably at least 97 , still more preferably at least 99 %, yet still more preferably at least 99 . 5 % or exact identity to seq id no : 1 over the entire length of seq id no : 1 , or the entire length of that portion of seq id no : 1 which encodes seq id no : 2 ; ( b ) a polynucleotide sequence encoding a polypeptide that has at least 95 % identity , even more preferably at least 97 , still more preferably at least 99 %, yet still more preferably at least 99 . 5 % or 100 % exact , to the amino acid sequence of seq id no : 2 , over the entire length of seq id no : 2 . a polynucleotide encoding a polypeptide of the present invention , including homologs and orthologs from species other than streptococcus pneumoniae , may be obtained by a process that comprises the steps of screeaing an appropriate library under stringent hybridization conditions with a labeled or detectable probe consisting of or comprising the sequence of seq id no : 1 or a fragment thereof , and isolating a full - length gene and / or genoric clones comprising said polynucleotide sequence . the invention provides a polynucleotide sequence identical over its entire length to a coding sequence ( open reading frame ) in table 1 [ seq id no : 1 ]. also provided by the invention is a coding sequence for a mature polypeptide or a fragment thereof , by itself as well as coding sequence for a mature polypeptide or a fragment in reading frame with another coding sequence , such as a sequence encoding a leader or secetory sequence , a pre -, or pro - or prepro - protein sequence . the polynucleotide of the invention may also comprise at least one non - coding sequence , including for example , but not limited to at least one non - coding 5 ′ and 3 ′ sequence , such as the transcribed but non - translated sequences , termination signals ( such as rho - dependent and rho - independent termination signals ), ribosome binding sites , kozak sequences , sequences that stabilize mrna , introns , and polyadenylation signals . the polynucleotide sequence may also comprise additional coding sequence encoding additional amino acids . for example , a marker sequence that facilitates purification of a fused polypeptide can be encoded . in certain embodiments of the invention , the marker sequence is a hexa - histidine peptide , as provided in the pqe vector ( qiagen , inc .) and described in gentz et al ., proc . natl . acad . sci ., usa 86 : 821 - 824 ( 1989 ), or an ha peptide tag ( wilson et al ., cell 37 : 767 ( 1984 ), both of that may be useful in purifying polypeptide sequence fused to them . polynucleotides of the invention also include , but are not limited to , polynucleotides comprising a structural gene and its naturally associated sequences that control gene expression . a preferred embodiment of the invention is a polynucleotide of consisting of or comprising nucleotide 1 to the nucleotide immediately upstream of or including nucleotide 718 set forth in seq id no : 1 of table 1 , both of that encode a trmd polypeptide . the invention also includes a polynucleotide consisting of or comprising a polynucleotide of the formula : wherein , at the 5 ′ end of the molecule , x is hydrogen , a metal or a modified nucleotide residue , or together with y defines a covalent bond , and at the 3 ′ end of the molecule , y is hydrogen , a metal , or a modified nucleotide residue , or together with x defines the covalent bond , each occurrence of r 1 and r 3 is independently any nucleic acid residue or modified nucleic acid residue , m is an integer between 1 and 3000 or zero , n is an integer between 1 and 3000 or zero , and r 2 is a nucleic acid sequence or modified nucleic acid sequence of the invention , particularly a nucleic acid sequence selected from table 1 or a modified nucleic acid sequence thereof . in the polynucleotide formula above , r 2 is oriented so that its 5 ′ end nucleic acid residue is at the left bound to r 1 , and its 3 ′ end nucleic acid residue is at the right , bound to r 3 . any stretch of nucleic acid residues denoted by either r 1 and / or r 2 , where m and / or n is greater than 1 , may be either a heteropolymer or a homopolymer , preferably a heteropolymer . where , in a preferred embodiment , x and y together define a covalent bond , the polynucleotide of the above formula is a closed , circular polynucleotide , that can be a double - stranded polynucleotide wherein the formula shows a first strand to which the second strand is complementary . in another preferred embodiment m and / or n is an integer between 1 and 1000 . other preferred embodiment of invention are provided where m is an integer between 1 and 50 , 100 or 500 , and n is an integer between 1 and 50 , 100 , or 500 . it is most preferred that a polynucleotide of the invention is derived from streptococcus pneumoniae , however , it may preferably be obtained from other organisms of the same taxonomic genus . a polynucleotide of the invention may also be obtained , for example , from organisms of the same taxonomic family or order . the term “ polynucleotide encoding a polypeptide ” as used herein encompasses polynucleotides that include a sequence encoding a polypeptide of the invention , particularly a bacterial polypeptide and more particularly a polypeptide of the streptococcus pneumoniae trmd having an amino acid sequence set out in table 1 [ seq id no : 2 ]. the term also a polynucleotides that include a single continuous region or discontinuous regions encoding the polypide ( for example , polynucleotides interrupted by intergrated phage , an integrated insertion sequence , an integrated vector sequence , an integrated tansposon sequence , or due to rna editing or genomic dna reorganization ) together with additional regions , also may comprise coding and / or nono - coding sequences . the invention further relates to variants of the polynucleotides describe herein that encode variants of a polypeptide having a deduced amino acid sequence of table 1 [ seq id no : 2 ]. fragments of polynucleotides of the invention may be used , for example , to synthesize full - length polynucleotides of the invention . further particularly preferred embodiments are polynucleotides encoding trmd variants , that have the amino acid sequece of trmd polypeptide of table 1 [ seq id no : 2 ] in which several , a few , 5 to 10 , 1 to 5 , 1 to 3 , 2 , 1 or no amino acid residues are substituted , modified , deleted and / or added , in any combination . especially preferred among these are silent substitutions , additions and deletions , that do not alter the properties and activities of trmd polypeptide . preferred isolated polynucleotide embodiments also include polynucleotide fragments , such as a polynucleotide comprising a nuclic acid sequence having at least 15 , 20 , 30 , 40 , 50 or 100 contiguous nucleic acids from the polynucleotide sequence of seq id no : 1 , or an polynucleotide comprising a nucleic acid sequence having at least 15 , 20 , 30 , 40 , 50 or 100 contiguous nucleic acids truncated or deleted from the 5 ′ and / or 3 ′ end of the polynucleotide sequence of seq id no : 1 . further preferred embodiments of the invention are polynucleotides that are at least 95 %, 97 % or 99 . 5 % identical over there entire length to a polynucleotide encoding trmd polypeptide having an amino acid sequence set out in table 1 [ seq id no : 2 ], and polynucleotides that are complementary to such polynucleotides . most highly preferred are polynucleotides that comprise a region that is at least 95 % are especially preferred . furthermore , those at least 97 % are highly preferred among those with at least 95 %, and among these those with at least 98 % and at least 99 % are particularly highly preferred , with at least 99 . 5 % being the more preferred . preferred embodiments are polynucleotides encoding polypeptides that retain substantially the same biological function or activity as a mate polypeptide encoded by a dna of table 1 [ seq id no : 1 ]. in accordance with certain preferred embodiments of this invention the are provided polynucleotides that hybridize , particularly under it conditions , to trmd polynucleotide sequence , such as those polynucleotides in table 1 . the invention further relates to polynucleotides that hybridize to the polynucleotide sequences provided herein . in this regard , the invention especially relates to polynucleotides that hybridize under stringent conditions to the polynucleotides described herein . as herein used , the terms “ stringent conditions ” and “ stringent hybridization conditions ” mean hybridization occurring only if there is at least 95 % and preferably at least 97 % identity between the sequences . a specific example of stringent hybridization conditions is overnight incubation at 42 ° c . in a solution comprising : 50 % formamide , 5 × ssc ( 150 mm nacl , 15 mm trisodium citrate ), 50 mm sodium phosphate ( ph7 . 6 ), 5 × denhardt &# 39 ; s solution , 10 % dextran sulfate , and 20 micrograms / ml of denatured , sheared salmon sperm dna , followed by washing the hybridization support in 0 . 1 × ssc at about 65 ° c . hybridization and wash condition are well known and exemplified in sambrook , et al ., molecular cloning : a laboratory manual , second edition , cold spring harbor , n . y ., ( 1989 ), particularly chapter 11 therein . solution hybridization may also be used with the polynucleotide sequences provided by the invention . the invention also provides a polynucleotide consisting of or comprising a polynucleotide sequence obtained by screening an appropriate library comprising a complete gene for a polynucleotide sequence set forth in seq id no : 1 under stringent hybridization conditions with a probe having the sequence of said polynucleotide sequence set forth in seq id no : 1 or a fragment thereof ; and isolating said polynucleotide sequence . fragments useful for obtaining such a polynucleotide include , for example , probes and primers fully described elsewhere herein . as discussed elsewhere herein regarding polynucleotide assays of the invention , for instance , the polynucleotides of the invention , may be used as a hybridization probe for rna , cdna and genonic dna to isolate full - length cdnas and genomic clones encoding trmd and to isolate cdna and genomic clones of other genes that have a high identity , particularly high sequence identity , to a trmd gene . such probes generally will comprise at least 15 nucleotide residues or base pairs . preferably , such probes will have at least 30 nucleotide residues or base pairs and may have at least 50 nucleotide residues or base pairs . particularly preferred probes will have at least 20 nucleotide residues or base pairs and will have least than 30 nucleotide residues or base pairs . a coding region of a trmd gene may be isolated by screening using a dna sequence provided in table 1 [ seq id no : 1 ] to synthesize an oligonucleotide probe . a labeled oligonuceotide having a sequence complementary to that of a gene of the invention is then used to screen a library of cdna , genoic dna or mrna to determine which members of the library the probe hybridizes to . there are several methods available and well known to those skilled in the art to obtain full - length dnas , or extend short dnas , for example those based on the method of rapid amplification of cdna ends ( race ) ( see , for example , frobman , et al ., pnas usa 85 : 8998 - 9002 , 1988 ). recent modifications of the technique , exemplified by the marathon ™ technology ( clonech laboratories inc .) for example , have significantly simplified the search for longer cdnas . in the marathon ™ technology , cdnas have been prepared from mrna extracted from a chosen tissue and an ‘ adaptor ’ sequence ligated onto each end . nucleic acid amplification ( pcr ) is then carried out to amplify the “ missing ” 5 ′ end of the dna using a combination of gene specific and adaptor specific oligonucleotide primers . the pcr reaction is then repeated using “ nested ” primers , that is , primers designed to anneal within the amplified product ( typically an adaptor specific primer that anneals further 3 ′ in the adaptor sequence and a gene specific primer that anneals further 5 ′ in the selected gene sequence ). the products of this reaction can then be analyzed by dna sequencing and a full - length dna constructed either by joining the product directly to the existing dna to give a complete sequence , or carrying out a separate full - length pcr using the new sequence information for the design of the 5 ′ primer . the polynucleotides and polypeptides of the invention may be employed , for example , as research reagents and materials for discovery of treats of and diagnostics for diseases , particularly human diseases , as further discussed herein relating to polynucleotide assays . the polynucleotides of the invention that are oligonuciotides derived from a sequence of table 1 [ seq id nos : 1 or 2 ] may be used in the processes herein as described , but preferrably for pcr , to determine whether or not the polynucleotides identified herein in whole or in part are transcribed in bacteria in infected tissue . it is recognized that such sequences will also have utility in diagnosis of the stage of infection and type of infection the pathogen has attained . the invention also provides polynucleotides that encode a polypeptide that is a mature protein plus additional amino or carboxyl - terminal amino acids , or amino acids interior to a mature polypeptide ( when a mature form has more than one polypeptide chain , for instance ). such sequences may play a role in processing of a protein from precursor to a mature form , may allow protein transport , may lengthen or shorten protein half - life or may facilitate manipulation of a protein for assay or production , among other things . as generally is the case in vivo , the additional amino acids may be processed away from a mature protein by cellular enzymes . for each and every polynucleotide of the invention there is provided a polynucleotide complementary to it . it is preferred that these complementary polynucleotides are fully complementary to each polynucleotide with which they are complementary . a precursor protein , having a mature form of the polypeptide fused to one or more prosequence may be an inactive form of the polypeptide . when prosequences are removed such inactive precursors generally are activated . some or all of the prosequences may be removed before activation . generally , such precursors are called proproteins . as will be recognized , the entire polypeptide encoded by an open reading frame is often not required for activity . accordingly , it has become routine in molecular biology to map the boundaries of the primary structure required for activity n - treminal and c - treminal deletion experiments . these experiments utilize exonuclease digestion or commit restriction sites to cleave coding nucleic acid sequence . for example , promega ( madison , wis .) sell an erase - a - base ™ system that uses exonuclease iii designed to facilitate analysis of the deletion products ( protocol available at www . promega . com ). the digested endpoints can be repaired ( e . g ., by ligation to synthetic linkers ) to the extent necessary to preserve an open reading fame . in this way , the nucleic acid of seq id no : 1 readily provides contiguous fragments of seq id no : 2 sufficient to provide an activity , such as an enzymatic , binding or antibody - inducing activity . nucleic acid sequences encoding such fragments of seq id no : 2 and variants thereof as described herein are within the invention , as are polypeptides so encoded . in sum , a polynucleotide of the invention may encode a mature protein , a mature protein plus a leader sequence ( which may be referred to as a preprotein ), a precursor of a mature protein having one or more prosequences that are not the leader sequences of a preprotein , or a preproprotein , that is a precursor to a proprotein , having a leader sequence and one or more prosequences , that generally are removed during processing steps that produce active and mature forms of the polypeptide . the invention also relates to vectors that comprise a polynucleotide or polynucleotides of the invention , host cells that are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques . cell - free translation systems can also be employed to produce such proteins using rnas derived from the dna costructs of the invention . recombinant polypeptides of the present invention may be prepared by process well known in those skilled in the art from genetically engineered host cells comprising expression systems . accordingly , in a further aspect , the present invention relates to expression systems that comprise a polynucleotide or polynucleotides of the preset invention , to host cells that are genetically engineered with such expression systems , and to the production of polypeptides of the invention by recombinant techniques . for recombinant production of the polypeptides of the invention , host cells can be genetically engineered to incorporate expression systems or portions thereof or polynucleotides of the invention . introduction of a polynucleotide into the host cell can be effected by methods described in many standard laboratory manuals , such as davis , et al ., basic methods in molecular biology , ( 1986 ) and sambrook , et al , molecular cloning : a laboratory manual , 2nd ed ., cold spring harbor laboratory press , cold spring harbor , n . y . ( 1989 ), such as , calcium phosphate transfection , deae - dextran mediated transfection , transvection , microinjection , cationic lipid - mediated transfection , electoporation , transduction , scrape loading ballistic introduction and infection . representative examples of appropriate hosts include bacterial cells , such as cells of streptococci , staphylococci , e . coli , streptomyces , cyanobacteria , bacillus subtilis , and streptococcus pneumoniae ; fungal cells , such as cells of a yeast kluveromyces , saccharomyces , a basidiomycete , candida albicans and aspergillus ; insect cells such as cells of drosophila s2 and spodoptera sf9 ; animal cells such as cho , cos , hela c127 , 3t3 , bhk , 293 , cv - 1 and bowes melanoma cells ; and plant cells , such as cells of a gymnosperm or angiosperm . a great variety of expression systems can be used to produce the polypeptides of the invention . such vectors include , among other , chromosomal -, episomal - and virus - derived vectors , for example , vetors derived from bacterial plasmids , from bacteriophage , from transposons , from yeast episomes , from insertion elements , from yeast chromosomal elements , from viruses such as baculoviruses , papova viruses , such as sv40 , vaccinia viruses , adenoviruses , fowl pox viruses , pseudorabies viruses , picornaviruses and retroviruses , and vectors derived from combinations thereof , such as those derived from plasmid and bacteriophage genetic elements , such as cosmids and phagemids . the expression system constructs may comprise control regions that regulate as well as engender expression . generally , any system or vector suitable to maintain , propagate or express polynucleotides and / or to express a polypeptide in a host may be used for expression in this regard . the appropriate dna sequene may be inserted into the expression system by any of a variety of well - known and routine techniques , such as , for example , those set forth in sambrook et al ., molecular cloning , a laboratory manual , ( supra ). in recombinant expression systems in eukaryotes , for secretion of a translated protein into the lumen of the endoplasmic reticulum , into the periplasmic space or into the extracellular environment , appropriate secretion signals may be incoporated into the expressed polypeptide . these signals may be endonous to the polypeptide or they may be heterologous signals . polypeptides of the invention can be recovered and purified from recombinant cell cultures by well - known methods including ammonium sulfate or ethanol precipitation , acid extraction , anion or cation exchange chromatography , phosphocellulose chromatography , hydrophobic interaction chromatography , affinity chromatography , hydroxylapatite chromatography , and lectin chromatography . most preferably , high performance liquid chromatography is employed for purification . well known techniques for refolding protein may be employed to regenerate active conformation when the polypeptide is denatured during isolation and or purification . this invention is also related to the use of trmd polynucleotides and polypeptides of the invention for use as diagnostic reagents . detection of trmd polynucleotides and / or polypeptides in a eukaryote , particularly a mammal , and especially a human , will provide a diagnostic method for diagnosis of disease , staging of disease or response of an infectious organism to drugs . eukaryotes , particularly mammals , and especially humans , particularly those infected or suspeted to be infected with an organism comprising the trmd gene or protein , may be detected the nucleic acid or amino acid level by a variety of well known techniques as well as by methods provided herein . polypeptides and polynucleotides for prognosis , diagnosis or other analysis may be obtained from a putatively infected and / or infected individual &# 39 ; s bodily materials . polynucleotides from any of these sources , particularly dna or rna , may be used directly for detection or may be amplified enzymatically by using pcr or any other amplification technique prior to analysis . rna , particularly mrna , cdna and genomic dna may also be used in the same ways . using amplification , characterization of the species and strain of infectious or resident organism present in an individual , may be made by an analysis of the genotype of a selected polynucleotide of the organism . deletions and insertions can be detected by a change in size of the amplified product in comparison to a genotype of a reference sequence selected from a related organism preferably a different species of the same genus or a different strain of the same species . point mutations can be identified by hybridizing amplified dna to labeled trmd polynucleotide sequence . perfectly or significantly matched sequences can be distinguished from imperfectly or more significantly mismatched duplexes by dnase or rnase digestion , for dna or rna resctively , or by detecting differences in melting temperatures or renaturation kinetics . polynucleotide sequence differences may also be detected by alterations in the electrophoretic mobility of polynucleotide fragments in gels as compared to a reference sequence . this may be carried out or without denaturing agents . polynucleotide may also detected by direct dna or rna sequencing . see , for example , myers et al ., science , 230 : 1242 ( 1985 ). sequence changes at specfic locations also may be revealed by nuclease protection assays , such as rnase , v 1 and s 1 protection assay or a chemical cleavage method . see , for example , cotton et al ., proc . natl . acad . sci . usa , 85 : 4397 - 4401 ( 1985 ). in another embodiment , an array of oligonucleotides probes comprising trmd nucleotide sequence or fragments thereof can be constructed to conduct efficient screening of , for example , genetic mutations , serotype , taxonomic classification or identification . array technology methods are well known and have general applicability and can be used to address a variety of questions in molecular genetics including gene expression , genetic linkage , and genetic variability ( see , for example , chee et al ., science , 274 : 610 ( 1996 )). thus in another aspect , the present invention relates to a diagnostic kit that comprises : ( a ) a polynucleotide of the present invention , preferably the nucleotide sequence of seq id no : 1 , or a fragment thereof ; ( b ) a nucleotide sequence complementary to that of ( a ); ( c ) a polypeptide of the present invention , preferably the polypeptide of seq id no : 2 or a fragment thereof ; or ( d ) an antibody to a polypeptide of the present invention , preferably to the polypeptide of seq id no : 2 . it will be appreciated that in any such kit , ( a ), ( b ), ( c ) or ( d ) may comprise a substantial component . such a kit will be of use in diagnosing a disease or susceptibility to a disease , among others . this invention also relates to the use of polynucleotides of the present invention as diagnostic reagents . detection of a mutated form of a polynucleotide of the invention , example , seq id no : 1 , that is associated with a disease or pathogenicity will provide a diagnostic tool that can add to , or define , a diagnosis of a disease , a prognosis of a course of disease , a detection of a stage of disease , or a susceptibility to a disease , that results from under - expression , over - expression or altered expression of the polynucleotide . organisms , particularly infectious organisms , carrying mutations in such polynucleotide may be detected at the polynucleotide level by a variety of techniques , such as those described elsewhere herein . the differences in a polynucleotide and / or polypeptide sequence between organisms possessing a first phenotype and organisms possessing a different , second different phenotype can also be determined . if a mutation is observed in some or all organisms possessing the first phenotype but not in any organisms possessing the second phenotype , then the mutation is likely to be the causative agent of the first phenotype . cells from an organism carrying mutations or polymorphisms ( allelic variatons ) in a polynucleotide and / or polypeptide of the invention may also be detected at the polynucleotide or polypeptide level by a variety of techniques , to allow for serotyping , for example . for example , rt - pcr can be used to detect mutations in the rna . it is particularly preferred to use rt - pcr in conjunction with automated detection systems , such as , for example , genescam rna , cdna or genomic dna may also be used for the same purpose , pcr . as an example , pcr print complementary to a polynucleotide encoding trmd polypeptide can be used to identify and analyze mutations . the invention further provides these primers 1 , 2 , 3 or 4 nucleotides removed from the 5 ′ and / or the 3 ′ end . these primers may be used for , among other things , amplifying trmd dna and / or rna isolated from a sample derived from an individual , such as a bodily material . the primers may be used to amplify a polynucleotide isolated from an infected individual , such that the polynucleotide may then be subject to various techniques for elucidation of the polynucleotide sequence . in this way , mutations in the polynucleotide sequence may be detected and used to diagnose and / or prognose the infection or its stage or course , or to serotype and / or classify the infectious agent . the invention further provides a process for diagnosing , disease , preferably bacterial infections , more perferably infections caused by streptococcus pneumoniae , comprising determining from a sample derived from an individual , such as a bodily material , an increased level of expression of polynucleotide having a sequence of table 1 [ seq id no : 1 ]. increased or decreased expression of a trmd polynulceotide can be measured using any on of the methods well known in the art for the quantitation of polynucleotides , such as , for example , amplification , pcr , rt - pcr , rnase protection , northern blotting , spectrometry and other hybridization methods . in addition , a diagnostic assay in accordance with the invention for detecting over - expression of trmd polypeptide compared to normal control tissue samples may be used to detect the presence of an infection , for example . assay techniques that can be used to determine levels of a trmd polypeptide , in a sample derived from a host , such as a bodily material , are well - known to those of skill in the art . such assay methods include radioimmunoassays , competitive - binding assays , western blot analysis , antibody sandwich assays , antibody detection and elisa assays . polypeptides and polynucleotides of the invention may also be used to assess the binding of small molecule substrates and ligands in , for example , cells , cell - free preparations , chemical libraries , and natural product mixtures . these substrates and ligands may be natural substrates and ligands or may be structural or functional mimetics . see , e . g ., coligan et al ., current protocols in immunology 1 ( 2 ): chapter 5 ( 1991 ). polypeptides and polynucleotides of the present invention are responsible for many biological functions , including many disease states , in particular diseases herein mentioned . it is therefore desirable to devise screening methods to identify compounds that agonize ( e . g ., stimulate ) or that antagonize ( e . g ., inhibit ) the function of the polypeptide or polynucleotide . accordingly , in a further aspect , the present invention provides for a method of screening compounds to identify those that agonize or that antagonize the function of a polypeptide or polynucleotide of the invention , as well as related polypeptides and polynucleotides . in general , agonists or antagonists ( e . g ., inhibitors ) may be employed for therapeutic and prophylactic purposes for such diseases as herein mentioned . compounds may be identified from a variety of sources , for example , cells , cell - free preparations , chemical libraries , and natural product mixtures . such agonists and antagonists so - identified may be natural or modified substrates , ligands receptors , enzymes , etc ., as the case may be , of trmd polypeptides and polynucleotides ; or may be structural or functional mimetics thereof ( see coligan et al ., current protocols in immunology 1 ( 2 ): chapter 5 ( 1991 )). the screening methods may simply measure the binding of a candidate compound to the polypeptide or polynucleotide , or to cells or membranes bearing the polypeptide or polynucleotide , or a fusion protein of the polypeptide by means of a label directly or indirectly associated with the candidate compound . alternatively , the screening method may involve competition with a labeled competitor . further , these screening methods may test whether the candidate compound results in a signal generated by activation or inhibition of the polypeptide or polynucleotide , using detection systems appropriate to the cells comprising the polypeptide or polynucleotide . inhibitors of activation are generally assayed in the presence of a known agonist and the effect on activation by the agonist by the presence of the candidate compound is observed . constitutively active polypeptide and / or constitutively expressed polypeptides and polynucleotides may be employed in screening methods for inverse agonists , in the absence of an agonist or antagonist , by testing whether the candidate compound results in inhibition of activation of the polypeptide or polynucleotide , as the case may be . further , the screening methods may simply comprise the steps of mixing a candidate compound with a solution comprising a polypeptide or polynucleotide of the present invention , to form a mixture , measured trmd polypeptide and / or polynucleotide activity in the mixture , and comparing the trmd polypeptide and / or polynucleotide activity of the mixture to a standard . fusion proteins , such as those made from fc portion and trmd polypeptide , as herein described , can also be used for high - throughput screening assays to identify antagonists of the polypeptide of the present invention , as well as of phylogenetically and and / or functionally related polypeptides ( see d . bennett et al ., j mol recognition , 8 : 52 - 58 ( 1995 ); and k . johanson et al ., j biol chem , 270 ( 16 ): 9459 - 9471 ( 1995 )). the polynucleotides , polypeptides and antibodies that bind to and / or interact with a polypeptide of the present invention may also be used to configure screening methods for detecting the effect of added compounds on the production of mrna and / or polypeptide in cells . for example , an elisa assay may be constructed for measuring secreted or cell associated levels of polypeptide using monoclonal and polyclonal antibodies by standard methods known in the art . this can be used to discover agents that may inhibit or enhance the production of polypeptide ( also called antagonist or agonist , respectively ) from suitably manipulated cells or tissues . the invention also provides a method of sounds to identify those that enhance ( agonist ) or block ( antagonist ) the action of trmd polypeptides or polynucleotides , particlarly those compounds that are bacteristatic and / or bactericidal . the method of screening may involve high - throughput techniques . for example , to screen for agonists or antagonists , a synthetic reaction mix , a cellular compartment , such as a membrane , cell envelope or cell wall or a preparation of any thereof , comprising trmd polypeptide and a labeled substrate or ligand of such polypeptide is incubated in the absence or the presence of a candidate molecule may be a trmd agonist or antagonist . the ablity of the candidate molecule to agonize or antagonize the trmd polypeptide is reflected in deceased binding of the labeled ligand or decreased production of product from such substate . molecules that bind gratuitously , i . e ., without inducing the efects of trmd polypeptide are most likely to be good antagonists . molecules that bind well and , as the case may be , increase the rate of product production from subsrate , increase signal transduction , or increase chemical channel activity are agonists . detection of the rate or level of , as the case may be , production of product from substrate , signal transduction , or chemical channel activity may be enhanced by using a reporter system . reporter systems that may be useful in this regard include but are not limited to colorimetric , labeled substate converted into product , a reporter gene that is responsive to changes in trmd polynucleotide or polypeptide activity , and binding assays known in the art . polypeptides of the invention may be used to identify membrane bound or soluble receptors , if any , for such polypeptide , through standard receptor binding techniques known in the art . these techniques include , but are not limited to , ligand binding and crosslinking assays in which the polypeptide is labeled with a radioactive isotope ( for instance , 125 i ), chemically modified ( for instance , biotinylated ), or fused to a peptide sequence suitable for detection or purification , and incubated with a source of the putative receptor ( e . g ., cells , cell membranes , cell supernatants , tissue extracts , bodily materials ). other methods include biophysical techniques such as surface plasmon resonance and spectroscopy . these screening methods may also be used to identify agonist and antagonist of the polypeptide that compete with the binding of the polypeptide to its receptor ( s ), if any . standard methods for conducting such assays are well understood in the art . the fluorescence polarization value for a fluorescently - tagged molecule depends on the rotational correlation time or tumbling rate . protein complexes , such as formed by trmd polypeptide associating with another trmd polypeptide or other polypeptide , labeled to comprise a fluorescently - labeled molecule will have higher polarization values than a fluorescently labeled monomeric protein . it is preferred that this method be used to characterize small molecules that disrupt polypeptide complexes . fluorescence energy transfer may also be used characterize small molecules that intefere with the formation of trmd polypeptide dimers , trimers , tetramers or higher order structures , or structures formed by trmd polypeptide bound to another polypeptide . trmd polypeptide can be labeled with both a donor and acceptor fluorophore . upon mixing of the two labeled species and excitation of the donor fluorophore , fluorescence energy transfer can be detected by observing fluorescence of the acceptor . compounds that block dimerization will inhibit fluorescence energy transfer . surface plasmon resonance can be used to monitor the effect of small molecules on trmd polypeptide self - association as well as an association of trmd polypeptide and another polypeptide or small molecule . trmd polypeptide can be coupled to a sensor chip at low site density such that covalently bound molecules will be monomeric . solution protein can then passed over the trmd polypeptide - coated surface and specific binding can be detected in real - time by monitoring the change in resonance angle caused by a change in local refractive index . this technique can be used to characterize the effect of small molecules on kinetic rates and equilibrium binding constants for trmd polypeptide self - association as well as an association of trmd polypeptide and another polypeptide or small molecule . a scintillation proximity assay may be used to characterize the interaction between an association of trmd polypeptide with another trmd polypeptide or a different polypeptide . trmd polypeptide can be coupled to a scintillation - filled bead . addition of radio - labeled trmd polypeptide results in binding where the radioactive source molecule is in close proximity to the scintillation fluid . thus , signal is emitted upon trmd polypeptide binding and compounds that prevent trmd polypeptide self - association or an association of trmd polypeptide and another polypeptide or small molecule will diminish signal . in other embodients of the invention there are provided methods for identify compounds that bind to or otherwise interact with and inhibit or activate an activity or expression of a polypeptide and / or polynucleotide of the invention comprising : contacting a polypeptide and / or polynucleotide of the invention with a compound be screened under conditions to permit binding to or other interaction between the compound and the polypeptide and / or polynucleotide to assess the binding to or other interaction with the compound , such binding or interaction preferably being associated with a second component capable of providing a detectable signal in response to the binding or interaction of the polypeptide and / or polynucleotide with the compound ; and determining whether the compound binds to or otherwise interacts with and activates or inhibits an activity or expression of the polypeptide and / or polynucleotide by detecting the presence or absence of a signal generated from the binding or interaction of the compound with the polypeptide and / or polynucleotide . another example of an assay for trmd agonists is a competitive assay that combines trmd and a potential agonist with trmd - binding molecules , recombinant trmd binding molecules , natural substrates or ligands , or substate or ligand mimetics , under appropriate conditions for a competitive inhibition assay . trmd can be labeled , such as by radioactivity or a colorimetric compound , such that the number of trmd molecules bound to a binding molecule or converted to product can be determined accurately to assess the effectiveness of the potential antagonist . it will be readily appreciated by the skilled artisan that a polypeptide and / or polynucleotide of the present invention may also be used in a method for the structure - based design of an agonist or antagonist of the polypeptide and / or polynucleotide , by : ( a ) determining in the first instance the three - dimensional structure of the polypeptide and / or polynucleotide , or complexes thereof ; ( b ) deducing the three - dimensional stucture for the likely reactive site ( s ), binding site ( s ) or motif ( s ) of an agonist or antagonist ; ( c ) synthesizing candidate compounds that are predicted to bind to or react with the deduced binding site ( s ), reactive site ( s ), and / or motif ( s ); and ( d ) tesing whether the candidate compounds are indeed agonists or antagonists . it wil be further appreciated that this will normally be an iterative process , and this iterative process may be performed using automated and computer - controlled steps . in a further a the present invention provides methods of treating abnormal conditions such as , for instance , a disease , related to either an excess of , an under - expression of , an elevated activity of , or a decreased activity of trmd polypeptide and / or polynucleotide . if the expression and / or activity of the polypeptide and / or polynucleotide is in excess , several approaches are available . one approach comprises administering to an individual in need thereof an inhibitor compound ( antagonist ) as herein described , optionally in combination with a pharmaceutically acceptable carrier , in an amount effective to inhibit the function and / or expression of the polypeptide and / or polynucleotide , such as , for example , by blocking the binding of ligands , substrates , receptors , enzymes etc ., or by inhibiting a second signal , and thereby alleviating the abnormal condition . in another approach , soluble forms of the polypeptides still capable of binding the ligand , substrate , enzymes , receptors , etc . in competition with endogenous polypeptide and / or polynucleotide may be administered . typical examples of such competitors include fragments of the trmd polypeptide and / or polypeptide . in still another approach , expression of the gene encoding endogenous trmd polypeptide can be inhibited using expression blocking techniques . this blocking may be targeted against any step in gene expression , but is preferably targeted against transcription and / or tanslation . an examples of a known technique of this sort involve the use of antisense sequences , either internally generated or separately administered ( see , for example , o &# 39 ; connor , j neurochem ( 1991 ) 56 : 560 in oligodeoxynucleotides as antisense inhibitors of gene expression , crc press , boca raton , fla . ( 1988 )). alternatively , oligonucleotides that form triple helices with the gene can be supplied ( see , for example , lee et al ., nucleic acids res ( 1979 ) 6 : 3073 ; cooney et al ., science ( 1988 ) 241 : 456 ; dervan et al ., science ( 1991 ) 251 : 1360 ). these oligomers can be administered per se or the relevant oligomers can be expressed in vivo . each of the polynucleotide sequences provided herein may be used in the discovery and development of antibacterial compounds . the encoded protein , upon expression , can be used as a target for the screening of antibacterial drugs . additionally , the polynucleotide sequences encoding the amino terminal regions of the encoded protein or shine - delgarno or other translation facilitating sequences of the respective mrna can be used to construct antisense sequences to control the expression of the coding sequence of interest . the invention also provides the use of the polypeptide , polynucleotide , agonist or antagonist of the invention to interfere with the initial physical interaction between a pathogen or pathogens and a eukaryotic , preferably mammalian , host responsible for sequelae of infection . in particular , the molecules of the invention may be used : in the prevention of adhesion of bacteria , in particular gram positive and / or grain negative bacteria , to eukaryotic , preferably mammalian , extracellular matrix proteins on in - dwelling devices or to extacellular matrix proteins in wounds ; to block bacterial adhesion between eukaryotic , preferably mammalian , extracellular matrix proteins and bacterial trmd proteins that mediate tissue damage and / or ; to block the normal progression of pathogenesis in infections initiated other than by the implantation of in - dwelling devices or by other surgical techniques . in accordance with yet another aspect of the invention , there are provided trmd agonists and antagonists , preferably bacteristic or bactericidal agonists and antagonists . the antagonist and agonists of the invention may be employed , for instance , to prevent , inhibit and / or treat diseases . helicobacter pylori ( herein “ h . pylori ”) bacteria infect the stomachs of over one - third of the world &# 39 ; s population causing stomach cancer , ulcers , and gastritis ( international agency for research on cancer ( 1994 ) schistosomes , liver flukes and helicobacter pylori ( international agency for research on cancer , lyon , france , http :// www . uicc . ch / ecp / ecp2904 . htm ). moreover , the international agency for research on cancer recently recognized a cause - and - effect relationship between h . pylori and gastric adenocarcinoma , clasifying the bacterium as a group i ( definite ) carcinogen . preferred antimicrobial compounds of the invention ( agonists and antagonists of trmd polypeptides and / or polynucleotides ) found using screens provided by the invention , or known in the art , particularly narrow - spectrum antibiotics , should be useful in the treatmet of h . pylori infection . such treatment should decrease the advent of h . pylori - induced cancers , such as gastrointestinal carcinoma . such treatment should also prevent , inhibit and / or cure gastric ulcers and gastritis . all publications and references , including but not limited to patents and patent applications , cited in this specification are herein incorporated by reference in their entirety as if each individual publication or reference were specifically and individually indicted to be incorporated by reference herein as being fully set forth . any patent application to which this application claims priority is also incorporated by reference herein in its entirety in the manner described above for publications and references . the following definitions are provided to facilitate understaning of certain terms used frequently herein . “ bodily material ( s ) means any material derived from an individual or from an organism infecting , infesting or inhabiting an individual , including but not noted to , cells , tissues and waste , such as , bone , blood , serum , cerebrospinal fluid , semens , saliva , muscle , cartilage , organ tissue , skin , urine , stool or autopsy materials . “ disease ( s )” means any disease caused by or related to infection by a bacteria , including , for example , otitis media , conjuctivitis , pneumonia , bacteremia , meningitis , sinusitis , pleural empyema and endocarditis , and most particularly meningitis , such as for example infection of cerebrospinal fluid . “ host cell ( s )” is a cell that has been introduced ( e . g ., transformed or transfected ) or is capable of introduction ( e . g ., transformation or transfection ) by an exogenous polynucleotide sequence . “ identity ,” as known in the art , is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences , as the case may be , as determined by comparing the sequences . in the art , “ identity ” also means the degree of sequence relatedness between polypeptide or polynucleotide sequences , as the case may be , as determined by the match between strings of such sequences . “ identity ” can be readily calculated by known methods , including but not limited to those described in ( compuational molecular biology , lesk , a . m ., ed ., oxford university press , new york , 1988 ; biocomputing : informatics and genome projects , smith , d . w ., ed ., academic press , new york , 1993 ; computer analysis of sequence data , part i , griffin , a . m ., and griffin , h . g ., eds ., humana press , new jersey , 1994 ; sequence analysis in molecular biology , von heinje , g ., academic press , 1987 ; and sequence analysis primer , gribskov , m . and devereux , j ., eds ., m stockton press , new york , 1991 ; and carillo , h ., and lipman , d ., slam j . applied math ., 48 : 1073 ( 1988 ). methods to determine identity are designed to give the largest match between the sequences tested . moreover , methods to determine identity are codified in publicly available computer programs . computer program methods to determine identity between two sequences include , but are not limited to , the gcg program package ( devereux , j ., et al ., nucleic acids research 12 ( 1 ) 387 ( 1984 )), blastp , blastn , and fasta ( altschul , s . f . et al ., j . molec . biol . 215 : 403 - 410 ( 1990 ). the blast x program is publicly available from ncbi and other sources ( blast manual , altschul , s ., et al ., ncbi nlm nih bethesda , md . 20894 ; altschul . s ., et al ., j . mol . biol . 215 : 403 - 410 ( 1990 ). the well known smith waterman algorithm may also be used to determine identity . parameters for polypeptide sequence comparison include the following : algorithm : needleman and wunsch , j . mol biol . 48 : 443 - 453 ( 1970 ) comparison matrix : blossum62 from hentikoff and hentikoff , proc . natl . acad . sci . usa . 89 : 10915 - 10919 ( 1992 ) a program useful with these parameters is publicly available as the “ gap ” program from genetics computr group , madison wis . the aforementioned parameters are the default parameters for peptide comparisons ( along with no penalty for end gaps ). parameters for polynucleotide comparison include the following : algorithm : needleman and wunsch , j . mol biol . 48 : 443 - 453 ( 1970 ) available as : the “ gap ” program from genetics computer group , madison wis . these are the default parameters for nucleic acid comparisons . a preferred meaning for “ identity ” for polynucleotides and polypeptides , as the case may be , are provided in ( 1 ) and ( 2 ) below . ( 1 ) polynucleotide embodiments further include an isolated polynucleotide comprising a polynucleotide sequence having at least a 95 , 97 , 99 . 5 or 100 % identity to the reference sequence of seq id no : 1 , wherein said polynucleotide sequence may be identical to the reference sequence of seq id no : 1 or may include up to a certain integer number of nucleotide alterations as compared to the reference sequence , wherein said alterations are selected from the group consisting of at least one nucleotide deletion , substitution , including transition and transversion , or insertion , and wherein said alterations may occur at the 5 ′ or 3 ′ terminal positions of the reference nucleotide sequence or anywhere between those terminal positions , interspersed either individually among the nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence , and wherein said number of nucleotide alterations is determined by multiplying the total number of nucleotides in seq id no : 1 by the integer defining the percent identity divided by 100 and then subtracting that product from said total number of nucleotides in seq id no : 1 , or : wherein n n is the number of nucleotide alterations , x n is the total number of nucleotides in seq id no : 1 , y is 0 . 95 for 95 %, 0 . 97 for 97 %, 0 . 995 for 99 . 5 % or 1 . 00 for 100 %, and • is the symbol for the multiplication operator , and wherein any non - integer product of x n and y is rounded down to the nearest integer prior to subtracting it from x n . alterations of a polynucleotide sequence encoding the polypeptide of seq id no : 2 may create nonsense , missense or frameshift mutations in his coding sequence and thereby alter the polypeptide encoded by the polynucleotide following such alterations . ( 2 ) polypeptide embodiments further include an isolated polypeptide comprising a polypeptide having at least a 95 , 97 or 100 % identity to a polypeptide reference sequence of seq id no : 2 , wherein said polypeptide sequence may be identical to the reference sequence of seq id no : 2 or may include up to a certain integer number of amino acid alterations as compared to the reference sequence , wherein said alterations are selected from the group consisting of at least one amino acid deletion , substitution , including conservative and non - conservative substitution , or insertion , and wherein said alterations may occur at tha amino - or carboxy - terminal positions of the reference polypeptide sequence or anywhere between those terminal positions , interspersed either individually among the amino acids in the reference sequence or in one or more contiguous groups within the reference sequence , and wherein said number of amino acid alterations is determined by multiplying the total number of amino acids in seq id no : 2 by the integer defining the percent identity divided by 100 and then subtracting that product from said total number of amino acids in seq id no : 2 , or : wherein n a is the number of amino acid alterations , x a is the total number of amino acids in seq id no : 2 , y is 0 . 95 for 95 %, 0 . 97 for 97 % or 1 . 00 for 100 %, and • is the symbol for the multiplication operator , and wherein any non - integer product of x a and y is rounded down to the nearest integer prior to subtracting it from x a . “ individual ( s )” means a multicellular eukaryote , including , but not limited to a metzoan , a mammal an ovid , a bovid , a simian , a primate , and a human . “ isolated ” means altered “ by the hand of man ” from its natural state , i . e ., if it occurs in nature , it has been changed or removed from its original environment , or both . for example , a polynucleotide or a polypeptide naturally present in a living organism is not “ isolated ,” but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is “ isolated ”, as the term is employed herein . moreover , a polynucleotide or polypeptide a is introduced into an organism by transformation , genetic manipulation or by any other recombinant method is “ isolated ” even if it is still present in said organism , which organism may be living or non - living . “ organism ( s )” mmeans a ( i ) pro karyote icluding but not limited to , a member of the genus streptococcus , staphylococcus , bordetella , corynebacterium , mycobacterium , neissera , haemophilus , actinomycetes , streptomycetes , nocardia , enterobacter , yersinia , fancisella , pasturella , moraxella , acinetobacter , erysipelothrix , branhamella , actinobacillus , streptobacillus , listeria , calymmatobacterium , brucella , bacillus , clostridium , treponema , escherichia , salmonella , kleibsiella , vibrio , proteus , erwinia , borrelia , leptospira , spirillum , campylobacter , shigella , legionella , pseudomonas , aeromonas , rickettsia , chlamydia , borrelia and mycoplasma , and further induding , but not limited to , a member of the species or group , group a streptococcus , group b streptococcus , group c streptococcus , group d streptococcus , group g streptococcus , streptococcus pneumoniae , streptococcus pyogenes , streptococcus agalactiae , streptococcus faecalis , streptococcus faecium , streptococcus durans , neisseria gonorrheae , neisseria meningitidis , staphylococcus aureus , staphylococcus epidermidis , corynebacterium diptheriae , gardnerella vaginalis , mycobacterium tuberculosis , mycobacterium bovis , mycobacterium ulcerans , mycobacterium leprae , actinomyctes israelii , listeria monocytogenes , bordetella pertusis , bordatella parapertusis , bordetella bronchiseptica , escherichia coli , shigella dysenteriae , haemophilus influenzae , haemophilus aegyptius , haemophilus parainfluenzae , haemophilus ducreyi , bordetella , salmonella typhi , citrobacter freundii , proteus mirabilis , proteus vulgaris , yersinia pestis , kleibsiella pneumoniae , serratia marcessens , serratia liquefaciens , vibrio cholera , shigella dysenterii , shigella flexneri , pseudomonas aerusinosa , franscisella tularensis , brucella abortis , bacillus anthracis , bacillus cereus , clostridium perfringens , clostridium tetani , clostridium botulinum , treponema pallidum , rickettsia rickettsii and chlamydia trachomitis , ( n ) an archaeon , including but not limited to archaebacter , and ( iii ) a unicellular or filamentous eukaryote , including but not limited to , a protozoan , a fungus , a member of the genus saccharomyces , kluveromyces , or candida , and a menber of the species saccharomyces ceriviseae , kluveromyces lactis , or candida albicans . “ polynucleotide ( s )” generally refers to any polyribonucleotide or polydeoxyribonucleotide , that may be unmodified rna or dna or modified rna or dna . “ polynucleotide ( s )” include , without limitation , single - and double - stranded dna , dna that is a mixture of single - and double - stranded regions or single -, double - and triple - stranded regions , single - and double - stranded rna , and rna that is mixture of single and double - straned regions , hybrid molecules comprising dna and rna that may be single - stranded or , more typically , double - stranded , or triple - stranded regions , or a mixture of single - and double - stranded regions . in addition , “ polynucleotide ” as used herein refers to triple - stranded regions comprising rna or dna or both rna and dna . the so in such regions may be from the same molecule or from different molecules . the regions may include all of one or more of the molecules , but more typically involve only a region of some of the molecules . one of the molecules of a triple - helical region often is an oligonucleotide . as used herein , the term “ polynucleotide ( s )” also includes dnas or rnas as described above that comprise one or more modified bases . thus , dnas or rnas with backbones modified for stability or for other reasons are “ polynucleotide ( s )” as that term is intended herein . moreover , dnas or rnas comprising unusual bases , such as inosine , or modified bases , such as tritylated bases , to name just two examples , are polynucleotides as the term is used herein . it will be appreciated that a great vatiety of modifications have been made to dna and rna that serve many useful purposes known to those of skilled in the art . the term “ polynucleotide ( s )” as it is employed herein embraces such chemically , enzymatically or metabolically modified forms of polynucleotides , as well as the chemical forms of dna and rna characteristic of viruses and cells , including for example , simple and complex cells . “ polynucleotide ( s )” also embraces short polynucleotides often referred to as oligonucleotide ( s ). “ polypeptide ( s )” refers to any peptide or protein compising two or more amino acids joined to each other by peptide bonds or modified peptide bonds . “ polypeptide ( s )” refers to both short chains , commonly referred to as peptides , oligopeptides and oligomers and to longer chains generally referred to as proteins . polypeptides may comprise amimo acids other than the 20 gene encoded amino acids . “ polypeptide ( s )” include those modified either by natural processes , such as processing and other post - translational modifications , but also by chemical modification techniques . such modifications are well described in basic texts and in more detailed monographs , as well as in a voluminous research literature , and they are well known to those of skill in the art . it will be appreciated that the same type of modification may be present in the same or varying degree at several sites in a given polypeptide . also , a given polypeptide may comprise many types of modifications . modifications can occur anywhere in a polypeptide , including the peptide backbone , the amino acid side - chains , and the amino or carboxyl termini . modifications include , for example , acetylation , acylation , adp - ribosylation , amidation , covalent attachment of flavin , covalent attachment of a heme moiety , covalent of a nucleotide or nucleotide derivative , covalent attachment of a lipid or lipid derivative , covalent attachment of phosphotidylinositol , cross - linking , cyclization , disulfide bond formation , demethylation , formation of covalent cross - links , formation of cysteine , formation of pyroglutamate , formylation , gamma - carboxylation , gpi anchor formation , hydroxylation , iodination , methlation , myristoylation , oxidation , proteolytic processing , phosphorylation , prenylation , racemization , glycosylation , lipid attachment , sulfation , gamma - carboxylation of glutamic acid residues , hydroxylation and adp - ribosylation , selenoylation , sulfation , tansfer - rna mediated addition of amino acids to proteins , such as arginylation , and ubiquitination . see , for instance , proteins — structure and molecular properties , 2nd ed ., t . e . creighton w . h . freeman and company , new york ( 1993 ) and wold , f ., posttranslational protein modifications : perspectives and prospects , pgs . 1 - 12 in posttranslational covalent modification of proteins , b . c . johnson , ed ., academic press , new york ( 1983 ); seifter et al ., meth . enzymol . 182 : 626 - 646 ( 1990 ) and rattan et al ., protein synthesis : posttranslational modifications and aging , ann . n . y . acad . sci . 663 : 48 - 62 ( 1992 ). polypeptides may be branched or cyclic , with or without branching . cyclic , branched and branched circular peptides may result from post - translational natural processes and may be made by entirely synthetic methods , as well . “ recombinant expression system ( s )” refers to expression systems or portions thereof or polynucleotides of the invention introduced or transformed into a host cell or host cell lysate for the production of the polynucleotides and polypeptides of the invention . “ variant ( s )” as the term is used herein , is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide respectively , but retains essential properties . a typical variant of a polynucleotide differs in nucleotide sequence from another , reference polynucleotide . changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide . nucleotide changes may result in amino acid substitutions , additions , deletions , fusion proteins and truncations in the polypeptide encoded by the reference sequence , as discussed below . a typical variant of a polypeptide differs in amino acid sequence from another , reference polypeptide . generally , differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and , in many regions , identical . a variant and reference polypeptide may differ in amino acid sequence by one or more substitutions , additions , deletions in any combination . a substituted or inserted amino acid residue may or may not be one encoded by the genetic code . the present invention also includes include variants of each of the polypeptides of the invention , that is polypeptides that vary from the referents by conservative amino acid substuitions , whereby a residue is substituted by another with like characteristics . typical such substitutions are among ala , val , leu , and ile ; among ser and thr ; among the acidic residues asp and glu ; among asn and gln ; and among the basic resides lys and arg ; or aromatic residues phe and tyr . particularly preferred are variants in which several , 5 - 10 , 1 - 5 , 1 - 3 , 1 - 2 or 1 amino acids are substituted , deleted , or added in any combination . a variant of a polynucleotide or polypeptide may be a naturally occurring such as an allelic variant , or it may be a variant that is not known to occur naturally . non - naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techniques , by direct synthesis , and by other recombinant methods known to skilled artisans . the examples below are carried out using standard techniques , that are well known and routine to those of skilled in the art , except where otherwise described in detail . the examples are illustrative , but do not limit the invention . the polynucleotide having a dna sequence given in table 1 [ seq id no : 1 ] was obtained from a library of clones of chromosomal dna of streptococcus pneumoniae in e . coli . the sequencing data from two or more clones comprising overlapping streptococcus pneumoniae dnas was used to construct the contiguous dna sequence in seq id no : 1 . libraries may be prepared by routine methods , for example : total cellular dna is isolated from streptococcus pneumoniae 0100993 according to standard procedures and size - fractionated by either of two methods . total cellular dna is mechanically sheared by passage through a needle in order to size - fractionate according to standard procedures . dna fragments of up to 11 kbp in size are rendered blunt by treatment with exonuclease and dna polymerase , and ecori linkers added . fragments are ligated into the vector lambda zapii that has been cut with ecori , the library packaged by standard procedures and e . coli infected with the packaged library . the library is amplified by standard procedures . total cellular dna is partially hydrolyzed with a one or a combination of restriction enzymes appropriate to generate a series of fragments for cloning into library vectors ( e . g ., rsai , pali , alui , bshl235i ), and such fragments are size - fractionated according to standard procedures . ecori linkers are ligated to the dna and the fragments then ligated into the vector lambda zapii that have been cut with ecori , the library packaged by standard procedures , and e . coli infected with the packaged library . the library is amplified by standard procedures . the s . pneumoniae trmd gene is expressed during infection in a respiratory tract infection model the determination of expression during infection of a gene from streptococcus pneumoniae excised lungs from a 48 hour respiratory tract infection of streptococcus pneumoniae 0100993 in the mouse is efficiently disrupted and processed in the presence of chaotropic agents and rnaase inhibitor to provide a mixture of animal and bacterial rna . the optimal conditions for disruption and processing to give stable preparations and high yields of bacterial rna are followod by the use of hybridisation to a radiolabelled oligonucleotide specific to streptococcus pneumoniae 16s rna on northern blots . the rnaase free , dnaase free , dna and protein free preparations of rna obtained are suitable for reverse transcription pcr ( rt - pcr ) using unique primer pairs designed from the sequence of each gene of streptococcus pneumoniae 0100993 . a ) isolation of tissue infected with streptococcus pneumoniae 0100993 from a mouse animal model of infection ( lungs ) streptococcus pneumoniae 0100993 is seeded onto tsa ( tryptic soy agar , bbl ) plates containing 5 % horse blood and allowed to grow overnight at 37 ° c . in a co2 incubator . bacterial growth is scraped into 5 ml of phosphate - buffered saline ( pbs ) and adjusted to an a600 ˜ 0 . 6 ( 4 × 106 / ml ). mice ( male cba / j - 1 mice , approximately 20 g ) were anaesthetized with isoflurane and 50 microliters of the prepared bacterial inoculum is delivered by intranasal instillation . animals are allowed to recover and observed twice daily for signs of moribundancy . forty - eight hours after infection the animals are euthanized by carbon dioxide overdose and their torsos swabbed with ethanol and then rnazap . the torso is then opened , and the lungs are aseptically removed . half of each pair of lungs is placed in a cryovial and immediately frozen in liquid nitrogen ; the other half is used for bacterial enumeration after homogenization of the tissue in 1 ml of pbs . b ) isolation of streptococcus pneumoniae 0100993 rna from infected tissue samples infected tissue samples , in 2 - ml cryo - strorage tubes , are removed from − 80 ° c . storage into a dry ice ethanol bath . in a microbiological safety cabinet the samples are disrupted up to eight at a time while the remaining samples are kept frozen in the dry ice ethanol bath . to disrupt the bacteria within the tissue sample , 50 - 100 mg of the tissue is transfered to a fastrna tube containing a silica / ceramic matrix ( bio101 ). immediately , 1 ml of extraction reagents ( fastrna reagents , bio101 ) are added to give a sample to reagent volume ratio of approximately 1 to 20 . the tubes are shaken in a reciprocating shaker ( fastprep fp120 , bio101 ) at 6000 rpm for 20 - 120 sec . the crude rna preparation is extracted with chloroform / isoamyl alcohol , and precipitated with depc - treated / isopropanol precipitation solution ( bio101 ). rna preparations are stored in this isopropanol solution at − 80 ° c . if necessary . the rna is pelleted ( 12 , 000 g for 10 min . ), washed with 75 % ethanol ( v / v in depc - treated water ), air died for 5 - 10 min , and resupended in 0 . 1 ml of depc - treated water , followed by 5 - 10 minutes at 55 ° c . finally , after at least 1 minute on ice , 200 units of rnasin ( promega ) is added . rna preparations are stored at − 80 ° c . for up to one month . for longer term storage the rna precipitate can be stored at the wash stage of the protocol in 75 % ethanol for at least one year at − 20 ° c . quality of the rna isolated is assessed by running samples on 1 % agarose gels . 1 × tbe gels stained with ethidium bromide are used to visualise total rna yields . to demonstrate the isolation of bacterial rna from the infected tissue 1 × mops , 2 . 2m formaldehyde gels are run and vacuum blotted to hybond - n ( amersham ). the blot is then hybridised with a 32p - labelled oligonucleotide probe , of sequence 5 ′ aactgagactggctttaagagatta 3 ′ [ seq id no : 3 ], specific to 16s rrna of streptococcus pneumoniae . the size of the hybridising band is compared to that of control rna isolated from in vitro grown streptococcus pneumoniae 0100993 in the northern blot . correct sized bacterial 16s rrna bands can be detected in total rna samples which show degradation of the mammalian rna when visualised on tbe sels . c ) the removal of dna from streptococcus pneumoniae - derived rna dna was removed from 50 microgram samples of rna by a 30 minute treatment at 37 ° c . with 20 units of rnaase - free dnaasei ( genhunter ) in the buffer supplied in a final volume of 57 microliters . the dnaase was inactivated and removed by treatment with trizol ls reagent ( gibco brl , life technologies ) according to the manufacturers protocol . dnaase teated rna was resuspended in 100 microliters of depc treated water with the addition of rnasin as described before . d ) the preparation of cdna from rna samples derived from infected tissue 3 microgram samples of dnaase treated rna are reverse transcribed using a superscript preamplification system for first strand cdna synthesis kit ( gibco brl , life technologies ) according to the manufacturers instructions . 150 nanogram of random hexamers is used to prime each reaction . controls without the addition of superscriptii reverse transcriptase are also run . both +/− rt samples are treated with rnaseh before proceeding to the pcr reaction e ) the use of pcr to determine the presence of a bacterial cdna species pcr reactions are set up on ice in 0 . 2 ml tubes by adding the following components : 43 microliters pcr master mix ( advanced biotechnologies ltd . ); 1 microliter pcr primers ( optimally 18 - 25 basepairs in length and designed to possess similar annealing temperatures ), each primer at 10 mm initial concentration ; and 5 microliters cdna . pcr reactions are run on a perkin elmer geneamp pcr system 9600 as follows : 2 minutes at 94 ° c ., then 50 cycles of 30 seconds each at 94 ° c ., 50 ° c . and 72 ° c . followed by 7 minutes at 72 ° c . and then a hold temperature of 20 ° c . ( the number of cycles is optimally 30 - 50 to determine the appearance or lack of a pcr product and optimally 8 - 30 cycles if an estimation of the starting quantity of cdna from the rt reaction is to be made ); 10 microliter aliquots are then run out on 1 % 1 × tbe gels stained with ethidium bromide , with pcr product , if present , sizes estimated by comparison to a 100 bp dna ladder ( gibco brl , life technologies ). alternatively if the pcr products are conveniently labelled by the use of a labelled pcr primer ( e . g . labelled at the 5 ′ end with a dye ) a suitable aliquot of the pcr product is run out on a polyacrylamide sequencing gel and its presence and quantiy detected using a suitable gel scanning system ( e . g . abi prism ™ 377 sequencer using genescan ™ software as supplied by perkin elmer ). rt / pcr controls may include +/− reverse transcriptase reactions , 16s rrna primers or dna specific primer pairs designed to produce pcr products from non - transcribed streptococcus pneumoniae 0100993 genomic sequences . to test the efficiency of the primer pairs they are used in dna pcr with streptococus pneumoniae 0100993 total dna . pcr reactions are set up and run as described above using approx . 1 microgram of dna in place of the cdna . primer pairs which fail to give the predicted sized product in either dna pcr or rt / pcr are pcr failures and as such are uninformative . of those which give the correct size product with dna pcr two classes are distinguished in rt / pcr : 1 . genes which are not transcribed in vivo reproducibly fail to give a product in rt / pcr ; and 2 . genes which are transcribed in vivo reproducibly give the correct size product in rt / pcr and show a stonger signal in the + rt samples than the signal ( if at all present ) in − rt controls . the trmd gene is essential for s . pneumoniae in vitro growth . an allelic replacement cassette was generated using pcr technology . the cassette consisted of a pair of 500 bp chromosomal dna fragments flanking an erythromycin resistance gene . the chromosomal dna sequences are the 500 bp preceding and following the dna sequence encoding the trmd gene contained in seq . id no . 1 . the allelic replacement cassette was introduced into s . pneumoniae r6 by transformation . competent cells were prepared according to published protocols . dna was introduced into the cells by incubation of ng quantities of allelic replacement cassette with 10 6 cells at 30 ° c . for 30 minutes . the cells were transferred to 37 ° c . for 90 minutes to allow expression of the erythromycin resistance gene . cells were plated in agar containing lug erythromycin per ml . following incubation at 37 ° c . for 36 hours , colonies are picked and grown overnight in todd - hewitt broth supplemented with 0 . 5 % yeast extract . typically 1000 transformants containing the appropriate allelic replacement are obtained . if no transformants are obtained in three separate transformation experiments as was the case for this gene trmd , then the gene is considered as being essential in vitro . glu his ser ile val gly lys ala arg glu lys gly leu leu asp ile gln tyr his asn phe arg glu asn ala glu lys ala arg his val asp ile phe asn ser phe asp ala ile glu lys lys asn pro arg val ile tyr asp glu arg ile lys thr leu val thr asp glu ile ser leu gly ala thr val arg leu ile pro glu val ile gly lys glu ser ser his gly his his glu lys ile arg gln trp arg leu tyr glu ser leu lys | 0 |
referring first to fig1 there is indicated generally by numeral 10 a ski glove as observed from the palm side of the hand . it is seen to include a wrist band 12 having a velcro ® releasable fastener affixed thereto . specifically , the hook portion of the velcro fastener is identified by numeral 14 and formed on a mating surface of the wrist band 12 is the loop - type fabric 16 . in this fashion , the glove can be snugged against the wrist of the wearer to a desired degree of tension . as is conventional , the glove includes five finger receiving pockets including a thumb - receiving pocket 18 and an index finger - receiving pocket 20 . a strap 22 which may be formed from leather or nylon ® webbing is sewn at a first end 24 to the wrist band 12 near the location of the pisiform bone in the hand and is routed at a predetermined angle across the palm 26 of the glove to then pass between the thumb - receiving pocket 18 and the index finger receiving pocket 20 . the free end of the strap 22 may have a short segment of elastic fabric 28 sewn to it and , the side of the elastic segment 28 facing away from the observer in fig1 also has a velcro segment sewn to it , as identified by numeral 30 . referring to fig2 it can be seen that the velcro segment 30 is arranged to mate with a corresponding segment 32 sewn to the back of the glove 34 at a location which allows the attachment to be made without twisting the strap 22 in any way . by providing a velcro fastener 30 - 32 , the amount of tension exerted by the strap 22 across the palm of the hand can be adjusted . referring again to fig1 there is attached to the strap 22 at a location on the palm side of the strap near the intersection of the thumb - receiving pocket 18 and the index finger - receiving pocket 20 a means for engaging a latch member on a ski pole , all as will be more particularly described below . in accordance with a first embodiment and , with reference to fig3 the ski pole in question comprises an elongated tubular or solid shaft 36 having a ground - engaging end 38 , a basket - like extension 40 located near the ground - engaging end 38 and secured to the pole 36 . attached to the opposite end of the pole 36 is a hand grip member 42 having a forward facing surface area 46 . the term &# 34 ; forward &# 34 ; is in reference to the direction the grip is pointing when being grasped by the skier when in use . formed on the rear facing surface area 48 , which is at a location about 180 ° opposite the forward facing surface area 46 is a latch pin 50 in the form of a transversely extending pin . latch pin 50 fits into a recess 52 formed inward of the rear surface area 48 of the ski pole handle member 42 . in fig1 through 5 , the means attached to the strap 22 for engaging the latch pin 50 comprises a hook 54 which may be formed from metal or plastic and which includes a semi - circular recess 56 for receiving the latch pin 50 affixed to the hand grip 42 . forming a part of the hook 54 is a spring - type leaf detent 58 which , as is shown in fig4 and 5 , can be depressed to allow the latch pin 50 to slip into the recess 56 in the hook . when released , it springs up to block the latch pin 50 from sliding out of its semi - circular recess . the latch pin 50 may be secured to the strap 22 by any suitable means , such as rivet 60 . in use , when the skier wishes to engage the hook 54 on the strap 22 to the ski pole , he merely grasps the hand grip 42 of the ski pole in such a fashion that the hook 54 fits within the recess 52 . the pressure of the latch pin 50 against the leaf detent 58 causes it to depress to the point where the latch pin 50 can slip into the semi - circular recess 56 formed in the inside surface of the hook . once so seated , the leaf detent 58 can move to the position shown in fig5 to thereby block the latch pin 50 from coming free from the hook . when it is desired to uncouple the ski pole from the hook , the user merely inserts the thumb of his opposite hand against the leaf detent 58 while pulling down on the hand grip 42 . this combination of resulting forces causes the leaf detent 58 to be depressed to the position shown in fig4 allowing the hook to be released from its latch pin 50 . referring now to fig6 there is shown an alternative arrangement wherein a d - shaped ring or bail 62 is attached to the rear surface area 64 of the ski pole handle , i . e ., the side which is 180 ° away from the forward facing surface area 46 . affixed to the strap 22 is a bent metal or plastic hook 66 having a mouth which is downwardly oriented when the strap 22 is dropped across the glove in the fashion illustrated in fig1 and 2 of the drawings . by merely slipping the hook 66 over the outwardly projecting d - shaped ring 62 , the ski pole becomes latched to the glove of the wearer . in the arrangement shown in fig7 and 8 , the hand grip 42 includes a slot - like recess 68 and internal of the hand grip 42 is a flat leaf spring member 70 which functions as a pawl . the leaf spring 70 is affixed to the handle by a suitable fastener 72 at its upper end and then extends past a circular opening 74 in which is fitted a push button 76 . the other end of the leaf spring 70 intersects with the slot 68 , as at 78 , and thus normally extends into the slot 68 . depression of the push button 76 , however , deflects the leaf spring 70 such that its free end 78 is no longer within the confines of the slot 68 . adapted to mate with the latch mechanism is a flat blade - like member 80 having a saw tooth pattern of notches 82 formed on the upper surface thereof . the toothed plastic flat member 80 is appropriately secured to the strap 22 so as to project generally perpendicularly from the palm of the hand of the wearer . the flat member 80 , when pushed into the slot or recess 68 in the hand grip 42 of the ski pole , becomes engaged with the leaf spring 70 because the tip end 78 thereof falls into one of the series of notches 82 . when so inserted , the ski pole handle is latched to the ski glove assembly . by depressing the push button 76 and thereby lifting the end 78 of the leaf spring out of the slot 68 , it no longer engages the teeth 82 allowing the pole to be pulled free of the strap on the glove . fig9 and 10 show yet another alternative embodiment of the invention . here , the strap 22 has a d - shaped ring 81 affixed to it . the ring may be integrally formed with a backing member 83 and fasteners 84 pass through it to secure the d - shaped ring assembly to the strap 22 which , as in the embodiment of fig1 through 3 , traverses the palm of the wearer &# 39 ; s glove . the d - shaped ring 81 is arranged to fit into a slot - like recess 86 which extends into the rear surface of the hand grip 42 . with reference to fig1 , it can be seen that a d - shaped slot 88 is formed downward into the body of the hand grip 42 in the bottom wall of the recess 86 . extending over the d - shaped slot 88 is a spring loaded arm 90 which is pivoted for limited rotation about a pivot point 92 and normally biased rearward by the action of a spring 94 . a push button 96 fits into an aperture formed through the wall of the hand grip 42 and operatively engages the pivot arm 90 as illustrated . by depressing the push button 96 , the arm can be swung inward against the force provided by the bias spring 94 until the lower end 98 of that arm no longer subtends the d - shaped slot 88 . in use , then , the skier by merely gripping the hand grip 42 in his gloved hand will cause the d - shaped ring 81 to enter the slot 86 , pushing the pivot arm 90 inward until the d - shaped ring 81 slips into the d - shaped notch 88 . at this point , the force of the spring 94 swings the pivot arm 90 again in a covering relationship relative to the d - shaped notch 88 containing the d - shaped ring 81 . fig1 illustrates yet another embodiment of the invention whereby a skier can rapidly engage and disengage his gloved hand to the hand grip of a ski pole . in this manner , the skier may put on a special glove , quickly attach to the pole , ski and then detach quickly from the pole . here , the glove 10 also includes a diagonally extending strap 22 traversing the palm 26 of the hand and extending between the thumb - receiving pocket 18 and the index finger - receiving pocket 20 to fasten to the back of the glove as shown in fig2 . the strap 22 is bunched at 100 to form a generally cylindrical roll 102 by suitable stitching not shown . the roll projects outward from the exposed surface of the strap 22 . with the arrangement shown in fig1 , the hand grip 42 of the ski pole is provided with a circular slot 104 formed in the surface thereof . the slot or bore 104 is formed so as to be slightly closer to the rear surface than the radius of the slot 104 and , as such , has a narrow slit through the rear surface of the handle leading to the bore 104 . as is represented by the dotted line in fig1 , the cylindrical protuberance 102 formed on the strap 22 is arranged to fit within the bore 104 formed in the ski pole hand grip 42 in a side entry fashion . the diameter of the protuberance 102 is larger than the slit - like opening in the rear of the handle so that the roll 102 will be retained within the bore 104 while the skier is skiing . by merely sliding the gloved hand sideways relative to the pole hand grip 42 , the roll 102 can be easily disengaged from the bore 104 . fig1 illustrates yet another embodiment of the invention whereby a skier can rapidly engage and disengage his gloved hand to the grip of a ski pole . here , glove 10 also includes a diagonally extending strap 22 traversing the palm 26 of the hand and extending between the thumb - receiving pocket 18 and the index finger - receiving pocked 20 to fasten to the back of the glove as shown in fig2 . the strap 22 includes a substantially inelastic segment 106 , such as nylon webbing , at a location on the palm side of the strap 22 near the intersection of the thumb - receiving pocket 18 and the index finger - receiving pocket 20 . longitudinal slot 108 is disposed in segment 106 to form a first side 110 and second side 112 . referring now to fig1 , loop 114 comprising a substantially inelastic material such as nylon is formed projecting outward from the exposed surface of strap 22 by attaching a first end 116 to first side 110 and a second end 118 to second side 112 , such as by stitching . referring now to fig1 , a substantially elastic portion 120 is attached , such as by sewing , to an unexposed side of strap 22 adjacent an area of slot 108 where loop 114 is formed . first end 122 of portion 120 is sewn to first side 110 of segment 106 , portion 120 extending across slot 108 to second end 124 which is sewn to the second side 112 of segment 106 . with the arrangement shown in fig1 - 14 , where like reference numbers represent like items , the hand grip 42 of the ski pole has an end portion 126 tapering toward point 128 and forming a generally conical shape . narrowed portion 130 , formed by a generally v - shaped or rectangular - shaped notch / recess , for example , is disposed nearly proximate point 128 . as represented by the dotted line in fig1 , point 128 of hand grip 42 is arranged to be insertable in loop 114 such that loop 114 slides over the end portion 126 such that elastic portion 120 stretches , and loop 114 fits snugly into the notch defining narrowed region 130 . this arrangement securely and comfortably fastens hand grip 42 to loop 114 while the skier is skiing . to remove the hand grip 42 quickly from loop 114 , hand grip 42 is rotated about 180 ° while removing it from loop 114 . elastic portion 120 stretches across slot 108 slightly to loosen loop 114 such that loop 114 can slide back over tapered end portion 126 . loop 114 and segment 106 can endure repeated connect and disconnect motions since they are substantially inelastic and will not wear quickly . this invention has been described herein in considerable detail in order to comply with the patent statutes and to provide those skilled in the art with the information needed to apply the novel principles and to construct and use such specialized components as are required . however , it is to be understood that the invention can be carried out by specifically different equipment and devices , and that various modifications , both as to the equipment details and operating procedures , can be accomplished without departing from the scope of the invention itself . | 8 |
it is known that a tubular blank 150 is constituted by four consecutive flaps connected by score - lines 1 a - 1 d 2 a - 2 d , which behave as hinges . tabs 1 f , 1 g only illustrated in fig2 a , 2 b are hinged to the heads of the other flaps , by means of relative score - lines . in the remaining figures these tabs are not represented with the aim of making the technical and functional aspects of the invention clear . with reference to the figures , 100 , 200 , 300 , 400 respectively denote : a store containing a stack p of blanks 150 in a tubular flattened configuration ; first means for removing the blank at the bottom of the stack ; a drum 300 kept in constant rotation in a direction f , peripherally interested by work stations 20 , identical to one another and angularly equidistanced , each of which is destined to receive , and retain , a blank 150 supplied thereto by the first means ; a supply line of crates 450 of which the head facing the drum 300 has been illustrated . with the blank in the flattened configuration , the flaps 1 a - 1 d are distributed according to an external plane ( flaps 1 a , 1 b ) and an internal plane ( flaps 1 c , 1 d ); the internal flaps are connected by the score - line 2 a . the walls 100 a , 100 b of the store are mutually positioned such as to have the score - lines 2 a of the blanks of the stack p arranged along a plane 7 ( first reference plane ); this is satisfied independently of the format of the blanks ( see fig3 a , 3 b relating , for example , to the maximum and minimum format ). the first means 200 are constituted by a flanked pair of arms 6 a , 6 b splined on a shaft 8 made to oscillate in an outward and a return run h and k ; if necessary the shaft 8 is made to oscillate by synchronizing means , along an arc of circumference c 1 , coaxial with the shaft 11 of the drum 300 , in operating directions c 1 , and a non - operating direction i 2 . the arms , the mutual distance between which is greater than the thickness of the drum 300 , are positioned so as to be arranged at the end of the outward run , bilaterally with respect to the heads of the drum itself . each station 20 of the drum 300 is provided with two retaining suckers 22 transversally flanked , i . e . in a direction parallel to the axis of the drum 11 ; a plate 23 is provided upstream of the suckers 22 , aligned with the plane defined by the suckers . the station further comprises , in an internal position with respect to suckers 22 , a portion of the crown wheel 27 that externally enmeshes with a rotating mechanism 25 and is internally supported and guided by idle rollers 28 the axes of which are parallel to the axis c of the crown wheel ; the axis c is located downstream ( with reference to the direction f of the drum rotation ) with respect to the suckers 22 and the plane identified by said suckers 22 . the distance between the axis c of the crown wheel and the plane identified by the axes of the suckers 22 is a predetermined value d . at an end thereof , the crown 27 bears folding means 29 orientated inwardly according to a diameter plane of the crown wheel which , as a result of the oscillation , oscillates about the axis c . in the end position y 1 , the suckers 12 borne by the arms 6 a , 6 b intercept the first flap 1 a of the two external flaps of the bottom blank from the stack p ; the arms are conformed and positioned such that the distance in this position between the reference plane 7 and the plane identified by the axes thereof 12 borne at the free ends of the arms is equal to the above - mentioned predetermined value d ( see enlarged detail s of fig3 b ) which is maintained when the blank format is varied . the oscillation of the arms in the outward run h enables transfer of the attached blank from the suckers 12 to a corresponding work station 20 . the mutual phase relationship between the oscillation of the arms and the velocity of the drum 300 is such as to place the pick - up suckers transversally flanked to the station , which causes the impact of the first flap 1 a against the retaining suckers 22 . in phase relation with this impact the pick - up suckers 12 are deactivated and the retaining suckers 22 activated . to avoid stress to the external surface 1 a of the first flap 1 a , the shaft 8 is moved in the operational direction 11 , such as to impose , at least at the moment of impact , a peripheral velocity of the pick - up suction device 12 that is equal to the peripheral velocity of the retaining suckers 22 . following the disengaging of the suckers 12 from the first flap 1 a , the arms continue forward in the outward run up until reaching the end position y 2 ( fig3 a , 3 b ): this enables them to make the return run without interfering with the blank drawn in the direction f by the retaining suckers 22 . at the moment of impact of the first flap 1 a on the retaining suckers 22 , the planes defined by the axes of the pick - up suckers 12 and the retaining suckers 22 coincide : it follows that the score - line 2 a connecting the external flaps 1 a , 1 b is arranged along the axis c . in phase relation with the engaging of the first flap 1 a by the suckers 22 , the rotating mechanism 25 imposes the oscillation of the crown wheel 27 in the direction q , with a consequent oscillation of the folding means 29 , with respect to the axis c , in the opposite direction to the direction f of rotation of the drum . the folding means 29 intercept the second flap 1 b of the external flaps 1 a , 1 b of the blank , causing it to oscillate about the score - line 2 a thereof ( i . e . swing around the axis c ) by at least 90 °; in reality this angle is exceeded ( position n in fig4 ) in order to prevent the elastic return of the score - lines 2 a - 2 d when the folding means cease the action thereof . fig4 shows that the first flap 1 a is resting on the plate 23 : this helps to stabilize the flap during the opening - out of the blank , consequent to the rotation of the second flap 1 b with respect to the score - line 2 a . the combined action of the retaining suckers 22 and the folding means 29 enables obtaining the configuration of the opened - out tubular blank 150 as shown in fig3 a , 3 b ; this configuration is maintained up to a release zone z in which the station 20 functionally cooperates with a device 500 for transferring the tubular blank 150 from the station to a crate 450 of the upper branch 470 of the supply line 400 . the line 400 is constituted , in a known way , by a first pair of identical belts 410 , arranged facing on vertical planes , winding in a closed loop on crown wheels , a drive wheel and a driven wheel , of which only the driven wheels 430 are illustrated ; the axis 430 a of the crown wheels is parallel to the axis 11 of the drum 300 . the ends of the first segments 415 facing outward are perpendicularly solidly constrained to the belts , with each segment being transversally flanked to a corresponding segment of the remaining belt such as to define pairs of thrust segments 415 ; at the upper branch of the said pair of belts , the front surfaces of these segments define a second reference plane 70 , or reference plane for the tubular blank 150 . the line 400 comprises a second pair of identical belts 420 , correspondingly adjacent to the preceding belts 410 and developing similarly thereto , with respect to which they are operated in synchrony , according to known techniques . second segments 425 facing outward are perpendicularly solidly constrained to the second pair of belts ; in this way pairs of abutting segments 425 are defined . the distance between the pair of abutting segments 425 and the pair of thrust segments 415 , arranged upstream of the abutting segments 425 , identify , at the upper branch 470 of the line 400 , a corresponding crate 450 . according to known techniques , the first and second pairs of belts are operated in a staggered way : for example , fig3 a , 3 b relate to the minimum and maximum size of the crate , that is , the minimum and maximum size of the tubular blank 150 . the device 500 is constituted by a rotating member 510 arranged between the longitudinal walls 490 of the line 400 at the head 440 thereof situated opposite the zone z ; this member is coaxial with the crowns 430 of the head and is conformed and positioned such as not to interfere either with the belts 410 , 420 or with the segments 415 , 425 borne thereby . the rotating member 510 , for example constituted by a drum or a facing pair of discs , solidly constrained to each other , peripherally bear second pick - up means , constituted for example by pairs of transfer suckers 525 ( connected to a vacuum source , not illustrated ) angularly equidistanced along the periphery of the rotating member 510 ; the transfer suckers 525 of each pair are transversally flanked , i . e . arranged in a diameter plane of the rotating means . the transfer suckers describe a circular trajectory tangential to the upper branch 470 of the line 400 . as is known , the segments 415 , 425 are vertical at the upper branch 470 , such as to define the volume of the crate 450 identified thereby ; when the belts cross the crown wheels located upstream of the upper branch 470 , the segments are arranged radially such as define there - between a housing , a minimum distance of which , in the rotation direction w of the rotation of the crowns themselves , is greater than the size , in the same direction , of the tubular blank 150 ( see fig3 a , 3 b , 5 ). the rotating member 510 , in following the pathway facing towards the head 440 , positions a pair of transferring suckers 525 in a corresponding transfer dynamic seating 460 . the mutual phase relation between the movements of the drum 300 and the rotating member 510 are such that the retaining suckers 22 in the station 20 and the transfer suckers 525 of the rotating member 510 are arranged aligned on a same plane x that is diametral both for the drum 300 and for the rotating member 510 . in this situation the suckers 525 intercept the external flap 1 c parallel to the first flap 1 a . in phase relation with the alignment , the folding means 29 disengage from the second flap 1 b , the retaining suckers 22 deactivate and the transfer suckers 525 activate . the abutting segments 425 delimiting the dynamic seating 460 downstream are positioned relative to the suckers 525 in such a way as to counter the closure , due to elastic return , of the tubular blank 150 . the dynamic seating 460 in which the tubular blank 150 hooked , with its flap 1 c , to the transfer suckers 525 , maintains the spatial configuration thereof , not necessarily having a rectangular section , up to when the contrast segments 425 , from being radial , become arranged vertical at the start of the upper branch 470 of the line 400 ( position m 1 in fig3 a ): at this point the size of the seating 460 in the direction w gradually decreases and then stabilizes as the segments 415 have also changed from radial to vertical up to defining the volume of the crate 450 ( m 2 position of fig3 a ). the deactivation of the transfer suckers 525 occurs in phase relation with the above position , and in practice before it , such as to avoid stress on the flap 1 c when placing the tubular blank 150 between the thrust segments 415 and the abutting segments 425 . during the transfer of the blank tube 150 from the zone z up to the upper branch 470 of the line , the flap 1 c is abutted by small lateral walls 480 , first curved ( fig2 a , 2 b ) and then straight : in the curved tract the flap is tangential of the walls ( fig3 b ), then to go to rest thereof in the straight tract , i . e . in the upper branch . the above - described small walls contribute to stabilizing the blank tube 150 . subsequently , in a known way in the packing machine , not illustrated , the flaps 1 g are folded to define the bottom of a corresponding container , articles are placed therein , and finally the remaining flaps 1 g are folded to realize the cover of the container . with regard to the change of format , note that the two considered reference planes 7 , 70 must be respected . with regard to the first reference plane 7 , the mutual distance between the walls 100 a , 1008 of the store 100 is varied , such that the plane 7 on which the score - lines 2 a of the flattened blanks 150 are arranged at distance d with respect to the plane identified by the collecting suckers 12 when they intercept the first flap 1 a of the bottom blank in the stack : the mutual positioning between the bottom of the stack p of blanks , the first means 200 and the drum 300 is maintained . as regards the second reference plane 70 , which is crucial for the filling and closing operations of the container ( corresponding to the tubular blank 150 ) carried out by the above - described packing machine , which presupposes not modifying the positioning of the line in any way with respect to the machine , it is necessary to consider that on varying the format , the distance between the axes 11 , 430 a , respectively of the drum and the crown wheels 430 of the line 400 also necessarily varies : see fig3 a , 3 b , where this distance is indicated by d 1 ( minimum format fig3 a ) and d 2 ( maximum format fig3 b ). for the above reasons , the apparatus constituted by the store 100 , the first means 200 and the drum 300 , is borne by a same structure ( not shown ) that can translate in the direction b defined by the line which connects the axes 11 , 430 a , along a tract that is at least equal to the difference between d 2 and d 1 . the above description has considered a particular embodiment of the drum 300 , the work stations of which intervene to vary the shape of the blank from flattened to tubular without causing lacerations and / or scoring and / or creasing and / or stress on the second flap 1 b , which is the one subjected to the action of the folding means . the ambit of protection of the invention is understood to extend independently of the modes with the blank is opened out . | 1 |
a dual fuel premix nozzle 40 is shown in detail in fig3 through 6 . dual fuel premix nozzle 40 has a base 41 with three through holes 42 for bolting premix fuel nozzle 40 to a housing 75 ( see fig7 ). extending from base 41 is a first tube 43 having a first outer diameter , a first inner diameter , a first thickness , and opposing first tube ends . within premix fuel nozzle 40 is a second tube 44 having a second outer diameter , a second inner diameter , a second thickness , and opposing second tube ends . the second outer diameter of second tube 44 is smaller than the first inner diameter of first tube 43 thereby forming a first annular passage 45 between the first and second tubes , 43 and 44 , respectively . dual fuel premix nozzle 40 further contains a third tube 46 having a third outer diameter , a third inner diameter , a third thickness , and opposing third tube ends . the third outer diameter of third tube 46 is smaller than said second inner diameter of second tube 44 , thereby forming a second annular passage 47 between the second and third tubes 44 and 46 , respectively . third tube 46 contains a third passage 57 . dual fuel premix nozzle 40 further comprises an injector assembly 49 , which is fixed to first and second tubes , 43 and 44 , respectively , at the tube ends thereof opposite base 41 . injector assembly 49 includes a plurality of radially extending fins 50 , each of the fins having an outer surface , an axial length , a radial height , and a circumferential width . each of fins 50 are angularly spaced apart by an angle a of at least 30 degrees and fins 50 further include a first radially extending slot 51 within fin 50 and a second radially extending slot 52 within fin 50 , a set of first injector holes 53 located in the outer surface of each of fins 50 and in fluid communication with first slot 51 therein . a set of second injector holes , 54 and 54 a are located in the outer surface of each of fins 50 and in fluid communication with second slot 52 therein . fixed to the radially outermost portion of the outer surface of fins 50 to enclose slots 51 and 52 are fin caps 55 . injector assembly 49 is fixed to nozzle 40 such that first slot 51 is in fluid communication with first passage 45 and second slot 52 is in fluid communication with second passage 47 . premix nozzle 40 further includes a fourth tube 80 having a generally conical shape with a tapered outer surface 81 , a fourth inner diameter , and opposing fourth tube ends . fourth tube 80 is fixed at fourth tube ends to injector assembly 49 , opposite first tube 43 and second tube 44 , and to third tube 46 . the fourth inner diameter of fourth tube 80 is greater in diameter than the third outer diameter of third tube 46 , thereby forming a fourth annular passage 82 , which is in fluid communication with second passage 47 . nozzle 40 further includes the capability of operating under dual fuel conditions , gas or liquid fuel , through the use of additional concentric tubes . within third tube 46 is a fifth tube 56 having a fifth outer diameter , a fifth inner diameter , a fifth thickness , and opposing fifth tube ends . the outer diameter of fifth tube 56 is smaller than the inner diameter of third tube 46 such that third passage 57 , which is formed between third tube 46 and fifth tube 56 , is annular in shape . the fifth tube 56 further includes a means for engagement 60 , such as threading , located at the fifth tube end proximate base 41 . located coaxial to and within fifth tube 56 is sixth tube 61 . sixth tube 61 has a sixth outer diameter , a sixth inner diameter , a sixth thickness , and opposing sixth tube ends . the outer diameter of sixth tube 61 is smaller than the inner diameter of fifth diameter 56 thereby forming a fifth annular passage 62 . sixth tube 61 further includes a swirler 63 located on its outer diameter at a sixth tube end , proximate the nozzle tip cap assembly 59 , such that a swirl is imparted to the fluid flowing through fifth annular passage 62 . a means for engagement 64 is located at an end of sixth tube 61 , opposite of swirler 63 . sixth tube 61 also contains a passage 65 contained within its inner diameter . when assembled , fifth tube 56 and sixth tube 61 are each fixed to housing 75 , shown in fig7 , through the means for engagement 60 and 64 , respectively . in order to allow fifth tube 56 and sixth tube 61 to fit within nozzle tip cap assembly 59 , the cap assembly , which is fixed to fourth tube 80 , has a seventh outer diameter and seventh inner diameter such that the seventh inner diameter has substantially the same inner diameter as that of third tube 46 . the use of a conical shaped tube as fourth tube 80 allows a smooth transition in flow path between injector assembly 49 and cap assembly 59 such that large zones of undesirable recirculation , downstream of fins 50 , are minimized . if the recirculation zones are not minimized , they can provide an opportunity for fuel and air to mix to the extent that combustion occurs and is sustainable upstream of the desired combustion zone . the dual fuel premix nozzle 40 , in the present embodiment , injects fluids , such as natural gas and compressed air , or liquid fuel , water , and compressed air , depending on the mode of operation , into a combustor of a gas turbine engine for the purposes of establishing a premix pilot flame and supporting combustion downstream of the fuel nozzle . one operating embodiment for this type of fuel nozzle is in a dual stage , dual mode combustor similar to that shown in fig7 . a dual stage , dual mode combustor 70 includes a primary combustion chamber 71 and a secondary combustion chamber 72 , which is downstream of primary chamber 71 and separated by a venturi 73 of reduced diameter . combustor 70 further includes an annular array of diffusion type nozzles 74 each containing a first annular swirler 76 . in the gas only combustor operation , the dual fuel premix nozzle 40 of the present invention is located along center axis a — a of combustor 70 , upstream of second annular swirler 77 , and is utilized as a secondary fuel nozzle to provide a pilot flame to secondary combustion chamber 72 and to further support combustion in the secondary chamber . in gas operation , flame is first established in primary combustion chamber 71 , which is upstream of secondary combustion chamber 72 , by an array of diffusion - type fuel nozzles 74 , then a pilot flame is established in secondary combustion chamber 72 when fuel and air are injected from nozzle 40 . gaseous fuel flow is then increased to secondary fuel nozzle 40 to establish a more stable flame in secondary combustion chamber 72 , while flame is extinguished in primary combustion chamber 71 , by cutting off fuel flow to diffusion - type nozzles 74 . once a stable flame is established in secondary combustion chamber 72 and flame is extinguished in primary combustion chamber 71 , fuel flow is restored to diffusion - type nozzles 74 and fuel flow is reduced to secondary fuel nozzle 40 such that primary combustion chamber 71 now serves as a premix chamber for fuel and air prior to entering secondary combustion chamber 72 . the present invention , as operated on gas fuel , will now be described in detail with reference to the particular operating environment described above . in the preferred embodiment , nozzle 40 operates in a dual stage dual mode combustor 70 , where nozzle 40 serves as a secondary fuel nozzle . the purpose of the nozzle is to provide a source of flame for secondary combustion chamber 72 and to assist in transferring the flame from primary combustion chamber 71 to secondary combustion chamber 72 . in this role , the second passage 47 , second slot 52 , and second set of injector holes 54 and 54 a flow a fuel , such as natural gas into plenum 78 where it is mixed with compressed air prior to combusting in secondary combustion chamber 72 . during engine start - up , first passage 45 , first slot 51 , and first set of injector holes 53 flow compressed air into the combustor to mix with the gaseous fuel . in an effort to maintain machine load condition when the flame from primary combustion chamber 71 is transferred to secondary combustion chamber 72 , first passage 45 , first slot 51 , and first set of injector holes 53 flow fuel , such as natural gas , instead of air , to provide increased fuel flow to the established flame of secondary combustion chamber 72 . once the flame is extinguished in primary combustion chamber 71 and securely established in secondary combustion chamber 72 , fuel flow through the first passage 45 , first slot 51 , and first set of injector holes 53 of premix nozzle 40 is slowly cut - off and replaced by compressed air , as during engine start - up . nox emissions are reduced through the use of this premix nozzle by ensuring that all fuel that is injected is thoroughly mixed with compressed air prior to reaching the flame front of the combustion zone . this is accomplished by the use of the fin assembly 49 and through proper sizing and positioning of injector holes 53 , 54 , and 54 a . thorough analysis has been completed regarding the sizing and positioning of the first and second set of injector holes , such that the injector holes provide a uniform fuel distribution . to accomplish this task , first set of injector holes 53 , having a diameter of at least 0 . 050 inches , are located in a radially extending pattern along the outer surfaces of fins 50 as shown in fig3 . to facilitate manufacturing , first set of injector holes 53 have an injection angle relative to the fin outer surface such that fluids are injected upstream towards base 41 . second set of injector holes , including holes 54 on the forward face of fins 50 and 54 a on outer surfaces of fin 50 , proximate fin cap 55 , are each at least 0 . 050 inches in diameter . injector holes 54 a are generally perpendicular to injector holes 54 , and have a slightly larger flow area than injector holes 54 . second set of injector holes 54 and 54 a are placed at strategic radial locations on fins 50 so as to obtain an ideal degree of mixing which both reduces emissions and provides a stable shear layer flame in secondary combustion chamber 72 . to further provide a uniform fuel injection pattern and to enhance the fuel and air mixing characteristics of the premix nozzle , all fuel injectors are located upstream of second annular swirler 77 . dual fuel premix nozzle 40 can operate on either gaseous fuel or liquid fuel , and can alternate between the fuels as required . depending on gas fuel cost , gas availability , scheduled operating time , and emissions regulations , it may advantageous to operate on liquid fuel . when dual fuel premix nozzle 40 is operating in a liquid mode in a dual stage dual mode combustor , the annular array of diffusion type nozzles 74 of fig7 are also operating on liquid fuel . both the diffusion type nozzle 74 and dual fuel premix nozzle 40 alternate between liquid and gas fuels together . in the preferred embodiment of a dual stage dual mode combustor , when operating on liquid fuel , the start - up sequence to the combustor is similar to that of the gas fuel operation , but when increasing in load to full power , fuel nozzle operating conditions are slightly different . liquid fuel is first flowed to the diffusion type nozzles 74 and a flame is established in primary combustion chamber 71 . liquid flow is then decreased to diffusion nozzles 74 while it is directed to the dual fuel premix nozzle 40 to establish a flame in secondary combustion chamber 72 . the fuel flow is maintained in both the diffusion nozzles 74 and dual fuel premix nozzle 40 as the engine power increases to full base load condition , with flame in both the primary and secondary combustion chambers , 71 and 72 , respectively . at approximately 50 % load condition , water can be injected into the combustion chambers , by way of the fuel nozzles , to lower the flame temperature , which in turn reduces nox emissions . with specific reference to the nozzle embodiment disclosed in fig3 - 6 in the liquid fuel operating condition , liquid fuel passes through passage 65 of sixth tube 61 and injects fuel into secondary combustion chamber 72 . mixing with the liquid fuel in secondary combustion chamber 72 , at load conditions above 50 %, is a spray of water that is also injected by nozzle 40 . water flows coaxial to sixth tube 61 through fifth tube 56 via fifth annular passage 62 , and exits nozzle 40 in a swirling pattern imparted by swirler 63 , which is positioned in fifth annular passage 62 . passages 45 and 47 , slots 51 and 52 , and first and second sets of injector holes 53 , 54 , and 54 a , which flowed either natural gas or compressed air in the gas mode operation each flow compressed air in liquid operation to purge the nozzle passages such that liquid fuel does not recirculate into the gas or air passages . an alternate embodiment of the present invention is shown in fig8 and 9 . the alternate embodiment includes all of the elements of the preferred embodiment as well as a fourth set of injector holes 83 , which are in communication with fourth annular passage 82 of fourth tube 80 . these injector holes provide an additional source of gas fuel for combustion . the additional gas fuel from fourth set of injector holes 83 premixes with fuel and air , from injector assembly 49 , in passage 78 ( see fig7 ) to provide a more stable flame , through a more fuel rich premixture , in the shear layer of the downstream flame zone region 90 . fourth set of injector holes 83 are placed about the conical surface 81 of fourth tube 80 , between injector assembly 49 and cap assembly 59 , and have a diameter of at least 0 . 025 inches . a second alternate embodiment of the present invention is shown in fig1 - 13 . a fuel nozzle 140 capable of dual fuel operation has a base 141 with three through holes for bolting fuel nozzle 140 to a housing . referring to fig1 and 12 , a first tube 143 extends from base 141 having a first outer diameter , a first inner diameter , and opposing first tube ends . within fuel nozzle 140 and coaxial with first tube 143 is a second tube 144 having a second outer diameter , a second inner diameter , and opposing second tube ends . the second outer diameter of second tube 144 is smaller than the first inner diameter of first tube 143 thereby forming a first annular passage 145 between the first and second tubes , 143 and 144 , respectively . fuel nozzle 140 further contains a third tube 146 having a third outer diameter , a third inner diameter , and opposing third tube ends . the third outer diameter of third tube 146 is smaller than said second inner diameter of second tube 144 , thereby forming a second annular passage 147 between second and third tubes , 144 and 146 , respectively . referring to fig1 , fuel nozzle 140 further comprises an injector assembly 149 , which is fixed to both first and second tubes , 143 and 144 , respectively , at the tube ends thereof opposite base 141 . injector assembly 149 includes a plurality of radially extending fins 150 , each of the fins having an outer surface , an axial length , a radial height , and a circumferential width . fins 150 are angularly spaced apart by an angle a of at least 30 degrees and further include a radially extending slot 151 that is in fluid communication with second annular passage 147 . located in the outer surface of each fin 150 is a set of first injector holes 152 that are in fluid communication with radially extending slots 151 and preferably have a diameter of at least 0 . 040 inches . fixed to the radially outermost portion of the outer surface of fins 150 , to enclose slots 151 , are fin caps 153 . injector assembly 149 also includes a set of second injector holes 154 that are in fluid communication with first passage 145 , located upstream of and circumferentially offset from fins 150 . second injector holes preferably have a diameter of at least 0 . 150 inches . referring to fig1 - 12 , nozzle 140 further includes a fourth tube 180 having a generally conical shape with a tapered outer surface 181 , a fourth inner diameter , and opposing fourth tube ends . fourth tube 180 is fixed at a fourth tube end to injector assembly 149 , opposite first tube 143 and second tube 144 , and is in sealing contact with third tube 146 at the fourth tube inner diameter . nozzle 140 also includes a fifth tube 170 having a fifth outer diameter , a fifth inner diameter , opposing fifth tube ends , where fifth tube 170 is located within third tube 146 such that the fifth outer diameter is smaller than the third inner diameter , thereby forming a third annular passage 171 between the third tube and the fifth tube . fifth tube 170 has a means for engagement at a fifth tube end and contains a fourth annular passage 172 within the fifth inner diameter . referring now to fig1 , fixed to a fourth tube end opposite injector assembly 149 is a cap assembly 156 having a sixth outer diameter and a sixth inner diameter with the sixth inner diameter substantially the same as the fourth inner diameter . third tube 146 and fifth tube 170 extend from upstream of base 141 to proximate cap assembly 156 . the second alternate embodiment of the present invention , nozzle 140 , preferably operates in a dual stage dual mode combustor . the purpose of the nozzle is to provide a flame source for a secondary combustion chamber and to assist in transferring a flame from a primary combustion chamber to a secondary combustion chamber . this type of combustion system can utilize different fuels such as gas or a liquid fuel such as oil . the fuel selection will determine which circuits of nozzle 140 are flowing fuel or compressed air to purge the nozzle . when the present invention is being operated on natural gas , compressed air initially flows through first passage 145 and is injected into the surrounding airstream through second injector holes 154 while gas flows through second passage 147 , slots 151 , and is injected into the surrounding airstream through first injector holes 152 . then , in an effort to maintain machine load while transferring the flame from the primary combustion chamber to the secondary combustion chamber , first passage 145 and second injector holes 154 flow a fuel , such as natural gas , instead of air , to provide an enriched fuel flow to the secondary combustion chamber . once the flame is extinguished in the primary combustion chamber and securely established in secondary combustion chamber , fuel flow through first passage 145 and second set of injector holes 154 of nozzle 140 is slowly cut - off and replaced with compressed air , as during initial operation . during this entire operation , compressed air flows through third passage 171 and fourth passage 172 to ensure that no fuel particles recirculate into the premix nozzle 140 . when conditions are present that require nozzle 140 to be operated on liquid fuel , a liquid fuel such as oil passes through fourth passage 172 of fifth tube 170 and injects fuel into the secondary combustion chamber . mixing with the liquid fuel in the secondary combustion chamber , at load conditions above 50 %, is a spray of water that is also injected by nozzle 140 . water flows coaxial to fifth tube 170 through third tube 146 via third annular passage 171 , and exits nozzle 140 in a swirling pattern imparted by swirler 190 , which is positioned in third annular passage 171 . first annular passage 145 , second annular passage 147 , slots 151 , and first and second sets of injector holes 152 and 154 , which flowed either natural gas or compressed air in the gas mode operation each flow compressed air during liquid operation to purge the nozzle passages such that liquid fuel does not recirculate into the gas or air passages . prior embodiments of the present invention included second injector holes in the fins of the injector assembly . it has been determined through extensive analysis that the flow exiting from the second injector holes , when placed in the fins , penetrates far enough into the main flow of compressed air passing between the fins to block part of the compressed air from flowing in between the fins . as a result , less compressed air mixes with the fuel injected from first injector holes thereby resulting in increased fuel / air ratio , especially when second injector holes are flowing fuel . while an increased fuel supply provides a more stable flame , emissions tend to be higher . analysis results indicate that this blockage is on the order of approximately 10 % of the total flow area . further compounding the blockage issue in the previous embodiments is the flow disturbance created by sharp corners along the upstream side of fins 50 . in the second alternate embodiment , fins 150 have rounded edges along the upstream side , creating a smoother flow path along the fin outer surfaces . by placing second injector holes 154 in injector assembly 149 adjacent first outer tube 143 , thereby eliminating a portion of the fins , the overall geometry of injector assembly 149 is simplified . each of the improvements outlined herein leads to improved fuel nozzle performance by reducing the amount of flow blockage between adjacent fins while simplifying the configuration for manufacturing purposes . while the invention has been described in what is known as presently the preferred embodiment , it is to be understood that one skilled in the art of combustion and gas turbine technology would recognize that the invention is not to be limited to the disclosed embodiment but , on the contrary , is intended to cover various modifications and equivalent arrangements within the scope of the following claims . | 5 |
turning now to the drawings , in fig1 a fuel injection pump 1 is shown schematically , which supplies fuel over lines 2 to an internal combustion engine 3 . an exhaust recirculation line 6 leads from the exhaust manifold 5 of the engine , which is illustrated only schematically , to the intake manifold 7 downstream of the shaft 9 of a throttle valve 10 that is disposed in the intake manifold . the exit opening 11 of the exhaust recirculation line 6 is controllable with the portion of the throttle valve 10 located downstream of the shaft 9 and is closed thereby at full load . thus , the exhaust recirculation control apparatus so embodied by the position of the throttle valve , affects both the cross section of the exit opening 11 and the pressure drop at this opening . the shaft 9 of the throttle valve is mechanically connected via a rod 14 with an adjusting device 15 of a servomotor 16 . the adjusting device 15 is embodied as a piston and encloses a work chamber 19 within a closed cylinder 18 and is subjected on the opposite side to the force of a return spring 20 . the work chamber 19 communicates with a fuel container 24 via a relief line 22 , in which an adjustable throttle 23 is disposed . there is a further connection between the work chamber 19 and the chamber 28 of the fuel injection pump , which may also be called the suction chamber and is filled with fuel and under pressure , this connection being provided by a control line 26 , whose cross section is controllable by a valve 27 . the suction chamber 28 of the fuel injection pump is supplied with fuel with the aid of a fuel supply pump 30 via a fuel supply line 31 from the fuel container 24 . a pressure regulating valve 32 is switched parallel to the fuel supply pump 30 . in this case , the fuel injection pump is a distributor - type injection pump of a known design , in which the effective supply stroke of the pump 35 is determined by the position of the control slide 34 which functions as the quantity adjustment device . in accordance with the structural principle of this distributor injection pump , the pump piston performs a reciprocating and simultaneously rotating movement , as is indicated by arrows . the adjustment of the control slide 34 occurs in a known manner by means of a lever 38 supported in the middle , which is connected at one end with the control slide 34 and on the other end is subjected to the force of at least one control spring 39 of adjustable initial tension . the governor sleeve 40 of a centrifugal governor 42 ( see fig2 ) engages the lever 38 in a known manner , against the force of this spring 39 . the control sleeve 40 is adjustable by means of flyweights 41 , which are driven to rotate in proportion to the rotational speed of the pump . depending on the initial tension of the control spring 39 , the governor sleeve 49 is displaced to a greater or lesser extent at a certain rpm , so that the control slide 34 as well assures a higher or lower position relative to the pump piston 35 . the position of the governor sleeve 40 as well as of the lever 38 and of the control slide 34 represent a standard for the set fuel supply quantity or for the load . as is indicated by broken lines in fig1 the cross section of the valve 27 can be adjusted in accordance with load depending on the position of the control slide 34 , the lever 38 or the governor sleeve 40 . such an adjustment can be performed either by mechanical or by electrical means without retroactive effect . an advantageous embodiment for generating a mechanical control variable which has no retroactive effect is shown in fig2 . there the carrier 43 , on which the governor sleeve 40 is displaceable by means of the flyweights 41 , has an axial bore 45 , which discharges into an external annular groove 46 that is provided in the carrier 43 . the annular surface of the external annular groove 46 thereby forms a first , stationary , passage opening 47 of the valve 27 . the axial bore 45 is part of the control line 26 . in the wall of the governor sleeve 40 , a second passage opening 48 , this one adjustable together with the governor sleeve 40 , is provided , which forms the other part of the valve 27 . through the displacement of the governor sleeve 40 , the second passage opening 48 can be made to overlap the first passage opening 47 , so that beyond a certain axial displacement of the governor sleeve 40 , a connection can be furnished from the suction chamber 28 to the work chamber 19 via the control line 26 . the apparatus described above may be conceived of as a comparison apparatus , wherein the first , stationary passage opening 47 ( that is , the annular groove 46 ) represents a comparison or threshold value as a standard for a certain minimum load or minimum fuel injection quantity . only when the second passage opening 48 is made to overlap the first passage opening 47 does this comparison apparatus produce a signal , in the form of a fuel flow which passes through both passage openings and this signal is conveyed to the work chamber 19 . a work pressure then builds up at the throttle 23 in the work chamber 19 , which displaces the adjusting device 15 and puts the throttle valve 10 into the closed position with respect to the exhaust recirculation line . the process described above may equally well be attained by mechanical - electrical means , such as by means of a pair of contacts , of which the first contact is stationary and characterizes a certain load and the other contact represents the actual load at that particular time . upon the attainment of the set minimum load , an electrical circuit is closed via the contacts , which actuates an adjusting device in such a manner that the recirculation of exhaust is precluded . the adjusting device may be an electromotor or a magnet . beyond a certain settable load , the recirculation of exhaust can be precluded in the manner described above , so that during full - load operation the combustion chambers of the engine can be supplied with the maximum possible charge . also , when there is an increased fuel delivery during starting , no recirculation of exhaust gases occurs , which would impair the starting of a cold engine . fig3 shows a different embodiment of the control apparatus for exhaust recirculation having an exhaust recirculation valve 49 , which is driven in the same manner as that revealed in the exemplary embodiment of fig1 and 2 . here , the discharge of the exhaust recirculation line 6 into the intake manifold 7 is shown . the entry opening 50 in the intake manifold 7 is here controlled by a valve plate 51 , the valve shaft 52 of which is slidably positioned within a valve guide 54 placed on the opposite side from the entry opening 50 and thus projects into the intake manifold 7 . on an end which protrudes out of the intake manifold 7 , the valve shaft 52 is connected with a holder plate 55 for an adjustment diaphragm 56 , which is the adjusting device of a hydraulic servomotor 58 . the work chamber 19 &# 39 ; is enclosed by the adjustment diaphragm 56 in the housing 59 of this servomotor 58 , and the control line 26 discharges into this work chamber 19 &# 39 ; and leads out of the relief line 22 containing the throttle 23 and into the fuel supply container 24 . the adjustment diaphragm 56 is urged via the holder plate 55 by a compression spring 60 in such a manner that it brings the valve shaft 52 and the valve plate 51 into a position which closes the entry opening 50 . the chamber between the adjustment diaphragm 56 and the intake manifold 7 containing the compression spring 60 is connected by a bore 62 with the intake manifold 7 for the purpose of pressure equalization . this embodiment of the exhaust recirculation control apparatus has the advantage that the closing movement of the valve plate 51 is reinforced by the pressure of the exhaust . the described embodiment of the hydraulic servomotor has the advantage that no fuel can leak into the intake manifold of the engine . this is substantially effected by the use of the adjustment diaphragm 56 , which tightly seals the work chamber 19 &# 39 ; independently of the position of the valve plate 51 . as soon as fuel is conveyed over the control line 26 into the work chamber 19 &# 39 ;, pressure builds up through the retroactive effect of the throttle 23 and displaces the adjustment diaphragm 56 against the force of the compression spring 60 and lifts the valve plate 51 from its seat at the entry opening . if the passage openings 47 and 48 are closed , then the work chamber 19 &# 39 ; is relieved via the throttle 23 and the relief line 22 , so that the valve plate 51 can move back into its closed position . the speed of adjustment on the part of the valve can be set with the aid of the throttle 23 . fig4 shows a supplementary embodiment to that concept shown in fig3 . here , an exhaust recirculation valve 49 is provided which is identical to that shown in fig3 . however , in deviation from the embodiment of fig3 a pressure switch 64 is provided which comprises a diaphragm 66 firmly held within the pressure switch housing 65 which tightly encloses a pressure chamber 67 in the housing 65 and separates it from a second chamber 69 , in which a compression spring 68 is disposed between the diaphragm 66 and the housing 65 . a second relief line 70 protrudes into the chamber 69 at right angles to the diaphragm 66 , which upon a deflection against the force of the compression spring 68 can close the entry opening 71 of the second relief line 70 . the chamber 69 is further connected with the second portion , which cannot be closed , of the second relief line 70 which leads to the fuel supply container 24 . in contrast , the pressure chamber 67 communicates via a branch line 73 with the control line 26 . the second relief line 70 , as may be inferred from fig1 leads from the suction chamber 28 to the fuel supply container 24 and this relief line , as shown in fig1 contains a scavenging throttle 74 at the point where the line exits from the suction chamber 28 . when the relief line 70 is not closed , this scavenging throttle 74 determines the quantity of scavenging fuel flowing out of the suction chamber 28 . this scavenging is used in a conventional manner for the purpose of thermal relief and for degassing of fuel injection pumps . the apparatus of fig4 functions in the following manner : when the passage openings 47 and 48 are made to overlap , that is , when fuel flows through the control line 26 to the work chamber 19 &# 39 ; of the hydraulic servomotor , this fuel also enters the pressure chamber 67 , in which the pressure which builds up at the throttle 23 is then established . under the effect of this pressure , the diaphragm 66 is deflected and closes the entry opening 71 of the second relief line 70 and thus prevents the scavenging fuel quantity from flowing out through the relief line 70 to the fuel supply container 24 . that is , in this embodiment of the invention the scavenging quantity which is otherwise conventional is advantageously replaced by the fuel quantity which flows through the throttle 23 into the fuel supply container 24 and performs the same function . then , in an advantageous manner , a quantity of fuel which is constant , given a controlled internal pressure in the suction chamber 28 , flows out via one of the throttles 23 or 74 , so that the controlled pressure in the suction chamber , which serves the purpose of injection adjustment , for instance , is not disturbed upon the actuation of the exhaust recirculation apparatus . fig5 shows a further modification of the invention in which only a very small fuel discharge quantity is necessary for the actuation of the exhaust recirculation valve . in the same manner as in the foregoing exemplary embodiments , a control pressure is established in the control pressure line 26 by throttling the fuel flowing through the passage openings 47 and 48 , which now overlap , at the throttle 23 . these numerals are shown in fig1 and 2 . deviating from the exemplary embodiments of the invention shown in fig3 and 4 , a pressure switch generally denoted as 76 is provided which has a switching diaphragm 77 , which encloses a pressure chamber 79 in the housing 78 of the pressure switch 76 . the control line 26 discharges into this pressure chamber 79 . the switching diaphragm 77 is subjected to the force of a compression spring 80 from the side opposite the pressure chamber 79 . on this side there is also a contact 81 that is insulated with respect to the housing 78 ; the switching diaphragm 77 is made to touch this contact 81 when it is deflected against the force of the spring 80 . the switching diaphragm is electrically conductive and connected with one pole of a voltage source 83 , while the other pole of the voltage source leads to the contact 81 . furthermore , the magnetic coil of a magnetic valve 84 is included in the connecting line between the voltage source 83 and the contact 81 . the magnetic valve is located in a supply line 86 for the adjustment medium which leads from a pressure source 87 into the work chamber 19 &# 34 ; of a pressure - actuated servomotor 88 . this servomotor 88 is equipped , as a diaphragm - type servomotor , with an adjustment diaphragm 89 tightly enclosing the work chamber 19 &# 34 ; and thus functions as the actuation device for the exhaust gas recirculation valve 49 &# 34 ;. in a development which varies from the foregoing exemplary embodiments of this invention , the servomotor is adapted in such a way that it is actuatable by underpressure . to this end , a compression spring 90 is disposed in the work chamber 19 &# 34 ; which urges the adjustment diaphragm 89 into a displacement direction which closes the exhaust recirculation valve 49 &# 39 ;. here , as well , in order to relieve the work chamber 19 &# 34 ;, a relief line 91 containing a throttle 92 is provided . the underpressure source may be realized in the form of an underpressure supply container or in the form of a suction pump 93 . as soon as a pressure is established at the throttle 23 as a result of inflowing fuel -- which pressure also becomes effective in the pressure chamber 79 -- the switching diaphragm 77 is arranged to touch the contact 81 and the electrical circuit is then closed . the magnetic valve 84 thereby becomes attractive and establishes the connection between the pressure source 87 and the work chamber 19 &# 34 ;. as a result of the underpressure being established there , the adjustment diaphragm 89 is deflected against the force of the spring 90 and the exhaust recirculation valve 49 &# 39 ; is opened . if the pressure in the control line 26 drops , then the electrical circuit is opened and the supply line 86 for the adjustment medium is closed by the magnetic valve 84 . the exhaust recirculation valve 49 &# 39 ; accordingly closes after pressure equalization via the throttle 92 . as a result of this embodiment of the invention , only a very small quantity of fuel is required for actuating the pressure switch 76 , so that the pressure in the suction chamber 28 of the fuel injection pump is not substantially disturbed in the event of the necessary actuation of the exhaust recirculation apparatus . in an advantageous manner , a pressure source which is already available in the vehicle driven by the internal combustion engine can be used for the actuation of the exhaust recirculation apparatus . this may be , for example , the use of the intake manifold underpressure . however , it is also possible , given the availability of a compressed - air brake system , to use the brake supply pressure for the actuation of an appropriately modified exhaust recirculation valve . fig6 shows a modified form of still another embodiment of this invention in which , again , the quantity of fuel flowing out of the suction chamber of the injection pump is used as the control means for a switching valve when the passage openings 47 and 48 ( see fig2 ) overlap ; as a result , an auxiliary energy source can be connected with a servomotor for the exhaust recirculation valve . the form of embodiment shown functions in the same manner as the embodiment of fig5 with underpressure as the adjustment medium . to this extent , the two embodiments are quite similar . however , instead of a magnetic valve 84 , a pressure switch 95 is used here in the supply line 86 for the adjustment medium and the pressure switch 95 has an adjustment diaphragm 97 tightly enclosing a pressure chamber 96 in the housing . on the other side , the adjustment diaphragm 97 encloses a fuel - filled chamber 100 , in which a compression spring 98 engaging the adjustment diaphragm 97 is disposed and into which one portion of the supply line 86 for the adjustment medium discharges in the form of a nozzle in such a fashion that its discharge portion 99 lies opposite the adjustment diaphragm 97 and acts as the valve closing element therefor . the supply line 86 for the adjustment medium leads , in a manner preventing its closure , from the chamber 100 to the pressure source 87 . the pressure chamber 96 is connected with the control pressure line 26 , so that upon an increase in pressure in the control pressure line 26 the adjustment diaphragm 97 is deflected against the force of the spring 98 and the passage opening 99 of the supply line 86 for the adjustment medium is closed . then , as in the preceding example , after a pressure relief of the work chamber 19 &# 34 ;, the exhaust recirculation valve 49 &# 39 ; is closed . in this exemplary embodiment , in an advantageous manner , no electrical switching means are necessary . also , only a small quantity of fuel needs to be withdrawn from the interior of the fuel injection pump for control purposes in order to effect the rapid actuation of the exhaust recirculation apparatus , so that the controlled pressure in the suction chamber of the fuel injection pump is not disturbed . this pressure acts , for example , to actuate the injection timing adjustment . in an advantageous manner , and in contrast to the embodiment of fig1 - 4 , the fuel in this embodiment of the invention is kept away from the exhaust recirculation valve , which heats up severely during operation . the foregoing relates to preferred exemplary embodiments of the invention , it being understood that other embodiments and variants thereof are possible within the spirit and scope of the invention , the latter being defined by the appended claims . | 5 |
the present invention relates to multi - system read / write data sharing in a clustered system arrangement . the following description is presented to enable one of ordinary skill in the art to make and use the invention and is provided in the context of a patent application and its requirements . various modifications to the preferred embodiment and the generic principles and features described herein will be readily apparent to those skilled in the art . it should be appreciated that the following discussion refers to an s / 390 parallel sysplex arrangement . this is meant as illustrative of a preferred embodiment , the features of which are applicable in other substantially equivalent clustering type arrangements of multiple systems that utilize operations of a byte file system . thus , the following discussion is meant as illustrative and not restrictive of the aspects of the present invention . in order to achieve a shared read / write byte file system in a multi - system clustered environment , the same overall file hierarchy must be seen by all the systems . fig2 illustrates an example of a multi - system mount table 30 in accordance with the present invention that acts to hide multi - system complexity from the applications and system administration of the sysplex . referring to fig2 for multiple systems records , e . g ., sy 1 , sy 2 , to sy 32 , the mount table 30 suitably includes a mount point indicator 32 for each record , and an indicator 34 of the file system to which the record belongs . also included are an owner indicator 36 , a file system type 38 , e . g ., hfs , nfs ( network file system ), a status indicator 40 for the record , e . g ., mounting or unmounting , and a mode indicator 42 , e . g ., read - only ( r / o ) or read - write ( r / w ). through the use of the multi - system mount table , an application or an application instance sees the same file hierarchy independent of which particular system the application executes . the handling of modified file metadata and file data is another important aspect in achieving a read / write shared byte file system for a sysplex arrangement . the present invention utilizes advantageous features of traditional hfs deferred write of modified metadata and file data , while enhancing the traditional approach for operation in a sysplex environment . traditional hfs maintains file system metadata in an index structure on dasd . a shadow write technique is normally used for updating the index , which provides atomic application of an entire set of metadata changes . the atomic shadow write technique insures consistency of the dasd image of all metadata and consistency on dasd between metadata and file data for all files within a byte file system across a system failure that occurs while updating the metadata . the format of metadata stored in dasd is organized and partitioned within the index space to achieve indexed look - up and atomic dasd update through the shared write technique . traditional hfs further caches the metadata of directories , symbolic links , and files in local memory , and also caches file data . the in - memory / cache format of the metadata is organized for fast look - up and use of named items , e . g . directory / link / file entries . hfs applies changes to the in - memory metadata structure without immediately reflecting the changes on dasd . deferring the dasd write of metadata changes , as well as file data changes , is a fundamental method used to achieve file system performance requirements . in accordance with the present invention , the capability of atomic update of file system metadata is maintained through the use of a single system in the sysplex acting as the manager of modified metadata for any single file system . preferably , the management function is spread around the multiple systems within the sysplex at the granularity of file system . thus , each system may be the metadata manager for a set of file systems . the management role for a file system may then be transferred from one system to another system . therefore , when one system in the sysplex fails , other surviving systems take over metadata management of the file systems that were being managed by the failed system . in order to achieve such management of metadata in the sysplex , the present invention utilizes a message sending , i . e ., function sending , protocol to access metadata that is managed by another system . in general terms , when a system obtains metadata for a file from another system that manages the metadata , a global serialization token is assigned and returned along with the metadata . the global serialization token permits the receiving system to cache and reuse the metadata locally as long as the token has not been revoked . a more detailed explanation of the global token utilization in accordance with the present invention is presented hereinbelow with reference to fig4 . the metadata management with a global token utilizes a form of client / server protocol . the system that manages the modified metadata is called the server . other systems that access the metadata while it is being managed by a different system are called clients . the client / server roles apply at file system granularity . thus , for example , a single os / 390 system capably acts as the server , i . e ., metadata manager , for a set of hfs file systems , and at the same time , acts as one of a set of clients accessing metadata of file systems managed by other os / 390 systems . fig3 a illustrates a block diagram representation of a client / server system arrangement for metadata access with a process for client / server protocol shown in the block flow diagram of fig3 b in accordance with the present invention . on first reference to a file , e . g ., file a , on a system that is not the metadata manager for that file , that system , i . e ., the client system , 200 sends a message request to the system , i . e ., server system 202 , that does act as the metadata manager for that file . the client system 200 requests permission to reference the file ( step 50 ). the server system 202 obtains a global token on the file on behalf of the client system 200 ( step 52 ). the global token insures that the client system 200 receives the most current and consistent metadata for the file . the server 202 thus sends a response message to the client system 200 that includes the global token and the metadata of the file ( step 54 ). the file metadata preferably includes a page map , which the client system 200 uses to access the file data from dasd 204 . the client system 200 creates an in - memory structure to represent the file and places the metadata in the structure . the structure is connected to an in - memory file look - up structure , which allows future reference / use of the file by the client system 200 and validity checking of the file global token without having to communicate with the server system 202 . the global token technique acts as the mechanism for performing cross - system serialization of file system items . global tokens are assigned and managed by the server system that manages the metadata of the file system in which the corresponding file system items exist . the server uses local single - system serialization methods to maintain the state of the global tokens . two types of global tokens , shared and exclusive , are used in a preferred embodiment . multiple clients may concurrently hold shared global tokens on the same item , while only one client system at a time may hold an exclusive global token . the shared global token allows the client system to read , use , and locally cache the file . while an exclusive global token is held , no client may hold a shared global token on the file . the exclusive token gives the holding system permission to modify the corresponding file . as shown in the example of fig4 a client system 200 ′ holds a shared global token on file a and an exclusive global token on file b . a second client system 200 ″ also holds a shared global token on file a . server system 202 , acting as the manager for file a and file b , tracks the global token status for client systems accessing the files , and thus , marks file a as having shared global token status for client systems 200 ′ and 200 ″ and marks file b as having an exclusive global token status for client system 220 . two cases of incompatible global tokens for a file system item are possible . in a first case , one or more shared global tokens exist for the file , when a request for an exclusive global token is processed . in a second case , an exclusive global token exists for the file and a request for a share or exclusive global token is processed . thus , when reference to the file on a client system 200 includes modification of file data , the client system 200 first requests permission for write access from the server 202 that owns the file &# 39 ; s metadata . the client system 200 therefore sends a message to the server 202 requesting write access to the file . when the server 202 determines that assigning a new global token , i . e ., exclusive token , for a file would be incompatible with existing global token ( s ) for the file , the server 202 revokes the existing global token ( s ). a revoke token message is sent to the client ( s ) that hold the existing global token ( s ). the client system ( s ) process the revoke message using local serialization to synchronize the revoke with any local access / use of the file corresponding to the token . the client system ( s ) then mark the in - memory structure that represents the file to show that there is no valid global token for the file . the client system ( s ) send a message to the server 202 indicating completion of the revoke processing . when the server 202 receives a revoke completion message for each revoke message it sent , the server 202 assigns or grants a new token , i . e ., an exclusive token , to the requestor client system , so that the requestor client system can obtain write access to the file . this process results in assigning an exclusive global token on the file to the client that made the request to write . the server assigns new data pages , i . e ., dasd space , for use by the writing client , and sends a response message communicating the new data pages to the client . the client updates its in - memory structure for the file and may now write to the file . reading and writing to the file may continue as long as the file global token remains valid . the case of revoking an exclusive global token on a file includes the following additional processing by the client system and the server system . since an exclusive token gives the client system permission to modify the file and the file &# 39 ; s metadata , any modifications must now become visible to all systems . thus , when the server system sends the token revoke request to the client system with the exclusive token , that client system processes the revoke request by writing to dasd any data modifications it has made to the file . the client system then sends the revoke complete message to the server system . the revoke completion message also includes the client &# 39 ; s changes to the file &# 39 ; s metadata . the server system receives the revoke completion message and updates its in - memory changes of the file &# 39 ; s metadata to include the client &# 39 ; s changes . all systems now see the latest copy of the file and its metadata . in order to provide performance optimization of caching in local memory , writing of changed file data and changed metadata is deferred . by deferring the write to dasd , modifications can accumulate and be written to dasd more efficiently using chained dasd write operations . the deferred write technique is suitably used on both the client systems and the server systems of the sysplex . the exclusive global file token held by a client system enables a deferred write of changes to the file &# 39 ; s data and / or metadata . while the client system holds the exclusive global token , no other system is accessing the file or its metadata . deferring the writes does not introduce a file system consistency or integrity problem . when the client system completes its changes to a file and the file &# 39 ; s metadata , it places its in - memory structure that represents the file on a deferred write queue . periodically , a write daemon executes on the client system to process the deferred write queue , as is well understood by those skilled in the art . the daemon process writes to dasd any deferred write data for the file and then sends a copy of the file &# 39 ; s metadata changes to the server . thus , for files a , b , c , d , e , f , g , and h illustrated in the example of fig5 the write daemon of a client system 200 ′ writes the modified data 300 for file a and the modified data 304 for file b to dasd ( not shown ) and sends messages containing the modified metadata 302 for file a and the modified metadata 306 for file b to server 202 . similarly , the write daemon for client 200 ″ writes the modified data 308 for file c and the modified data 312 for file d to dasd ( not shown ) and sends messages containing the modified metadata 310 for file c and the modified metadata 314 for file d to server 202 . in addition to the periodic action of the write daemon , revocation of the exclusive global token on a file also triggers a client system to write to dasd any modified data for the file and copy the file &# 39 ; s metadata changes to the server . a server system also accumulates in - memory modified file data and modified metadata . similar to the clients , the server uses a deferred write queue and a write daemon to periodically write changes to dasd . thus , for fig5 the server 202 system &# 39 ; s write daemon writes the modified data 316 and metadata 318 for file e to dasd and the modified metadata 320 , 322 , and 324 for files f , g , and h to dasd . to improve the performance of look - up requests , each system in the sysplex maintains in its local memory a directory look - aside for each file system directory that it has recently referenced , as described with reference to fig6 . fig6 illustrates an example of a directory 400 for a client system / node , e . g ., vnode . included in the directory 400 is a directory look - up look - aside table 402 , e . g , vnode lla . the directory entries , e . g ., tmp , usr , datafile , of the lla table 402 suitably reference a memory address , e . g ., vnodeaddr , for each entry . when a client system / node performs its first look - up in a directory , it has no local information for the directory and therefore must function ship the request to the server . the server then returns metadata for the referenced directory . the metadata includes the directory fsp ( file security packet ). the client system then creates the in - memory structure to represent the directory and places the metadata in the structure . with the copy of the metadata and fsp , the authority of a requestor trying to access the directory can be readily checked , as is well understood by those skilled in the art . when metadata for a directory is changed , the server function suitably sends a copy of the updated metadata to all clients . the clients refresh the metadata in their in - memory structures that represent the directory . further , when the server removes an entry from a directory , the server preferably broadcasts a message to all clients telling them to invalidate any directory look - aside copy of the entry . in a preferred embodiment , global tokens are not used to serialize client directory look - asides . serialization is not utilized , since the information is only used for look - up and the look - up process realizes that entries are sparse and potentially stale . the look - up process naturally corrects itself . a look - up miss on the look - aside results in a function ship of the request to the server . the server has complete and current information and uses serialization to correctly complete the look - up . if the client look - up gets a hit on its look - aside and the file corresponding to the found name has actually been deleted , subsequent attempt to access the file provides the discovery that the file has been deleted . as previously mentioned , continued access by client systems to files managed by a server when the server fails is provided in the sysplex arrangement of the present invention . the continued access is accomplished by one of the surviving , non - failing systems taking over and becoming the server . file system granularity is used to achieve the acquisition of server function management in the surviving systems . since a server system acts as the server for many file systems , upon its failure , preferably one of the remaining systems becomes the server for some of the file systems , while other systems become the server for others of the file systems originally handled by the failing server . at the time of a server failure , the client systems of that server typically have locally cached metadata and file data for file systems that were managed by the failed server . the present invention attempts to preserve validity of that cached information by using the file attribute ctime ( change time ), as illustrated with reference to fig7 . the client copy of metadata for a file includes the ctime value . upon failure of a server , the client systems become aware of the failure . the client systems then participate in recovery actions that result in a new server for the file system . when the new server is established , the client systems make requests to the new server to send the clients a copy of the metadata as stored on dasd 204 for each file whose metadata they have locally cached . for the example of fig7 client 200 ′ requests metadata for files a , b , and c , while client 200 ″ requests metadata for files a , b , and d . when the client systems receive the metadata , the client systems compare the ctime of the metadata received with the ctime in their locally cached copy . if the times are equal , the cached metadata and any cached data for that file remains valid . the new server preferably assigns a new global token for the file and returns the token to the client . the global token permits the client system to continue using the file with the failure transparent to applications accessing the file . if the ctimes are not equal , e . g ., as for files c and d of fig7 the newer metadata is used to update the cached metadata to ensure that file consistency is maintained . through the present invention , the ability to directly read and write a file from multiple systems is effectively achieved . the shared dasd functions that permit access from multiple systems through the described software protocols / techniques provide the serialization for maintaining full integrity of the file systems across the multi - system data sharing environment . although the present invention has been described in accordance with the embodiments shown , one of ordinary skill in the art will recognize that there could be variations to the embodiment and those variations would be within the spirit and scope of the present invention . accordingly , many modifications may be made by one of ordinary skill without departing from the spirit and scope of the present invention , the scope of which is defined by the following claims . | 8 |
the basestock used in the lubricating oil may be selected from any of the synthetic or natural oils used as crankcase lubricating oils for spark - ignited and compression - ignited engines . the lubricating oil base stock conveniently has a viscosity of about 2 . 5 to about 12 mm 2 / s and preferably about 2 . 5 to about 9 mm 2 / s at 100 ° c . mixtures of synthetic and natural base oils may be used if desired . the ashless dispersant comprises an oil soluble polymeric hydrocarbon backbone having functional groups that are capable of associating with particles to be dispersed . typically , the dispersants comprise amine , alcohol , amide , or ester polar moieties attached to the polymer backbone often via a bridging group . the ashless dispersant may be , for example , selected from oil soluble salts , esters , amino - esters , amides , imides , and oxazolines of long chain hydrocarbon substituted mono and dicarboxylic acids or their anhydrides ; thiocarboxylate derivatives of long chain hydrocarbons ; long chain aliphatic hydrocarbons having a polyamine attached directly thereto ; and mannich condensation products formed by condensing a long chain substituted phenol with formaldehyde and polyalkylene polyamine . the oil soluble polymeric hydrocarbon backbone used in an ashless dispersants in the detergent inhibitor package is selected from ethylene alpha - olefin ( eao ) copolymers and alpha - olefin homo - and copolymers such as may be prepared using the new metallocene catalyst chemistry , which may have a high degree ( e . g ., & gt ; 30 %) of terminal vinylidene unsaturation . the term alpha - olefin is used herein to refer to an olefin of the formula : ## str1 ## wherein r &# 39 ; is preferably a c 1 - c 18 alkyl group . the requirement for terminal vinylidene unsaturation refers to the presence in the polymer of the following structure : ## str2 ## wherein poly is the polymer chain and r is typically a c 1 - c 18 alkyl group , typically methyl or ethyl . preferably the polymers will have at least 50 %, and most preferably at least 60 %, of the polymer chains with terminal vinylidene unsaturation . as indicated in wo - a - 94 / 19426 , ethylene / 1 - butene copolymers typically have vinyl groups terminating no more than about 10 percent of the chains , and internal mono - unsaturation in the balance of the chains . the nature of the unsaturation may be determined by ftir spectroscopic analysis , titration or c - 13 nmr . the oil soluble polymeric hydrocarbon backbone may be a homopolymer ( e . g ., polypropylene ) or a copolymer of two or more of such olefins ( e . g ., copolymers of ethylene and an alpha - olefin such as propylene or butylene , or copolymers of two different alpha - olefins ). other copolymers include those in which a minor molar amount of the copolymer monomers , e . g ., 1 to 10 mole %, is an α , ω - diene , such as a c 3 to c 22 non - conjugated diolefin ( e . g ., a copolymer of isobutylene and butadiene , or a copolymer of ethylene , propylene and 1 , 4 - hexadiene or 5 - ethylidene - 2 - norbornene ). atactic propylene oligomer typically having m n of from 700 to 5000 may also be used , as described in ep - a - 490454 , as well as heteropolymers such as polyepoxides . one preferred class of olefin polymers is polybutenes and specifically poly - n - butenes , such as may be prepared by polymerization of a c 4 refinery stream . other preferred classes of olefin polymers are eao copolymers that preferably contain 1 to 50 mole % ethylene , and more preferably 5 to 48 mole % ethylene . such polymers may contain more than one alpha - olefin and may contain one or more c 3 to c 22 diolefins . also usable are mixtures of eao &# 39 ; s of varying ethylene content . different polymer types , e . g ., eao , may also be mixed or blended , as well as polymers differing in m n ; components derived from these also may be mixed or blended . the olefin polymers and copolymers preferably have an m n of from 700 to 5000 , more preferably 2000 to 5000 . polymer molecular weight , specifically m n , can be determined by various known techniques . one convenient method is gel permeation chromatography ( gpc ), which additionally provides molecular weight distribution information ( see w . w . yau , j . j . kirkland and d . d . bly , &# 34 ; modern size exclusion liquid chromatography &# 34 ;, john wiley and sons , new york , 1979 ). another useful method , particularly for lower molecular weight polymers , is vapor pressure osmometry ( see , e . g ., astm d3592 ). the degree of polymerisation d p of a polymer is : ## equ1 ## and thus for the copolymers of two monomers d p may be calculated as follows : ## equ2 ## in a prefered aspect of the invention the degree of polymerisation of copolymers used in the invention is at least 45 , typically from 50 to 165 , more preferably 55 to 140 . in a prefered aspect of the invention the olefin polymers and copolymers may be prepared by various catalytic polymerization processes using metallocene catalysts which are , for example , bulky ligand transition metal compounds of the formula : where l is a bulky ligand ; a is a leaving group , m is a transition metal , and m and n are such that the total ligand valency corresponds to the transition metal valency . preferably the catalyst is four co - ordinate such that the compound is ionizable to a 1 + valency state . the ligands l and a may be bridged to each other , and if two ligands a and / or l are present , they may be bridged . the metallocene compound may be a full sandwich compound having two or more ligands l which may be cyclopentadienyl ligands or cyclopentadienyl derived ligands , or they may be half sandwich compounds having one such ligand l . the ligand may be mono - or polynuclear or any other ligand capable of η - 5 bonding to the transition metal . one or more of the ligands may π - bond to the transition metal atom , which may be a group 4 , 5 or 6 transition metal and / or a lanthanide or actinide transition metal , with zirconium , titanium and hafnium being particularly preferred . the ligands may be substituted or unsubstituted , and mono -, di -, tri , tetra - and penta - substitution of the cyclopentadienyl ring is possible . optionally the substituent ( s ) may act as one or more bridges between the ligands and / or leaving groups and / or transition metal . such bridges typically comprise one or more of a carbon , germanium , silicon , phosphorus or nitrogen atom - containing radical , and preferably the bridge places a one atom link between the entities being bridged , although that atom may and often does carry other substituents . the metallocene may also contain a further displaceable ligand , preferably displaced by a cocatalyst -- a leaving group -- that is usually selected from a wide variety of hydrocarbyl groups and halogens . such polymerizations , catalysts , and cocatalysts or activators are described , for example , in u . s . pat . nos . 4 , 530 , 914 , 4 , 665 , 208 , 4 , 808 , 561 , 4 , 871 , 705 , 4 , 897 , 455 , 4 , 937 , 299 , 4 , 952 , 716 , 5 , 017 , 714 , 5 , 055 , 438 , 5 , 057 , 475 , 5 , 064 , 802 , 5 , 096 , 867 , 5 , 120 , 867 , 5 , 124 , 418 , 5 , 153 , 157 , 5 , 198 , 401 , 5 , 227 , 440 , 5 , 241 , 025 ; ep - a - 129368 , 277003 , 277004 , 420436 , 520732 ; and wo - a - 91 / 04257 , 92 / 00333 , 93 / 08199 , 93 / 08221 , 94 / 07928 and 94 / 13715 . the oil soluble polymeric hydrocarbon backbone may be functionalized to incorporate a functional group into the backbone of the polymer , or as one or more groups pendant from the polymer backbone . the functional group typically will be polar and contain one or more hetero atoms such as p , o , s , n , halogen , or boron . it can be attached to a saturated hydrocarbon part of the oil soluble polymeric hydrocarbon backbone via substitution reactions or to an olefinic portion via addition or cycloaddition reactions . alternatively , the functional group can be incorporated into the polymer in conjunction with oxidation or cleavage of the polymer chain end ( e . g ., as in ozonolysis ). useful functionalization reactions include : halogenation of the polymer at an olefinic bond and subsequent reaction of the halogenated polymer with an ethylenically unsaturated functional compound ( e . g ., maleation where the polymer is reacted with maleic acid or anhydride ); reaction of the polymer with an unsaturated functional compound by the &# 34 ; ene &# 34 ; reaction absent halogenation ; reaction of the polymer with at least one phenol group ( this permits derivatization in a mannich base - type condensation ); reaction of the polymer at a point of unsaturation with carbon monoxide using a koch - type reaction to introduce a carbonyl group in an iso or neo position ; reaction of the polymer with the functionalizing compound by free radical addition using a free radical catalyst ; reaction with a thiocarboxylic acid derivative ; and reaction of the polymer by air oxidation methods , epoxidation , chloroamination , or ozonolysis . the functionalized oil soluble polymeric hydrocarbon backbone is then further derivatized with a nucleophilic reactant such as an amine , amino - alcohol , alcohol , metal compound or mixture thereof to form a corresponding derivative . useful amine compounds for derivatizing functionalized polymers comprise at least one amine and can comprise one or more additional amine or other reactive or polar groups . these amines may be hydrocarbyl amines or may be predominantly hydrocarbyl amines in which the hydrocarbyl group includes other groups , e . g ., hydroxy groups , alkoxy groups , amide groups , nitriles , imidazoline groups , and the like . particularly useful amine compounds include mono - and polyamines , e . g . polyalkylene and polyoxyalkylene polyamines of about 2 to 60 , conveniently 2 to 40 ( e . g ., 3 to 20 ), total carbon atoms and about 1 to 12 , conveniently 3 to 12 , and preferably 3 to 9 nitrogen atoms in the molecule . mixtures of amine compounds may advantageously be used such as those prepared by reaction of alkylene dihalide with ammonia . preferred amines are aliphatic saturated amines , including , e . g ., 1 , 2 - diaminoethane ; 1 , 3 - diaminopropane ; 1 , 4 - diethylene ; 1 , 6 - diaminohexane ; polyethylene amines such as diethylene triamine ; triethylene tetramine ; tetraethylene pentamine ; and polypropyleneamines such as 1 , 2 - propylene diamine ; and di -( 1 , 2 - propylene ) traimine . other useful amine compounds include : alicyclic diamines such as 1 , 4 - di ( aminomethyl ) cyclohexane , and heterocyclic nitrogen compounds such as imidazolines . a particularly useful class of amines are the polyamido and related amido - amines as disclosed in u . s . pat nos . 4 , 857 , 217 ; 4 , 956 , 107 ; 4 , 963 , 275 ; and 5 , 229 , 022 . also usable is tris ( hydroxymethyl ) amino methane ( tham ) as described in u . s . pat nos . 4 , 102 , 798 ; 4 , 113 , 639 ; 4 , 116 , 876 ; and uk 989 , 409 . dendrimers , star - like amines , and comb - structure amines may also be used . similarly , one may use the condensed amines disclosed in u . s . pat . nos . 5 , 053 , 152 . the functionalized polymer is reacted with the amine compound according to conventional techniques as described in ep - a 208 , 560 ; u . s . pat . no . 4 , 234 , 435 and u . s . pat . no . 5 , 229 , 022 . the functionalized oil soluble polymeric hydrocarbon backbones also may be derivatized with hydroxy compounds such as monohydric and polyhydric alcohols or with aromatic compounds such as phenols and naphthols . polyhydric alcohols are preferred , e . g ., alkylene glycols in which the alkylene radical contains from 2 to 8 carbon atoms . other useful polyhydric alcohols include glycerol , mono - oleate of glycerol , monostearate of glycerol , monomethyl ether of glycerol , pentaerythritol , dipentaerythritol , and mixtures thereof . an ester dispersant may also be derived from unsaturated alcohols such as allyl alcohol , cinnamyl alcohol , propargyl alcohol , 1 - cyclohexane - 3 - ol , and oleyl alcohol . still other classes of the alcohols capable of yielding ashless dispersants comprise the ether - alcohols and including , for example , the oxy - alkylene , oxy - arylene . they are exemplified by ether - alcohols having up to 150 oxy - alkylene radicals in which the alkylene radical contains from 1 to 8 carbon atoms . the ester dispersants may be di - esters of succinic acids or acidic esters , i . e ., partially esterified succinic acids ; as well as partially esterified polyhydric alcohols or phenols , i . e ., esters having free alcohols or phenolic hydroxyl radicals . an ester dispersant may be prepared by one of several known methods as illustrated , for example , in u . s . pat . no . 3 , 381 , 022 . a preferred group of ashless dispersants includes those substituted with succinic anhydride groups and reacted with polyethylene amines ( e . g ., tetraethylene pentamine ), aminoalcohols such as trismethylolaminomethane and optionally additional reactants such as alcohols and reactive metals e . g ., pentaerythritol , and combinations thereof . also useful are dispersants wherein a polyamine is attached directly to the backbone by the methods shown in u . s . pat . no . 3 , 275 , 554 and 3 , 565 , 804 where a halogen group on a halogenated hydrocarbon is displaced with various alkylene polyamines . another class of ashless dispersants comprises mannich base condensation products . generally , these are prepared by condensing about one mole of an alkyl - substituted mono - or polyhydroxy benzene with about 1 to 2 . 5 moles of carbonyl compounds ( e . g ., formaldehyde and paraformaldehyde ) and about 0 . 5 to 2 moles polyalkylene polyamine as disclosed , for example , in u . s . pat . no . 3 , 442 , 808 . such mannich condensation products may include a polymer product of a metallocene cataylsed polymerisation as a substituent on the benzene group or may be reacted with a compound containing such a polymer substituted on a succinic anhydride , in a mannersimilar to that shown in u . s . pat . no . 3 , 442 , 808 . examples of functionalized and / or derivatized olefin polymers based on polymers synthesized using metallocene catalyst systems are described in publications identified above . the dispersant can be further post - treated by a variety of conventional post treatments such as boration , as generally taught in u . s . pat . nos . 3 , 087 , 936 and 3 , 254 , 025 . this is readily accomplished by treating an acyl nitrogen - containing dispersant with a boron compound selected from the group consisting of boron oxide , boron halides , boron acids and esters of boron acids , in an amount to provide from about 0 . 1 atomic proportion of boron for each mole of the acylated nitrogen composition to about 20 atomic proportions of boron for each atomic proportion of nitrogen of the acylated nitrogen composition . usefully the dispersants contain from about 0 . 05 to 2 . 0 wt . %, e . g . 0 . 05 to 0 . 7 wt . % boron based on the total weight of the borated acyl nitrogen compound . the boron , which appears be in the product as dehydrated boric acid polymers ( primarily ( hbo 2 ) 3 ), is believed to attach to the dispersant imides and diimides as amine salts e . g ., the metaborate salt of the diimide . boration is readily carried out by adding from about 0 . 05 to 4 , e . g ., 1 to 3 wt . % ( based on the weight of acyl nitrogen compound ) of a boron compound , preferably boric acid , usually as a slurry , to the acyl nitrogen compound and heating with stirring at from 135 ° to 190 ° c ., e . g ., 140 °- 170 ° c ., for from 1 to 5 hours followed by nitrogen stripping . alternatively , the boron treatment can be carried out by adding boric acid to a hot reaction mixture of the dicarboxylic acid material and amine while removing water . additional additives are typically incorporated into the compositions of the present invention . examples of such additives are metal or ash - containing detergents , antioxidants , anti - wear agents , friction modifiers , rust inhibitors , anti - foaming agents , demulsifiers , and pour point depressants . metal - containing or ash - forming detergents function both as detergents to reduce or remove deposits and as acid neutralizers or rust inhibitors , thereby reducing wear and corrosion and extending engine life . detergents generally comprise a polar head with a long hydrophobic tail , with the polar head comprising a metal salt of an acidic organic compound . the salts may contain a substantially stoichiometric amount of the metal in which case they are usually described as normal or neutral salts , and would typically have a total base number or tbn ( as may be measured by astm d2896 ) of from 0 to 80 . it is possible to include large amounts of a metal base by reacting an excess of a metal compound such as an oxide or hydroxide with an acidic gas such as carbon dioxide . the resulting overbased detergent comprises neutralised detergent as the outer layer of a metal base ( e . g . carbonate ) micelle . such overbased detergents may have a tbn of 150 or greater , and typically of from 250 to 450 or more . detergents that may be used include oil - soluble neutral and overbased sulfonates , phenates , sulfurized phenates , thiophosphonates , salicylates , and naphthenates and other oil - soluble carboxylates of a metal , particularly the alkali or alkaline earth metals , e . g ., sodium , potassium , lithium , calcium , and magnesium . the most commonly used metals are calcium and magnesium , which may both be present in detergents used in a lubricant , and mixtures of calcium and / or magnesium with sodium . particularly convenient metal detergents are neutral and overbased calcium sulfonates having tbn of from 20 to 450 tbn , and neutral and overbased calcium phenates and sulfurized phenates having tbn of from 50 to 450 . sulfonates may be prepared from sulfonic acids which are typically obtained by the sulfonation of alkyl substituted aromatic hydrocarbons such as those obtained from the fractionation of petroleum or by the alkylation of aromatic hydrocarbons . examples included those obtained by alkylating benzene , toluene , xylene , naphthalene , diphenyl or their halogen derivatives such as chlorobenzene , chlorotoluene and chloronaphthalene . the alkylation may be carried out in the presence of a catalyst with alkylating agents having from about 3 to more than 70 carbon atoms . the alkaryl sulfonates usually contain from about 9 to about 80 or more carbon atoms , preferably from about 16 to about 60 carbon atoms per alkyl substituted aromatic moiety . the oil soluble sulfonates or alkaryl sulfonic acids may be neutralized with oxides , hydroxides , alkoxides , carbonates , carboxylate , sulfides , hydrosulfides , nitrates , borates and ethers of the metal . the amount of metal compound is chosen having regard to the desired tbn of the final product but typically ranges from about 100 to 220 wt % ( preferably at least 125 wt %) of that stoichiometrically required . metal salts of phenols and sulfurised phenols are prepared by reaction with an appropriate metal compound such as an oxide or hydroxide and neutral or overbased products may be obtained by methods well known in the art . sulfurised phenols may be prepared by reacting a phenol with sulfur or a sufur containing compound such as hydrogen sulfide , sulfur monohalide or sulfur dihalide , to form products which are generally mixtures of compounds in which 2 or more phenols are bridged by sulfur containing bridges . dihydrocarbyl dithiophosphate metal salts are frequently used as anti - wear and antioxidant agents . the metal may be an alkali or alkaline earth metal , or aluminum , lead , tin , molybdenum , manganese , nickel or copper . the zinc salts are most commonly used in lubricating oil in amounts of 0 . 1 to 10 , preferably 0 . 2 to 2 wt . %, based upon the total weight of the lubricating oil composition . they may be prepared in accordance with known techniques by first forming a dihydrocarbyl dithiophosphoric acid ( ddpa ), usually by reaction of one or more alcohol or a phenol with p 2 s 5 and then neutralizing the formed ddpa with a zinc compound . for example , a dithiophosphoric acid may be made by reacting mixtures of primary and secondary alcohols . alternatively , multiple dithiophosphoric acids can be prepared where the hydrocarbyl groups on one are entirely secondary in character and the hydrocarbyl groups on the others are entirely primary in character . to make the zinc salt any basic or neutral zinc compound could be used but the oxides , hydroxides and carbonates are most generally employed . commercial additives frequently contain an excess of zinc due to use of an excess of the basic zinc compound in the neutralization reaction . the preferred zinc dihydrocarbyl dithiophosphates are oil soluble salts of dihydrocarbyl dithiophosphoric acids and may be represented by the following formula : ## str3 ## wherein r and r &# 39 ; may be the same or different hydrocarbyl radicals containing from 1 to 18 , preferably 2 to 12 , carbon atoms and including radicals such as alkyl , alkenyl , aryl , arylalkyl , alkaryl and cycloaliphatic radicals . particularly preferred as r and r &# 39 ; groups are alkyl groups of 2 to 8 carbon atoms . thus , the radicals may , for example , be ethyl , n - propyl , i - propyl , n - butyl , i - butyl , sec - butyl , amyl , n - hexyl , i - hexyl , n - octyl , decyl , dodecyl , octadecyl , 2 - ethylhexyl , phenyl , butylphenyl , cyclohexyl , methylcyclopentyl , propenyl , butenyl . in order to obtain oil solubility , the total number of carbon atoms ( i . e . r and r &# 39 ;) in the dithiophosphoric acid will generally be about 5 or greater . the zinc dihydrocarbyl dithiophosphate can therefore comprise zinc dialkyl dithiophosphates . conveniently at least 50 ( mole ) % of the alcohols used to introduce hydrocarbyl groups into the dithiophosphoric acids are secondary alcohols . oxidation inhibitors or antioxidants reduce the tendency of mineral oils to deteriorate in service which deterioration can be evidenced by the products of oxidation such as sludge and varnish - like deposits on the metal surfaces and by viscosity growth . such oxidation inhibitors include hindered phenols , alkaline earth metal salts of alkylphenolthioesters having preferably c 5 to c 12 alkyl side chains , calcium nonylphenol sulfide , ashless oil soluble phenates and sulfurized phenates , phosphosulfurized or sulfurized hydrocarbons , phosphorous esters , metal thiocarbamates , oil soluble copper compounds as described in u . s . pat . no . 4 , 867 , 890 , and molybdenum containing compounds . typical oil soluble aromatic amines having at least two aromatic groups attached directly to one amine nitrogen contain from 6 to 16 carbon atoms . the amines may contain more than two aromatic groups . compounds having a total of at least three aromatic groups in which two aromatic groups are linked by a covalent bond or by an atom or group ( e . g ., an oxygen or sulfur atom , or a -- co --, -- so 2 -- or alkylene group ) and two are directly attached to one amine nitrogen also considered aromatic amines . the aromatic rings are typically substituted by one or more substituents selected from alkyl , cycloalkyl , alkoxy , aryloxy , acyl , acylamino , hydroxy , and nitro groups . friction modifiers ma y be included to improve fuel economy . oil - soluble alkoxylated mono - and diamines are well known to improve boundary layer lubrication . the amines may be used as such or in the form of an adduct or reaction product with a boron compound such as a boric oxide , boron halide , metaborate , boric acid or a mono -, di - or trialkyl borate . other friction modifiers are known , among these are esters formed by reacting carboxylic acids and anhydrides with alkanols . other conventional friction modifiers generally consist of a polar terminal group ( e . g . carboxyl or hydroxyl ) covalently bonded to an oleophillic hydrocarbon chain . esters of carboxylic acids and anhydrides with alkanols are described in u . s . pat . no . 4 , 702 , 850 . examples of other conventional friction modifiers are described by m . belzer in the &# 34 ; journal of tribology &# 34 ; ( 1992 ), vol . 114 , pp . 675 - 682 and m . belzer and s . jahanmir in &# 34 ; lubrication science &# 34 ; ( 1988 ), vol . 1 , pp . 3 - 26 . rust inhibitors selected from the group consisting of nonionic polyoxyalkylene polyols and esters thereof , polyoxyalkylene phenols , and anionic alkyl sulfonic acids may be used . when the formulation of the present invention is used , these anti - rust inhibitors are not generally required . copper and lead bearing corrosion inhibitors may be used , but are typically not required with the formulation of the present invention . typically such compounds are the thiadiazole polysulfides containing from 5 to 50 carbon atoms , their derivatives and polymers thereof . derivatives of 1 , 3 , 4 thiadiazoles such as those described in u . s . pat . nos . 2 , 719 , 125 ; 2 , 719 , 126 ; and 3 , 087 , 932 ; are typical . other similar materials are described in u . s . pat . nos . 3 , 821 , 236 ; 3 , 904 , 537 ; 4 , 097 , 387 ; 4 , 107 , 059 ; 4 , 136 , 043 ; 4 , 188 , 299 ; and 4 , 193 , 882 . other additives are the thio and polythio sulfenamides of thiadiazoles such as those described in uk . patent specification no . 1 , 560 , 830 . benzotriazoles derivatives also fall within this class of additives . when these compounds are included in the lubricating composition , they are preferrably present in an amount not exceding 0 . 2 wt % active ingredient . a small amount of a demulsifying component may be used . a preferred demulsifying component is described in ep 330 , 522 . it is obtained by reacting an alkylene oxide with an adduct obtained by reacting a bis - epoxide with a polyhydric alcohol . the demulsifier should be used at a level not exceeding 0 . 1 mass % active ingredient . a treat rate of 0 . 001 to 0 . 05 mass % active ingredient is convenient . pour point depressants , otherwise known as lube oil flow improvers , lower the minimum temperature at which the fluid will flow or can be poured . such additives are well known . typical of those additives which improve the low temperature fluidity of the fluid are c 8 to c 18 dialkyl fumarate / vinyl acetate copolymers and polyalkylmethacrylates . foam control can be provided by many compounds including an antifoamant of the polysiloxane type , for example , silicone oil or polydimethyl siloxane . some of the above - mentioned additives can provide a multiplicity of effects ; thus for example , a single additive may act as a dispersant - oxidation inhibitor . this approach is well known and does not require further elaboration . when lubricating compositions contain one or more of the above - mentioned additives , each additive is typically blended into the base oil in an amount which enables the additive to provide its desired function . representative effective amounts of such additives , when used in crankcase lubricants , are listed below . all the values listed are stated as mass percent active ingredient . ______________________________________ mass % mass % additive ( broad ) ( preferred ) ______________________________________ashless dispersant 0 . 1 - 20 1 - 8 metal detergents 0 . 1 - 15 0 . 2 - 9 corrosion inhibitor 0 - 5 0 - 1 . 5 metal dihydrocarbyl dithiophosphate 0 . 1 - 6 0 . 1 - 4 supplemental anti - oxidant 0 - 5 0 . 01 - 1 . 5 pour point depressant 0 . 01 - 5 0 . 01 - 1 . 5 anti - foaming agent 0 - 5 0 . 001 - 0 . 15 supplemental anti - wear agents 0 - 0 . 5 0 - 0 . 2 friction modifier 0 - 5 0 - 1 . 5 mineral or synthetic base oil balance balance______________________________________ the components may be incorporated into a base oil in any convenient way . thus , each of the components can be added directly to the oil by dispersing or dissolving it in the oil at the desired level of concentration . such blending may occur at ambient temperature or at an elevated temperature . preferably all the additives except for the pour point depressant are blended into a concentrate or additive package described herein as the detergent inhibitor package , that is subsequently blended into basestock to make finished lubricant . use of such concentrates is conventional . the concentrate will typically be formulated to contain the additive ( s ) in proper amounts to provide the desired concentration in the final formulation when the concentrate is combined with a predetermined amount of base lubricant . preferably the concentrate is made in accordance with the method described in u . s . pat . no . 4 , 938 , 880 . that patent describes making a premix of ashless dispersant and metal detergents that is pre - blended at a temperature of at least about 100 ° c . thereafter the pre - mix is cooled to at least 85 ° c . and the additional components are added . the final formulations may employ from 2 to 15 mass % and preferably 5 to 10 mass %, typically about 7 to 8 mass % of the concentrate or additive package with the remainder being base oil . the invention will now be described by of illustration only with reference to the following examples . in the examples , unless otherwise noted , all treat rates of all additives are reported as mass percent active ingredient . a series of multigrade crankcase lubricating oils according to the invention meeting sae j300 viscosity specifications for a 15w / 40 grade were prepared from a mineral basestock ( which was a blend of 150n mineral oil with various amounts of 600n mineral basestock ), a detergent inhibitor package ( di package ) containing an ashless dispersant , zddp , antioxidant , metal - containing detergents , friction modifier , demulsifier and an antifoam agent , with the ashless dispersants identified in table 1 below , and a separate pour point depressant . the oil comprised comprised 12 . 7 % di package , 0 . 2 % pour point depressant , and the amounts of vm and 600n basestock are given in the table , the balance being 150n basestock . the kv100 ° c . and ccs (- 15 ° c .) viscosities for each oil was measured and the results are shown in table 2 . comparisons are provided by oils blended with conventional dispersants with and without vm . the vm used in these comparisons was an oil solution of an ethylene propylene copolymer having an ssi of 25 . table 1______________________________________ polymer terminal mn ethylene dispersant type . sup . 1 vinylidene (%) ( gpc ) ( mole %) d . sub . p . sup . 2______________________________________1 ebco / pam 61 3700 41 93 . 2 2 ebco / pam 58 4250 55 117 . 6 3 ebco / pam 64 4700 51 126 . 7 4 ebco / pam 65 3300 48 87 . 2 5 ebco / pam 64 2400 39 59 . 6 6 ebco / pam 69 2750 50 73 . 7 7 ebco / pam 57 3500 65 103 . 1 8 ebco / pam 62 3500 35 84 . 4 a pibsa / pam 2200 0 39 . 3 b pibsa / pam 950 0 17 . 0______________________________________ table 2______________________________________ kv dispt vm 600n 100 ° c . ccs disper - treat treat basestock . sup . 3 oil (- 15 ° c .) example sant ( a . i . %) (%) treat (%) ( mm . sup . 2 / s ) p______________________________________1 1 3 . 63 0 12 . 16 12 . 8 32 . 5 2 2 2 . 75 0 11 . 56 12 . 8 32 . 5 3 3 2 . 55 0 13 . 55 12 . 8 32 . 5 4 4 5 . 12 0 4 . 05 12 . 8 32 . 5 5 5 6 . 28 0 4 . 04 12 . 8 32 . 5 6 6 4 . 45 0 8 . 24 12 . 8 32 . 5 7 7 2 . 31 0 16 . 57 12 . 8 32 . 5 8 8 3 . 9 0 8 . 53 12 . 8 32 . 5 comp . 1 a 3 . 0 7 . 49 13 . 8 14 . 0 32 . 5 comp . 2 b 4 . 5 8 . 02 14 . 0 14 . 0 32 . 5 comp . 3 a 7 . 19 0 0 9 . 45 * 32 . 5 comp . 4 a 10 . 54 0 0 12 . 8 45 . 9 * comp . 5 a 6 . 3 4 . 56 0 14 . 0 32 . 5______________________________________ footnotes : . sup . 1 ebco / pam = borated dispersant prepared by aminating with a polyamine an ethylene butene copolymer functionalised with a carbonyl group by a koch reaction such as described in woa - 94 / 13709 ; pibsa / pam = borated polyisobutenyl succinimide dispersant . . sup . 2 d . sub . p = of polymerisation . sup . 3 600n basestock is a mineral oil basestock with a basestock neutral number of 600 * off grade for a 15w / 40 oil examples 1 to 9 show 15w / 40 oils formulated without vm . comparative examples 1 , 2 and 5 show that to achieve 15w / 40 oils with the same ccs performance it is necessary to employ significant amounts of vm which is not shear stable and reduces the diesel performance of the oils as discussed above . the higher viscosity of the oils also means that it fuel economy performance is worse than the oils of the invention . comparative examples 3 and 4 show that in the absence of vm the conventional oils do not meet the viscosity requirements for a 15w / 40 oil . the oils of the invention provide very good dispersancy and also have good elastomer compatability , as compared to conventional oils . | 2 |
in the following description of various illustrative embodiments , reference is made to the accompanying drawings , which form a part hereof , and in which is shown , by way of illustration , various embodiments in which aspects of the disclosure may be practiced . it is to be understood that other embodiments may be utilized , and structural and functional modifications may be made , without departing from the scope of the present disclosure . fig1 illustrates an example communication network 100 on which many of the various features described herein may be implemented . network 100 may be any type of information distribution network , such as satellite , telephone , cellular , wireless , etc . one example may be an optical fiber network , a coaxial cable network , or a hybrid fiber / coax distribution network . such networks 100 use a series of interconnected communication links 101 ( e . g ., coaxial cables , optical fibers , wireless , etc .) to connect multiple premises 102 ( e . g ., businesses , homes , consumer dwellings , etc .) to a local office or headend 103 . the local office 103 may transmit downstream information signals onto the links 101 , and each premises 102 may have a receiver used to receive and process those signals . there may be one link 101 originating from the local office 103 , and it may be split a number of times to distribute the signal to various premises 102 in the vicinity ( which may be many miles ) of the local office 103 . the links 101 may include components not illustrated , such as splitters , filters , amplifiers , etc . to help convey the signal clearly , but in general each split introduces a bit of signal degradation . portions of the links 101 may also be implemented with fiber - optic cable , while other portions may be implemented with coaxial cable , other lines , or wireless communication paths . the local office 103 may include an interface , such as a termination system ( ts ) 104 . more specifically , the interface 104 may be a cable modem termination system ( cmts ), which may be a computing device configured to manage communications between devices on the network of links 101 and backend devices such as servers 105 - 107 ( to be discussed further below ). the interface 104 may be as specified in a standard , such as the data over cable service interface specification ( docsis ) standard , published by cable television laboratories , inc . ( a . k . a . cablelabs ), or it may be a similar or modified device instead . the interface 104 may be configured to place data on one or more downstream frequencies to be received by modems at the various premises 102 , and to receive upstream communications from those modems on one or more upstream frequencies . the local office 103 may also include one or more network interfaces 108 , which can permit the local office 103 to communicate with various other external networks 109 . these networks 109 may include , for example , networks of internet devices , telephone networks , cellular telephone networks , fiber optic networks , local wireless networks ( e . g ., wimax ), satellite networks , and any other desired network , and the network interface 108 may include the corresponding circuitry needed to communicate on the external networks 109 , and to other devices on the network such as a cellular telephone network and its corresponding cell phones . as noted above , the local office 103 may include a variety of servers 105 - 107 that may be configured to perform various functions . for example , the local office 103 may include a push notification server 105 . the push notification server 105 may generate push notifications to deliver data and / or commands to the various premises 102 in the network ( or more specifically , to the devices in the premises 102 that are configured to detect such notifications ). the local office 103 may also include a content server 106 . the content server 106 may be one or more computing devices that are configured to provide content to users at their premises . this content may be , for example , video on demand movies , television programs , songs , text listings , etc . the content server 106 may include software to validate user identities and entitlements , to locate and retrieve requested content , to encrypt the content , and to initiate delivery ( e . g ., streaming ) of the content to the requesting user ( s ) and / or device ( s ). the local office 103 may also include one or more application servers 107 . an application server 107 may be a computing device configured to offer any desired service , and may run various languages and operating systems ( e . g ., servlets and jsp pages running on tomcat / mysql , osx , bsd , ubuntu , redhat , html5 , javascript , ajax and comet ). for example , an application server may be responsible for collecting television program listings information and generating a data download for electronic program guide listings . another application server may be responsible for monitoring user viewing habits and collecting that information for use in selecting advertisements . yet another application server may be responsible for formatting and inserting advertisements in a video stream being transmitted to the premises 102 . although shown separately , one of ordinary skill in the art will appreciate that the push server 105 , content server 106 , and application server 107 may be combined . further , here the push server 105 , content server 106 , and application server 107 are shown generally , and it will be understood that they may each contain memory storing computer executable instructions to cause a processor to perform steps described herein and / or memory for storing data . an example premises 102 a , such as a home , may include an interface 120 . the interface 120 can include any communication circuitry needed to allow a device to communicate on one or more links 101 with other devices in the network . for example , the interface 120 may include a modem 110 , which may include transmitters and receivers used to communicate on the links 101 and with the local office 103 . the modem 110 may be , for example , a coaxial cable modem ( for coaxial cable lines 101 ), a fiber interface node ( for fiber optic lines 101 ), twisted - pair telephone modem , cellular telephone transceiver , satellite transceiver , local wi - fi router or access point , or any other desired modem device . also , although only one modem is shown in fig1 , a plurality of modems operating in parallel may be implemented within the interface 120 . further , the interface 120 may include a gateway interface device 111 . the modem 110 may be connected to , or be a part of , the gateway interface device 111 . the gateway interface device 111 may be a computing device that communicates with the modem ( s ) 110 to allow one or more other devices in the premises 102 a , to communicate with the local office 103 and other devices beyond the local office 103 . the gateway 111 may be a set - top box ( stb ), digital video recorder ( dvr ), computer server , or any other desired computing device . the gateway 111 may also include ( not shown ) local network interfaces to provide communication signals to requesting entities / devices in the premises 102 a , such as display devices 112 ( e . g ., televisions ), additional stbs 112 , personal computers 114 , laptop computers 115 , wireless devices 116 ( e . g ., wireless routers , wireless laptops , notebooks , tablets and netbooks , cordless phones ( e . g ., digital enhanced cordless telephone — dect phones ), mobile phones , mobile televisions , personal digital assistants ( pda ), etc . ), landline phones 117 ( e . g . voice over internet protocol — voip phones ), and any other desired devices . examples of the local network interfaces include multimedia over coax alliance ( moca ) interfaces , ethernet interfaces , universal serial bus ( usb ) interfaces , wireless interfaces ( e . g ., ieee 802 . 11 , ieee 802 . 15 ), analog twisted pair interfaces , bluetooth interfaces , and others . fig2 illustrates general hardware elements that can be used to implement any of the various computing devices discussed herein . the computing device 200 may include one or more processors 201 , which may execute instructions of a computer program to perform any of the features described herein . the instructions may be stored in any type of computer - readable medium or memory , to configure the operation of the processor 201 . for example , instructions may be stored in a read - only memory ( rom ) 202 , random access memory ( ram ) 203 , removable media 204 , such as a universal serial bus ( usb ) drive , compact disk ( cd ) or digital versatile disk ( dvd ), floppy disk drive , or any other desired storage medium . instructions may also be stored in an attached ( or internal ) hard drive 205 . the computing device 200 may include one or more output devices , such as a display 206 ( e . g ., an external television ), and may include one or more output device controllers 207 , such as a video processor . there may also be one or more user input devices 208 , such as a remote control , keyboard , mouse , touch screen , microphone , etc . the computing device 200 may also include one or more network interfaces , such as a network input / output ( i / o ) circuit 209 ( e . g ., a network card ) to communicate with an external network 210 . the network input / output circuit 209 may be a wired interface , wireless interface , or a combination of the two . in some embodiments , the network input / output circuit 209 may include a modem ( e . g ., a cable modem ), and the external network 210 may include the communication links 101 discussed above , the external network 109 , an in - home network , a provider &# 39 ; s wireless , coaxial , fiber , or hybrid fiber / coaxial distribution system ( e . g ., a docsis network ), or any other desired network . additionally , the device may include a location - detecting device , such as a global positioning system ( gps ) microprocessor 211 , which can be configured to receive and process global positioning signals and determine , with possible assistance from an external server and antenna , a geographic position of the device . the fig2 example is a hardware configuration . modifications may be made to add , remove , combine , divide , etc . components of the computing device 200 as desired . additionally , the components illustrated may be implemented using basic computing devices and components , and the same components ( e . g ., processor 201 , rom storage 202 , display 206 , etc .) may be used to implement any of the other computing devices and components described herein . for example , the various components herein may be implemented using computing devices having components such as a processor executing computer - executable instructions stored on a computer - readable medium , as illustrated in fig2 . some or all of the entities described herein may be software based , and may co - exist in a common physical platform ( e . g ., a requesting entity can be a separate software process and program from a dependent entity , both of which may be executed as software on a common computing device ). one or more aspects of the disclosure may be embodied in a computer - usable data and / or computer - executable instructions , such as in one or more program modules , executed by one or more computers or other devices . generally , program modules include routines , programs , objects , components , data structures , etc . that perform particular tasks or implement particular abstract data types when executed by a processor in a computer or other data processing device . the computer executable instructions may be stored on one or more computer readable media such as a hard disk , optical disk , removable storage media , solid state memory , ram , etc . as will be appreciated by one of skill in the art , the functionality of the program modules may be combined or distributed as desired in various embodiments . in addition , the functionality may be embodied in whole or in part in firmware or hardware equivalents such as integrated circuits , field programmable gate arrays ( fpga ), and the like . particular data structures may be used to more effectively implement one or more aspects of the disclosure , and such data structures are contemplated within the scope of computer executable instructions and computer - usable data described herein . fig3 illustrates an example portion of the network shown in fig1 . in particular , the communication link 101 between a termination server 104 and a corresponding access device , such as modem 110 , may be comprised of a variety of sub - links 301 - 302 . these sub - links may be logical and / or physical transmission channels or frequencies , such as docsis downstream and upstream frequencies , bonded groups of frequencies , timeslot allocations on a shared channel , or any other desired transmission protocol . the termination server 104 , in the example of an hfc network , may manage one or more quadrature amplitude modulation ( qam ) transmitters for downstream channels 301 a - c that may be used to deliver data from the termination server to the modem 110 , while upstream channel 302 may be used to deliver data from the modem 110 to the termination server 104 . elements 301 a - c may be any type of a communication path . in one example use scenario , a user may be using a tablet computing device to watch a streaming movie offered by a video delivery service . to obtain the movie , the user may use a browser on the tablet to connect to the user &# 39 ; s modem 110 , which may then forward a request to the termination server 104 , requesting access to the video delivery service &# 39 ; s listing of content and / or internet portal . the termination server 104 may receive the request , and prepare a corresponding request to a content server 106 for the delivery service ( e . g ., an edge cache in a video content delivery network ), via whatever intermediate network connections may be needed , and the content server 106 may respond by providing the requested listing and / or internet portal page to the termination server 104 , which may in turn provide this information to the modem 110 for eventual delivery to the user &# 39 ; s tablet . during streaming playback of the movie , the user &# 39 ; s tablet might only receive an initial portion of the movie , and may periodically issue requests for more of the movie as they are needed . for example , the tablet may initially store , or buffer , the first minute of the movie , and it may then request additional fragments of the movie as they are needed . the fragments themselves may vary in size and / or playback duration , depending on the data compression used for the video and audio , and typical fragments may contain between 2 and 10 seconds of playback audiovisual data . for example , when the video content service adds a video program to its offerings , the service may process the video program to encode the various fragments that comprise the video program , and may assign them sequential numbers to indicate their order in the presentation of the program ( e . g ., fragment number 148 ). the service may store information identifying the location of these fragments , as well as their data size ( e . g ., 14 mb ). in some embodiments , the service may generate different versions of the video program to accommodate different types of playback conditions . for example , the service may generate higher and / or lower resolution versions of the same fragments , such as a 1080p or 720p pixel resolution version in addition to a standard definition version and a reduced - size version for smart phones , and a version with 7 . 1 stereo audio in addition to a version with basic two - channel stereo audio . these different versions may be used to accommodate different playback devices ( e . g ., smart phones , tablets , personal computers , standard - definition televisions and high - definition televisions ), and to also accommodate different amounts of available bandwidth . the video delivery service may share the downstream bandwidth 301 a - c with a variety of other services , and the overall usage may vary over time , as illustrated in the graphs 303 a - c . this variation may change the amount of available unused bandwidth , and embodiments described herein may account for this variance in available bandwidth , and adjust its delivery of content to optimize the usage of the available bandwidth . as will be described further below , in some embodiments , the content server 106 may intentionally delay and / or reorder the delivery of content fragments to best use the available bandwidth . further , since the available bandwidth may also fluctuate , embodiments herein may receive bandwidth usage reports from the termination server 104 , and use the reports to identify how much bandwidth is available . fig4 illustrates an example process for managing bandwidth usage . the process may be performed by a computing device , e . g ., the content server 106 , upon execution of corresponding instructions stored on a computer - readable medium , such as hard drive 205 and / or ram 203 , and may begin in step 401 with the initial configuration . the initial configuration may include establishing the downstream communication paths , or channels 301 a - c that will be used by the content serer 106 . this may include identifying the initial user request for a streaming session , identification of the source and destination addresses for the session , and any other desired configuration detail to establish the downstream communication . the initial configuration may also include establishing an upstream communication path , or channel 302 , which the modem 110 may use to transmit content requests and status messages to the termination server 104 . the initial configuration may also include establishing a channel through which the termination server 104 can communicate with the content server 106 . in step 402 , the content server 106 may create a request queue . the request queue may be a data structure that is used to identify the pieces of content that have been requested by the various devices in the system . for example , the queue may identify the various video fragments by their file name ( e . g ., “ movie # 12342 , fragment 343523 ”), and also identify the requesting device ( e . g ., by its media access control ( mac ) address , or its internet protocol ( ip ) address , or by any other desired identification ) and the time by which the requested fragment is needed ( e . g ., monday , dec . 10 , 4 : 13 : 03 pm , or epoch time 1355174028 ). in step 403 , the content server 106 may determine whether an incoming request for a content fragment has been received from a requesting client device , such as a user &# 39 ; s tablet computer or the user &# 39 ; s gateway or modem . the request itself may be formatted as an ip packet , and may contain information identifying the requesting device , the requested content , and the time the content is needed . if such a request has been received , then in step 404 , the content server 106 may begin to extract information from the request . in step 404 , the content server 106 may identify the time by which the fragment is needed . as noted above , the time may indicate a time of day , which may indicate the time when the requesting device will finish playback of the portions of the program that it has already received . alternatively , the requesting device may factor into account delay due to reception , decoding and processing delays , and the time needed value may indicate the point at which the requesting device wishes to have the next fragment , so that it may finish decoding it in time for display to the user . in step 405 , the content server 106 may identify the requested fragment , based on the content identification contained in the request . the content identification may identify the content fragment by identifying , for example , the program or content item to which the fragment belongs , and the playback point in time of the needed fragment . for example , the content identification may indicate that the requesting device needs the next portion of the high - definition ( hd ) version of the movie “ the dark knight rises ,” beginning at 20 minutes , 10 seconds into the movie . instead of listing the playback time of the requested fragment , the request may alternatively simply indicate the last fragment number ( e . g ., fragment 2352 ) in the requesting device &# 39 ; s buffer , and the content server 106 may respond by looking for the next fragment after the one identified in the request . as part of identifying the next fragment , the content server 106 may actually identify multiple versions of the fragment , as noted above . so , for a given portion of the video program , the content server may have a first fragment encoded at a standard video definition ( e . g ., 486 lines per frame ), a second fragment encoded at a high - definition ( e . g ., 1080 lines per frame ), and a third fragment encoded at a low resolution ( e . g ., 300 lines per frame ). in the step 405 identification , the content server may identify all of these variant fragments as possibilities for responding to the request . if the request identified a specific version ( e . g ., high - definition ), then the content server 106 may also identify the one that was requested by the user . in step 406 , for each of the identified fragments , the content server 106 may determine , based on the data transmission rate of the downstream channels 301 a - c and the data size of the fragment , a cutoff time by which the transmission of the fragment needs to begin in order to arrive on or before the “ time needed ” indicated in the request . for example , if the data rate is 300 mb / sec , and the hd fragment is a 300 mb file , then the content server 106 may determine in step 406 that the fragment needs to be sent one second before the time needed in the request . additional time ( e . g ., another second ) may also be added to account for processing delay . information identifying the time needed , fragment requested , alternative fragments and cutoff times may be stored by the content server 106 in the data queue discussed above . in step 407 , the content server 106 may receive a message from the termination server 104 , identifying the current bandwidth usage levels for the one or more downstream channels 301 a - c . for example , in an hfc - type network , the termination server 104 may indicate the number of qam channels that are available for the video service to use , and the amount of space on the channels that is available in a current time slot ( or slots , or future time slots ) being prepared by the termination server 104 . alternatively , the bandwidth usage level may indicate an amount of the available bandwidth on a communication path or channel that is already consumed . over time , the bandwidth usage may resemble that depicted in fig5 a . as illustrated , the bandwidth usage for a given channel ( e . g ., channel 301 a ) may vary over sequential time slots , remaining under a limit 501 , which may be a limit of the channel 301 a and / or a limit imposed on the service . the illustration also includes two requested fragments q 1 , q 2 in the queue , awaiting transmission , with the sizes representative of the bandwidth needed for their transmission . the content server 106 may continuously , or periodically , receive these messages from the termination server 104 . the loop shown in fig4 may also skip this step in situations where a bandwidth update has not been sent by the termination server 104 . in step 408 , the content server 106 may determine what future bandwidth availability currently exists ( e . g ., has not been scheduled for use ). referring to fig5 a , if the current bandwidth message is received for time t 1 , then the available bandwidth 502 may be used by the service . in step 409 , the content server 106 may determine whether there are any urgent fragments awaiting transmission in the queue . a fragment may be deemed urgent if the current time has reached the cutoff time for a requested fragment . if there are any urgent fragments in the queue , then in step 410 , the content server 106 may consult the stored information identifying the available bandwidth ( from step 407 ), and the stored information identifying the requested fragments and their variants ( from step 405 ) and determine how best to fit all of the urgent fragments in the currently available bandwidth . assuming that the requested urgent fragments will fit in the currently available bandwidth , then in step 411 , those urgent fragments will be sent from the content server 106 to the termination server 104 for delivery to the requesting device . however , if the available bandwidth is insufficient to fit the urgent fragment ( s ), then in step 412 , the content server 106 may identify reduced - sized versions of the requested fragment ( s ), and send the reduced - sized or reduced - quality version ( s ) to the termination server 104 for delivery to the requesting device . the selection of the reduced - sized version may involve selecting the largest version that will fit in the available bandwidth . if there is insufficient bandwidth for even the smallest version of the requested fragment , then the content server can skip the requested fragment for now , and await the next bandwidth opportunity to send it . in step 413 , the content server 106 may adjust its own stored information identifying the available bandwidth , to account for any fragments sent in steps 411 or 412 , so that the bandwidth information is up - to - date for further use , and in case step 409 is encountered again before an updated bandwidth message is received from the termination server 104 . in step 414 , the content server 106 may then check to determine if anything remaining in the queue will fit in the currently - available bandwidth . if there is enough room , then in step 415 , the content server 106 may send one or more fragments from the queue to maximize the usage of the currently - available bandwidth . to maximize this usage , the content server 106 may seek to use as much of the available bandwidth as possible . referring to fig5 b , if q 2 were the only fragment awaiting transmission , then during the time slot t 1 there will be an amount of unused bandwidth 503 in that time slot . if the same fragment were sent in time t 2 instead , there would be virtually no unused bandwidth , so sending the q 2 fragment at time t 2 would better maximize the use of the bandwidth . of course , at time t 1 , the content server 106 might not know that a better slot will be coming up in time t 2 . in such embodiments , if q 2 were the only fragment awaiting transmission , then the content server 106 may simply send that fragment in time t 1 . however , if multiple fragments are awaiting transmission at time t 1 , then the content server 106 may seek to send the largest fragment that will still fit in the available bandwidth . so for example , referring to fig5 c , the fragment q 1 is shown as using up more of the available bandwidth at time t 1 , leaving unused space 504 that would be smaller than the space 503 that would remain if q 2 were sent instead . to fill this space , the content server 106 may enter into a recursive algorithm , filling the available space with the largest fragment that will fit , reducing the amount of available space accordingly , and then repeating the process until no more awaiting fragments will fit in whatever space remains . however , if at time t 1 , the content server 106 has information for a plurality of future time slots ( e . g ., if the message in step 407 provided information for a plurality of future time slots on the downstream channels 301 a - c ), then the content server 106 could schedule the q 1 fragment for transmission in time t 1 , and the q 2 fragment for transmission in time t 2 . the content server 106 can use the same approach discussed above — find the largest waiting fragment that will fit in an available slot , and repeat until no more waiting fragments can fit . when the content server 106 has finished arranging the fragment ( s ) to fill the available bandwidth , then in step 416 , the content server 106 may transmit the fragment ( s ) to the termination server 104 for delivery to the requesting devices . from there , the process may return to step 403 , and can repeat as long as desired . the example process above shows a degree of urgency in step 409 , and gives those fragments priority in filling available space . in some embodiments , multiple degrees of urgency may be defined . for example , a fragment may be deemed “ urgent ” if the current time is at or beyond the time needed value identified in the client request . another degree of urgency ( e . g ., “ less than urgent ”) may be defined if the current time is within 5 seconds ( or any other desired time window ) of the time needed , and those “ less than urgent ” fragments may be given the next opportunity after step 413 . in such embodiments , after step 413 , another set of steps similar to steps 409 - 413 may be used for the “ less than urgent ” fragments . there may be many such degrees of urgency , each with a different time window preceding the time needed , and each classification of fragment may await its turn for consuming the current time slot ( s ) being filled . the example process above handles urgent fragments first , and then arranges whatever less urgent additional fragments will fit in the remaining available bandwidth . in alternate embodiments , the urgent fragments may also be arranged to maximize the usage of the available bandwidth . for example , if multiple time slots are available as shown in fig5 b , and if q 2 were urgent , then the content server 106 may elect to place the q 2 fragment in the t 2 slot , since that will result in less unused bandwidth . this may be acceptable under the condition that delivery of the q 2 fragment at time t 2 to the requesting client will still be within the time needed indicated in the client &# 39 ; s request . this may also be true , even if the request for q 2 was made before the request for q 1 — the content server 106 may rearrange the fragments so that they are not sent in the same order in which their respective requests were received . such a usage is illustrated in fig5 d . in some embodiments , the fragment requests 403 can be sent in response to a user who has changed a playback speed of a streaming video . for example , a user may be watching a streaming movie , and decide to press the fast - forward button on his / her remote control . in response to that press , the user &# 39 ; s client device ( e . g ., a dvr or tablet ) may transmit a new fragment request 403 , identifying a new fragment that is needed , and indicating that previous unfilled requests are no longer needed . the content server may update its schedule to remove the unfilled requests , and add the new fragment request . in embodiments where the user may indicate a new playback point ( e . g ., by requesting to jump ahead in the program by 30 seconds ), the user &# 39 ; s client device may transmit a new fragment request for the new playback point , and prior unfilled requests for the user may be discarded by the content server . if the new playback point is one for which the client has already sent a request ( e . g ., if the client was trying to keep a 45 - second buffer of content ahead of the current playback point , then the fragment that is 30 seconds ahead may have already been the subject of an earlier request ), then the content server may respond by escalating the priority of that requested fragment , and its subsequent fragments , to reflect the jumping ahead . in this manner , an upstream signaling from the client to the server may indicate the client &# 39 ; s current playback status , and that upstream signaling may be used by the content server to manage its downstream bandwidth allocation . although example embodiments are described above , the various features and steps may be combined , divided , omitted , and / or augmented in any desired manner , depending on the specific outcome and / or application . various alterations , modifications , and improvements will readily occur to those skilled in art . such alterations , modifications , and improvements as are made obvious by this disclosure are intended to be part of this description though not expressly stated herein , and are intended to be within the spirit and scope of the disclosure . accordingly , the foregoing description is by way of example only , and not limiting . this patent is limited only as defined in the following claims and equivalents thereto . | 7 |
the method of creating seamless tungsten plugs , for small diameter contact holes , will now be described . this invention can be used as part of metal oxide semiconductor field effect transistors , ( mosfet ), devices , that are currently being manufactured in industry , therefore only the specific areas , unique to understanding this invention , will be covered in detail . a typical n channel , ( nfet ), device , that small diameter contact holes , filled with seamless tungsten plugs , can be applied to , is schematically shown in fig1 . a substrate , 1 , composed of p type , single crystalline silicon , with a & lt ; 100 & gt ; crystallographic orientation , is used . thick field oxide regions , 2 , ( fox ), are formed for isolation purposes . the fox regions are formed by patterning a composite insulator , oxidation mask , composed of an overlying silicon nitride layer , and an underlying silicon dioxide layer . patterning is accomplished via conventional photolithographic and reactive ion etching , ( rie ), procedures . after photoresist removal , performed via plasma oxygen ashing , followed by careful wet cleans , a thick fox insulator is grown in the silicon regions not covered with the composite insulator oxidation mask . the fox insulator is obtained via thermal oxidation in an oxygen -- steam ambient , at a temperature between about 850 ° to 1050 ° c ., grown to a thickness between about 4000 to 6000 angstroms . after removal of the insulator composite oxidation mask , using hot phosphoric acid for the silicon nitride layer , and a buffered hydrofluoric acid solution for the underlying silicon dioxide layer , a thin silicon dioxide , gate insulator , 3 , is grown in an oxygen steam ambient , at a temperature between about 800 ° to 1000 ° c ., to a thickness between about 50 to 300 angstroms . a polysilicon layer is next deposited using low pressure chemical vapor deposition , ( lpcvd ), processing , at a temperature between about 500 ° to 700 ° c ., to a thickness between about 1500 to 4000 angstroms . the polysilicon can be grown using insitu doping techniques via the addition of either phosphine or arsine , to a silane ambient . the polysilicon can also be deposited intrinsically and doped via ion implantation of either phosphorous or arsenic , at an energy between about 50 to 100 kev ., at a dose between about 1e15 to 1e16 atoms / cm 2 . conventional photolithographic and rie procedures , using cl 2 as an etchant , are used to create polysilicon gate structure , 4 , shown schematically in fig1 . after photoresist removal , via use of plasma oxygen ashing and careful wet cleans , an n type , lightly doped source and drain region , 5 , is formed via use of an ion implantation procedure , using phosphorous at an energy between about 30 to 60 kev ., at a dose between about 1e12 to 5e13 atoms / cm 2 . a silicon oxide layer is next deposited using either lpcvd or plasma enhanced chemical vapor deposition , ( pecvd ), procedures , at a temperature between about 400 ° to 800 ° c ., to a thickness between about 1500 to 4000 angstroms , using tetraethylorthosilicate as a source . an anisotropic , rie procedure , using chf 3 as an etchant , is used to create insulator sidewall spacer , 6 , shown schematically in fig1 . another ion implantation process , using arsenic at an energy between about 50 to 100 kev ., and at a dose between about 1e14 to 5e15 atoms / cm 2 , is used to create the heavily doped source and drain region , 7 . another silicon oxide layer , 8 , is deposited using either lpcvd , pecvd , or atmospheric pressure chemical vapor deposition , ( apcvd ), processing , at a temperature between about 400 ° to 800 ° c ., to a thickness between about 5000 to 10000 angstroms . photolithographic and rie procedures , using chf 3 and cf 4 as etchants , are then used to open contact hole , 9 , exposing heavily doped source and drain region , 7 . more aggressive designs , employing sub - micron features , results in contact holes exhibiting high aspect ratios , that is the depth of the contact hole , divided by the width of the contact hole opening . the size of the opening for contact hole , 9 , is between about 0 . 3 to 0 . 5 um , in diameter , resulting in high aspect ratios between about 1 to 3 , making it more difficult to fill with conventional metallization deposition processes , such as sputtering or lpcvd , then larger contact hole counterparts . fig1 schematically depicts this structure after photoresist removal , accomplished via plasma oxygen ashing , followed by careful wet cleans . fig2 - 4 , schematically represent prior art , and attempts at filling high aspect ratio contact holes , with lpcvd tungsten . fig2 shows the deposition of a tungsten layer , 10 , performed using lpcvd processing , attempting to fill a high aspect ratio contact hole , 9 , using tungsten hexafluoride as a source , at a temperature between about 400 ° to 500 ° c ., to a thickness between about 4000 to 8000 angstroms . the filling of contact hole , 9 , proceeds by tungsten deposition on the sidewalls of contact hole , 9 . at the conclusion of the deposition it is possible that a seam , 11 , in the tungsten fill can result due to the imperfect convergence of the tungsten coated sidewalls . blanket , selective rie processing , used to form a tungsten plug in contact hole , 9 , by removal of unwanted tungsten from areas outside contact hole , 9 , can attack seam , 11 , creating a larger seam , or opening , 12 , shown schematically in fig3 . the harmful consequence of opening , 12 , in the tungsten plug , 10 , is the inability of the subsequent overlying interconnect metallization , 13 , to conformally deposit on the underlying tungsten plug . the poor conformality of an overlying metallization , such as a sputtered aluminum based layer , results in a thinner then desired interconnect metallization layer , specifically in region , 14 , where the interconnect metallization overlies opening , 12 , in the tungsten plug . the thin interconnect metallization layer will experience higher current densities in the thinner region , 14 , thus increasing the risk of electromigration failure . this is shown schematically in fig4 . a process will now be described in which the defect , or opening , in a tungsten plug , used to fill a high aspect ratio contact hole , is corrected via a redeposition and etch back of a second tungsten layer . again applying this invention to the n channel structure depicted in fig1 a buffered hydrofluoric acid pre - clean is used to remove native oxides from the surface of heavily source and region , 7 , at the bottom of the contact hole . the dimensions of the contact hole are ; an opening of between about 0 . 3 to 0 . 5 um , in diameter , and with a depth between about 5000 to 10000 angstroms , resulting in aspect ratios between about 1 to 3 . a layer of titanium , 15 , shown in fig5 is deposited using r . f . sputtering , to a thickness between about 200 to 500 angstroms . the titanium layer , 15 , is used to optimize the contact resistance of subsequent overlying materials , to underlying source and drain region , 7 . in addition titanium layer , 15 , provides excellent adhesion to the silicon oxide sidewalls , of contact hole , 9 . next a layer of titanium nitride , 16 , is deposited , again via the use of r . f . sputtering , to a thickness between about 500 to 1000 angstroms . the titanium nitride layer serves as a barrier to protect underlying materials , such as titanium layer , 14 , as well as source and drain region , 7 , from the deleterious effects of by - products produced during subsequent processing . the decomposition of tungsten hexafluoride , used as a source for lpcvd tungsten , produces fluorine containing by - products that can react with titanium or silicon , if not protected . tungsten layer , 17 , is next deposited using lpcvd processing , at a temperature between about 400 ° to 500 ° c ., using tungsten hexafluoride and silane , to a thickness between about 6000 to 8000 angstroms . the mechanism of filling high aspect ratio holes with lpcvd metallizations , again results in a tungsten seam , 18 , at the point of convergence of the tungsten coated sidewalls . this is schematically shown in fig5 . a blanket , selective , rie etch back process , using sf 6 in nitrogen as an etchant , is used to create a tungsten plug in the high aspect ratio contact hole , by removal of unwanted tungsten from all regions , outside of the contact hole . the etch back is extended to insure removal of both titanium nitride , 16 , as well as titanium , 15 , from the top surface of silicon oxide layer , 8 . the extended etch back process results in the tungsten plug being recessed between about 1000 to 2000 angstroms below the top surface of dielectric layer , 8 . this is shown schematically in fig6 . besides a recessed tungsten plug , 17 , in the contact hole , the original seam , 18 , develops into the unwanted larger seam or void , 19 , as a result of the extended etch back process . fig7 - 8 , will now show a process used to overcome , or close void , 19 . a second layer of tungsten , 20 , is deposited , again using lpcvd processing , at a temperature between about 400 ° to 500 ° c ., to a thickness between about 3000 to 5000 angstroms , again via the use of tungsten hexafluoride and silane . the deposition of the second tungsten layer reduces the severity of void , 19 , resulting in the formation of only a mild crevice , 21 . this is shown in fig7 . the etch back procedure , used to remove unwanted tungsten layer , 20 , from the surface of silicon oxide layer , 8 , is again performed using a rie process , employing sf 6 in nitrogen , as an etchant . the resulting tungsten plug , composed of underlying tungsten layer , 17 , and overlying tungsten layer , 20 , is schematically shown in fig8 . the mild crevice , 21 , is not transferred to the tungsten plug during the etch back process . a metallization layer of aluminum , containing between about 0 . 5 to 3 . 0 % copper , is deposited using r . f . sputtering , to a thickness between about 4000 to 8000 angstroms . conventional photolithographic and rie procedures , using cl 2 as an etchant , are used to create metallization interconnect structure , 22 , shown in fig9 . the interconnect structure , 22 , unlike counterpart structure , 13 , previously shown in fig4 does not exhibit thinning or poor conformality . this is accomplished by depositing the aluminum based metallization layer on a voidless , or seamless , underlying tungsten plug . therefore the risk of aluminum electromigration failures , due to high current densities in thin aluminum regions , is reduced . photoresist removal is once again accomplished via the use of plasma oxygen ashing , followed by careful wet cleans . this process , although shown for tungsten filled contact holes , used to connect overlying interconnect metallization structures , to underlying active silicon device regions , can also be applied to tungsten filled via holes , used to connect two levels of interconnect metallization layers . in addition this process , although shown as an application for an n channel , ( nfet ), device , can also be applied to p channel , ( pfet ), devices , to complimentary , ( cmos ), devices , as well as to bicmos devices . while this invention has been particularly shown and described with reference to , the preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made without departing from the spirit and scope of this invention . | 7 |
fig1 shows a steam generator 10 associated with a pressurized water nuclear reactor ( not shown ). a more complete description of a steam generator 10 is set forth in u . s . pat . no . 7 , 434 , 546 , issued oct . 14 , 2008 . generally , the steam generator 10 includes an elongated , generally cylindrical shell 12 defining an enclosed space 14 , at least one primary fluid inlet port 16 , at least one primary fluid outlet port 18 , at least one secondary fluid inlet port 20 , at least one secondary fluid outlet port 22 , and a plurality of substantially uniformly , diametrically sized tubes 24 extending between , and in fluid communication with , the primary fluid inlet port 16 and the primary fluid outlet port 18 . the cylindrical shell 12 is typically oriented with the longitudinal axis extending substantially vertically . the tubes 24 are sealingly coupled to a tube sheet 38 that forms part of a manifold within the enclosed space that divides the fluid inlet port 16 and the fluid outlet port 18 . as seen in fig1 , the tubes 24 generally follow a path shaped as an inverted “ u ”. as seen in fig2 and 3 , the tubes 24 are disposed in a substantially regular pattern having substantially uniform , narrow gaps 28 between adjacent tubes 24 . the tube gap 28 ( shown in fig3 ) is typically between about 0 . 11 and 0 . 41 inch ( 0 . 30 and 1 . 04 cm . ), and more typically about 0 . 116 inch ( 0 . 29 cm .). also , as shown , the “ u ” shape of the tubes 24 creates a tube lane 26 extending across the center of the shell 12 . on both ends of the tube lane 26 there is a tube lane access opening 30 . the tube lane access opening 30 , which is usually round , typically has a diameter of between about five and eight inches ( 12 . 7 and 20 . 3 cms . ), and more typically about six inches ( 15 . 2 cms .). during operation of the pressurized water nuclear reactor , heated , primary water from the reactor is passed through the tubes 24 via the primary fluid inlet port 16 and removed from the steam generator 10 via the primary fluid outlet port 18 . secondary water , enters the steam generator 10 via the secondary fluid inlet port 20 and leaves the steam generator 10 via the steam outlet port 22 . as the secondary water is passed over the outer surface of the tubes 24 , the secondary water is converted to steam leaving sludge to collect between the tubes 24 , on the tube sheet 38 , and on other structures in the steam generator 10 . typically , access for a full sized sludge lance is through the tube lane access opening 30 . fig2 shows a partial cross sectional view of a steam generator taken along the lines 2 - 2 of fig1 . for certain steam generator designs , divider plate 32 restricts access for sludge lancing as the divider plate is approximately centered at the hand hole access opening 30 . for these types of steam generators , effective cleaning is accomplished by spraying high pressure water outward from the tube lane coupled with introducing peripheral water flow around the annular area between the shell 12 and the tubes 24 which follows a circumferential direction of flow as indicated by the arrow 34 , along with suction at location 36 , at an inspection port , to remove sediment / water from the steam generator ( as explained in u . s . pat . no . 4 , 079 , 701 ). the small gap “ g ” between the divider plate 32 and the inner row tubes severely limits the space available to introduce water jet spray which must be accurately aligned with the gaps between the tubes . the small gap “ g ” also restricts the use of opposing water jets to balance the reaction forces on a sludge lance nozzle . without opposing balanced jets , a typical reaction force of 50 pounds ( 22 . 7 kilograms ) is induced into the sludge lance nozzle . fig3 shows an enlarged sectional view of the steam generator 10 , divider plate 32 , tubes 24 and hand hole access opening 30 . due to the manufacturing tolerances of the steam generator , the divider plate 32 may not be parallel to the tubes . this angular misalignment results in a variation in the gap between the inner row of tubes and the divider plate . the difference between “ g 1 ” and “ g 2 ” may be as great as 0 . 25 inch ( 0 . 64 cms .) across the length of the divider plate . fig4 and 5 are respectively plan and elevational views of one embodiment of the invention claimed hereafter , shown mounted to the steam generator 10 and passing through the hand hole access opening 30 . rotatable high pressure jets 40 introduce water flow into the steam generator , breaking loose and moving unwanted residue from between the tubes and towards the outer structure of the steam generator . in conjunction with the foregoing , a peripheral flow and suction system removes the residue from the steam generator . the jets 40 are part of the nozzle assembly 42 which is attached in the head assembly 44 . in fig5 , the jets 40 are shown pointing downward which is the normal starting position when the system is pressurized forcing high pressure water through the jets . in fig4 , the jets 40 are shown as rotated closest to the horizontal to direct water into the tube gaps 28 . as the jets rotate from a downward vertical position to near horizontal , the jet reaction forces the head assembly 44 towards the divider plate 32 . a locking plunger 46 ( that will be described in more detail hereafter ) maintains the head assembly 44 laterally fixed by reacting against the divider plate 32 , thus maintaining angular alignment of the cleaning spray to the tube gaps . two or more rail assemblies 48 , which are joined together , are used to translate the head assembly 44 along the tube lane within the tube bundle . the rail assemblies 48 also provide the means for passage of high pressure flow water along with rotation of the nozzles . fixed to the rear rail assembly is oscillator assembly 50 . the oscillator assembly provides the rotational drive for the sweeping motion of the jets 40 . water introduced into quick coupling 52 , connected to swivel joint 54 , enables flexible motion of a water feed hose . index drive assembly 56 , attached to intermediate plate 58 and supported by mount assembly 60 , provides precise translation of the rails 48 into or out of the steam generator 10 . the cross sectional geometry of the rail assemblies 48 provides sufficient flexible rigidity such that no additional supports are necessary to position the head assembly seven feet or more into the steam generator . each assembly will be described hereafter . for cleaning to be effective jets 40 must be positioned at each tube gap . proper index of the jets with the tube gaps can be reset or verified by the alignment marks 62 with adjustable pointer 64 . fig6 shows a cross section of the head 44 , rail 48 and oscillator 50 . passage 66 is used to deliver high pressure water ( approximately 3 , 000 psi ) from the oscillator 50 to the head assembly 44 . drive shaft 68 transfers rotation motion from the oscillator 50 to the head assembly 44 . both the oscillator 50 and the rail 48 are similar to those disclosed in u . s . patent application publication no . 2011 / 0079186 . in the embodiment described herein , the drive shaft 68 is located below the water passage 66 such that the axis of rotation of the nozzle 40 is near the bottom of the head assembly 44 . this arrangement is desirable to place the nozzle 40 close to the steam generator tube sheet , support the nozzle , and allows placement of the components in the head assembly 44 that are required for its functionality . fig7 is an enlarged sectional view of the oscillator 50 , also disclosed in u . s . patent application publication no . 2011 / 0079186 . rotation of the drive shaft 68 is limited to +/− 90 degrees by pin 70 in slot 72 . it is important to prevent the jets 40 from inadvertently rotating in an upward direction which may add excessive stress to the rail assemblies 48 . fig8 a is an elevational sectional view of the head assembly 44 which provides the means to direct high pressure water spray accurately down the tube gaps . high pressure water enters passage 66 and is directed around annular opening 74 of the nozzle body 76 . water then flows through angular port 78 into offset port 80 . displacing port 80 from the nozzle rotational axis 82 provides clearance for the jets 40 to sweep in the limited space between the divider plate 32 and the inner row of tubes 24 . sealed ball bearings 84 provide rigid rotational support for the approximately 50 pound radial load on the nozzle body 76 . two seals 86 that contain the high pressure within annular opening 74 are leak limiting in order to provide minimal rotational friction . since some water may leak by the seals , front openings 88 provide a leak path to prevent water pressure building up at the rear sealed bearing 84 . low pressure seal 90 , fixed in place with pin 92 , provides a barrier to redirect high pressure seal leakage through port 94 . without low pressure seal 90 water may pass along the drive shaft 68 and out of the steam generator . as mentioned earlier , a locking plunger 46 maintains the head assembly 44 laterally fixed by reacting against the divider plate 32 ; thus maintaining angular alignment of the cleaning spray to the tube gaps . the locking plunger 46 is integral to the head assembly 44 . fig8 b shows a cross section taken at the lines a - a through the head assembly 44 shown in fig8 a . fig8 c is an enlarged sectional view which shows the locking plunger partially depressed by the divider plate 32 . referring to fig8 c , during translation of the head assembly 44 into or out of the steam generator , piston 96 is biased against the divider plate 32 with compression spring 98 . the force from the spring 98 is low enough ( less than 0 . 5 pounds ( 0 . 23 kilograms )) to prevent excessive lateral deflection of the head assembly 44 . the piston 96 is constructed from a polymer such as acetal to permit low friction to exist between the divider plate 32 and the piston 96 to protect the divider plate from damage . to increase rigidity of the outside diameter of the polymer piston 96 , stainless steel ring 100 is utilized and captured by end cap 102 . the stainless steel ring 100 is not susceptible to diameter changes due to hydroscopic swelling and provides a higher co - efficient of friction for the “ locked ” state . surrounding stainless steel ring 100 is lock ring 104 and o - ring 106 . for high strength , moderate co - efficient of friction , lower modulus of elasticity , and lower water absorption , lock ring 104 is preferably constructed from peek ( polyether ether ketone ). o - ring 106 and lock ring 104 are captured between the head assembly housing 108 and cover plate 110 . seal ring 112 prevents loss of fluid so that the annular chamber 114 can be pressurized . referring to fig8 a and 8c , the locking plunger functions as follows . the lance assembly is initially aligned to be parallel with the tube lane ( as described hereafter ) and close enough to the divider plate such that the lock plunger piston 96 will just touch or is depressed by the divider plate . a small amount of radial clearance between the outside diameter of ring 100 and the inside diameter of lock ring 104 provides a slidable interface for a spring 98 to keep piston 96 in intimate contact with the divider plate 32 . prior to pressurized water flow , the lance head assembly is positioned within the steam generator with the jets facing downward as shown in fig8 a . increased water pressure initiates fluid flow into the head at port 66 . the smaller diameter of the jets 40 restricts water flow such that the pressure at port 66 is elevated to the system pumping pressure . a passage is available so the high pressure water can flow into port 116 and into the annular chamber 114 . pressurized water in the annular chamber 114 forces o - ring 106 radially inward against lock ring 104 which also presses lock ring 104 around steel ring 100 . the radial clearance between the inside diameter of lock ring 104 and the outside diameter of steel ring 100 is small enough to maintain the deformation of the lock ring well within the elastic limit of the material which assures that when the system is depressurized the lock ring will force the o - ring 106 radially outward and permit free travel of the piston 96 . to prevent axial movement of the piston 96 when the system is pressurized , lock ring 104 is axially captured between housing 108 and cover plate 110 . as the system is pressurized with the jets facing downward water flow through the jets produces a reaction force that lifts the head in an upward direction ( not laterally ) that is restrained by the rail assembly 48 . with the system at pressure , piston 96 is held fixed with respect to the divider plate 32 . during cleaning , rotation of the jets into the tube bundle will create a horizontal reaction forcing the head assembly 44 in the direction of the divider plate 32 . locked piston 96 prevents lateral movement of the head which maintains angular alignment of the jets 40 with the tube gaps . fig9 a , 9 b and 9 c show the mount assembly 60 and intermediate plate 58 attached to a steam generator 10 . the index drive assembly ( not shown in fig9 ) is attached to intermediate plate 58 with bolts engaged in threaded holes 118 or 120 depending on the desired side of the divider plate the lance fixture is to traverse . corresponding dowel pins 122 or 124 accurately position the index drive relative to the intermediate plate 58 . once the intermediate plate position is adjusted , the index drive can be removed and positioned for either side of the divider plate 32 with little or no adjustment . intermediate plate 58 is secured to mount assembly 60 with four clamp knobs 126 . height adjusters 128 permit roll , pitch , and vertical position adjustment of the intermediate plate 58 . lateral and angular position ( yaw ) of the intermediate plate 58 is adjustable with screws 130 . slotted openings 132 in the mount assembly 60 permit lateral and angular motion . the index drive assembly 56 is shown in fig1 - 14 . while the index drive assembly 56 is similar to that described in published patent application u . s . 2011 / 0079186 , the differences are the addition of the lateral support mechanism and the bearing support for increase cantilever load from the rail assemblies 48 . captured top mounting screws are also utilized . front and side elevation views are respectively shown in fig1 a and 10b . the main parts of the index drive are the lower housing 134 , upper housing 136 and front cover 138 . captured screws 140 are used to couple the lower housing to the intermediate plate 58 on the mount assembly 60 . rail assembly 48 is shown in phantom as it would be located in the index drive 56 . fig1 is a plan view of the index drive 56 . access to the captured screws 140 is shown along with the adjustable pointer 64 . fig1 is a sectional view taken along the lines b - b of fig1 a and shows the lateral clamp mechanism for the rail assemblies 48 . two ball bearings 142 supported by shafts 144 position the rails 48 laterally a fixed distance relative to the lower housing 134 while enabling low friction translation of the rails into or out of the steam generator . a second set of ball bearings 146 supported on shafts 148 are attached to bracket 150 . tightening of knob 152 on threaded shaft 154 moves bracket 150 along with bearings 146 toward the rails 48 which puts the rails in intimate contact with the bearings 142 . dowel pins 156 press fit into bracket 150 have sufficient radial clearance to provide a slidable coupling with holes in the front cover 138 . it is desirable to provide a specific lateral clamping load on the rails with bearings 142 and 146 . too much clamp force will increase rolling friction and possibly overstress bracket 150 . too little clamp force may permit the rails 48 to move laterally causing misalignment of the jets 40 . at the point of contact of bearings 142 and 146 with the rail 48 , there is a predetermined gap 158 between the bracket 150 and front cover 138 . further tightening of knob 152 closes gap 158 causing bracket 150 to act as a leaf spring with the correct lateral loading . fig1 is a sectional view taken along the lines of c - c of fig1 and shows a rail section 48 positioned between bearings 142 and 146 such that the rail is laterally supported relative to the lower housing 134 . vertical support of the rail 48 is achieved by drive wheel 160 rotatably fixed to the lower housing 134 with bearings 162 and 164 . a second idler ( not shown ) is also located in the lower housing . two idler assemblies 166 in the upper housing 136 complete the vertical support mechanism . fig1 is a sectional view taken along the lines d - d of fig1 . upper housing 136 is slidably coupled to the lower housing 134 with twin shafts 168 passing through linear ball bearings 170 . tightening of the threaded knob 172 forces the upper housing 136 towards the lower housing 134 providing rigid support of the rail 48 in the vertical direction . for effective sludge removal , it is important that the jets 40 are positioned at the tube gaps and the angle of the jets is parallel to the tube gaps . when reacting on the divider plate to limit lateral deflection , it is also important to verify the distance from the lance to the divider plate is within acceptable limits . the alignment tool performs these functions and works on either side of the divider plate . fig1 shows the alignment tool consisting of an arm assembly 174 and a pointer assembly 176 which may be attached to one or more rails 48 . rail drive shaft 68 is used to communicate rotational motion between the arm 174 and the pointer 176 . fig1 a and 16b respectively show front and sectional , elevational views of the arm assembly 174 . swing arm 178 attached to shaft 180 is rotatably coupled to housing 182 with a pair of ball bearings 184 . the ball bearings 184 are axially restrained to shaft 180 by means of nut 186 and inner race spacer 188 . retaining screw 190 axially secures the rotatable assembly within the housing 182 . tapered coupling 197 engages the rail drive shaft 68 which is axially loaded to eliminate backlash . ball plunger 192 may engage anyone of three grooves 194 to hold the swing arm upward ( as shown ) or 90 degrees rotated clockwise or counterclockwise . during translation into or out of the steam generator , the swing arm 178 is positioned in the vertical position . the 90 degree position is used for setting the index pointer ( described hereafter ). plastic guides 196 and 198 installed over mating “ c ” shaped profiles on the housing 182 are slidably fixed to the housing 182 with spring pins 200 . the plastic guides 196 and 198 prevent metal to metal contact with the steam generator tubes 24 . lower plastic guide 198 contains holes 202 to permit free engagement with the drive pins 204 ( shown in fig1 b ). fig1 and 18 are respectively rear and sectional , elevational views of the pointer assembly 176 . rear block 206 is coupled to a rail section 48 with capture screws 208 . dowel pins 210 provide accurate position of the rail / block assembly . split bushings 212 provide a suitable rotational and translational coupling between the drive shaft 214 and the rear block 206 . pointer 216 is rotatable coupled to the shaft 214 with a square drive 218 . a small clearance in the square drive permits translation of the shaft 214 within the pointer 216 . compression spring 220 located between bushings 212 provides a separation force between the split bushings 212 . the rear bushing forces pointer 216 away from the block 206 ( to prevent rubbing ) and against thrust washer 222 which is held axially fixed by retainer 224 . the outside diameter of the shaft 214 is sufficiently larger than the installed inside diameter of the front split bushing 212 to prevent movement of the bushing on the shaft . therefore , compression spring 220 provides an axial load to the shaft 214 to the left of the figure . the axial shaft load is then applied to each rail drive shaft and the arm assembly 174 to eliminate rotational backlash . referring to fig1 , there are two sets of scribe lines . the top set labeled “ dp ” is for measuring the distance from the lance to the divider plate . the lower set labeled “ r 1 ” is for measuring the distance from the row 1 tubes ( row adjacent to the center tube lane ) to the lance . which set of scribe lines are used , i . e ., left or right , depends on which side of the divider plate the lance is mounted . the alignment tool functions on either side . in order to provide a direct correlation between the radial translation of the swing arm 78 in fig1 and the actual linear displacement of the lance to the tubes ( or the divider plate ), the spacing between the scribe lines is scaled accordingly . linear displacement values between the lance and the tubes permits a direct relation for calculated positioning of the lateral adjustment screws ( 130 in fig9 ). fig1 shows the swing arm 178 at the tube gap alignment position . initially , the swing arm 178 is rotated upward so the alignment tool can be translated into the steam generator . once within the tube lane , the swing arm 178 is rotated towards the tubes while checking for interference with a tube 24 . if interference is realized , the alignment tool is translated along the tube lane until the swing arm 178 can be rotated 90 degrees . with the swing arm rotated 90 degrees , the tool is moved inward ( to the left of fig1 ) until the front surface of the swing arm contacts a tube 24 . this is the position where the jets align with the tube gaps . referring to fig5 , the index pointer 64 is then positioned to correspond to one of the marks 62 or the joint where two rails are connected together . to align the angle of the jets 40 parallel to the tube gaps , the swing arm 178 is rotated to the vertical position so the alignment tool can be moved into or out of the steam generator . if the alignment tool is moved to the adjacent rail mark 62 , or every other mark , the alignment tool will be positioned with respect to the tubes as shown in fig2 . swing arm 178 is then rotated towards the tube 24 until edge 226 makes contact . as described earlier , the “ r 1 ” distance is measured on the pointer assembly 176 . the swing arm 178 is then moved back to the vertical position so the alignment tool can be repositioned into or out of the steam generator to obtain further “ r 1 ” measurements . since the linear spacing of the rail marks 62 are known and the “ r 1 ” readings correspond to linear displacement , the angular misalignment with respect to the tubes can be directly calculated . a corresponding correction can be made with the lateral adjustment screws described earlier . after making angular corrections , it may be necessary to reset the index pointer 64 with the swing arm in the position shown in fig1 . the final function of the alignment tool is to measure the distance to the divider plate 32 . as shown in fig2 , the swing arm is rotated until edge 228 contacts the divider plate 32 . the displacement is measured with the “ dp ” scale on the pointer assembly 176 . corrections to lateral displacement are also made with the lateral adjustment screws described earlier . although the sludge lance disclosed is specifically suited for a steam generator with a divider plate , the alignment tool can also be applicable to steam generators without a divider plate . while specific embodiments of the invention have been described in detail , it will be appreciated by those skilled in the art that various modifications and alternatives to those details could be developed in light of the overall teachings of the disclosure . accordingly , the particular embodiments disclosed are meant to be illustrative only and not limiting as to the scope of the invention which is to be given the full breadth of the appended claims and any and all equivalents thereof . | 5 |
the present invention is a device which in fig1 has an flat elongated surface of generally rectangular shape which serves as a base 10 and is a strip mountable to a surface such as a wall 12 . fig1 and 2 show that at approximately the midpoint of the width of the base 10 of present invention two closely spaced inner parallel walls 14 rise upward at right angles , with each of the two inner walls terminating in a hooked jaw 16 . in cross - sectional view , fig2 , 4 , and 6 , the two inner jaws curve upward and inward in the form of a question mark , each jaw 16 facing the other . each inner jaw is capable of mating with a corresponding exterior locking hooked jaw 18 . in an alternative embodiment , the two parallel walls 14 may be replaced by a single wall ( not shown ) from which the hooked jaws 16 extend . the embodiment having two walls 14 , is preferred as it is easier to work with . in its open and disengaged state , fig2 the device presents two exterior walls 20 which extend outward from the base 10 in the same direction as the two inner walls 14 and rise from the perimeters of the device &# 39 ; s elongated base 10 measuring approximately three times the length of the inner walls 14 . located on the exterior wall at approximately one - third up from the base 10 , is a pre - determined bend or flexible joint 22 which allows the exterior wall 20 to bend inward and gives the walls sufficient flexibility so as allow them to be manipulated downward so that the device may assume its engaged state , fig1 , 5 , and 6 . likewise , the flexible joints 22 allow the exterior walls 20 to be bent outward when the device is in its disengaged state , fig2 and 3 . the flexible joint 22 is preferably formed of three pieces of flexible material such as a flexible plastic and these pieces may be fixedly secured together in ways known to those skilled in the art . one typical way in which these three pieces may be joined is by fusing or welding them together . as shown in fig4 a , the joint 22 is formed by the exterior wall 20 , a central portion 28 and wall 30 . alternatively , the flexible joint may be made in one piece by conventional molding techniques known to those skilled in the art . where the tri - partite joint 22 is utilized , the exterior wall 20 may be comprised of a plastic such as polyvinyl chloride ( pvc ), while the central portion 28 may be comprised of a flexible plastic such as dupont hytrel ™ or any other suitable flexible plastic although these materials may be varied depending upon the circumstances of use and desired flexibility properties known to those skilled in the art of such materials . terminating the tip of each exterior wall 20 is a hooked . jaw 18 which in cross - sectional view curves inward from distal end of both exterior walls 20 . the exterior hooked jaws 18 are capable of mating and locking with the previously described inner jaws 16 of the device . the two sets of jaws may also be unlocked or disengaged to permit the exterior walls 20 to bend outward in the disengaged state of the device of the present invention . to engage the device , as shown in fig1 , 5 , and 6 , the exterior walls 20 which are flexible owing to the predetermined flexible joint 22 can be bent downward and toward the midpoint of the elongated base 10 . as the exterior walls are pressed downward , the exterior jaws 18 contact and mate with the inner jaws 16 thus engaging the locking mechanism of the device . once engaged , fig4 the exterior walls 20 arch inward toward the midpoint of the device . the predetermined flexible joint 22 in the exterior walls 20 allows the last two - thirds of the exterior wall to bend downward thus lowering and permitting the exterior jaw 18 to latch underneath the inner locking jaw 16 . as the pairs of inner and exterior jaws have locked in place , the exterior walls form a semicircular convex arch fig1 , 5 , and 6 , and define the seam 24 between two adjoining fabric panels . with the device in its locked and engaged state , fig1 , 5 , and 6 , a bend at the distal end of the exterior wall 20 and at the base of each exterior jaw 18 forms the opposing lips of a central seam 24 , fig1 and 5 , which runs down the midpoint of the length of the device of the present invention . prior to engaging and locking the device , the ends of the desired lengths of fabric 26 which will form the seam 24 of the panel are admitted into the central interior cavity of the disengaged device alongside its interior length as shown in fig3 . with the fabric ends inserted into the device , the exterior walls 20 of the device may be manually bent inward toward the mid - section of the device and the two pairs of jaws locked and engaged . in this way , the ends of the fabric are trapped and secured as show in fig4 . with the ends of the fabric 26 secured in the device of the present invention , the fabric 26 is stretched taut across the area to be defined as the panel and its opposite end is secured into a separate , adjacent locking jaw of the device of the present invention , fig4 , and 6 . in this way , a uniform fabric panel is created by the system . optionally , a double - faced conventional adhesive ( not shown ) will run along the length of the underside of the external wall 20 adjacent to its jaw 18 . this optional adhesive is to aid installers in positioning and fitting the fabric 26 prior to actually engaging and locking the device of the present invention . the device disclosed may be manufactured in a variety of rigid materials , most typically , rigid pvc , as this is acceptably flame retardant . metal or other polymers may also be used . because the device of the present invention can be manufactured at approximately the same cost as the manufacture of the two tracks that it replaces , the benefits of the device of the present invention are gained with no increase in cost of manufacturing materials . the device of the present invention may be manufactured at a range of scale and dimensions . a typical embodiment would extend approximately one inch from the wall surface to which it is mounted with the device in its locked and engaged state , however , the device may be larger or smaller depending on the exigencies of its application . without further elaboration , the foregoing so fully illustrates the invention that others may , by applying current or future knowledge , readily adapt the same for use under various conditions of service . | 4 |
fig1 shows a print material removing apparatus according to an embodiment of the present invention . the apparatus comprises a treating bath 3 opened upwardly . the treating bath 3 is filled with a liquid 2 for removing the print material on a sheet 1 as a recording member . on the left side of the treating bath 3 in fig1 is provided a sheet feed roller 4 , while on the right side is provided a drying roller 5 . at the downstream side of the sheet feed roller 4 is disposed a first shower unit 6 for showering the both surfaces of the sheet 1 with the liquid 2 to removing the print material on the sheet 1 . at the upstream side of the drying roller 5 is disposed a second shower unit 7 for washing down the print material remaining on the sheet 1 . as the liquid for removing the print material , in the case of removing the print material by dissolving or swelling the print material , organic solvent having a property of dissolving or swelling the print material or such organic solvent with additive such as surface - active agent can be used . in the case of removing the print material by swelling the surface of the sheet , liquid such as water or aqueous solvent having a property of swelling the surface of the sheet , or such liquid with additive such as surface - active agent can be used . inside the treating bath 3 are disposed first and second sheet conveying rollers 8 and 9 between which a scraping roller 10 is disposed . between the sheet feed roller 4 and the first sheet conveying roller 8 , between the first sheet conveying roller 8 and the scraping roller 10 , between the scraping roller 10 and the second sheet conveying roller 9 , and between the second sheet conveying roller 9 and the drying roller 5 , there are disposed sheet guides 11 , 12 , 13 and 14 for guiding the both side of the sheet 1 . outside the treating bath 3 is arranged a liquid circulation line 16 which starts from the bottom of the treating bath 3 via a pump 15 , leads to the first shower unit 6 and the second shower unit 7 , and returns to the treating bath 3 from the first and second shower units 6 , 7 . above the treating bath 3 is disposed a feed cartridge guide 17 having a configuration of rectangular plate for guiding and mounting a feed cartridge 31 which will be described hereinafter . as shown in fig2 the feed cartridge guide 17 is formed with a mounting hole 18 . on the under surface of the feed cartridge guide 17 , a cross bar 19 is fixed so that the cross bar 19 crosses the mounting hole 18 . the cross bar 19 is provided with two projections 20 projecting upwardly into the mounting hole 18 . from the mounting hole 18 of the feed cartridge guide 17 is arranged a liquid feed line 22 to the top of the treating bath 3 via a gate valve 21 . the gate valve 21 is arranged to close when a liquid level sensor 23 detects a predetermined liquid level . the gate valve 21 has a lock mechanism for holding the valve in a closing state if necessary , for example , in the case of jam treatment . there is arranged a circulation hose 26 which starts from the bottom of the treating bath 3 via a cock 24 and a pump 25 with built - in filter , and leads to a feed port 34 of a feed cartridge 31 which will be described hereinafter . the cock may be opened at predetermined time interval when no maintenance work such as jam treatment is conducted . under the treating bath 3 is disposed a discharge cartridge guide 27 having a configuration of rectangular plate for guiding and mounting a discharge cartridge 32 which will be described hereinafter . the discharge cartridge guide 27 is formed with a mounting hole 28 in the same manner as the feed cartridge guide 17 . in the discharge cartridge guide 27 , no provisions such as the cross bar 19 , its projections 20 and the liquid feed line 22 in the aforementioned mounting hole 18 of the feed cartridge quid 17 are provided . there is arranged a discharge circulation hose 30 which starts from the bottom of the treating bath 3 via a cock 29 , and leads to a discharge port 34 of a discharge cartridge 32 . the feed cartridge 31 and the discharge cartridge 32 to be mounted on the feed cartridge guide 17 and the discharge cartridge guide 27 respectively will be explained below on the assumption that both are same . the two cartridges 31 , 32 are rectangular vessels respectively . on the top surface of each cartridges 31 , 32 is formed with a circular feed port 34 closable with a cap 33 . on the bottom surface of each cartridges 31 , 32 is formed with a discharge port 36 comprising two openings 35 , 35 . the discharge port 36 is also closable with a cap 33 . inside the discharge port 36 is rotatably attached a bow - like slide valve 38 around an axis 37 as shown in fig3 so that the two openings 35 are opened and closed by the rotation of the slide valve 38 . operation of the print material removing apparatus having above construction will be described hereinafter . the printed sheet 1 is fed in a direction of arrow in fig1 by the sheet feed roller 4 and showered with the liquid by the first shower unit 6 . then the sheet 1 passes through the sheet guide 11 and is immersed in the liquid 2 in the treating bath 3 . thus , in the case that the liquid for dissolving or swelling the print material is used , the liquid penetrates into the print material on the sheet to dissolve or swell the print material . in the case that the sheet having a water - swelling surface layer is used , an aqueous solvent penetrates into the surface layer of the sheet to swell the sheet surface layer . as a result , adhesiveness between the print material and the sheet surface are weakened , leading to a condition that the print material is easily removed from the sheet surface . it is also possible to extend the penetration time of the sheet 1 into the liquid 2 in the treating bath 3 by temporarily stopping conveying the sheet 1 in order to enhance the penetration of the liquid . consequently , the sheet 1 is conveyed to the scraping roller 10 through the first sheet conveying roller 8 and the sheet guide 12 , where the print material on the sheet 1 is scraped . then , the sheet 1 emerges from the liquid 2 through the sheet guide 13 , the second sheet conveying roller 9 and the sheet guide 14 . after the print material remaining on the sheet 1 is washed down by the second shower unit 7 , the sheet 1 is dried by the drying roller 5 and discharged outside of the apparatus . as a result , the sheet 1 becomes reusable . when occurrence of sheet jam is detected by a jam sensor s during the removing operation of the print material , the gate valve 21 is locked to keep closed . then , the cock 29 at the bottom of the treating bath 3 is opened to transfer the liquid 2 in the treating bath 3 to the discharge cartridge 32 via the discharge hose 30 . in this case , prior to opening the cock 29 , the discharge cartridge 32 has been mounted beforehand on the discharge cartridge guide 27 by engaging the discharge port 36 closed by the cap 33 with the mounting hole 28 of the discharge cartridge guide 27 , while the discharge hose 30 has been inserted into the feed port 34 opened by taking off the cap 33 . the liquid 2 in the treating bath 3 is not necessarily transferred thoroughly but may be transferred to an extent that the liquid level becomes slightly lower than the conveying path of the sheet 1 so that the jam treatment can be easily conducted . if the liquid 2 is deteriorated , the discharge cartridge 32 would be recovered to dispose of the liquid 2 as a waste liquid . if the liquid 2 is reusable , the discharge cartridge 32 would be interchanged with the feed cartridge 31 mounted on the feed cartridge guide 17 . in order to dismount the feed cartridge 31 from the feed cartridge guide 17 , as shown in fig4 the feed cartridge 31 is slid in a direction of arrow “ a ” from a state shown in two - dots chain line and rotated by a predetermined angle around the discharge port 36 . then , the slide valve 38 is pushed by the projections 20 of the mounting hole 18 to relatively rotate , whereby the discharge port 36 is closed . consequently , upon lifting up the feed cartridge 31 , the feed cartridge 31 can be dismounted from the feed cartridge guide 17 without spilling the liquid . subsequently , in order to mount the discharge cartridge 32 on the feed cartridge guide 17 , as shown in fig4 the discharge cartridge 32 is put on the feed cartridge guide 17 in a rotating state with respect to the feed cartridge guide 17 in a predetermined angle so that the discharge port 36 of the discharge cartridge 32 can be fit in the mounting hole 18 of the feed cartridge guide 17 . then , the discharge cartridge 31 is slid in a direction of arrow “ b ” from a state shown in solid line and rotated by a predetermined angle around the discharge port 36 . then , the slide valve 38 is pushed by the projections 20 of the mounting hole 18 to relatively rotate , whereby the discharge port 36 is opened . consequently , the feed cartridge 31 can be mounted on the feed cartridge guide 17 without spilling the liquid . after completion of the jam treatment , the switch sw is on and the gate valve 21 of the feed line 22 is unlocked to open . as a result , the liquid in the discharge cartridge 32 mounted on the discharge cartridge guide 17 flows out of the discharge hole 35 and returns to the treating bath 3 through the feed line 22 . when the liquid 2 in the treating bath 3 becomes to the predetermined liquid level , the liquid level sensor 23 detects this , allowing the gate valve 21 to be closed . thus , the print material removing apparatus can be operated again . in the case that a serviceman cleans the treating bath 3 in his regular service , the liquid 2 in the treating bath 3 is transferred thoroughly to the discharge cartridge 32 . thus , he can take the treating bath 3 with no liquid out of the apparatus to clean it . after completion of cleaning , the liquid is fed from the feed cartridge 31 to the treating bath 3 , or the liquid is returned to the treating bath 3 by mounting the discharge cartridge 32 instead of the feed cartridge , whereby the apparatus can be immediately operated again . if the liquid is deteriorated , the liquid is discharged into the discharge cartridge 32 and then fresh liquid is fed from a new feed cartridge 31 . in fig1 the circulation hose 26 is provided so as to constantly keep the liquid clean by circulating the liquid . the print material such as toner and other impure ingredient are removed by the filter build in the pump 25 so as not to enter into the circulation hose 26 . in the case that the liquid is consumed little by little due to takeout by adhering to the sheet or vaporization and becomes short , the liquid can be replenished by dismounting the feed cartridge 31 to fill it with fresh liquid and then mounting it again , or by mounting an another feed cartridge 31 filled with fresh liquid . in order to simplify the construction of the apparatus , it is possible not to provide the circulation hose 26 . in this case , at the time when the feed cartridge 31 becomes empty , the feed cartridge may be exchanged with a new feed cartridge 31 filled with fresh liquid , or the feed cartridge 31 may be dismounted to fill it with fresh liquid and then mounted again . in the aforementioned embodiment , two cartridges 31 , 32 have the same configuration . however , those may have different configuration from each other if the position of the feed port 34 and the discharge port 36 , i . e ., the dimensions “ a ”, “ b ”, “ c ” and “ d ” from the side surfaces are same . fig6 shows an another embodiment of the present invention , in particular an another embodiment of valve construction of a discharge port 47 of a feed cartridge 41 and a discharge cartridge 42 . in this embodiment , a valve 44 is provided inside the discharge port 47 so that a valve shaft 45 extends to the outside from the inside of the discharge port 47 . the valve 45 is biased downwardly by means of a spring 46 so that the valve 45 can close openings 43 of the discharge port 47 formed on the bottom of the cartridges 41 , 42 . the discharge port 47 is closable with a cap 48 . on the other hand , on the inner surface of the liquid feed line 22 of the feed cartridge guide 17 is formed a protrusion 49 facing to the valve shaft 45 of the valve 44 via the mounting hole 18 . thus , when the cartridges 41 , 42 are mounted on the discharge cartridge guide 17 , the valve shaft 45 of the valve 44 is push up by the projection 49 as shown in two - dots chain line in fig6 causing the openings 43 to be opened . a bias means for biasing the feed cartridge 41 downwardly may be provided above the feed cartridge 41 . in this embodiment , comparing to the embodiment of fig2 the cartridges 41 , 42 can be easily handled because the cartridges 41 , 42 are mounted by just putting them on the cartridge guide 17 . although the present invention has been fully described by way of the examples with reference to the accompanying drawings , it is to be noted here that various changes and modifications will be apparent to those skilled in the art . therefore , unless such changes and modifications otherwise depart from the spirit and scope of the present invention , they should be construed as being included therein . | 6 |
fig1 a and 1 b illustrate the situation of water refilling in steam generating apparatuses according to the state of the art . when the water reservoir of the steam generating apparatus is emptied during operation , the inner surfaces of the boiler ( shell , heating plate ; not shown ) are usually still hot , when the user is beginning to refill water . to facilitate the refilling , a cup - shaped or funnel - shaped water inlet 2 is provided . the user usually wants to minimize the time required for the refilling process and tries to pour as much water as possible . due to the cup - shaped form of the water inlet 2 and the narrower inner diameter of the pipe 4 leading to the boiler , the water inlet 2 is initially completely filled with water . the cold water being poured in gets in contact with the hot inner surfaces of the boiler and evaporates immediately . this undesirably generated steam escapes through the water filling inlet pipe . this situation is shown in fig1 a , where the water being poured in meets the steam escaping the boiler . since the amount and speed of the steam are considerable , the situation shown in fig1 b happens : the water in the inlet cup 2 is carried along or displaced and splashes out of the water inlet cup 2 . this is an uncomfortable and unsafe situation for the user . fig1 c and 1 d illustrate a faster and safer refilling . fig1 c is a detailed cross sectional view of the filling end 16 of the water filling inlet pipe 14 of the steam generating apparatus 10 ( fig1 d ). the steam generating apparatus 10 comprises a boiler 12 for heating water . the boiler is equipped with heating elements 22 being in a thermal contact with a heating plate 24 at the bottom of the boiler 12 . further , temperature switches 26 , 28 are provided . the water filling inlet pipe 14 comprises besides the filling end 16 an elbow - like bending portion 20 and a boiler inlet end 18 . the boiler 12 is connected with an iron 30 via a steam hose 32 . an electro - valve 34 is provided for the steam hose 32 between the boiler 12 and the iron 30 . the detail operation of the steam generation , delivering the steam from the boiler 12 to the iron 30 and applying the steam is discussed in more detail relating to the embodiments to follow . as depicted in fig1 c , by providing an inner diameter of the water filling inlet pipe 14 , which is constant or increasing from the filling end 16 to the boiler inlet end 18 by omitting the cup - shaped inlet portion , as can be seen in fig1 a and 1 b , and by providing a wider inner diameter the problems mentioned above can be avoided . the wider inner diameter of the water filling inlet pipe 14 allows for faster refilling by reducing the filling time by 30 - 50 % and provides a better visibility of the water level for the user . omitting the cup form prevents water damming at the filling end 16 of the water filling inlet pipe 14 . air and steam are allowed to leave the boiler without colliding with water closing the filling end 16 . further , the water filling inlet pipe 14 comprises an elbow 20 to prevent steam from splashing through the water filling inlet pipe 14 . additionally , the elbow shape causes water being poured in , to flow down the vertical surfaces of the boiler 12 . in consequence , the steam generated primarily hits the shell first , making it safer for the user . further , the formation of a thin water film is enhanced , which facilitates the prevention of a sudden steam generation . these features can also be combined with a tilting of the boiler by five to ten degrees . fig2 shows a steam generating apparatus according to the present invention . the steam generating apparatus 50 comprises a boiler 52 for heating water . the bottom of the boiler 52 is in thermal contact with a heating plate 72 . the heating element 74 as well as two temperature switches 76 , 78 are also thermally connected with the heating plate 72 . the boiler 52 is provided with an electro - valve 80 coupled with a steam duct 58 connecting the boiler 52 with a steam applying means , e . g . an iron 60 . a stand 66 is provided for the iron 60 . the boiler 52 further comprises water filling inlet pipe 54 . the water filling inlet pipe 54 is provided with an inner thread 68 being connectable with a screw 56 . in that portion of the water filling inlet pipe 54 , where the thread 68 is arranged , a branching of a by - pass duct 62 connecting the water filling inlet pipe 54 and the steam duct 58 is provided . during steam generating operation , the screw 56 is completely screwed into the thread 68 , thus closing the water filling inlet pipe 54 and the by - pass duct 62 . if the user has to refill the boiler 52 because of a lack of water , he unscrews the screw 56 . during the slow transversal movement of the screw 56 inside the water inlet - filling pipe 54 the branching of the by - pass duct 62 is opened . then steam present inside the boiler 52 is able to leave the boiler 52 via the branching of the water filling inlet pipe 54 and the by - pass duct 62 . thus , the boiler 52 is depressurized by coupling the inside of the boiler 52 with the atmosphere , in this case over the iron 60 . the generated steam inside the boiler leaves the boiler 52 , which is thus depressurized before the screw 56 has completely been removed . the by - pass duct 62 may be connected with the steam duct 58 or directly connected with the iron 60 . as shown in fig3 , a by - pass duct 64 connecting the water filling inlet pipe 54 directly with the stand 66 may be provided . depending on the overall construction of the steam generating apparatus 50 either the iron 60 or the stand 66 may be preferred for emitting the steam before opening the boiler 52 in a safe way . fig4 shows a further steam generating apparatus . the steam generating apparatus 100 comprises a boiler 102 , comprising a water inlet 104 , heating elements 106 and two temperature switches 120 , 122 . the boiler 102 is connected via a steam duct 110 with an iron 112 . the steam duct 110 may be closed and opened with an electro - valve 108 . in operation , the temperature switch 120 operates the electro - valve 108 . the temperature switch 120 has a threshold temperature ta , i . e . when the temperature measured by the temperature switch 120 is greater than ta the temperature switch closes . this causes the electro - valve 108 to open , thus connecting the boiler 102 directly via the steam duct 110 with the iron 112 . the second temperature switch 122 opens , when its threshold temperature tb , e . g . smaller than ta , is exceeded by the measured temperature . when the water level inside the boiler 102 reduces , and the heating elements 106 are not fully covered by water , the temperature increases . during normal steam operation , the temperature inside the boiler 112 is lower than tb . in consequence , the heating elements 106 are active , whereas the electro - valve 108 is deactivated and is being triggered only for ejecting steam . in the case of a need for refilling , the temperature inside the boiler 102 is rising and at first is greater than tb . thus , the heating elements 106 are turned off by the first temperature switch 120 . afterwards , the temperature exceeds the threshold temperature ta and the electro - valve 108 is activated and couples the boiler 102 and the steam iron 112 . now , the boiler is being depressurized for allowing the user to open the boiler 102 safely . the temperature relation of ta and tb can be arranged the other way round , i . e . ta is smaller than tb . in this case , the electro - valve 108 is opened before turning off the heating element 106 . fig5 shows a still further steam generating apparatus . a thermistor 118 is mounted onto the boiler shell being in thermal contact with the boiler 102 . the thermistor 118 may be used to electronically control the system to switch on / off the electro - valve 108 and the power for the heating elements 106 in order to control the water level of the boiler 108 . therefore , an electronic control system 116 is provided . the electronic control system 116 is connected with the thermistor 118 , with the heating elements 106 , the electro - valve 108 and with an indicator 120 arranged in a stand 122 . a boiler - opening request may be provided via the thermistor 118 or alternatively / additionally by a user operable switch , providing a signal via the line 124 . the process of turning off the heating element 106 and activating the electro - valve 108 may be performed as discussed above . thereby , the steam may be ejected via the steam duct 110 or alternatively via a by - pass duct 114 , leading to the iron 112 or to the stand 122 . additionally , a third temperature threshold tc may be used . the electronic control system 116 will then turn on the heating element 106 only , if the temperature inside the boiler 102 less than tc . additionally , the electro - valve will only be switched off ( i . e . closed ), when the temperature is lower than tc . this will further ensure that the user is safe during opening and refilling of the boiler 102 via the water - filling inlet 104 . additionally , this information may be provided at the indicator 120 showing the user when to refill the boiler 102 . fig6 shows a flow chart of a method of controlling the pressure of steam . in step s 01 , the target pressure p target is set to a first pressure level p 1 . the pressure level p 1 usually is suitable for generating steam on a continuous basis . in step s 02 , the current pressure level p cur of the boiler is measured . this may be done by a pressure sensor ; alternatively a temperature switch or a thermistor may be utilized . the measured pressure level p cur is compared with the target pressure level p target and the heating power provided to the boiler is adjusted , if appropriate ( step s 03 ). in step s 04 , an indication of a boiler - opening request is determined . if the boiler has to be opened ( e . g . the water level is low , the user pushes a button , etc . ), the target pressure level is lowered to a target pressure level p 2 ( step s 05 ). this may be performed by adjusting the heating power or releasing steam , for example . afterwards , the safe state of the boiler is indicated to the user ( step s 06 ). if in step s 04 no boiler - opening request is present , the process continues in step s 03 . fig7 shows a further steam generating apparatus according to the invention . in comparison to the steam generating apparatus according to fig2 , the steam generating apparatus has an additional opening 126 . while with the steam generating apparatus according to fig2 a rinsing procedure by draining off water from the boiler 52 has to be performed via the opening 54 that is also used for water filling purposes , the steam generating apparatus according to fig7 has a dedicated draining opening 126 . the draining opening 126 is closed by a closing means 128 similar to the closing means 56 at the water filling means 54 . additionally to selectively closing the draining opening 126 , the closing means 128 selectively closes the by - pass duct 130 . this is achieved in a comparable manner as described for the water filling means 54 with reference to fig2 . fig8 shows a still further steam generating apparatus according to the invention . while the embodiments described so far are limited systems in the sense that only a limited amount of water is provided and the boiler has to be refilled manually , fig8 shows an unlimited system comprising a boiler connected to an unlimited water supply via a water inlet port 132 . in relation to the remaining features the embodiment of fig8 is comparable to the embodiment of fig7 . fig9 shows different positions of a valve applicable with the present invention . the valve 136 comprises a valve body 140 and a central valve element 142 . the central valve element 142 has a bore 144 and is rotatable within the valve body 140 . a sealing 146 is provided in order to selectively connect or disconnect the various ports of the valve 132 . one port of the valve is connected to the boiler 52 , namely at the boiler opening 54 for filling or at the boiler opening 126 for draining the boiler . a second port is connected to the atmosphere 138 . a third port is connected to a by - pass duct 62 , 130 leading to the iron 60 . the central valve element 142 can be realized as a cylindrically shaped plug or as a ball - type member . in the first position depicted in fig9 a the valve 136 is completely closed , hence disconnecting the boiler 52 , the atmosphere 138 and the by - pass duct 62 , 130 . in the second position depicted in fig9 b the central valve element 142 has been rotated such that a connection between the boiler 52 and the by - pass duct 62 , 130 is provided , while the valve 136 still disconnects the boiler 52 from atmosphere 138 . in the third position , depicted in fig9 c , the valve 136 connects the boiler 52 with atmosphere 138 , thus allowing filling or draining the boiler 52 ; the by - pass duct 62 , 130 is disconnected from the boiler 52 . according to an alternative embodiment it is possible that in the third position all ports are connected , thus providing also a connection between atmosphere 138 and the by - pass duct 62 , 130 . fig1 shows different positions of a push button applicable with the present invention . in the position shown in fig1 a a mechanically operable valve 134 closes the by - pass duct 62 , 130 . by pushing the valve 134 like a push button , the valve can be transferred in the position depicted in fig1 b , hence opening the by - pass duct 62 , 130 . thus , fig1 shows a possibility to open and close a by - pass duct independently from opening and closing a water filling or draining opening . the essential concept remains , namely exhausting steam from the boiler 52 via the iron 60 . equivalents and modifications not described above may also be employed without departing from the scope of the invention , which is defined in the accompanying claims . | 5 |
chemokines are a superfamily of small , cytokine - like proteins that induce cytoskeletal rearrangement , firm adhesion to endothelial cells and directional migration through interaction with g - protein - coupled receptors . the chemokine receptor / chemokine ligand , cxcr4 / sdf - 1a , is a unique chemokine receptor - ligand pair in that ( i ) the receptor is required in development ( cxcr4 knockouts in mice are developmentally lethal ), and there is only one identified ligand for this receptor ( sdf - 1a , knockouts of which are developmentally lethal ); ( ii ) the cxcr4 receptor has been shown to be a co - receptor for the human immunodeficiency virus ( hiv - 1 ). cxcr4 has been shown to be highly expressed by human breast carcinoma cells , and skin melanomas . it has been found that primary , or normal epithelial cell types : i . e ., normal cells from which tumors ( mammary epithelial cells , and melanocytes respectively ) normally lack expression of the cxcr4 receptor . expression of this chemokine receptor on the cell surface appears to promote metastasis by acting directly on tumor cell migration and invasion . the chemokine receptor / chemokine ligand , cxcr4 / sdf - 1a have also been shown to be critically involved in a growth factor - regulated signaling system in endothelial cells that mediates important steps in postnatal vascular remodeling postnatally . vascular remodeling or angiogenesis is a critical step in the establishment and subsequent fitness of tumors . development of antagonists for the cxcr4 receptor presents a useful means for interfering with tumor progression and metastasis . there is extensive literature on hiv - 1 envelope - induced apoptosis . the gp 120 - induced effects on endothelium , including apoptosis , have been observed as recorded herein . it has now been found that the observed gp 120 - induced effects are mediated through the cxcr4 receptor . this has been shown by using competition assays with cxcr4 or ccr5 antibodies , or the respective ligands for each receptor . many studies have addressed cell killing of uninfected lymphocytes through apoptotic mechanisms that were mediated by the hiv - 1 envelope . in accord with the teachings herein , the affects of gp 120 and sequences therefrom through the cxcr4 receptor , which is expressed by epithelial carcinomas and vascular endothelium , show that this modulator will act to selectively kill tumor cells , while effacing deleterious effects on the normal epithelium , and will act on vascular remodeling of the tumor . compositions containing the gp 120 modulator in cancer cell apoptotic - enhancing amounts may advantageously be administered at therapeutic levels as treatment for cancer . for example , dosages such as 1 to 10 ηg in small animals and from 10 micrograms to 10 milligrams in large mammals may be administered . these agents may be administered in the usual pharmaceutical carriers such as saline , buffered saline , glucose , etc . such compositions may be provided as capsules , tablets , inhalants , sprays , or as liquids or gels for topical application . the modulators may also be administered using solid supports such as a sponges or fiber materials and targeted liposomes and microspheres as carriers . compositions for oral ingestion may be enteric coated or administered on carriers such as microspheres to provide controlled release . the envelope proteins of hiv - 2 , simian immunodeficiency virus ( siv ), and feline immunodeficiency virus ( fiv ) are very similar to the t - tropic gp 120 protein of hiv - 1 in some respects . all have been shown to have variants that interact with the cxcr4 receptor , and in some cases to compete for binding with hiv - 1 gp 120 iiib . thus , these variants could be used to induce a similar effect on tumor cells . soluble hiv - 1 gp 120 protein has been taken through clinical trials as part of the hiv / aids vaccine program . these trials show that , in short / acute exposures , this protein appears not to cause any overt effects in healthy volunteers . the teachings herein further describe these modulators for use in short and limited pulsed exposures . it has been suggested that extracellular nef protein induces cell death in uninfected cells . a number of nef - induced effects have been observed ( not requiring nef antibodies ) on endothelium and epithelium , including apoptosis . in studies conducted during study of the invention , it was found that nef - induced effects are mediated through the cxcr4 receptor . this has been shown by using competition assays with cxcr4 or ccr5 antibodies or their respective ligands for each receptor . the gp120 protein , which was obtained from intracel ( issaquah , wash . ; cat . # 12001 ), is the iiib variant , and was measured to be & gt ; 90 % pure as estimated by coomassie blue gel staining . gp120 was expressed from a baculovirus expression system , and is full length , and glycosylated , rantes and sdf - 1a were human receptor ligands obtained from chemicon ( temecula , calif .). the following antibodies were used : monoclonal mouse anti - human fusin clone 12g5 , migg2a [ cxcr4 ] ( rdi cat # rdi - fusinnabm , research diagnostics inc , pleasant hill road , flanders n . j . 07836 ); immunopurer goat anti - rabbit igg ( h + l ), peroxidase , conjugated rabbit anti - hiv - 1 nef antiserum ( nih aids research and reference reagent program , cat # 2949 ), polyclonal ( rabbit ) anti - cxcr4 antibody ( abr cat . # opa1 - 01101 ); monoclonal ( mouse ) anti - ccr5 antibody ( pharmingen , cat . # 36461a ); monoclonal ( mouse ) anti - cd4 antibody ( american bio - technologies , inc ., cat . # 003101 ). ceramide was obtained from rbi ( natick , mass .). the nef protein was expressed and purified in the inventors &# 39 ; laboratory . overlapping 20 mer peptides encompassing the entire nef protein and overlapping 15 mer peptides encompassing the entire gp 120 protein were obtained from the nih aids research & amp ; reference reagent program ( mckesson hbc bioservices , md ). other specific peptides designed from within gp 120 or nef were obtained from sigmagenosys . normal human mammary epithelial cells ( biowhittaker , walkersville , md .) were grown in megm bulletkit ( biowhittaker , walkersville , md . ), reagentpack ( biowhittaker , walkersville , md .). normal human vascular endothelial cell ( huvec ) ( biowhittaker ) were grown in endothelial cell growth medium ( egm ). the medium was supplemented with 10 ηg / ml human recombinant epidermal growth factor ( hegf ), 1 . 0 μg / ml hydrocortisone , 50 μg / ml gentamicin , 50 μg / ml amphotericin b , 12 μg / ml bovine brain extract ( bbe ) and 2 % v / v fetal bovine serum ( fbs ). breast lines mda - mb - 468 ( atcc # htb - 132 ) were grown in leibovitz &# 39 ; s l - 15 with 2 mm l - glutamine , 90 %; fetal bovine serum , 10 %. mda - mb - 231 ( atcc # htb - 26 ), grown in rpmi 1640 medium containing fetal bovine serum 10 %. mcf7 ( atcc # htb - 22 ), grown in minimum essential medium eagle with 2 mm l - glutamine and earle &# 39 ; s bss adjusted to contain 1 . 5 g / l of sodium bicarbonate , 0 . 1 mm non - essential amino acids , 1 . 0 mm sodium pyruvate supplemented with 0 . 01 mg / ml bovine insulin , and containing fetal bovine serum , 10 %. du4475 ( atcc # htb - 123 ) were grown in rpmi 1640 medium with 5 ml of penicillin - streptomycin - glutamine , and adjusted to contain 1 . 5 g / l sodium bicarbonate , 4 . 5 g / l glucose , 10 mm hepes , 1 . 0 mm sodium pyruvate , with fetal bovine serum , 10 %. media was removed , cultures rinsed with 0 . 25 % trypsin , 1 mm edta solution ( gibco brl , cat # 25200072 ) for 5 to 10 min at rt , and spun at 2000 rpm for 15 min . the solution was removed , fresh culture medium added , and cells dispensed into fresh culture flasks . cultures were incubated at 37 ° c . with 5 % co 2 for two to four days . colon lines sw480 ( atcc # ccl - 228 ) were grown in leibovitz / s l - 15 with 2 mm l - glutamine and 10 % fbs . ht - 29 ( atcc # htb - 8 ) was grown in mccoy &# 39 ; s 5a medium with 1 . 5 mm l - glutamine and 10 % fbs . the human prostate cell lines lncap ( a lymph note metastatic line ), primary prostatic tumor cell line cwr22 , lung metastatic line pc - 3 and brain metastatic line du145 were also cultured . apoptosis generates dna free ends which can be labeled in situ using terminal deoxynucleotidyl - transferase ( tdt ), incorporating an exogenously added labeled nucleotide to the dna strand . this label can then be visualized directly by fluorescence or indirectly using anti - fitc - peroxidase , and a calorimetric assay . cells on coverslips were washed with pbs , and fixed for 30 minutes at rt with 4 % paraformaldehyde , in pbs , ph 7 . 4 . they were then washed with pbs , and permeabilized with 0 . 1 % triton x - 100 for 10 minutes at room temperature ( rt ). the slides were rinsed twice with pbs , and air dried for 2 minutes . the manufacturer &# 39 ; s procedure for tunel staining the slides was followed ( manufacturer &# 39 ; s procedure for the in situ cell death detection kit , ap ; boehringer mannheim , indianapolis , ind .). total cell counts were determined by counterstaining fixed cultures with 20 μg / ml of hoechst 33258 . all specimens were observed by epifluorescence on a computer - controlled microscope system based on a zeiss axioskop microscope ( carl zeiss , thornwood , n . y . ), and the images were obtained and examined using a charged coupled device ( ccd ) camera , magnafire , model s99806 ( olympus american , melville , n . y .). images were examined using image - pro plus 4 . 1 for windows ( media cybernetics , silver springs , md .) software . cultures ( 2 . 5 × 10 5 cells / dish ) were incubated for 24 to 48 hours . cultures were then pretreated with the appropriate antibody for 30 min . at room temperature ( rt ). cultures were subsequently washed with pbs and then treated with the modulator for 24 hours . finally , slides were stained and imaged as described above . cultures were rinsed 2 × with 1 × pbs containing 0 . 1 % glycine to reduce intrinsic fluorescence . they were blocked with 1 % goat serum in pbs containing 0 . 3 % triton x - 100 at room temperature ( rt ) for 1 hr . primary antibody ( 1 : 250 ) was added to the blocking solution , and the slides were incubated overnight at 4 ° c . the slides were rinsed 3 × with 1 × pbs containing 1 % triton x - 100 at rt , and the second antibody ( 1 : 200 ) ( texas red anti - mouse igg [ h + l ], vector cat . # ti - 2000 , 1 . 5 mg / bottle ) was added in the blocking solution and incubated at rt for 1 hr . the slides were then rinsed 3 times with 1 × pbs containing 1 % triton x - 100 at rt , and fixed in 4 % paraformaldehyde at rt for 60 min . finally , they were rinsed 3 times with 1 × pbs , briefly dried , mounted with media - mowoil , excess oil removed and slides were visualized or stored in the refrigerator . slides were observed by epifluorescence on a computer controlled microscope system based on a zeiss microscope , and a ccd camera as described above . images were subsequently examined as described above . to clone and express proteins from hiv - 1 , hiv - 2 and siv , the nef reading frames of each virus were amplified by pcr from full length viral clones and placed into the expression vector pcdma 3j / v5 - his topo ( invitrogen ). the hiv - 1 viral clone used was pnl4 - 3 ( gift of eric freed , nih ), the hiv - 2 clone was from the jk strain ( hiv7312a , gift of john kappes , university of alabama , birmingham ) and the siv clone was from siv mac239 ( p239spe3 ′ nef open , aids reagent program , cat # 2476 ). the primers used to amplify the nef reading frame from pnl3 - 4 were : forward 5 ′- cct aga aga ata aga cag ggc ( seq . i . d . no . 1 ) and reverse 5 ′ cac tac ttg aag cac tca agg c ( seq . i . d . no . 2 ). the primers used to amplify the nef reading frame from siv p239spe3 ′ were , forward , 5 ′- cct ctt cag cta cca ccg ctt gag aga ctt act c ( seq . i . d . no . 3 ) and , reverse , 5 ′ tga cta aaa tgg tct gag g ( seq . i . d . no . 4 ). the primers used to amplify the nef reading frame of hiv - 2 were , forward , 5 ′ gaa gaa gga ggt gga aac gac g ( seq . i . d . no . 5 ) and , reverse , 5 ′- aag tgc tgg tga gag tct agc ( seq . i . d . no . 6 ). after pcr amplification , each pcr product was inserted into the vector by topo cloning according to the manufacturer &# 39 ; s instructions . the sequence of each clone was confirmed by dideoxy sequencing . the functionality of each clone was verified by its ability to trans complement a nef - deleted strain of nl4 - 3 and restore infectivity as determined by magi infectivity assays . to express the desired protein , 6 μg of each plasmid was separately transfected into hek 293 cells using effectene reagent ( qaigen ). the effectene was removed after 6 hours and fresh medium was added . after 48 hours , the supernatants were collected and spun at 400 × g to remove any cellular debris . supernatants were either used immediately or frozen at − 80 ° c . until use . untreated or treated cells were collected , and dna was harvested from normal or cancer cell cultures . briefly , the cells were washed with pbs , pelleted at 1600 g for 20 minutes at 4 ° c ., and resuspended in 50 mm tris - hcl , ph 7 . 5 , 20 mm edta buffer at about 10 7 cells / ml . the cells were then treated 2 times with lysis buffer : 1 . 0 % np - 40 ( sigma , st . louis , mo .) in the same tris / edta buffer at rt for 2 minutes followed by centrifugation at 1600 g for 5 minutes . after the last spin , sds was added to the supernatant to 1 % final concentration , rnase a ( sigma , st . louis , mo .) was added to 5 mg / ml final concentration , and the solution incubated at 56 ° c . for 2 hours . subsequently , protease k ( promega , madison , wis .) was added to the solution to 2 . 5 μg / ml and incubated at 37 ° c . for 2 . 5 hr . ammonium acetate was added to 4 m final concentration , 0 . 7 volumes of isopropanol was added , the solution was put at − 20 ° c . overnight followed by centrifugation at 14 , 000 rpm for 30 minutes . the pellets were washed twice with 70 % ethanol , dried and resuspended in 10 mm tris - hcl , ph 7 . 5 , 1 mm edta . dna samples , 18 μg per condition , were prepared in neutral loading buffer to a final concentration of 0 . 02 % bromophenol blue , 5 % glycerol , 0 . 1 % sds , and 50 μg of ethidium bromide , loaded onto a neutral agarose gel ( 1 . 7 %), and run at 50v for 2 . 5 hours . dna size standards were hindiii digested lambda dna , and dna ladder markers ( promega , madison , wis .). the resultant separated bands were visualized and photographed using a kodak electrophoresis documentation and analysis system 120 ( eastman kodak company , rochester , n . y .) with a fotodyne transilluminator uv box . mda - mb - 468 cells in log phase were transfected with 1 or 2 . 5 microg of pcxcr4 and 8 microg of gfp vector ( transfection control ) or with 2 . 5 microg of pcr 3 . 1 vector and 8 microg of gfp vector as negative controls . the aliquots were transferred to 0 . 4 cm electroporation curvette and electroporated with 0 . 25 kv . 950 μf . capacitance pulse and 200 ohms resistance . cells were then allowed to sit at room temperature for 10 minutes , then transferred to a microfuge tube containing 400 ml rpmi and centrifuged at 3000 rpm for 5 minutes to remove debris . the cell pellet was resuspended in 1 ml of rpmi containing serum and incubated overnight or 16 hours at 37 ° c . in 6 - well plates to allow expression of the transfected gene . in assays examining effect of the gp 120 blocking on apoptosis , the transfected cell pellets were exposed to 6 μg of anti - gp120 antibody in 200 μl of huvec culturing medium at 37 ° c . for 1 hour . this solution was then diluted into 1 ml of huvec culturing medium and layered onto the huvec monolayers . male cb , 17 scid mice , aged 5 to 6 weeks , were housed in horizontal laminar flow cabinets free of microbial pathogens . mice were obtained at age 1 month and quarantined for at least 1 week before inoculation . mice ( 5 per group per study ) were injected with at least 10 6 epithelial cells ( the prostate , colon , breast cell lines as identified below ) in 0 . 1 ml phosphate buffered saline ( ph 7 . 4 ) or hank &# 39 ; s balanced salt solution ( hbss ) subcutaneously into the bilateral flank region over the right hip . mice were then housed and monitored over time for tumor formation . the animals tolerated the procedures without incident and none died due to technique or infection . tumors were routinely monitored for tumor implantation , propagation and metastasis . all tumor volumetric measurements were done in 3 dimensions in cubic centimeters using an engineer &# 39 ; s caliper . cell lines injected included breast epithelial tumor lines du4475 , mda - mb - 648 , colon epithelial tumor lines sw480 and ht - 29 , human prostate cell lines lncap ( a lymph note metastatic line prostatic tumor cell line cwr22 , lung metastatic line pc - 3 and brain metastatic line du145 . mice were euthanized by cervical dislocation . tumor areas identified and measured previously in mice sere examined for tumor tissue . tumor was then taken for histological studies or reimplementation according to usual protocols . sigmaplot 2000 ( chicago , ill . ), a statistical analysis program , was used to compile the data . the data were subsequently analyzed by the student &# 39 ; s t - test , using a two - factor , unpaired test . in this analysis , data gathered using the various treatment conditions were compared to those gathered in the untreated control conditions . for this study , significance , or lack of significance of the data was set at : p & lt ; or & gt ; 0 . 01 , respectively . initial analysis of modulator effect in an in vitro epithelial line culture model using a series of breast carcinoma cell lines as well as primary mammary epithelial cells expressing various levels of the cxcr4 receptor , the antagonistic / killing effects of the modulators in these cells were studied . the modulators selectively induced apoptosis in cells expressing the cxcr4 receptor , but had no effect on cells not expressing that receptor ( e . g ., normal primary epithelium ). further , the amount of induced apoptosis was directly proportional to the relative amount of cxcr4 expressed by those cells . the hiv - 1 gp120 jr - fl variant , a macrophage - tropic variant that acts through the ccr5 receptor , had no effect on any of these cell lines . antibodies to the cxcr4 receptor were shown to block the apoptotic effect of the modulator , where antibodies to ccr5 or cd4 had no effect on modulator - induced apoptosis . the natural ligand of cxcr4 , sdf , had no similar effect on the carcinoma cell lines . this clearly indicates that the modulator uniquely induces apoptosis in epithelial carcinomas through the cxcr4 receptor expressed at varying levels on these carcinoma lines , but does not kill normal epithelial cells . the effect of the modulator ( gp120 iiib ) on four breast carcinoma cell lines , as well as normal primary mammary epithelium was studied . the cell lines were selected based - on their expression levels of the cxcr4 receptor mrna . it was found that ( i ) primary normal mammary epithelial cells , or mda - mb - 468 expressed no cxcr4 receptor rna , ( ii ) mcf7 expressed low levels of cxcr4 mrna , ( iii ) mda - mb - 231 expressed medium levels , and ( iv ) du4475 expressed very high levels of the receptor mrna . the primary mammary epithelial cells were shown to lack expression of cxcr4 mrna . the levels of cxcr4 in these cell types was confirmed using immunocytochemical analysis ( ica ) as a tool to perform a semi - quantitative , relative measurement of the amounts of cxcr4 protein on the cell surface of each cell type . cells were grown on coverslips , and stained unfixed ( which only stains cxcr4 on the cell surfaces ) using a monoclonal antibody for cxcr4 , and a secondary texas red goat antimouse antibody . cultures were imaged by confocal microscopy , and the intensity of staining on the cultured cell surfaces was measured from the images using image - pro 5 . 0 software . it was found that the relative amount of surface labeling of cxcr4 , when comparing the five cell types examined , was directly proportional to their mrna levels . thus , primary normal mammary epithelial cells , and mda - mb - 468 showed no cxcr4 staining on the cell surface . alternatively , both mcf7 and mda - mb - 231 displayed medium levels of cxcr4 staining on the cell surface , with the levels observed with mcf7 being somewhat less than those displayed by mda - mb - 231 . finally , du4475 displayed the highest levels of cxcr4 staining . each of these cell lines was exposed to the soluble modulator , at varying concentrations from 10 g / ml to 100 ηg / ml . the modulator selectively induced apoptosis in cells expressing the cxcr4 receptor ( ii , iii , iv ), but had no effect on cells not expressing that receptor ( i ). this apoptosis was a function of the relative amount of cxcr4 expressed by those cells . it was found that the tumor cells expressing the most cxcr4 ( du4475 ) were killed most effectively , and at the lowest concentrations of the modulator . alternatively , the normal primary mammary epithelial cells were not affected by any concentration of the modulator . thus it was shown that the modulator induces cell killing / apoptosis in the tumor cells through the cxcr4 receptor . the amount of apoptosis induced in these tumor cells is directly proportional to the amount of cxcr4 receptor on the cell surface . the modulator has no effect on normal mammary epithelial cells . further evidence of modulator ( gp120 ) induced apoptosis in the cxcr4 expressing cell lines was gathered from gel electrophoresis of purified dna from untreated and modulator - treated cultures . cultures were either untreated , treated for 24 hours with 10 ηg / ml of the modulator , or with 10 mm ( 6 . 35 mg / ml ) ceramide . ceramide at that concentration has been shown to cause apoptosis , and the dna laddering band pattern suggestive of apoptosis . subsequently , chromosomal dna was extracted from these cultures , and separated using neutral gel electrophoresis . the resulting agarose gels were visualized for the laddering band pattern suggestive of internucleosomal cleavage caused by apoptosis . as expected , in the positive control ceramide treated cultures , dna laddering characteristic of apoptotic cells was observed when compared to the negative control dna from the untreated cultures . in the modulator - treated cultures of mda - mb - 231 , mcf7 , and du4475 , dna laddering was observed . alternatively , in the modulator exposed cultures of mda - mb - 468 and the primary mammary epithelial cells there was no evidence of dna laddering , with the electrophoretic pattern looking like the untreated negative control . the gp 120 jr - fl variant , a macrophage - tropic gp 120 variant that interacts predominantly with the ccr5 chemokine receptor , had no effect on any of these cell lines . monoclonal or polyclonal antibodies to the cxcr4 receptor blocked the apoptotic effect of gp120 iiib . alternatively , antibodies to ccr5 or cd4 had no blocking effect on modulator - induced apoptosis . the natural ligand of cxcr4 , sdf - 1 , had no similar apoptotic effect on any of the carcinoma cell lines . finally , a significant reduction , essentially to background levels , in the percentage of apoptotic cells was observed when the gp 120 protein solution was pretreated with an anti - gp 120 antibody , and this antibody - treated protein solution was subsequently used to treat cultures of mda - mb - 231 cells . alternatively , mouse igg had no effect on gp120 - induced increases in apoptosis in the cultures . this evidence clearly shows that the modulator ( i . e ., gp120 iiib ) uniquely induces the apoptotic affect through the cxcr4 receptor expressed on these carcinoma lines . mda - mb - 468 cells , which do not express cxcr4 and are refractive for modulator - induced apoptosis , were transfected with pcxcr4 and gfp vector ( transfector control ), or with pcr 3 . 1 vector and gfp vector as negative controls . these cells were then either assayed for cxcr4 expression or exposed to modulator for 24 hours . it was observed that cxcr4 expression on the mda - mb - 468 cells correlated directly with modulator induction of apoptosis . all of the observations lend strong evidence of modulator - induced apoptosis in those cell lines expressing cxcr4 , with no apoptosis induced in the exposed cells which did not express cxcr4 . nef - induced apoptotic effects have been observed on endothelium and epithelium . both mda - mb - 231 cells or huvec cells were treated with various concentrations of purified bacterially - expressed nef protein . subsequently , the cultures were either ( 1 ) analyzed for chromatic condensation and nuclear fragmentation by phase contrast microscopy , ( 2 ) assayed for apoptosis by tunel in connection with immunofluorescence microscopy , or ( 3 ) analyzed by agarose gel electrophoreses for dna laddering . substantial chromatic condensation and extensive nuclear fragmentation was observed in cells exposed to exogenous nef protein . in dose response / tunel assays using different concentration of nef , there was a clear dosage dependence of nef protein and apoptosis . alternatively , in time response / terminal dutp nick end labeling ( tunel ) assays there was a clear and direct relationship between the time of nef exposure and the amount of induced apoptosis . finally , nef protein exposure induced considerable dna laddering , as measured by agarose gene electrophoresis / dna fragmentation analysis . it was also found that the observed nef - induced apoptosis is mediated through the cxcr4 receptor . apoptosis has been shown in cxcr4 expressing tumor epithelial lines and huvecs , with no effect observed in cells types not expressing cxcr4 ( mda - mb - 468 , primary breast epithelial cells ). further studies performed indicating the specificity of nef for the cxcr4 receptor included ( 1 ) competition assays with cxcr4 or ccr5 antibodies or the respective ligands for cxcr4 or ccr5 receptor as described above and ( 2 ) cxcr4 transfection assay with mda - mb 468 cells , as described above . all evidence points towards nef protein as a modulator protein . the cloned nef cdna from hiv - 1 , hiv - 2 and siv were separately transfected into hek 293 cells . after 48 hours the conditioned medium was collected from the transfected cultures and spun at 400 × g to remove any cellular debris . these conditioned supernatants were shown to contain the respective nef protein ( hiv - 1 , hiv - 2 and siv ) by western analysis . interestingly , these conditioned supernatants were shown to have all the apoptotic properties described above for the bacterially expressed hiv - 1 nef protein . thus , hiv - 2 nef and siv nef protein were shown to have similar modulator properties . all of the results described above that were modulator - induced have also been shown to result from use of a number of peptide sequences identified in either the gp 120 or nef proteins . overlapping peptide sets obtained from the aids reagent bank were used in the apoptotic assay as disclosed above . specific pg 120 and nef peptides within those sets were identified as inducing apoptosis in epithelial tumor cell lines , as well as in huvecs . alternatively , these same peptides had no effect in primary mammary epithelium or in mda - mb - 468 tumor lines . similar studies to those described above ( e . g ., anti - cxcr4 competition , mda - mb - 468 transfections with the cxcr4 cdna clone ) were used to show that all peptides identified have apoptotic properties which exert their activity through the cxcr4 receptor . within the nef protein , a motif spanning amino acids 50 - 60 from the n - terminus of the protein ( naacawleaq ) ( seq . i . d . no . 7 ) was found to have apoptotic / modulator properties . the 10 mer peptide spanning this 50 - 60 motif was made by standard methods and was found to induce almost 100 % of the apoptosis observed for the full nef protein at an equivalent molar ration ( 10 mer peptide is 5 % the amount used when studying the full protein ). similarly , this same 10 mere sequence , with amino acids randomly scrambled into the sequence alaetconawa ( seq . i . d . no . 8 ) lost all apoptotic effects , suggesting sequence specificity of this motif . within the gp 120 protein , one apoptosis - inducing motif within the v3 loop was identified spanning amino acids 315 to 321 ( sequence grafytt ) ( seq . i . d . no . 9 ). a second large apoptosis - inducing region within the c2 region was identified spanning amino acids 252 - 280 ( sequence stolllngslaeeevvirsenftdnaktiiv ) ( seq . i . d . no . 10 ). a 9 mer peptide spanning amino acids 315 - 324 of gp 120 ( grafyttky ) ( seq . i . d . no . 11 ) was designed and found to induce about 60 % of the apoptosis observed from the full gp 210 protein at an equivalent molar ration ( 9 mer peptide is 2 % of the full protein ). the effects of gp 120 ( iiib variant ) on endothelium was studied . using huvec &# 39 ; s as a model , it was shown that the soluble gp 120 / iiib protein induced apoptosis . using competition assays with either cxcr4 or ccr5 antibodies , or their respective natural ligands , it was shown that apoptotic effect could be induced through the cxcr4 chemokine receptor . it was also shown that soluble gp 120 iiib - induced apoptosis involves protein kinase - c ( pkc ), and that phorbol ester stimulated the cxcr4 endocytosis pathway , with the gp 120 - induced pkc induction and the gp 120 - induced apoptosis in huvecs being found to be insensitive to pertussis toxin . this suggests that the endocytosis step is involved in these viral protein induced effects and that activation of the natural ligand ( sdf - 1a ) mediated signaling pathway is not involved in gp 120 - induced apoptosis . it further indicates clear differences in effects of modulator / receptor interactions versus natural ligand / receptor interaction versus phorbol ester / receptor interaction . similar apoptotic effects were observed for the nef protein as well as for the gp 120 and nef peptides described above . scid mice were injected with several prostate tumor lines . tumors appeared at about 4 - 6 weeks post - injection . once tumor growth was confirmed by observation , one group of 5 mice were injected with a modulator ( for example , gp 120 , 100 ηg / 0 . 1 ml ) and a similar group was injected with 0 . 1 ml buffer every 3 days for 4 weeks . tumor area was monitored over this time as described above . mice receiving the modulator showed no further growth in the tumor area or showed some shrinkage of the tumor mass over the 4 week dosing regimen . alternatively , mice receiving the control injection continued to show increased growth in the tumor mass , and were sacrificed before the end of the 4 week period . scid mice were injected with two colon tumor lines as described above , with tumors appearing at about 4 to 6 weeks post - injection . on confirmation of tumor growth , one group of mice ( 2 of each colon tumor type ) were injected with modulator ( nef peptide ) at 20 ηg / 0 . 1 ml and a second similar group was injected with 0 . 1 ml buffered solution once a week for 4 weeks . tumor area was monitored over this time as described above . mice receiving the modulator showed significant shrinkage of the tumor mass over the 4 week dosage regimen . alternatively , mice receiving the control injection continued to show growth in the tumor mass and were sacrificed before the end of the 4 weeks . | 0 |
referring now to the drawings wherein like reference numerals denote like elements throughout the several views , fig1 illustrates a structure in accordance with the present invention as used in a test site 10 of an integrated circuit handler interfacing with a tester . the decoupling apparatus in accordance with the present invention can be used , as is apparent from the figures , in conjunction with a test site configured for processing of dual in - line packages ( dips ) 12 . it will be understood , however , that , although it is envisioned that the primary application for the particular decoupling apparatus disclosed and claimed herein would be in a handler / tester assembly designed for dips , handlers capable of cycling other types of integrated circuit devices might also be adapted to incorporate the present invention . fig4 , and 6 illustrate , in part , a transmission line connector 14 , as known in the prior art , for use in such test sites . such transmission line connector structures , typically , have a plurality of probe fingers 16 mounted at opposite ends 18 thereof with an intersecting foot insulator 20 adjacent a central portion of the connector 14 . the connector 14 , as known in the prior art , is of a flex - tape material and has a plurality of impedance controlled traces 22 extending from each of the probe fingers 16 to plated through holes 24 proximate the center line of the connector 14 . the foot insulator 20 would , typically , be manufactured from a plastic - type material . the insulator 20 carries a plurality of pins 26 , and , with its pins 26 , is plugged into the plated through holes 24 formed centrally in the transmission line connector 14 . the connector 14 can , in turn , by use of the pins 26 extending through the holes 24 centrally in the connector 14 , be plugged into a socket in a test head adaptor ( not shown ) to render it in electronic communication with a tester . fig4 and 5 , further , illustrate a pair of return spring structures 28 , one on either side of the foot insulator 20 . these return springs 28 function to accomplish an intended purpose as will be discussed hereinafter . additionally , fig4 and 5 illustrate components of the decoupling apparatus of the present invention . these components will , however , be discussed in more detail with reference to other figures . referring now to fig1 , and 3 , fig1 illustrates a plate 30 with respect to which the test site can be disposed above . a central , longitudinally - extending support 32 is seated on the plate 30 . the support 32 mounts a track 34 , having opposite lateral walls 36 , down which integrated circuit devices ( in this case dips 12 ) pass . such dips 12 are of a construction well known in the prior art . they include a main body portion 38 , generally rectangular in shape , and pluralities of contact pins 40 extending from opposite longitudinal edges 42 of the main body portion 38 the pins 40 flare slightly outwardly with respect to a plane perpendicular to a surface of the main body portion 38 . the lateral walls 36 of the track 34 , therefore , are , similarly , flared outwardly to accommodate the pins 40 . the flexible transmission line connector 14 is mounted to the support 32 by securing members , such as screws 44 , passing through apertures 46 in wings 48 of the return springs 28 and into the support 32 . fixed positioning of the transmission line connector relative to the support 32 is accomplished by fastening foot insulator 20 , with pins 26 , onto support 32 . the probe fingers 16 , as a result of the affixation of the transmission line connector 14 to the support 32 by the wings 48 of the return springs 28 , are disposed upwardly from the foot insulator 20 and proximate apertures 50 provided in the side walls 36 of the track 34 . the return springs 28 bias the probe fingers 16 outwardly away from the apertures 50 in the side walls 36 so as not to obstruct passage of dips 12 down the track 34 . actuators ( not shown ) can , however , be provided to urge the probe fingers 16 inwardly through the apertures 50 and into engagement with the pins 40 of a dip 12 in a station at the test site 10 . a stop 52 can be provided to maintain the dip 12 to be tested in a desired station . the stop 52 can be disposed for reciprocation upwardly and downwardly through an aperture 54 formed in the floor 56 of the track 34 . the aperture 54 can be elongated along the axis of the track 34 in a direction down which dips pass in order to adjust the location cf the stop 52 and , thereby , vary the relative position of a dip 12 in the station with respect to the probe fingers 16 . the definition of the station can be changed , therefore , depending upon the size of the dip 12 , the number of pins 40 it carries , and other factors . as best seen in fig2 and 3 , a rack mount 58 , in accordance with the invention , is secured in place overlying each lateral plurality of probe fingers 16 each rack mount 58 extends substantially across the length of the transmission line connector 14 at the location of its proximity thereto . the rack mounts 58 are provided with pluralities of recesses 60 , each plurality of recesses 60 corresponding in number to the number of probe fingers 16 provided . the recesses 60 extend fully through the thickness of the rack mount 58 and are positioned in locations such that , when the rack mount 58 is fixedly secured in a location relative to the fingers 16 , each of the probe fingers 16 will be accessible through one of the recesses 60 . as previously discussed , the return springs 28 bias the probe fingers 16 outwardly away from the track 34 down which dips 12 pass . further , as previously indicated , actuators can be provided to overcome this bias and urge the probe fingers 16 into engagement with the pins 40 of a dip 12 in the test site station when it is so desired . a block 62 can be secured in position overlying the outwardly facing surface of each return spring 28 and can be disposed to be engaged by its respective actuator . as best seen in fig3 each rack mount 58 can carry therewith an integrally formed pin 64 . the pin 64 of one rack mount 58 can pass through registered apertures in the transmission line connector 14 and the respective return spring 28 and into a port 66 formed in the corresponding engagement block 62 . both the rack mount 58 , with its protruding pin portion 64 , and engagement block 62 are formed from a dielectric material , and sonic welding can be utilized to effect secure retention of the mount rack pin 64 to the inner surface of the port 66 in the engagement block 62 . the transmission line connector 14 and the return spring 28 can , thereby , be sandwiched tightly between the rack mount 58 and engagement block 62 . an upper extension 68 of each mount 58 can be provided with a plurality of slits 70 to accommodate inward angling of the probe fingers 16 . the lower , inner end of the each of these slits 70 can be provided with an upwardly turned lip 72 for a purpose that will be described hereinafter . fig2 and 3 illustrate a contact strip / decoupling strap assembly which bridges the gap between the two facing rack mounts 58 . the assembly can be secured to each of the rack mounts by passing appropriate securing fasteners 74 through apertures 76 in the contact strips 78 and into holes 80 provided in the rack mounts 58 . both the contact strips 78 and the strap 82 soldered to lower extremities 84 of the contact strips 78 are formed from highly conductive materials for a purpose to be discussed hereinafter . the strap 82 bridging the distance between the contact strips 78 and soldered to lower extremities thereof would , typically , be made from a thin copper sheet . the surfaces of the copper sheet can be provided with an insulating film . each contact strip 78 is provided with a plurality of upwardly extending projections 86 . the projections 86 are disposed at axial locations therealong so that , when the contact strip 78 is secured to its respective rack mount 58 , each projection 86 will overlie one of the recesses 60 formed in the mount 58 . as best seen in fig3 each projection 86 is provided with a dimple 88 which projects inwardly into its respective recess 60 and a curled upper end 90 which hooks around the upwardly extending lip 72 in the respective slit 70 of the rack mount 58 . by hooking the curled upper ends 90 of the contact strip projections 86 over the upwardly extending lips 70 of the rack mounts 58 , tight engagement and contact can be made with an end of either a decoupling capacitor 92 or shorting element 94 disposed in the particular recess 60 . similarly , the pressure exerted upon the capacitor 92 or shorting element 94 by the dimple 88 will , in turn , urge the opposite end of the capacitor 92 or shorting element 94 into tight engagement with the respective probe finger 16 . in securing the contact strip conductive strap assembly to the rack mount 58 , the curled ends 90 of the various projections 86 can be fitted into their respective slits 70 and brought downwardly over the upwardly turned lips 72 onto which they hook . the dimples 88 are formed relative to the curled portions 90 so that , with the curled portions 90 fitted over the lips 72 , the dimples 88 will be at the entrances to their respective recesses 60 the assembly can then be securely attached to the rack mounts 58 by use of the screws 74 as previously discussed . decoupling of a dip pin 40 from its primary power supply an the tester , as connected through the transmission line connector 14 , is efficiently accomplished by multi - layer ceramic capacitors 92 . such capacitor chips 92 are almost ideal capacitors for high frequency decoupling . as seen in fig3 such a capacitor chip 92 includes a center capacitor portion 96 having solder 98 infused thereto at both of opposite ends . outwardly facing surfaces 100 of the solder portions 98 can be plated with a gold film . while the solder portions 98 might allow for defective contacting the high coefficient of conductivity of gold overcomes this shortcoming . the left recess 60 , as viewed in fig3 is shown as containing a shorting element 94 . such an element 94 is made from a highly conductive material and functions to complete a circuit path . it will be understood that the decoupling capacitors 92 and shorting elements 94 can be shaped and sized similarly . further , the recesses 60 in which they can be received can be shaped and sized so that the members inserted therein have a close tolerance to the containing wall . as can be seen , various decoupling capacitors 92 and shorting elements 94 can be inserted into the recesses 60 proximate the particular probe fingers 16 with respect to which it is either desired or necessary to decouple between . for example , if the third pin on one side of a dip is a power pin and the fifth pin on the other side of the dip is a ground pin , a decoupling capacitor 92 can be inserted into the recess 60 proximate the power pin , and a shorting element 94 into the recess 60 proximate the ground pin . since the strap 82 bridging the contact strips 78 is in electronic communication with the full length of the strips 78 , and therefore with each and every projection 86 from the strips 78 , a complete circuit will exist between the dip power pin and the ground pin . a structure in accordance with the present invention , therefore , has a very universal application with regard to the testing of dips 12 . as long as each pin 40 of the dip 12 can be registered with one of the recesses 60 in the rack mount 58 , decoupling between any of the pins 40 can be accomplished by inserting decoupling capacitors 92 and shorting elements 94 in the appropriate recesses 60 . numerous characteristics and advantages of the invention covered by this document have been set forth in the foregoing description . it will be understood , however , that this disclosure is , in many respects , only illustrative . changes may be made in details , particularly in matters of shape , size , and arrangement of parts without exceeding the scope of the invention . the invention &# 39 ; s scope is , of course , defined in the language in which the appended claims are expressed . | 8 |
fig1 shows an unassembled view of a fill plate 10 , stripper plate 12 and a top plate 14 . fig2 shows an assembled view of the fill plate 10 , stripper plate 12 and top plate 14 , further comprising a stripper plate spacer and hold down 16 , a cylindrical section 18 and a curved section 20 . fig3 shows a side view of the patty molding machine having an auger driver motor 30 an auger 32 , knockouts 34 and a shear plate drive cylinder 36 . fig4 shows a top view of an embodiment of the present invention , having a stripper plate drive 40 , a fill and stripper plate assembly 42 , a mold plate 44 and a draw bar 46 . fig5 shows a breather plate 60 having orifices 62 and 64 in the breather plate 60 . fig6 shows the breather plate 70 having orifices 72 and 74 . the channels are made up of a spherical section 76 intersecting a cylindrical section 78 . fig7 further shows the orifice 74 having the spherical section 76 and a cylindrical section 78 . fig8 shows the breather plate 80 having the orifices 82 . fig9 shows the breather plate 90 having the orifices 92 . fig1 shows a venturi 100 comprising a diameter 102 angle transition 104 , throat length 106 and discharge 108 . fig1 shows an orifice plate 200 having apertures 210 . fig1 shows a magnified view of the orifice plate 200 showing the apertures 210 . fig1 shows the orifice plate 200 having the apertures 210 . the apertures comprising a sphere section 212 and a cylinder section 214 . fig1 shows a magnified view of the apertures 210 having a spherical section 212 and a cylinder section 214 . the present invention relates to fiber orientation technology . the fiber orientation technology drops pressure across the grinder plate , aligns the fibers of meat so that the contraction of the muscle fiber that does take place is in a direction of choice controlling both bite and shrinkage . the fiber orientation technology provides a lower resistance to product flow using a wider opening . the fiber orientation technology provides a better shear surface for a cleaner cut . the fiber orientation technology aligns the fibers in the grinder plate so the shearing action disrupts as few muscle cells as possible . the fiber orientation technology decreases the total area of grinder plate blocking the meat flow resulting in less direction change to the product which works the meat . the fiber orientation technology pulls the meat fiber through the apertures of the grinder plate instead of pushing using the principles of the venturi / choke plate . all of these characteristics of fiber orientation technology reduce the release and mixing of myosin with actin , the net effect is a controlled orientation of the fiber , less myosin activity resulting in a better bite / bind and control over the final cook shape . spherical geometry in apertures of the grinder plate creates venturi effects . the process of the present invention makes a patty cool uniformly and soften the texture / bite of the product . a food patty molding machine has a mold plate and at least one mold cavity therein . a mold plate drive is connected to the mold plate for driving the mold plate along a given path , and a repetitive cycle , between a fill position and a discharge position . a food pump pumps a moldable food product through a fill passage connecting the food pump to the mold cavity when the mold plate is in the fill position . a fill plate , interposed in the fill passage immediately adjacent to the mold plate has a multiplicity of fill orifices distributed in a predetermined pattern throughout an area aligned with the mold cavity when the mold plate is in fill position . the fill orifices define paths through the fill plate , wherein some of the paths each have a path portion obliquely angled or perpendicular to the fill side of the mold plate . the paths consist of spherical intersections or a curved structure . the side of the fill plate which is in contact with the stripper consists of a spherical hemisphere or curved structure which has a diameter approximately 1 . 1 to 2 . 5 times greater than a cylindrical portion which intersect the top of the mold plate perpendicularly or at an angle of less than or equal to about +/− 75 degrees , or about +/− 45 degrees in a preferred embodiment as measured from vertical in the longitudinal direction of the mold plate . by a reduction in the cross - sectional area a “ choked - flow ” condition is created . by using spherical sections or a curved structure , intersections between cylinder and spheres or curved structures create transitions which can be manufactured whose geometry approaches a venturi style system . it is preferred to have a sharper edge from the edge to the hole . to get a perfect edge it is preferred to sharpen with a grinder . in a preferred embodiment , the fill plate is chrome coated on the side adjacent to the stripper plate with a material significantly harder than the fill plate material . this is because the stripper plate wears out . the piece is approximately 39 rockwell c . it becomes approximately 60 - 65 rockwell c . the material is applied in a thickness to facilitate a surface which cuts the food product upon movement of a stripper plate . the material goes from about 1 / 1000 th of an inch to about 10 / 1000 th of an inch with the chrome . a cutting hemisphere into bottom of plate , with a cylinder . a stripper plate is interposed in the fill passage immediately adjacent to the fill plate . the stripper plate is movable in a direction transverse to the mold plate , between the fill and discharge locations . the stripper plate has a multiplicity of fill openings aligned one - for - one with the fill orifices in the fill plate when the stripper plate is in fill position . a stripper plate drive is synchronized with the mold plate drive , such that the movement of the stripper plate facilitates the cutting of the meat product , which was pushed through the fill plate by the food pump . the stripper plate drive moves the stripper plate to its discharge position , in each mold cycle , before the mold plate moves appreciably toward the discharge location . the stripper plate drive maintains the stripper plate in the discharge position until the mold plate cavity is displaced beyond the fill orifices . the fill paths can be in a direction to the front or rear of the machine . all fill paths consist of a hemispherical shape which is intersected by a cylindrical shape at an angle less or equal to about +/− 75 degrees of vertical , and preferably about +/− 45 degrees of vertical . the use of spherical geometry , with cylindrical intersections , and the ratio of the diameter of the sphere divided by the diameter of the cylinder is approximately 1 . 1 to 2 . 5 creates conditions to meat flow which maintain improved cell structure . using conservation of mass and conservation of energy principles the volume rate of flow must be equal at all points in the systems . ( ρ 1 a 1 v 1 )=( ρ 2 a 2 v 2 ). since ρ is a constant , velocity is inversely proportional to cross sectional area . also , a venturi requires a ramp of some finite distance and a throat which also has a finite distance . a spherical geometry feeding into a circular cross section which creates a product velocity increased while maintaining more consistent pressure on the meat . a sphere has the following properties : all points on a sphere are the same distance from a fixed point . contours and plane sections of spheres are circles . spheres have the same width and girth . spheres have maximum volume with minimum surface area . these properties allow meat to flow with minimum interruptions . there are no static or dead zones . no matter what angle the cylinder intersects the sphere ; the cross section is always a perfect circle . pressure inside of a sphere is uniform in all directions . when meat is passed through a circular cross section of a sphere , the fact that pressure is uniform in a sphere creates forces which will be coaxial with the sphere . the reduction in area accelerates the meat through the cylindrical section of the fill plate . the acceleration has been shown empirically to align fibers in the primary direct of flow . hence , there is fiber orientation . | 1 |
fig1 is a representation of an exploded view of the component parts of the object lifting , pulling and digging apparatus 10 of this disclosure . each of the component parts represented in fig1 is constructed of a material that gives the component part sufficient strength for its intended functioning of pulling and digging posts , trees , bushes , etc . from the ground . referring to fig1 - 4 , the apparatus 10 has a base 12 with opposite front 14 and rear 16 surfaces . the rear surface 16 of the base 10 is configured for removable attachment to the loader arms of a vehicle having an auxiliary hydraulic circuit . for example , the rear surface 16 could be attached by a universal quick attach hitch to the loader arms of a “ skid steer ” type vehicle . with the base 16 attached to the vehicle , the rear surface 16 of the base is directed toward the vehicle and the front surface 14 of the base is directed away from the vehicle . the base 12 is constructed with a plurality of reinforcing panels and gussets 18 on the front surface 14 of the base . the base 12 is also constructed with a reinforced , protective box on the front surface 14 of the base . the box is comprised of a top wall 22 , an opposite bottom wall 24 , and opposite angled side walls 26 , 28 . as can be seen in fig1 , a pair of pivot holes 32 are formed through the box top wall 22 and a pair of pivot holes 34 are formed through the box bottom wall 24 . each pivot hole 32 through the top wall 22 is coaxial with the pivot hole 34 below it through the bottom wall 34 . the axis of the pivot holes 32 , 34 are positioned in a single vertically oriented plane relative to the base 12 . a brush guard assembly 36 is attached to the top of the base 12 . the brush guard assembly 36 provides protection to the operator of the vehicle to which the apparatus 10 is attached when pulling or digging up posts , trees , bushes , etc . using the apparatus . a first jaw 42 having a length with opposite proximal and distal ends and a second jaw 44 having a length with opposite proximal and distal ends are attached to the front surface 14 of the base 12 . both of the jaws 42 , 44 are constructed as generally flat panels having elongate lengths that extend from proximal portions 46 , 48 of the respective first 42 and second 44 jaws to distal portions 52 , 54 of the respective first 42 and second 44 jaws . as shown in fig5 and 6 , the first jaw 42 is constructed as a single , generally flat panel with an elongate , triangular configuration that extends from an apex of the triangular configuration at the distal end portion 52 of the first jaw 42 to a base of the triangular configuration at the proximal portion 46 of the first jaw 42 . the second jaw 44 is also constructed as a single , generally flat panel with an elongate , triangular configuration that extends from an apex of the triangular configuration at the distal end portion 54 of the second jaw 44 to a base of the triangular configuration at the proximal portion 48 of the second jaw 44 . a first cylindrical pivot tube 56 is attached to the first jaw 42 . the pivot tube 56 has an interior bore that extends completely through the pivot tube and through the first jaw 42 . the pivot tube 56 separates the first proximal portion 46 and the first distal portion 52 of the first jaw 42 with a majority of the length of the first jaw extending along the first distal portion 52 forwardly from the first pivot tube 56 . a second pivot tube 58 is attached to the second jaw 44 . the second pivot tube 58 also has an interior bore that extends completely through the second pivot tube and through the second jaw 44 . the second pivot tube 58 separates the second proximal portion 48 and from the second distal end 54 of the second jaw 44 with a majority of the length of the second jaw 44 extending along the second distal portion 54 forwardly from the second pivot tube 58 . a first pin 62 connects the first jaw 42 to the front surface 14 of the base 12 for pivoting movement of the first jaw about the first pin between an open position and a closed position of the first jaw relative to the base . the first pin 62 extends through the pivot hole 32 through the top wall shown to the left in fig1 , through the first pivot tube 56 and into the pivot hole 34 in the bottom wall shown to the left in fig1 . the first pivot pin 62 is secured to the box top wall 22 to prevent rotation of the pin relative to the base 12 . a second pin 62 connects to the second jaw 44 to the front surface 14 of the base 12 for pivoting movement of the second jaw about the second pin between an open position and a closed position of the second jaw relative to the base . the second pin 64 extends through the pivot hole 32 in the box top wall 22 shown to the right in fig1 , through the second pivot tube 58 and into the pivot hole 34 through the box bottom wall 24 shown to the right in fig1 . the first pin 62 and the second pin 64 are positioned on the base 12 in a single , generally vertical plane relative to the base . the first distal portion 52 of the first jaw 42 extends forwardly from the first pivot pin 62 . the first proximal portion 46 of the first jaw 42 extends rearwardly of the first pivot pin 62 . the second distal portion 54 of the second jaw 44 extends forwardly from the second pivot pin 64 . the second proximal portion 48 of the second jaw 44 extends rearwardly of the second pivot pin 64 . thus , the majority of the length of the first jaw 42 and the second jaw 44 are positioned forwardly of the first pin 62 and the second pin 64 . a single linear actuator 72 is connected between the first proximal portion 46 of the first jaw 42 and the second proximal portion 48 of the second jaw 44 . the actuator 72 shown in fig1 is a hydraulic actuator . however , any equivalent type of linear actuator could be connected between the first proximal portion 46 of the first jaw 42 and the second proximal portion 48 of the second jaw 44 . the actuator 72 has a conventional construction with a housing 74 at one end of the actuator and a rod 76 at the opposite end of the actuator . a pair of hydraulic hoses 78 , 82 extend from the opposite sides of the actuator housing 74 . the hoses 78 , 82 communicate the actuator housing 74 with the auxiliary hydraulics of the vehicle with which the apparatus 10 is used . when the actuator 72 is operated to cause the housing 74 and rod 76 to move to their extended condition , the first jaw 42 and second jaw 44 are moved to their closed positions . when the actuator 72 is operated to cause the housing 74 and rod 76 to move to their retracted condition , the first jaw 42 and second jaw 44 are moved to their open positions . with the actuator 72 positioned rearwardly of the first pin 62 and second pin 64 , the actuator is positioned rearwardly of the first jaw 42 and second jaw 44 and away from the pulling or digging operation performed by the apparatus 10 . the actuator 72 is also positioned in the protective box comprised of the top wall 22 , the bottom wall 24 and the opposite side walls 26 , 28 . thus , the actuator 72 is protected from the pulling and / or digging environment of the apparatus 10 in use . the first proximal portion 46 of the first jaw 42 is formed with a first gear tooth section 84 . the second proximal portion 48 of the second jaw 44 is formed with a second gear tooth section 86 . these can be seen in fig1 . the first gear tooth section 84 of the first jaw 42 and the second gear tooth section 86 of the second jaw 44 mesh between the first pivot pin 62 and the second pivot pin 64 . the meshing of the first gear tooth section 84 and the second gear tooth section 86 synchronizes the movements of the first jaw 42 and the second jaw 44 as they are moved between their open positions and their closed positions , and between their closed positions and their open positions . the first jaw 42 cannot be moved without the second jaw 44 also moving , and the second jaw 44 cannot be moved without the first jaw 42 also moving . the first distal portion 52 of the first jaw 42 is formed with a generally vertically oriented first saw tooth section 92 . the first saw tooth section 92 is constructed as a single , generally flat panel with an elongate , triangular configuration that extends from an apex at the distal end of the triangular configuration of the first saw tooth section 92 adjacent the apex of the triangular configuration of the first jaw 42 , to a base of the triangular configuration of the first saw tooth section 92 at a proximal portion of the first saw tooth section adjacent the proximal portion 46 of the first jaw 42 . the first saw tooth section 92 is secured to the top surface of the first jaw 42 and projects vertically upward from the length of the first jaw 42 as can be seen in fig1 and 7 . as can be seen in fig1 and 7 , as the first saw tooth section 92 extends along the first distal portion 52 of the first jaw 42 from the distal end of the first jaw toward the first pivot tube 56 , a line of saw teeth 94 on the first saw tooth section 92 are positioned further away from the first jaw 42 by the first saw tooth section 92 . the second distal portion 54 of the second jaw 44 is also formed with a generally vertically oriented second saw tooth section 96 . the second saw tooth section 96 is constructed as a single , generally flat panel with an elongate , triangular configuration that extends from an apex at a distal end of the triangular configuration of the second saw tooth section 96 adjacent the apex of the triangular configuration of the second jaw 44 , to a base of the triangular configuration of the second saw tooth section 96 at a proximal portion of the second saw tooth section 92 adjacent the proximal portion 48 of the second jaw 44 . the second saw tooth section 96 is secured to the top surface of the second jaw 44 and projects vertically upwardly from the length of the second jaw 44 . as can be seen in fig1 and 8 , as the second saw tooth section 96 extends along the second distal portion 54 of the second jaw 44 from the distal end of the second jaw toward the second pivot tube 58 , a line of second saw teeth 98 on the second saw tooth section 96 is positioned further away from the second jaw 44 . the first saw tooth section 92 and the second saw tooth section 96 are configured to saw through roots of trees , bushes , etc . when the apparatus 10 is used for digging . with the first jaw 42 and the second jaw 44 positioned in their closed position as represented in fig5 , the first saw tooth section 92 and the second saw tooth section 94 extend parallel across the respective first jaw 42 and second jaw 44 . with the first saw teeth 94 extending further away from the first jaw 42 as they extend toward the first pivot tube 56 and the second saw teeth 98 extending further away from the second jaw 44 as they extend to the second pivot tube 58 , as the jaws are pushed into the ground by the loader arms of the vehicle with which the apparatus 10 is used the flat , planar jaws 42 , 44 prevent the saw teeth 94 , 98 from moving away from the roots and the saw teeth 94 , 98 continue to cut through the roots of trees , bushes , etc . as the lengths of the draws 42 , 44 are pushed further into the ground . referring to fig1 , 5 and 6 , the first jaw 42 is provided with a key tab 102 that projects from the distal end of the first jaw toward the second jaw 44 . the second jaw 44 is provided with a key hole or key slot 104 at the distal end of the second jaw . when the first 42 and second 44 jaws are moved to their closed positions for a digging operation , the key tab 102 engages inside the key slot 104 to securely attach the distal ends of the first 42 and second 44 jaws together and prevent their moving vertically relative to each other during a digging operation . the engagement of the key tab 102 into the key slot 104 can be seen in fig2 and 5 . referring to fig1 and 6 , the first jaw 42 has a straight section of gripping teeth 106 that extend along a substantially straight line as the straight section of teeth extend from the distal end of the first jaw toward the proximal end of the first jaw . the second jaw 44 also has a straight section of gripping teeth 108 that extend along a substantially straight line as the straight section of teeth extend from the distal end of the second jaw toward the proximal end of the second jaw . the straight section of gripping teeth 106 on the first jaw 42 and the straight section of gripping teeth 108 on the second jaw 44 mesh with each other when the first jaw and the second jaw are moved to their closed positions . this can be seen in fig5 . referring to fig1 and 6 , the first jaw 42 also has a curved section of gripping teeth 112 . the curved section of gripping teeth 112 on the first jaw 42 extend from the straight section of gripping teeth 106 on the first jaw toward the proximal end of the first jaw . the curved section of gripping teeth 112 on the first jaw 42 extend along a curved line as they extend from the straight section of gripping teeth 106 on the first jaw toward the proximal end of the first jaw . the second jaw 44 is also provided with a curved section of gripping teeth 114 . the curved section of gripping teeth 114 extend from the straight section of gripping teeth 108 of the second jaw 44 toward the proximal end of the second jaw . the curved section of gripping teeth 114 on the second jaw 44 extend along a curved line as they extend from the straight section of gripping teeth 108 on the second jaw toward the proximal end of the second jaw . the curved section of gripping teeth 112 on the first jaw 42 and the curved section of gripping teeth 114 on the second jaw 44 allow larger objects , for example larger diameter posts , larger diameter trees , large rocks , etc . to be engaged between the sections of gripping teeth near the proximal ends of the jaws 42 , 44 and closer to the loader arms of the vehicle with which the apparatus 10 is used for a maximized pulling and lifting force . referring to fig1 and 5 - 8 , a first tooth 14 is removably attached to the distal end of the first jaw 42 and a second tooth 118 is removably attached to the distal end of the second jaw 44 . the teeth 116 , 118 represented in the drawing figures are replaceable , excavator style digging teeth . other types of digging teeth could be employed instead of those shown . with the teeth 116 , 118 being replaceable , they can be replaced when worn after several digging operations . as various modifications could be made in the construction of the apparatus and its method of operation herein described and illustrated without departing from the scope of the invention , it is intended that all matter contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative rather than limiting . thus , the breadth and scope of the present disclosure should not be limited by any of the above described exemplary embodiments , but should be defined only in accordance with the following claims appended hereto and their equivalents . | 0 |
this detailed description of various exemplary embodiments of the invention makes reference to exemplary compositions and methods . while these embodiments are described in sufficient detail to enable those skilled in the art to practice the invention , it should be understood that other embodiments may also be realized , and that logical and processing changes may be made without departing from the spirit and scope of the invention . thus , the detailed description herein is present for the purposes of illustration only and not of limitation . in the development of the present invention , it was discovered that certain mixtures of extracts of the herb sophora with extracts of other herbs such as honeysuckle , kudzu , and licorice provide a synergistic antioxidant effect when prepared within certain ranges of concentration ratios . the detailed description of this discovery with respect to each herb mixture ( i . e ., sophora / honeysuckle , sophora / kudzu , and sophora / licorice ) will be taken up separately in the sections to follow : sophora flower is the dried flower of the japanese pagoda tree ( sophora japonica ), which is native to japan , china , korea and other eastern asia countries it is described as having numerous medicinal uses , particularly in traditional chinese medicine , including use as an anti - inflammatory agent . the sophora flower extracts used in the present study were obtained from symrise gmbh & amp ; co ., kg ., holzminden , germany , under the name actipone ® sophora flower . in the present specification and claims , the extract will be referred to either as “ sophora ” or as “ sophora flower .” honeysuckle is an herb extract obtained from the dried flowers of the plant lonicera japonica . it is mentioned throughout history not only as a candy and food ingredient but also as a natural remedy for a wide range of ailments , including use for anti - inflammatory , anti - irritant , and vasodilatory effect . the honeysuckle extracts used in the present study were obtained on the market from symrise gmbh & amp ; co ., kg ., holzminden , germany , under the name actipone ® honeysuckle flower . in the present specification and claims , the extract will be referred to either as “ honeysuckle ” or “ honeysuckle flower .” in the development of the present invention , the measurement of antioxidant activity was made using the oxygen radical absorbance capacity ( orac ) assay described in the publication by huang , d . ; ou , b . ; hampshe - woodill , m . ; flanagan , j . a . ; and prior , r . i ., entitled “ high - throughput assay of oxygen radical absorbance capacity ( orac ) using a multichannel liquid handling system coupled with a microplate fluorescence reader in 96 - well format ”, 2002 j . agric . food chem ., 50 , 4437 - 4444 . in these measurements , for each herb extract , the fluorescence decay curves of sodium fluorescein ( na2f1 ) induced by 2 , 2 prime - azobis (- amidopropane ) dihydrochloride ( aaph ) in the presence of trolox standards was evaluated . the orac measurement was performed at 30 ° c . on a synergy ™ ht multi - detection microplate reader ( bio - tek instruments , inc ., winooski , vt .) with an excitation wavelength of 485 ± 20 nm and emission wavelength of 530 ± 20 nm . the plate reader was controlled by software kc4 3 . 4 . in these measurements , an 8 . 0 × 10 − 5 mm fresh na2f1 solution was made daily by diluting the stock solution in 75 mm phosphate buffer ( ph 7 . 4 ). aaph ( 0 . 414 g ) was completely dissolved in 10 ml of 75 mm phosphate buffer ( ph 7 . 4 ) to a final concentration of 150 mm and was kept in an ice bath . trolox standard was prepared as follows : 0 . 0125 g of trolox was dissolved in 10 ml meoh solution to give a 0 . 5m stock solution . the stock solution was diluted with the same phosphate buffer to 50 , 25 , 12 . 5 and 6 . 25 μm , i . e . 12 . 5 , 6 . 25 , 3 . 13 , and 1 . 56 μg / ml working solutions . these samples were used in each test as control . in each test , samples were freshly prepared by dissolving into 75 mm phosphate buffer ( ph 7 . 4 ) to make stock solution and then diluting and the phosphate buffer solution was tested as blank . in the course of the work leading to the present invention , mixtures of sophora and honeysuckle in a number of varying concentration ratios were tested for antioxidant effectiveness using the orac assay method . the fluorescence decay curves of na2f1 induced by aaph in the presence of trolox standards for each herb extract and the combination of herb extracts were plotted after each test . their area under the curve ( a . u . c .) was calculated . the net a . u . c . was calculated as a . u . c . sample − a . u . c . blank . the net a . u . c . from the combination of herb extracts and the sum of net a . u . c . from each herb extract were listed in table and also plotted in diagram . the results of such testing for a first group of mixtures , using sophora and honeysuckle are set forth in the following table 1 - a : it will be noted that , in the above table 1 - a , a positive percentage number in the ( net − sum )/ sum * 100 column indicates that the mixtures possesses synergistic effect , while a negative percentage number indicates non - synergistic effect . a second group of sophora / honeysuckle mixtures , but with concentration ratios differing from the first , was submitted to the same orac testing , with the results being shown in the following table 1 - b : it will be noted that , in the above table 1 - b , all numbers in the ( net - sum )/ sum * 100 column are positive numbers , indicating that all concentration ratios provided synergism . to summarize the synergistic and non - synergistic findings in the above studies , the synergistic ratios are tabulated below in table 1 - c , and the non - synergistic ratios are set out below in table 1 - d : the data of tables 1 - c and 1 - d have been incorporated in an xy scatter chart which is presented in this application as fig1 . it will be noted that the concentration ratios found to be synergistic are located within the area marked a on the chart . to summarize all of the foregoing , in the embodiment of the invention involving mixtures of sophora and honeysuckle , the concentration ratios which have been found to be synergistic are within the range of 1 . 0 μg / ml ≦ c sophora ≦ 8 . 0 μg / ml , 6 . 0 μg / ml ≦ c honeysuckle ≦ 28 . 0 μg / ml . in the embodiment involving mixtures of sophora and kudzu , the sophora is the herb extract obtained from the japanese pagoda tree ( sophora japonica ), which is described in more detail in the previous section . kudzu is an herb extract obtained from the plant pueraria lobata , which is native to china and japan but has been transplanted in many other countries of the world , including the united states . it is described as having numerous medicinal uses , particularly in traditional chinese medicine . the kudzu extracts used in the present study were on the market from symrise gmbh & amp ; co ., kg ., holzminden , germany , actipone pueraria root . in the present specification and claims , the extract will be referred to as “ kudzu ”. in the development of the sophora / kudzu embodiment of the present invention , the measurement of antioxidant activity was made using the oxygen radical absorbance capacity ( orac ) assay , which is described in detail in the preceding section relating to the sophora / honeysuckle embodiment . in the course of the work leading to the present invention , mixtures of sophora and kudzu in a number of varying concentration ratios were tested for antioxidant effectiveness using the orac assay method to obtain net a . u . c . values , and the results of such testing for a first group of mixtures are set forth in the following table 2 - a : it will be noted that , in the above table 2 - a , all numbers in the ( net - sum )/ sum * 100 column are positive numbers , indicating that all concentration ratios provided synergism a second group of sophora / kudzu mixtures , but with concentration ratios differing from the first , was submitted to the same orac testing , with the results being shown in the following table 2 - b : it will be noted that , in the above table 2 - b , a positive percentage number in the ( net - sum )/ sum * 100 column indicates that the mixtures possesses synergistic effect , while a negative percentage number indicates non - synergistic effect . a third group of sophora / kudzu mixtures , but with concentration ratios differing from the first two , was submitted to the same orac testing , with the results being shown in the following table 2 - c : it will be noted that , in the above table 2 - c , all numbers in the ( net − sum )/ sum * 100 column are positive numbers , indicating that all concentration ratios provided synergism to summarize the synergistic and non - synergistic findings in the above two studies relating to mixtures of sophora and kudzu , the synergistic ratios are tabulated below in table 2 - d , and the non - synergistic ratios are set out below in table 2 - e : the data of tables 2 - d and 2 - e have been incorporated in an xy scatter chart which is presented in this application as fig2 , relating to mixtures of sophora and kudzu extracts . it will be noted that the concentration ratios found to be synergistic are located within the area marked a on the chart . to summarize the above data for the embodiment of the invention involving mixtures of sophora and kudzu extracts , the concentration ratios which have been found to be synergistic are within the range of 0 . 5 μg / ml ≦ c sophora ≦ 25 . 0 μg / ml , 0 . 5 μg / ml ≦ c kudzu 25 . 0 μg / ml . in the embodiment involving mixtures of sophora flower and licorice , the sophora flower is the herb extract obtained from the japanese pagoda tree ( sophora japonica ), which is described in more detail in a previous section . licorice is an herb extract obtained from the root of the glycyrrhiza glabra plant , which is indigenous to many subtropical climes , including china , greece , spain , turkey , and iraq . it is mentioned throughout history not only as a candy and food ingredient but also as a natural remedy for a wide range of ailments , including use for anti - inflammatory effect . the licorice extracts used in the present study were obtained on the market from symrise gmbh & amp ; co ., kg ., holzminden , germany , under the name actipone ® licorice root . in the present specification and claims , the extract will be referred to as “ licorice ”. in the course of the work leading to the present invention , mixtures of licorice and sophora in a number of varying concentration ratios were tested for antioxidant effectiveness using the orac assay method to obtain net a . u . c . values , and the results of such testing for a first group of mixtures , using licorice ( liquid ) and sophora ( liquid ) obtained from symrise are set forth in the following table 3 - a : it will be noted that , in the above table 3 - a , all numbers in the ( net - sum )/ sum * 100 column are positive numbers , indicating that all concentration ratios provided synergism . a second group of licorice / sophora mixtures , but with concentration ratios differing from the first , was submitted to the same orac testing , with the results being shown in the following table 3 - b : it will be noted that , in the above table 3 - b , a positive percentage number in the ( net − sum )/ sum * 100 column indicates that the mixtures possesses synergistic effect , while a negative percentage number indicates non - synergistic effect . a third group of licorice / sophora mixtures , but with concentration ratios differing from the first two , was submitted to the same orac testing , with the results being shown in the following table 3 - c : it will be noted that , in the above table 3 - c , a positive percentage number in the ( net - sum )/ sum * 100 column indicates that the mixtures possesses synergistic effect , while a negative percentage number indicates non - synergistic effect . to summarize the synergistic and non - synergistic findings in the above three studies , the synergistic ratios are tabulated below in table 3 - d , and the non - synergistic ratios are set out below in table 3 - e : the data of tables 3 - d and 3 - e have been incorporated in an xy scatter chart which is presented in this application as fig3 . it will be noted that the concentration ratios found to be synergistic are located within the area marked a on the chart . to summarize all of the foregoing , in the embodiment of the invention involving mixtures of licorice and sophora , the concentration ratios which have been found to be synergistic are within the range of 1 . 5 μg / ml ≦ c sophora ≦ 27 . 0 μg / ml , 1 . 5 μg / ml ≦ c licorice ≦ 28 . 0 μg / ml . in the practice of the invention , the plant extract combinations mentioned above may be included in any suitable skin care bases medicinally acceptable for dermal application , including various base formulations such as liquids , creams , gels , foams , lotions , body washes , liquid hand soaps , shampoos , antiperspirants , deodorants , and the like . such base formulations conventionally contain known skin care ingredients , such as found in “ cfta cosmetic ingredient handbook ,” j . m . nikitakis , ed ., the cosmetic , toiletry and frangrance association , inc ., washington , d . c . ( 1988 ), incorporated herein by reference . such ingredients include , but not by way of limitation , numerous enhancing elements , such as alcohols , oleaginous substances , surfactants , preservatives , emollients , perfumes , colorants , humectants , thickening agents , skin care agents , water - soluble polymers , chelating agents , ph adjusting agents , foaming agents , antimicrobial agents , vitamins , and the like . examples of the above - mentioned surfactants include , but are not limited to , lauryl sulfates , octyl sulfates , 2 - ethylhexyl sulfates , lauramine oxides , decyl sulfates , tridecyl sulfates , cocoates , lauryl sulfosuccinates , lauryl sarcosinates , lauryl ether sulfates ( 1 and 2 moles ethylene oxide ), myristamine oxide , ricinoleates , cetyl sulfates , alkyl glucosides , and similar surfactants . examples of the above preservatives include benzoic acid salts , salicylic acid salts , sorbic acid salts , dehydroacetic acid salts , parahydroxybenzoic acid esters , benzalkonium chloride , 2 , 4 , 4 ′- trichloro - 2 ′- hydroxydiphenyl ether , 3 , 4 , 4 ′- trichlorocarbanilide , hinokitiol , resorcinol , and ethanol . examples of humectants include glycerin , sodium pyrrolidone carboxylate , and the like . examples of foam stabilizers include cetyl alcohol , cetearyl alcohol , stearic acid , and the like . examples of skin care agents include guar gum , hydroxyethylcellulose , hydroxypropylmethylcellulose , polyethylene glycol , hydrolyzed wheat protein , polyoxyethylene stearyl ether , and the like . the actual formulation of the skin care consumer products incorporating the plant extract combinations of the present invention is through standard methods of manufacturing . all the liquid formulations are easily made in batch mixtures , with addition of water usually first , such that the liquid is above the mixing impeller within the tank . then the specialty chemicals , such as the surfactants are added , followed by the dyes , preservatives , plant extract combinations , etc . the methods of manufacture are well known . while numerous exemplary embodiments of the invention have been presented in the foregoing detailed description of the invention , it should be appreciated that a vast number of variations exist . it should also be appreciated that the exemplary embodiments are only examples , and are not intended to limit the scope , applicability , or configuration of the invention in any way . rather , the foregoing detailed description will provide those skilled in the art with a convenient road map for implementing an exemplary embodiment of the invention , it being understood that various changes may be made in the function and arrangement of elements described in an exemplary embodiment without departing from the scope of the invention set forth in the appended claims and their legal equivalents . | 0 |
fig1 - 3 show the structure of the preferred embodiment of the projected forensic scale ( pfs ). the pfs 1 contains two light sources with lenses 2 which can be ground , compound , fresnel , or masked shaped , and a mounting hole 3 . the light sources can be lasers , leds , or incandescent lights . fig2 is a view of the rear of the unit showing a power switch 4 , a power source 5 , a power indicator 6 , and a trigger 21 . fig3 shows the pfs mounted on a camera 7 in the preferred embodiment . fig4 - 8 show how pfs indicates the size and distance of photographed objects . fig4 shows two projected points of light 8 one unit of length apart and two projected rings 9 onto an object 10 with nominal dimensions of four units wide in an imaging device &# 39 ; s fov 11 . the distance between the dots is constant , and can be used in a captured image to determine the size of objects within the image , showing in this case , that the object is four units wide . fig5 shows two projected points of light 8 one unit of length apart and two projected rings 9 onto an object 12 with nominal dimensions of two units wide and the same distance from the photographer as object 10 in fig4 . the scale indicates that this object is two units wide . fig6 shows two projected points of light 14 one unit of length apart and two projected rings 15 onto an object 13 with nominal dimensions of four units wide in an imaging device &# 39 ; s fov 11 . object 13 is farther from the photographer than object 10 was . in this case , the projected points 14 appear closer together than the points 8 . however , the scale indicates that object 13 is the same size as object 10 ( four units wide ). unlike the scale , the diverging rings 15 are larger than the rings 9 projected onto object 10 because object 13 is farther from the photographer . fig7 shows a orthogonal view of projected diverging ring 16 and a projected point 17 originating from the device . fig8 shows a top view of two projected diverging rings 16 and projected points 17 originating from the device . fig9 - 10 show how pfs indicates the orientation of the photographed object . fig9 shows how the projected ring 19 and projected point 20 would display on a tilted cube 18 . this illustrates another key attribute of the invention : when the circle is projected onto a surface that is not normal to the camera , the circle is distorted . this distortion gives a two - dimensional photograph an indication of the orientation , position , and or shape of the photographed object as well as means to identify the angle and distance at which the image was captured . fig1 shows the projected ring 19 on the tilted cube 20 from the viewpoint of the pfs and imaging device . the projected forensic scale ( pfs ) consists of an electronic device contained in a case (“ pfs compartment ”) that is affixed to a camera or other image - capture device . in its basic form , the pfs consists of two laser projectors . these lasers are parallel , so that they project two spots that are always a known , preset distance apart . in this manner , the size of an object in a photograph taken while using the pfs can be quickly ascertained by scaling the object relative to the distance between the two spots of light . the current method requires a ruler or scale to be placed on or near the object before the photograph is taken to achieve this same goal . using the pfs is a much faster because the photographer only has to activate the pfs , and then capture images ; the scale is automatically captured . in addition to the spots of light , each projector may display a circle or ring of light . the lenses of the pfs may be configured to project a small focused spot in the center of a diverging ring of light . thus the projected ring , captured on the surface of an object provides information about the object such as its shape , orientation to the photographer , surface finish , and distance from the photographer . devices for projecting different patterns of light , including circles and rings , are well known in the art . for example , the laser mouse cat toy by doctors foster and smith , is light source device capable of projecting complex shapes such as a “ mouse - shaped silhouette .” see laser mouse cat toy at http :// www . drsfostersmith . com / product / prod_display . cfm ? pcatid = 2972 & amp ;( cmpid = 02csegb & amp ; ref = 3312 & amp ;( subref = aa & amp ; ci_src = 14110944 & amp ; ci_sku = 0008829000000 ( last visited dec . 12 , 2009 ). post - processing software that is also well known in the art could then be used to calculate the original properties ( shape , orientation , viewing distance , etc .) of the object from the captured image . use of the pfs is very simple . the user only needs to turn the device on , and then capture images as they would ordinarily . the device would require little or no periodic maintenance . in the preferred embodiment , the lens and projector alignment is fixed . in an alternate embodiment , one of the projectors could be fixed within the pfs while the alignment of the other projector could be adjusted by set screws . the mounting to the imager can take several forms . most commercially - available imaging devices have a standard threaded hole in their base — designed for mounting the camera on a tripod — which can be used to mount the pfs with a screw . other mounting alternatives include mounting the device on the outside of the imager lens ( such as with a clamp that fits on the outside of a camera lens ), or otherwise affixing to the body of the imager ( such as with magnets ). these alternatives may have advantages including desirable alignment with the lens , but could require camera - specific mounting configurations . this basic invention can be expanded in a number of areas including separate switches for the dot scale and the projected ring . one method of incorporating this feature is to use separate projectors for the spot scale and the rings . this would be an advantage if it is desired to project the dots and rings eccentrically . the lasers could also be linked to a camera shutter or flash so that the pfs is only switched on when the picture is taken , thereby increasing the battery life of the device , as well as creating a potentially safer product ( if a person looks directly at the beam , shorter - duration laser light is less likely to cause eye damage ). additionally , the pfs could be configured to produce other shapes or information . in another embodiment , these shapes or information may be created by interchangeable lenses . other shapes could also be produced by the projector lenses instead of rings . for example , a cross - hairs or square may be preferable by some users . this could even be incorporated in the design through interchangeable lenses . another embodiment of the invention would project horizontal and vertical diverging lines ( crosshair ) through a lens that is not axially symmetric . the rates of divergence for these two lines could be different . in this case , the ratio of the lengths of the two lines could be used to calculate distance from the viewer as well as the size of the object . in this case , the scale measurement that the lines represent would be different for different viewing distances , but would still be constant between targets at the same orientation and distance from the viewer . at short range , focused leds have sufficient brightness to serve as a source for the projected scale , though the precision of the scale may be impacted . in another embodiment of the invention , leds could also be used alone or in combination with lasers . for example , lasers could serve to produce the point scale while leds could project the ring . in another embodiment of the design , a single light source could also be used to produce multiple beams , through the use of a beam splitter , mirrors , and lenses . in another embodiment , the pfs can be integrated directly into an image capture device . the pfs &# 39 ; s laser used in this device could also be incorporated into a laser rangefinder in a different embodiment . this distance information could then be used directly by the photographer or image capture device ( to set flash timings or autofocus , for example ) as well as to modulate laser power for eye safety . | 7 |
the following description should be read with reference to the drawings , in which like elements in different drawings are numbered in like fashion . the drawings , which are not necessarily to scale , depict selected embodiments and are not intended to limit the scope of the disclosure . although examples of construction , dimensions , and materials are illustrated for the various elements , those skilled in the art will recognize that many of the examples provided have suitable alternatives that may be utilized . for the following defined terms , these definitions shall be applied , unless a different definition is given in the claims or elsewhere in this specification . all numeric values are herein assumed to be modified by the term “ about ”, whether or not explicitly indicated . the term “ about ” generally refers to a range of numbers that one of skill in the art would consider equivalent to the recited value ( i . e ., having the same function or result ). in many instances , the term “ about ” may be indicative as including numbers that are rounded to the nearest significant figure . the recitation of numerical ranges by endpoints includes all numbers within that range ( e . g ., 1 to 5 includes 1 , 1 . 5 , 2 , 2 . 75 , 3 , 3 . 80 , 4 , and 5 ). although some suitable dimensions ranges and / or values pertaining to various components , features and / or specifications are disclosed , one of skill in the art , incited by the present disclosure , would understand desired dimensions , ranges and / or values may deviate from those expressly disclosed . it is often desirable to obtain a measure of the temperature of a fluid ( e . g . a liquid or gas ) inside of an enclosed tank , such as a water heater tank . while water heaters are described below as one example application , it should be recognized that there are many other applications where it may be desirable to obtain a measure of the temperature of a fluid inside of an enclosed tank . for example , in some industrial applications , it may be desirable to obtain a measure of the temperature of a fluid passing through a supply pipe that is supplying a constituent to an industrial process . in another example , in a food processing application , it may be desirable to obtain a measure of the temperature of a fluid that is in a distilling tower or a fermenting vat . these are just some examples . fig1 provides a schematic view of an illustrative but non - limiting water heater 10 . water heater 10 includes a water heater tank 12 . the water heater tank 12 may include an insulating layer ( not explicitly shown ) positioned about the water heater tank 12 to help reduce thermal losses from the water heater tank 12 . cold water enters water heater tank 12 through a cold water line 14 and is heated by a gas burner 24 . in some cases , the water heater 10 may include an electric heating element rather than a gas burner 24 . a power delivery unit ( not shown ) may be used to selectively apply power ( i . e . current ) to the electric heating element . in either case , the resulting heated water exits through a hot water line 16 . for gas - fired water heaters , a gas control unit 18 , such as a gas valve , regulates gas flow from a gas source 20 through a combustion gas line 22 and into gas burner 24 . a flue 26 permits combustion byproducts to safely exit . as can be seen , water heater 10 may include a temperature sensor 28 . in some cases , temperature sensor 28 may enter water heater tank 12 at a location laterally offset from gas control unit 18 . in some instances , however , temperature sensor 28 may instead be located behind gas control unit 18 , and in some cases , may be supported and retained by a common mounting bracket such as that described more fully below . in some embodiments , a non - immersion type temperature sensor may be provided . while not explicitly shown , the water heater tank 12 may include a threaded spud 30 ( fig3 ) or other feature ( s ) for mounting a non - immersion type temperature sensor 28 relative to the water heater tank 12 . fig2 is a perspective view of an illustrative but non - limiting mounting bracket 32 that may be used in conjunction with the water heater 10 . the mounting bracket 32 , in combination with the threaded spud 30 ( see fig3 - 4 ) may position a temperature sensor assembly 41 in a relatively precise location relative to the water heater tank 12 such that water temperature may be accurately and reliably measured and / or calculated . in some instances , the mounting bracket 32 may include a component retaining region 34 , and a sensor portion 36 forming an elongated stem extending from the component retaining region 34 . in the illustrative embodiment , bracket 32 may be configured to retain a gas valve module and / or a water heater controller module ( not explicitly shown ) within component retaining region 34 , as well as a temperature sensor assembly 41 ( see also fig3 ) within elongated stem . component retaining region 34 may form at least a portion of a housing of a gas control unit , such as gas control unit 18 of fig1 , but this is not required . in some instances , component retaining region 34 may include an opening 48 connecting the component retaining region 34 a hollow portion 50 of the sensor portion 36 . in some cases , opening 48 may extend from the component retaining region 34 and through the sensor portion 36 to an open end 37 of the sensor portion defining a hollow portion 50 . bracket 32 may be formed of any suitable material . in some cases , bracket 32 may include non - metallic materials such as a polymeric material , glass , ceramic , plastic , and the like . in some cases , bracket 32 may be manufactured as a single piece by injection molding a nylon material such hylon ®, available from entec polymers in manchester , tenn . it is contemplated that in some cases , bracket 32 may not be formed entirely from the same material , or bracket 32 may not be formed as a single piece . in some cases , bracket 32 may include metallic materials , if desired . in the illustrative embodiment , sensor portion 36 of the bracket 32 may include an elongated stem extending from component retaining region 34 . sensor portion 36 may include an internal hollow portion 50 ( shown in more detail in fig3 ) for slidably receiving a temperature sensor assembly 41 . in the embodiment shown , the temperature sensor assembly 41 may extend out of an open end 37 of the sensor portion 36 and away from the component retaining region 34 . the elongated stem of sensor portion 36 may include a first portion 40 and a threaded region 38 extending around the exterior of the sensor portion 36 . in some instances , as illustrated , threaded region 38 can be used to secure bracket 32 to or within a threaded aperture 31 ( fig3 ) of a water heater spud 30 . as discussed in more detail below , the sensor portion 36 and temperature sensor assembly 41 may be configured such that when the threaded region 38 is engaged with the threaded water heater spud 30 , a temperature sensor 52 ( see fig3 ) may be positioned in a relatively precise position relative to the water heater tank 12 . in some embodiments , bracket 32 may also include two ( or more ) bosses 44 on a first lateral side , and two ( or more ) bosses 44 on a second opposing lateral side . while bracket 32 is shown having four bosses 44 , it is contemplated that bracket 32 may have any number of bosses 44 as desired , for example , but not limited to , one , two , three , or more . additionally , it is contemplated that bosses 44 may be disposed on fewer than , or more than , two lateral sides . bosses 44 may provide , among other things , an area for torque to be applied directly to the bracket 32 during installation . for example , an installation tool may grip and apply torque to bosses 44 to threadably engage threaded region 38 of sensor portion 36 with the threaded water heater spud 30 on a water heater tank 12 . in some instances , bosses 44 may further include a rib 46 disposed between adjacent bosses 44 . rib ( s ) 46 may provide additional support to the bracket 32 , and may also help prevent an installation tool from contacting the component retaining region 34 of bracket 32 during installation . turning to fig3 , which is cross - section of an illustrative , but non - limiting mounting bracket 32 and temperature sensor assembly 41 engaging a threaded aperture 31 of a water heater spud 30 . as discussed above , the water heater tank 12 may include a feature ( s ) for mounting a non - immersion type temperature sensor 52 . for example , the water heater tank 12 may include a spud 30 extending from the outer wall 13 thereof . in some instances , the spud 30 may include a threaded aperture 31 for mating with the threaded region 38 of the mounting bracket 32 . however it is contemplated that the other retaining feature ( s ), such an adhesive , friction fit , snap fit , clips , etc . may be used to secure the sensor portion 36 of the bracket 32 to the water heater tank 12 . the temperature sensor assembly 41 may include a thermal conduction temperature sensor 52 , sometimes disposed within a capsule 42 . it is contemplated that the temperature sensor 52 may be of any type desired and is not necessarily limited to a thermal conduction temperature sensor . the temperature sensor 52 may be electrically connected to a control unit ( such as gas control unit 18 in fig1 ) via an electrical cable 60 and connection element 58 ( e . g . plug ). in the illustrative embodiment shown , capsule 42 may have a generally cylindrical shape , although this is not required . it is contemplated that the capsule may have any cross - sectional shape desired such as , but not limited to : rectangular , square , elliptical , polygonal , etc . it is further contemplated that the capsule 42 may be sized and shaped to conform to the shape of the temperature sensor 52 . however , it is contemplated that the capsule 42 may take any shape as desired . it is contemplated that while the capsule 42 is illustrated has having a first end 43 with a smaller cross - sectional area , the first end 43 may be similar in size or larger than the second end 45 of the capsule 42 . in some embodiments , capsule 42 may include feature ( s ) adjacent the second end 45 that are configured to maintain a portion of the temperature sensor assembly 41 within the hollow portion 50 of the sensor portion 36 . for example , in some instances , the second end 45 of the capsule 42 may include one or more protrusions extending away from the capsule 42 . the one or more protrusions may be configured to engage a mating feature , such as a protrusion adjacent the open end 37 on the sensor portion 36 , to maintain the temperature sensor assembly 41 within the hollow portion 50 ( e . g . to help ensure that the temperature sensor assembly 41 does not slide out of the open end 37 on the sensor portion 36 ). it is contemplated that the one or more protrusions may be temporarily deformed to allow the temperature sensor assembly 41 to be initially assembled within the hollow portion 50 of sensor portion 36 by inserting the temperature assembly through the open end 37 and into the hollow portion 50 . it is further contemplated that the protrusions may also be temporarily deformed if the temperature sensor 52 and / or temperature sensor assembly 41 need to be removed . in some instances , the temperature sensor assembly 41 may be slidably disposed within or about the hollow portion 50 . in some cases , the sensor portion 36 may include a lip or shelf 55 generally perpendicular to the elongated stem to maintain the temperature sensor assembly 41 within a region of the sensor portion 36 between the shelf 55 and the open end 37 . the temperature sensor assembly 41 may be movable within the hollow portion 50 to accommodate various size spuds 30 , manufacturing tolerances , equipment variations , and / or other variations as desired . for example , if a shorter spud is used , the second end 45 of the capsule 42 may be positioned closer to the shelf 55 , whereas if a longer spud 30 is used , the second end 45 may be positioned further from the shelf 55 . the sensor portion 36 may include a compliant body 54 , such as a biasing element or spring , configured to maintain the temperature sensor assembly 41 in a proper position . in some cases , it is contemplated that the biasing element 54 may be sized to accommodate various water tank spud 30 lengths . the biasing element 54 may have a first end 53 configured to engage temperature sensor assembly 41 , and a second end 56 configured to contact shelf 55 . in some instances , the biasing element 54 may be partially disposed within capsule 42 . the biasing element 54 may be configured to bias the temperature sensor assembly 41 away from the shelf 55 . when the sensor portion 36 of the mounting bracket 32 is engaged with the water tank spud 30 , the biasing element 54 may exert sufficient force to bias the temperature sensor assembly 41 towards the water heater tank 12 such that a first end 43 of the temperature sensor assembly 41 physically contacts the outer wall 13 of the water heater tank 12 . physical contact between the first end 43 of the temperature sensor assembly 41 and the outer wall of the water heater tank 12 may increase thermal conduction between the temperature sensor 52 and the water heater tank 12 , which may increase the accuracy and reliability of the temperature sensor measurement . turning now to fig4 , which is cross - section of another illustrative , but non - limiting mounting bracket 132 and temperature sensor assembly 141 engaging a threaded aperture 31 of a water heater spud 30 . it is contemplated that the mounting bracket 132 may be similar in form and function to mounting bracket 32 of fig3 . for example , while not explicitly shown , the mounting bracket 132 may include bosses and / or ribs to facilitate installation of the bracket 132 and / or to provide additional support . the mounting bracket 132 in combination with the threaded spud 30 may position a temperature sensor assembly 141 in a proper or desired location relative to the water heater tank 12 such that water temperature may be accurately and reliably measured and / or calculated . in some instances , the mounting bracket 132 may include a component retaining region 134 , and a sensor portion 136 extending from the component retaining region 134 forming an elongated stem . in the illustrative embodiment , bracket 132 may be configured to retain a gas valve module and / or a water heater controller module ( not explicitly shown ) within component retaining region 134 , as well as a temperature sensor assembly 141 within elongated stem of sensor portion 136 . component retaining region 134 may form at least a portion of a housing of a gas control unit , such as gas control unit 118 of fig1 , but this is not required . in some instances , component retaining region 134 may include an opening 148 connecting the component retaining region 134 a hollow portion 150 of the sensor portion 136 . opening 148 may extend from the component retaining region 134 and through the sensor portion 136 to an open end 137 of the sensor portion defining a hollow portion 150 . bracket 132 may be formed of any suitable material . in some cases , bracket 132 may include non - metallic materials such as a polymeric material , glass , ceramic , plastic , and the like . in some cases , bracket 132 may be manufactured as a single piece by injection molding a nylon material such hylon ®, available from entec polymers in manchester , tenn . it is contemplated that in some cases , bracket 132 may not be formed entirely from the same material , or bracket 132 may not be formed as a single piece . in some cases , bracket 132 may include metallic materials , if desired . in the illustrative embodiment , sensor portion 136 of the bracket 132 may include an elongated stem extending from component retaining region 134 . sensor portion 136 may include an internal hollow portion 150 for slidably receiving a temperature sensor assembly 141 . in the embodiment shown , the temperature sensor assembly 141 may extend out of an open end 137 of the sensor portion 136 and away from the component retaining region 134 . the elongated stem of sensor portion 136 may include a first portion 140 and a threaded region 138 extending around the exterior of the sensor portion 136 . in some instances , as illustrated , threaded region 138 can be used to secure bracket 132 to or within a threaded aperture 131 of a water heater spud 130 . as discussed in more detail below , the sensor portion 136 and temperature sensor assembly 141 may be configured such that when the threaded region 138 is engaged with the threaded water heater spud 130 , a temperature sensor 152 may be positioned in a relatively precise position relative to the water heater tank 12 . it is contemplated that the temperature sensor assembly 141 may include an infrared ( ir ) temperature sensor 152 disposed within and attached to a capsule 142 . it is contemplated that the temperature sensor 152 may be of any type desired and is not necessarily limited to an ir temperature sensor . the temperature sensor 152 may be electrically connected to a control unit ( such as gas control unit 18 in fig1 ) via an electrical cable 160 and connection element 158 ( e . g . plug ). capsule 142 may include a first portion 145 having a first cross sectional area and a second portion 143 having a second cross - sectional area . in some instances , the second cross - sectional area may be larger than the first cross - sectional area , although this is not required . it is contemplated that in some instances , the first portion 145 may have a cross - section that is similar in size or smaller than the cross - section of the second portion 143 . it is contemplated that the capsule may have any cross - sectional shape desired such as , but not limited to : rectangular , square , elliptical , polygonal , etc . in some instances , the cross - sectional shapes of the first portion 145 and the second portion 143 may be different . for example , in some embodiments , the first portion 145 may have a generally circular cross - sectional shape while the second portion 143 may have a generally square cross - sectional shape . in other embodiments , the cross - sectional shapes of the first and second portions 145 , 143 may be the same or similar . in some embodiments , the first and second portions 145 , 143 may be formed from a single piece or a unitary structure . in other embodiments , the first and second portions 145 . 143 may be separate components . the first and second portions 145 , 143 may be attached in any manner known in the art , such as , but not limited to , welding , brazing , soldering , adhesive , friction fit , snap fit , fasteners , etc . in some embodiments , the second portion 143 may include a generally solid end 139 adjacent to the first portion 145 of the capsule 142 . temperature sensor 152 may be mounted or otherwise affixed to the solid end 139 such that the temperature sensor 152 faces a water heater tank 12 when the mounting bracket 132 is engaged with a water tank spud 30 . temperature sensor 152 may be mounted to the capsule 142 such that the temperature sensor 152 is partially enclosed within the capsule 142 , but this is not required . it is contemplated that the second portion 143 may be sized such that a when the mounting bracket 132 is engaged with a water tank spud 30 , the temperature sensor 152 is spaced a predetermined distance ‘ d ’ from the outer wall 13 of the water heater tank 12 , as shown in fig4 . for example , the temperature sensor 152 may be positioned approximately 0 . 10 inches , 0 . 25 inches , anywhere between 0 . 10 inches and 0 . 25 inches , or any other suitable distance from the outer wall 13 of the water heater tank 12 . capsule 142 may be formed from a relatively non - compliant and / or relatively non - deformable material such that when a biasing force is exerted on the capsule 142 by biasing member 154 , the capsule 142 resists deformation and maintains the temperature sensor 152 at a fixed distance from the outer wall 13 of the water heater tank 12 . in some instances , capsule 142 may include features adjacent the first portion 145 thereof that are configured to maintain a portion of the temperature sensor assembly 141 within the hollow portion 150 of the sensor portion 136 . for example , in some cases , the first portion 145 of the capsule 142 may include one or more protrusions extending away from the capsule 142 . the one or more protrusions may be configured to engage a mating feature such as a protrusion adjacent the open end 137 , on the sensor portion 136 to maintain the temperature sensor assembly 141 within the hollow portion 150 . it is contemplated that the one or more protrusions may be temporarily deformed to allow the temperature sensor assembly 141 to be assembled within the hollow portion 150 of sensor portion 136 by inserting the temperature assembly through the open end 137 and into the hollow portion 150 . it is further contemplated that the protrusions may also be temporarily deformed if the temperature sensor 152 and / or temperature sensor assembly 141 needs to be removed . in some instances , the temperature sensor assembly 141 may be slidably disposed within or about the hollow portion 150 . the sensor portion 136 may include a lip or shelf 155 generally perpendicular to the elongated stem to maintain the temperature sensor assembly 141 within a region of the sensor portion 136 between the shelf 155 and the open end 137 . the temperature sensor assembly 141 may be movable within the hollow portion 150 to accommodate various size spuds 30 . for example , if a shorter spud is used , the first portion 145 of the capsule 142 may be positioned closer to the shelf 155 , whereas if a longer spud 30 is used , the first portion 145 may be positioned further from the shelf 155 . the sensor portion 136 may further include a compliant body 154 , such as a biasing element or spring , configured to maintain the temperature sensor assembly 141 in a specified position . it is contemplated that the biasing element 154 may be sized to accommodate various water tank spud 30 lengths . for example , the biasing element 154 may have a first end 153 configured to contact the generally solid end 139 of the capsule 142 and a second end 156 configured to contact shelf 155 . in some instances , the biasing element 154 may be partially disposed within capsule 142 . the biasing element 154 may be configured to bias the temperature sensor assembly 141 away from the shelf 155 . when the sensor portion 136 of the mounting bracket 132 is engaged with the water tank spud 30 , the biasing element 154 may be configured to bias the temperature sensor assembly 141 towards the water heater tank 12 such that a second portion 143 of the capsule 142 physically contacts the outer wall 13 of the water heater tank 12 . the biasing element 154 may exert sufficient force on the temperature sensor assembly 141 to continually bias the temperature sensor assembly 141 towards the outer wall 13 of the water heater tank 12 . physical contact between the second portion 143 of the capsule 142 and the outer wall 13 of the water heater tank 12 may maintain the temperature sensor 152 a fixed distance ‘ d ’ from the outer wall 13 of the water heater tank 12 such that water temperature may be accurately and reliably measured and / or calculated . the disclosure should not be considered limited to the particular examples described above , but rather should be understood to cover all aspects of the disclosure as set out in the attached claims . various modifications , equivalent processes , as well as numerous structures to which the disclosure can be applicable will be readily apparent to those of skill in the art upon review of the instant specification . | 6 |
the present invention relates to a method for inhibiting the growth and / or proliferation of l . monocytogenes in a food sample contacted with an anti - listeria effective amount of levulinate . preferably , the present invention relates to a method for inhibiting the growth and / or proliferation of l . monocytogenes in a ready - to - eat meat containing an anti - listeria effective amount of levulinate . the food sample can be any food with a moisture content making it susceptible to growth of bacteria including listeria . preferred foods include ready - to - eat foods , deli products , fruits , vegetables and meat . more preferred foods are deli items , including , but not limited to salads , side dishes , desserts and sauces . also more preferred are ready - to - eat foods , including , but not limited to prepared meals that are prepared on the premises of grocery stores , delis , cafeterias or any other venue other than semi - sterile conditions present at a food processing and packaging facility . these would include take home meals from grocery stores and delis , meals on wheels and the like . the most preferred food sample is a meat sample . a meat sample of the present invention can be any meat product including carcasses , fresh meat , frozen meat , prepared meat , processed meat , ready - to - eat meat , meat - containing products or meat byproducts . the meat can be from any animal , preferably warm blooded animals , preferably birds or farm mammals , most preferably chickens , turkeys , beef , pork and lamb . the method of the invention is most useful for production of prepared , processed or ready - to - eat meat products under the u . s . department of agriculture &# 39 ; s directive to reduce l . monocytogenes in ready - to eat meat and poultry products ( 9 cfr part 430 ). the food or meat sample is placed in contact with levulinate , levulinic acid , or combinations of levulinate and levulinic acid sufficient to provide significant inhibition of proliferation of listeria bacteria . a significant inhibition of proliferation is inhibition greater than the statistical margin of error for measuring the level of listeria bacterial infection of a food or meat sample . in the present invention , such inhibition is at least 10 percent , preferably 50 percent , more preferably at least 75 percent and most preferably 90 percent or more of what the proliferation would have been in a control food or meat sample not in contact with levulinate . inhibition of proliferation of listeria in contact with levulinate is the measurement of inhibition during a time period during which listeria grows in the untreated product , typically a time period of from about 1 hour to 12 weeks or more , reflecting the expected shelf life of many food or meat products . in the present invention , reduction of listeria growth , or inhibition of proliferation , is intended to include each integer from 10 to 99 percent , and each time period from 1 hour to 12 weeks or more . to have inhibitory effects against listeria , levulinate is typically applied to a meat sample in an amount of 0 . 1 to 10 percent by weight , preferably 1 to 5 percent by weight , more preferably 1 . 5 to 2 . 5 percent by weight , most preferable about 2 . 5 percent by weight . in the present invention , the percentage of levulinate by weight that is preferred to be contacted with the food or meat sample is intended to include each 0 . 1 increment from 0 . 1 to 10 percent . listeria that are included in the term anti - listeria include any bacteria from the genus listeria , preferably the species listeria monocytogenes . preferably , the invention will be effective against a broad spectrum of l . monocytogenes strains that are known to cause food borne infections in humans , such as strains archived in the international life sciences institute ( ilsi ) listeria monocytogenes strains collection housed at cornell university ( http :// www . foodscience . cornell . edu / weidmand / listeriadbase . htm ): fsl j1 - 177 , ribotype dup - 1051d , lineage i , serotype 1 / 2b , isolated from human sporadic case ; fsl c1 - 056 , ribotype dup - 1030a , lineage ii , serotype 1 / 2a , isolated from human sporadic case ; fsl n3 - 013 , ribotype dup - 1042b , lineage i , serotype 4b , food isolate associated with human listeriosis epidemic in the uk ( 1988 - 1990 ); fsl r2 - 499 , ribotype dup - 1053a , lineage ii , serotype 1 / 2a , human isolate associated with us outbreak linked to sliced turkey ( 2000 ); and fls n1 - 227 , ribotype dup - 1044a , lineage i , serotype 4b , food isolate associated with us outbreak ( 1998 - 1999 ). levulinate used in the present invention is intended to include levulinic acid and alkali salts of levulinic acid , salt solutions of levulinic acid and combinations thereof . levulinic acid is the preferred form for topical decontamination of food . alkali salt solutions of levulinic acid ( such as sodium levulinate , potassium levulinate , and calcium levulinate ) are the preferred form for addition to a food sample . the levulinate is contacted with the food or meat sample so that any listeria bacteria that are , or become , associated with the food or meat will also be exposed to the levulinate . contact of the levulinate with the food or meat sample can be by application of levulinate to surfaces of the food or meat sample , or by incorporating levulinate into the meat sample . application of levulinate to food or meat surfaces can be accomplished by known methods , including mixing , spraying ( such as an aerosol , vegetable mister or sprinkler ), dips , vapor , marination , and injection or use of an apparatus such as hansen and watts , u . s . pat . no . 6 , 763 , 760 . contact of the levulinate with the food or meat sample can be via direct incorporation or application to food or meat . alternatively , contact of levulinate can be achieved via indirect means such as application or incorporation of levulinate to packaging materials or casings . packaging materials can include known materials including plastic wraps and storage bags ( such as polyethylene ( pe ), polyvinylidene chloride ( pvcd ), and polyvinyl chloride ( pvc )), meat wrapping paper , freezer paper , parchment paper , wax paper , delicatessen paper , glassine , and nylon . casings can include natural , collagen and synthetic casings . levulinic acid is the preferred choice for topical application where its acidity is less likely to be a detriment to product quality , but may provide for an initial reduction in bacterial pathogens . the sodium , potassium , and calcium salts of levulinic acid are the preferred choices for incorporation . the present invention also includes formulations of levulinate salts and levulinic acid . such formulations are combinations of levulinate salts or levulinic acid with other ingredients that might contribute to the stability of the levulinate , ease of application to a food or meat sample , and uniformity of the amount of active ingredient levulinate that is applied to the food or meat sample . such other ingredients can include buffers , clumping inhibitors , dessicants , encapsulants , and surfactants . the levulinate and / or formulations thereof can be incorporated into a kit for application or contact of levulinate with food , meat or carcasses . such a kit could include levulinate or formulations of levulinate with one or more of an applicator and instructions for application . the levulinate and / or formulations thereof can be incorporated into a kit for packaging or wrapping of food , meat or carcasses allowing direct migration of levulinate . such a kit could include levulinate or formulations of levulinate with instructions for packaging . the methods and formulations of the present invention are useful to improve the safety of food , particularly meat , by inhibiting proliferation of l . monocytogenes bacteria in meat and preventing serious human food borne illness from infection by l . monocytogenes bacteria . this invention is intended to cover all uses of levulinate as an anti - listeria agent in food or meat , including , but not limited to , use of levulinate following u . s . department of agriculture &# 39 ; s directives for reduction of l . monocytogenes in ready - to eat meat and poultry products ( 9 cfr part 430 ). anticipated variations of this invention include , but are not limited to : the use of levulinc acid for surface decontamination of carcasses and fresh meat under the u . s . department of agriculture directive for pathogen reduction and hazard analysis and critical control point systems ( 9 crf parts 304 , 308 , 310 , 320 , 327 , 381 , 416 , and 417 ); the use of levulinate as an anti - listeria agent in dairy products and other ready - to - eat foods ; and , the use of levulinate as an anti - listeria additive different from its current status as gras flavoring agent or adjunct ( 21 cfr , 172 . 515 ). the embodiments and aspects of the invention described in the specification including the examples that follow are illustrative of the invention and are not intended to be limiting in any way . those in the art will appreciate the variations of this invention that are included within the scope of the present invention such as use of levulinate and levulinc acid to inhibit growth of l . monocytogenes and other bacterial pathogens in any food capable of supporting bacterial growth . anti - listeria activity of levulinate added to fresh ready - to - eat meat the following virulent strains of listeria monocytogenes were obtained from international life sciences institute ( ilsi ) collection housed at cornell university ( http :// www . foodscience . cornell . edu / weidmand / listeriadbase . htm ): fsl j1 - 177 ; ribotype dup - 1051d ; lineage i ; serotype 1 / 2b ; isolated from human sporadic case . fsl c1 - 056 ; ribotype dup - 1030a ; lineage ii ; serotype 1 / 2a ; isolated from human sporadic case . fsl n3 - 013 ; ribotype dup - 1042b ; lineage i ; serotype 4b ; food isolate associated with human listeriosis epidemic in the uk ( 1988 - 1990 ) fsl r2 - 499 ; ribotype dup - 1053a ; lineage ii ; serotype 1 / 2a ; human isolate associated with us outbreak linked to sliced turkey ( 2000 ). fls n1 - 227 ; ribotype dup - 1044a ; lineage i ; serotype 4b ; food isolate associated with us outbreak ( 1998 - 1999 ). we completed two 12 - week challenge trials in a ready - to - eat product made from turkey breast . product was formulated , and sodium levulinate was contacted with the meat by direct addition and hand mixing of a 30 % sodium levulinate solution sufficient to obtain final concentrations ( v / wt of meat ) of 1 %, 2 %, and 3 % sodium levulinate . product was stuffed into plastic casings and fully cooked to 71 ° c ., and the final product was sliced . sample slices were inoculated with the 5 strain cocktail of l . monocytogenes , vacuum packaged , and stored at 2 ° c . for up to 12 weeks . samples were collected biweekly and analyzed for growth of l . monocytogenes using biorad rapid l &# 39 ; mono . the averaged results from two separate trials of this experiment are shown in fig1 a . counts of l . monocytogenes recovered from untreated control turkey product showed significant growth from the innoculated level after only 2 weeks of storage at 2 ° c ., and growth peaked at more than 10 8 cfu / cm 2 after 8 weeks storage . as compared to the control , addition of 1 % to levulinate delayed growth of l . monocytogenes , and greatly inhibited peak levels of growth after 12 weeks of storage . addition of 2 % or 3 % sodium levulinate to the turkey product completely inhibited growth of l . monocytogenes for the entire 12 weeks of storage . the same experiment was conducted with additional comparisons to the growth of l . monocytogenes on product that contained sodium lactate and sodium lactate plus sodium diacetate , and results are shown in fig1 b . the sodium lactate alone was mixed to a final concentration of 2 %. the sodium lactate plus sodium diacetate together was mixed to a final concentration of about 2 % volume to weight combined ( 1 . 875 % sodium lactate and 0 . 125 % sodium diacetate ). the averaged results from two trials of this experiment are shown in fig1 b . sodium levulinate used at 2 and 3 % was more effective at inhibiting growth of l . monocytogenes than sodium lactate alone or sodium lactate combined with sodium diacetate . anti - listeria activity of levulinate added to cured ready - to - eat meat we completed two separate 12 - week challenge trials in a cured ready - to - eat bologna made from pork . product was formulated , and a volume of 60 % sodium levulinate syrup was contacted with the meat by direct addition and bowl chopping of a 30 % sodium levulinate solution sufficient to obtain final concentrations ( v / wt of meat ) of 1 %, 2 %, and 3 % sodium levulinate . product was stuffed into casings and fully cooked to 71 ° c ., and the final product was sliced . sample slices were then inoculated with the 5 strain cocktail of l . monocytogenes ( described in example 1 ), vacuum packaged , and stored at 2 ° c . for up to 12 weeks . samples were collected biweekly and analyzed for growth of l . monocytogenes using biorad rapid l &# 39 ; mono . the results from this experiment are shown in fig2 a . counts of l . monocytogenes recovered from untreated control bologna showed significant growth from the inoculated level after 6 weeks of storage at 2 ° c ., and growth reached at 10 7 cfu / cm 2 after 12 weeks . addition of 1 , 2 and 3 % sodium levulinate to the bologna completely inhibited growth of l . monocytogenes for the entire 12 weeks of storage . the same experiment was conducted with additional comparisons to the growth of l . monocytogenes on product that contained sodium lactate and sodium lactate plus sodium diacetate . the sodium lactate alone was mixed to a final concentration of 2 %. the sodium lactate plus sodium diacetate together was mixed to a final concentration of about 2 % volume to weight combined ( 1 . 875 % sodium lactate and 0 . 125 % sodium diacetate ). the averaged results from the two trials of this experiment are shown in fig2 b . sodium levulinate at 1 , 2 or 3 % was as inhibitory to growth of l . monocytogenes as sodium lactate alone or sodium lactate combined with sodium diacetate . a sensory panel consisting of anonymous consumers rated samples of turkey breast roll and bologna for their overall liking of the products . samples were scored on a scale of 1 to 9 , with 1 = strongly dislike , 5 = neither like nor dislike , and 9 = strongly like . in the turkey roll panel , judges were given samples containing no antimicrobial ( control ), 2 % sodium lactate , 2 % sodium lactate plus sodium diacetate , 2 % sodium levulinate , and 3 % sodium levulinate . in the bologna analysis , the consumers were given samples containing no antimicrobial ( control ), 2 % sodium lactate , the 2 % combination of sodium lactate and sodium diacetate , 1 % sodium levulinate and 2 % sodium levulinate . there were 132 consumers that participated in the sensory panel for the turkey roll and 112 for the bologna . of those who participated in the turkey roll panel , 66 were female and 66 were male . there was a wide range of age among the participants , with the majority being in the 18 to 25 age group . similar demographic data was found among the participants of the bologna sensory panel . there were 58 females and 54 males , most of who were in the age group 18 to 25 . results of the sensory studies are given in table 1 . there were no differences in overall liking among the preparations of turkey roll or bologna indicating that addition of sodium levulinate did not negatively impact the sensory quality of the products . this experiment tests the residual anti - listeria activity imparted by topical application of levulinate to ready - to - eat meat product . in this experiment , levulinic acid is topically applied to a ready - to - eat meat product , and residual anti - listeria activity followed in a post - treatment challenge . briefly , bologna slices are surface contacted ( spray , wash , or dips ) with solutions of 1 to 3 % levulinic acetic acid . the slices are inoculated with a cocktail of 5 pathogenic strains of l . monocytogenes . samples are vacuum packaged and stored at 4 ° c . for 16 weeks . pathogen counts are determined at 0 , 2 , 4 , 8 , 12 and 16 weeks . the results show a significant decrease in the proliferation of listeria bacteria in meat samples that have been treated ( contacted ) with levulinic acid . pathogen decontamination by levulinic acid topically applied to meat carcass tissue as compared to lactic acid and acetic acid this experiment tests the extent of decontamination achieved by topical application of levulinic acid to carcass meats as compared to lactic and acetic acids . briefly , carcass tissues samples from beef , pork , lamb , and poultry ( or any other species ) are inoculated with pathogenic bacteria including , but not limited to , listeria monocytogenes . levulinic acid ( 2 %), lactic acid ( 2 %), and acetic acid ( 2 %) are independently applied at 54 ° c . to individual meat samples by washing , dipping , or spraying . samples are vacuum packaged and stored at 4 ° c . for 12 hours , and pathogen counts are determined . the results show that addition or application of levulinic acid to meat products provides an equal or greater decontamination of pathogens as compared to lactic acid and acetic acid . residual anti - pathogenic activity of levulinic acid topically applied to carcass tissues as compared to lactic acid and acetic acid this experiment tests the extent of residual anti - pathogenic activity of levulinic acid ( 2 %) topically applied to carcasses by dipping , spraying , or washing as compared to lactic acid ( 2 %) or acetic acid ( 2 %). briefly , levulinic acid , lactic acid and acetic acid are independently applied at 54 ° c . to samples of carcass tissues from beef , pork , lamb , and poultry ( or any other species ) by topical application . samples are inoculated with pathogenic bacteria ( including , but not limited to listeria monocytogenes ), vacuum packaged , and stored ( 4 to 8 ° c .) for 16 weeks . pathogen counts are determined at 0 , 2 , 4 , 8 , 12 , and 16 weeks . the results show that addition or application of levulinic acid to meat products provides an equal or greater residual anti - pathogenic activity as compared to lactic acid and acetic acid . pathogen decontamination by temperature - specific and concentration - specific levulinic acid topically applied to meat products this experiment tests the use of elevated temperatures in combination with topical application of varying concentrations of levulinic acid as compared to standard temperature and concentrations of lactic acid and acetic acid . briefly , sample meat products are inoculated with pathogenic bacteria ( including , but not limited to , listeria monocytogenes ). levulinic acid solutions ( 0 , 0 . 5 , 1 . 0 , and 2 . 0 % levulinic acid ) are topically applied at 54 , 68 , and 77 ° c . to the surfaces of inoculated meat products by washing , dipping , or spraying . in parallel , lactic acid and acetic acid solutions ( 2 % fixed concentration ) are topically applied at fixed temperature of 54 ° c . to the surfaces of inoculated meat products by washing , dipping , or spraying . samples are vacuum packaged and stored at 4 ° c . for 12 hours , and pathogen counts are determined . the results show that addition or application of concentration - specific levulinic acid at temperatures greater than 54 ° c . to meat products provides significant initial surface decontamination activity against pathogenic bacteria as compared to fixed concentrations of lactic acid or acetic acid at a fixed temperature . anti - pathogenic activity of levulinate and levulinic acid applied or added to foods this experiment tests the extent of decontamination and residual anti - pathogenic activity imparted by addition or topical application of levulinic acid and levulinate to fresh , processed , and ready - to - eat foods . briefly , a sample of food is challenged with an inoculation of pathogenic bacteria ( including , but not limited to , listeria monocytogene ) before or after treatment of the food with levulinic acid or levulinate . treatment with levulinate and levulinic acid is by addition or application of levulinc acid or levulinate in any of its physical ( solid , liquid , or vapor ) or chemical ( acid , salt , or other derivative ). challenged samples are packaged and stored at 4 to 8 ° c . for up to 16 weeks . pathogen counts are determined at 0 , 2 , 4 , 8 , 12 , and 16 weeks . the results show that addition or application of levulinic acid or levulinate to any food provides significant initial decontamination and residual activity against pathogenic bacteria . this experiment will evaluate whether topical application of levulinate to raw meats impacts the sensory quality of the final products . ground beef trimmings and turkey breast will be washed with water , 2 % lactic acid , 2 % acetic acid , or 2 % levulinic acid at 54 ° c . these raw materials will be made into cooked ground beef patties and turkey roll , respectively . a sensory panel consisting of anonymous consumers will rate cooked ground beef and ready to eat sliced turkey roll samples for their overall liking of the products . samples are scored on a scale of 1 to 9 , with 1 = strongly dislike , 5 = neither like nor dislike , and 9 = strongly like . results show that topical application of levulinate to raw meats does not negatively impact the sensory quality of the final products . | 0 |
a detailed description of the preferred embodiment of the device for producing a cnt film on a substrate and a method of producing the same is described herein below . fig1 describes a method and apparatus consistent with a first embodiment of the instant invention . generally , in the present embodiment , an aerosol 3 comprising a fluid suspension of cnt particles , enters a chamber 4 of a heat exchanger 5 as it is emitted from a cvd reactor 1 . the heat exchanger 5 may be of conventional design for cooling the aerosol 3 as it passes through the chamber 4 . the cvd reactor 1 is of conventional construction . accordingly , details of the cvd reactor are omitted . the aerosol 3 experiences a decrease in thermal energy as it passes through the chamber 4 of the heat exchanger 5 and is deposited on a filter substrate 9 in the downstream end of the heat exchanger 5 to form cnt film 7 . an exhaust 11 is provided at the output end of the apparatus in the aerosol flow path , beyond the filter 9 , to provide means for collecting or disposing of residual fluid consisting of the fluid component of the aerosol with particulates removed by the filter 9 , and this residual fluid is finally output from the apparatus . more particularly , exhaust flow from the reactor 1 ( e . g ., a cvd apparatus ) produces an aerosol or suspension of cnt particles which may also include typical catalyst particulates employed to produce the cnt in the cvd reactor . the aerosol or suspension typically exits the reaction zone of the reactor at a temperature between 300 ° c . and 1400 ° c . subsequently the heat exchanger 5 reduces the temperature of the cnt aerosol or suspension 3 in the chamber 4 to a temperature low enough to prevent any damage or malfunction of the filter 9 . this allows the use of low - cost flexible filter elements , such as polymeric cloth filters . a pressure differential across the filter 9 may depend on positive pressure from the reactor side , such as would result from the flow of feedstock gas into the reactor ; or on negative pressure from the exhaust side , such as would result from a vacuum pump 12 , shown schematically , on the exhaust 11 . in this embodiment , the film 9 is a felt - like mesh formed of low - density cnt , which builds up uniformly on the filter , with the resultant film thickness dependent upon the reactor production rate , the active filter area , and the duration of the exposure of the filter to the process output . although the above description of fig1 shows a cvd reactor which can be used to make swnt , dwnt or mwnt , other types of reactors known in the art may be substituted for the cvd reactor and still provide a suspension that may be used to produce carbon mats as conceived in this invention . therefore the reader should understand that the cvd reactor shown in fig1 and subsequent figures , could be replaced by any reactor whose output is a hot exhaust gas with an entrained aerosol suspension of cnt or other micro - tubular particles . further , although one would not necessarily produce a carbon mat with identical morphology , one could also begin with bulk nanotube powders manufactured separately , and then by some means , such as using a surfactant and sonication , or vortex mixers ( for cnt powders into a liquid ); or rotary mixers or sifters or gas vortex mixers ( for powders into gas phase ), create a uniform dispersion of nanotubes in a fluid stream which might be a liquid or an aerosol suspension . in these cases it would not be necessary to have a heat exchanger in the apparatus . fig2 describes another embodiment of a device consistent with the instant invention . like the first embodiment , in the second embodiment of the invention an aerosol 3 , as described in reference to fig1 , enters the chamber 4 of a heat exchanger 5 from the output of a cvd reactor 1 . the aerosol 3 experiences a decrease in thermal energy as it passes through the heat exchanger 5 and is deposited on a filter substrate 9 to form cnt film 7 . as described before , in reference to fig1 , the exhaust 11 , comprising the fluid component of the aerosol is outputted from the apparatus . however , in the second embodiment of the invention , the filter substrate 9 is formed on a wound filter material roll 13 . the filter substrate 9 moves underneath an aperture ( not shown ) downstream of the heat exchanger 5 so that cnt aerosol 3 can be directly deposited . the newly formed cnt film 7 is then wound around a cnt film roll 15 . the filter material roll 13 and the cnt film roll 15 forms a transport mechanism that enables filter substrate 9 to continuously move underneath the output aperture of the chamber 4 of the heat exchanger 5 thereby exposing fresh filter material to a continuous stream of cnt aerosol 3 . the thickness of the cnt film can be varied by adjusting either the transport rate of the filter substrate 9 , or the outflow of the reactor 1 or both . a third embodiment of the invention is described with reference to fig3 . the apparatus of the third embodiment includes all of the features of the first embodiment and second embodiments with the additional feature of a cover material 17 for the cnt film 7 deposited on the filter substrate 9 . the cover material 17 which comprises an elongate film or tape having a layer of adhesive ( if needed to achieve attachment greater than that provided by natural affinity of the deposited film ), paraffin wax or a low melting point metal heated to near its melting point , so that it can bond to the cnt film 7 is fed from a roll 18 . alternatively , the cover material 17 may comprise backed polymer or resin sheets made tacky by heat or chemical processes , pre - impregnated carbon - carbon composite cloth or adhesive tape , a carbon slurry , a sugar , tar , a green ceramic , wax , a polymer or a composite made from a combination thereof . optionally , the adhesive coated cover material 17 may be patterned , e . g ., grooved , to orient the cnts on the substrate 9 . in use , the cover material 17 is brought in contact with the cnt film 7 , and the cnt film 7 is then wound around a roller . in this latter embodiment , the transportation system that moves the filter material 9 may include a roller for the filter material roll 13 and a roller for a covered cnt film roll 19 . the purpose of the cover material 17 in the third embodiment of fig3 is to form an adherent substrate for the cnt film . however , the filter material 9 is not removed from the cnt film 7 at the time of application of the cover material 17 , but is instead wound around a covered cnt film roller 19 . thus , both the cover material 17 and the filter material 7 may be kept together to produce efficiently a safe means of transport of the cnt film to its final destination . however , the output of the apparatus and method of the third embodiment need not necessarily be a continuous roll , but might instead be pieces of adherent substrate 17 with the attached cnt film 7 cut to fit a specified shape needed for some other process or product . the fourth embodiment will be discussed with reference to fig4 . the method and apparatus of the fourth embodiment utilizes a cvd reactor 1 , the cnt aerosol 3 , the heat exchanger 5 including the chamber 4 and exhaust 11 as in the first through third embodiments . however , instead of a filter material formed on a roll , the filter material of the fourth embodiment is in the form of a continuous conveyor belt 25 that is moved in a loop underneath the output aperture of the chamber 4 of the of the heat exchanger . the cnt aerosol 3 is deposited on the conveyor belt 25 similarly to the deposition on the filter 9 in respect to the above - described embodiments to form the cnt film 7 . once the cnt film 7 is formed , an adhesive - coated cover material 21 is brought into contact with the cnt film 7 , whereupon the cnt film is taken up from the conveyor belt 25 , and transferred to the substrate material 21 . as described before in reference to fig3 , the adhesive - coated cover material may either be a layer of tacky material on a backing material or other substrate . after the cnt film 7 is transferred to the substrate material 21 , the conveyor belt 25 is peeled away leaving the cnt film on the substrate 21 . the cnt film carrying substrate 21 is then wound on a roll 23 . optionally , the then exposed surface of the cnt film 7 may be coated , e . g ., with second adhesive material to further stabilize the film . if necessary the negative image of the pattern of cnt film remaining on the conveyor belt 25 may be removed by mechanical means such as scraping or blowing . alternatively , if the negative image forms a pattern that is useful , that negative image may then be lifted intact from the belt by application of a second , unpatterned , adhesive substrate to form a second patterned film . fig5 is a photograph of cnt adhered to a thin film of parafilm brand paraffin made in accordance with the present invention as described in reference to fig3 . generally , cnt film made according to the above described embodiments is partially aligned , since the cnt tubes tend to form a layer that is randomly oriented within the filter plane , but that essentially lies flat within that plane . for many purposes , such as conduction of heat and electricity , the films made in this way are sufficiently aligned as - produced . however , adjusting the filter angle from perpendicular to the flow of cnt aerosol 3 , emitted from the output of the chamber 4 of the heat exchanger 5 , i . e ., as shown in fig6 causes the flow velocity of cnt aerosol 3 as deposited on the filter 9 to have at least one vector where the velocity is significantly greater . this causes the cnts of the filter 7 to align on the filter 9 in a direction parallel to the direction of the greatest flow velocity . this difference in flow velocity results in significant alignment of the cnt &# 39 ; s on the filter 7 as they are deposited . also , it is possible to further align the nanotubes so that they lie mostly parallel to one another in the plane of alignment by use of electrical and / or magnetic fields ( shown schematically in phantom at 30 in fig1 ) established in the filter collection region of the apparatus . the cnt film made in accordance with the present invention may be extruded and / or folded to a desired number of layers and / or degree of axial stretch of the cnt film . such approaches can provide arbitrarily uniform distribution of cnts throughout the volume of the cnt film , and the mechanical shearing forces of extrusion may be employed to modify the alignment of cnts in the cnt film . the cnt film may also be formed into a composite material of suspension performance and properties . surprisingly , films of carbon nanotubes made by this technique exhibit an area - wide adherent property that makes the intact removal of as - produced films from an original substrate possible with almost any material , including untreated metals , plastics , and glass . therefore , all of the embodiments described herein may substitute the inherent adherent property of the nanotube film in place of an added adhesive on the collecting substrate . another unique embodiment of this invention is production of a composite film structure made by coating a film produced by the instant invention with a layer of metal using an rf metal evaporation system , for example . because of the very low density of the deposited films , it is practical to fully coat individual bundles of nanotubes , with the depth of such metal coating into the nanotube film controllable over a useful range of thicknesses . such films may have uncoated nanotubes on one face , and fully metal coated tubes on the other face . this can greatly simplify establishing good electrical contact with tubes in the films , and can also be used to make a kind of “ nanoadhesive ” tape or film . the output from a cvd reactor comprising a hot exhaust gas flow with entrained dwnt particles was deposited on a canister filter element comprising a stainless steel woven mesh . the output from the reactor ( 35 mg / hr of dwnt particles ) was allowed to deposit dwnt for a period of 30 minutes . the coating deposited on the canister filter element was then transferred to an aluminum foil substrate which exhibits a higher natural affinity for the dwnt mat than the stainless steel woven mesh canister filter element . the transfer was made by applying a uniform pressure through the aluminum foil to the film initially adherent to the canister filter . this was then carefully unrolled from the canister to produce the aluminum foil substrate coated with a layer of dwnt approximately 0 . 7 microns thick ( see fig7 ). a high - resolution scanning electron microscope was then used to produce the image ( fig8 ), showing the densely entangled structure of the dwnt mesh . the present invention has advantages in that the process may be run continuously , and the cnt film may be produced directly , i . e ., without stopping or handling the film . also , the cnt film produced is of lower density than prior art films . various changes may be made without departing from the spirit and the scope of the invention . | 2 |
reference will now be made in detail to the preferred embodiment of the present invention , examples of which are illustrated in the drawings attached hereinafter , wherein like reference numerals refer to like elements throughout . the embodiments are described below so as to explain the present invention by referring to the figures . in one aspect , as discussed above , the present invention provides a polymer blend membrane comprising a highly sulfonated polysulfone copolymer and a nonsulfonated polysulfone copolymer . the highly sulfonated polysulfone copolymer is used for achieving high proton conductivity and the nonsulfonated polysulfone copolymer is used for improving methanol barrier property . preferably , the highly sulfonated polysulfone copolymer has 60 mol % or more of disulfonated pendant groups to obtain 0 . 17 s / cm or higher in proton conductivity . more preferably , the highly sulfonated polysulfone copolymer has 60 - 80 mol % of disulfonated pendant groups to obtain 0 . 17 - 0 . 30 s / cm in proton conductivity . morphology of the polymer blend membranes can be controlled by regulating phase separation process through varying drying condition and concentration of the casting solution . in a preferred embodiment , a polymer blend membrane with co - continuous morphology is provided . the co - continuous morphology of polymer blend membrane can be prepared by capturing the phase separation at early stage of the spinodal decomposition . suppression of the phase separation can be obtained , for example , by freeze - drying the polymer blend solution with a high concentration . the co - continuous morphology can be formed , for example , by accelerating solvent removal such as using a solvent with a low boiling point , increasing the viscosity of the polymer solution , or lowering the drying temperature . when the viscosity is increased and drying temperature is lowered near or below the tg of the solution to restrict the phase separation , spinodal decomposition is frozen at the early stage and the co - continuous percolating structure is obtained . the size of the co - continuous phase is described by a wavelength marking the distance between the centers of the neighboring continuous phase , and the submicron sized ( about 1 μm or less , or 0 . 5 - 0 . 6 μm ) domain is observed . in another preferred embodiment , a polymer blend membrane with two - layer morphology is provided . the polymer blend membrane with two - layer structure is composed of one layer having highly sulfonated polysulfone matrix and the other layer having nonsulfonated polysulfone matrix . the polymer blend membrane with two - layer structure can be formed by maintaining the phase separation until later stage of the spinodal decomposition . for example , it can be formed by retarding solvent removal such as using solvent with a high boiling point , lowering the viscosity of the polymer casting solution or increasing the drying temperature . the polymer blend membrane with two - layer structure can also be formed by the difference in specific gravity of the two component copolymers . preferable difference in specific gravity between the two component copolymers is 0 . 01 or more . a more preferable difference is 0 . 01 ˜ 0 . 1 . according to preferred embodiments of the present invention , delamination of the two - layer structure is prevented by increased interfacial adhesion which is attained by in - situ formation of the two - layer structure during the phase separation . suitably , in an application to dmfc , membrane - electrode assembly ( mea ) of the two - layer polyelectrolyte membranes may comprise the layer having the highly sulfonated polysulfone matrix with high proton conductivity which faces the cathode , and the layer having the nonsulfonated polysulfone matrix with low methanol permeability which faces the anode . as the solvent is removed from blend solution by evaporation , liquid - liquid phase separation occurs and two - layered morphology is detected when the difference in specific gravity between the two components is significant . however , the difference in specific gravity between the sulfonated and nonsulfonated polysulfones causes sulfonated polysulfone liquid phase to settle to the bottom layer since the viscosity is low . after the formation of the two layers , further evaporation of the solvent causes the secondary phase separation in each layer and thus small domains are also detected in the layered structure . the morphology of the blend membrane was observed by scanning electron microscopy and energy dispersive x - ray analysis ( edax ). the exchange of the cation from proton (— so 3 h ) to potassium (— so 3 k ) in the sulfonic acid groups of sulfonated poly sulfone copolymer was performed for the edax analysis to increase the contrast between the sulfonic acid group - rich sulfonated component region and the nonsulfonated component region with no sulfonic acid groups . the two - layered structure was confirmed by the step change of the potassium profile in the edax analysis . co - continuous morphology wherein both components were connected in a three - dimensional space was obtained by edax analysis which confirmed that potassium elements of sulfonic acid groups in the sulfonated polysulfone copolymer were evenly distributed throughout the membrane . the proton conductivity of the membrane in a proton exchange membrane fuel cell is a critical parameter with respect to the evaluation of a fuel cell system . specifically , a higher value of proton conductivity is required to achieve a higher power density . methanol permeability is also one of the important membrane properties in dmfc applications since methanol crossover from the anode to the cathode leads to lower cell voltage and fuel efficiency due to the loss of the unreacted fuel . in order to apply a blend membrane to dmfc systems , not only proton conductivity and methanol permeability but also membrane selectivity should be considered . the selectivity can be defined as the following equation . selectivity change of blend membranes at different temperatures can be classified into two groups based on distinctive morphological characteristics such as two - layer morphology and co - continuous morphology of the membrane . the preferred embodiments are further illustrated by the following non - limiting examples . sulfonated poly ( arylene ether sulfone ) copolymer and nonsulfonated poly ( ether sulfone ) copolymer were blended with 1 : 1 weight based blend ratio in n , n - dimethylacetamide ( dmac ). initial casting concentration was from 20 wt % ( blend 1 ) to 15 wt % ( blend 2 ) and cast solution was freeze dried at − 75 ° c . for 140 hours under vacuum condition and then the temperature was raised to 100 ° c . to remove the residual solvent completely . according to scanning electron microscopy , the size of the co - continuous domain was less than 1 μm . well developed hydrophilic channels facilitated proton movement and hydrophobic network restricted the methanol crossover . consequently , fuel leakage was effectively limited and membrane selectivity was maximized , and excellent selectivity was maintained even at a high temperature . transport properties of the blend membranes measured at different temperature are shown in fig1 - 3 . proton conductivity , methanol permeability and membrane selectivity thereof are compared in fig4 - 6 . sulfonated poly ( arylene ether sulfone ) copolymer and nonsulfonated poly ( ether sulfone ) copolymer were blended with 1 : 1 weight based blend ratio in n , n - dimethylacetamide ( dmac ). initial casting concentration was 15 wt % ( blend 3 ) to 10 wt % ( blend 4 ). cast solution was dried at 80 ° c . under ambient atmosphere for 12 hours and then dried at 120 ° c . under vacuum for 24 hours to remove the residual solvent completely . two layered morphology was characterized through scanning electron microscopy and energy dispersive x - ray analysis . even though the proton conductivity and membrane selectivity were not higher than those of co - continuous morphology as shown in fig1 and 3 , nonsulfonated poly ( ether sulfone ) copolymer rich layer reduced the methanol crossover remarkably as shown in fig2 . the cathode catalyst ink was prepared by mixing 20 wt % pt / c , 5 wt % nafion dispersion ( dupont ), and isopropanol together . the catalyst loading on the anode side was 3 mg / cm 2 with ptru black ( 1 : 1 a / o ) and 5 wt % of nafion solution . after the mixture was stirred and dispersed uniformly , catalyst ink was directly coated onto the carbon paper to form a catalyst layer . both electrodes were dried at 70 ° c . for 1 hour and then the nafion and isopropanol mixture ( weight ratio was 1 : 3 ) was coated on the electrode surface . finally , membrane electrode assembly with an active area of 3 cm 2 was fabricated by hot pressing at 125 ° c . and 100 atm . when the polymer blend membrane with two - layer morphology was applied to dmfc application , the layer having the highly sulfonated polysulfone matrix with a high proton conductivity was faced to the cathode , and the layer having the nonsulfonated polysulfone matrix with a low methanol permeability was faced to the anode . the invention has been described in detail with reference to preferred embodiments thereof . however , it will be appreciated by those skilled in the art that changes may be made in these embodiments without departing from the principles and spirit of the invention , the scope of which is defined in the appended claims and their equivalents . | 8 |
[ 0101 ] fig1 shows a simplified web page 10 of the type of often used to provide access by the customers of a company to the technical support services of the company . the technical support services in this scenario are provided by a number of contact centres in a network , as shown in fig2 . the web page 10 of fig1 is hosted on a web server 12 connected to a data network 14 which may be an intranet or the internet . a user at a pc 16 accesses the web page 10 via the internet using browser software on the pc in known fashion . referring back to fig1 it can be seen that the web page 10 has two frames 18 , 20 . frame 18 allows the user to choose a product of the company , and the selection of a product dictates the content appearing in frame 20 . ( of course , the web pages need not relate to product technical support and can relate to any activity for which a contact centre is a useful route to deal with customers or users . as shown in fig1 the user has accessed the english language product support page for the “ home office ” laptop product . icons 22 enable the user to access corresponding pages in german , japanese or french . a series of links , indicated generally at 24 , enable the user to initiate different contacts types , such as a query form , a web chat session , a video call , an email , or a telephone call from the user &# 39 ; s pc . in this scenario , the video call and telephone call options require that the pc has appropriate software and hardware to initiate the respective contacts types . in the prior art , a user initiating a contact such as a telephone call from a web page of this type would trigger a contact request which would be distributed within the network of contact centres by a network management unit . the network management unit would poll the contact centres in the network to determine the centre with the best availability for the skillset required to deal with the contact brackets based on language , contact type ( telephone call ) and subject matter ( technical support for “ home office ” laptop ), based on the agent activity in each centre . the contact would then be routed to the chosen contact centre and placed in a queue for an agent having the appropriate skillset to deal with the call . referring to fig2 it can be seen that the company providing the web page has three dedicated contact centres 26 , 28 , 30 ( called contact centres a , b and c , respectively ) and employs freelance contact centre 32 ( called contact centre x ). together , these contact centres form a network of contact centres . the number of centres and the identity of centres can change over time as individual contact centres become available or as demand increases and decreases . each centre has a plurality of agents 34 available to deal with contacts from users . [ 0106 ] fig3 shows the architecture of a contact centre in more detail . the centre 26 connects to the internet 14 ( to which the user pc 16 is also connected ). in addition , the centre 26 connects to the public switched telephone network ( pstn ), allowing users to make conventional telephone calls from a telephone 38 . conventional calls arrive over one of a number of dedicated telephone lines 40 to a private branch exchange ( pbx ) 42 . calls may be routed through an interactive voice response ( ivr ) unit 44 which prompts users through a series of menu choices in order to determine the nature of the inquiry , and hence the skillset required by an agent to deal with the contact . the call is then “ held ” in the pbx 42 and information regarding the call ( such as the skillset determined in the ivr process , the line on which the call was received , and the caller line id if available ) is provided to a contact centre manager 46 . the contact centre manager 46 operates a queue into which it places a token representing the terminated call . when the token reaches the top of the queue and a suitable agent is available to deal with the call , the contact centre manager 46 instructs the pbx to transfer the call to the agent terminal 34 . [ 0108 ] fig4 illustrates the processes operating in contact centre manager 46 . in addition to calls held at pbx 42 , the contact centre manager 46 also queues contacts which arrive over the internet such as e - mails , web chat sessions , video calls and voice over internet protocol ( voip ) calls . the contacts which arrive over the internet have a skillset determined by the link which was activated by the user to initiate the contact . the contacts from the internet and the contacts from the pbx are represented by tokens placed in a contact queue 48 . each of the agents at the contact centre is represented in an agent resource file 50 which records the current activity of the agent and the skillsets which the agent possesses . thus , it can be seen agents and 1 and 2 are currently engaged in telephone calls originating from lines 427 and 122 , respectively , whereas agent 3 is currently responding to an email designated as number 04544 . the agent resources 50 and the contact queue 48 are reconciled using a contact assignment list 52 . in contact assignment list 52 , the contact centre manager 46 decides the agents to which the contacts in the queue should be assigned based on the skillset requirements of the contact and the availability of the agent . it can be seen that the call represented by call token 0413 at the top of the queue 48 has been assigned to agent 84 . when agent 84 becomes free , the pbx 42 will be instructed to direct the call terminated at line 353 to agent terminal 84 . call token 0413 will then be deleted from the contact queue and the agent resources for agent 84 will be updated accordingly . alternatively , the contact assignment list can be updated based on notifications of agent availability rather than pre - allocating agents to contacts . in addition , the contact centre manager 46 maintains a list of available resources 54 categorised by skillset . thus , it can be seen that skillset a ( which relates to voice calls in english about “ product01 ”) has 124 agents possessing this skillset logged in , and 18 contacts categorised under the skillset are currently in the contact queue 48 . skillset b , which relates to the same product and language , has only 70 agents logged in ( for example , because not all agents have the necessary software to conduct web chat sessions , or are not all of the agents have been trained in web chat procedures ). skillset c is again the same product and language , but relates to the email medium . this has the same group of agents as skillset a , but has 45 contacts queued . each skillset has a different priority rating and the priority rating is used when moving contacts within the contact queue 48 . thus , voice calls will be promoted quicker than e - mails ( alternatively , different queues could be maintained for different contacts types , with voice calls being assigned to agents more frequently than e - mails ). depending on the priority rating , number of agents active , and number of contacts queued , each skillset will have a current wait time , which is the expected wait for new contacts in that skillset . a statistics generator 56 is available to generate statistics and transmit them over the internet in a predetermined format . such statistics provide a summary of the availability of the contact centre to deal with new contacts , taking into account the current loads from both the internet 14 and the pstn 36 . referring now to fig5 the web server 12 can be seen connected to the internet 14 , with a representative user pc 16 and representative contact centre 26 also connected to the internet as previously described . in the manner previously described , the user submits url requests to the web server 12 and web server 12 responds by transmitting html code corresponding to web pages back to the user 16 via the internet 14 . when a web page such as web page 10 is requested in this way , a page server 58 locates the page requested in a web page store 60 . the pages are not static html pages but are dynamic pages stored in java ( tm ) server pages ( jsp ) format . as is well known in the programming arts , when a jsp page is requested , code embedded within the page is run on a servlet engine 62 which outputs html code to the page server 58 for transmission to the user 16 . similar results can be achieved using common gateway interface ( cgi ) scripts , application server pages ( asp ), and equivalent technology . in the case of web page 10 , the code specifies that the user is to be shown the text and graphical elements illustrated in fig1 . among these text elements are the five links indicated generally at 24 . taking the link having text “ telephone ( internet telephony required )” as an example , clicking this link initiates an internet phone call from the internet telephony software on the user &# 39 ; s pc to a predetermined ip address which is specified within the link . the ip address is determined dynamically by the servlet engine 62 with reference to a database 64 . the contents of the database 64 are updated based on statistics received from contact centre 26 and the other contact centres shown in fig2 . each contact centre supplies statistics records , the contents of which are illustrated in fig6 . each statistics record 66 includes an email address and an ip address for the contact centre as well as a number of sub - records 68 which detail the response times in hours , minutes and seconds for each link on the web page . for example , contact centre x has a sub - file 68 ′ relating to english language support for the “ home office ” laptop product , in which there is detailed an expected response time of 25 minutes for forms , one minute and 20 seconds for web chat sessions , 40 minutes for e - mails and 30 seconds for voice calls . contact centre x does not support video calls at all , and thus in each record 68 an indication has been given that video calls are not supported . another record 68 ″ details the response times for the “ enterprise ” desktop product in the japanese language . because none of the agents at contact centre x is sufficiently proficient in japanese to conduct voice calls or to participate in web chat sessions in japanese , these activities are also indicated to be “ not supported ”. a single agent is sufficiently proficient to respond in japanese to forms and the emails , but as these are “ low priority ” skillsets in contact centre x , a response time of 2 hours is indicated . more than a single email address and a single ip address can be provided . for example , each skillset might be associated with an individual email address or ip address , which can be recorded in the statistics sent to the web server . in this way , the database could be updated with the address of an individual agent or a group of agents within a contact centre , removing the need for the contact centre to process the contact upon arrival . the statistics records 66 are processed in a processing and updating unit 70 ( fig5 ) which populates and updates the current network address and expected delay database 64 . the contents of the database 64 are illustrated in fig7 . the database contains a record for each support page on the website , and lists in each record the respective addresses associated with the links on the page . thus , comparing fig1 and 7 it can be seen that when the option to “ email ” is clicked , the email address returned to the user &# 39 ; s pc will be “ xyzagents @ freelanceccx . com ”. the “ email ” link activates a “ mailto ” activity such that when the user &# 39 ; s browser is integrated with the user &# 39 ; s email program , a blank mail message is generated with the specified address in the “ to ” field ( and optionally , a suitable heading in the subject line , such as “ home office english technical support question ”). similarly , clicking “ live video call ” will result in a video call being initiated from the user &# 39 ; s pc 16 to the ip address specified for “ home office english ” video chat , namely 140 . 11 . 0 . 0 . it can be seen that the email address for this product and language is that of contact centre x whereas the video ip address is that of contact centre a . [ 0118 ] fig8 shows the process in providing a page to a user . a contact request page is created in step 72 . in this page , contact request links are encoded as having dynamic content , step 74 . the activation of links on the contact page is associated with particular addresses in the database 64 , step 76 . thus , the video call link on web page 10 is not directly associated with the ip address 140 . 11 . 0 . 0 ; rather it is associated with the appropriate record address in the database 64 , the contents of which may be changed over time . when a user navigates to web page 10 this will normally be done by clicking a link on another page or frame on the site . this result in a url request being sent to the web server which is received in step 78 . the jsp servlet engine interprets the page , step 80 and in doing so notes the dynamic links for the contact request links 24 , step 82 . the database 64 is queried for the current address associated with each of the dynamic links , step 84 and when these are retrieved , the engine generates a html page from the static links stored in the web page store and the dynamic elements retrieved from the database ( and optionally , from other locations ), step 86 . this html code is provided to the web server which serves it as a web page to the client , step 88 . the database is maintained in the following manner , illustrated in fig9 a . initially , the database is populated with default contact addresses , step 90 . this might be done by selecting the largest of the call centres , or the call centre which is most often on - line , and using the addresses ( email address , ip address , etc .) of that contact centre in each field of the table . alternatively , different contact centres can be initially selected for different fields of the table , i . e . one contact centre might specialise in video calls in english and french , another might specialise in japanese communications of all types , and the appropriate addresses for the contact centres would then be entered in the appropriate records in the database . the database is also populated , step 92 , with initial delay times . the purpose of these delay times is to provide a time which can be compared against the real delay times in the statistic records 66 received from the contact centres . when a contact centre indicates that it has a better ( lower ) delay time than the default time initially populated , then the database will be updated with a new contact address so that communications are sent to the centre with the best availability . the processing and updating unit 70 monitors for statistical sets ( statistic records 66 ) from the nodes ( contact centres ), step 96 . when a statistic set is received in step 96 , it is processed according to fig9 b , while the main process reverts to step 94 , monitoring for further statistic sets . at this point , it should be noted that the statistics generator 56 ( fig4 ) processes the information in the skillset resource file 54 and convert this to an output having a format expected by the processing and database updating unit 70 . thus , the individual response time entries in the sub - records 68 are determined by a concordance maintained by the statistics generator between the product descriptions in the skillset resource record ( e . g . product01 ) and the product descriptions expected by the web server ( e . g . traveller french ). in fig9 b , the statistics file 66 is processed , entry by entry in a loop between steps 98 and 100 until all of the entries have been processed . for each entry , the delay time recorded by the contact centre ( e . g . the delay time of 40 minutes for responses to emails in english relating to the “ home office ” laptop ) is compared to the corresponding entry in the database , fig7 . ( in the illustrated example , contact centre x is already recorded in the database as being the best email address for this skillset , with a response time of 40 minutes .) if the statistic set record shows a better response time than that currently in the database , decision 112 , then the database is updated with the new delay time from the statistic set , step 114 . otherwise , the process moves to step 100 . in decision 116 , it is then determined if the node address in the statistics file is different to that in the database for the same contact type , language and product . if not , and the process proceeds to step 100 . if , however , the node address is different , the database entry is updated with the new address , taken from the statistic files 66 . to demonstrate how this would work in practice , let us assume , for example , that the statistics from contact centre x indicate that the expected response time for web chat sessions in french relating to the “ traveller ” product is now three minutes and 50 seconds . in step 110 this time ( 0 : 03 : 50 ) is compared to the time recorded in the database ( fig7 ) and it is noted that this expected delay is better than the current recorded delay time of 0 : 04 : 20 ( when web chat sessions are directed to ip address 111 . 234 . 90 . 0 ( contact centre c )). the database is therefore updated with the new time of 0 : 03 : 50 , step 114 , and it is next noted in decision 116 that the ip address of contact centre x ( 207 . 123 . 21 . 0 ) is not the same as that currently recorded for french web chat sessions relating to the “ traveller ” product and therefore , the ip address is updated as well , step 118 . the effect of this change to both the delay time and the ip address is that if a user clicks on the web chat option in the french “ traveller ” support page , a web chat session will be initiated , from this point onwards , to contact centre x , rather than to contact centre c as before . the other effect of this change is that only when another contact centre has a lower delay time will the database be updated with a new address . in practice , a further check can be built into the loop of fig9 b : when a statistic set is received from a contact centre having one or more entries in the database , the current delay times in the statistic set are compared with those recorded in the database to ensure that times have not lengthened . where a delay time has lengthened , this new longer time is recorded , increasing the possibility that another contact centre will have a better current delay time , leading to a further change of address . by comparing corresponding statistics from the various contact centres in the network , the most appropriate contact centre for any particular skillset and contact type can be determined and recorded in the database . then , instead of processing each contact request separately after it has entered the network of contact centres , the routing for different contact types and skillsets can be set up in advance by associating the various addresses appropriate to different contact types and skillsets with links on the contact page . in another embodiment , shown in fig1 , a plurality of agent stations 134 are each connected to a data network 114 via one of a number of session initiation protocol ( sip ) proxy servers 126 , 128 , 130 , 132 . sip is a protocol for setting up , administering and tearing down voip calls and other multimedia conferences . in the protocol , a proxy server receives a request from a user to contact a remote user , and the proxy server forwards the request either to the local server for that remote user ( if known ) or to another server on the network which in turn tries to locate the remote user &# 39 ; s server . once a request has been accepted , the call is set up directly between the respective proxy servers . in the architecture of fig1 , the four proxy servers 126 , 128 , 130 , 132 of the respective contact centres each communicate statistical records ( as in the previous embodiments ) to a sip proxy / redirect server 112 for the contact centre network . this server , like web server 112 of the previous embodiments , maintains a current network address database which may be populated , updated and maintained in the manner already described . for sip - based calls , the network address of each agent can be specified as a uri in the form “ sip : a01 @ xyztechsupp . com ”, and it is these addresses which the database records for individual skillsets ( e . g . by recording for each skillset the sip address of the agent having the necessary skillset and the longest idle time ). a sip - enabled user wishing to contact technical support by telephone , video , text messaging or any other sip - enabled technology may do so in a number of ways . for example , a sip call can be initiated from a telephone by consulting a directory or website to determine the telephone number for the relevant service . taking the previous example , if the user wishes to access english technical support for the “ home office ” laptop , the webpage may provide a dedicated telephone number . when the user at a telephone 116 , who has the identity “ sip : user01 @ sipuser . com ” and obtains sip access from the domain sipuser . com dials the number provided on the webpage , the number is resolved to a sip address in the sipuser . com proxy server 117 . however , proxy 117 does this on the basis of a uri cache which has been updated from the database maintained in the proxy / redirect server 112 ( the information can be updated periodically on request from server 117 or on the instruction of server 112 , or it can be done every time there is a change in the contents of the database , for example ). thus , the fixed contact number on the webpage for the requested service is resolved dynamically to a sip address for the most suitable agent . assuming this is agent a03 , for example , this means that when the user dials the fixed number , sipuser . com proxy server 117 will consult the cache , resolve this to the address “ sip : a03 @ xyztechsupp . com ” and initiate a call directly from the user to the agent , without the necessity of the call entering a queue for analysis . the invention is not limited to the specific embodiments described herein which may be varied or departed from within the spirit and scope of the invention as defined in the appended claims . | 7 |
in the following description of the various embodiments , reference is made to the accompanying drawings which form a part hereof , and in which is shown by way of illustration various embodiments in which the invention may be practiced . it is to be understood that other embodiments may be utilized and structural and functional modifications may be made without departing from the scope of the present invention . fig1 shows a block diagram 100 of a serving apparatus operating in a cooling mode in accordance with an embodiment of the invention . block diagram 100 shows the basic elements of the serving apparatus but may not explicitly show the dimensions and relative placement of the elements . for example , heat pipes 105 and 104 may be bent in a horizontal plane rather than a vertical plane so that the operation of the heat pipes is not adversely affected ( e . g ., by gravity ). the measured temperature of serving surface 101 is changed by transferring heat from peltier devices 102 and 103 through heat pipes 104 and 105 and through heat sinks 106 and 107 , respectively . control device 108 activates and deactivates peltier devices 102 and 103 based on an indication from temperature sensor 109 that is indicative of the measured temperature of serving surface 101 . temperature sensor 109 is typically placed against serving surface 101 in order to provide thermal coupling . for example , when the measured temperature is above a cooling temperature setting ( i . e ., the desired temperature ) control device 108 provides electrical power to peltier devices 102 and 103 through electrical connections 110 and 111 and connections 112 and 113 , respectively . with some embodiments , heat transfer may be enhanced by fans 114 and 115 producing air circulation from heat sinks 106 and 107 , respectively , and through vent openings 116 and 117 , respectively . fig2 shows a block diagram 200 of a serving apparatus operating in a heating mode in accordance with an embodiment of the invention . with some embodiments , the serving apparatus may be the same serving apparatus as with block diagram 100 . control device 208 reverses the transfer of heat with respect to block diagram 100 by reversing the electrical polarity of electrical connections 210 and 211 and connections 212 and 213 . ( as will be discussed , the peltier effect is a reversible process .) consequently , heat flows to serving surface 201 to heat it . fig3 shows peltier device 300 in accordance with an embodiment of the invention . however , some embodiments may use other types of semiconductor devices that provide similar heating and / or cooling characteristics . heat is transferred between top side 351 and bottom side 352 based on the peltier effect . thermoelectric cooling by peltier device 300 uses the peltier effect to create a heat flux between the junctions of two different types of materials . peltier device 300 may be classified as a heat pump . when direct current is provided to peltier device 300 , heat is moved from one side to the other . peltier device 300 may be used either for heating or for cooling since the peltier effect is reversible . for example , heat may be transferred from top side 351 to bottom side 352 to cool a serving surface by providing electrical power at terminals 314 and 315 . moreover , the direction of the heat transfer may be reversed ( i . e ., from bottom side 352 to top side 351 ) in order to heat the serving surface by reversing the polarity of the electrical power at terminals 314 and 315 . peltier device 300 comprises a plurality of n type and p type semiconductor grains 301 - 309 that are electrically interconnected through electrical conductor arrangements 310 and 311 . ceramic layers 312 and 313 provide thermal conductivity as well as electrical isolation so that peltier device 300 is able to cool or heat a serving surface . with some embodiments , the serving surface and heat pipe are thermally coupled to ceramic layers 312 and 313 , respectively . with some embodiments , one or more peltier devices may be used to exchange heat with the serving surface . for example , with the embodiment shown in fig5 , four peltier devices may provide faster cooling than with one peltier device . additional peltier devices may be used ; however , electrical power and physical constraints may be factors that limit the number of peltier devices . fig4 shows heat pipe 400 in accordance with an embodiment of the invention . with some embodiments , heat pipe 400 is a heat - transfer device that combines the principles of both thermal conductivity and phase transition to efficiently manage the transfer of heat between two solid interfaces . at the hot interface within heat pipe 400 , which is typically at a very low pressure , a liquid ( fluid ) is in contact with a thermally conductive solid surface that turns into a vapor by absorbing heat from the surface . the vapor condenses back into a liquid at the cold interface , releasing the latent heat . the liquid then returns to the hot interface through either capillary action or gravity action , where it evaporates once more and repeats the cycle . in addition , the internal pressure of the heat pipe may be set or adjusted to facilitate the phase change depending on the demands of the working conditions of the thermally managed system . with some embodiments , heat pipe 400 does not contain mechanical moving parts and typically requires little or no maintenance . heat pipe 400 may be a heat - transfer device that combines the principles of both thermal conductivity and phase transition to efficiently manage the transfer of heat between two ends . with traditional systems , a radiator using single - phase convection with a high - speed motor often provides heat transfer . however , heat pipe 400 can transfer the heat efficiently without a high - speed motor . heat pipe 400 transports heat from portion 452 to portion 451 . heat pipe 400 comprises casing 401 , wick 402 , and vapor cavity 403 . casing 401 may comprise a sealed pipe or tube made of a material with high thermal conductivity such as copper or aluminum at both hot and cold ends . working fluid evaporates to vapor absorbing thermal energy at event 404 . examples of such fluids include water , ethanol , acetone , sodium , or mercury . the vapor migrates along cavity 403 from portion 452 ( high temperature end ) to portion 451 ( low temperature end ). the vapor condenses back to fluid and is absorbed by wick 402 at event 406 , and the fluid flows back to portion 402 through wick 402 . with some embodiments , referring to fig5 , heat pipe 503 comprises a sealed pipe or tube made of a material with high thermal conductivity , i . e ., copper at both hot and cold ends . for example , a copper pipe or tube may be approximately 300 mm long with a diameter of approximately 8 mm . heat pipe 503 is typically constructed with a tube shell , wick and end caps . heat pipe 503 may be drawn into negative pressure and may be filled with the fluid such as pure water . wick 402 is typically constructed with a capillary porous material . evaporation of the fluid occurs at one end of heat pipe 503 , while condensation occurs at the other end . when the evaporation end is heated , the capillary action in the fluid evaporates quickly . with a small gravity difference between two ends , the vapor flows to the other end , releasing heat . the vapor is then re - condensed into fluid , which runs along the porous material by capillary forces back into the evaporation end . this cycle is repeated to transfer the heat from the one end to the other end of heat pipe 503 . this cycle is typically fast , and the heat conduction is continuous . good performance of the wick is often characterized by : 1 . large capillary action or small effective aperture of wick , 2 . smaller fluid flow resistance , which have higher permeability , 3 . good thermal conductivity characteristics , and 4 . good repeatability and reliability in the manufacturing process . referring to fig4 , heat pipe 400 may have bends in order to route the heat transfer to or from a heat exchange device providing that the bends to not adversely affect the capillary or gravity action of heat pipe 400 . for example , referring to fig5 , heat pipe 503 is bent in a horizontal plane to route the heat between peltier device 502 and heat sink 505 , fig5 shows serving apparatus 500 in accordance with an embodiment of the invention . while serving apparatus 500 is depicted in the cooling mode , apparatus 500 may be used to heat aluminum plate 501 ( which functions as the serving surface on which an item is placed ) based on the previous discussion . peltier device 502 is thermally coupled to serving surface 501 and copper block 504 , where the top side ( corresponding to ceramic layer 312 as shown in fig3 ) is physically situated against serving surface 501 and the bottom side ( corresponding to ceramic layer 313 ) is physically situated against copper block 504 . thermal conductivity may be enhanced by ensuring the flatness of the installation surface , and coating the contact surface with a thin layer of heat conduction silicon grease . also , in order to avoid fracturing the ceramic layers of peltier device 502 , the pressure against the layers should be even and not excessive when fixing device 502 . heat pipe 503 is thermally coupled to peltier device 502 through copper block 504 so that heat flows along heat flow 509 a and 509 b . however , with some embodiments , heat pipe 503 may be directly placed against peltier device 502 . heat pipe 502 transports heat along heat flow 509 b by traversing through copper block 504 via branches 507 a - 507 c and heat sink 505 . heat is thus transported along heat flow 509 c and into the surrounding environment of serving apparatus 500 . with some embodiments , heat sink 505 may be constructed from copper and / or aluminum in order to achieve performance , size , and cost objectives . with some embodiments , fan 506 operates when apparatus is operating in the cooling mode . however , with some embodiments , fan 506 may operate in the heating and / or cooling modes . fan 506 assists in the transfer of heat by drawing in cool air 510 a and 510 b so that heat sink 505 may be kept to a smaller size than without fan 506 . with some embodiments , the speed of fan 506 may be changed based on the temperature of serving surface 501 . for example , the speed may be increased when the difference of measured temperature of serving surface 501 and the desired temperature increases . however , with some embodiments , the speed of fan 506 may be fixed when fan 506 is activated and may operate during the entire duration of operation . with some embodiments , while not explicitly shown in fig5 , a cooling fan may circulate air to provide inner air convection within the serving chamber ( within serving cover 508 and serving plate 501 ) to enhance the cooling of food within the chamber . with some embodiments , a fan may support inner air convection when the apparatus is operating in the heating mode . fig6 shows control device 600 for controlling apparatus 100 ( corresponding to control device 108 as shown in fig1 ), apparatus 200 ( corresponding to control device 208 as shown in fig2 ), and apparatus 500 ( as shown in fig5 ) in accordance with an embodiment of the invention . processing system 601 may execute computer executable instructions from a computer - readable medium ( e . g ., storage device 604 ) in order provide verify communication redundancy for a network , memory 602 is typically used for temporary storage while storage device 504 may comprise a flash memory and / or hard drive for storing computer executable instructions and a profile image . however , computer storage media may include volatile and nonvolatile , removable and non - removable media implemented in any method or technology for storage of information such as computer readable instructions , data structures , program modules or other data . computer storage media include , but may not be limited to , random access memory ( ram ), read only memory ( rom ), electronically erasable programmable read only memory ( eeprom ), flash memory or other memory technology , cd - rom , digital versatile disks ( dvd ) or other optical disk storage , magnetic cassettes , magnetic tape , magnetic disk storage or other magnetic storage devices , or any other medium that can be used to store the desired information and that can be accessed by processing system 601 . the executable instructions may carry out any or all of the method steps described herein . with some embodiments , processing system 601 may correspond to one or more processors and storage device 604 may correspond to one or more memories . control device 600 may be implemented as one or more asics or other integrated circuits ( e . g ., a single chip computer ) having instructions for performing operations as described in connection with one or more of any of the embodiments described herein . said instructions may be software and / or firmware instructions stored in a machine - readable medium and / or may be hard - coded as a series of logic gates and / or state machine circuits in one or more integrated circuits and / or in one or more integrated circuits in combination with other circuit elements . with some embodiments , control device 600 supports different control capabilities for heating and / or cooling . for example , device 600 may obtain a temperature setting ( desired temperature ) from a user through an input device and control one or more peltier devices ( e . g ., peltier devices 802 - 805 as shown in fig8 ) to compensate for environmental factors in order to approximate the desired temperature . control device 600 may also sense when cover 508 ( as shown in fig5 ) is open ( e . g . through a switch not explicitly shown ), and control the peltier devices accordingly . for example , control device 600 may activate the peltier devices for a longer period of time when cover 508 is open than when it is shut . fig7 shows circuitry 700 for controlling peltier devices in accordance with an embodiment of the invention . while some of the functionality of a serving apparatus may be implemented with a control device ( e . g ., control device 600 as shown in fig6 ), some or all of the functionalities may be implemented with separate circuitry , e . g ., circuitry 700 . for example , circuitry 700 controls the activation of the peltier devices by a comparator 701 comparing temperature setting 704 and measured temperature 703 . comparator 701 may have hysteresis characteristics so that once peltier device 706 is activated by providing electrical power from source 705 through power switch 702 , activation continues until the serving surface reaches a hysteresis temperature . fig8 shows a collection of peltier devices for changing a serving surface temperature in accordance with an embodiment of the invention . embodiments may support one or more peltier devices in order to increase or decrease the temperature of a serving surface . with some embodiments , as shown in fig8 , four peltier devices 802 - 805 may heat or cool serving surface 801 . some or all of the peltier devices may be activated at one time . for example , when the temperature of serving surface 801 is within a temperature range , peltier devices 802 - 805 may be deactivated . when the measured temperature of serving surface 801 is outside the temperature range , all of the peltier devices 802 - 805 are activated . ( this approach is incorporated in flowchart 1100 as shown in fig1 and will be further discussed .) however , with some embodiments , only a proper subset of peltier devices ( e . g ., devices 802 and 805 or devices 803 and 804 ) is activated at a given time when the temperature is outside the temperature range . moreover , different subsets may be activated in a sequenced manner in order to provide more consistent thermal properties , such as more even cooling and / or heating , over serving surface 801 . for example , a first subset and a second subset may be activated and deactivated , respectively , during a first time duration while reversing activation states during the second time duration . some embodiments may support a greater number of peltier devices . however , the number of peltier devices may be limited by physical constraints and / or electrical power limitations . fig9 shows a collection of sixteen peltier devices 902 - 917 for changing serving surface 901 in accordance with an embodiment of the invention . as discussed previously , some or all of devices 902 - 917 may be activated at the same time . devices 902 - 917 may be partitioned into a plurality subsets , e . g ., a first subset including devices 802 , 805 , 807 , 808 , 811 , 812 , 814 , and 817 , a second subset including 802 , 804 , 807 , 809 , 810 , 812 , 815 , and 817 , and third subset including devices 803 , 805 , 806 , 808 , 811 , 813 , 814 , and 816 , where some or all of the subsets may have overlapping members . with some embodiments , the same peltier devices may be used for different modes of operation . for example , referring to fig8 , peltier devices 802 - 805 may be used both for heating and cooling . with some embodiments , different peltier devices may be used for different modes of operation . for example , peltier devices 802 and 805 may be used for cooling while peltier devices 803 and 804 may be used for heating . as another example , peltier devices 802 - 805 may be used for cooling while only peltier devices 502 and 805 are used for heating . fig1 shows flowchart 1000 for controlling a serving apparatus in accordance with an embodiment . at block 1001 , a control device ( e . g ., control device 108 as shown in fig1 ) reads the measured temperature of the serving surface ( e . g ., surface 101 ) from the temperature sensor ( e . g ., sensor 109 ). at block 1002 , the control device determines whether to activate some or all of the peltier devices at block 1003 . with some embodiments , selected peltier devices ( i . e ., all or some of the peltier devices ) may be activated until the measured temperature reaches a hysteresis temperature so that a hysteresis characteristic is incorporated . for example , the temperature setting may be 35 ° f . when the serving apparatus is operating in the cooling mode . in such a case , the selected peltier devices may be activated until the serving surface is cooled down sufficiently so that the measured temperature reaches 33 ° f . ( the hysteresis temperature ). the hysteresis temperature is typically offset from the temperature setting by several degrees so that control cycling is reduced . different exemplary procedures for controlling the peltier devices will be discussed in fig1 and 12 . at block 1004 , the control device determines whether to activate one or more fans ( e . g ., fans 114 and 115 ). for example , with some embodiments the fans may be activated at block 1005 only when the measured temperature is outside a temperature range to assist transferring heat with the environment of the serving apparatus . however , with some embodiments , a fan may be activated only for specific operating modes , e . g ., a cooling mode or a heating mode . fig1 shows flowchart 1100 for controlling peltier devices in accordance with an embodiment . at block 1101 a control device obtains a measured temperature of a serving surface from a temperature sensor and the temperature setting ( desired temperature ) of the serving surface from a user input . at block 1102 , the control device determines the mode of operation , i . e ., cooling or heating . based on the mode of operation , the control device determines whether to activate the peltier devices based on the measured temperature , temperature setting , and hysteresis temperature at blocks 1103 - 1108 . at block 1103 , the control device operates in the cooling mode and determines whether the measured temperature exceeds the cooling temperature setting . if so , the control device activates the peltier devices until the measured temperature is less than or equal to the cooling hysteresis temperature at block 1104 . otherwise ( i . e ., the measured temperature does not exceed the cooling temperature setting ), the control device deactivates the peltier devices at block 1105 . at block 1106 , the control device operates in the heating mode and determines whether the measured temperature is less than the heating temperature setting . if so , the control device activates the peltier devices until the measured temperature is greater than or equal to the heating hysteresis temperature at block 1107 . otherwise ( i . e ., the measured temperature does not exceed the cooling temperature setting ), the control device deactivates the peltier devices at block 1108 . fig1 shows flowchart 1200 for controlling peltier devices in accordance with an embodiment . flowchart 1200 is similar to flowchart 1100 , where blocks 1201 and 1202 correspond to blocks 1101 and 1102 , respectively . however , process 1200 activates all of the peltier devices when the measured temperature is outside a temperature range ( e . g ., between the temperature setting and the hysteresis temperature ) at blocks 1204 and 1207 and a selected subset of the peltier devices when the measured temperature is within the temperature range at blocks 1205 and 1208 . when operating at blocks 1205 and 1208 , the control device may select different subsets from the plurality of peltier devices and sequence through the different subsets . for example , referring to fig9 , the control device may first select and activate the first subset for a first time duration , followed by the second subset , followed by the third subset , followed by the first subset , and so forth . fig1 shows a serving apparatus 1300 with a heating side 1301 and a cooling side 1302 in accordance with an embodiment . heating side 1301 and cooling side 1302 may operate at the same time so that heating serving surface 1305 may be heating one food item ( e . g ., hot cereal for breakfast ) while cooling serving surface 1303 may be simultaneously cooling another food item ( e . g ., orange juice for breakfast ). cooling serving surface 1303 is cooled by peltier device 1304 transferring heat from its top to bottom , where peltier device 1304 is thermally coupled to surface 1303 . heating service surface 1305 is thermally coupled to peltier device 1306 , which transfers heat from its bottom to its top . consequently , waste heat is generated at the bottom of peltier device 1304 while waste cold ( loss of heat ) is generated at the bottom of peltier device 1306 . with some embodiments , peltier device 1304 and / or peltier device 1306 may comprise a plurality of plurality of peltier devices similarly shown in fig8 and 9 . a first portion of heat pipe 1307 is thermally coupled to peltier device 1304 while a second portion of heat pipe 1307 is thermally coupled to peltier device 1306 , in which the operation of heat pipe 1307 is similar to the operation of heat pipe 400 as shown in fig4 . consequently , waste heat is transferred from peltier device 1304 to peltier device 1306 , which absorbs some of the waste heat . on the other hand , waste cold is transferred from peltier device 1306 to peltier device 1304 , which utilizes the cold in order to lower its operating temperature . as a result , waste heat and waste cold may be used by peltier devices 1304 and 1306 that would have otherwise been expended into the surrounding environment . heat pipe 1307 may be directly coupled to peltier device 1304 and / or peltier device 1306 . however , heat pipe 1307 may be thermally coupled to ambient air adjacent to the bottom of peltier device 1304 and / or peltier device 1306 . with some embodiments , heat pipe 1307 may be thermally coupled to peltier device 1304 and / or peltier device 1306 through another material ( e . g ., similar to copper block 504 as shown in fig5 ). with some embodiments , heat pipe 1307 may be directly routed between peltier devices 1304 and 1306 , where heat pipe 1307 provides a continuous connection between the hot side and the cold side of peltier devices 1304 and 1306 , respectively . consequently , separate heat sinks ( heat exchange device ) and fans ( e . g ., as shown in fig1 , 2 , and 5 ) may not be required because the opposite peltier device may function as the heat sink for the other peltier device . for example , the phase change ( liquid to gas and / or gas to liquid ) of heat pipe 1307 may cause heat / cold flow from one peltier device to the other so that separate heat sinks and / or fans may not be needed to cause the temperature change to influence the heat / cold flow . with some embodiments , heat pipe 1307 may be routed through a heat exchange device to assist in expending waste heat and / or waste cold . heat pipe 1307 may have bends ( not explicitly shown in fig1 ) in order to route the heat transfer to or from a heat exchange device providing that the bends to not adversely affect the capillary or gravity action of heat pipe 1307 . one or more fans 1308 and 1309 and / or heat exchange devices ( not explicitly shown in fig1 ) may be positioned in the vicinity of heat pipe 1307 to assist in the exchange of waste heat and / cold . thermal barrier 1308 provides thermal separation ( isolation ) between heating side 1301 and cooling side 1302 so that heating serving surface 1305 and cooling serving surface 1303 do not adversely affect each other . while serving apparatus 1300 may support one heating surface ( surface 1305 ) and one cooling surface ( surface 1303 ), a serving apparatus may support more than two serving surfaces with some of the embodiments . for example , fig1 shows a top view of apparatus 1400 that has heating surface 1401 ( that may be used for the main course ) and two cooling surfaces 1402 and 1403 ( that may be used for a salad and cold desert , respectively ). the surface areas and the temperature changes may be different for the different serving surfaces . for example , apparatus 1400 may have a plurality of cooling zones , where cooling surface 1402 chills a salad while cooling surface 1403 keeps ice cream from melting . moreover , while serving surfaces 1401 - 1403 are depicted as rectangularly shaped , some embodiments may have differently shaped serving surfaces . also , with some embodiments , surfaces 1401 - 1403 may have flat or concave surfaces in order to better contain the served item . with some embodiments , heat pipes 1404 and 1405 may be routed between serving surfaces 1401 , 1402 , and 1403 to assist in expending waste heat and / or waste cold . different heat pipe configurations may be supported such as routing a heat pipe between a pair of serving surfaces ( e . g ., between serving surfaces 1401 and 1402 ) or routing a heat pipe across more than two serving surfaces ( e . g ., 1401 , 1402 , and 1403 ). fig1 shows portable serving tray 1500 that supports serving surfaces 1501 - 1503 that may be used to heat or cool different items in accordance with an embodiment . portable serving tray 1500 contains at least one peltier device ( not explicitly shown in fig1 ) to provide desirable temperature changes for serving surfaces 1501 - 1503 . in order to have portable operating characteristics , portable serving tray 1500 may be powered by portable electrical source 1504 that may be inserted into tray 1500 . with some embodiments , portable electrical source 1504 may include a battery and / or fuel cell . portable serving tray 1500 may be used in different serving environments , including a hospital , hotel , or restaurant . also , different types of items may be heated or cooled , including food , liquids , and non - eatable items . fig1 shows serving apparatus 1600 with a plurality of portable trays 1500 ( as shown in fig1 ) and 1602 - 1603 stacked in rack 1601 in accordance with an embodiment . portable trays 1500 and 1602 - 1603 may be stacked into rack 1601 so that trays 1602 - 1604 can be transported to a desired location . in addition , rack 1600 provides a holding means ( e . g ., slots or shelves ) so that the portable trays can be inserted into and removed from rack 1600 . as can be appreciated by one skilled in the art , a computer system with an associated computer - readable medium containing instructions for controlling the computer system may be utilized to implement the exemplary embodiments that are disclosed herein . the computer system may include at least one computer such as a microprocessor , digital signal processor , and associated peripheral electronic circuitry . while the invention has been described with respect to specific examples including presently preferred modes of carrying out the invention , those skilled in the art will appreciate that there are numerous variations and permutations of the above described systems and techniques that fall within the spirit and scope of the invention as set forth in the appended claims . | 5 |
the components of the liquid delivery assembly in accordance with preferred embodiments of the invention can be manufactured via known methods of plastic molding and manufacture , the details of which will be apparent to those having skill in the art . the precise shapes and sizes of the components described herein are not necessarily essential to the invention , since the invention is described with reference to illustrative embodiments . a preferred fluid delivery assembly in accordance with the invention comprises a dispensing cap having an applicator extension or tube , an interior piercing tip , a hollow channel extending throughout said piercing tip to the applicator tube and a base attachable to an external fluid reservoir . a sealed fluid reservoir having a region pierceable by said piercing tip on the cap is engaged to the cap . a multi - stage detent mechanism on said dispensing cap and fluid reservoir will allow said dispensing cap to captively engage said fluid reservoir in at least one inactive configuration where the fluid reservoir is not pierced and at least one active configuration where the fluid reservoir is pierced . such multi - stage detent mechanism is also capable of preventing said piercing tip from piercing said reservoir until a user elects to convert said inactive configuration into said active configuration . fluid reservoirs in accordance with the invention should be substantively inactive to the fluid or gel stored therein , pliable enough to allow fluid to be squeezed out , but hard enough to engage the cap portion to keep the cap from detaching or prematurely shifting into the active configuration . a non - exhaustive list of acceptable materials for the reservoir includes propylene , etaylene , nylon , k - resin , polypropylene , and polyethylene in either homo or copolymer versions . dispensing caps in accordance with the invention should be substantively inactive to the fluid or gel therein and sufficiently rigid to allow the piercing tip to puncture the fluid reservoir . a non - exhaustive list of acceptable materials for the cap includes propylene , etaylene , nylon , k - resin , polypropylene , polyethylene , polyoxymethylene , polyacetal , and aliphatic polyketones ( carilon ). a non - limiting example of a fluid delivery assembly constructed in accordance with preferred embodiments of the invention is shown generally as fluid delivery system 100 in fig1 . it will be appreciated that fluid delivery systems identified herein can also be used to deliver gels , with little or no modification . delivery system 100 includes a hollow fluid reservoir 110 or another suitable fluid delivering tube or source engaged with a dispensing cap 120 . reservoir 110 stores the fluid or gel therein . in a preferred embodiment of the invention , reservoir 110 stores a single dose of pesticide for a dog , cat , horse or other animal of appropriate size . dispensing cap 120 includes a short hollow cylindrical tube 130 , which terminates in a slanted piercing tip 140 . tube 130 can be of uniform width and extends perpendicularly from within an interior 151 of a dome 150 of dispensing cap 120 . tube 130 serves as a conduit from reservoir 110 to cap 120 . cap 120 is designed to selectively form an opening in reservoir 110 and provide a tip to dispense the fluid or gel therein in a convenient manner . cap 120 also includes an extended applicator tube 160 , which can be unitary with and extend from the top of dome 150 . applicator tube 160 terminates in a nozzle 170 . tube 160 defines a channel 161 , which extends from piercing tip 140 , through short tube 130 to nozzle 170 and defines a liquid passageway capable of communicating fluid from piercing tip 140 to a nozzle end 171 . it should be appreciated that extended applicator tube 160 and applicator nozzle 170 may adopt a variety of shapes and sizes consistent with different usage , other than what is depicted in fig1 . for example , the extended applicator tube may be longer or shorter and may contain a bend , a flare or a constriction . applicator nozzle 170 may taper into a narrow tip or contain one or more fur - spreading fin structures for accessing difficult to reach areas or terminate in a rounded blunt bulge to avoid damaging the skin of the pet when applying a parasiticide . in one embodiment of the invention , extended tube 160 , channel 161 and nozzle 170 can be conical , so that trimming back the tip can increase the diameter of the opening at the tip of channel 161 . the present invention is not limited to the extended applicator tube and applicator nozzle presented herein . it should be appreciated that the external surface of dome 150 may adopt a variety of features to facilitate usage . for example , an external surface top face 152 of dome 150 may contain a plurality of ridges capable of providing the user a firm grip during activation . fluid reservoir 110 includes a reservoir tip 115 . an upper end of tip 115 includes a pierceable region 190 , whereby the surface of the pierceable region 190 is proximal and perpendicular to cylindrical tube 130 when fluid reservoir 110 and dispensing cap 120 are engaged in an inactive position as shown in fig1 a . pierceable region 190 should be sufficiently wide to receive the outside diameter of cylindrical tube 130 when fluid reservoir 110 and dispensing cap 120 are engaged in an active configuration as shown in fig1 b . the area of pierceable region 190 may be adjusted to balance the force required for piercing against the force feedback once piercing occurs . to further reduce the force of piercing , the thickness of the material in the pierceable region 190 may be adjusted so that the outer diameter of pierceable region 190 is thinner than at its center . generally , the fluid reservoir and the dispensing cap should be appropriately sized with respect to the space within the dome of the dispensing cap , allowing the fluid reservoir and the dispensing cap to move from the inactive configuration to active configuration . fluid delivery assemblies in accordance with the invention can contain a multi - stage detent mechanism to provide multi - stage engagement , while preventing unintended activation due to inadvertent piercing of the fluid reservoir . a dispensing cap 200 in accordance with another embodiment of the invention is shown generally in fig2 . cap 200 is configured to work with a reservoir tip 300 shown generally in fig3 . a multi - stage detent between cap 200 and tip 300 is provided as a ridge 310 on an external surface 301 of fluid reservoir tip 300 and two retaining grooves 211 and 212 on an internal wall surface 202 of dispensing cap 200 . in an inactive configuration , ridge 310 engages retaining groove 211 and dispensing cap 200 is captively held on tip 300 of a fluid reservoir 350 during transport or storage without piercing a pierceable region 390 of fluid reservoir tip 300 . in an active configuration , ridge 310 engages retaining groove 212 and dispensing cap 200 is captively held on tip 300 of fluid reservoir 350 while a piercing tip 240 penetrates piercing region 390 . this brings the fluid content in an interior 351 of reservoir 350 into communication with a channel 261 of dispensing cap 200 , allowing the contents of fluid reservoir 350 to enter and flow through hollow channel 261 from piercing tip 240 and exit through a tip 271 of an applicator nozzle 270 . internal wall 202 of dome 205 of dispensing cap 200 is provided with screw threads 213 about internal wall 202 thereof . screw threads 213 are threadingly engageable with corresponding screw threads 314 on fluid reservoir 300 . the threading engagement between screw threads 213 and 314 ensures that piercing tip 240 will not breach fluid reservoir 300 at pierceable region 390 unless the user deliberately converts the inactive configuration into the active configuration by turning dispensing cap 200 in relation to fluid reservoir 300 to urge cap 200 and piercing tip 240 towards reservoir 300 and pierceable region 390 until ridge 310 of fluid reservoir 300 engages retaining groove 212 of dispensing cap 200 . thus , after cap 200 is urged out of its retained state in the inactive position , it becomes retained in the active state . it should be appreciated that other type of detent mechanism may be used instead of the mechanism shown in fig2 and fig3 . for example , the ridge may be present on the interior surface of the dispensing cap and two matching retaining grooves may be present on the fluid reservoir . other multi - stage detent mechanisms are suitable as well . the present invention is not limited to the selection of the engaging mechanisms presented herein . the features of another preferred embodiment of the invention are shown in fig4 a and 4b as assembly 400 . a dispensing cap 420 is configured to work with a reservoir tip 410 . multi - stage detention between cap 420 and tip 410 is accomplished via use of a ridge 415 on an external surface 411 of fluid reservoir tip 410 and two retaining grooves 451 and 453 inside and unitary with a base 450 of dispensing cap 420 . in an inactive configuration , ridge 415 engages retaining groove 453 and dispensing cap 420 is captively held on tip 410 of a fluid reservoir during transport or storage without piercing a pierceable region 490 of fluid reservoir tip 410 . in an active configuration , ridge 415 engages retaining groove 451 and dispensing cap 420 is captively held on tip 410 of a fluid reservoir 401 while a piercing tip 440 penetrates a piercing region 490 on tip 410 . this brings the fluid content in interior of reservoir 401 into communication with a channel 461 of dispensing cap 420 , allowing the contents of fluid reservoir 401 to enter hollow channel 461 from piercing tip 440 and exit through cap 420 . to prevent accidental activation , screw threading 455 inside base 450 of cap 420 is threadingly engageable with corresponding screw threading 415 on tip 410 . the threading mechanism ensures that piercing tip 440 will not breach pierceable region 490 unless the user deliberately converts the inactive configuration into the active configuration by turning dispensing cap 420 in relation to tip 410 until ridge 415 engages retaining groove 451 of dispensing cap 420 . in accordance with a preferred embodiment of the invention , piercing tip 440 is designed with a slant ( which can be symmetrical or asymmetrical ) to avoid a potential problem that a flap of material left on a piercing region 490 may partially cover the opening of a hollow channel 461 at piercing tip 440 and impede fluid flow . the angle for piercing tip 440 is preferably from 55 ° to 120 ° and most preferably from 60 ° to 90 °. in another preferred embodiment of the invention shown in fig5 and fig6 , two regions of an internal wall 502 of a dome 550 of a dispensing cap 500 are raised to form a pair of tab breakers 515 that extends from an edge 503 of dome 550 to a first retaining groove 511 . a pair of breakaway tabs 617 extends from an external surface 610 of a fluid reservoir 600 . a pair of pre - activation rims 619 on fluid reservoir 600 extends from and are unitary with fluid reservoir 600 . the pre - activation rims 619 are generally on the same plane with and flank breakaway tabs 617 without being directly connected with breakaway tabs 617 . a pair of bump stops 621 are provided on one end of each pre - activation rims 619 . the breakaway tab mechanism ensures that piercing tip 540 will not breach pierceable region 690 unless the user deliberately rotates dispensing cap 500 with enough deliberate force until the side of tab breakers 515 rests against bump stops 621 ( at which point tab breakers 515 are poised over and aligned with breakaway tabs 617 ), and push dispensing cap 500 onto fluid reservoir 600 , breaking breakaway tabs 517 from fluid reservoir 600 , and form the retained activated configuration . another preferred embodiment of the invention is shown in fig7 and fig8 . a dispensing cap 700 , in accordance with another embodiment of the invention is shown generally in fig7 . cap 700 is configured to work with a fluid or gel reservoir 800 shown generally in fig8 . the engagement between cap 700 and fluid reservoir 800 is accomplished via the use of a raised structure 850 and a pre - activation ridge 801 of a head region 810 of fluid reservoir 800 and a locking groove 773 and a pair of slanted cam followers 771 about an internal surface 751 of dome 750 thereof . they are shown as , but are not limited to being 180 ° apart and unitary with dispensing cap 700 . as shown in fig7 , internal wall 751 of dome 750 of dispensing cap 700 extends perpendicularly from edge 753 of dome 750 to approximately halfway up dome 750 where a smaller inside diameter of dome defines a second edge 755 and an internal wall 757 . the lower junction of internal wall 757 is shaped into locking groove 773 . two regions of internal wall 751 of dome 750 of dispensing cap 700 are raised to form slanted cam followers 771 . slanted cam followers 771 are preferably positioned in the region between edges 753 of dome 750 to edge 755 . as shown in fig8 , the top surface 815 of head region 810 includes a pierceable region 811 . a pair of pre - activation rims 850 on fluid reservoir 800 extend from and are unitary with fluid reservoir 800 . one end of each pre - activation rim 850 adopts a downward slanting region 851 , which further turns vertically downward to join a cap stabilizing ring 859 . a pair of lug locks 855 are notches provided on the lower edges 853 of each of slanting region 851 . in an inactive configuration , a ridge 813 on head region 810 is engaged with a locking groove 759 to prevent accidental activation and dispensing cap 700 is captively held on head 810 of fluid reservoir 800 during transport or storage without piercing the pierceable region 819 . to put a channel 761 of cap 700 in communication with fluid reservoir 800 , fluid reservoir 800 and dispensing cap 700 are pushed towards each other with sufficient force to urge ridge 813 on head region 810 out of locking groove 759 and rotated until slanted cam followers 771 advance through a pair of gaps 861 between and defined by pre - activation rims 850 . once cam followers 771 drop into gaps 861 and make contact with the upper edge of downward slanting region 854 , dispensing cap 700 and fluid reservoir 800 may be turned so that slanted cam followers 771 move in spaces 863 between and defined by lower edge of pre - activation rims 850 and the upper edge of cap stabilizing ring 859 until cam followers 771 enter lug locks 855 . during rotation , a piercing tip 740 is gradually lowered to penetrate pierceable region 813 . in the activated condition , a top surface 815 of head region 810 contacts an inner ceiling 759 of dome 750 , thereby creating a seal to prevent fluid leakage during dispensing . in another embodiment of the invention , shown in fig9 a , 9 b and 9 c , dispensing cap 900 has a base 950 and an applicator tube 980 . dispensing cap 900 is configured to work with and dispense fluid from a fluid reservoir 910 . a top surface 951 of base 950 contains a plurality of ridges 953 capable of providing the user a firm grip during activation . applicator tube 980 contains two opposing fin structures 982 constructed and arranged to be able to part the fur coat of the animal . a nozzle end 981 of applicator tube 980 has a notch 983 . when nozzle end 981 is in contact with the skin of the animal , the space formed between notch 983 and the skin permits the outflow of parasiticde . fin structures 982 help part the animal &# 39 ; s fur and the notch permits smooth fluid flow even if the tip is resting on the skin of the animal . it should be appreciated that the fur and insecticide spreading fins and the notch may adopt a wide variety of shapes and configurations . another preferred embodiment of the invention is shown in fig1 and fig1 . a dispensing cap 1000 shown generally in fig1 is configured to work with a fluid reservoir 1100 shown generally in fig1 . it should be noted that the fluid reservoirs identified herein can also be gel reservoirs . the engagement between cap 1000 and fluid reservoir 1100 is accomplished via the use of a raised structure 1150 and a pre - activation ridge 1101 of a head region 1115 of fluid reservoir 1100 and a locking groove 1073 and a pair of slanted cam followers 1071 about an internal wall 1051 of dome 1050 thereof . these are shown as , but are not limited to , being 180 ° apart and unitary with dispensing cap 1000 . as shown in fig1 , internal wall 1051 of dome 1050 of dispensing cap 1000 extends perpendicularly from an edge 1053 of dome 1050 to approximately halfway up dome 1050 where a smaller inside diameter of dome defines an internal ledge 1055 and an internal wall 1057 . the lower junction of internal wall 1057 is shaped into locking groove 1073 . two regions of internal wall 1051 of dome 1050 of dispensing cap 1000 are raised to form slanted cam followers 1071 . slanted cam followers 1071 are generally positioned in the region between edge 1053 of dome 1050 and edge 1055 . as shown in fig1 , a top surface of head 1115 includes a pierceable region 1113 . a pair of pre - activation rims 1150 on fluid reservoir 1100 extend from and are unitary with fluid reservoir 1100 . one end of each pre - activation rim 1150 adopts a downward slanting region 1151 , which further turns vertically downward to join a cap stabilizing ring 1159 . a pair of notched lug locks 1155 are provided on lower edges 1153 of each of slanting region 1151 . a fluid reservoir 1200 of another preferred embodiment of the invention are shown generally in fig1 a and 12b . a top surface 1215 of a head 1210 includes a pierceable region 1213 . a pair of pre - activation rims 1250 on fluid reservoir 1200 extend from and are unitary with fluid reservoir 1200 . one end of each pre - activation rim 1250 adopts a downward slanting region 1251 , which further turns vertically downward to join a cap stabilizing ring 1259 . a pair of notched lug locks 1255 are provided on a lower edge 1253 of each of slanting region 1251 . the partial cross - sectional view of an activated configuration of a system in 1399 in accordance with still another embodiment of the invention is shown in fig1 . in the activated condition , a fluid channel 1361 of a cap 1300 pierces a pierceable region 1313 on a top surface 1315 of a head region 1310 of a fluid supply 1301 and is in fluid communication with fluid supply 1301 . top surface 1315 of head region 1310 contacts an inner ceiling 1359 of a dome 1350 , thereby creating a seal to prevent fluid leakage during dispensing . a pair of cam followers 1371 on an inside wall 1351 of dome 1350 of cap 1300 travels in spaces 1363 between and defined by lower edge of a pre - activation rims 1311 and the upper edge of a cap stabilizing ring 1319 on head region 1310 . in another embodiment of the invention , the applicator tip branches into a forked dispensing manifold having multiple , preferably 2 to 5 , and most preferably 3 , projections or tines . at least one projection has an opening at the distal end to dispense fluid from the fluid reservoir . fig1 a and 14b show an applicator cap 1400 of a fluid delivery assembly in accordance with another embodiment of the invention . the distal portion of cap 1400 is connected to a forked dispensing manifold 1480 having a central projection tine 1481 and two side projection tines 1483 . the distal end of central tine 1481 has an opening 1482 . a channel 1461 extends from opening 1482 along the length of central tine 1481 through a base 1450 of applicator cap 1400 . central tine 1481 and side tines 1483 can further adopt a elliptical or tapered circumference to aid the parting of hair . other embodiments with four or more projections tines or dispensing ports at the end of each projection tines are acceptable . fig1 a and 15b show an applicator cap 1500 of a fluid delivery assembly in accordance with another embodiment of the invention . the distal portion of cap 1500 is connected to a forked dispensing manifold 1580 having three projection tines 1581 . the distal portion of tines 1581 are further curved from the plane of manifold 1580 to form a claw - like bend . the distal ends of one or more of tines 1581 each have an opening 1582 . a branched channel 1561 extends from opening 1582 along the length of tines 1581 and dispensing manifold 1580 through a base 1550 of applicator cap 1500 . tines 1581 , manifold 1580 and base 1550 may be constructed as an unitary piece or as separate pieces to be attached by the user over the end of a shorter tip . fig1 a and 16b show an applicator cap 1600 of a fluid delivery assembly in accordance with the invention . the distal portion of cap 1600 is connected to a forked dispensing manifold 1680 having three projection tines 1681 . the distal portion of tines 1681 are tapered . the distal ends of tines 1691 each have an opening 1682 . a branched channel 1661 extends from opening 1682 along the length of tines 1681 and dispensing manifold 1680 through a base 1650 of applicator cap 1600 . tines 1681 , manifold 1680 and base 1650 may be constructed as an unitary piece or as separate pieces to be attached by the user over a shorter tip structure . the examples provided herein are merely exemplary , as a matter of application specific to design choice , and should not be construed to limit the scope of the invention in any way . in one embodiment of the invention the tube for delivering the liquid or gel is about 15 to 25 mm long , preferably 18 to 20 mm long and has an internal diameter of about 1 to 4 mm , preferably 2 to 3 mm . in an embodiment of the invention , the reservoir has a volume of about 0 . 01 to 100 ml . thus , while there have been shown and described and pointed out novel features of the present invention as applied to preferred embodiments thereof , it will be understood that various omissions and substitutions and changes in the form and details of the disclosed invention may be made by those skilled in the art without departing from the spirit of the invention . it is the intention , therefore , to be limited only as indicated by the scope of the claims appended hereto . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described and all statements of the scope of the invention which , as a matter of language , might be said to fall therebetween . | 0 |
shown in fig1 a , 1b and 1c are schematics of exemplary traction elevator systems 10 . features of the elevator system 10 that are not required for an understanding of the present invention ( such as the guide rails , safeties , etc .) are not discussed herein . the elevator system 10 includes an elevator car 12 operatively suspended or supported in a hoistway 14 with one or more belts 16 . the one or more belts 16 interact with one or more deflector sheaves 18 to be routed around various components of the elevator system 10 . the one or more belts 16 could also be connected to a counterweight 22 , which is used to help balance the elevator system 10 and reduce the difference in belt tension on both sides of the traction sheave during operation . it is to be appreciated that while the embodiments herein are described as applied to coated steel belts , it is to be appreciated that the disclosure herein may similarly be applied to steel ropes , either coated or uncoated . the deflector sheaves 18 each have a diameter 20 , which may be the same or different than the diameters of the other deflector sheaves 18 in the elevator system 10 . at least one of the sheaves could be a traction sheave 24 . the traction sheave 24 is driven by a machine 26 . movement of the traction sheave 24 by the machine 26 drives , moves and / or propels ( through traction ) the one or more belts 16 that are routed around the traction sheave 24 . in some embodiments , the elevator system 10 could use two or more belts 16 for suspending and / or driving the elevator car 12 . in addition , the elevator system 10 could have various configurations such that either both sides of the one or more belts 16 engage the one or more deflector sheaves 18 ( such as shown in the exemplary elevator systems in fig1 a , 1b or 1c ) or only one side of the one or more belts 16 engages the one or more sheaves 18 . fig1 a provides a 1 : 1 roping arrangement in which the one or more belts 16 terminate at the car 12 and counterweight 22 . fig1 b and 1c provide different roping arrangements . specifically , fig1 b and 1c show that the car 12 and / or the counterweight 22 can have one or more deflector sheaves 18 thereon engaging the one or more belts 16 and the one or more belts 16 can terminate elsewhere , typically at a structure within the hoistway 14 ( such as for a machineroomless elevator system ) or within the machine room ( for elevator systems utilizing a machine room ). the number of deflector sheaves 18 used in the arrangement determines the specific roping ratio ( e . g ., the 2 : 1 roping ratio shown in fig1 b and 1c or a different ratio ). fig1 c also provides a cantilevered type elevator . the present invention could be used on elevator systems other than the exemplary types shown in fig1 a , 1b and 1c . fig2 provides a schematic of a belt construction or design . each belt 16 is constructed of a plurality of wires 28 ( e . g . twisted into one or more strands 30 and / or cords 32 as shown in fig3 ) in a jacket 34 . as seen in fig2 , the belt 16 has an aspect ratio greater than one ( i . e . belt width is greater than belt thickness ). the belts 16 are constructed to have sufficient flexibility when passing over the one or more deflector sheaves 18 to provide low bending stresses , meet belt life requirements and have smooth operation , while being sufficiently strong to be capable of meeting strength requirements for suspending and / or driving the elevator car 12 and counterweight 22 . the wires 28 may be steel , or formed from other metals or fibers . the jacket 34 could be any suitable material , including a single material , multiple materials , two or more layers using the same or dissimilar materials , and / or a film . in one arrangement , the jacket 34 could be a polymer , such as a thermoplastic elastomer , applied to the cords 32 using , for example , an extrusion or a mold wheel process . the jacket 34 can substantially retain the cords 32 therein . the phrase substantially retain means that the jacket 34 has sufficient engagement with the cords 32 to transfer torque from the machine 26 through the jacket 34 to the cords 32 to drive movement of the elevator car 12 . the jacket 34 could completely envelop the cords 32 ( such as shown in fig2 ), substantially envelop the cords 24 , or at least partially envelop the cords 32 . over time , by operation of the elevator system 10 , the jacket 34 wears , altering a surface roughness of an outer surface 36 of the jacket 34 . altering of the surface roughness alters performance of the belt 16 , and affects operational characteristics of the elevator system 10 such as noise , vibration and ride quality . to restore an initial surface roughness of the outer surface 36 , a belt resurfacer 38 , such as that shown in fig4 is utilized . the belt resurfacer 38 includes a resurfacer housing 40 in which the other components of the resurfacer 38 are positioned . two or more resurfacing rollers 42 are rotatably located in the housing 40 , with each resurfacing roller 42 rotatable about a respective roller axis 44 . the resurfacing rollers 42 are positioned on opposing sides 46 a and 46 b of the belt 16 , such that the belt 16 is positioned between two resurfacing rollers 42 . the resurfacing rollers 42 are formed from a metal or other heat - conductive material , and have a non - stick roller outer surface 48 . the roller outer surface 48 is formed to have a surface roughness substantially matching a selected surface roughness of the jacket 34 after refinishing . it is to be appreciated that while two resurfacing rollers are shown in the embodiment of fig4 , in other embodiments , the belt 16 may be positioned between one resurfacing roller 42 and another surface , for example a low friction plate or other surface . such embodiments may be utilized for resurfacing on side of the belt 16 at a time , or in situations where resurfacing of only one side of the belt 16 is desired . to resurface the jacket 34 , the belt resurfacer 38 is positioned , as shown in fig5 , in the hoistway 14 , with the resurface rollers 42 positioned at the opposing sides 46 a and 46 b of the belt 16 . referring again to fig4 , the resurfacing rollers 42 are biased toward the belt 16 by , for example , tensioning springs 60 to apply pressure on the belt 16 . in some embodiments , the applied pressure is in the range of 20 to 50 psi . while tension springs 60 are shown in fig4 , in other embodiments the pressure may be applied using a pneumatic cylinder , electromechanical actuator or other device . the resurfacing rollers 42 are heated to a temperature below the melting temperature of the jacket 34 material , but a temperature high enough to soften the jacket 34 material . in some embodiments , the resurfacing rollers 42 are heated to a temperature between 140 and 180 degrees celsius . alternatively , in other embodiments , the belt 16 may be heated separately from the rollers 42 or before encountering the rollers 42 by , for example , passing the belt 16 through a heater . it is to be appreciated that some jacket materials may require heating to temperatures outside of this exemplary range , depending on the speed at which the belt 16 is routed through the rollers 42 during resurfacing operations . at higher speeds , heating of the belt 16 to higher temperatures may be required to accomplish resurfacing . the resurfacing rollers 42 are heated to the selected temperature by one or more heater rods 50 , also known as cal rods , installed in the resurfacing rollers 42 . alternatively a heating coil arrangement installed in the resurfacing rollers 42 , or other means , may be utilized to facilitate heating of the resurfacing rollers 42 . as shown in fig6 , the heater rods 50 are connected to a power source 52 that supplies electrical current to the heater rods 50 . a controller 54 connected to the power source 52 regulates the flow of electric current to the heater rods 50 , thus maintaining a selected temperature of the resurfacing rollers 42 . one or more temperature sensors ( not shown ) located at the resurfacing rollers 42 may provide temperature feedback to the controller 54 . the belt 16 is moved through the belt resurfacer 38 , such that the heated resurfacing rollers 42 soften the outer surface 36 and imprint the surface roughness from the resurfacing rollers 42 into the outer surface 36 , with aid from the pressure applied by the tensioning springs 60 . once through the belt resurfacer 38 , the outer surface rehardens with the selected surface roughness matching that of the resurfacing rollers 42 . in some embodiments , the belt resurfacer 38 includes one or more guide rollers 56 to guide the belt 16 toward the resurfacing rollers 42 . the belt resurfacer 38 disclosed herein allows field repair of a worn belt 16 to improve traction and other operational characteristics of the belt 16 and the elevator system 10 . the device and method does not require unroping of the belt 16 from its installed position in the hoistway 14 for resurfacing and thus saves time and labor . further , the device and method allows for service of a worn belt , thus avoiding premature replacement of the belt . while the invention has been described in detail in connection with only a limited number of embodiments , it should be readily understood that the invention is not limited to such disclosed embodiments . rather , the invention can be modified to incorporate any number of variations , alterations , substitutions or equivalent arrangements not heretofore described , but which are commensurate with the spirit and scope of the invention . additionally , while various embodiments of the invention have been described , it is to be understood that aspects of the invention may include only some of the described embodiments . accordingly , the invention is not to be seen as limited by the foregoing description , but is only limited by the scope of the appended claims . | 1 |
referring to fig1 an optimiser 10 according to a preferred embodiment of the present invention comprises a processor 102 ( for example an intel ™ pentium ™ microprocessor or a reduced instruction set ( risc ) microprocessor ), communicating via a bus ( not shown ), with a memory 104 comprising a program memory 106 ( which may , for example , be a read only memory ); a working or scratch pad memory 108 ( which may , for example , be random access memory ); and a function memory 110 . the function memory 110 may be read only memory ( rom ) where the optimiser is desired to solve only a single function , but is more normally random access memory ( ram ) to permit the input of a new function . all three memories 106 - 110 may simply be partitioned areas within a common memory device 104 , as shown . also provided are a random number generator 112 and a best solution storage register 116 ; these are shown as separate integers for clarity but conveniently in this embodiment the random number generator is incorporated within the processor 102 operating under control of the program memory 106 and the best solution storage register 116 is provided within the working memory 108 . finally , an input / output interface device 114 is provided , at which data partly or completely defining a function to be optimised is received and supplied to the processor 102 and thence to the function memory 110 ; and at which the processor 102 makes available the input values and / or the optimal function value which will be derived as described hereafter . conveniently , the optimiser 10 may be provided as a suitably programmed personal computer or workstation , such as a sun sparcstation ™. the operation of this embodiment will now be described with reference to the flowchart of fig2 and 3 , and the illustrated function in fig4 . referring to fig2 in step 20 the processor 102 inputs the data defining the function to be optimised at the input / output interface 114 , and stores the function to be optimised in the function memory 110 . in the present embodiment , it will be assumed that the function data input comprises the typing in of the function at a keyboard comprised within the i / o interface 114 , together with upper and lower ranges for each variable over which the function is to be optimised . in step 22 , the optimiser 10 calculates an optimum value for each input value , and in step 24 the processor 102 outputs the optimum values at the i / o interface 114 . referring now to fig3 a , the process performed in step 22 will now be described in greater detail . in step 32 , an initial value for each of the input variables ( i . e . input signals ) is selected , so as to collectively comprise an input vector . the values may be randomly chosen within the range of each input , or may for example be the centre point of the range of each . in step 34 , a first input signal ( i . e . a first component of the current input signal vector ) is selected . in step 36 , the processor 102 decides whether or not to select a new signal value for that component and , if so , does so . this process will be described in greater detail below . in step 38 , the processor 102 determines whether the component just tested was the last component of the vector and , if not , returns to select the next component of the vector at step 34 . in step 40 , the processor 102 determines whether the change in the value of the function over the last n cycles ( where n is large predetermined number ) has crossed a predetermined threshold over that number of cycles and , if not , the process of optimisation terminates and the processor 102 proceeds to step 24 . if the exit criterion is not met , then the processor 102 tests ( step 42 ) whether a larger predetermined number of cycles m has expired and , if so , in step 44 , the processor 102 selects as a new current vector value the stored value within the best value register 116 and resets a convergence parameter g ( step 46 ) which will be discussed in greater detail below . the processor then returns to step 34 to repeat the process from the new starting point . referring to fig3 b , within each cycle , the process of determining whether to move , and doing so , will now be described in greater detail , with particular reference to the function illustrated in fig4 in which the optima are minimum . in a step 50 , the processor 102 calculates the value of the function f old of the current vector . in a step 52 , the processor 102 generates an offset from the current signal value , by the process of fig3 c , comprising generating a pseudo random number r having an amplitude between 0 and 1 via the random number generator 112 in a step 90 , testing whether the random number lies above 0 . 2 in a step 92 ; if so ( as will be the case during 80 % of cycles on average ), generating the offset a 1 as the sum of a predetermined constant a having a low value relative to the range of the component signal , and the product of the random number r and a second predetermined constant b equal to ( or , in general , comparable in magnitude with ) the input range of the component signal . if the random number lies below 0 . 2 in step 92 ( as will be the case on 20 % of the cycles ) the processor proceeds to calculate the offset a 1 in accordance with step 96 , as the sum of the predetermined constant and the product of the predetermined constant a and twice the random number r . thus , the . random number r is here being used for two different purposes ; firstly , to select whether a local or a global test is performed in the current cycle ( the ratio of the total number of local to global tests being set by the threshold used in the step 92 ), and secondly to select the magnitude of the offset of a test input signal value from the current input signal value . if a local test is to be performed as a result of the determination in step 92 , then the offset a 1 from the current input signal is determined randomly by the random number r , but its range is constrained to lie close to the current value by the constant a in step 96 , whereas if the test is to be global test the offset a 1 is determined in step 94 randomly to lie within a much greater range comparable to that of the input signal by the constant b . in step 54 , a first test value x 1 is calculated as the current signal component value v i less the offset a 1 multiplied by the random number r and by a convergence factor g , which starts with a value close to unity . in fig4 a , the current value of the input signal vector component v i is shown as a dark circle . it will be seen that the current value lies close to a local minimum in the function , but with deeper local minima to either side , and a global minimum still further to the right ( at a still higher value of the input signal component v i ). in step 56 , the processor 102 calculates the value of the function at the test point x 1 . from fig4 a , it will be seen that this value lies close to a deeper local minimum than the current value . in step 58 , the processor compares the test value just calculated with the current function value calculated in step 50 . if the test value is lower than the current value , then in step 60 the processor 102 reduces the value of the convergence term g by multiplying it by a constant l having a value slightly less than unity . this will reduce the range which the offset of the test function point x 1 collector can take in subsequent cycles , and hence make the search less “ global ” and more “ local ”. in a step 62 , the processor then calculates a new current value , x 3 , for the vector component by adding to the current value a fraction ( determined by the value of a predetermined fixed constant k substantially less than unity ) of the difference , ( x 1 − v i ) between the test value and the old current value . in a step 64 , the current value of the input signal component v i is therefore set to the newly calculated value x 3 . it will be seen from fig4 a that this new value of the input signal is less optimal than the previous current value . however , it has moved the current value towards a more optimal point , namely x 1 . thus , the described process permits the current value to “ climb ” out of a local minimum and towards a global minimun , whilst moving sufficiently slowly to enable some eventual convergence . referring now to fig3 d , to ensure that the whole range of the input signal component is searched and not just the lower part , a further test value x 2 on the opposite side of the previous current value is next calculated . in step 66 , the offset a 1 is calculated by repeating the process of fig3 c , and in step 68 , a new test value x 2 higher than the old current value is calculated , much as described in relation to step 54 , but by adding ( rather than subtracting ) the product of the offset a 1 , the convergence factor g and the random number r to the old current value v i of the signal component . in step 70 , the value of the function is calculated by the processor 102 at the test point x 2 , substantially as described in relation to step 56 . in step 72 , the value thus calculated is compared with the previous test value calculated at step 50 above , and if ( as shown in fig4 a ) it lies ( somewhat ) below the old value f old of the function at the previous current input signal , then the convergence constant g is reduced as described in relation to step 60 above , and a new position x 4 is calculated exactly as described in relation to the position x 3 in step 62 above , but utilising the test position x 2 in place of the test position x 1 . in a step 78 , the processor 102 determines whether the function values at both test positions x 1 and x 2 were lower than the function value at the previous current signal value , calculated at step 50 . where , as here , this is the case then in step 80 the next current value of the signal component v i is calculated as : it will be seen that this corresponds substantially to the calculation performed in steps 76 and 62 to determine the positions x 3 and x 4 ; the only difference is that instead of using the current value of the input signal v i from the previous cycle , the value x 3 is used , corresponding to a shifted position of the input value towards the point x 1 . thus , some convergence movement within a cycle takes place . it will be seen that the effect of this is to move the value of the signal out of the local minimum within which it was initially located and into a deeper minimum , before it can converge within the previous local minimum . this feature of the invention thus permits rapid convergence on a global minimum . where the processor 102 determines , in step 78 , that the value of the function at the test point x 2 is lower than the value at the previous current value of the input signal , but the value of the function at the other test point x 1 was not , then the new current value of the input signal is calculated , in step 82 , to be equal to the position x 4 calculated in step 76 above . where , in step 58 or step 72 , it is determined by the processor 102 that the value of the function at the current position is more optimal than that at the test position , then the value of the current position is left unchanged ( i . e . the test position plays no part in determining the next current value ). fig4 c shows an alternative starting situation , in which the test value x 1 is no lower than the initial value , but the test value x 2 is lower than the initial function value . in this case , the value x 3 is not used , and the next current input value is x 4 , which as shown happens to lie at the bottom of the global minimum of the function . it is noteworthy that the present embodiment does not attempt to converge on the nearer local minimum . the process of fig3 then continues with the next component of the input signal vector at step 34 of fig3 a . it will therefore be seen that the process of fig3 corresponds to perturbing each input signal ( i . e . input variable or component of the input signal vector v ) along opposite directions , the amplitudes of the perturbations being different from each other and from one iteration to the next . the size of the perturbation explores areas of the range of each signal component local to the current value for a fixed percentage at the time , and globally for the remaining cycles . the embodiment therefore explores local and global areas simultaneously , permitting local regions to be searched in detail , but to escape from local minima before excessive cycles have been spent converging . the process can therefore move “ uphill ” out of local minima , as well as “ downhill ” into them , where a deeper minimum occurs elsewhere within the range of a signal component . the above described embodiment was applied to the five test functions created by de jong , which are described in the above referenced article by de la maza and will not be farther described in detail here . for comparative purposes , the tests were repeated with the dynamic hill climbing ( dhc ) algorithm described in that paper and a genetic algorithm ( ga ), and the results are reproduced below : in the above , ‘ dls ’ indicates the results obtained by the present embodiment . the present invention converged in 103 function evaluations for the third test function ( a step function which has long flat surfaces surrounded by discontinuities ), whereas it was found that the dynamic hill climbing algorithm would not converge . it will therefore been that the present invention outperformed the dhc algorithm in 4 of the 5 cases . the performance was less good on the second test function ( a saddle function with a curving valley ) which has few local minima and is relatively smooth . thus , relative to the dynamic hill climbing algorithm , the above described embodiment gives an improved performance for functions with local minima , or with flat portions and / or discontinuities . it has particularly been found that the present invention is a substantial improvement over many local search optimisation techniques for functions of the type including flat areas , because local search techniques find greater difficulty in escaping from such flat areas or in optimising to a local minimum within a given flat area , whereas the present invention will encounter no such difficulty . this makes the present invention suitable for , for example , heavily quantised output functions where the output function is represented only by a few levels , for example a few bits ( as in a - law pcm ). it is therefore anticipated that the invention will find use in applications such as low bit rate signal coding where heavily quantised outputs exist , but will also be useful in computing applications in general since quantisation due to digital representation , clipping of the range or the like may be an important factor . fig5 shows an embodiment of the invention comprising a communications terminal 200 ( e . g . a digital cellular telephone ). the telephone comprises a microphone 202 , the output of which is fed to an analog digital converter 204 , digitised speech from which is supplied to an optimiser unit 10 ( embodied in , for example , a digital signal processor chip which also performs linear predictive coding ( lpc ) as described in “ linear predictive coding , a tutorial review ”, by john makhoul , proc . iee , vol . 63 , no . 4 , april 1975 ). as is well known , the technique of linear predictive encoding a low bit rate speech coding technique comprises analysing speech signals to determine a set ( for example , 12 ) of filter parameters which correspond to the tap weights of a filter which , when excited by an excitation signal , will reconstruct the original speech signal . one particular type of linear predictive coding is known as multi - pulse linear predictive coding ( mplpc ). in mplpc , the excitation consists of a series of pulses , the positions in time of which ( and , in some cases . the amplitudes of which ) are determined by optimisation , by testing various pulse positions , re - synthesising the signal using the already determined lpc coefficients and those pulse positions , and comparing it with the original speech signal . those pulse positions which give the lowest squared error are selected , and the pulse positions and amplitudes thus determined are passed , together with the lpc coefficients , to a channel coder 206 which performs channel coding such as tdma or cdma encoding followed by error correcting encoding ( e . g . convolutional , block or turbo . coding ). the encoded filter parameters and excitation are then supplied to an rf output stage 208 at which they are modulated onto a radio frequency signal and transmitted through an antenna . accordingly , the present invention is employed to optimise the position and amplitudes of the pulses , illustrated in fig6 making up the excitation . this is done by the process of fig7 which represents a modification of the process of fig2 . in a step 20 a , a frame of successive speech samples are input from the analog to digital converter ( for example , 20 milliseconds of samples ). in a step 20 b , a set of lpc filter coefficients are extracted in conventional fashion . in a step 20 c , the function to be optimised ( minimised in this case ) is set as the sum of the square of the errors between each input digitised speech sample of the frame , and the corresponding synthesised speech sample produced by applying the lpc coefficients to a given input vector ( step 20 d ) comprising the set of pulse positions and amplitudes making up the excitation . the optimiser 10 then proceeds to steps 22 and 24 of fig2 to find optical pulse positions and amplitudes ; i . e . those pulse and amplitudes which minimise the error between the synthesised speech and the input sample speech . these are then transmitted to the channel coder for subsequent transmission . if ( step 26 ) speech is detected no longer to be present at the microphone , the process terminates . if speech is detected as present , however , the process of fig6 returns to step 28 to extract a further frame of digitised speech . fig8 shows a further embodiment of the invention comprising a motion compensated video coder used in , for example , a video telephone of video conference unit . in such coders , as is well known , the main reason for the change from picture to picture is the motion of , for example , a human face within the image . it is therefore possible to achieve a substantial reduction in the volume of data to be transmitted by locating the “ motion vector ”; in other words , the combination of vertical and horizontal offset values , in pixels , which indicate how much a portion of the image has moved from one frame to the next , and to send this motion vector together with other data encoding the frame to frame change ( for example , using the moving picture expert group or mpeg standard ). accordingly , this embodiment comprises a camera 302 , the output of which is fed to a video adc 202 which supplies successive video samples to a frame store 304 in which an entire image is stored . the address within the frame store of a pixel at a position x , y within the image will therefore be n * y + x , where n is the number of pixels per line . the frame store also retains the previous image frame . the optimiser 10 of the present invention is arranged to read data from the frame store 304 and to extract a motion vector comprising x and y position offset values . the same device is arranged to perform mpeg video coding , as is well known in the art . the motion vector and mpeg data are supplied to a channel coder 206 where channel coding is applied and thence to an output port 208 for transmission . referring to fig9 the process of fig2 is performed as follows . in a step 20 a , a new frame of video data is input and in a step 20 b , the previous frame of data is accessed . in a step 20 c , the function to be minimised is set as the sum of the squared errors between the corresponding pixels of the previous frame and synthesised pixels created by decoding mpeg encoded video data created from the difference between pixel values of the previous frame and those of the current frame when shifted by a motion vector , the x and y components of which form the inputs to this function to be optimised ( i . e . minimised in this case ). the process then proceeds to step 22 and 24 of fig2 to test various values of x and y offset and return those which result in the minimum error between the previous video frame and that which would be synthesised by decoding the mpeg encoding image with that motion vector . it will be apparent that other embodiments of the invention may also be provided to find an optimum offset between two portions of a signal . for example , the invention may be employed within an echo cancellor , as a means of finding the length of the echo to be cancelled ; in other words , the time offset between a reference impulse and its echo . this corresponds to a search for a time offset for which the sum of the squares of the differences between signal values , and corresponding signal values shifted by that offset , is minimal . in other words , the invention may be used to locate the maximum correlation within a time domain signal , and may therefore also find application in related devices such as sonar or radar units . referring to fig1 , in another embodiment the present invention comprises a network management centre ( nmc ) 402 within a telecommunications network comprising a plurality of interconnected exchanges 400 a - 400 f . the nmc is connected via a signalling link to each of the exchanges 400 a - 400 f ( the connections to the exchanges 400 a - 400 c are omitted here for clarity ). the nmc is thereby able to control the routing performed at each of the exchanges 400 a - 400 f , for example to vary routing tables held at those exchanges , so as to control the passage of a call through the network . the nmc monitors the traffic at each of the exchanges 400 a - 400 f and controls the routing so as to achieve a desired distribution of traffic . this may be achieved by minimising a cost function , the inputs to which are the routings between the exchanges 400 a - 400 f , the cost function being calculated in accordance with the traffic loadings which would be produced by those routings , weighted by other cost factors such as the length of the path through the network , and the relative actual costs of using particular channels such as fibre optic or satellite channels . the network management centre 402 therefore comprises a computer , receiving as inputs the current loadings at exchange and other factors such as the current capacity at each exchange , and performing an optimisation to calculate allocation of traffic , the inputs to the function being the routing control data to set up the routing tables in each exchange 400 a - 400 f . referring to fig1 , an embodiment of the invention useful for modelling crystal structures will now briefly be described . in general terms , this embodiment is similar to the disclosure of gb 2254458 . within the store 502 , data characterising the wave functions of different atoms are stored . the keyboard 504 allows a user to input the atoms it is desired to model , and the optimiser 10 is arranged to access the store 502 , and then to calculate the positions which such atoms would take in a crystal or compound structure , in accordance with the wave function data , to minimise the hamiltonian equation ( i . e . to find the positions of the atoms which correspond to a minimum energy configuration ). having done so , the processor 10 creates a screen displaying showing the structure , on the vdu 506 . fig1 illustrates a further embodiment of the invention , comprising a chemical process control system . a reactor vessel 602 is fed from tanks of four ingredients via respective valves 604 a - 604 d , which control the rate of supply of each component to the reactor vessel 602 . the reactor vessel includes sensors such as a temperature sensor . the yield of the desired product is a function of the ratio of the components supplied via the valves 604 , and temperature . the optimiser 10 is arranged to sense the temperature from the reactor vessel , and to determine optimum settings of the valves 604 a - 604 d to achieve the optimum yield at the sensed temperature . many other embodiments of the invention will be clear from the foregoing including , without limitation , industrial process control embodiments ; pattern matching embodiments in which a transform between two images is calculated ( the embodiment given above of a motion vector generator is an example of this type of embodiment where only translational transformations are considered ); signal processing embodiments ( including signal encoding embodiments and particularly analysis - by - synthesis embodiments as described above in relation to speech ) and signal correlating or filtering embodiments . the foregoing examples have dealt with optimisation of a function directly . however , in many cases it is desired to optimise a function whilst not violating some constraints . for example , in the case of the telecommunications network management embodiment above , each telephone exchange is constrained to a maximum number of calls that it can handle . likewise , in the case of the chemical process plant embodiment above , each valve can open only up to a predetermined point . these are direct constraints on the possible input values , but more complex constraints may exist ; for example , in the telecommunications network management example , there may be a constraint on the maximum routing distance such that calls should not be routed through more than x exchanges . the present invention is also capable of optimising functions with constraints , in which case the function which is optimised is not the original function but a modified function composed of this original function with the addition of penalty terms where a constraint is violated . thus , where a minimum in the original function is reached at which a constraint is not satisfied , the modified function value is increased because of the penalty term and the minimum in the original function does not therefore result in a minimum in the modified function . further details are given in the paper “ constraint optimisation using dynamic local search ” by the present inventors , to be published in a workshop aug . 18 , 1996 , incorporated herein by reference in its entirety . other embodiments and modifications which will be apparent to the skilled person are to be understood to form part of the present invention , including design of communications network architecture ; design and implementation of network restoration systems , and in processes such as a work manager . | 6 |
the following description is intended to refer to the specific embodiments of the invention illustrated in the drawings . this description is not intended to define or limit the scope of the invention , which is defined separately in the claims that follow . referring to fig1 the pail 10 produced by an embodiment of this mold assembly invention has a bottom 12 with outer surface 14 and inner surface 16 . the pail also has a wall 18 with outer surface 20 and inner surface 22 . on the outer surface of the pail &# 39 ; s wall is a skirt 24 with an outer downwardly inclined surface 26 and a recessed surface 28 . above skirt 24 is a double locking mechanism 30 which allows secure or even permanent locking engagement with a mating cover ( not shown ). fig2 is a detailed representation of double locking mechanism 30 formed in pail wall 18 . locking mechanism 30 has inner lock member 36 , outer lock member 44 , and stiffening flange 32 . inner lock member 36 has inner surface 38 , outer surface 40 and terminates in outwardly extending inclined flange 42 . similarly , outer lock member 44 has inner surface 46 , outer surface 48 and terminates in outwardly extending flange 50 . stiffening flange 32 is formed integrally with outer lock member 44 via a plurality of ribs 34 , thereby providing additional support to outer lock member 44 as well as additional hoop strength to the pail . fig3 illustrates an embodiment of a mold assembly according to this invention , generally designated 60 , in its closed configuration . mold assembly 60 has a core 62 movable along its centerline cl , hereinafter referred to as the core axis . core 62 is shaped to form inner surface 38 of inner lock member 36 ( fig2 ), inner surface 22 of pail wall 18 , and inner surface 16 of pail bottom 12 . a mold cavity 64 is fixedly mounted along the core axis and is provided with insert 66 . cavity 64 is shaped to form outer surface 20 ( fig1 ) of pail wall 18 and outer surface 14 of pail bottom 12 . insert 66 is shaped to form recessed surface 28 of skirt 24 . insert 66 is preferably shaped to form portions of skirt 24 adapted for attachment of the usual bail handle ( not shown ). a solid stripper ring 68 is mounted to guide rods 70 with axes parallel to the core axis cl . guide rods 70 have stops 71 adjacent their upper ends to limit travel of ring 68 as it moves away from core 62 , as will be described in further detail hereinafter . ring 68 is shaped to form outer surface 40 ( fig2 ) and flange 42 of inner lock member 36 of the pail as well as inner surface 46 and flange 50 of outer lock member 44 of the pail . ring 68 is provided with rigidly mounted guide rods 76 which are directed at an angle from the core axis and away from centerline cl of core 62 . guide rods 76 have shoulders 77 and are mounted in stationary positions by means of a press - fit between the shaft of rods 76 and ring 68 . ring 68 , along with guide rods 76 , travels along guide rods 70 in a direction parallel to the core axis . split ring segments 74 are positioned adjacent ring 68 ( as in fig3 ) when mold assembly 60 is in its closed configuration . segments 74 are adapted to form outer surface 48 of outer lock member 44 , stiffening flange 32 , ribs 34 and outer surface 26 of skirt 24 ( fig2 ). in operation segments 74 are pushed away from core 62 by ejector rods 72 of which there are preferably two for each segment 74 . segments 74 are shaped to accommodate guide rods 76 , each segment 74 preferably accommodating two guide rods 76 . mold assembly 60 preferably has four segments 74 that are approximately equal in size and equally spaced . opposing segments are preferably shaped to cooperate with insert 66 to form pail portions of skirt 24 adapted for attachment of a bail handle . when the components of mold assembly 60 are in their closed configuration as shown in fig3 fluid material such as polyethylene , for example , is injected between the core 62 , the cavity 64 , split ring segments 74 and solid ring 68 , by means of sprue 78 formed in cavity 64 or a separate sprue insert . the fluid material , by this injection , fills the annular void created by cooperation of the aforesaid mold components 62 , 64 , 66 , 68 and 74 . the operation of mold assembly 60 is now described with reference to fig4 a - 4e . fig4 a illustrates the mold components in their closed configuration after fluid material has been injected into the mold assembly . in fig4 b the core 62 is shown removed from engagement with cavity 64 and insert 66 , thereby freeing the recess surface 28 of skirt 24 ( fig1 ) and the outer surfaces of the pail &# 39 ; s wall and bottom from the mold cavity 64 . ejector rods 72 then , under the influence of driving means such as hydraulics ( not shown ), force ring segments 74 to travel in a direction parallel to the core axis . ring 68 follows ring segments 74 along guide rods 70 in a direction parallel to the core axis , and ring 68 and segments 74 do not move relative to each other . the inside surfaces of pail 10 are readily separated from core 62 as ring 68 and ring segments 74 push pail 10 along the core axis . inner lock member 36 of pail 10 ( fig2 ) engages ring 68 , causing ring 68 to follow ring segments 74 . a pusher ( not shown ) optionally provides downward force sufficient to assist ring 68 in following segments 74 . the pusher is preferably a pneumatically or hydraulically actuated piston ( known per se ) that moves downwardly when the area of a cylinder above the pusher is pressurized in the usual manner . release or reversal of the pressure in the usual manner permits the pusher to travel upwardly as the mold returns to its closed configuration . fig4 c illustrates the pail &# 39 ; s locking mechanism as it appears immediately after ring 68 has reached the limit of its travel , as a surface 75 of split ring segments 74 ( fig3 ) separates from a surfaces 69 of ring 68 , but before ring segments 74 travel any significant distance along guide rods 76 . because ring 68 and segments 74 have traveled along the core axis for the limited travel of ring 68 without moving relative to each other , and because ring segments 74 can only move outwardly along guide rods 76 after ring 68 stops , there is no sliding contact between mold components 68 and 74 . flange 50 on pail outer lock member 44 and flange 42 on pail inner lock member 36 both separate from solid ring 68 of the mold . flange 42 of the pail deforms inwardly from the portion of ring 68 that forms the inner lock member &# 39 ; s outer surface to permit the release of pail flange 42 from ring 68 . the curved contour between pail flange 42 and outer surface 40 of pail inner lock member 36 permits this deformation without causing damage to inner lock member 36 . stiffening flange 32 and ribs 34 ( not shown ) remain in contact with ring segments 74 . fig4 d shows mold assembly 60 as it appears after split ring segments 74 have traveled along guide rods 76 outwardly from core 62 . ejector rods 72 , as will be apparent , continue to push ring segments 74 along angled guide rods 76 as solid stripper ring 68 remains stationary at the end of its travel . at this point in the molding process , pail outer lock member 44 , stiffening flange 32 , ribs 34 ( not shown ) and skirt 24 are substantially free from mold components 62 , 68 and 74 , although there is not yet enough clearance to remove the pail without interfering with ring segments 74 . fig4 e shows mold assembly 60 in a fully opened configuration in which ejector rods 72 have fully extended to move ring segments 74 along guide rods 76 to the end of their travel while solid stripper ring 68 remained stationary at the end of its travel . ring segment 74 is now separated from stripper ring 68 in a direction having a component along the core axis or centerline cl . at this point , the molded pail material has had time to at least partially solidify and the molded pail 10 can be easily removed from mold assembly 60 . the distance ring segments 74 travel along guide rods 76 , and the angle at which guide rods 76 are mounted within ring 68 , must cooperate to permit removal of the pail from the mold . the angle of rods 76 to the centerline cl is preferably between about 5 ° and 90 °, and more preferably between about 10 ° and 35 °. the length of travel along the rods 76 may be in accordance with the angle selected and the size of the locking mechanism 30 to be molded . the steps of injecting , forming and releasing pails are , of course , rapidly repeated , time after time , to produce a large number of pails by repeated molding operations . to prepare for the injection of fluid material to form the next pail in the cycle , the ejector rods 72 bring ring segments 74 back along guide rods 76 until they contact solid stripper ring 68 . at that point ring segments 74 and ring 68 move along the axis of guide rods 70 in a direction parallel to the core axis until ring 68 fully contacts core 62 . core 62 then recontacts cavity 64 , thereby returning mold assembly 60 to its closed configuration . mold assembly 60 shown in fig3 has ring segment guide rods 76 rigidly mounted within solid stripper ring 68 so that guide rods 76 travel with ring 68 and remain stationary when ring 68 reaches the end of its travel . this feature minimizes relative sliding contact between ring 68 and ring segments 74 as well as the mold wear associated with such sliding contact . another embodiment of the mold assembly according to this invention , generally indicated in fig5 by numeral 80 , differs from the embodiment shown in fig3 in that guide rods 96 along which split ring segments 94 travel are mounted within core 82 and not in solid stripper ring 88 . guide rods 96 are mounted within core 82 with threads 97 . mold assembly 80 has a core 82 , a cavity 84 , an insert 86 , a solid stripper ring 88 , guide rods 90 , ejector rods 92 , split ring segments 94 , guide rods 96 and a sprue 98 . fig6 a shows mold assembly 80 in its closed configuration after material has been injected to form pail 10 . core 82 forms inner surfaces 16 , 22 and 38 of pail bottom 12 , pail wall 18 , and inner lock member 36 , respectively ( fig1 and 2 ). cavity 84 forms outer surfaces 14 and 20 of pail bottom 12 and wall 18 , and insert 86 forms recess surface 28 of skirt 24 . solid ring 88 forms outer surface 40 and flange 42 of inner lock member 36 as well as inner surface 46 and flange 50 of outer lock member 44 . split ring segments 94 form outer surface 48 of outer lock member 44 , stiffening flange 32 , ribs 34 , and outer surface 26 of skirt 24 . fig6 b illustrates mold assembly 80 as it appears after core 82 is removed from engagement with cavity 84 and ejector rods 92 have begun to force ring segments 94 away from core 82 . a pusher ( not shown ) provides downward force sufficient to cause ring 88 to travel in a direction parallel to the core axis along guide rods 90 and follow ring segments 94 . because guide rods 96 are rigidly mounted within core 82 , ring segments 94 immediately travel along guide rods 96 at an angle to the core axis causing separation between ring segments 94 and the outside surfaces of pail 10 . ring 88 does not , however , travel along guide rods and instead travels parallel to the core axis . accordingly , ring 88 is provided with slots 89 to accommodate each guide rod 96 . referring to fig6 c , ring 88 and ring segments 94 remain in contact as ring segments 94 separate from outer surface 48 of outer lock member 44 , stiffening flange 32 , ribs 34 ( not shown ) and outer surface 20 of pail wall 18 . as pail 10 is pushed away from core 82 , the gap between the inner wall of the pail and the surface of core 82 permits the inward deflection of inner lock member 36 so that the lock member &# 39 ; s flange 42 can be released from the contour of ring 88 . as illustrated in fig6 d , ring 88 remains stationary at the end of its travel due to stops 91 in guide rods 90 . split ring segments 94 , however , continue to move along guide rods 96 by means of force exerted by ejector rods 92 . when ring segments 94 reach the end of their travel along guide rods 96 , pail 10 is entirely free from mold components 82 , 88 and 94 and can be removed from the mold . the angle at which guide rods 96 are mounted in core 82 , and the distance segments 94 travel along the rods , are determined in the same manner as the angle of guide rods 76 in mold assembly 60 . to prepare to mold the next pail , ejector rods 92 return ring segments 94 along guide rods 96 until they contact ring 88 . the ring segments 94 then force ring 88 along guide rods 90 until it rejoins core 82 or ring 88 is moved toward core 82 separately along guide rods 90 by a pneumatic or hydraulic cylinder ( not shown ). after core 82 recontacts cavity 84 , mold assembly 80 is in its fully closed configuration and is prepared for the injection of material to form the next pail . the rigid mounting of guide rods 96 within core 82 provides this embodiment of the mold assembly with additional structural rigidity . however , because ring segments 94 always travel along guide rods 96 at an angle to the core axis , before ring 88 reaches the end of its travel , there is some limited sliding contact between ring segments 94 and ring 88 . in any embodiment of the mold assembly according to this invention , several important benefits are conferred . a mold assembly according to this invention is capable of forming pails having pronounced and detailed protrusions on their walls , thereby facilitating the manufacture of pails having superior locking mechanisms to which covers can be securely or permanently attached . a mold assembly according to this invention provides a stripper ring having the dual function of stripping the molded pail from the core and forming important details in the pail &# 39 ; s locking mechanism . a mold assembly according to this invention also provides split ring segments which form important details of the locking mechanism and facilitate the release of the molded pail . a mold assembly according to this invention provides these and other features without utilizing complicated assemblies or incurring undue mold wear . because the ejector rods push against the split ring segments ( rather than against the solid stripper ring which merely follows the ring segments ) to open the mold assembly , there is a reduction in the force and associated wear between the rings as the mold is opened . also , because the ring segments do not rely on the solid ring for forward advancement , this configuration permits the separation of the rings after a predetermined distance of the stripper ring &# 39 ; s travel , thereby reducing mold wear caused by relative sliding contact between the rings . in fact , when ring segment guide rods are mounted within the stripper ring rather than in the core , wear caused by sliding contact between the rings is almost eliminated . if desired , many changes and modifications can be made without departing from the spirit and scope of this invention . the various components of the mold assembly can be configured to create pails having protrusions with a variety of shapes . in fact , the mold assembly can be configured to create any number of products which could have larger , smaller or even no protrusions . as indicated previously , the split ring guide rods can optionally be mounted in the core to provide additional stability to the mold assembly or within the solid stripper ring to minimize or eliminate wear caused by sliding contact between the solid stripper ring and the split ring segments . although this invention has been described with reference to specific forms selected for illustration in the drawings , and with reference to many variations thereof , it will be appreciated that many other variations may be made without departing from the important feature of providing an inexpensive and reliable mold assembly and method for forming articles having radially extending protrusions . all variations to the embodiments explicitly described herein , including the substitution of equivalent elements for those specifically shown and described , are within the spirit and scope of the invention as defined in the appended claims . | 1 |
hereinafter , description will be provided of preferred embodiments of the present invention with reference to the drawings . fig1 illustrates a general configuration of a communication system according to a preferred embodiment of the present invention . this communication system preferably includes the internet 3 and two lans 1 , 2 each connected to the internet 3 , for example . the lans 1 and 2 correspond to networks constructed at physically separate places , respectively . for example , the lan 1 corresponds to a local area network constructed in a head - office building and the lan 2 corresponds to a local area network constructed in a branch - office building . the lans 1 and 2 are connected to the internet 3 which is a global network , respectively . as illustrated in fig1 , communication terminals 11 and 12 are connected to the lan 1 . each of the communication terminals 11 and 12 has a private ip address . as described above , typically , a terminal connected to a lan has a private ip address which is uniquely controlled only in the lan . in addition , a relay server 13 is connected to the lan 1 . the relay server 13 is not only connected to the lan 1 , but is also connected to the internet 3 . the relay server 13 has a private ip address for a lan interface and a global ip address for a wan interface . communication terminals 21 and 22 each having a private ip address are connected to the lan 2 . further , a relay server 23 is connected to the lan 2 . the relay server 23 is not only connected to the lan 2 , but is also connected to the internet 3 . the relay server 23 has a private ip address for a lan interface and a global ip address for a wan interface . further , a sip - server 4 is connected to the internet 3 . the sip - server 4 serves as a proxy server for relaying a sip method or a response when the relay servers 13 and 23 carry out communications with each other through a sip ( session initiation protocol ), and serves as a sip registrar server for registering therein the accounts of the relay servers 13 and 23 . on the other hand , the relay server 13 connected to the lan 1 serves as a sip registrar server for registering therein the accounts of the communication terminals 11 and 12 connected to the lan 1 through the sip . more specifically , as illustrated in fig2 , the relay server 13 serves as a sip registrar server for registering therein the accounts on the basis of reception of registration requests ( resister ) from the communication terminals 11 and 12 , in terms of a relationship with the communication terminals 11 and 12 , and serves as a client for sending an account registration request ( resister ) to the sip - server 4 , in terms of a relationship with the sip - server 4 . likewise , the relay server 23 connected to the lan 2 serves as a sip registrar server for registering therein the accounts of the communication terminals 21 and 22 connected to the lan 2 through the sip . more specifically , as illustrated in fig2 , the relay server 23 serves as a sip registrar server for registering therein the accounts on the basis of reception of registration requests ( resister ) from the communication terminals 21 and 22 , in terms of a relationship with the communication terminals 21 and 22 , and serves as a client for sending an account registration request ( register ) to the sip - server 4 , in terms of a relationship with the sip - server 4 . fig3 illustrates a functional block diagram of the relay servers 13 and 23 . the relay servers 13 and 23 are similar in functions to each other ; therefore , description thereof will be provided with reference to the single drawing . each of the relay servers 13 and 23 includes a lan interface 101 , a wan interface 102 , a communication controller 103 and a local account information database 104 . the lan interface 101 uses a private ip address to carry out communications with a communication terminal connected to a lan . that is , the relay server 13 carries out communications with the communication terminals 11 and 12 through the lan interface 101 , and the relay server 23 carries out communications with the communication terminals 21 and 22 through the lan interface 101 . the wan interface 102 uses a global ip address to carry out communications with the sip - server 4 connected to the internet 3 which is a global network as well as other communication servers and communication terminals each connected to the internet 3 . in this preferred embodiment , the relay server has the wan interface 102 . however , connection with the wan may be performed through a router and the relay server may be placed under the router . the communication controller 103 is a processor arranged to control various communications carried out through the lan interface 101 and the wan interface 102 . the communication controller 103 controls various types of communication processing according to protocols such as a tcp / ip ( transmission control protocol / internet protocol ), a udp ( user datagram protocol ) and a sip . the communication controller 103 has a function of receiving an account registration request ( register ) from the communication terminal connected to the lan , and registering account information of the communication terminal in the local account information database 104 . for example , the relay server 13 receives the account registration request ( register ) from the communication terminal 11 , and registers the account information of the communication terminal 11 in the local account information database 104 . further , the communication controller 103 executes processing for exchanging the account information registered in the local account information database 104 with another relay server . as will be described later , this processing is executed by a message method . the exchange of the account information by this message method is performed periodically , for example . alternatively , the exchange of the account information may be performed through an operation by an operator . further , the communication controller 103 has a function of sending to the sip - server 4 a registration request ( register ) for registering an account of the relay server itself . in addition , the communication controller 103 has a function of maintaining connection of a tunneling session between the relay servers 13 and 23 . that is , transmission of an invite method of the sip from one of the relay servers 13 and 23 can establish the tunneling session between the relay servers 13 and 23 . the communication controllers 103 of the relay servers 13 and 23 maintain the established tunneling session , thereby relaying communication data between the communication terminals connected to the lans 1 and 2 . that is , the communication terminals connected to the lans 1 and 2 have private accounts , respectively , as will be described later . therefore , the communication terminals on the respective lans 1 and 2 designate the mutual private accounts in order to carry out communications with each other . however , communication data such as a sip command for designating such a private account is encapsulated while being transmitted through the path between the relay servers 13 and 23 and then is sent to one of the relay servers 13 and 23 . upon reception of the communication data , the relay server 13 or 23 extracts the sip command , and then sends the communication data for designating the private account to the relevant communication terminal . fig4 illustrates a functional block diagram of the sip - server 4 . as illustrated in fig4 , the sip - server 4 includes a wan interface 41 , a communication controller 42 and a relay server account information database 43 . the wan interface 41 uses a global ip address to carry out communications between the server and the terminal each connected to the internet 3 . the sip - server 4 can carry out communications with the relay servers 13 and 23 through the wan interface 41 . the communication controller 42 is a processor for controlling various communications carried out through the wan interface 41 . the communication controller 42 controls communication processing according to a protocol such as a tcp / ip , a udp or a sip . the communication controller 42 has a function of receiving an account registration request ( register ) from the relay server connected to the internet 3 , and registering the account information of the relay server in the relay server account information database 43 . for example , the sip - server 4 receives the account registration request ( register ) from the relay server 13 , and registers the account information of the relay server 13 in the relay server account information database 43 . in addition , the communication controller 42 has a function of relaying various communication data such as a sip method and a response from one of the relay servers 13 and 23 to the other relay server . with reference to processing sequence diagrams in fig5 and 6 , description will be provided of a flow of the communication processing in the communication system configured as described above . fig5 illustrates a sequence from step s 1 to step s 7 , and fig6 illustrates a sequence from step s 8 , which is subsequent to step s 7 , to step s 11 . first , the relay server 13 sends an account registration request ( register ) to the sip - server 4 ( step s 1 ). as illustrated in fig5 , herein , the relay server 13 makes a registration request of an account ( sip : relay server1 @ sip . srv ) thereof . the sip - server 4 sends back an ok response to the relay server 13 , and registers the account of the relay server 13 in the relay server account information database 43 while bringing the account of the relay server 13 into correspondence with the global ip address of the relay server 13 . if password authentication is used , a password that has been previously registered in the relay server account information database 43 is brought into correspondence with the account of the relay server 13 . in such a case , a user sends the password when the relay server 13 makes the registration request . if the password is successfully authenticated , the account is registered while being brought into correspondence with the ip address . next , the relay server 23 sends an account registration request ( register ) to the sip - server 4 ( step s 2 ). as illustrated in fig5 , the relay server 23 makes a registration request of an account ( sip : relay server2 @ sip . srv ) thereof . the sip - server 4 sends back an ok response to the relay server 23 , and registers the account of the relay server 23 in the relay server account information database 43 while bringing the account of the relay server 23 into correspondence with the global ip address of the relay server 23 . similarly , the password authentication may be performed here . next , the communication terminal 11 sends an account registration request ( register ) to the relay server 13 ( step s 3 ). as illustrated in fig5 , the communication terminal 11 makes a registration request of an account ( sip : 0001 @ privatesip1 ) thereof . the relay server 13 sends back an ok response to the communication terminal 11 , and registers the account of the communication terminal 11 in the local account information database 104 while bringing the account of the communication terminal 11 into correspondence with the local ip address of the communication terminal 11 . if password authentication is used , a password that has been previously registered in the local account information database 104 is brought into correspondence with the account of the communication terminal . in such a case , a user sends the password when the communication terminal makes the registration request . if the password is successfully authenticated , the account is registered while being brought into correspondence with the ip address . next , the communication terminal 21 sends an account registration request ( register ) to the relay server 23 ( step s 4 ). as illustrated in fig5 , the communication terminal 21 makes a registration request of an account ( sip : 0002 @ privatesip2 ) thereof . the relay server 23 sends back an ok response to the communication terminal 21 , and registers the account of the communication terminal 21 in the local account information database 104 while bringing the account of the communication terminal 21 into correspondence with the local ip address of the communication terminal 21 . similarly , password authentication may be performed here . next , the communication terminal 12 sends an account registration request ( register ) to the relay server 13 ( step s 5 ). the relay server 13 registers an account ( sip : 0003 @ privatesip1 ) of the communication terminal 12 in the local account information database 104 while bringing the account of the communication terminal 12 into correspondence with the local ip address of the communication terminal 12 . thus , the registration of the accounts of the relay servers 13 and 23 in the sip - server 4 is completed , and the registration of the accounts of the communication terminals 11 , 12 and 21 in the relay servers 13 and 23 is completed . next , the relay server 13 sends a connection request command ( invite method ) for the relay server 23 to the sip - server 4 ( step s 6 ). in this invite method , the relay server 13 designates the account ( sip : relay server2 @ sip . srv ) of the relay server 23 which receives the connection request . the sip - server 4 refers to the relay server account information database 43 , thereby acquiring the global ip address of the relay server 23 . then , the sip - server 4 relays the invite method from the relay server 13 to the relay server 23 . as described above , when the relay server 13 sends the connection request command to the relay server 23 , the relay server 23 sends back an ok response to the relay server 13 via the sip - server 4 . thus , a tunneling session is established between the relay servers 13 and 23 by acceptance of the connection request command ( step s 7 ). the aforementioned processing from step s 1 to step s 7 is typically performed by an operator during the initial set - up of a network . the operator performs an operation of registering in the sip - server 4 a relay server on a lan which is intended to be connected through the internet 3 . moreover , the operator performs an operation of registering in the relay server a communication terminal which is intended to carry out communications through the internet 3 . next , as shown in fig6 , the relay server 13 sends local account information la 1 to the relay server 23 by a message method ( step s 8 ). the message method preferably is directly sent to the relay server 23 via no sip - server . alternatively , this communication may be carried out via the sip - server 4 . the sequence diagram in fig6 illustrates details of the local account information la 1 transferred in step s 8 . the local account information la 1 contains information about a communication terminal which is connected to the lan 1 having the relay server 13 placed thereon and which performs account registration on the relay server 13 . as described with reference to the sequence in fig5 , in this state , the communication terminals 11 and 12 perform account registration on the relay server 13 ; therefore , the local account information la 1 contains the account information of the communication terminals 11 and 12 . upon reception of the local account information la 1 , the relay server 23 registers the received information in the local account information database 104 thereof . however , the received account information is registered while being brought into correspondence with the account information of the relay server 13 which sent the account information . in such a case , each of the account ( sip : 0001 @ privatesip1 ) of the communication terminal 11 and the account ( sip : 0003 @ privatesip1 ) of the communication terminal 12 is registered while being brought into correspondence with the account ( sip : relay server1 @ sip . srv ) of the relay server 13 . next , the relay server 23 sends local account information la 2 to the relay server 13 by the message method ( step s 9 ). the message method preferably is directly sent to the relay server 13 via no sip - server . alternatively , this communication maybe carried out via the sip - server 4 . the sequence diagram in fig6 illustrates details of the local account information la 2 transferred in step s 9 . the local account information la 2 contains information about a communication terminal which is connected to the lan 2 having the relay server 23 placed thereon and which performs account registration on the relay server 23 . the relay server 13 registers the information in the local account information database 104 thereof . in such a case , the account ( sip : 0002 @ privatesip2 ) of the communication terminal 21 and the account ( sip : relay server2 @ sip . srv ) of the relay server 23 are registered in the local account information database 104 while being brought into correspondence with each other . thus , the relay server 13 and the relay server 23 exchange the local account information la 1 and the local account information la 2 with each other , and register the acquired information in the local account information databases 104 thereof , respectively . the communication terminals 11 and 12 connected to the lan 1 access the relay server 13 , thereby referring to the local account information database 104 of the relay server 13 . for example , the users of the communication terminals 11 and 12 can refer to the contents of the local account information database 104 through an operation of referring to an address book . similarly , the communication terminals 21 and 22 connected to the lan 2 can refer to the local account information database 104 of the relay server 23 . next , it is assumed herein that the user of the communication terminal 11 must carry out communications with the communication terminal 21 . the user of the communication terminal 11 accesses the relay server 13 to refer to the address book . then , the user designates the account ( sip : 0002 @ privatesip2 ) of the communication terminal 21 to execute the communication processing with the communication terminal 21 . thus , the communication terminal 11 sends to the relay server 13 a sip command addressed to the communication terminal 21 ( step s 10 ). upon reception of the sip command which designates the communication terminal 21 as an address account , the relay server 13 refers to the local account information database 104 , and specifies a relay server in which the relevant address account is registered . in this case , the account of the communication terminal 21 is registered while being brought into correspondence with the relay server 23 ; therefore , the relay server 23 is selected as a relay . thus , the relay server 13 receives the sip command from the communication terminal 11 , and then directly transfers the sip command to the relay server 23 via the tunneling session ( step s 10 . 1 ). further , the relay server 23 receives the sip command from the relay server 13 , and then transfers the sip command to the communication terminal 21 ( step s 10 . 1 . 1 ). through the aforementioned procedure , the sip command sent from the communication terminal 11 is transferred to the communication terminal 21 . upon reception of the sip command from the communication terminal 11 , the communication terminal 21 sends back a sip response to the communication terminal 11 . this response is directly transferred from the relay server 23 to the relay server 13 via the tunneling session again , and further is transferred to the communication terminal 11 via the relay server 13 . when the user of the communication terminal 12 must carry out communications with the communication terminal 21 , the aforementioned processing is performed similarly . when the user of the communication terminal 12 executes communication processing which designates the account ( sip : 0002 @ privatesip2 ) of the communication terminal 21 , the communication terminal 12 sends to the relay server 13 a sip command addressed to the communication terminal 21 ( step s 11 ). upon reception of the sip command which designates the communication terminal 21 as an address account , the relay server 13 refers to the local account information database 104 , and specifies a relay server in which the relevant address account is registered . also in this case , the account of the communication terminal 21 is registered while being brought into correspondence with the relay server 23 ; therefore , the relay server 23 is selected as a relay . the relay server 13 receives the sip command from the communication terminal 11 , and then directly transfers the sip command to the relay server 23 via the tunneling session ( step 11 . 1 ). further , the relay server 23 receives the sip command from the relay server 13 , and then transfers the sip command to the communication terminal 21 ( step s 11 . 1 . 1 ). in response thereto , the communication terminal 21 sends back a sip response to the communication terminal 11 . this response is directly transferred from the relay server 23 to the relay server 13 via the tunneling session again , and further is transferred to the communication terminal 11 via the relay server 13 . as described above , the use of the communication system according to this preferred embodiment allows the communication terminal on the lan 1 to carry out communications with the communication terminal on the lan 2 , through the internet 3 . according to this preferred embodiment , the sip - server 4 connected to the internet 3 does not necessarily control the accounts of all the communication terminals connected to this communication system in a collective manner . it is sufficient that the sip - server 4 controls only the accounts of the relay servers . in the aforementioned processing , it is sufficient that the sip - server 4 controls the account information of the relay servers 13 and 23 . accordingly , the accounts can be controlled in a distributed manner , which makes it possible to lessen a load imposed on the sip - server 4 . the account information sent to the respective lans are not collectively controlled by the sip - server 4 , but are controlled by the relay servers on the respective lans . then , the relay server which controls the account information sent to each lan carries out communications with another relay server through the sip - server to exchange the account information held thereby with the another relay server . thus , the communication terminal on each lan can acquire the account information of the communication terminal on another lan via the relay servers on the respective lans . further , the communication system according to this preferred embodiment has a feature in that the relay server controls the account information acquired from another relay server while bringing the account information into correspondence with the account information of the relay server which sends the account information . in the processing described with reference to fig6 , for example , the relay server 13 acquires from the relay server 23 the account information of the communication terminal connected to the lan 2 . the relay server 13 controls the acquired account information while bringing the account information into correspondence with the account information of the relay server 23 . according to the communication system , therefore , the communication terminal can obtain an account freely in each lan . that is , when a unique account is provided to a communication terminal in each lan , there is no possibility that identical accounts are provided to different lans . this is because the account of the relay server is controlled by the sip - server 4 so as to be unique . thus , the accounts of all the communication terminals may not be collectively controlled in the entire communication system , which makes it possible to reduce a burden in account control . in the sequences illustrated in fig5 and 6 , different domains are allocated to the communication terminals 11 , 12 connected to the lan 1 and the communication terminal 21 connected to the lan 2 . as described above , alternatively , the account can be freely set for each lan . therefore , there arises no necessity of identifying a domain name uniquely . as described above , in addition , the communication system according to this preferred embodiment relays communication data between the communication terminals in an application protocol layer which is higher in order than the tcp / ip . in this preferred embodiment , that is , each of the relay servers 13 and 23 relays communication data between the communication terminals in a sip layer . this allows communications between different lans using an existing network system . while the present invention has been described with respect to preferred embodiments thereof , it will be apparent to those skilled in the art that the disclosed invention may be modified in numerous ways and may assume many embodiments other than those specifically set out and described above . accordingly , it is intended by the appended claims to cover all modifications of the present invention that fall within the true spirit and scope of the present invention . | 7 |
referring to fig1 , in an example embodiment of the disclosure , a plan view of a stator 100 for use in an electrically driven motor or a rotating generator , has a planar composite structure ( pcs ) 110 with at least one dielectric layer and a plurality of substrate layers having conductive traces 111 thereon . the diameter of the stator shown in fig1 can be on the order of cm to tens of meters . conductive traces 111 can be part of a winding structure in accordance with an embodiment of the disclosure that can be connected at the outer annulus and inner section of a pcb structure . pcs 110 is characterized at least in part by a center origin point 101 and an outer periphery 102 . stator 100 includes a plurality of first conductive traces 111 extending radially from a radius 140 ( r 0 ) ( measured from the center origin point 101 ) to a radius 142 ( r 1 ) ( measured from center origin point 101 ) toward periphery 102 of pcs 110 and disposed angularly on the pcs . one or more of the first conductive traces are connected at their outer end , at radius r 1 , to typically one or more other of the first conductive trace ( s ) at its outer radius r 1 . such an interconnect , designated as an outer loop , has a starting region 144 , a transition region 148 , and an ending region 150 . in a complementary manner , a plurality of the conductive traces are connected at their inner ends , at radius r 0 , by inner conductive loops 151 , each inner conductive loop similarly having a starting region , a transition region , and an ending region . in this manner , the combination of conductive traces 111 , and their connecting structures , provide for a winding structure on the surface ( s ) of the dielectric layer ( s ). in more complex structures , the conductive traces 111 can be connected to conductive traces on other layers using interior layer connections such as vias or other interior layer links . in these interlayer connections , the combination of the conductive traces on each of , for example , two ( or more ) layers combine to form an advantageous structure of multilayered windings as is well known in the field . there is a concern , however , that the current passing from one conductive trace 111 to the next conductive trace does not create electromagnetic fields which may damage or reduce the efficiency of the operating system of the motor or generator . such negative effects can result , for example , in parasitic currents or eddy currents in nearby electrically conductive structures which can act as a drag on the system . as is explained further below , such drag reduces efficiency , and is not typically considered in the structural design of the motor or generator of fig1 . however the present disclosure is directed to reducing substantially , by proper shaping and design of the interconnecting end loops 151 , 153 , such undesirable electromagnetic fields . thus , a stator 100 may include multiple layers similar to the one illustrated in the planar view of fig1 . the multiple layers may be arranged to provide a sequence of coils or windings that are connected , usually in series , to form the poles of a motor or generator . the poles are then typically segregated into groups , with at least one group for each phase of current supplied to the motor ( or generated by the generator ). collectively , when properly controlled by an external electric circuit , the arrangement of conductors ( for example , traces 111 , and interconnecting conductive traces 151 and 153 in pcs 110 ) creates a rotating current density and associated magnetic field . this rotating current density ( and magnetic field ) can exert a torque on a surrounding magnetic structure ( for a motor ) or generate a current output ( for a generator ). the part of the printed circuit board with the radial structures 111 ( the “ active area ”) is the part of the stator designed to participate in this interaction . accordingly , the active area of stator 100 may include conductive traces 111 coupled through interconnecting conductive traces 151 and 152 to form the rotating current . some embodiments include two sets of rare - earth magnets fixed to a shaft passing through the center origin point 101 of pcs 110 , which forms a compact , high - efficiency axial field synchronous electric device . in addition to the active area including a rotating current density that interacts with an inhomogeneous magnetic field , stator 100 may include conductive elements in a peripheral area and conductive elements in an interior area . conductive elements and can dissipate heat generated by stator 100 , while in operation . in accordance with the structure of the disclosure , a planar pcb , for example , for a rotary electrical motor or generator , has inner , outer , and neutral end - turn structures which are shaped to optimize stator performance . in a planar pcb motor stator , or planar composite stator ( pcs ), the end turn design is of critical importance for the simple reason that end - turns serving different roles in the winding plan usually cannot co - exist on a single layer , and also cannot appear on a large number of layers as a method of reducing their total resistance . another consideration for end - turns is that they are in close proximity to other conductive materials , for example , other structures on the same or adjacent layers , which can lead to eddy currents and parasitic loads at high frequencies . the present disclosure addresses both issues , and can be compared to other design strategies and structures through use of finite element measurements ( fem ). the use of “ end - turn ” in the following description should be understood to include similar features in inner and outer end turns , in links between pole groups , in cross - layer links , power connections , and in neutral tie - point structures . it is also important to recognize that while a major use of the technology disclosed herein is for no tears and generators , the application of the technology to any printed circuit board , single layer or multilayered , can be advantageous for reducing losses in the circuit . it is also important to note that within the motor / generator field , the number of end turns and their function will vary depending upon the number of phases , turns , and the poles for the motor . as noted above , an inner or outer end turn has several connected regions . the basic functional part of an end - turn is a corner , a region that connects electrical current from an active region radial conductor or trace to a prescribed radius after the turn or corner is executed , typically changing the direction of the current on the planar surfaces from a substantially radially directed current to an angularly directed current . often , the turn connects to a narrow width radial trace at its beginning connection point , the width of the radially directed trace being dictated by the spacing of conductors in the active region of the plane and the space available for the angular part of the turn . for purposes of illustration , and because the feature under consideration is approximately ( locally ) cartesian , the angular travel in the embodiments that follow is indicated on the x - axis , while the radial travel is indicated on the y - axis . there is a conformal map between this case and the cylindrical coordinate case directly applicable to the pcs for axial field machines . to explore the relationship between structure or shape of the end turn design , and its performance , fem simulations of several example designed structures and examples from earlier designs are described with the condition that each structure carry exactly the same total current . plots of current density magnitude within a structure were subsequently produced from the fem solution , and are illustrated in fig2 - 4 . the scales in these plots are adjusted so that they can be compared . it should be appreciated that in the black - and - white versions of the color drawings presented herein ( i . e ., fig2 a , 3a , 4a , 10a and 11a ), the darker regions do not necessarily correspond to higher current density regions in the fem solutions and the lighter regions do not necessarily correspond to lower current density regions in those solutions . this is true because the red and blue regions near the top and bottom , respectively , of the scales for the colored versions both copied as a darker color in the black - and - white versions . accordingly , it is helpful to consider the grayscale versions of the fem solutions ( i . e ., fig2 b , 3b , 4b , 10b and 11b ) in conjunction with the black - and - white copies of the colored versions of those solutions to better understand the relative current densities in the various regions . it is common for prior printed circuit board cad packages to merge lines of different widths with square corners , as illustrated in fig5 . end turns with corners drawn this way appear , for example , in u . s . pat . no . 7 , 109 , 625 . an adverse consequence of this structure , as shown in the fem produced current density map in fig2 a and 2b , is that the current is concentrated significantly at the inner corner 250 of the inner edge section 251 of the end turn . this creates a concentration of current , and hence energy loss at the inner edge corner , and the current is essentially zero at the outer corner edge 252 . the concentration of current at the inner edge corner leads to a much stronger magnetic field h ( amperes per meter , or a / m ) in the immediate vicinity of the inner edge corner . the outer corner copper serves essentially no function in the conductivity of the structure , but by virtue of proximity to the high current density at the inner corner edge and other current sources on the pcs , may present an undesirable parasitic secondary to time - varying magnetic fields from such other sources . further , the inner corner concentrates current and produces a magnetic field that may undesirably interact with other structures in the pcs . collectively these effects lead to increased losses at higher frequencies , as well as a relatively higher resistance for the amount of copper used ( because the copper at the outer edge of the corner carries substantially no current , as noted above ). the actual end - to - end conductivity of the structure in fig5 varies in a predictable fashion as a function of material conductivity , thickness , and scale . for purposes of comparison and to emphasize the importance of end - turn corner shape independent of these other variables , the conductivity of the structure in fig5 is designated as 1 . 000 . it is important to note , for the fig5 shape / structure , that while the current entering the starting region 254 of the end turn is substantially uniform across the entire cross - sectional extent of the trace , in making the sharp turn it tends to congregate inward . another common practice in cad tools is to provide the option of merging lines with the application of a specified constant turning radius at the turn . often the radii at the inner radiused corner 642 and outer radiused corner 645 used to replace the sharp corner of fig5 are chosen based on the widths of the lines to be merged . the geometry of the corner illustrated in fig6 shows this type of end turn corner . note that in fig6 , there are 3 nested end loops 635 . in this case , the inner and outer radii for inner edge 640 and outer edge 650 are the same as the radius of the aperture used for the vertical trace segment . the operation of the structure illustrated in fig6 is improved relative to the structure illustrated in fig5 ( as shown by the fem simulation of fig3 a and 3b ), although the fig6 structure / shape still shows current concentration near the inner corner edge , and some copper at the outer corner edge still does not carry significant current . the conductivity of the structure illustrated in fig6 relative to fig5 is 1 . 046 . the structure of fig6 therefore provides less resistance loss ; however , the current density is still undesirably high at the inner corner edge resulting in the same undesirable effects noted in connection with the structure of fig5 , albeit at slightly lower levels . an example embodiment described herein thus recognizes the need to obtain a further reduction from the high current densities of the earlier structures illustrated in fig2 and 5 , and fig3 and 6 , to determine a design shape and function which significantly reduces the concentration of current density along the inner corner , and specifically the inner corner edge , with the consequent reduction of the negative effects resulting from the high concentration of current density illustrated in fig2 and 3 . referring to fig7 , the end - turn structure illustrated there is bounded by its inner and outer edges , and corresponds to a local solution of a first - order differential equation in x and y ( or r and θ ). this example and preferred embodiment , corresponding to a single - variable parameterization of a continuous transition from the starting width and location 710 of the end - turn corner 712 , through the corner , to the x or theta directed portion 714 of the end turn . the smooth transition described in more detail below avoids the localized concentration of current in the corner transition found in the fig5 and 6 examples and does not tend to concentrate the current density in the turn . accordingly the undesirable magnetic fields produced by earlier structures ( fig5 and 6 ) are minimized . the parameterization of the turn provides an independent variable that can be used for optimization purposes in different designs . as illustrated in fig4 , this end turn design avoids concentration of current density and magnetic field and has a relative conductivity of 1 . 197 , almost 20 % higher than the end - turn structure illustrated in fig5 . further , in one particular example embodiment of the disclosure , the inner and outer edges can be shaped in accordance with the so - called “ corner equation ”: r ( θ ) = r d + ( r s - r d ) e - θ - θ s α for a corner starting at θ s and r s and evaluated for θ & gt ; θ s , or the equivalent reflected version with r ( θ )= r d +( r s − r d ) e −( θ s - θ )/ α for a corner evaluated with θ & lt ; θ s and ending at θ s and r s . this equation provides for a gradual change of the radius of curvature along the edges and is controllable by a single parameter , α , selected depending upon the beginning and end points of the edge . in a preferred embodiment , the slope is a continuously changing variable having a zero second derivative . this is equivalent to saying that the radiused edge is characterized by a slope , which is a linear function of r from the starting point , ( the intersection between the starting region and the conductive trace ) to the transition region and that the slope is a different linear function from the transitional region to the end of the ending region . the entire loop edge structure can be described from initiating trace 111 to final trace 111 by a single equation : r ( θ ) = r s 1 + ( r d - r s 1 ) ( 1 - e - θ - θ 1 α ) + ( r s 2 - r d ) ( e - θ 2 - θ 0 α ) where r s1 , θ 1 is the starting point of the structure at the initiating trace 111 , r s2 , θ 2 is the ending point of the structure , α is the parameter of the corners , and r d is the radius at which the structure extends primarily in the angular direction . the avoidance of a concentration of current density in the loop ( inner or outer ) can be viewed by measuring the current density along the inner edge of a loop in the starting region . typically , the current density measurement will be higher in the beginning of the starting region where it connects to a conductive radial trace , and lowest at the inner edge at the intersection of the starting and transition regions . if the inner edge section of the interconnect from the connection between the first conductive trace and the starting region to the beginning of the transition region is designated the “ ct inner edge ” distance , then in an example embodiment , the current density achieves at least 90 % of the maximum current density value , as determined by fea / fem calculations , within the first 20 % of the ct inner edge measured along the inner edge of the interconnect from the first conductive trace toward the transition region . this differs substantially from the structures of fig5 and 6 wherein the peak occurs much further away from the radial conductor at a location which more likely adversely effects parasitic and eddy currents in nearby conductors . as noted above , the distance of a conductor to a source of electromagnetic radiation can significantly affect the strength of the electromagnetic field impinging on the conductor and its adverse consequences . this “ proximity ” effect is the tendency for a current in an adjacent conductor to influence the distribution of current in a primary conductor , and vice versa . this effect results in a change of current distribution in the primary conductor as well as losses in both conductors , and is apparent as an increase in the electrical resistance of the primary conductor as the current frequency increases . a closely aligned concept is : the tendency of a conductive material that is not part of the circuit at dc to become a parasitic “ secondary ” due to a current density induced by a time varying current in the primary conductor . this effect increases as ( i ) the frequency goes up , ( ii ) the strength of the magnetic field increases , and ( iii ) as the proximity of the parasitic conducting material to the primary decreases . these considerations mitigate in favor of both reducing the concentration of the electromagnetic field , for example , by using the example corner shape structure illustrated in fig7 , and reducing the proximity of the conductor where possible to adjacent conductors . in a preferred example embodiment of the disclosure , the “ corner equation ” specified hereinafter helps ameliorate both of these effects . for either of the equations above , the parameter α determines the rate at which the end turn will approach its essentially constant radius , angularly directed , portion of the stator structure ( the transition region ). an important consideration is that the corner needs to avoid interference with nearby structures . if the nearby structures are nested corners , such as those described by the corner equation and illustrated at 153 in fig1 , the outer edge of an inner end turn must be less than the “ constant ” radius of the inner edge of the adjacent outer end turn . further , large values of α , may produce interference or minimum clearance violations with adjacent structures on the printed circuit board , such as termination structures that are not governed by the corner equation . with these considerations in mind , the determination of a suitable value of α can be inferred from the angular displacement ( designated as δ ) of two adjacent radial traces 111 such as those shown in fig1 . in a typical stator , having for example , 120 radial traces , the angular separation δ may be , for example , on the order of 3 ° ( or 2π / 120 radians ) or less . further , while a minimum fabrication clearance will factor into a precise calculation of the largest possible α for a given design , it is undesirable to use an a that is too large since the width of the complete end turn structure may be reduced , with the effect of increasing dc resistance of the structure . on the other hand , setting α to values that are too small , for example less than 0 . 1δ , effectively produces a square corner shape and reduces the advantages identified herein . accordingly , a potential “ range ” for α where the angular separation between adjacent radial traces is , for example , between about 0 . 2δ and 0 . 06δ radians . in addition to the corner equation described above , there are other descriptions of forming and shaping the corner of an end loop or trace which also ameliorate the effects seen when the corner is “ sharp .” thus , for example , as described above , and in the context of an end loop as described above in connection with , for example , and loop 714 illustrated in fig7 , the first radiused inner edge section and the second radiused inner edge section of the endloop in the starting and ending regions of the loop can each characterized by a slope dr / dθ which is a linear function of r ( θ ) from a first conductive trace to the transitional region and where the slope is a different linear function from the transitional region to the conductive trace to be connected . in another description of the forming and shaping of the corner of in the end loop , one can select any point between the inner and outer edge of the loop , and shape the loop , so that the smallest current density magnitude under direct current excitation at that point is not less than 50 % of the largest current density magnitude evaluated along the shortest line between the inner and outer edge of the loop and passing through that point . this approach accordingly also reduces the adverse effects of aggregated current density . in yet another description for forming and shaping the corner of an end loop , the respective slope of the first radiused inner edge section and the second radiused inner edge section of the loop are each characterized by a monotonically changing value of slope as a function of the rotational angle from the one conductive trace to the conductive trace to be connected . this also reduces induced currents by reducing the aggregated current density at the corner . in yet another approach to reducing aggregated current density , an example embodiment achieves at least 90 % of the maximum current density value , as determined by fea / fem calculations , within the first 20 % of the ct ( as defined above ) inner edge measured along the inner edge of an interconnect from the first conductive trace toward the transition region . in practical stator designs , out - of - plane structures may also form parasitic secondary elements . fig8 shows a greatly expanded ( in the z - axis ) rendering of a motor stator stack up . in actual construction , the spacing between copper would be roughly the same as the copper thickness . this illustrates the considerable complexity of the notion of “ proximity ”, which can vary based on stator design parameters such as pole count , number of turns , etc . accordingly , as shown in the figure , conductive surfaces can be staggered in groups ( groups of three as shown in fig8 are but one example configuration ), in structure , and in function in order to maintain the necessary efficiencies of the overall device . thus , for example , all of the outer loops will not align for the full height of the stacked layers of the motor / generator stator , and advantages will be obtained in reduced electromagnetic fields generated at other than the active area of a board . referring to fig9 , an end turn loop 700 has an interconnecting trace which is split longitudinally into two or more parallel paths 704 for most of its length . the longitudinal split ( s ) have little effect on end - to - end conductivity , but does change the way in which time - varying flux is linked by the structure . the resulting current density induced in the end - turn segments separated by the slit ( s ) 706 ( caused by narrow elongated region ( s ) of substantially no or zero electrical conductivity ) is illustrated in fig1 and 11 by a simulation , using the same conditions , so that the effects can be compared across different embodiments , both in shape and magnitude . further , the effect of the slits is to prevent a substantial increase in current density often seen when no slit or fewer slits are used . the fem result displayed in fig1 shows a substantial effect of induced current caused by an external time - varying field at the origin 1004 of elongated trace 1002 . the induced currents are particularly large at the origin , and the surface regions 1006 and 1008 vertically aligned with the origin . note that the longitudinal slit 706 in fig1 , given a particular radial clearance for the end turn , necessarily reduces the cross - sectional area and therefore increases the dc resistance of the end - turn segment . further , the width of the slit is dependent on the copper thickness , which determines the minimum feature size achievable using the photoresist / etch process by which printed circuit boards are made . thus , the number of slits in any given design is dependent on the flux leakage , other db / dt sources , radial clearance for end turns , and the operating speed of the motor or generator design . advantageously , however , as illustrated in fig1 , the existence of these novel slits can substantially reduce induced current distributions in end turn , link , neutral , power connection , and similar features in a stator design , at both the origin and at the aligned surface regions . the physical extent of the effect of the induced current is also reduced . a design consideration in stator 100 involves a trade - off between conduction and eddy current losses in the stator active area . to reduce conduction losses , the conductors must be wider ( or connected in parallel on subsequent layers ). to reduce eddy current losses , the effective areas capturing time - varying flux must be smaller , thus the conductors must be narrower . a third heat source involves eddy currents due to the magnetic field from current carrying conductors . this effect is important to consider in the inner and outer regions of the pcb , where different layers may perform different functions . fig1 illustrates a partial cross - sectional view of stator 100 , according to some embodiments . without limitation and for illustration purposes , a “ z ” axis is shown in the direction of the stacking of the different layers in stator 100 , and a perpendicular axis ‘ r ’ is shown along its cross section . as seen , stator 100 may include a dielectric substrate 162 sandwiched between conductive layers 161 a and 161 b . vias 125 provide electrical conductivity between conductive layers 161 a and 161 b . in addition , a via ( or vias ) 125 , which is electrically conducting , may also provide thermal conductivity between layers 161 a and 161 b due to the conducting material that is typically used in these elements ( e . g ., copper , aluminum , tin , tungsten , and derived compounds ). dielectric substrate 162 may include any material used in pcbs , such as a composite material including woven fiberglass with an epoxy resin binder ( e . g ., fr - 4 and the like ). as illustrated in fig1 , the non - crosshatched regions , that is , the clear regions , are electrically conductive and vias 125 extend through the substrate providing electrical contact from the traces on one surface to the traces on the opposite surface of the substrate . accordingly , in some embodiments , stator 100 includes at least one of conductive elements 111 , located on different conductive layers 161 a and 161 b . for example , conductive element 111 a may be one of the plurality of conductive elements 111 in the active area of stator 100 and disposed on conductive layer 161 a . correspondingly , conductive element 111 b may be one of the plurality of conductive elements 111 in the active area of stator 100 and disposed on a different conductive layer 161 b . fig1 illustrates a detail of stator 100 including a plurality of conductive elements 111 , disposed radially on pcs 110 , according to some embodiments . conductive elements 152 , the inner loops , are disposed angularly on pcs 110 and in this example embodiment , the outer loops are split along the slits 157 . the inner loops illustrated here are not split due to the limited space available closer to the center of the stator . in some embodiments , stator 100 further includes a plurality of third conductive elements extending radially from a radius greater than r 1 from center origin point 101 toward periphery 102 and disposed angularly on pcs 110 , wherein at least one of the third conductive elements and at least one of the second conductive elements are coincident but located on different conductive layers . for example , and without loss of generality , the third conductive elements may be included in conductive layer 161 a , and the second conductive elements 121 b may be included in conductive layer 161 b . in the illustrated embodiment of fig1 , the radial conductive traces 111 can terminate at a termination connector 191 at a distance 142 ( r 1 ) from center origin point 101 . these connectors are described in more detail in co - pending u . s . application ser . no . 15 / 199 , 527 identified and incorporated by reference above . fig1 illustrates a detail of an inner area proximal to center origin point 101 of stator 100 , including a plurality of conducting elements 111 disposed radially and conductive elements 151 disposed angularly on pcs 110 , according to some embodiments . due to the spatial constraints near center origin point 101 , in some embodiments only certain conductive elements 151 are electrically coupled to corresponding conductive elements 111 . this arrangement avoids making undesirable electrical contact between adjacent conductive elements such as those used to enhance thermal energy dissipation , near center origin point 101 . in addition , to address the issue of thermal and electrical conductivity in the highly constrained space of the inner area of pcs 110 , conductive elements such as end loops 151 can alternate or be staggered , with one end loop being on one layer of a multilayered pcs 110 and the other end loop being on an adjacent layer of pcs 110 . by staggering the end loops , in different conductive layers , they can extend inward while maintaining a desired clearance between adjacent conductive elements on the same conductive layer . other staggering configurations consistent with this feature may be envisioned , for example connecting every third or fourth conductive element through a via . the vias can extend not only between conductive layers on the surface of a single substrate , but across multiple layers as well . some embodiments include one or more vias between layers near the outer portions of termination structure 115 to provide electrical connection between layers . these vias are typically employed in interlink connections , and in particular in connection with the outer and inner loops , to provide the winding structures required by the device . these connections can employ multiple vias , or only one via , extending through multiple layers to enable the connections necessary for the required circuit . thus , the starting region of an inner or outer loop can be on a first layer , the ending region on a second layer , and the transition region can then include the interlink connections ( for example , a trace wire connecting to the starting region , a via or other interlayer connector , and a second connecting trace connecting to the ending region ). in this configuration , as in the configurations shown for example in fig7 , the traces of the starting region and the ending region will want to meet the terms of , for example , a corner equation . fig1 shows a perspective view of connection configuration 615 a , according to some embodiments . connection configuration 615 a includes conductive elements 111 a , b and 121 a , b in two different conductive layers ( e . g ., conductive layer 161 a and 161 b ), forming an electrical coupling at termination structure 115 . more specifically , connection configuration 615 a provides electrical coupling between conductive elements 111 a , b and conductive elements 121 a , b . fig1 illustrates a flow chart for a method 800 for manufacturing a stator including a planar composite layer ( pcs ) having at least one dielectric layer and a plurality of conductive layers , according to some embodiments ( for example , stator 100 , pcs 110 , dielectric substrate 162 , conductive layers 161 a , b ). methods consistent with the present disclosure may include at least some , but not necessarily all , of the steps illustrated in method 800 , and in some embodiments may be performed in a different sequence . furthermore , methods consistent with the present disclosure may include at least two or more steps as in method 800 performed overlapping in time , or almost simultaneously . step 802 includes forming a first conductive layer on the one surface of the pcs by radially disposing in accordance with the disclosure herein , first conductive elements on a dielectric substrate each starting from a first distance from a center origin point of the pcs and extending radially to a fixed outer radius . step 804 includes forming a second conductive layer on a side of the substrate opposite the first conductive layer , by disposing a second conductive elements extending radially from a prefixed distance from the center origin point of the pcs . step 806 includes forming a plurality of outer end loops in accordance with embodiments of the disclosure on both surfaces of the substrate , and coupling , in accordance with the disclosure herein , the first conductive elements to each other and to the second conductive elements through an interlink connection using the outer loops . step 808 includes forming a plurality of inner end loops in accordance with embodiments of the disclosure on both surfaces of the substrate , and coupling , in accordance with the disclosure herein , the first conductive elements to each other and to the second conductive elements through an interlink connection using the inner loops . in step 810 , vias or other between surface connections can be employed . in some embodiments , coupling the first conductive element with the second conductive elements may include a thermal coupling . furthermore , the coupling can include a connection configuration having interlink structures including vias that go through the dielectric substrate from one conductive layer to another , non - adjacent , conductive layer ( for example , using vias 125 ). one skilled in the art will realize the disclosure may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . the foregoing embodiments are therefore to be considered in all respects illustrative rather than limiting of the disclosure described herein . the scope of the disclosure is thus indicated by the appended claims , rather than by the foregoing description , and all changes that come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein . various aspects of the present invention may be used alone , in combination , or in a variety of arrangements not specifically discussed in the embodiments described in the foregoing and is therefore not limited in this application to the details and arrangement of components set forth in the foregoing description or illustrated in the drawings . for example , aspects described in one embodiment may be combined in any manner with aspects described in other embodiments . also , the invention may be embodied as a method , of which an example has been provided . the acts performed as part of the method may be ordered in any suitable way . accordingly , embodiments may be constructed in which acts are performed in an order different than illustrated , which may include performing some acts simultaneously , even though shown as sequential acts in illustrative embodiments . use of ordinal terms such as “ first ,” “ second ,” “ third ,” etc . in the claims to modify a claim element does not by itself connote any priority , precedence or order of one claim element over another or the temporal order in which acts of a method are performed , but are used merely as labels to distinguish one claimed element having a certain name from another element having a same name ( but for use of the ordinal term ) to distinguish the claim elements . also , the phraseology and terminology used herein is used for the purpose of description and should not be regarded as limiting . the use of “ including ,” “ comprising ,” or “ having ,” “ containing ,” “ involving ,” and variations thereof herein , is meant to encompass the items listed thereafter and equivalents thereof as well as additional items . | 7 |
referring now to the drawings and firstly to fig1 to 3 , the apparatus depicted therein comprises a plurality of reheating tubes 1 forming heat exchange passages , made of aluminum , each comprising a &# 34 ; downflow &# 34 ; or leading tubular element 2 and an &# 34 ; upflow &# 34 ; tubular element 3 , which are connected by a bottom elbow 4 . the leading tubular element 2 is connected to a pipe 5 leading to a supply of cryogenic or low - temperature fluid which is to be reheated via a coupling box 10 , whereas the tubular element 3 is connected directly to a pipe 6 for withdrawal of reheated fluid : the tubular elements 2 and 3 are suspended in such manner that they extend in substantially vertical manner , and flows of reheating fluid in the form of sheets 8 and 9 which are formed beforehand by top distribution devices 11 trickle all around and along these tubular elements which comprise external fins 7 . in this case , the coupling box 10 ( see fig2 ) has welded to it in extension of the leading element 2 , a jacket tube 12 having a constant wall thickness in a low section 12 &# 39 ; and increasing radially in a middle portion 12 &# 34 ;, with a constant internal diameter ; at the upper end , this jacket tube 12 is extended as far as 13 up to an end 14 for connection of the pipe 5 for the low - temperature fluid . all these elements are made of aluminum so that they may conveniently be welded to each other and to the tubular heat exchange element 1 . the end 14 has an internal bore 16 of small diameter into which is welded a pipe element 17 which leads into the greater width of the leading tubular element 2 . a heat insulation material 18 is situated between the pipe element 17 on the one hand and the jacket tube 13 - 12 and the top part of the tubular element 2 , on the other hand . the assembly which has been described is housed within a distribution well 20 comprising a ring of perforations 21 . this well 20 is secured on the distribution device 11 sheathing the tubular element 2 and its fins 7 with a small spacing , and the perforations 21 are situated at the top level of the portion 12 &# 34 ; of increasing wall thickness . in practice , and as will be apparent from the drawings , the trickling heating fluid which is intended to flow in sheets such as 8 and 9 along the &# 34 ; downflow &# 34 ; tubular elements 2 and &# 34 ; upflow &# 34 ; tubular elements 3 , comes from a supply of liquid 25 which , for its part is supplied by a source 25 &# 39 ;. in operation , the trickling heating fluid is transferred into a lower portion of the distribution well 20 in the form of a plurality of liquid jets or streams 26 coming from the supply 25 and formed starting from the perforations 21 . due to the system described , the cryogenic fluid flowing within the pipe 5 and the tube 17 to reach the leading tubular element 2 is radially insulted from the outside by the insulating material 18 . moreover , the substantial longitudinal frigorific flow which is generated substantially on the &# 34 ; downflow &# 34 ; side , to the level of the end 14 and travels downwards and flows down along the jacket tube 13 - 12 towards the tubular element 2 , is substantially deflected outwards radially at the point of the jacket tube 12 having a wall thickness increasing gradually towards the upflow side . as a matter of fact , in the middle portion 12 &# 34 ; which has a considerable wall thickness of the jacket tube 12 , at that point , the longitudinal frigorific flow undergoes a maximum transfer to the water which is present in the form of jets 26 in free and rapid gravitic flow . this maximum radial and outward heat transfer action derives on the one hand from the provision at the level of the jets 26 of a substantial excess wall thickness of the portion 12 &# 34 ; of the jacket tube 12 which provides an increased heat conduction in the radial direction , and on the other hand from a rapid flow of the water in free fall , which has the result of raising the heat exchange factor to its maximum value . this system thus allows of a deflection towards the jets of liquid 26 of a substantial part of the longitudinally flowing frigorific flow , which commensurately reduces the residual frigorific flow continuing its longitudinal travel within the section 12 &# 39 ; of lesser wall thickness and primarily towards the top section 2 &# 39 ; of the leading element 2 which is immersed in a separate supply 29 of water for distribution which is of substantially still nature and thus has a low heat exchange factor with respect to the wall of the tubular element 2 . without the arrangement described above , what would be observed would be the arrival of a substantial frigorific flow travelling in the wall longitudinally at the level of the part 2 &# 39 ; of the tubular element 2 surrounded by a stock of still water 29 which could not fail to cause harmful superficial freezing of the water at the level of the part 2 &# 39 ; since these freezing actions could affect the total stock of water 29 by extending radially , and could thus obstruct the heat exchange of the tube 2 - 3 . on the contrary , due to the arrangement described , control may be exercised in a very precise manner of the heat flow reaching the part 2 &# 39 ; of the leading element 2 since this heat flow is the sum of a longitudinally propagated residual heat flow and of a radially propagated heat flow which is small for its part , in view of the interpositioning of the insulating material 18 . moreover , it is possible by contrast in particular cases to effect a slight increase in the heat exchange coefficient between the part 2 &# 39 ; of the tubular element 2 and the supply of water 29 by imparting to the latter a degree of convection movement due to the presence of clearing holes 21 &# 39 ; formed at a low level within the distributing wall 20 , thus promoting a definite complementary intake of water coming direct from the principal supply 25 . as has been hereinbefore explained , the trickling water is formed into a trickling sheet on the outer finned surface of the downflow tubular element 2 and cools gradually as far as the lower extremity of this tubular element 2 , at which the trickling water is then drawn off at 30 together moreover with that provided by the trickling in counterflow on the &# 34 ; upflow &# 34 ; tubular element 3 . it may be observed that the risk of freezing of the trickling water is reduced distinctly at the level of this tubular element 3 , as the fluid which is being heated whilst flowing in the tubes 1 has had its temperature raised until it is close to that of the trickling liquid , so that the discharge of the heated fluid from the tubular element 3 may be performed without application of a coupling box such as described with reference to fig2 by means of an uncomplicated discharge pipe 6 , whilst the distribution device 11 however evidently allows of forming a uniform trickling sheet 9 as illustrated in fig3 . instead of making use of a heating tube whose intake end receives the unprocessed fluid which is to be reheated and whose discharge end delivers the fluid at the required reheat temperature ( or more specifically , a plurality of such tubes arranged in parallel and connected direct to inlet manifolds 30 and discharge manifolds 31 ), it is possible to organize the tubular elements in a particular number of combinations . referring to fig4 it will be apparent that a plurality of tubular elements 42a , 42b , . . . 42n , has all its tubes connected between an upper distribution manifold or header 50 and a lower connecting manifold 51 feeding another plurality 43a , 43b , . . . 43n of tubular elements , thereby forming a first multi - tubular module the upper end of which is connected via a manifold 52 to a second multi - tubular module formed by another plurality of tubular elements 44a , 44b , . . . 44n , the final module comprising a plurality of tubular elements 45a , 45b , . . . 45r and a plurality of tubular elements 46a , 46b , . . . 46s , feeding the heated liquid into a final manifold 52 &# 34 ;. according to fig5 mono - tubular modules such as those described with reference to fig1 each comprising a downflow tubular element ( 54a , 54b , . . . etc . . . . ), are supplied at their top extremity via a common feed manifold 55 and are joined by separate connections 58a , 58b , . . . to an upflow tubular element ( 56a , 56b , . . . etc . . . . ), the latter themselves being connected at their upper extremities to a common discharge manifold 57 . according to fig6 several lines 61 and 62 , such as those depicted in fig4 that is to say each incorporating several multi - tubular modules 63 , 64 . . . 63 &# 39 ;, 64 &# 39 ; . . . in series , are connected in parallel between a principal intake manifold 68 and a principal discharge manifold 69 . according to fig7 several lines 70 , 71 , each comprising several multi - tubular modules 72 , 73 . . . 72 &# 39 ;, 73 &# 39 ; . . ., are not only connected between a principal supply manifold 74 and a principal discharge manifold 75 , but intermediate balancing manifolds connect the homologous modules of several lines in parallel . according to fig8 a cluster of tubular elements is formed by a first set of lines 81a , 81b , 81c ( three for example ) comprising a multi - tubular module ( or several multi - tubular modules in series ) between a feed manifold 83 and an intermediate manifold 84 which supplies a second set of lines 82a and 82b ( two for example ) between this intermediate manifold 84 and the final discharge manifold 85 . according to fig9 a first group comprising a plurality of lines 91a , 91b , 91c ( three for example ) supplied via a feed manifold 93 and drained via a discharge manifold 95a , is connected via a pipe 96 having a relief valve 97 to a second group comprising another plurality of lines 92a , 92b connected between a feed manifold 95b and a discharge manifold 94 . this system may be applied , for example , if the grid pressure is 40 bars and the gas is available under higher pressure , for example 80 bars , and it will be observed that this delayed expansion which brings about a frigorific i . e . chilling release does not harm the piping since the natural gas is then in the already partially reheated condition . if applicable , a separator may be situated at the outlet of the release valve 97 , which renders it possible to draw off and eliminate the heavier condensates , such as ethane , propane or butane , whilst the gaseous fraction alone is being reheated . the invention is applicable in particular for the reheating and the revaporization of liquified natural gas . | 5 |
fig2 through 9 illustrate the system of the present invention as viewed by a seller accessing the purchaser &# 39 ; s website . as shown in fig2 the “ home ” page contains simple instructions to the seller on how to use the site 202 , and links to additional information about the purchaser , and terms and conditions regarding the purchase of used cds 204 . after reading the instructions , the seller begins by initiating a search for a particular group , artist , or cd title . in the example illustrated in fig2 the seller has entered the artist name “ nascimento ” 206 , and then clicks the “ search ” button 208 . the basic information used to create the cd database is obtained from a commercial source , such as that at ftp :// bbs . pconestop . com / catalogs , which is then modified or updated as required by the purchaser . fig3 shows the results of the seller &# 39 ; s search . the search engine on the purchaser &# 39 ; s site has identified three matches to the name “ nascimento ”; the seller proceeds by clicking on the appropriate name ( for purposes of the example , “ milton ”) 302 . the search engine on the purchaser &# 39 ; s site then presents the seller with a list of all cd titles for the selected group or artist , as shown in fig4 . the seller selects the appropriate title ( for purposes of the example , “ miltons ”), 402 . next , the seller is asked to quantify the condition of the cd , as shown in fig5 . the seller is presented with a ranked list of conditions , such as “ fair ”, “ good ”, and “ excellent ”; a short descriptive narrative 502 next to each rank aids the seller in assigning the appropriate rank to the cd . for example , if the cd surface has “ a small light scuff / mark or two ”, the seller assigns a rank of “ good ”. based upon the database list price of the cd and the condition ranking , the purchaser site software computes an offer value for the individual cd , but does not display the individual offer price to the seller . the use of seller - ranking of the condition of the cd is an significant feature of the present invention . fig6 illustrates the “ quote ” presented to the seller after the entry of one cd title . it may be observed in fig6 that no offer price is displayed for the single cd . the seller repeats the above process for each cd the seller wishes to sell . fig7 illustrates an example where the seller has entered a total of four cd titles . since the seller is required to enter more than a minimum number of cds to obtain a quote ( in the example illustrated the seller must enter six or more cd titles ), fig7 like fig6 does not show a quote price . fig8 illustrates the “ quote ” presented to the seller when the minimum number of cds has been entered . a “ get quote ” button 802 appears , permitting the seller to obtain a total quoted price on the cds entered . alternatively , the seller may continue entering cd titles , or may remove one or more cd titles already entered . while the seller must enter more than a specified minimum number of cd titles to obtain a quote , no upper limit is placed on the number of cd titles which may be entered . if the seller selects the “ get quote ” button in fig8 a “ completed quote ” is presented , as illustrated in fig9 . the completed quote lists the cd titles selected by the seller , the condition of each cd , and a total dollar value for all the cds 902 . it is a further significant feature of the present invention that a dollar value is presented to the seller only for a completed quote comprising more than a fixed minimum number of cds , rather than presenting a quoted value for each individual cd . the seller is prompted to enter his or her name and address information ; when complete , the seller selects “ send me my money ” 904 , completing the on - line interactive portion of the transaction . the remaining steps in the transaction take place through the mail , with e - mail confirmation messages . at each significant step of the off - line portion of the process , the software at the purchaser &# 39 ; s site will generate e - mail messages to the seller &# 39 ; s e - mail address , informing the seller of the current status of the transaction . the first e - mail includes a copy of the quote , and the stated terms of the transaction . for the example illustrated in fig2 - 9 , the message would typically be as follows : 1 ) due to inventory and database changes , cashforcds . com reserves the right to buy or not buy any cds for which we have provided a quote . 2 ) all conditions of cds quoted are subject to our review . if the conditions don &# 39 ; t actually match the conditions that were listed in the quote , cds will be returned to the customer at the customer &# 39 ; s expense . 3 ) quotes are given for a minimum of six cds . cashforcds . com cannot buy more than two cds of the same title from the same customer . 4 ) cds must be in working condition and must include the front cover for copyright purposes . 5 ) cds with missing back covers will be accepted , but at a reduced rate . 7 ) the terms and conditions of this agreement are subject to change at any time without prior notice . offline , the purchaser then generates a mailing list , shipping instructions , and a prepaid mailing label , which is mailed to the seller &# 39 ; s address ; an e - mail message is also sent to the seller : we have sent you a postage - paid mailer and checklist you can use to send the cds to us . you should be receiving this package soon . please follow the instructions inside to complete the process . the seller packages the compact disks and printed inserts in the provided envelope ( without the “ jewel boxes ”), and places the pre - paid mailing label on the envelope . when the envelope is received by the purchaser , a third confirming e - mail message is sent : we just wanted to let you know we have received your cds and we are processing them now . as soon as that &# 39 ; s done , we &# 39 ; ll be sending your check ! the purchaser verifies the cd titles and conditions , prepares and mails a check for the agreed total purchase price , and sends a final e - mail message : just wanted to let you know that your check has been mailed ! please look for it to arrive soon . fig1 illustrates the major software components of the presently preferred implementation , and the flow of information between the components . the major components of the software , including the “ quote ” form , the cd database , and the seller information database , reside on a commercial hosting site . the seller uses a standard “ web browser ” to access the site . the purchaser maintains the cd database with a database management tool from a local computer at the purchaser &# 39 ; s location , and accesses the seller database as necessary with a simple interface tool . also at the purchaser &# 39 ; s location is software to generate the shipping list and mailing label based on information e - mailed from the hosting site . the software on the hosting site is written is a common language such as perl , and is “ open architecture ”, such that it may be enhanced or used in conjunction with other “ e - commerce ” software , quickbooks , or other software with inventory tracking and accounting capabilities . in the presently preferred implementation , the quote given will be based on a product of the cd list price and its condition ( e . g ., excellent = 20 % of list price , good = 15 % of list price , fair = 10 % of list price ). these parameters are not hard - coded into the software , but may changed as desired . the software is capable of handling exceptions where a different formula is used for some specified cds , or a fixed price is used . if some titles cannot be found in the database query , those cds will not be given a quote . the software at the hosting site accumulates a database of all site visitors &# 39 ; information that has been collected from the quote forms . the seller database interface tool at the purchaser &# 39 ; s location allows the purchaser to retrieve this information as a database or in other useful formats . the above is a detailed description of particular embodiments of the invention . it is recognized that departures from the disclosed embodiments may be within the scope of this invention and that obvious modifications will occur to a person skilled in the art . it is the intent of the applicant that the invention include alternative implementations known in the art that perform the same functions as those disclosed . this specification should not be construed to unduly narrow the full scope of protection to which the invention is entitled . specifically , although the invention is described primarily with respect to the purchase of used compact disks , the system and method of the invention are also applicable to the purchase other used items from consumers , such as dvd &# 39 ; s . the database may also be configured to permit other searching methodologies , such as searching by sku number . the corresponding structures , materials , acts , and equivalents of all means or step plus function elements in the claims below are intended to include any structure , material , or acts for performing the functions in combination with other claimed elements as specifically claimed . | 6 |
fig1 illustrates a spray booth 10 in cross section , having a top wall 12 and spaced vertical end walls 14 that extend between the floor and the top wall 12 to define a front opened enclosure within which spraying activity can take place . the size of the spray booth depends on the size of the article 15 to be sprayed , but the booth generally will be at least several feet in depth , several feet up to preferably seven or eight feet in height , and five to twenty feet or more in length . at the rear of the spray booth , an exhaust plenum 16 is provided which is connected by a duct 18 through the top wall of the spray booth and through the roof ( not shown ) of the building within which the spray booth is housed . a fan or blower 20 is supported by arms 21 in the exhaust duct , and is powered by an electric motor 22 through a drive belt 23 . a damper 26 is mounted on a shaft 28 to extend crosswise of a damper section 29 . a spring 30 connected between the damper and bracket 31 normally biases the damper to its closed position crosswise to the axis of the duct ( shown in solid lines in fig2 ). a motor 32 keyed to the shaft is used for overcoming the force of spring 30 and for turning the damper clockwise in fig2 to its opened position where the plane of the damper 26 is generally in line with the axis of the duct ( shown in phantom in fig2 ). the damper 26 and its schematically illustrated shaft supported , motor opened - spring closed construction can be of conventional design , except it is preferred however that the motor be of a low output , low amperage draw configuration as will be apparent later . shown between the rear confines of the spray booth 10 and the exhaust plenum 16 is a cleaning system 34 illustrated in the form of removable filter pads or the like . these filters thereby remove excess paint particles from the air before it is exhausted to the atmosphere . other type cleaning systems can be incorporated between the spray booth and exhaust system , such cleaning systems being for example of a water wash or spray type where a pump ( not shown ) forces water crosswise to the flow of the air through the cleaning system . the article 15 to be sprayed is suspended by a hanger 36 from a conveyor 38 schematically shown enclosed within a housing 39 . the conveyor 38 moves the articles 15 along a path crosswise of the width of the spray booth and in line generally with the cleaning system 34 and through openings 41 in the endwalls 14 . also illustrated within the spray booth is the spraying apparatus itself , generally designated at 42 , and including specifically a spray gun 44 having a trigger control 46 and an eyelet 47 for supporting the gun when the same is not in use . further a hose 49 typically communicates the spray gun 44 with a connection 50 supported from a bracket 52 adjacent the top wall 12 of the spray booth . the location of the connection is of no significance but it is common to provide for a convenient spray gun mounting location and the same is merely illustrative of a system that can be used . although the same is not shown , it will be understood that this connection 50 communicates with a paint tank or the like for holding in bulk form the paint to be sprayed and a means for pressurizing the tank and / or pressurizing air in order to force the paint from the source through the hose to the gun for spraying discharge therefrom . also depending from the bracket 52 is a control box 54 supporting therefrom a hook 56 . the hook 56 is designed to fit through the eyelet 47 and hold the gun when the same is not in use . for purposes of this disclosure , this hook is thereby used to determine when the spray gun is in use and when the spray gun is not in use . also located in the spray booth on top wall 12 are overhead illuminating lights 58 , although any other illuminating lights ( not shown ) may be used as might be appropriate . fig3 illustrates an electrical schematic for operating the paint and exhaust systems illustrated in fig1 and 2 . an a . c . power connection of typical voltage is supplied across lines 60 and 61 , and a main on / off switch 62 having open and closed contacts 63 is located between power lines 60 and 64 . thus , an a . c . potential exists across lines 64 and 61 whenever the main on / off switch 62 is in the on position and the contacts 63 are closed . the spray booth lights 58 are located in a series circuit across the controlled a . c . power lines 64 and 61 with the normally open contacts cr1 - 1 ; as likewise is the motor 22 for the fan or blower 20 located in a series circuit with the normally open contacts cr1 - 2 ; as likewise would be the water wash pump with additional normally opened contacts ( shown only in phantom ) if such a cleaning system were used . likewise the high voltage coil 65 of a step down transformer 66 is located across the lines 64 and 61 to provide low control voltage at lines 68 and 69 from the low voltage coil 67 of the transformer . the preferred control voltage would typically be of twenty - four volts or the like for added safety and convenience , and a hot potential would therefore exist across lines 68 and 69 whenever the main on / off switch contacts were closed . a fuse 72 is connected in series with the power line 68 as is thermal switch 74 having a movable leaf 74 - 1 and a normally closed contact 74 - 2 and a normally open contact 74 - 3 . the thermal switch would be of conventional construction for sensing or detecting a fire , where a bimetal 74 - 4 for example of the switch would preferably operate when exposed to a temperature of approximately 140 ° f . to move the leaf 74 - 1 from the normally closed contact 74 - 2 to the normally open contact 74 - 3 . when the same would happen , for example , responsive to the detection of a fire , a power circuit would then be completed through indicator 76 , shown typically in the form of a red light , to provide a visual or sensual appraisal that the thermal switch has been shifted . in normal operation , however , with the thermal switch 74 in the position where its leaf 74 - 1 is closed against the switch contact 74 - 2 , to line 77 which thus is at a control potential relative to line 69 whenever the on / off control 62 is closed . the coil of the control relay cr1 is connected across the lines 77 and 69 ; and the control relay operates the previously noted normally opened contacts cr1 - 1 , cr1 - 2 and a third set of normally opened contacts cr1 - 3 . the control relay contacts cr1 - 3 are connected to line 78 going in turn to a seasonal selector switch 80 having a moving leaf 80 - 1 and a first set of contacts 80 - 1 which are connected by the leaf 80 - 1 in one operative position corresponding to a summer operation or a nonheating season , and having a second set of contacts 80 - 3 which would be connected by leaf 80 - 1 in the other operative position corresponding to a winter operation or a heating season . the summertime contacts 80 - 2 connect from hot potential line 78 via line 81 through the damper motor 32 to the ground potential at line 69 . when the seasonal selector switch 80 is shifted to the winter position , the hot potential at line 78 is connected across the switch to line 82 , which firstly connects through normally closed contacts 84 - 1 of the timer 84 and in turn via line 81 through the damper motor 32 , and secondly connects across contacts 86 - 1 of the switch means 86 and in turn through the timer 84 . the timer 84 allows for adjustable operation as determined by a control knob 84 - 2 , whereby any specific delay between approximately twenty and two hundred seconds may be set to require that the set duration must lapse or pass before the timer contacts 84 - 1 are opened even after the timer has been energized . however , immediately upon the timer being deenergized , the contacts 84 - 1 would shift to their normally closed positions . any conventional timer that operates in this manner would be suitable . further connected off of the potential line 79 are two sets of contacts 88 - 1 and 89 - 1 respectively of limit switches 88 and 89 . the limit switches are located in physical proximity to the damper to indicate when the damper is either fully opened or fully closed as illustrated schematically in fig2 . thus when the damper is fully opened ( as shown schematically in fig2 ) the limit switch 88 is depressed and contacts 88 - 1 are closed and are connected across a visual or sensual indicator 90 for example , in the form of a green light which then would appraise the operator that the damper is opened ; whereas when the damper is physically closed , the second limit switch 89 is depressed and its contacts 89 - 1 are closed to power indicator 92 , for example in the form of an auburn light which would appraise the operator visually that such a condition did exist . the operation of the exhaust system and its damper control would preferably be as follows . the fan or blower 20 and the spray booth lights 58 would be energized and operated when the main on / off switch 62 is shifted on and the contacts 63 closed , and would remain operating until the on / off switch were opened or under certain overheat conditions as will be noted later . when the operator decides to spray and removes the spray gun 44 from the hook 56 , the hook closed switch contact 86 - 1 are allowed to open which deenergizes the timer 84 . this immediately allows the normally closed contacts 84 - 1 to close to energize the damper motor 32 which thereby powers the damper to the opened position . as noted earlier , the damper motor is preferably in the form of a low output fractional horsepower motor having a low amperage draw and is designed to be operated continually in the stall condition in order to maintain the damper in the opened position . the enclosure air is thereby drawn in from the open front of the spray booth and within and through the confines of the spray booth to pick up excess paint particles and move them through the cleaning system 34 to the exhaust plenum 16 and out the duct 18 , as caused by the operating exhaust fan 20 . should then the operator stop spraying activity and hang the gun on the hook 56 , the hook controlled switch contacts 86 - 1 would be closed to activate the timer 84 . as explained earlier , the timer would operate for an adjustable duration , typically in excess of twenty seconds and up to for example two hundred seconds , before opening the normally closed timer contacts 84 - 1 in the series connection with the damper motor 32 . this continued operation of the fan with the damper in the opened position purges contaminated air within the confines of the spray booth for the adjustably set duration even after spraying activity has been terminated , as sensed by the use - nonuse hook 56 . however , after the set duration has lapsed and the controlled timer contacts 84 - 1 open , the damper motor 32 would be deenergized and the spring 30 would be allowed to shift the damper 26 to the closed position blocking the exhaust duct 18 . the fan or blower 20 would yet continue to operate , although little air would be passed through the exhaust blower or fan and out the exhaust duct because of the closed damper . this mode of control is quite economical since the power drain of the fan motor 22 in the no load condition is appreciably less than in the normal loaded or exhausting condition . further , the power required to shift the damper 26 between the opened and closed positions is virtually nil , since the motor 32 used to open the damper is of a low current draw type . moreover , once the damper 26 has been closed , the air discharged from the confines of the spray hood would be reduced to virtually nothing and consequently the heat lost because of discharged air is substantially eliminated . further , the economy of this mode of control in blocking the fan output while allowing the fan to operate compares favorably to normal heavy current start up draw of a typical fan motor or to the extreme wear of the motor 22 and / or the drive belt 23 caused by frequent start up cycling of the fan motor itself . in fact , the operation is advantageous to merely cycling the fan motor on and off , since even with the fan not operating but with the damper yet maintained open , there is still a chimney or convective air flow of the warmer enclosure or spray booth air , particularly during the heating season , up the exhaust duct that generates continued heat losses . the damper 26 also operates as the fire damper should a fire occur in the confines of the spray booth 10 . in this regard , the overheat switch 74 can be located in proximity of the spray booth such as in underlying relation to the wall 12 . when the overheat switch is activated such as by the presence of heat in excess of 140 ° f . for example , the switch contacts 74 - 2 would open and drop out power to main power line 77 to the low voltage control to deenergize the control relay cr1 and the damper motor 32 . this would terminate the operation of the exhaust fan 20 and the lights 58 , and further would allow the damper 26 to be spring closed . further , the shifted leaf 74 - 1 of the switch 74 against contact 74 - 3 completes a circuit with the warning indicator 76 to give sensual appraisal of the triggered fire control . it should be noted that although the switch 86 for operating the damper timer 84 is illustrated as being located in the control box 54 , the same switch might for example be located itself in the spray gun and be actuated by the trigger 46 . thus , for example , when the trigger 44 were activated to initiate a spraying action , the switch contacts 86 - 1 would be opened to open the exhaust damper 26 ; whereas when the trigger 44 were released to terminate the spraying action , the switch contacts 86 - 1 would be closed to start the timer 84 and the timed duration before which the damper motor 32 would be deenergized to allow the damper 26 to be closed . while a timer 84 has been illustrated in the circuit , it is entirely possible although not the preferred embodiment to have a direct immediate response of the damper 26 closing upon the termination of the spraying activity ( with the trigger control noted above ) and / or upon the spray gun being hung up on hook 56 . this would eliminate the continued purging of the confines of the spray booth , but under certain conditions may not even be needed . | 1 |
fig1 illustrates a general perspective view of a vehicle suspension 10 utilizing a fluid strut such as a mcpherson strut 12 which defines an axis a . the strut 12 includes upper 14 and lower 16 portions . the upper portion 14 supports a spring 18 such as a coil spring . the upper portion 14 is supported on the vehicle frame ( illustrated schematically at 22 ) by a resilient mount system 24 . the spring 18 is retained between the mount system 24 and a fixed lower spring mount 26 attached to the strut 12 . strut 12 provides hydraulic dampening for a wheel knuckle 28 mounted at the lower portion 16 through a bracket 29 or the like . the knuckle 28 supports a brake assembly 30 and a wheel ( not shown ) as is well known . the strut 12 may rotate to accommodate a steering input , as is also generally known in the art . referring to fig2 , a radial sectional view , which passes through axis a , further illustrates the mount system 24 . the upper portion 14 of the strut 12 preferably includes a rod 31 having a threaded section 32 of a smaller diameter to define a step 34 . a jounce bumper 36 forms a lower portion of mount system 24 . the jounce bumper 36 is located upon the threaded section 32 adjacent the step 34 . an annular upper retention plate , or rate plate , 38 forms an upper portion of mount system 24 . rate plate 38 is separated from the jounce bumper 36 by a resilient bushing 40 . preferably , a nut 42 is threaded upon the threaded section 32 to compresses the resilient bushing 40 between the rate plate 38 and the jounce bumper 36 . the rate plate 38 and the jounce bumper 36 are preferably cup shaped members with their open ends facing away from each other . the resilient bushing 40 of the mount system 24 resiliently retains the strut 12 with a cylindrical frame opening 44 in a rigid mount plate 122 , which is attached to the vehicle frame 22 . a bearing seat 46 is mounted about the cylindrical frame opening 44 to provide support for bearing 102 and to assist in the insertion of the resilient bushing 40 by covering an edge 47 of the mount plate 122 with a radial pilot surface 200 . edge 47 may be relatively sharp while an angled annular upper frame area 49 opposite thereto is of a radiused shape . the radial pilot surface 200 is located adjacent to the relatively sharp edge 47 to pilot installation of the resilient bushing 40 during assembly , as will be explained below . this surface also facilitates centering of the resilient bushing 40 during operation of the strut 12 . the bearing seat 46 generally includes an annular section 210 defined about the axis a , and a mount section 212 transverse to the annular section 210 . the annular section 210 is received over and around the mount plate 122 . the mount section 212 extends to an annular frame area 49 to provide support for bearing 102 . notably , because the strut 12 is typically installed at an angle relative the vehicle frame 22 , the mount section 212 defines a bearing seating surface for the bearing 102 that is not perpendicular to the axis a . it should be understood that various relationships may be provided by the bearing seat 46 and the angled relationship illustrated in the disclosed embodiment shall not be limiting . the bearing seat 46 is also at least partially retained by the resilient bushing 40 . a radially outwardly extending lip 100 of the resilient bushing 40 extends beneath the bearing seat 46 to provide this retention feature . it should be understood that the bearing seat 46 and the resilient bushing 40 extend about axis a such that the bearing seat 46 also serves to pilot or position the resilient bushing 40 during assembly ( fig9 a ). various vehicle frame and suspension structures will benefit from the mount systems of the present invention , and the present invention is not limited to the illustrated embodiment . referring to fig3 , the resilient bushing 40 generally includes a central section 107 , an upper radially outwardly extending lip 105 and the lower radially outwardly extending lip 100 . notably , the central section 107 defines a diameter that is less than that of the lips 100 , 105 such that the bushing 40 has a generally hourglass shape . preferably , the intersections between the central section 107 and the upper and lower radially outwardly extending lips 100 , 105 are radiused and are received adjacent the frame area 49 and the radial pilot surface 200 ( fig2 ). one feature of the upper radially outwardly extending lip 105 , is to provide a contact surface between the rate plate 38 and the mount plate 122 . similarly , the lower radially outwardly extending lip 100 provides a contact surface between the jounce bumper 36 and the bearing seat 46 . the resilient bushing 40 may be provided with internal support from an optional annular carrier 48 . the annular carrier 48 is preferably a rigid member surrounded by the resilient bushing 40 ( fig3 ). that is , the annular carrier 48 is essentially encapsulated by the resilient bushing 40 . “ encapsulated ” as defined herein means the resilient bushing 40 essentially surrounds the annular carrier 48 , however , lip edge portions 50 or the like on the annular carrier 48 can extend at least partially through the resilient bushing 40 . as shown , portions of the resilient bushing 40 are both radially inward and radially outward of the annular carrier 48 . the annular carrier 48 is preferably cup shaped , facing outward relative to axis a , and essentially forms a hub upon which the resilient bushing 40 is molded . a rigid annular member 52 is mounted within an inner diameter 53 ( fig2 ) of the resilient bushing 40 ( fig4 ). the annular member 52 is a rigid bushing that defines the distance between the rate plate 38 and the jounce bumper 36 . that is , a portion of the rate plate 38 and the jounce bumper 36 contact the annular member 52 such that a proper compression is applied to the resilient bushing 40 when the nut 42 is threaded upon the threaded section 32 . in this embodiment , the resilient bushing 40 , the annular carrier 48 , and the annular member 52 are formed of two - pieces that are preferably mirror images when reflected through an equator s ( fig2 ). the two - piece structure allows rapid assembly in cylindrical frame opening 44 . as known in the art , bearing seat 46 supports a bearing 102 . a spring seat 104 ( fig5 ) is mounted on bearing 102 and spring 18 is supported on spring seat 104 . the details of this structure are as known in the art and form no part of this invention . referring to fig5 , a radial sectional view , which passes through axis a of another mount system 24 ′, is illustrated . mount system 24 ′ includes a one - piece resilient bushing 54 , an optional annular carrier 66 , and an annular member 52 ′. the resilient bushing 54 , the annular carrier 66 , and the annular member 52 ′ are each a single component . the annular carrier 66 is preferably cylindrical to assist the one - piece resilient bushing 54 with insertion through the cylindrical frame opening 44 in the mount plate 122 . that is , the annular carrier 66 is generally tubular rather than having the cup shape described above , as the resilient bushing 54 is one - piece rather than two - piece . the annular member 52 ′ is mounted within an inner diameter 53 ′ of the resilient bushing 54 and functions as described above . see fig7 also . referring to fig6 , the one - piece resilient bushing 54 preferably includes an arcuate chamfered surface on upper lip 105 ′. this surface assists in inserting the resilient bushing 54 past the bearing seat 46 and into the cylindrical frame opening 44 of the mount plate 122 . a radially outwardly extending lip 100 ′ generally receives and retains bearing seat 46 . as can be appreciated from either fig2 or fig5 , a radial pilot surface 200 of the bearing seat 46 is non - parallel and non - perpendicular to the axis a . in fact , as disclosed , the surface is preferably an annular radial pilot which defines a radius . the surface creates a pilot space that assists in insertion of the resilient bushings 40 , 54 within the bearing seat 46 and through the mount plate 122 . in particular with the embodiment of fig6 , this surface facilitates initial passage of the enlarged upper lip 105 ′ through the inner periphery of the mount plate 122 and the bearing seat 46 . the upper outwardly extending lips 105 , 105 ′ thereafter sit atop the mount plate 122 . referring to fig8 a , the mount system 24 of fig5 - 7 is illustrated in a partially assembled condition . the mount plate 122 is mounted to a vehicle frame . the bearing seat 46 is located over the cylindrical frame opening 44 such that the radial pilot surface 200 extends adjacent the edge 47 . in this way , the bearing seat 46 facilitates installation of the resilient bushing 54 while minimizing the potential for damage as the radially outwardly extending lip 105 ′ of the resilient bushing 54 is compressed to pass through the smaller diameter cylindrical frame opening 44 until reaching an installed position . the resilient bushing 54 is maintained slightly in compression ( illustrated schematically by the dashed line in fig8 b ) once installed . although fig8 a utilizes the resilient bushing 54 of fig5 , it should be understood that installation is likewise generally similar for the embodiment of fig2 . referring to fig9 a , the resilient bushing 40 is symmetrical about the equator s to define a two - piece structure 40 a , 40 b . the two - piece structure provides for assembly into the cylindrical frame opening 44 from each side of the mount plate 122 . here , the bearing seat 46 need not provide as significant of the pilot function as described with reference to fig8 a , 8b but does provide for centering alignment within the cylindrical frame opening 44 during operation . the bearing seat 46 also minimizes stresses upon the resilient bushing which may otherwise occur should the edge 47 be exposed as in conventional bearing seat arrangements known in the prior art . here too , the resilient bushing 40 is maintained in compression ( illustrated schematically in fig9 b ) once installed . furthermore , the two - piece structure 40 a , 40 b of the resilient bushing 40 is retained together by the interaction between the step 34 , nut 42 , rate plate 38 , and jounce bumper 36 ( fig2 ). the foregoing description is exemplary rather than defined by the limitations within . many modifications and variations of the present invention are possible in light of the above teachings . the preferred embodiments of this invention have been disclosed , however , one of ordinary skill in the art would recognize that certain modifications would come within the scope of this invention . it is , therefore , to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described . for that reason the following claims should be studied to determine the true scope and content of this invention . although a preferred embodiment of this invention has been disclosed , a worker of ordinary skill in this art would recognize that certain modifications would come within the scope of this invention . for that reason , the following claims should be studied to determine the true scope and content of this invention . | 1 |
further features and advantages of the invention , as well as the structure and operation of various embodiments of the invention , are described in detail below with reference to the accompanying fig1 - 6 . the embodiments of the invention are described in the context of a military computing infrastructure such as the global information grid ( gig ) envisioned by the u . s . department of defense ( dod ). nonetheless , one skilled in the art recognizes that the present invention is applicable to any information infrastructure , particularly those in which dynamically changing conditions require a flexible information management environment . in the current state of standardization of information systems , many discreet types of information environments exist . the integration of these environments to create unique communities of interest is often expensive and risky due to the extensive software development required . the present invention overcomes these difficulties by enabling the creation of a global information architecture that achieves the integration of these discreet environments through the use of configuration instead of software development . the present invention enables a “ global information architecture ” ( gia ) for managing a global information grid ( gig ). a global information grid refers generally to a distributed environment for collecting , transforming , and presenting information to users , both human and machine . the gia supports gigs for any size organization , for example , organizations as large as the dod or as small as a two - person web - based retail organization . in an embodiment of the invention , gia is implemented as a software - based environment that permits information consumers , both users and other software environments , to manage network - resident information within a structure that provides the right information to the right consumer in the right format at the right time . the gia manages the full range of information objects including : simple instances of information , e . g ., text ; complex instances of information , e . g ., a document with its metadata ; collections of information , e . g ., a directory with files ; complex collections of information , e . g ., a table with rows and columns ; and dynamic instances of information , e . g ., a really simple syndication ( rss ) video stream . a central concept in gia is that objects can be referenced in multiple “ worldspaces ” and these are inherently hierarchical . a user &# 39 ; s ( including non - human users ) view of information data sources are controlled by her worldspace , a structure that uses the attributes she has that makes her unique to identify the appearance and behavior that an object in gia would present to her . these attributes can include ( among others ) her username , roles , language , locale , and organization . hence , worldspace allows constraint of objects and its services that are available to a user . this view is itself described via vector relational data modeling ( vrdm ) through vectors and is wholly configurable , unlike most traditional information systems whose ability to lock down data access is fixed . since worldspace constraints are described in the language of vrdm itself , this description can be changed completely with metadata , allowing for new and unique implementations of worldspace without coding . this is achieved by making the user the starting point for any traversal to objects of interest . the vectors ( which are configurable ) used for this traversal then constrain what objects a user can see and / or change . in addition to managing any type of data agnostic to type or form , the gia is able to access that information anywhere on the network . it is also able to understand that information in a context that includes the relationships between instances of information , both explicit and implicit . moreover , the gia supports a spectrum of actions on information objects , e . g ., the collecting , transforming , and presenting mentioned above , but also updating , deleting , validating , starting , etc . in addition , the gia recognizes that information objects may generate consequences in other related objects , e . g ., a change to an inventory level can sometimes cause a sales order to go on hold . solving the gig management problem cost - effectively virtually requires that the gia be configurable . however , the configuration requirements needed to support the gig are deeper than in a typical software model : not only must there be a model where object components can be configured , but object relationships and services must also be configurable . moreover , a conventional multi - level security ( mls ) approach may be insufficient as different collections of information consumers can have different models . to meet that demand , the gia implements , among other things , two new types of software models : a configurable , bootable , reflexive information object model (“ gia information model ”) and a model that can create and run information model configurations (“ gia execution model ”). “ reflexive ” means that the system is self - describing , i . e . a system that describes other systems is reflexive if it is an example of the type of systems it describes . the approach used by the gia execution model is to wrap all acquired instances of network - available information in a software object with a standard interface that exposes the same collection of methods , and provides for access to components of the information through named properties . the gia information model is a coherent information model and is a configuration , i . e ., it exists in metadata , and is reflexive because the gia information model can be represented in the gia information model . as the gia information model is bootable , the gia execution model actually loads the first components which represent the primitive concepts of the model into active memory and then uses them to bring in the rest of the gia information model description to create the gia information model . fig1 illustrates a basic gia structure 100 according to an embodiment of the invention . the environment that it is responsible for controlling information object interaction is a directory subsystem ( dss ), shown here by the object that encapsulates all of its functionality : the dssmanager 110 . the dss is an instance of the gia execution model running an instance of the gia information model , i . e ., it represents one of the interoperating environments that collectively represent a gia . the dssmanager 110 exposes a simple , sql - like data access layer ( dal ) 120 interface , the implementation of which is apparent to one of ordinary skill in the art , which is suitable for both object - oriented and database - oriented applications to use . sql or structured query language is the language used to get or update information in a relational database management system , e . g ., oracle , microsoft sqlserver . the dal supports semantics for the acquisition and management of uniquely identified instances of information , or collections thereof . these instances , i . e ., information objects , have named properties , and named services that can be invoked . in practice , organizations have hard - coded “ expert systems ” for performing sophisticated manipulation of digital data . when looking at employing a gig , organizations generally look at the taking some subset of the organization &# 39 ; s data , and enabling easy retrieval , display and simple updates “ in context ,” i . e ., with their relationships exposed and viewable . gia supplies its own interface environment , its task - oriented - user interface ( toui ) 130 to meet non - specialized needs for visualization and management of gig data . gia &# 39 ; s toui is a configurable , browser - based data representation environment that makes meeting that organizational need “ easy .” gia &# 39 ; s toui includes components for displaying any kind of digital that has been collected by gia , e . g ., one can use gia &# 39 ; s toui to represent text , images , documents , video , etc ., using components that display the desired type of digital information one creates displays of gia - collected data by configuring a representation , its components , and a mapping of the representation and components to the components of the gia - collected data . gia &# 39 ; s toui includes the ability to display information objects geographically through a global information system ( gis ) display . gia &# 39 ; s toui 130 operates directly on the base dal 120 . however , when other applications or user interfaces need to access gig data , and cannot use the base dal (“ non - conforming ” user - interfaces and applications , e . g ., systems that are built on top of non - odbc - compliant databases — odbc stands for open database connectivity ), then an adaptor 125 can be added that works with the base dal 120 and exposes a dal interface 140 that is compliant with the non - conforming user - interface 150 or application . the adaptor is a program that exposes the services that are required by the non - conforming application , and translates them into calls on the base dal . since the dal 120 exposes both object - oriented and database - oriented semantics , as long as the non - conforming application or user interface can operate over uniquely - identified instances , or collections of instances , of sets of named components with named services , this adaptation of the dal 120 to different types of applications and user interfaces requires a straightforward mapping of the “ from ” syntax to the base dal &# 39 ; s syntax . most applications built over the last 30 years use some variation of these semantics . the dss 110 interoperates with any network available information sources to retrieve any information on the network , agnostic to form , type , structure or location through the use of network information accessors 160 . network information accessors are programs that communicate over a network protocol to information sources that expose information on that protocol . for example , the major databases are accessible using remote odbc over tcp / ip . many systems expose their data using web services over http or https . web sites themselves represent html - based information sources operating over http or https . network file systems also function as network - available information sources . a network information accessor is a program that the dssmanager can communicate with directly , and that can access information provided by a network - available information source through the network . all network information accessors expose a common interface that provides the same semantics as the base dal . the process of configuring the dss 110 to access an information source is referred as “ aggregating the information source .” although the figure represents a single dss , in actuality the dss may be configured to interoperate with other dss &# 39 ; s as network - available information sources . hence , a set of dss &# 39 ; s that are connected over the network can function as a multi - node , virtual single point of entry for all of the information sources ( not shown ) aggregated by all of the dss &# 39 ; s . this characteristic , that instances of dss &# 39 ; s can interoperate with other instances of dss &# 39 ; s as information repositories in their own right , is important for at least three reasons : ( 1 ) it allows a data source that has been aggregated by one dss to be treated as an aggregated information source by all of the other dss &# 39 ; s in communication with the first dss without additional effort , ( 2 ) multiple dss &# 39 ; s provide for multiple points of completely independent administrative interfaces , a requirement in many large organizations , and an absolute requirement in situations which require highly restrictive access , e . g ., classified information inside of the u . s . federal government , and ( 3 ) it easily enables multi - organizational integration capability . moreover , by allowing a single method of communication from one network to another , i . e ., gia - to - gia interfacing , the dss supports communication over the public internet using standard encryption techniques , e . g ., https communication . fig2 illustrates the overall structure 200 of a dss according to an embodiment of the invention . the dss structure 200 comprises a number of basic layers of gia : an information access control component (“ worldspacemanagers ”) 210 that operates on top of a service control component (“ service managers ”) 220 that manages operations on the content that is collected and harmonized by the component that manages content (“ contentmanagers ”) 230 that is aggregated by the network - information accessors 160 (“ contentservers ”) 240 . this layered structure is part of what enables gia to be a configured environment , i . e ., it enables the programming that is required to change or enhance gia to be expressed as configurations of “ object metadata ,” i . e ., metadata that describes the behavior of an object , i . e ., services , properties , and vectors ( relationships ), not as actual coding . the foundation of configurability is fundamental to the gia architecture and the “ information object ” methodology that gia embodies . an information object is an instance of information that exposes the standard information object interface used by gia ; it gets this interface by being wrapped in a gia information object wrapper , which is the collection of components that are assembled to wrap an instance of network - available information so that it functions as an information object . to create new information objects in gia , one creates a configuration that specifies the information object &# 39 ; s components , services , and location , rather than doing programming . then , using the configuration as a set of instructions , gia creates and assembles a series of objects , using the layer managers described above , that collectively function as the required information object . this process of configuration is described in more detail below . gia assembles its information model according to a specification 250 that describes the components and their relationships . gia incorporates novel and important variations on the standard object - oriented development factory pattern . ( the factory pattern is a design construct used in object - oriented development where an object is created whose function is to create new objects .) first , the dssmanager actually functions as a factory - of - factories . second , the dssmanager uses object metadata expressed as information objects to define the actual objects that get created as factories , and then again to define the objects that are created by the factories . the use of information - object - driven object definitions gives gia unlimited extensibility . fundamentally , then , gia manages configurations of components that function as “ information objects .” the idea of creating reusable components to create larger software objects has been employed in , for example , microsoft &# 39 ; s component object model ( com ). in practice , however , the use of reusable components has been restricted to very large objects , as in the com model , or small objects that become components used in a larger , programmed systems , as is done with java and microsoft &# 39 ; s . net . gia is fundamentally different : it successfully accomplishes complete user - interface - to - data - store configurability . gia successfully accomplishes a complete , user - interface - to - data - store , objects - through - component configurability as a result of two strategic architectural decisions ( as mentioned above ) that were imposed on gia design , and five concepts that came out of those decisions : gia manages “ information objects ,” i . e ., objects that are primarily displaying , updating , or using information , rather than objects that are performing complex tasks . for instance , a typical web site almost exclusively uses information objects , while a weather simulation uses relatively few information objects . gia manages these types of objects through configured components . although at first this seems like a major limitation , in practice these types of objects support a very large subset of the overall software requirements that are emerging in the highly network - centric computer environment that exists now . in traditional applications , e . g ., sap r / 3 enterprise resource planning ( erp ), information objects have a high degree of applicability . it is not unreasonable for an erp system to have more than 90 % of its software built using information objects . by design , information objects are relatively simple to represent as configurations of relatively few , highly - reusable component objects . this decision ended up being fortuitous : the approach is far more fundamental to the success of gia as an environment for managing information objects through configuration than was originally anticipated . by forcing gia to be a gia application a large number of problems were identified early on that had to be solved by creating new structures for managing information objects . of importance was the identification of an information object representation of information objects . this problem led to the following two concepts : in order for gia to be a gia application , then an information object has to have a representation as information objects . hence , a component version of all of the characteristics of an information object must be present : services , properties , and relationships . it is possible to represent information services and properties by specifying a name , set of characteristics , and an implementing object only . however , expressing relationships as information objects required the following concept : there are three different requirements to expressing information object relationships as information objects : the relationship , the characteristic of the relationship , and the use of the relationship by the information objects . vrdm provides all three of those constructs as information objects . this capability is fundamental : to successfully componentized services , properties , and relationships , the relationship between information objects and their services , properties and relationships is expressed through configuration . since the configuration of a gia object is an information object , each component of the information object has to be an assembly of the corresponding components . this concept is the driver for the organization shown in fig2 , and the information object representation shown in fig3 . once one has the structure described in ( 1 )-( 5 ) above , a new possibility exists for managing multi - level access control : the components available to a user simply become vectors between the user and the component objects that make up the information objects accessible by the user . in order to have all of these concepts come together , the information objects that manage the components are assembled per the vectors that define the relationships between those components . in addition to the methodology used to implement the dss structure 200 , important methods are expressed in the structure itself : there is a very strong separation of the structures for accessing data ( contentservers ) 240 , harmonizing and homogenizing data ( contentmanagers ) 230 , operating on that data through services ( servicemanagers ) 220 , and controlling access to that data ( worldsapcemanagers ) 210 . this layered approach provides critical capabilities . first , the contentservers 240 collect content and expose that content in a way that is consistent with the rest of the dss components . in effect , the contentservers 240 create a universal information source space that can then be managed in any way desired . second , the contentmanagers 230 operate in the universal information source space as information sources in their own right that can be structured in any way desired to support gig requirements . this layer is a departure from existing content aggregation approaches : gia provides an independent object creation and management layer on top of information sources . hence , capabilities ( 3 ) and ( 4 ) can be met without leaving the gia environment . the separation of services from content management is another important capability provided by the dss structure 200 . although many of the operations that one might desire to be performed on the aggregated information sources , or the virtual information sources created by the contentmanagers 230 , can be implemented using one information object , many important ones cannot . for instance , the simple act of e - mailing ( information source ) a document ( information object ) involves the interaction between multiple information objects in the universal information object space . being able to configure such methods involves the use of a servicemanager 220 . finally , the worldspacemanagers 210 support the limitations on the instances of information objects that get exposed to the user . fig3 illustrates an information object structure 300 according to an embodiment of the invention . the layering of the dss structure 200 is also reflected in the layering of the information object 300 . in effect , the layers in the dss 200 are used to assemble a layered information object 300 that encapsulates all of the components required to represent the information object in the way that is desired for the user for which the information object is being assembled . this compartmentalization of capabilities produces the required result : a configured information object that manages the universal information object space that is the dss 200 . the information object structure 300 employs a consistent interface , icontent interface 305 , for all of the layered assemblies . this icontent interface exposes methods for getting or setting values , invoking services , and for moving to next instances , when the information object is actually a set of instances . mirroring the package description above , the object that functions as the primary interface for an information object is the worldspacemanager 210 . as shown , this object exposes the icontent interface 305 . it is responsible for selecting the particular instances of an information object that are allowed to be presented to the user . it , in turn , acts on a lower level object that exposes the same icontent interface 315 . however , some of the instances that are exposed at lower levels will not be exposed by the worldspace manager . ( this separation prevents limitations on what a user can see from causing problems with the actual implementation of the information object , as is possible with some systems .) in most configurations , this lower level object is a servicemanager 220 . the servicemanager 220 is the object configured to handle the services , i . e ., named actions that can be invoked on an information object , provided by the information object . again , as described above , this is a fundamental departure from typical systems where every service is programmed . instead , the servicemanager 220 manages a collection of services 310 . as in the case of the worldspacemanager 210 , the servicemanager 220 also operates on another icontent interface 325 . this interface is typically exposed by a contentmanager 230 . whereas the servicemanager 220 manages the services for information objects , the contentmanager 230 primarily manages the properties and relationships of information objects , called elements 320 . the contentmanager 230 also provides directives 330 that performs functions , either directly , or by interacting with the actual information that comes from an object that interacts with network available information , an informationcontent 340 . this object also exposes the icontent interface 335 . this layering of icontent interfaces 305 , 315 , 325 , and 335 is one of the techniques that allow gia to work . the actual structure of an information object can be the full set of layers described above , or simply an informationcontent object 340 . without this layered approach , the first concept identified as number 3 above would not be possible . the service objects 310 identified above can invoke directives 330 , other service objects ( not shown ), and / or events 350 . an event is a broadcast message in real - time that says something has happened ( consistent with the traditional meaning of “ event ” in software development ). in addition to supporting the standard use of events , gia provides an event / service interaction model for managing information source actions . these capabilities provide all of the service requirements needed to support information objects . in addition , the inclusion of a full event model , where events can trigger other services , allows for both synchronous and asynchronous processing of events . this event model provides the entire information object capabilities required . when some change occurs on a network - available information store that is important to the information object , the informationcontent object 340 can notify the appropriate object of the change event , and have it handled properly . the final structure required to support information objects is the element structure . these are of two primary types , vectorelements 360 and propertyelements 370 . there are also two different types of propertyelements 370 , those that work with propertyelements 370 , and those that work as part of the informationcontent 340 , contentcomponents 380 . propertyelements 370 can refer either to these contentcomponents 380 or to other propertyelements 370 . vectorelements provide the relationship capability that information objects require . they reference a vector 390 which can navigate to another information content representing other information objects that are in relationship with the primary information object that is diagrammed . the objects assembled above illustrate the configurability that was mentioned before . each of the components of information object become component objects of that information object : services become service objects 310 , properties become propertyelements 370 , relationships become vectors 390 , and navigable relationships become vectorelements 360 . this approach provides the flexibility to define information objects in virtually any way that makes sense ( within the limitations that define “ information objects ”). moreover , because gia is designed as a gia application , these definitions themselves are information objects . in fact , the data stores that are illustrated in fig4 describe the data stores that are used to assemble gia itself , and have names that tie back to many of the objects described above . an important consequence of this assembly of an information object from component objects is not obvious : the assembled information object functions as an executable implementation of that information object &# 39 ; s specification (“ configuration ”). in effect , the information object represents the executable object described by the configuration , not a specification that is then interpreted by some other ( large ) “ information object program ,” the traditional approach . in a very real way the dss 200 executes the specification 250 — no traditional programming is required . the use of a common interface for all of the structures is another important aspect of the invention : by using that approach the same sets of configurations can be used to represent information sources , information objects , and user - specific information objects . this commonality makes the implementation of the dal 120 , and the adaptation of the dal 120 , achievable , unlike the conventional situation where every information object has its own interface . fig4 illustrates a supporting data structure 400 according to an embodiment of the invention . particularly , the figure describes the data stores 410 that are used to assemble the dss . the most fundamental data store is the xtype data store 430 . the xtype data store 430 describes the different types of information objects 420 that are available in the dss 200 . each xtype has a collection of services 410 ( a ) and elements 410 ( b ) that are associated with it , as well as a set of information sources (“ source ”) 410 ( c ) from which it gets information . each source 410 ( c ) has components (“ column ”) 410 ( d ) and connections 410 ( e ) with which it communicates to get network - available information . relationships between xtypes 430 are defined by vectors 410 ( f ), and navigation from one information object to another is done by elements 410 ( b ) that point to vectors 410 ( f ). a structure that can be used to assemble a simple form - based user interface is also illustrated according to an embodiment of the invention . forms 410 ( g ) can be made up of windows 410 ( h ), which are in turn made up of fields 410 ( i ). windows 410 ( h ) manage a particular xtype 430 , and their fields 410 ( i ) are associated with particular elements 410 ( b ). in addition to the base definition of the information object depicted by the data stores listed above , three other data stores have important implications for the behavior of the assembled gia instances . the user 410 ( j ) is represented in a data store . there are access vectors 410 ( k ) that make up the worldspace 420 definition that determine which of the components 410 ( i ), windows 410 ( h ), forms 410 ( g ), and which xtypes 430 to which the user has access . the following tables illustrate a simple configuration of a user interface that displays and allows updating of the customers of the bank , and their bank accounts . this example application uses two xtypes : the bankcustomer and the bankaccount . the bankcustomer uses a customer source that has “ columns ” customerno and name ( in this application , the “ columns ” are likely to be actual columns in a table ). these are mapped to the elements : customernumber and customername , respectively . in addition to the two propertyelements , there are two vectorelements : customers and accounts . the former represents lists of customers , and the latter represents the listing of the bankaccounts for any given customer . likewise , we have the corresponding examples from the bankaccount xtype . table 2 illustrates the vector specifications of this example application . the vectors are specified by the target xtype to which the vector navigates , and the elements of the starting xtype that will be used to perform the navigation . table 3 illustrates a simple user interface , displaying a list of customers ( note “ customers ” vectorelement ), their customer and name , and then the bank accounts that belong to them , including both the type and balance . tables 1 through 3 illustrate a configuration of a simple form as described in the data stores outlined above ( worldspace not illustrated ). the forms 410 ( g ) have a collection (“ vector ”) of windows 410 ( h ), the windows 410 ( h ) have a vector of fields 410 ( i ), and the fields 410 ( i ) are associated with elements 410 ( b ). these in turn are used to update columns 410 ( d ) in a source 410 ( c ). in addition , windows 410 ( h ) use a vectorelement to describe which instances of their associated xtype 430 that should be displayed when the window is first displayed . the set of data stores illustrated in fig4 are ones used in an exemplary embodiment of the invention , and also represent an example representation of information objects 430 . however , this actual set of data stores is not fundamental to gia . what is fundamental is the way gia is assembled from these data stores 410 . in traditional systems these data stores would be represented by some set of objects of some particular type . in gia the description of the way that one assembles these objects is described in the data stores themselves , and then assembled as information objects 420 . fig5 illustrates a bootstrap operation 500 according to an embodiment of the invention . ( bootstrap is the process of starting up a complex system by initially starting up a simple system that then starts up the more complex system by following a procedure that is intelligible to the simpler system .) bootstrapping a reflexive architecture is particularly challenging : one has to be able to start up the simple system with very few concepts if the system is to be truly reflexive . the bootstrap operation 500 is required where a subset of gia functionality is assembled using simple contentmanagers 230 , which are then used to assemble the more complex gia capabilities using compoundcontentmanagers 510 . the data store that represents an information object is called an “ xtype ” 520 . an xtype is a fundamental object for a gia . ( one surprising result is the information object for xtype 520 uses a compoundcontentmanager 520 .) again , gia accomplishes full configurability because the objects that represent gia are themselves configured information objects . this reflexive , self - describing characteristic of gia enables gia as the engine that creates objects that represent executable expressions of information object specifications described in object metadata . the servicemanager 220 is the object that can be configured to handle a collection of information object services . the object that functions as the primary interface for an information object is the worldspacemanager 210 , supporting limitations on the instances of information objects that get exposed to the user . fig6 illustrates a contentserver system 600 according to an embodiment of the invention . particularly , a contentserver 240 can have many possible data sources such as , but not limited to , relational database management system ( rdbms ) tables 610 , flat files ( files within a file server directory ) 620 , data streams 630 , and / or another dss through a dssmanager 110 . this list is not exhaustive as other sources can be accommodated as required by creating a contentserver 610 suitable for that data source . for example , a sqlcontentserver can be created that integrates with a microsoft sqlserver and then can be configured via metadata to point to any sqlserver database and table . alternatively , an rfidcontentserver could be created that listens to a radio frequency identification ( rfid ) server to track and report the location of physical assets . this rfidcontentserver would then be configured via metadata to listen to the rfidserver ( via host and port ). in yet another alternative , a dsscontentserver could be created that points to another dss node and allows us to access and update information about an xtype on that dss node . in this way we can have a network of dss nodes interacting with each other . a key capability of gia is the normalization of the object namespace . objects typically have three kinds of names : the name of the type of object , the name of each of its properties , and the names of the methods ( services ) it exposes . gia provides a normalization of this namespace from the content namespace ( also known as the native namespace ) to a gia namespace . it does this using the contentmanager to manage the transformation of informationcontent ( which is in native format ) to gia namespace and back . for instance a contentserver could point to a xtsales table with columns saleno , custno , and entrydt that is known in gia as salesorder with elements of salesordernumber , customernumber , and entrydate . gia manages the transformation of information between these two namespaces . vectors are a key component to building gia in that they describe how one object can be related to another . vectors do this either on a per object basis ( stan owns a red corvette ) or on a per object type basis ( salesorders have salesorderlines ). additionally vectors themselves can be described by vectors . this allows for two important capabilities , vector - chains and vector - sets . a vector - chain is a vector that represents the composition of two or more vectors where the “ to ” information object of the first vector is the “ from ” information object of the second vector . vector - chains can be components of vector - chains so that any number of vectors with the appropriate to - from relationship can be chained together . vector - chains allow for a vector to be configured as two or more other vectors , which are traversed in turn , navigating to the objects of interest . the results of the first vector traversal become the input for the traversal of the second vector , and so forth . vector - sets allow a vector to be configured as a collection of other vectors , each of which are traversed from the same starting object , and the objects returned by that traversal are then added to the overall result set . the traditional role of object methods as in standard object - oriented development terminology is provided by services . services are configured using a set of standard directives ( in effect , representing service “ primitives ,” and actually implemented by object methods ). services themselves can point to zero or more other services , allowing service chains to be built . thus , unlike standard information systems where processing must be described in code , complex behavior can be configured in gia from assembling simple directives and the services that use them . moreover , if some behavior is needed in the future not accounted for in an existing directive , new classes of contentmanagers 230 can be created that implement that functionality as a directive . event sources are supported both in and outside of dss . inside , a service or contentmanager 230 can raise events . outside of a dss , contentservers 230 can be configured to listen for external events ( new ground surface radar readings , additions to a table , etc . ), and then raise this as an internal event . events are processed by pointing them at a service . applications are built by creating forms ( toui ) around objects that participate in a common set of functionality . of necessity , the first two applications were ( 1 ) the application that supports the entry of metadata of the basic gia objects ( xtype , element , etc . ), and ( 2 ) the application that supports the creation of a simple toui ( forms , windows , and fields ), that enabled application ( 1 ). fig1 - 6 ( and their associated text in the preceding section ) outline how the gia model is designed and built and achieves the capabilities described in the preceding paragraphs . the invention has been described herein using specific embodiments for the purposes of illustration only . it will be readily apparent to one of ordinary skill in the art , however , that the principles of the invention can be embodied in other ways . therefore , the invention should not be regarded as being limited in scope to the specific embodiments disclosed herein , but instead as being fully commensurate in scope with the following claims . | 6 |
as stated above , optical fiber cable design , while simple in concept , is extremely complex in practice . a major reason for the complexity is the large number of factors that intervene between a mechanical force applied at the exterior boundary of an optical fiber cable , and the glass optical fibers , sometimes buried deep within the cable . in tracing a force being translated through the cable from the source to the optical fiber , many material interfaces are traversed . for example , the optical fiber cable design described and claimed in u . s . pat . no . 7 , 720 , 338 , a very successful commercial singlemode fiber product offered by ofs fitel , llc . as accupack ™, the force crosses seven interfaces bounding six layers of materials , each having different mechanical properties . some of these can be predicted , following existing established models , while many cannot . it can be appreciated intuitively that the impact of a change in any layer , or layers , may have complex and unforeseen consequences . as a result , modern optical fiber cable design follows a path of using sophisticated mechanical design tools combined with costly and expensive empirical studies . this background explains in part why a seemingly straightforward change in the dimensions of the optical fibers in a known optical fiber cable design may result in performance degradation , and why fixing that degradation is not an obvious matter . the cable design referred to above described above performs extremely well when the optical fibers are single mode . however , when 50 - mmf are substituted , the cable performance is degraded . reasons for this degradation were explored and it was found that the properties of the outer jacket have greater impact on the mechanical and optical performance of the cable than previously thought . of the seven interfaces and six material layers described earlier as influencing the transmission performance of the optical fibers deep within the cable , the cable jacket is the farthest removed . thus it was expected to have minimal influence on the optical fibers . however , empirical studies have demonstrated otherwise . design complexity is such that changing any one of the many design parameters may be modeled in an attempt to predict the mechanical stress profile for the overall cable these turn out to be best estimates only , and not always accurate . if the predictions were accurate it would be possible to write algorithms for cable design , and the industry would accept those as characterizing commercial product . but the industry recognizes the complexity of multilayer cable design , and the inability to accurately predict the consequence of design changes . this , to the point that international industry cable standards require empirically measured performance data before a manufacturer can represent that a cable design is acceptable according to industry standards . referring to fig1 , a twelve 50 - mmf fiber embodiment of the invention is shown with the twelve 50 - mmf optical fibers 11 , encased and embedded in a soft acrylate matrix 12 . the elements in the figures are not drawn to scale . surrounding and encasing the soft acrylate matrix is a relatively hard acrylate encasement layer 13 . together , the 50 - mmf optical fibers , the acrylate matrix , and the acrylate encasement layer , comprise a round dual layer optical fiber buffer encasement . in this embodiment the optical fiber buffer encasement contains 12 50 - mmf optical fibers , but may contain from 2 - 24 optical fibers . optical fiber buffer encasements with 4 to 12 50 - mmf optical fibers may be expected to be most common in commercial practice . the dual - layer acrylate construction of the optical fiber buffer encasement , with the soft inner layer and hard outer layer , functions to minimize transfer of bending and crushing forces to the optical fibers , thus minimizing signal attenuation . alternatively the optical fiber buffer encasement may have an oval cross section . the term matrix is intended to mean a body with a cross section of matrix material in which other bodies ( optical fibers ) are embedded . encasement is intended to mean a layer that both surrounds and contacts another body or layer . the soft acrylate matrix and the hard acrylate encasement are preferably uv - curable acrylates . other polymers may be substituted . the uv - curable resins may contain flame - retardants to improve the overall fire resistance of the cable . the acrylates may be clear or color coded . the color code , or other suitable marking , may indicate the type of fiber , 50 - mm , and the flame retardant characteristics . alternatively , a flame retardant polymer layer may be extruded over the dual layer optical fiber buffer encasement . this may be useful in especially demanding applications , for meeting the nfpa 262 - 2011 plenum fire standard . the extruded flame - retardant coating may be made from : pvc , low - smoke pvc , pvdf , fep , ptfe , compounded fluoropolymer blends , low - smoke zero halogen polyolefin - based resins , flame retardant thermoplastic elastomers , and flame retardant nylons . specific examples are dow chemical dfde - 1638 - nt exp2 non - halogen resin , and 3m dyneon 31508 / 0009 pvdf . the nfpa 262 - 2011 fire protection standard is a rigorous flame retarding test used throughout the industry . it is available from the national fire protection association . the test is straightforward and , for brevity , the details are not repeated here . this standard applies to the overall cable designs described in this specification . other fire protection standards are used in the industry , for example the iec 60332 - 3 - 24 flame spread test and iec 61034 - 2 smoke emission test . in general , international flame retardant standards may be referred to as class d , class c , or class b2 of the en 50399 fire safety test . the cable designs described here , with suitable flame and / or smoke retardants , are designed to meet these standards . as a general prescription , these are referred to as fire protection standards . in some industry applications there is also a requirement that the optical fiber cable be devoid of halogen - containing materials . these are referred to as non - halogen cables . the teachings herein apply in a general sense to non - halogen cables . the optical fiber buffer encasement is encased with a wrap 14 of reinforcing yarn , preferably polyaramid , although glass yarn could be used . the yarn may be run straight or may be helically twisted . an outer flame - retardant polymer jacket 15 is formed around the buffer encasement and the reinforcing yarn . suitable jacket polymers are pvc , low - smoke pvc , pvdf , fep , ptfe , compounded fluoropolymer blends , low - smoke zero halogen polyolefin - based resins , flame retardant thermoplastic elastomers , and flame retardant nylons . the jacket polymer may contain uv stabilizers to allow use of the cable in exposed environments . an advantage of using uv - cured acrylates in the dual - layer acrylate buffer encasement is that the cabling operation used to apply uv - cured coatings is rapid and cost effective . the following describes the production of the dual - layer acrylate buffer encasement at high cabling speeds . the method used is to apply the coating material as a prepolymer , and cure the prepolymer using uv light . the dual - layer acrylate coatings are applied in tandem or simultaneously ( using a two compartment dual die applicator ). in the tandem method , sometimes referred to as “ wet on dry ”, a first coating layer is applied , and cured , and the second coating layer is applied over the cured first layer , and cured . in the simultaneous dual coating arrangement , sometimes referred to as “ wet on wet ” both coatings are applied in a prepolymer state , and cured simultaneously . the uv curable polyacrylate prepolymers are sufficiently transparent to uv curing radiation , i . e ., wavelengths typically in the range 200 - 400 nm , to allow full curing at high draw speeds . other transparent coating materials , such as alkyl - substituted silicones and silsesquioxanes , aliphatic polyacrylates , polymethacrylates and vinyl ethers have also been used as uv cured coatings . see e . g . s . a . shama , e . s . poklacki , j . m . zimmerman “ ultraviolet - curable cationic vinyl ether polyurethane coating compositions ” u . s . pat . no . 4 , 956 , 198 ( 1990 ); s . c . lapin , a . c . levy “ vinyl ether based optical fiber coatings ” u . s . pat . no . 5 , 139 , 872 ( 1992 ); p . j . shustack “ ultraviolet radiation - curable coatings for optical fibers ” u . s . pat . no . 5 , 352 , 712 ( 1994 ). the coating technology using uv curable materials is well developed . coatings using visible light for curing , i . e . light in the range 400 - 600 nm , may also be used . the preferred coating materials are acrylates , or urethane - acrylates , with a uv photoinitiator added . examples of coating materials suitable for use in the optical fiber buffer encasement of the cables of the invention are : the inner layer and outer layer materials may be characterized in various ways . from the general description above it is evident that the modulus of the inner layer should be less than the modulus of the outer layer . using the astm d882 standard measurement method , the recommended tensile modulus for the inner layer is in the range 0 . 1 to 50 mpa , and preferably 0 . 5 to 10 mpa . a suitable range for the outer layer is 100 mpa to 2000 mpa , and preferably 200 mpa to 1000 mpa . the layer materials may also be characterized using glass transition temperatures . it is recommended that the t g of the inner layer be less than 20 degrees c ., preferably less than 0 degrees c ., and the t g of the outer layer greater than 40 degrees c . for the purpose of this description the glass transition temperature , tg , is the point in the middle of the transition curve . tg may also be generally defined as the peak of the tan delta curve in a dynamic mechanical analysis ( dma ) plot . suitable aramid yarn for the aramid layer is available from teijin twaron bv , identified as 1610 dtex type 2200 twaron yarn . the yarn may be run straight or with a twist . the cable dimensions are largely determined by the size of the dual - acrylate subunit . a typical diameter for the 12 fiber buffer encasement described above is 1 . 425 mm . in most embodiments the buffer encasement diameter , for 2 to 12 fibers , will be less than 2 mm . the reinforcing yarn layer and the outer jacket typically add 2 to 3 mm to the cable diameter . the thickness of the outer jacket may be , for example , 0 . 7 - 3 . 0 mm , preferably 1 . 0 to 2 . 0 mm . the modulus of the outer jacket is greater than 240 mpa , and in some preferred embodiments , 300 - 500 mpa . this modulus range , along with a thickness range just specified , is recommended in order to meet the performance standards described here . one example of an effective jacket is a 1 . 06 mm thick jacket of dyneon solef 31508 / 0009 . in another preferred embodiment , the jacket is polyone eccoh 5700 low - smoke zero - halogen . optical fiber cables with more than one multiple fiber buffer encasement offer an attractive alternative design , one that produces increased fiber count while still relatively small and compact . buffer encasements of any number , for example 2 - 12 , can be combined in a single jacket . efficient packing is obtained in a cable with 6 optical fiber buffer encasements 21 , as shown in fig2 . this design has a central strength member 22 to aid in organizing the buffer encasements , within the aramid yarn layer 23 and outer jacket 24 . alternatively , the center space may be occupied by another optical fiber buffer encasement . as mentioned above , the individual optical fibers may be color coded to aid in identifying and organizing the optical fibers for ribbonizing , connectorizing , or splicing . in the embodiment shown in fig2 , the cable jackets may also be color coded to provide additional aid in organizing the optical fibers . as in the embodiment of represented by fig1 , the thickness of the outer jacket is , for example , 0 . 7 - 3 . 0 mm , and preferably 1 . 0 mm to 2 . 0 mm . again , a minimum of . 0 . 7 mm , or 1 . 0 , is expected to allow the cable design to meet the performance standards described here . as one example of an effective jacket is a 1 . 0 - 2 . 0 mm thick jacket of dyneon solef 31508 / 0009 . the compact size of the optical fiber buffer encasement allows for manufacture of smaller cables than typically found in competing cable designs . for example , the cable design of the invention allows production of cables with four encasements of twelve fibers having an od of 5 mm or less . it will be evident to those skilled in the art that uv cured acrylate resins contain photoinitiators that can be identified in the final cable product . any suitable photoinitiator may be used in implementing the invention . as previously mentioned , the cable described in conjunction with fig2 is designed to meet industry standards when 50 - mmf is used in the cable . performance testing of cables described above according to north american icea - s - 596 and telcordia gr - 409 standards shows the values in the following table . more details relevant to the materials and cable designs of the invention may be found in u . s . pat . no . 7 , 720 , 338 , and pct / us12 / 48517 , both of which are incorporated herein by reference . in concluding the detailed description , it should be noted that it will be obvious to those skilled in the art that many variations and modifications may be made to the preferred embodiment without substantial departure from the principles of the present invention . all such variations , modifications and equivalents are intended to be included herein as being within the scope of the present invention , as set forth in the claims . | 6 |
in an embodiment , a vulnerability state of a machine may be determined . a vulnerability may be any type of weakness in a machine or network . for example , vulnerabilities may be found if certain ports are left open on a internet facing device ; certain versions of operating systems may also be considered vulnerabilities ; and any other potential weakness that may be exploited may be considered a vulnerability . data regarding the machine &# 39 ; s vulnerability state may be received from various sources . the various sources may include port scanners , network vulnerability scanners , database security scanners , host based vulnerability scanners , or other vulnerability testing devices . the data received from the various sources may be combined to determine a vulnerability state of the machine that has been scanned . in some cases the data received may be a vulnerability . in some other cases , rather than identifying the vulnerabilities during a scan of the machine , the machine &# 39 ; s current state may be received and the state data may be evaluated for vulnerabilities . the data used in determining vulnerabilities may come directly from the scanned machine , or may be retrieved from an echo of the machine stored in cloud storage . an echo is a snapshot of the machine &# 39 ; s state that may be stored in cloud based storage or some other remotely accessible storage . the machine state may be characteristics and attributes of the machine or other information relevant for use in determining vulnerabilities of the machine . scanning the echo for vulnerabilities rather than scanning the actual machine may free up resources at the machine and may allow scanning even if the machine is currently offline , e . g . not connected to a network . the data may be gathered by devices outside the network the machine resides in , e . g ., from outside a corporate network firewall , or from inside the network the machine resides in , e . g ., from inside a corporate network firewall . data gathered from outside of the network that the machine resides in , for example by scanning , may provide insight into how outsiders and potential hackers see the customer &# 39 ; s network . data gathered from inside of the network that the machine resides in , for example from an agent or other scanner deployed in the network , may help with detecting vulnerabilities that may only be found from within the network . for example , vulnerabilities may be caused by newly installed machines in the network , as well as other hard to scan areas inside the network . data may also be gathered by a collector . a collector may receive data from devices that manage an environment , e . g ., the customer &# 39 ; s network . thus , a device that manages a network where the scanned machine resides may be able to provide data for use in determining vulnerabilities of the machine . as an example , when using virtualization software such as vmware , there may be a machine inside a vmware server . there may also be vmware software that manages the vmware environment . the collector may talk to the vmware software to gather information about what the vmware software knows about the machine . thus , the data gathered is about the machine , but not gathered directly by the collector from the machine . in some embodiments , the data that may be analyzed for vulnerabilities may be gathered in a pseudo - continuous fashion . the vulnerability state may also be updated in a pseudo - continuous fashion . continuous scanning of a system may cause problems with the availability of the system for its intended purpose . continuous scanning may result in the network being unavailable for its intended users , similar to a denial of service ( dos ) network attack . thus , pseudo continuous scanning , in other words , as much scanning as possible without adversely affecting availability of the machine or network may be used . pseudo - continuous scanning may be different than the scanning employed by many network scanning systems , which may use a weekly scan that returns one large data set . weekly scans present a problem of one very large result set . large result sets require more time and processing power to analyze and may result in vulnerabilities being missed . further , periodic scanning may result in vulnerabilities that exist for several hours or days before detection . some embodiments may use continuous scanning if the scanned machine and network are capable of handling the increased traffic and processing that results from a continuous scan . in some embodiments , to reduce the impact of scanning on a network or device , the network or device may be scanned in a piecemeal fashion . for example , a customer may decide to scan a first portion of a machine or network at time a and then the remaining portion at time b . scanning only a part of the device or network may result in a lower impact to network resources . in this case , scan a and scan b would need to be combined in order to have a complete status of the network . sometimes , the data related to a scanned network or machine received from a first source may overlap with data related to the scanned network or machine received from a second source . for example , a first scan may indicate that a port is closed , while a second scan may indicate that the same port is open . when conflicting data is received , a determination may be made as to which source is more reliable , and the data from the more reliable source may be used for determining the vulnerability state . continuing the example , a decision may be me made as to which scan is authoritative regarding the port . the decision may be based on thoroughness of the scans , proximity of the scanner , or other relevant factors . there are several ways a vulnerability delta may exist . in some cases , a current vulnerability state may be different from a previous vulnerability state . in these cases , the differences between the two states would be considered deltas . as an example , a technician may install a new application on a monitored computer , if the application is not up to date , it may contain one or more vulnerabilities . in this case a delta would exist because of the newly installed application . in some other cases , a previously unknown vulnerability may be discovered . in these cases , the current vulnerability state may contain the newly discovered vulnerability , resulting in a delta . as an example , a zero day exploit may be discovered by a network security professional . a notification may be sent to the network monitoring systems to monitor for the newly discovered vulnerability . some machines may be vulnerable to the exploit , and thus a delta may exist , even though the state of the machine has not changed . rather than reporting the entire vulnerability state to the end user each time scan data is received and the vulnerabilities are updated , only the deltas may be reported to the end user . reporting deltas may be useful for systems that have a mature state and see a minimal amount of change to configurations of machines and / or the network . even if the system is not mature , reporting deltas may be useful for reducing the length of reports network security users are responsible for reviewing as well as other advantages gained by providing deltas to users . in some cases , the end user may configure the system such that only specific deltas are alerted on . thus , only a subset of deltas may be sent to the end user as alerts . as used herein , processors may control actions of a device or machine . any actions described as being taken by a processor might be taken by the processor alone or by the processor in conjunction with one or more additional components . additionally , while only one processor may be shown in certain devices , multiple processors may be present . thus , while instructions may be discussed as being executed by a processor , the instructions may be executed simultaneously , serially , or otherwise by one or multiple processors . a processor may be implemented as one or more cpu chips and may be a hardware device capable of executing computer instructions . the processor may execute instructions , codes , computer programs , or scripts . the instructions , codes , computer programs , or scripts may be received from an i / o module or from memory . as used herein , an i / o module may include modems , modem banks , ethernet devices , universal serial bus ( usb ) interface devices , serial interfaces , token ring devices , fiber distributed data interface ( fddi ) devices , wireless local area network ( wlan ) devices , radio transceiver devices such as code division multiple access ( cdma ) devices , global system for mobile communications ( gsm ) radio transceiver devices , universal mobile telecommunications system ( umts ) radio transceiver devices , long term evolution ( lte ) radio transceiver devices , worldwide interoperability for microwave access ( wimax ) devices , and / or other well - known devices for connecting to networks . i / o modules may also include liquid crystal displays ( lcds ), touch screen displays , keyboards , keypads , switches , dials , mice , track balls , voice recognizers , card readers , paper tape readers , printers , video monitors , or other well - known input / output devices . as used herein , memory may include random access memory ( ram ), read only memory ( rom ), or various forms of secondary storage . ram may be used to store volatile data and / or to store instructions that may be executed by a processor . rom may be a non - volatile memory device that may have a smaller memory capacity than the memory capacity of a secondary storage . rom may be used to store instructions and / or data that may be read during execution of computer instructions . access to both ram and rom may be faster than access to secondary storage . secondary storage may be comprised of one or more disk drives or tape drives and may be used for non - volatile storage of data or as an over - flow data storage device if ram is not large enough to hold all working data . secondary storage may be used to store programs that may be loaded into ram when such programs are selected for execution . fig1 is a block diagram of an embodiment of a system for detecting vulnerability state deltas . a customer network 190 may be made up of an internal network 105 and a perimeter network 110 . internal network 105 may contain servers 115 120 . while two servers 115 120 are shown , it should be understood that any number of servers may be present in internal network 105 . additionally , the servers 115 120 may coexist on a single physical machine , or may each be their own separate machine . server 115 may comprise a memory 116 , processor 117 , and an i / o module 118 . server 120 may comprise a memory 121 , processor 122 , and an i / o module 123 . server 115 120 may be mail servers , data servers , or any other type of server that resides within a network . internal network 105 may also contain collector 125 . collector 125 may comprise a processor 127 , memory 126 and an i / o module 128 . collector 125 may be used to gather data about devices in the customer network 190 without actually interacting with the devices that the data is related to . for example , collector 125 may interact with various network control devices to gather information from the network control devices about the other machines in the customer network 190 . collector 125 may provide the data or vulnerability information to state assembler 150 . internal network 105 may also include agent 130 . agent 130 may comprise a memory 131 , a processor 132 , and / or an i / o module 133 . while agent 130 is depicted as a single block , agents 130 may installed on each machine in the customer network 190 , or several agents 130 may monitor the machines in the customer network 190 . agent 130 may scan the internal network 105 for vulnerabilities and other data . agent 130 may scan server 120 for vulnerabilities and / or other data related to the current state of server 120 . agent 130 may also scan the internal facing side of web server 140 for vulnerabilities and / or other data related to the current state of web server 140 . agent 130 may provide the data or vulnerability information to state assembler 150 . while agent 130 and collector 125 are depicted as separate blocks , in some embodiments agent 130 and collector 125 may reside in a single appliance , or on other servers within the network , or both . further , more than one agent 130 and collector 125 may be present in an internal network . perimeter network 110 may contain webs servers 135 140 . while two webs servers 135 140 are shown , any number may be used in perimeter network 110 . web server 135 may comprise a memory 136 , a processor 137 , and an i / o module 138 . web server 140 may comprise a memory 141 , a processor 142 , and an i / o module 143 . perimeter network 110 may act as a network between internal network 105 and internet 160 . perimeter network 110 may also be referred to as a dmz . external users may only access internal network 105 via perimeter network 110 . a hacker or other malicious actor may gain access to internal network 105 by going through perimeter network 110 , in some cases by compromising an external network device , for example webservers 135 140 . security network 180 may be an external secure network that assists in monitoring customer network 190 . security network 180 may contain a scanner 145 . scanner 145 may comprise a memory 146 , a processor 147 , and an i / o module 148 . while only one scanner 145 is depicted , any number of scanners 145 may be deployed in security network 180 . scanner 145 may be used to scan the external facing portion of web servers 135 140 . scanner 145 may be used to determine vulnerabilities of the web servers 135 140 . scanner 145 may be used to approximate the view a hacker or other outsider may have of customer network 190 from an entity external to customer network 190 . in some embodiments , scanner 145 may not identify vulnerabilities , but may instead take a snapshot of the current state of web servers 135 140 . in any case , wither the current state or the vulnerability data may be provided to state assembler 150 . state assembler 150 may comprise a memory 151 , a processor 152 and an i / o module 153 . state assembler 150 may receive data from various sources including scanner 145 , collector 125 , and / or agent 130 . the data may include a current state of a machine and / or vulnerabilities associated with the machine . state assembler 150 may use the data to create a vulnerability state for machines in customer network 190 . the state assembler 150 may use data from one , some , or all of the data sources to create the vulnerability state . for example , the vulnerability state may be based only on data from scanner 145 , or vulnerability state may be based on data from any combination of sources . vulnerability state database 155 may be used by state assembler 150 to store vulnerability states of various machines . when new data is received by the state assembler 150 , the vulnerability state may be updated and any differences between the stored vulnerability state and the new vulnerability state may be reported as deltas to users in the customer network 190 and / or users in the security network 180 . fig2 is a data flow diagram of an embodiment of a system for detecting vulnerability state deltas . state assembler 150 may comprise a composite generator module 205 and a vulnerability state monitor 245 . composite generator module 205 may receive a flow of data 260 from various sources . the flow 260 may comprise scan data 210 , agent data 215 , collector data 220 , other data 225 , second agent data 230 , and second scan data 235 . the various data received may relate to one or many monitored machines . scan data 210 may be received from web - based scanners , agent data 215 may be received from agents installed in a customer &# 39 ; s network , collector data 220 may be received from collectors with knowledge of the customer &# 39 ; s network , and other data 225 may come from various other sources that may provide data related to machines in the customer &# 39 ; s network . the flow 260 may be received in series , one data source at a time , or in some cases may be received in parallel , more than one data source at a time . processing by the composite generator 205 of the various data in the flow 260 may occur in parallel or series . the flow 260 may contain data related to one customer &# 39 ; s network , or many customers &# 39 ; networks . composite generator 205 may receive data in flow 260 related to a monitored machine and combine the data related to the monitored machine to create a composite view 270 of the monitored machine based upon the received data . while only one composite view 270 is shown , many composite views may be created based upon the number of monitored machines . composite generator 205 may also determine which of a plurality of monitored machines a piece of data is from based upon information contained within the data . for example , if two machines are being monitored , composite generator 205 may analyze the received data in flow 260 and determine which of the two machines the data is related to based upon information contained in the data . composite view 270 may be made up of scan data 210 , agent data 215 , collector data 220 , and other data 225 . while the composite view 270 shown here is made up of four data sources , it may be made up of any number of data sources . region 240 of composite view 270 may indicate an overlap of data provided by scan data 210 and agent data 215 . while the overlap 240 is shown between scan data 210 and agent data 215 , the overlap may occur between any data sources that provide data related to a machine . as an example , scan data 210 may indicate that a port is open on a machine , agent data 215 may indicate that the port is closed on the machine . thus , because both data describe the port , they are considered to overlap . when there is an overlap 240 and there is conflicting data in the overlap 240 , a decision must be made as to which data is more reliable . in this case , agent data 215 may be found to be more reliable because the agent that provides agent data 215 may reside within a customer network and the scanner that provides scan data 210 may be outside of the customer network . various other criteria may be used to determine the reliability of received data . composite generator module 205 may transmit the composite view 270 to vulnerability state monitor 245 after resolving any overlaps . vulnerability state monitor 245 may determine a vulnerability state of a machine that the composite view 270 describes . the composite view 270 may contain a listing of vulnerabilities of the machine , or data about the machine , which the vulnerability state monitor 245 uses to determine vulnerabilities . once the vulnerability state of the machine is determined it may be stored in vulnerability state database 155 . at some point in time after composite view 270 has been generated and transmitted to vulnerability state monitor 245 , the composite generator 205 may receive second agent data 230 and second scan data 235 . although not pictured here , additional data from various sources may also be received at any time . the composite generator may update composite view 270 based upon the second agent data 230 and second scan data 235 . the updated composite view may then be transmitted to vulnerability state monitor 245 where an updated vulnerability state may be generated and compared to the stored vulnerability state in the vulnerability state database 155 . any differences between the stored vulnerability state and the updated vulnerability state may be referred to as deltas . when deltas are found by vulnerability state monitor 245 , a delta alert 255 may be transmitted to an interested user . in some cases , the interested user may wish to be notified about only certain types of deltas . in this case , vulnerability state monitor 245 may have stored a list of preferences as to which deltas result in a delta alert 255 . composite generator module 205 may continuously receive additional data from the various data sources regarding monitored machines . composite generator 205 may update composite views for each monitored machine as soon as the additional data is received . thus , the deltas are provided in real time based upon continuous monitoring of the machines . in other embodiments , deltas may be updated periodically based on time or amount of data received or other factors that may trigger a change in vulnerabilities . fig3 is a flow diagram of an embodiment of a method for detecting vulnerability state deltas . at step 310 , a state assembler may receive data related to a machine . the data may include the machine &# 39 ; s vulnerabilities or other status data related to the machine . the data may be received from one or many sources . in some cases the resources described by the data may overlap , in these cases , the state assembler may make a determination as to which source is more accurate and use the data from the more accurate source . once the data has been received , a vulnerability state of the machine is determined at step 320 . the vulnerability state may be determined by choosing data that is the most reliable and combining the data from various sources to make a single vulnerability state for each machine . the vulnerability state may be stored at step 330 . when the next iteration of data collection is complete , the data may be provided to the state assembler at step 340 . the state assembler may update the vulnerability status at step 350 . at step 360 , the state assembler or other comparator may compare the stored vulnerability state with the updated vulnerability state to determine deltas between the two . any differences between the states may be reported as deltas at step 370 . as used herein , networks may represent any form of communication network between connected machines and any other network elements , and may also represent a collection of machines or virtual machines operable to provide cloud computing services to users . networks may include a public cloud or a private cloud . networks may include routers , hubs , switches , firewalls , content switches , gateways , call controllers , and / or any other suitable components in any suitable form or arrangement . networks may include , in whole or in part , one or more secured and / or encrypted virtual private networks ( vpns ) operable to couple one or more network elements together by operating or communicating over elements of a public or external communication network . computing devices may include any device with a network interface , which includes , but is not limited to , network components , desktop computers , laptops , or mobile devices . while various embodiments in accordance with the disclosed principles have been described above , it should be understood that they have been presented by way of example only , and are not limiting . thus , the breadth and scope of the invention ( s ) should not be limited by any of the above - described exemplary embodiments , but should be defined only in accordance with the claims and their equivalents issuing from this disclosure . furthermore , the above advantages and features are provided in described embodiments , but shall not limit the application of such issued claims to processes and structures accomplishing any or all of the above advantages . as referred to herein , a machine or computing device may be a virtual machine , computer , node , instance , host , or machine in a networked computing environment . also as referred to herein , a networked computing environment is a collection of machines connected by communication channels that facilitate communications between machines and allow for machines to share resources . also as referred to herein , a server is a machine deployed to execute a program operating as a socket listener and may include software instances . a networked computing environment may include , but is not limited to , computing grid systems , distributed computing environments , cloud computing environment , etc . such networked computing environments include hardware and software infrastructures configured to form a virtual organization comprised of multiple resources which may be in geographically disperse locations . services and applications are described in this application using those alternative terms . services can be java services or other instances of operating code . a service / application is a program running on a machine or a cluster of machines in a networked computing environment . services may be transportable and may be run on multiple machines and / or migrated from one machine to another . various terms used herein have special meanings within the present technical field . whether a particular term should be construed as such a “ term of art ,” depends on the context in which that term is used . “ connected to ,” “ in communication with ,” or other similar terms should generally be construed broadly to include situations both where communications and connections are direct between referenced elements or through one or more intermediaries between the referenced elements , including through the internet or some other communicating network . “ network ,” “ system ,” “ environment ,” and other similar terms generally refer to networked computing systems that embody one or more aspects of the present disclosure . these and other terms are to be construed in light of the context in which they are used in the present disclosure and as those terms would be understood by one of ordinary skill in the art would understand those terms in the disclosed context . the above definitions are not exclusive of other meanings that might be imparted to those terms based on the disclosed context . words of comparison , measurement , and timing such as “ at the time ,” “ equivalent ,” “ during ,” “ complete ,” and the like should be understood to mean “ substantially at the time ,” “ substantially equivalent ,” “ substantially during ,” “ substantially complete ,” etc ., where “ substantially ” means that such comparisons , measurements , and timings are practicable to accomplish the implicitly or expressly stated desired result . additionally , the section headings herein are provided for consistency with the suggestions under 37 c . f . r . 1 . 77 or otherwise to provide organizational cues . these headings shall not limit or characterize the invention ( s ) set out in any claims that may issue from this disclosure . specifically and by way of example , although the headings refer to a “ technical field ,” such claims should not be limited by the language chosen under this heading to describe the so - called technical field . further , a description of a technology in the “ background ” is not to be construed as an admission that technology is prior art to any invention ( s ) in this disclosure . neither is the “ summary ” to be considered as a characterization of the invention ( s ) set forth in issued claims . furthermore , any reference in this disclosure to “ invention ” in the singular should not be used to argue that there is only a single point of novelty in this disclosure . multiple inventions may be set forth according to the limitations of the multiple claims issuing from this disclosure , and such claims accordingly define the invention ( s ), and their equivalents , that are protected thereby . in all instances , the scope of such claims shall be considered on their own merits in light of this disclosure , but should not be constrained by the headings herein . | 7 |
the following description is merely exemplary in nature and is not intended to limit the present disclosure , application , or uses . it should be understood that throughout the drawings , corresponding reference numerals indicate like or corresponding parts and features . a device in accordance with the present invention is shown in fig1 and identified as a whole with reference numeral 1 . it has a body 2 with a central throughgoing opening 3 . the body 2 has a solid , impermeable wall without holes . the throughgoing opening 3 has the shape of laval nozzle . it has a cross - section which changes in an axial direction smoothly , without steps . the opening 3 has two substantially conical parts 4 and 5 which are connected with one another at their narrowest locations 6 . an inlet part 4 of the opening 3 is shorter and it is generally identified as a confuser , while the outer portion 5 is longer and is usually identified with a diffuser . the size of the portions 4 and 5 of the inner opening 3 depends on current parameters of the layer ( layer pressure , current pressure of saturation , gas content , water content , porosity , permeability , density of oil , water , gas , etc ), and also on parameters of operation of the well ( around the clock production , the nature of production oil , water , gas , condensate ), an inlet pressure , a size of an inlet nozzle , a pressure in a line , a pressure in a separator , etc . based on these parameters , with the use of computer program a specific design of the device is calculated with corresponding sizes , in accordance with which the device is produced . the device is fixed to mandrels of different types , and with the mandrel it is lowered to a desired calculated depth as close as possible to an interval of perforation . it is fixed and kept hermetically closed by means of mandrel packers and kept in this position to provide the device operation . when the efficiency of the device is reduced due to significant natural changes in the parameters of the layer , a new device is calculated and made which correspond to new current parameters of the operation of the system the layer - well , and the new device by the mandrel and known means is lowered and replaced the old one . while in fig1 the device is shown as an integral , single piece part , it can be composed of several parts as shown in fig2 . the parts of the device which are identified with reference numerals 7 , 8 , 9 , can be connected with one another by known means , for example by thread 10 . such a device can be easier and simpler to manufacture . fig3 shows an arrangement of the device in the well and its connection with tubing by means of a mandrel . reference numeral 11 identifies the tubing , reference numeral 12 identifies a mandrel of any type , reference numeral 13 identifies a gripper mechanism of the mandrel , and reference numeral 14 identifies a packer of the mandrel . the body 2 is located below the mandrel 12 . the device improves production of oil and gas condensate . when the device is used for removal of liquid from the bottomhole of gas and gas - condensate wells , the body with horizontal openings 15 is mounted above the mandrel , as shown in fig4 , or it is arranged at the end of the tubing without the mandrel by means of another element . in a further embodiment shown in fig5 the body 2 with the horizontal openings 15 is located below the mandrel and a packer 16 for mounting of the mandrel is provided with a vertical passage 17 formed for example as a longitudinal opening through which liquid and gas condensate can pass and then passing through the horizontal openings . this device can be installed without these longitudinal opening , also depending on flow conditions . fig6 shows the cross - section ( of packer a - a and horizontal holes b - b ) of the second arrangement of the device . the inventive device generates a completely homogenous gas - liquid flow in a well due to elimination of the stepped zones in a system of venturi pipes , which create sources of swirling with resulting energy losses . the parameters of the device calculated from current data of the layer and the well can provide accurate forecast without deviations from real conditions of the regulating process and optimization of the system layer - well by the device and the inlet nozzle . the elements of automatic regulation of the bottomhole device are used fuller , a mono - dispersed structure is provided for the gas - liquid flow and it can move toward the inlet of the well without deterioration into gas and liquid , and annular regime mode is not formed . efficiency of recovery and time of operation of the well with the device significantly increases , so as to increase daily productions of oil and a coefficient of oil recovery as a whole . liquid is removed from the bottomhole of the well fast and efficient and , therefore , productivity of gas and gas - condensate wells are increased due to reduction of bottomhole pressure to a calculated level . the advantages of the device in accordance with the present invention can be clearly understood from comparison of a hydraulic calculation of the known apparatus with seven venturi pipes and a new apparatus , with identical inlet and outlet openings , the total length and length of the narrowest part of the device , with respect to the well rodador 179 ( mexico ). the well productivity was as follows : oil — 138 m 3 / day , water — 56 m 3 / day or 29 %, and gas 31200 m 3 / day . bottomhole pressure was 2848 psi , the outlet pressure was 569 psi , with a diameter of the outlet nozzle 26 / 64 , the measured layer pressure was 3020 psi . the depth of the well to the lower holes of perforation was 8423 feet . oil density was 25 api , water 1 . 19 , gas 0 . 838 . the prior device with the venturi pipes before lowering into the well was calculated for pressure drop 107 psi , and the bottomhole pressure had to reduce the depression ( difference reservoir and bottomhole pressure ) by 15 %. the productivity of the well had to be increased also approximately by 15 %. in actuality , after the first test , the yield of oil increased to 153 m 3 / day or in other words by 11 %. the yield of gas and water reduced by 25 %. however , as a result of an attempt to increase the oil recovery even more and to reduce content of water during a subsequent regulation of the well , it was not possible to go beyond the range 1 / 64 ″÷ 1 . 5 / 64 ″ on adjustable top chock . negative phenomena appeared in form of a fast drop of gas volume of a main source of energy in this layer . in other words the possibility of regulation of well turned to be very limited . a calculation of pressure drop in the device in accordance with the present invention shows a drop in the device only by 65 psi . in other words , the magnitude of local resistance in the prior art device was by 42 psi or by 39 % greater than in the inventive device . this shows that the calculation for the inventive device is much more accurate the use of the device in accordance with the present invention can increase the range of regulation at the outlet up to 5 / 64 ″÷ 6 / 64 ″, and maybe even more , which is extremely important for conditions of significant fluctuations of layer and well parameters during a long time , so as to maintain and optimize the operation of the well when the device is located in the well . referring generally to fig7 a - 14 , shown is a well device 40 according to an alternate embodiment . the well device 40 is configured to convert unwanted water within the well system into an atomized vapor or mist , which is transported to the surface by the hydrocarbon stream . the well device 40 has a laval nozzle 42 and a coupling device 44 that is configured to facilitate and regulate the proper installation of the laval nozzle 42 within a well . disposed between the laval nozzle 42 and the coupling device 44 is a first interface device 46 . in this regard , the interface device 46 defines an inner threaded through bore which is configured to mate with a corresponding set of threads on an outer surface of the laval nozzle 42 . optionally , these threads can be integrally formed within the coupling device 44 or can take the form of a separate threaded mounting portion 48 . disposed at a distal end of the coupling device 44 is a second interface device 50 which is configured to couple an optional filter 47 to the coupling device 44 . centrally disposed through the laval nozzle 42 , the coupling device 44 , and the filter 47 is a through bore 60 . as described in detail below , the through bore 60 is configured to facilitate the transfer of natural gas , well products , and atomized waste water from a well bottom to the well surface . disposed on an exterior surface of the coupling device 44 is at least one sealing member 52 . the sealing member 52 is configured to sealably interface and lock the coupling device 44 with an interior surface of a well tube . specifically , the sealing member 52 is configured to interface with an inner surface 59 of a landing nipple 57 . the landing nipple 57 , as traditionally known in the art , is a tube disposed within the well bottom having a smaller diameter than the tubing 58 traditionally used to extract products from the well . the sealing member 52 can be formed of deformable and compressible hydrocarbon - compatible materials . in the regard , it is envisioned the seal members 52 can be formed of metal or polymers which can withstand the environmental conditions within the well . p as shown in fig8 , the sealing members 52 function to fluidly seal and lock the well device 40 into the landing nipple 57 . above the sealing members 52 , the coupling device 44 and laval nozzle 42 have an exterior surface having a diameter which is generally smaller than the inner diameter of both the landing nipple 57 and the tube 58 . as such , an annular fluid collecting space 62 is defined between the tube 58 and the exterior surface of the device 40 . the lower portion of the collecting space 62 is sealed by the sealing members 52 . defined within the laval nozzle 42 is at least one fluid passage 64 , which fluidly couples the annular space 62 and a throat 66 of the nozzle 42 . as described further below , the annular space 62 functions to collect unwanted water from the well tube 58 in liquid form . the passages 64 defined in the nozzle 42 function to transport water from the annular space 62 into the throat 66 , thus allowing the atomization of the waste water by pressurized hydrocarbons through the nozzle 42 . this water vapor is then transported by the flowing hydrocarbon gas to the surface . fig9 - 13 depict cross - sections of the device 40 shown in a well installation . shown is the relative positioning of the various nozzle components with respect to the tube 58 and landing nipple 57 . as shown in fig8 , and 12 , the annular space 62 is divided into two separate portions 90 and 92 . the first portion 90 is generally below the passages 64 defined by the nozzle 42 and above the sealing members 52 . any water captured within the annular chamber 90 between the nozzle 42 and the tube 58 is transported through the passages 64 into the throat 66 of the nozzle . fig1 shows that the sealing members 52 function to completely seal and center the device 40 within the landing nipple 57 . fig1 shows and exploded view of the well device 40 . shown is a general construction showing one possible method for positioning the sealing members 52 with respect to the coupling device 44 . disposed between each of the sealing members 52 is a spacer ring 55 , which holds the sealing members 52 apart and prevents their transverse movement of the sealing members 52 with respect to the coupling device 44 . it is envisioned these spacer rings 55 can be integrally incorporated into the sealing members 52 . further shown on the top of the coupling device 44 is the coupling device mounting portion 48 . the coupling device mounted portion 48 has a threaded portion which functions to threadingly engage the laval nozzle 42 . it should be noted that , when installed , the laval nozzle 42 is generally positioned above the coupling portion 44 so as to define the annular space 62 between the device 40 and the interior surface of the tube 58 . furthermore , the location of the laval nozzle 42 allows for the installation or extraction of the nozzle member from within the landing nipple 57 . disposed on a proximal end of the laval nozzle 42 is a fixation mechanism 86 . the fixation mechanism 86 defines a transverse ledge 88 , which is used by an insertion tool ( not shown ) which is releasably coupled to the device for installation . fig1 a - 15 b depict perspective and cross - sectional views of optional laval nozzles 42 . as previously mentioned , the exact configuration of a laval nozzle first confuser cone 80 and second diffuser cone 82 will depend on the specifics of the environmental conditions in the well bottom . in this regard , the length and curvature or angularity of the specific cones 80 , 82 will depend on specific gas parameters and loading within the well . as shown in fig1 b and 15 d , the associated coupling device 44 can either be integral with the laval nozzle 42 or can be a stand alone separate member . fig1 and 17 depict the insertion of the well device 40 within the well construction . as can be seen , the well device 40 is inserted using an insertion mechanism 94 so as to position the sealing members 52 within the inner surface 59 of the landing nipple 57 . it is envisioned that the device 40 has a length which is longer than the length of the landing nipple 57 . as such , the filter 47 is disposed below a lower surface 72 of the landing nipple 57 . the perforated construction as well as the location of the filter 47 allows for the maximum transport of gas from the well without having to worry about the interference of excess or extraneous water found in the well bottom . the filter 47 is located both within and outside of the landing nipple 57 . fig1 a and 18 b represent cross - sectional views of the well device 40 inserted within the well . shown is a specific configuration and location of the various components within the system . specific note should be directed to the location of the filter 47 with respect to the inner surface 59 of the landing nipple 57 . in this regard , an annular chamber 96 is formed so as to allow the maximum input of gas into the through bore 60 under many different well operating conditions . fig1 a and 19 b show the functioning of the well device 40 . in this regard , the gas 98 is shown flowing through the through bore 60 . unwanted excess water has been trapped within the annular cavity 62 by the sealing members 52 . the nozzle 42 is positioned downstream with respect to gas flow in the well from the coupling device 44 and the filter 47 . when the first chamber portion 90 of the annular space 62 fills , water is transferred into the throat 66 of the laval nozzle 42 through the passages 64 defined within the nozzle 42 . a mixture of gas 98 and atomized water 100 is pushed by the gas pressure through the nozzle second diffuser cone 82 and up to the well surface . the device 40 advantageously provides for an efficient method to remove waste water which condenses or is transported by the inner surface 76 of the tube 58 . fig2 represents the use of a wire line truck 106 to insert the well device 40 . as can be seen , a wire line 104 is coupled to the removable locking mechanism 94 . the wire line 104 is used to lower the device and , in combination with gravity , to insert the device within the landing nipple . weights are then used to impact the locking mechanism 94 to drive the device 40 into the landing nipple . after setting the device , the wire line 104 and removable locking device 94 have been removed from the well . the well is “ swabbed ” to remove unwanted water . in this regard , it is envisioned that high pressure gas would be used to force water from the system through the device 40 into the well bottom . alternatively , water can be removed from the system prior to the insertion of the well device 40 . once the water is removed , the hydrocarbon well products move through the central throughbore 60 and are retrievable from the well . the device can similarly be removed from the well using the locking device 40 . it will be understood that each of the elements described above , or two or more together , may also find a useful application in other types of constructions differing from the types described above . while the invention has been illustrated and described as embodied in device for improving oil and gas recovery in wells , it is not intended to be limited to the details shown , since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention . | 4 |
fig1 a to 1 c show a possible embodiment of an insert which can be use provide a non - return valve in a conduit . the insert 10 comprises an open - ended body 12 formed by a continuous substantially cylindrical or annular wall , having a seal 14 , for example a rubber seal , on an inner surface thereof . as will be understood further from the description below , the seal 14 is shaped so as to cooperate with a substantially rigid valve flap 16 so that , when the valve flap 16 is in a closed position within the insert 10 in use , a reliable seal against passage of fluid or other material therethrough is formed . in the embodiment shown in fig1 a to 1 e , the insert 10 is usable in a pipe or conduit having a substantially circular cross - section . therefore the surface of the insert body 12 is substantially annular , the valve flap 16 is substantially circular in plan view and the seal 14 is substantially semi - circular or u - shaped in cross - sectional side view . as can be appreciated best from fig7 a and 7 b herein , the thickness of the substantially annular wall which forms the body 12 of the insert 10 shown in fig1 a to 1 d varies along its circumference . the lower semi circular portion of the wall when viewed in cross section is relatively thin , whilst the upper semi circular portion of the wall when viewed in cross section is relatively thick . this configuration arises because , as described below , a slot can be made in a pipe for fitting the insert 10 therein and so the upper part of the body 12 of the insert 10 should be thicker to account for the lack of pipe wall where that slot has been cut . the insert 10 as shown in fig1 a to 1 c further comprises a combined hinge and spring mechanism 18 . the valve flap 16 attaches to the body 12 of the insert 10 via the binge . as shown in fig1 a , the valve flap 16 corresponds to the body 12 so that , when the valve flap 16 is bingedly attached to the body 12 and is in a closed position as shown in fig1 b , the valve flap 16 creates a closure within the body 12 , preventing flow therethrough . as mentioned above , a seal 14 can be provided for the valve flap 16 to fit into or against in order to provide a reliable sealing closure . to create a non - return valve , the hinge and spring mechanism 18 is arranged so as to limit rotational movement of the valve flap 16 about the hinge in one rotational direction — clockwise in the embodiment of fig1 b — so that the valve flap 16 can pivot about the hinge in order to fit against the seal 14 but cannot rotate further in that direction . as a result , if fluid flow or another force acted upon the valve flap 16 shown in fig1 b in an attempt to pivot it clockwise about the hinge beyond the seal in order to open the valve , it could not do so . conversely , the hinge and spring mechanism 18 is arranged to allow rotation of the valve flap 16 about the hinge by at least 90 ° in the opposite rotational direction anticlockwise in this embodiment — so that the valve flap 16 can be rotated from the closed position as shown in fig1 b to an open position in which it enables flow through the insert 10 . because of the presence of the spring , in the absence of a force acting to rotate the valve flap 16 to an open position , the valve flap 16 will spring hack to the closed position . the physical appearance and operation of the insert 10 as shown in fig1 a to 1 c can be better understood in the context of its use in a pipe , fig2 a and 2 b thus shows the insert 10 in situ within a pipe 20 with a jointing strap 28 fitted outside the pipe 20 . fig9 a to 9 f also show perspective views of a valve insert inside a pipe 20 without the jointing strap 28 which is shown in fig2 a to 2 b . the permitted direction of valve flap movement differs between fig2 a and 2 b ( anti - clockwise ) and fig9 a to 9 d ( clockwise ). the manner in which the insert can be fitted to the pipe 20 will be described later , below . as can be seen from the figures , the body 12 of the insert 10 should be sized to fit within a cross section of the pipe 20 . in the figures a cylindrical pipe 20 is used and thus the insert 10 has a cylindrical or annular insert body 12 , as is best seen in fig9 a to 9 f . the outer diameter of the body 12 substantially corresponds to the inner diameter of the pipe 20 , so that the insert 10 fits snugly within the pipe 20 . the body 12 of the insert 10 should comprise a relatively thin annular wall , so as to reduce the bore of the pipe as little as possible . in the closed position as shown in fig2 b , 9 a and 9 d , the valve flap 16 creates a closure in the insert 10 . the insert 10 fills the pipe bore at the point at which it has been inserted into the pipe 20 , therefore closing the valve flap 16 prevents through flow in the pipe 20 . the closed non - return valve will resist any turning force caused by a flow or force within the pipe in a non - allowed axial direction . hence backflow of fluid , gas , odour , rodents or other material in the pipe 20 is prevented . when there is a turning force caused by a flow or force in the allowed direction within the pipe 20 , that flow will cause rotation of the valve flap 16 about its hinge and so will cause the valve to open and allow throughflow in the pipe 20 as shown in fig2 a , 9 c and 9 f . in order to maximise such throughflow , and to minimise the reduction of the pipe bore caused by the presence of the non - return valve , the valve flap 16 is thin . preferably its thickness is no more than half the diameter of the pipe , and ideally it is much less than that . the valve flap 16 is also , advantageously , curved about one axis . this curvature can be best understood with respect to fig3 and fig9 a to 9 f . as can be seen therein , the valve flap 16 is substantially saddle shaped , i . e . u - shaped in side view . the curvature of the valve flap 16 allows the valve flap 16 to cup or arch around the flow in the pipe 20 when the valve flap 16 is in its open position as seen best in fig9 c and 9 f . in this open position , the valve flap 16 arches over and so embraces the flow rather than blocking it . the curvature of the valve flap 16 is preferably matched to the curvature of the inner surface of the pipe in which the insert 10 is to be used . as a result , when the valve is in a fully open position as shown in fig2 a , 9 c and 9 f , the outer surface of the valve flap 16 should lie substantially parallel to that inner surface of the pipe 20 , preferably flush with it with minimal gaps or discontinuities therebetween . in addition , the valve flap 16 should be sufficiently thin so that , when it is in an open position , it causes minimal reduction to the bore of the pipe 20 for throughflow of fluid or other material . as shown in fig9 b and 9 e , it is possible for the valve flap 16 to be in a partially open position , between the closed position shown in fig9 a and 9 d and the hilly open position shown in fig9 c and 9 f . the valve flap 16 will be in a partially open position as shown in fig9 b and 9 e during opening and closing and also may be partially open when there is a flow through the pipe in the permitted direction but that flow is not large or forceful enough to fully open the valve flap 16 . in its partially open position as shown in fig9 b and 9 e , the valve flap 16 will arch over the flow which has forced it from the closed position . there are two different , interacting considerations for the three - dimensional shape of the substantially rigid valve flap 16 . as a first consideration , the valve flap 16 should be shaped so as to create a closure and thereby prevent axial flow along the pipe 20 when the valve flap is in a fully closed position therein . in the embodiments described above the pipe 20 and insert body 12 are both cylindrical , such that the valve flap 16 forms a circular closure in its closed position when viewed along the axial flow direction of the pipe , as shown in fig7 a and 9 d . ideally , there should be a seal 14 or valve seat on an inner surface of the insert body 12 , wherein that seal 14 is shaped to form a reliable closure with the valve flap 16 in its closed position . the second consideration for the three - dimensional shape of the substantially rigid valve flap 16 is that , as described above , it should cup or arch around the longitudinal axis of flow through the pipe 20 when the valve flap 16 is in an open position , as shown by way of example in fig7 b , 9 c and 9 f . the valve flap 16 therefore embraces the shape and direction of the flow through the pipe 20 , rather than acting as a blockade against or restriction of that flow . ideally , the valve flap 16 should lie flush with the inner surface of the pipe 20 and / or with the insert body 12 when in the open position . once the three - dimensional shape of the valve flap 16 has been determined , it must be attached to the body 12 of the insert 10 ( or directly to the pipe 20 ) at the correct place and in the correct orientation if the valve is to operate as a non - return valve . since the purpose of a non - return valve is to allow flow through a pipe or conduit in one direction but not in another , it is important that the suitably shaped valve flap 16 is attached to the body 12 of the insert 10 correctly , based on the permissible direction of flow and hence the permissible rotational direction of the valve flap 16 about the hinge . as described above , when the valve flap 16 is rotated into the open position within a pipe or conduit , the inner face of the valve flap 16 should cup the fluid flow , and should correspond as closely as possible to the inner shape and profile of the pipe or conduit in order to maximise flow therethrough . the valve insert 10 is particularly advantageous because it can be fitted into any type , size or shape of conduit , even when there is very limited access available to that conduit . an example of how an insert 10 including a valve flap 16 can be fitted to a pipe will now be described . this example involves a pipe 20 of substantially circular cross - section as shown in fig4 b , however it will be appreciated that the principle can be applied to other shapes of pipe or conduit . fig4 a shows a pipe 20 before an insert 10 is fitted . in order to prepare the pipe 20 for the insert 10 , a slot is cut into the pipe as shown in fig4 c . the slot 22 should he sized to enable fitting of the insert 10 into the pipe 20 , and to ensure that the pipe 20 and insert 10 form a leak - proof continuum after this fitting has taken place . for the pipe 20 shown in fig4 a to 4 c which has a substantially circular cross - section , a substantially annular insert 10 as described above with respect to fig1 a to 2 b can be used . in order to fit an annular insert 10 to the pipe 20 , a semi - annular section of the pipe 20 must be removed . therefore , as shown in fig4 c , the slot 22 only extends across half the diameter of the pipe 20 . since there is no complete severing or cut through of the pipe 20 at any point along its length in this process , the majority of the pipe &# 39 ; s rigidity and strength is maintained . there is no need to cut right through the pipe . as shown in fig5 a to 5 c , it is possible to fit the insert 10 into the pipe 20 by fixing it in position between two sleeves 24 . as will be understood from those figures , each sleeve 24 is substantially annular , with a semi - annular lip or flange 26 at one end thereof . a sleeve 24 can be inserted into the pipe 20 via the slot 22 and push fitted to one side of the slot 22 so that the majority of the sleeve 24 sits against the inner surface of the pipe 20 and the semi annular flange 26 sits against the semi annular edge which has been formed on the pipe 20 by the cut made therein . hence the semi annular flange 26 enables the sleeves 24 to be fitted securely in place within the pipe 20 . in the arrangement shown in fig5 c , sleeves 24 are fitted at either side of the slot 22 in the pipe 20 . in fig9 a to 9 f one of the sleeves ( shown on the left hand side in those figures ) has a cut - out upper portion to accommodate an edge of the valve flap 18 when it is in an open position as shown in fig9 c . the cut out portion on the sleeve 24 enables the surface of the valve flap to lie flush against the inner surface of the pipe in which it is inserted , rather than lying against the inner surface of the sleeve 24 , therefore reducing the inner bore of the pipe as little as possible . other shapes of sleeves and cut outs are possible in accordance with the principles described herein . as shown in fig6 , once the sleeves 24 have been fitted , an insert 10 as shown in fig1 b can be fitted into the pipe 20 . the insert 10 should be sized so as to plug the gap between the two sleeves 24 , across the slot 22 . as a result , there should be no gaps or leakage from the pipe 20 in the section which has been cut . it will be appreciated that this is not the only way to fit an insert 10 into a pipe 20 . it is possible to omit the sleeves 24 described above , or to include a single sleeve 24 , and / or to fix the insert 10 in position within the pipe 20 by any other suitable means . importantly , the valve insert 10 described herein can be fitted within a pipe 20 without making a complete cut or severance across the diameter of the pipe 20 at any point . the insert 10 should fit snugly within the pipe 20 , so that there are no gaps between an outer surface of the insert 10 and an inner surface of the pipe 20 . any suitable sealing means can be provided so that there is no leakage into or out of the pipe via the slot 22 once the insert 10 has been fitted therein . fig8 a and 8 b show a jointing strap 28 ( also shown in fig2 a and 2 b ) that can be used as a slot cutting template for a pipe . as can be seen therefrom , the jointing strap 28 can be wrapped around and affixed to the outer surface of a pipe 20 in any suitable manner . the strap 28 comprises a cut out portion 30 which can serve as a slot cutting template for cutting the correct size of slot 22 in order to fit a particular insert 10 into the pipe 20 . the cut portion 30 can also hold the insert 10 in place when the pipe 20 is being sealed therearound . after the pipe 20 has been cut and the insert 10 and any affixing means such as seals or sleeves 24 have been positioned within the pipe 20 , the jointing strap 28 can be rotated so that the cut out portion 30 thereof surrounds a portion of the pipe 20 which has not been cut ( i . e . the lower half of the pipe 20 in the figures herein ) and the slot 22 of the pipe 20 is covered by a continuous section of the strap 28 . this can enhance the seal formed between the insert 10 and the pipe 20 . furthermore , the jointing strap 28 acts as an indicator for the user as to the location of the insert 10 inside the pipe 20 . if the non - return valve needs to be altered , removed or replaced , the user can simply and easily rotate the strap 28 and thereby provide access to the insert 10 within the slot 22 . this is achieved in a simple and efficient manner . furthermore this arrangement enables someone other than the person who fitted the strap 28 and cut out the slot 22 to access the insert 10 subsequently in order to alter , replace or remove the non - return valve . the valve insert 10 can therefore be provided as a do - it - yourself ( diy ) kit for a domestic user to install a non - return valve in a pipe . it does not have to be fitted , replaced or repaired by a plumber or other professional tradesperson . the valve insert 10 described with respect to fig1 a to 9 f comprises a substantially rigid valve flap 16 which has a fixed saddle - like shape as shown best in fig3 . however it is also possible for an insert to be provided for implementing a valve within a pipe or conduit wherein the insert has a different type of valve flap which is at least partially deformable . fig1 shows a deformable valve flap 1002 for inserting into a pipe in order to provide a valve within that pipe . the deformable valve flap 1002 shown in fig1 is substantially circular in cross - section in order to be compatible with a substantially cylindrical pipe . however it is possible for the deformable valve flap 1002 to have a different cross - sectional shape in order to be compatible with a different shape of pipe or conduit . the deformable valve flap 1002 includes a substantially planar flap body 1004 . the substantially planar flap body 1004 is formed from a flexible material such as rubber . as described in more detail below , the flexibility of the flap body 1004 enables it to be deformed away from its substantially planar configuration upon application of a force thereto . for example , the flap body 1004 may be deformed by the pressure of water or other fluid pushing against the valve flap 1002 within a pipe . the deformable valve flap 1002 further comprises a flexible wire 1006 in order to provide some rigidity . the flexible wire 1006 may comprise spring wire or any other suitable type of wire . the flexible wire 1006 is preferably provided in a substantially circular configuration ( except at the top as described further below ) proximal to but not quite at the outer edge of the flap body 1004 . such a configuration reinforces the outer edge of the flap body 1004 but at the same time enables the radially inner parts of the flap body 1004 to still be deformable . in the embodiment shown in fig1 the flexible wire 1006 is also provided in two substantially parallel strips 1008 either side of the axial centre of the flap body 1004 . the strips 1008 of wire each join an upper part of the circular part of the flexible wire 1006 to a lower pad thereof . it will be appreciated that the particular configuration of flexible wire 1006 shown in fig1 is only one example . the flexible wire 1006 can be provided in any suitable configuration that balances the deformability and rigidity requirements for the valve flap 1002 in operation , which is described further below . the flexible wire 1006 should be reliably attached to the substantially planar flap body 1004 . the flexible wire 1006 may be bonded to the flap body 1004 or attached thereto by any other suitable means for example by welding , moulding or over moulding . as the skilled reader will appreciate , the best means for attaching the flexible wire 1006 to the flap body 1004 will depend at least in part on the particular materials chosen for the component parts of the deformable valve flap 1002 . in the embodiment shown in fig1 and 13 either end of the flexible wire 1006 , at the top of the substantially circular part , extends from the flap body 1004 to attach to a plate 1010 and spring 1012 mechanism . the ends of the flexible wire 1006 connect to either side of a coiled spring 1012 at first and second respective connection points 1014 a , 1014 b . first and second respective inner plate portions 1016 a , 1016 b are provided outward of the first and second connection points 1014 a , 1014 b . the plate 1010 further includes outer plate portions 1018 a , 1018 b located outward of the respective inner plate portions 1016 a , 1016 b . on either side of the spring 1012 there is a pin 1020 a , 1020 b which runs from the respective connection point 1014 a , 1014 b , through the inner plate portion 1016 a , 1016 b and through the outer plate portion 1018 a , 1018 b . the pins 1020 a , 1020 b terminate outward of the outer plate portions 1018 a , 1018 b and have pin heads which ensure that they are fixed to the outer plate portions 1018 a , 1018 b . an axis of rotation is defined for the valve flap 1002 , which runs substantially through the axial centre of the plate 1010 and spring 1012 mechanism . in operation , pressure of fluid in a pipe will cause the valve flap 1002 to rotate about the axis to create an opening in the pipe and thereby allow throughflow . the inner plate portions 1016 a , 1016 b rotate with the valve flap 1002 however the outer plate portions 1018 a , 1018 b do not rotate . instead , rotation of the inner plate portions 1016 a , 1016 b cause the corresponding outer plate portions 1018 a , 1018 b and pins 1020 a 1020 b to move outwards , away from the centre of the spring 1012 . because the pins 1020 a , 1020 b are attached to either end of the spring 1012 , this outward movement has the effect of stretching the spring when the valve flap 1002 rotates . therefore the spring 1012 is under tension when the valve flap 1002 is rotated to an open position . when the fluid pressure is removed from the valve flap 1002 , the bias of the spring 1012 ( to return to its relaxed position ) encourages the outer plate portions 1018 a , 1018 b to move inwards and hence encourages the inner plate portions 1016 a , 1016 b , and the ends of flexible wire 1006 to which they are connected , to rotate again in the opposite direction and thereby rotate the valve flap 1002 back to its closed position . fig1 shows an embodiment of the deformable valve flap 1002 attached to a coiled spring 1012 . as can be seen therein , the coiled spring 1012 , which is stretched by rotation of the flap body 1004 as described above , can be a continuation of the flexible wire 1006 that is used to provide rigidity to the flap body 1004 . in fig1 the spring wire 1006 is embedded within the flap body 1004 rather than being fixed to a surface of the flap body 1004 as shown in fig1 . as can also be seen from fig1 , it is possible for the outer edge of the flap body 1004 to be flared to provide a rim 1102 around the outer edge of the flap body 1004 . such a rim 1102 can help to locate the deformable valve flap 1002 next to a sleeve or seal ( not shown in fig1 ) in order to enhance the closure of the pipe when the deformable valve flap 1002 is in its closed position . the deformable valve flap 1002 can be provided as part of an insert including an insert body , as described in detail above with respect to the substantially rigid valve flap . the insert body can be substantially annular or cylindrical , to make it compatible with a cylindrical pipe , or it can be of any other suitable shape dependent on the shape of the pipe or conduit in which the insert is to be inserted . as described in detail above , the insert can be placed into a pipe by cutting a slot into the pipe , but not cutting through the pipe entirely , and fitting the insert into the slot where the section of pipe has been removed . the insert can include a seal as described in more detail with respect to fig1 and 12 herein . in addition it can be used in conjunction with one or more sleeves . fig1 shows an embodiment of an insert 1200 which includes a deformable valve flap 1002 . the insert 1200 includes an insert body 1202 , a deformable valve flap 1002 including a deformable flap body 1004 and flexible wire 1006 , and a spring 1012 provided above the flap body 1004 . the spring 1012 shown in fig1 is a continuation of the flexible wire 1006 which is attached to the flap body 1004 . the spring 1012 is coiled around an axis 1204 , about which the deformable valve flap 1002 can rotate in order to move from a closed position to an open position . any suitable spring or other biasing mechanism can be provided so as to allow rotation of the valve flap 1002 in one direction ( i . e . anti clockwise from closed to open in fig1 ). rotation of the valve flap 1002 in the opposite direction ( i . e . clockwise from closed to open in fig1 ) can be prevented either by the spring and / or by the insert body 1202 including a blocking means to prevent such rotation . although not shown in fig1 , the insert body 1202 can also include a seal or seat against which the flap body 1004 can fit when in the closed position . also shown in fig1 are two sleeves 1206 provided either side of the insert body 1202 within a pipe 1208 . as described above in relation to the rigid flap embodiment , the sleeves 1206 can assist with locating the insert 1200 within the pipe 1208 once a slot has been cut therein . the sleeves 1206 can also help to ensure that the pipe 1208 is airtight and watertight to prevent leaks once the insert 1200 has been inserted into the pipe 1208 . although not shown in the figures , it is possible for the base of an insert ( which includes either a rigid or a deformable valve flap ) to include a spigot extending therefrom wherein the spigot can locate into a recess on the bottom surface of the pipe in order to further secure the insert therein . for example , after a user has created a slot in the pipe he or she could then create an indentation or recess in the lower inner surface of the pipe before the insert is fitted therein , so as to locate the spigot into that indentation or recess thereafter . once it has been inserted into a pipe or conduit , the deformable valve flap 1002 can function so as to provide a non - return valve within that pipe or conduit . as with the rigid valve flap 16 described above , the deformable flap 1002 can be rotatable in one direction only , so as to allow flow along the pipe or conduit in one direction but not in the other . one particular example of spring mechanism that can be used in conjunction with the deformable valve flap 1002 has been described herein with respect to fig1 and 13 . however it will be appreciated that any other suitable biasing means can be used in conjunction with the deformable valve flap 1002 , for example the biasing mechanism shown herein in relation to the rigid valve flap insert . in operation , pressure of water or other fluid in the allowed direction through the pipe pushing against the valve flap 1002 will cause the valve flap 1002 to rotate within the pipe body and thereby to create an opening to allow fluid throughflow . the fluid pressure will cause the deformable valve flap 1002 to rotate but may initially not substantially deform its shape . however once more pressure is exerted and the valve flap 1002 moves towards a fully open position , the pressure of the fluid will have the additional effect of deforming the shape of the flap body 1004 , forcing it to deform and take the internal shape of the pipe in which it is fitted . as the skilled reader will appreciate , the configuration of flexible wire 1006 shown in fig1 is particularly useful because the central portion of the flap body 1004 , between the strips 1008 of flexible wire , has limited rigidity and thus will be quite deformable when subjected to fluid pressure . this will enable that central portion of the flap body 1004 to arch upwards against an inner surface of the pipe when the deformable valve flap 1002 is in an open position . as is the case for the rigid valve flap 16 described above , when there is no fluid pressure in the allowed direction on the deformable valve flap 1002 , or when there is pressure from fluid in the non - allowed direction on the valve flap 1002 , the valve flap 1002 will revert to a closed position wherein the flap body 1004 fills the body of the pipe and therefore prevents fluid throughflow in the non - allowed direction , if the flexible wire 1006 is provided proximate the outer edge of the flap body 1004 as shown in fig1 , this will reinforce the valve flap 1002 and will help to lock it into the closed position . it will also reinforce the flap &# 39 ; s resistance against fluid pressure in the non - allowed flow direction . as mentioned above , an insert including a deformable valve flap 1002 as described herein can include a suitable spring or other biasing means . that biasing means may be housed within the main body of the insert , so as to sit within the cut - out section of pipe when the insert is placed therein , or the biasing mechanism may sit outside the main body of the insert and therefore lie outward of the cut - out section of pipe when the insert is in place . the spring 1012 and plate 1010 arrangement described in relation to fig1 and 13 above preferably is provided external to the annular insert body . as described above in relation to the rigid valve flap insert , it is possible to use a jointing strap around the cut - out section of pipe when the insert is placed therein . if , as would he the case for the arrangement shown in fig1 and 13 herein , the biasing mechanism protrudes from the surface of the insert body , the jointing strap can include a suitable recess in order to house that biasing mechanism . any such recess in the jointing strap should allow component parts of the biasing mechanism , such as the pins 1020 a , 1020 b and outer plate portions 1018 a , 1018 b , to move as required for correct operation of the insert in practice . an insert that includes a deformable valve flap 1002 as described above has similar advantages to an insert that includes the rigid valve flap 16 in that the valve flap can arch over fluid flow in the allowed direction in the pipe , therefore maximising the cross - sectional area for that fluid flow . the deformable valve flap 1002 can be very thin , due to being formed of rubber or other deformable material , and so it will reduce the bore of the pipe very little when in an open position . furthermore , because the flap body 1004 is so thin , it is suitable for being fitted into very tight spaces where conventional valves simply could not be fitted . a deformable valve flap that is substantially planar in its relaxed configuration can be manufactured in a relatively straightforward manner , and a plurality of such deformable valve flaps can be stacked compactly for efficient storage and shipping . the specific arrangements described above with respect to the figures involve pipes , insert bodies and valve flaps of circular cross - section however the same principles apply to other cross - sections such as oval , elliptical and irregular shapes . if a pipe has a slightly irregular cross - section , an irregular insert or irregular valve flap can be designed so that its outer surface matches the cross - section of the pipe so as to mate therewith . when the insert comprises a valve flap provided in conjunction with an irregular insert body , an inner surface defined between the open ends of the insert body can be of a more regular cross - sectional shape , such as circular , so that a valve flap which is shaped to close a circular opening can be used therewith . additionally or alternatively , the thickness of the insert between its inner and outer surfaces can vary across its extent , to account for differences in pipe thickness and / or the absence of pipe wall at any point when the insert is fitted thereto . in all cases , the non - return valve insert should reduce the bore of the pipe as little as possible whilst at the same time providing a reliable blockade against flow when the valve flap is in the closed position . if the valve insert needs to be altered , changed or replaced , this can be done quickly and easily by removing the insert from the pipe without having to make any physical changes to the pipe itself . it is possible for the entire valve insert , including the insert body , valve flap and any attachment mechanisms , to be replaceable as a single unit . alternatively or additionally , a valve flap could be replaced without replacing the body of the insert . furthermore , the seal formed on the inner surface of the insert body could be replaced or updated as appropriate in order to ensure reliable operation of the valve over time . in the arrangements described above , the insert is arranged to provide a non - return valve however the shape of the valve flap is also useful for other types of valve . because the substantially rigid valve flap is u - shaped in side cross section , it maximises flow in one direction along a conduit when in an open position . if the substantially rigid valve flap was allowed to rotate about its hinge in response to flow in a second , opposite direction along the conduit , its curvature would not arch over the axis of flow but would abut against it . therefore the flow in that second direction would be at least partially impeded by the valve flap . the substantially rigid valve flap can thus be used in arrangements where flow is to he permitted in both directions in a conduit , but is to be more limited in one direction than in the other . it is possible to fit other components within a pipe or conduit that could work with the valve inserts described herein . for example , stopcock valves can be added either side of the insert within a pipe , for relieving water pressure when the insert is being changed in a water pipe . alternatively or additionally , it is possible to include an iris or other type of shut off valve upstream of the insert for shutting down flow in the pipe or conduit before the insert is replaced or changed . for example , such an iris could comprise a manually operated , knurled arrangement which forms a blockade in the pipe or conduit , preventing flow downstream to the non - return valve . alternatively or additionally , the iris could be operated by a gear or other mechanism on the outside of the pipe in preparation for work on the non - return valve . the process of changing or replacing the insert is quick and easy . once any external components such as the strap on the outside of the pipe have been removed , the insert comprising the valve flap can slot out of the pipe and a replacement can immediately be inserted therein . thus it is possible to avoid , or at least to substantially cut down on , time and money being lost in shutting down a production line for changing of a non - return valve . the ease and speed with which the valve insert can be fitted and changed is also highly advantageous for diy applications since the user would not have to enlist the services of a plumber for changing the valve and would not have to buy a completely new valve in a conventional sense , but could simply replace the valve insert . the valve insert could be fed from an open end of a pipe or conduit , to the desired position , instead of being inserted via a slot in the pipe . however it will be appreciated that in some instances , particularly where a valve must be implemented in an existing system such as a plumbing system , inserting the insert via a slot in the conduit will be the preferred option , to minimise disruption to the system . the valve insert as described herein provides an entirely scalable , flexible solution . it is different to conventional products since it does not have to provided in the form of a ready - made non - return valve per se , but can be a kit which allows ( part of ) a pipe or conduit to operate as a non - return valve . although an annular insert with an attached valve flap has been described herein , any appropriate insert shape may be used . the size of the insert body and valve flap can be designed and selected based on the size of the pipe or conduit in which they are to be fitted . the design should ensure that the valve flap can create a blockade against flow when in a closed position and allow flow in the other , arching over the flow direction to reduce the pipe bore as little as possible when in an open direction . as most industrial manufacturers of pipes produce pipes of standardised diameters , standard non - return valve inserts can be made to cooperate with those pipes . furthermore , if a pipe is of a non - standard size or shape it is possible to custom design and make a non - standard insert with a valve flap that can mate with that pipe and / or to seal a standard insert into an irregular pipe . if the latter is being done , the size and shape of the insert should be chosen so as to reduce the bore of the pipe as little as possible and to enable as much throughflow of fluid or other material in the pipe when the valve flap is in the open position during use . because the valve insert can be quickly and easily accessed , it is possible to check the operation of the non - return valve on a regular basis without substantially interfering with the operation of the pipeline system . this is advantageous , for example , when the insert is used to provide a non - return valve in the water or sewage system within a home or other building , since the valve can be regularly checked for insurance purposes and to avoid problems such as flooding and overflow before they happen . it is possible to fit an additional feature such as a viewing eye for checking whether the valve is working without removing it . the viewing eye could also be used during maintenance of the valve insert . whilst the valve inserts have been described herein predominantly with respect to controlling water or other fluid in a pipe , there are many other applications of the valve insert . for example it could be used within a vehicle engine , or in any other system including one or more conduits in which control of flow in one direction is desired . as well as acting to control flow as described in detail hereabove , the non - return valve insert can have , additional uses in a pipeline . for example , the insert could be impregnated with a suitable substance to be dissolved into the flow of fluid or other material that the non - return valve is designed to control . thus the insert could act as a water softening cartridge , a slow release inhibitor for a central heating system or a catalytic converter for an exhaust pipe . additionally or alternatively , part of or the entire insert can be formed from a material that will dissolve in , or react with , a fluid in the conduit . for example part of or the entire insert may be formed from copper or platinum . additionally or alternatively , the non - return valve insert could be used in water testing and purveying for mains drinking water . in addition , the insert might be used as a test device for extracting substrate from fluid . for such a purpose , the insert body could include storage means and / or could include means for directing the extracted substrate away from the pipe . the insert can be made from any suitable material including metal , ceramic , plastic , rubber , wire or other manmade material . whilst the valves described above can include a hinge and spring mechanism for attaching the valve flap to a body of the insert , any suitable attachment means may be used as long as it enables the valve flap to go from a closed position to an open position when in use . instead of a hinge for rotation of the valve flap , means can be provided for translational or other movement of the valve flap from a closed position to an open position in use . according to an embodiment , the valve flap and seal can be used in a pipe for blocking flow without an insert body also being provided . in such an embodiment , the valve flap can attach directly to the pipe and / or to the seal . the substantially deformable valve flap can be made from any suitable material or combination of materials . although flexible wire has been used in the specific embodiment described herein to add rigidity and guide deformation of the deformable valve flap , any suitable other material ( s ) could instead be used for this purpose . the valve flap can be spring loaded so as to bias it in the closed direction by a mechanical spring as shown in the figures herein . alternatively , this biasing means could be achieved using fluid or any other suitable alternatives to springs . when the non - return valve insert is used within an engine , for example a car engine , the valve flap could move towards the open position due to the force of an explosion within the engine . it is possible to use one or a plurality of valve inserts in a pipe or other conduit for controlling flow therein . the inserts can be fitted and operated in conjunction with existing valve arrangements or as a replacement for such arrangements . any reference to relative terms such as “ clockwise ”, “ anti - clockwise ”, “ right ”, “ left ”, “ upper ” or “ lower ” made herein is made only to describe the particular arrangement shown in the figures . it is not intended to be limiting . the embodiments and examples as described herein provide a flexible , scalable solution by which a non - return valve can be implemented in a cost effective manner . the non - return valve insert can be fitted , replaced and amended simply and quickly , making it user friendly and applicable to a wide range of industries and practical situations . | 5 |
with reference to fig1 - 5a and 5 b , hereinafter is described a preferred embodiment of the present invention . with reference to the drawings , a configuration of a stator winding 1 of the embodiment is described . the stator winding 1 is obtained by connecting a number of wire segments 3 ( hereinafter also just referred to as segments 3 ), each having a curve ( or a curved section ) 2 , in an electrically conductive manner . specifically , the segments 3 before being connected are mounted to slots 5 of a stator core 4 and deformed . then , predetermined connecting portions 6 of the respective segments 3 are connected to each other in an electrically conductive manner . in order to avoid complication , the connecting portions in the drawings are indicated by 6 aa , 6 ba , 6 ab and 6 bb , which will be described later , instead of being simply indicated by 6 . an integral body of the stator winding 1 and the stator core 4 provided in this way forms a stator 7 of a rotary electric machine . for example , the stator 7 is used in a vehicle alternator . each segment 3 is formed of a flat wire having a rectangular cross section 11 and having a surface applied with an insulation coating 8 . for example , a flat wire is substantially bent into a shape of a v to form the curve ( or the curved section ) 2 at the bottom of the v shape . as shown in fig4 and fig5 a and 5b , the rectangular cross section 11 of the flat wire as a material of the segment 3 has four corners 12 a , 12 b , 12 c and 12 d . of these corners , the two adjacent corners 12 a and 12 b have a larger curvature than the remaining two corners 12 c and 12 d . in short , the flat wire is a deformed flat wire . in cases where each of the four corners 12 a , 12 b , 12 c and 12 d is produced as part of a circle of a radius r , the curvature is defined as 1 / r . specifically , for example , as shown in fig3 and 4 , the rectangular cross section 11 of the deformed flat wire as a material of the segment 3 has two short sides 13 a and 13 b that are parallel to each other . of these short sides 13 a and 13 b , one short side 13 a has the two corners 12 a and 12 b whose curvature cv 1 is made larger than that cv 2 of the two corners 12 c and 12 d of the other short side 13 b ( refer to fig4 ). as shown in fig2 and 3 , each of the curves 2 is made to have a circumferential direction cr and a radial direction ra . for example , the short side 13 a is ensured to reside in the inner surface of the curve 2 in the radial direction ra and the short side 13 b is ensured to reside in the outer surface of the curve 2 in the radial direction ra . each segment 3 includes a v - shaped portion 15 and two linear portions 16 extending parallel to each other from the ends of the v - shaped portion 15 to display line symmetry ( see fig2 and 3 ). the v - shaped portion 15 functions as an intermediate portion connecting the two linear portions . in order to avoid complication , the linear portions in the drawings are indicated by 16 aa , 16 ba , 16 ab and 16 bb , which will be described later , instead of being simply indicated by 16 . two types of the segment 3 are used here , one type being a segment 3 a having the curve 2 of a larger curvature , and the other type being a segment 3 b having the curve 2 of a smaller curvature . the curve 2 of the segment 3 a is arranged confronting the inner surface of the curve 2 of the segment 3 b . the segments 3 a and 3 b , when inserted into the slots 5 , form a single wire unit 17 ( hereinafter also just referred to as unit 17 ). in the embodiment , the curve 2 is twisted so that both linear portions of each segment are allowed to be inserted at different layers ( levels ) of the respective slots 5 , as shown in fig2 . hence , the circumferential direction of each curve 2 is not parallel with that of the stator in one unit 17 , the linear portions 16 on one side a of the curves 2 of the respective segments 3 a and 3 b are inserted into a slot 5 so as to be located radially inward of the slot , while the linear portions 16 on the other side b of the curves 2 are inserted into another slot 5 so as to be located radially outward of the slot ( see fig2 ). hereinafter , of the two linear portions 16 of the segment 3 a , the one located radially inward of the slot 5 is referred to as a linear portion 16 aa , and the one located radially outward of another slot 5 is referred to as a linear portion 16 ab . also , of the two linear portions 16 of the segment 3 b , the one located radially inward of the slot 5 is referred to as a linear portion 16 ba , and the one located radially outward of another slot 5 is referred to as a linear portion 16 bb . the slot 5 into which the linear portions 16 aa and 16 ba are inserted is different from the slot 5 into which the linear portions 16 ab and 16 bb are inserted . these two slots 5 are interposed by two different slots 5 . specifically , the unit 17 is outstretched on both sides of the curve 2 in the circumferential direction and inserted into the stator core 4 , bridging three teeth 20 . the linear portions 16 aa , 16 ba , 16 ab and 16 bb of the unit 17 have respective folds 19 which are parallel to long sides 18 of the rectangular cross section 11 . the linear portions 16 aa , 16 ba , 16 ab and 16 bb are bent at the respective folds 19 ( see fig4 and fig5 a and 5b ). the linear portions 16 aa , 16 ba , 16 ab and 16 bb have respective end portions which are projected from the slots 5 in the axial direction , i . e . projected in a direction opposite to the curve 2 , to form the respective connecting portions 6 . here , the connecting portions 6 at the ends of the linear portions 16 aa , 16 ba , 16 ab and 16 bb are designated as connecting portions 6 aa , 6 ba , 6 ab and 6 bb , respectively . the connecting portion 6 aa is connected , in an electrically conductive manner , to the connecting portion 6 ba of a unit 17 which is inserted into a slot 5 , being interposed by three teeth 20 on the one side a in the circumferential direction . the connecting portion 6 ba is connected , in an electrically conductive manner , to the connecting portion 6 aa of a unit 17 which is inserted into a slot 5 , being interposed by three teeth 20 on the other side b in the circumferential direction . the connecting portion 6 ab is connected , in an electrically conductive manner , to the connecting portion 6 bb of a unit 17 which is inserted into a slot 5 , being interposed by three teeth 20 on the other side b in the circumferential direction . the connecting portion 6 bb is connected , in an electrically conductive manner , to the connecting portion 6 ab of a unit 17 which is inserted into a slot 5 , being interposed by three teeth 20 on the one side a in the circumferential direction . thus , in the stator 7 , the end portions of the linear portions 16 aa , 16 ba , 16 ab and 16 bb and the v - shaped portions 15 form coil ends axially projected from both axial sides of the stator core 4 . then , a rotor is arranged radially inside of the stator 7 to thereby form a rotary electric machine . referring to fig5 a and 5b , hereinafter is described a method of fabricating the stator winding 1 of the embodiment , in particular , a method of forming the deformed flat wire that is a material of the wire segment 3 . the deformed flat wire is fabricated by rolling a round wire applied with insulation coating and having a circular cross section . in the rolling , the round wire is rolled in two stages ( two - stage rolling ) using various rollers 22 . in the following description , the material supplied in a first rolling stage performed firstly may be referred to as an initial material 23 . also , the material resulting from the first rolling stage may be referred to as an intermediate material 24 . further , the material resulting from a second rolling stage may be referred to as a final material 25 . first , a round wire is prepared as the initial material 23 , and then the intimal material 23 is subjected to the first rolling stage . in the first rolling stage , a round wire as the initial material 23 is rolled into a flat wire as the intermediate material 24 whose cross section is in an isosceles trapezoid shape . then , in the second rolling stage , the intermediate material 24 is rolled into a deformed flat wire as the final material 25 . in a isosceles trapezoid cross section 27 of the intermediate material 24 , two bases 28 a and 28 b substantially parallel to each other correspond to the short sides 13 a and 13 b , respectively , in the rectangular cross section 11 of the final material 25 . similarly , two legs 29 correspond to the long sides 18 in the rectangular cross section 11 . further , of the two bases 28 a and 28 b , the longer base 28 a has two corners 30 a and 30 b which correspond to the two corners 12 a and 12 b ( i . e ., two first corners ), respectively , having a larger curvature in the rectangular cross section 11 . the shorter base 28 b has two corners 30 c and 30 d which correspond to the two corners 12 c and 12 d ( i . e ., two second corners ), respectively , having a smaller curvature in the rectangular cross section 11 . in the second rolling stage , a portion 32 is chiefly subjected to rolling . the portion 32 is a portion near the base 28 a , in which the length between the legs 29 is large . also , in the second rolling stage , the deformation volume of the intermediate material 24 is larger in the portion 32 near the base 28 a between the legs 29 , than in a portion near the base 28 b . therefore , camber is likely to be caused in the final material 25 in which the short sides 13 a and 13 b reside in the outer and inner surfaces , respectively . for this reason , in the second rolling stage , the rollers 22 are arranged to minimize the occurrence of camber . the stator winding 1 of the embodiment uses a deformed flat wire as the final material 25 . the deformed flat wire is bent to form the curve 2 . in bending the deformed flat wire , the two smaller - curvature corners 12 c and 12 d are ensured to reside in the outer surface of the curve 2 , and the two larger - curvature corners 12 a and 12 b are ensured to reside in the inner surface of the curve 2 . thus , the two smaller - curvature corners 12 c and 12 d are permitted to reside in the outer surface of the curve 2 , in which the insulation coating 8 is significantly expanded by the bending . with this configuration , expansion of the insulation coating 8 is minimized in the outer surface of the curve 2 . as a result , the probability of damaging the insulation coating 8 is reduced in the outer surface of the curve 2 of the stator winding 1 that uses a flat wire as a material . the deformed flat wire as the final material 25 is fabricated by rolling a round wire as the initial material 23 in two stages , the round wire having a circular cross section and applied with insulation coating . in the preceding first rolling stage , the round wire is rolled into the intermediate material 24 whose cross section is in an isosceles trapezoid shape . thus , the intermediate material 24 having a cross section in an isosceles trapezoid shape is subjected to rolling to thereby easily form a deformed flat wire as the final material 25 . specifically , plastic flow is easily caused , by rolling , in between the legs 29 of the isosceles trapezoid cross section , i . e . near the surface of the portion 32 in which the length between the legs 29 is large . accordingly , the metal is permitted to plastically flow into the two corners 30 a and 30 b which are desired to have large curvature , thereby easily forming a deformed flat wire . the two - stage rolling is performed with the sequential transition of the material from the initial material 23 to the intermediate material 24 and further to the final material 25 . in this two - stage rolling , the final material 25 can be formed without having to do so much rolling in the intermediate material 24 with respect to the two corners 30 c and 30 d which are desired to have smaller curvature . thus , compared to the case where the initial material 23 is rolled into the final material 25 without forming the intermediate material 24 , the probability of damaging the insulation coating is further reduced in the corners 30 c and 30 d . the mode of the stator winding 1 and a method of fabricating the same is not limited to the embodiment described above , but may be variously modified . for example , according to the fabrication method of the embodiment , the stator winding 1 is rolled in two stages . alternative to this two - stage rolling , a single - stage rolling may be performed in which the deformed flat wire as the final material 25 is fabricated from the round wire as the initial material 23 , without forming the intermediate material 24 . in this case , the number of the stages is reduced and the cost incurred in the fabrication is reduced . the present invention may be embodied in several other forms without departing from the spirit thereof . the embodiment and modifications described so far are therefore intended to be only illustrative and not restrictive , since the scope of the invention is defined by the appended claims rather than by the description preceding them . all changes that fall within the metes and bounds of the claims , or equivalents of such metes and bounds , are therefore intended to be embraced by the claims . | 7 |
the actual content of each embodiment of this invention is explained hereinafter by using figures . the method to read the value indicated by the meter automatically and the method to correct the apparatus is stated as follows : the action to read a meter for the purpose to collect fee takes place periodically with the certain interval . for example the meter reading of utility such as gas , water and electricity takes place once a month in general . the meter itself is basically an accumulator of utility flow and the amount of used utility is calculated by the difference the reading of this month from the reading of last month . for the reason , to employ the passive way of reading , the reading can be done by recognizing electrically the value shown on the meter periodically and by sending the value of reading through radio . in other words the reading of meter takes place only upon the demand . it is possible to cut unnecessary power off and to stop the function of the portion of system not in use . [ 0039 ] fig1 shows the structure of the passive meter reading system . the passive meter reading system 100 explained in this embodiment equips a calendar clock 110 , a power supply for the radio equipment . 130 , a radio communication unit 140 , a comparator 150 , a central processing unit 180 , a image - processing unit 170 , a main power supply 160 and two or logical circuits 120 and 125 . the calendar clock has two different functions . the calendar clock 110 and the or logical circuits 120 and 125 are connected a power supply of always in function . the calendar clock 110 is programmed the ambient period of the meter reading and the calendar clock 110 submits the signal to activate the power supply for the radio equipment 130 . the radio communication equipment 140 is powered up and the radio communication unit 140 is then turned on into function . the power supply for the radio equipment - 130 powers the radio communication unit 140 and the comparator 150 . when both are turned on , the radio communication unit 140 listens to the predefined frequency , and receives the modulated information of the frequency through the antenna 190 , and recovers the content of the information , and then sends the content to the comparator 150 . the radio communication unit has a function to receive the command coming from in distance and to transfer the result of meter reading in distance by modulating the result to radio frequency . for example , a transceiver , a radio of a transmitter and a receiver combined , of low power radio may minimize the transmitter power . the comparator 150 has a function to detect arrival of ‘ the command of meter reading ’ and to turn the main power supply 160 on . the image - processing unit 170 has the function to take in the value displayed in analog way or in digital way on the meter display panel . the central processing unit 180 has the main function to analyze the image took in and to control the radio communication traffic . [ 0041 ] fig2 shows the timing chart of the calendar clock 110 , the output status of the power supplies 130 and 160 . it is obvious from the chart but the calendar clock 110 submits the signal 210 while predefined meter reading period is in approach . synchronizing to this signal 210 , the power output 220 of the power supply for the radio equipment 130 is turned on . once receiving the ‘ command of meter reading ’, the power output 230 of the main power supply 160 remains on until all the meter reading process is done . for the period of time above the power supply for the radio equipment 130 remains also on . it is possible to turn the signal out of the calendar clock 110 down after reception of data is completed but taking a consideration of retry of meter reading the signal out of the calendar clock is kept high for the certain period of time before turning it down for the case of this embodiment . then , the signal out of the calendar clock 110 is turned down until an approach of next meter reading period . the date of next ambient meter reading period can be modified by sending the new date to the passive meter reading system 100 and by making the calendar clock to memorize the new date . turning down the signal out of the calendar clock 110 cuts completely the power off for the unnecessary circuits but not just putting them into the sleeping state . it is a common power saving technique to put circuits of not in use in the sleeping state while the interval between two sampling periods is longer than the effective sampling time . the circuit at the sleeping state sometime still may consume several microamperes of current . accumulating even microamperes of power consumption may become a factor to shorten the battery life . for the case that the interval between two samplings is nearly a month and the effective sampling time is several seconds , as stated in this embodiment of the invention , the power supply itself for the circuit is cut off except for some specific circuits . this method permits to conserve more power . the procedure to turn on and off of the power supply is indicated on fig3 . setting the calendar clock 110 to the ambient meter - reading period ( procedure 101 ). the calendar clock 110 carves time ( procedure 102 ). the calendar clock 110 starts to submit the periodical signal of activation ( procedure 151 ) when the ambient meter reading period , the period of time estimated that the meter reading is to be executed , is in approach ( procedure 151 ). in the other hand when the period of meter reading is determined far away ( procedure 151 ), the calendar clock 110 keeps carving time ( procedure 102 ). the logical state of the signal out of the first or circuit 120 is set high ( 1 ) activated by the signal out from the calendar clock 110 ( procedure 104 ). the logical state of the first or circuit output is set high ( 1 ) and then the power supply for the radio equipment 130 is enabled ( procedure 105 ). the radio communication units powered by the power supply 130 starts receiving radio signals ( procedure 106 ). the radio communication unit 140 demodulates the received signals ( procedure 107 ), sends the recovered information to the comparator 150 ( procedure 108 ), and makes a comparison if the information sent was the ‘ command of meter reading ’ ( procedure 109 ). if the received signal is the ‘ command of meter reading ’, the comparator 150 sends high ( 1 ) to the input of the second or circuit 125 ( procedure 110 ). then , the output of the second or circuit is turned high ( 1 ) ( procedure 111 ), and the main power supply is turned on ( procedure 112 ). then , the central processing unit 180 and the image - processing unit 170 gain power and start to be enabled ( procedure 113 ). the central processing unit 180 actives , while the action of meter reading , the input of both or circuits 120 and 125 for the reason to turn on the power supply ( procedure 114 ). the main power supply 160 is turned off after the central processing unit 180 finished all the action related the meter reading by setting the input of both or circuits at low ( 0 ) state ( procedure 115 ). and then the passive meter reading system 100 becomes to be ready for next meter reading action . the procedures to read the value digitalized mechanically or optically are explained hereinafter . fig4 shows the structures of the image - processing system that is comprised the image acquisition unit and the pattern recognition unit . the image - processing unit 170 is divided into the image acquisition unit that acquires the image of the value shown on the utility meter and the pattern - recognition unit that extracts the meter value in number by patter matching technique . the image acquisition unit is comprised the light emitting diode ( led ) 460 , the detector matrix 450 and the image - processing interface 430 . the led has a function to light up the surface of meter panel while acquisition of image . the detector matrix 450 is comprised ether for example a charge coupled device ( ccd ) or a complementally metal oxide semiconductor ( c - mos ) array and has a function to take an image in . the image - processing interface 430 has a function to save temporally the image taken and to transfer the image information to the pattern recognition unit . the patter recognition unit is consisted of the central processing unit 410 and the pattern recognition software 420 . the central processing unit 410 obtains the image information from the image - processing interface 430 , and extracts the value shown on the utility meter in number from the image taken in , and then transmits the extracted value to the receiver of the passive meter reading system through the radio communication unit 140 . the explanation of the image detection unit 500 that takes the image of the display panel of the utility meter is hereinafter . fig5 are the schematics showing the structure of the image detection unit 500 . the image detection unit 500 is comprised the light emitting diode ( led ) 520 for lighting and the detector matrix 530 . the display panel of the utility meter is expected round shape so that the image detection unit 500 has round shape . the led 520 is placed round on the surface of the image detection device 510 . the color of the led 520 should be the color of preference to acquire the image . the actual colors of led 520 , for example , are white , blue , green , yellow and so forth . the detector matrix 530 is located at lower level from the location of the led 520 . this structure eliminates unwanted light introduction to the detector matrix 530 such as direct − light from the led 520 or indirect light by reflection . the detector matrix 530 is connected to the detector cable 540 . the image detection unit 500 is covered by the detector enclosure 550 . the detector enclosure 550 has round shape as the image detection unit 500 . the function of the image - processing unit and the pattern recognition unit is as follows : fig6 is the flow chart indicating the flow of the image - processing unit and the pattern recognition unit . the central processing unit 410 gains power ( procedure 201 ). the central processing unit 410 initializes the parameter and the conditions ( procedure 202 ). the central processing unit 410 takes its own id number of the passive meter reading system ( procedure 203 ). the central processing unit 410 commands the radio communication unit 140 to transmit this value ( procedure 204 ). the radio communication unit transmits the own id number of the passive meter reading system ( procedure 205 ). the receiver of the passive meter reading receives the id number of the passive meter reading system ( procedure 206 ). the receiver of the passive meter reading system gives a permission to send the passive meter reading system 100 to perform meter reading ( procedure 207 ). when the central processing unit 410 receives the permission , the central processing unit 410 sends a command to set power on the lcd 520 to the image acquisition interface 430 ( procedure 208 ). the led 520 lights up and shines on the display panel of the utility meter ( procedure 209 ). the detector matrix 530 takes the image in ( procedure 210 ) and the image is temporally saved in the temporary memory unit 440 of the image acquisition interface 430 ( procedure 211 ). the central processing unit 410 extracts the numerical value of the display by digitalizing the image data stored temporally by use of the pattern recognition software 420 ( procedure 212 ). as the method of pattern recognition each pixel is binalized , classifying either 1 or 0 in other word , based upon the light intensity information of the entire pixels for the case of that the display is in numerical number . the lines are extracted from the binalized image and the number is determined by pattern matching of these lines and the lines pre - stored in the central processing unit 410 . this is a common way to determine the numerical value . for the case that the value is defined by the position of the needle the direction that the needle points out is extracted and the numerical value is calculated from the position . these are two examples of extraction of the numerical values . the central processing unit 410 sends the numerical value extracted by pattern recognition to the radio communication unit 140 ( procedure 213 ). the radio communication unit 140 modulates the value into rf frequency and transmits it ( procedure 214 ). the radio communication unit confirms if the reception was completed with correct values ( procedure 215 ). for the case of reception by correct values ( procedure 220 ) radio transmission is terminated ( procedure 216 ). in the other hand , for the case that reception with incorrect vales ( procedure 220 ), the procedures 214 , 215 and 220 are repeated until reception with correct values . when the radio transmission is over ( procedure 216 ), the central processing unit 410 send low ( 0 ) to the both or circuits 120 and 125 ( procedure 217 ). this action deactivates the power supply for the radio equipment 130 and the main power supply 160 into power down state ( procedure 218 ). when these two power supplies turned off , then only the calendar clock carves time and it continues until next meter reading moment . this embodiment is comprised the explanation of the automated meter reading system for water . fig7 shows the structure of the automated meter reading system for water . the passive meter reading system 100 has the physical shape of lid of the utility meter 760 that covers the display panel of the utility meter 760 . the passive meter reading system 100 equips a movable joint that permits the rotation from one side and also equips two metal - fittings 750 and 751 on the other side of the movable joint in order for the passive meter reading system 100 to fix to and / or to remove from the utility meter 760 . this system permits for a person of classical meter reading to look directly the surface of display panel of the utility meter 760 . fixing the passive meter reading system 100 over the utility meter 760 by the movable joint 755 and fixing metal fittings 750 and 751 without a space makes to eliminate coming light from out side and then it makes easy to perform pattern recognition . the passive meter reading 100 has two parts , the image acquisition unit and the main body of the passive meter reading system . the image detection device and the image acquisition interface are integrated in the image acquisition unit as the fig4 shows . the calendar clock 110 , the power supply for the radio equipment 130 , the main power supply 160 , the radio communication unit 140 , the central processing unit 180 and the antenna 190 are integrated in the main body of the passive meter reading system . the utility meter is connected to the waterway 780 by the piping 770 . the environment where the passive meter reading system is placed is as follows : fig8 shows the environment of placement for the passive meter reading system 100 . the utility meter 760 is placed in , in general , a metal box 840 with specifically a cast iron lid 830 . the metal box is , in general , placed under the ground . meter reading takes place to read the utility meter 760 by opening up the cast iron lid 830 . fig8 shows the case of an opening and shutting valve installation in the cast iron box . the next is the explanation of the receiver of the passive meter reading system that the passive meter reading system transmits the result of meter reading . for the actual installation setting there are two major ways . as the first case , the receiver of the passive meter reading system 920 is installed in a moving object such as an automobile 900 and , as the second case , meter reading is done by a hand held type remote receiver unit if the passive meter reading system where the receiver of the passive meter reading system is integrated in . fig9 show the case of meter reading by using an automobile 900 . fig1 shows the configuration of the receiver of the passive meter reading system for an automobile 920 . the receiver of the passive meter reading system for an automobile 920 is comprised the radio communication unit 1040 , the radio communication control unit 1010 , the memory unit for temporary data saving 1020 , the computer unit of meter data acquisition 1030 and the battery 1050 . while the receiver of the passive meter reading system is in action , the data communication unit sends contentiously with a certain interval the ‘ command of meter reading ’ toward the passive meter reading system . when the passive meter reading system 100 receives the radio transmission containing ‘ the command of meter reading ’, the computer unit of meter data acquisition collects the meter reading values following the flowchart indicated in fig6 . here explains the hand held type remote unit where a person executes meter reading carries around . fig1 indicates the hand held type remote receiver unit of the passive meter reading system in action . the hand held type remote receiver unit of the passive meter reading 1100 is shown in fig1 . the handheld type remote receiver unit of the passive meter reading 1100 is consisted of the radio communication unit 1240 , the radio communication controller 1210 , the memory unit for temporary data saving 1220 , the interface 1230 and the battery 1250 . the structural difference of the hand held type remote receiver unit from the receiver installed in an automobile is absence of the computer unit for meter data acquisition . the hand held type remote receiver unit 1100 saves meter data into the memory unit for temporary data saving and then these data will be transferred through the terminal 1130 . the hand held type remote receiver unit of the passive meter reading system 1100 equips the portion to , display the user id number in digits 1110 and the portion to display the current meter reading value coming from the utility meter 1120 in a chassis 1140 . now explains the data transfer method of the hand held type remote receiver unit of the passive meter reading system . fig1 shows the schematic connecting the hand held remote receiver unit of the passive meter reading system 1100 to the data terminal 1310 and transferring the data to the computer . the hand held type remote receiver unit of the passive meter reading system 1100 has to discharge the data before the memory unit 1220 in the hand held unit 1100 is completely full . the hand held type remote receiver unit of the passive meter reading system 1100 is expected to be carried around by a human being so that the quantity of the battery 1250 to be carried around is limited . the battery 1250 , therefore , must be recharged time to time . [ 0054 ] fig1 shows the status of data transfer from the hand held type remote receiver unit of the passive meter reading system 1310 through the data terminal 1310 . recharging of the battery can be taken in place while the data transfer . the data terminal 1310 is fed , for example , by the power supply 1320 rectifying the household 100 volt alternative current taking in from the power plug 1330 . the data terminal 1310 is fed by the direct current coming from the power supply 1320 and it is also possible for the hand held remote receiver unit 1310 to be fed by the direct current . the data terminal 1310 is connected to the computer unit for data acquisition 1340 through the interface 1230 . after meter reading work has be done , the data transfer can be done simply by for the hand held type remote receiver unit of the passive meter reading system 1100 to insert into the inlet of the data terminal 1310 . the recharging of the battery takes place at the same time to the data transfer . this invention is the passive meter reading system and it permits to conserve the electrical power as maximum as possible by shutting off the power of unnecessary circuit that does not deal with the function of purpose . this is very effective to elongate the life of the battery that is located where frequent replacement of battery is not efficient . in other words conservation of power has an advantage to prevent frequent replacement of battery . the system is program to turn on the power supply one by one when it became necessary after receiving ‘ the command of meter reading .’ it has an advantage to conserve more power than all the power supply is turned on at once . the system of this invention also permits current on - site reading the utility meter in addition to perform the passive meter reading in distance . | 8 |
according to a preferred embodiment , the host device hd consists of a pay tv set top box and the secure device sd consists of a smart card locally connected to the set top box via an appropriate card reader . the smart card comprises at least one chip set including a processor , a memory management unit , communication interfaces , random access and non volatile memories . software loaded in the chip set is configured for monitoring the behavior of the set top box in various conditions of functioning such as starting , encrypting or decrypting multimedia data , control messages and rights management , etc . the monitoring aims to authenticate a set top box by the smart card to prevent use of unauthorized devices or illegal data processing programs running on authorized devices . an advantage of the method is that it can be implemented on set top boxes already installed in the field . in fact , at first connection to the smart card , the set top box receives from the smart card the necessary data to update its firmware or in this case the conditional access kernel ( cak ) in order to be able to exchange data with the smart card . this update thus renders the smart card compatible with the set top box which has to interpret in a correct way the commands and queries sent by the smart card during the authentication process . according to an embodiment the set top box firmware update may be carried out on line , at connection of the smart card , by downloading the necessary data or messages from a managing center . once the smart card is connected and adapted to the set top box , the authentication mechanism may be activated remotely by the managing center , either globally for all set top boxes at a time , for a group or individually by addressing a particular set top box by a suitable identifier such as a serial number and / or smart card identifier . groups may be defined by geographical areas , type or configuration of device , software version , smart card family , etc . the secure device sd determines at least one hardware or software parameter , but preferably a set comprising a mix of hardware and software parameters p 1 , p 2 , . . . pn of the host device hd in working condition or for a specific operation mode . for example , authentication begins when the host device requests a key stored in the secure device , descrambles received data or at storing data on a disc , etc . commands and queries are sent by the secure device sd to the host device hd which answers by returning instantaneous or average values of the functioning hardware and software parameters ; see flowchart of fig2 . the hardware parameters comprise physical parameters depending on the electric functioning of the host device such as values of the power supply voltage and current , clock frequency , processor temperature , and signal timing . further hardware parameters are related to the communication protocol between the secure device and the host device according to standards : iso 7816 , or iso 14443 namely t = 0 or t = 1 i . e . character - level transmission protocol , respectively block - level transmission protocol , usb interface , namely conformity of application protocol data unit ( apdu ) sequences , transmission speed , data or blocks throughput , or other protocols such as sd ( secure digital ) or mmc ( multi media card ) protocol . the software parameters depend on the activity of the processor or the chip set of the host device during the progress of a data processing program . they are based on : a number of program instructions and the time required for a given cryptographic operation for example , the type and number of sub - routines called , the number of resets and the source or cause of them , tests having passed or failed , number of accesses to the internal non - volatile memory of the secure device and / or host device , i . e . read / write operation in the memories , quantity of secure device functional or internal alarms , number of access to stored cryptographic keys , and operations executed with these keys . periodicity of resets within a predetermined time period . a too high number of resets during the time period relative to a threshold may lead to countermeasures . number of messages by type processed within a predetermined time period . a too high frequency over a threshold of a certain type of message may also lead to countermeasures . these above mentioned hardware and software parameters are taken as non exhaustive examples . many other parameters depending on the nature of the host device processor or chip set may be envisaged . furthermore , software parameters comprise sequences of messages issued from the data processing be the host device or rather the type and number of certain category of messages , the syntax of the messages or interfaces requested by the host device hd . the errors status returned by the secure device sd may also be taken account . the selection of hardware and software parameters p 1 , p 2 , . . . , pn to be determined by the secure device sd may also be based on a predefined host device authentication program loaded in the security device sd which executes a detection scenario carrying out a wrong protocol , false data or generates errors on the secure device . the secure device sd analyses corresponding reaction of the host device hd to these unexpected commands , requests or responses . the detection scenario may preferably variable in time , i . e . a different scenario is executed at different pre - programmed moments . the secure device sd “ knows ” the behavior of an authorized host device by reference hardware and software parameters rp 1 , rp 2 , . . . , rpn stored in a non volatile memory . the determined parameters p 1 , p 2 , . . . , pn are compared with the stored reference parameters and in case of differences , i . e . determined parameter lower or higher than the reference parameter , a counter c 1 , c 2 , . . . cn associated to the concerned parameter is modified , i . e . incremented or decremented from an initial value . if the determined parameter p 1 , p 2 , . . . , pn is equivalent to the reference parameter rp 1 , rp 2 , . . . , rpn , the corresponding counter value remains unchanged i . e . the parameter test is considered as ok by the secure device sd . to improve security of the data transmission between the secure device and the host device , a random number or nonce ( a randomly generated cryptographic token ) may accompany a command or a query sent by the secure device . once this number has been received by the host device , it builds a response comprising at least the requested hardware or software parameter and the random number . according to an option , a mathematical function is carried out on the random number , said function being known to the secure device . thus the number received is either the random number itself or a direct function of the random number . the aim is to ensure that the random number received corresponds to the random number generated by the secure device . when these two random numbers are different , the secure device can also enable countermeasures similar to the ones activated when authentication fails . thanks to the presence of this random number in the data exchanges at authentication , every unauthorized reproduction attack or replay attack is prevented . a response to a request sent by a secured device coming from a given host device cannot be transferred to another host device . a response sharing is thus also avoided . in order to improve accuracy of the comparison by taking account variation of the parameters , the determination of the parameter and comparison with the reference parameter is preferably repeated several times either periodically , or at each start of the host device or of a particular operation thereof or even upon a request transmitted by a message sent by an external unit . for example , in the filed of pay tv , management messages emm are sent by broadcasters to update user rights in the secure device . at this opportunity , host device authentication may also be initiated to verify conformity of hardware and software . at each repetition time the counter is modified in the direction of the variation and may return to the initial value when parameter high values compensate parameter low values . each counter c 1 , c 2 , . . . cn has a threshold value tc 1 , tc 2 , . . . , tcn specific to the host device hd . depending on the counter values reached after several parameters tests , the secure device sd sends a command com to the host device hd enabling either further processing or a specific action . if the counter values correspond to expected ones for an authorized host device , the secure device authorize further processing ( ok status ). otherwise , when one or several counters shows abnormal or unusual values , the secure device sd may restart the authentication process from the beginning by the parameters determination to validate or invalidate the “ wrong ” results before executing countermeasures . according to an option , countermeasures are carried out as soon as the values of the counters are out of range . these countermeasures may act as well on the secure device as on the host device such as limiting access to payload data , disabling user rights , blocking communication between the secure device and the host device , putting out of service the secure device and / or the host device . according to an embodiment some counters may be associated to a subset of the set of the determined hardware or software parameters so that these counters are modified when at least one hardware or software parameter of the subset is different from the corresponding reference parameter . according to a further embodiment a tolerance may be set up in the configuration of the counters or their sensitivity to parameters variations is lowered . the value of such a counter related to one or a set of hardware and software parameters is modified only after a predetermined number of differences logged by comparing the determined hardware or software parameters with the corresponding reference parameters during a plurality of time periods . according to a further embodiment , the hardware and software parameters are determined at predefined time intervals and the duration of their variations are recorded duration of the variations of said parameter . the corresponding counter is then modified when the duration differs from a reference duration . according to a further embodiment the secure device filters the values of the counters associated to the hardware and software parameter of the set to keep only counter values selected according to predefined criteria . for example , among the determined parameters , the secure device selects only the counter values corresponding to the most critical parameters involved in secure operation executed by the host device . for example , a number of accesses and using keys from a memory to decrypt data should be limited to a value excluding tampering attempts . the filtering criteria are preferably defined by a type of data processing program executed by the host device to obtain a selection of hardware and software parameters specific to the behavior of said data processing program . to improve security and increase difficulty of reverse engineering of the secure device functionalities , the filtering criteria may also be variable in time so that not always the same parameters are tested . the authentication data including specific hardware and software parameters and the counters filtering criteria are stored in the secure device and may be exported to another device ( computer ) for various purposes such as : real time analyzing in a context of production quality evaluation , for statistical handling or for filtering criteria optimization . | 6 |
a method based on multi - core fbg probe for measuring structures of a micro part includes following steps : providing a multi - core fbg probe , which comprises a spherical tip and a multi - core fiber stylus inscribed fbgs in its cores . the multi - core fiber stylus , cantilevered at one end and with the spherical tip fixed on the other , serves as the multi - core fbg probe . the multi - core fiber utilized to fabricate the multi - core fiber stylus should have one or more cores located out of the center of the multi - core fiber ; in step 1 , the multi - core fiber comprised fbg in its cores with a special structure is served as the multi - core fbg probe stylus . when the spherical tip of the multi - core fbg probe is subjected to a radial contact displacement , for example in axis x as shown in fig1 , the multi - core fbg probe can be simplified into a cantilever and the distribution of strain in the multi - core fbg probe can be expressed as : where , l is the coordinate along the multi - core fbg probe , l = 0 at the fixed end , l = l at the free end , v r is the contact displacement , d is the eccentric distance from the core to the neutral plane and l is the length of the multi - core fbg probe , respectively . fbgs comprised in the multi - core fiber stylus are subjected to strain due to a radial contact displacement and shifts of their reflection spectra can be express as : where , λ is the bragg wavelength of fbg , p e is the effective photoelastic constant typically 0 . 213 for a common fbg , and ε is the strain caused by the contact deformation , respectively . it can be concluded from eq . ( 1 ) and eq . ( 2 ) that the distribution of strain in the multi - core fiber stylus caused by a radial contact displacement along axis x is not uniform . fbgs in the multi - core fiber stylus are transformed into linear chip fbgs , and shifts of reflection spectra of linear chip fbgs are the average of shifts of reflection spectra of local fbgs at both ends of the multi - core fbg probe . by substituting eq ( 1 ) into eq . ( 2 ), shifts of reflection spectra of fbgs can be given by : the remarkable difference between multi - core fiber and normal fiber used to fabricate the fiber stylus of a fbg probe is the cores located out of the center of the fiber stylus . it can be concluded from eq . ( 3 ) that the reflection spectrum of fbg comprised in the core located out of the center of the fiber stylus has significant changes and can be serviced as sensing signal as a result of the eccentric distance from the core to the neutral plane as shown in fig3 . however , the shift of the reflection spectrum of fbg comprised in the core located in the center of fiber stylus approximates to zero as a result of d = 0 as shown in fig4 . the structure of the core located out of the center of fiber stylus significantly improves the radial sensitivity of a fbg probe . as shown in fig2 , when the multi - core fbg probe is compressed through an axial contact along axis z and uniform strain in the multi - core fbg probe can be expressed as : where , v a is the contact displacement along axis z . by substituting eq ( 4 ) into eq . ( 2 ), shifts of reflection spectra of fbgs can be given by : it can be concluded from eq . ( 5 ) that the axial sensitivity of the core located out of and in the center of the multi - core fiber stylus is the same . providing a photoelectric probing system , which consists of the multi - core fbg probe mentioned in step 1 , an optical path for the operation of the multi - core fbg probe , and an interrogation unit ( consisting of a demodulation unit and a signal processing unit ) for detecting and processing the sensing signal of the multi - core fbg probe . when a micro part is measured , the spherical tip of the multi - core fbg probe is brought into contact with a micro part and the spectra of fbgs comprised in the multi - core fiber stylus shift accordingly . the optical path supplies the multi - core fbg probe with energy and ensures the sensing signal containing spectrum shifts of fbgs in the multi - core fiber stylus and the reference fbg can reach the interrogation unit . the interrogation unit detects the sensing signal , transforms it into spectrum shifts of fbgs , and then calculates contact displacements of the spherical tip of the multi - core fbg probe relative to its zero - force position ; in step 2 , the photoelectric probing system can be embodied in three ways : the light source can be a broadband ase source . when the light source is a broadband ase source , the reflected light signal is reflection spectra of fbgs , and the demodulation unit can be an optical spectrum analysis device . the optical spectrum analysis device has an optical input port and an electric output port . shifts of reflection spectra of fbgs detected by the optical spectrum analysis device are transformed into electric signal ; the electric signal is send to the signal processing unit to calculate contact displacements of the spherical tip of the multi - core fbg probe relative to its zero - force position . the light source can be a broadband ase source . when the light source is a broadband ase source , the reflected light signal is reflection spectra of fbgs and the demodulation unit can be also a matching fbg pair demodulation system which consists of a 50 : 50 coupler , a demodulation fbg and a multi - channel optical power measuring device . the matching fbg pair demodulation system has an optical input port and an electric output port . reflection spectra of fbgs comprised in the multi - core fiber stylus of the multi - core fbg probe and the reference fbg is reflected and enters the demodulation unit . the demodulation fbg is not affected by the measurement process . therefore , the spectrum overlap between the reflected light signal and the demodulation fbg just changes according to the spectrum shift of the reflected light signal . the optical power ratio of the reflected light signal and the spectrum overlap between the reflected light signal and the demodulation fbg is transformed into electric signal by the multi - channel optical power measuring device ; the electric signal is send to the signal processing unit to calculate contact displacements of the spherical tip of the multi - core fbg probe relative to its zero - force position . the light source can be a narrowband laser source whose wavelength is located in the range of reflection spectra of fbgs comprised in the multi - core fiber stylus of the multi - core fbg probe and the reference fbg . when the light source is a narrowband laser source , the reflected light signal is the reflectivity of the spectra of fbgs at current wavelength of the narrowband laser source and the demodulation unit can be a multi - channel optical power measuring device . the power of the reflected light signal is in related to the reflectivity of the spectra of fbgs at the wavelength of the narrowband laser source , and it changes according to shifts of reflection spectra of fbgs comprised in the multi - core fiber stylus of the multi - core fbg probe and the reference fbg . the optical power ratio of the reflected light signal and the narrowband laser source is transformed into electric signal by the multi - channel optical power measuring device ; the electric signal is send to the signal processing unit to calculate contact displacements of the spherical tip of the multi - core fbg probe relative to its zero - force position . combining the photoelectric probing system mentioned in step 2 with a coordinate measuring instrument system to form an equipment based on multi - core fbg probe for measuring structures of a micro part , contact displacements of the spherical tip of the multi - core fbg probe and coordinates of the multi - core fbg probe relative to the coordinate measuring instrument system are acquired in real time and are processed by a measurement computer , wherein coordinates of contact points can be calculated from coordinates of the multi - core fbg probe relative to the coordinate measuring instrument system and contact displacements of the spherical tip of the multi - core fbg probe relative to its zero - force position measured directly using the photoelectric probing system ; in step 3 , a type of equipment based on multi - core fbg probe for measuring structures of a micro part is formed , in which coordinates of the coordinate measuring instrument system and changes of the photoelectric probing system will be recorded in real time with a high speed . the photoelectric probing system is used as a trigger and the coordinate measuring instrument system offers a precise three - dimensional movement and feedback . the movement of the coordinate measuring instrument system will be stopped as soon as the spherical tip of the multi - core fbg probe contacts a micro part . coordinates of contact points can be calculated using a program embedded within the measurement computer . a micro part measured is fastened to a measurement table of the equipment based on multi - core fbg probe for measuring structures of a micro part mentioned in step 3 . the motion of the measurement table and the multi - core fbg probe fixed on the sleeve of the equipment is controlled by manual operation or a measurement program . relative motion between the multi - core fbg probe and a micro part occurs and the motion track is accurately designed to bring the spherical tip of the multi - core fbg probe into contact with a certain point of a micro part . coordinates of a contact point can be calculated in the measurement computer mentioned in step 3 ; in step 4 , coordinates of a contact point of a micro part can be manually or automatically acquired using the coordinate measurement method mentioned in step 3 . repeat the measurement process in step 4 to obtain coordinates of more contact points and the structure geometry of a micro part measured can be reconstructed from coordinates of these contact points . in step 5 , coordinates of a micro part are acquired using the measurement process mentioned in step 4 and the structure geometry of a micro part measured can be reconstructed according to contact points . according to the second purpose of the present invention , equipment based on multi - core fbg probe for measuring structures of a micro part can be set up in the following ways : as shown in fig5 , the equipment based on multi - core fbg probe 519 for measuring structures of a micro part consists of a coordinate measuring instrument system 51 , a photoelectric probing system 58 , and a measurement computer 520 . the coordinate measuring instrument system 51 consists of a crosspiece 52 , a sleeve 53 adjustable in the x and z direction , a measurement table 54 movable in the y direction , an instrument basement 55 , a xyz - counter 56 , a cnc controller 57 . the crosspiece 52 and the sleeve 53 adjustable in the x and z direction , the crosspiece 52 and the instrument basement 55 , the measurement table 54 movable in the y direction and the instrument basement 55 are linked with mechanical structures , respectively . the crosspiece 52 supports the sleeve 53 adjustable in the x and z direction . the instrument basement 55 supports the crosspiece 52 and the measurement table 54 movable in the y direction . the instrument basement 55 drives the measurement table 54 directly and the sleeve 53 indirectly through the crosspiece 52 . the multi - core fbg probe 519 for sensing contact displacements is fixed on the sleeve 53 and can be adjustable in the x and z direction . a micro part being measured is fastened to the measurement table 54 movable in the y direction . the sleeve 53 adjustable in the x and z direction and the xyz - counter 56 , the measurement table 54 movable in the y direction and the xyz - counter 56 , the instrument basement 55 and the cnc controller 57 , the xyz - counter 56 and the measurement computer 520 , and the cnc controller 57 and the measurement computer 520 are linked with electric cable , respectively . the xyz - counter 56 is used to determine coordinate values x , y , z of the multi - core fbg probe 519 relative to the coordinate measuring instrument system 51 , and to send coordinate values to measurement computer 520 . the cnc controller 57 receives the signal from the measurement computer 520 , and controls the motion of the sleeve 53 and the measurement table 54 . relative motion between the multi - core fbg probe 519 and a micro part is controlled by the cnc - controller 57 to implement cnc operations and measurement processes , and the motion track is accurately designed to bring the spherical tip 515 of the multi - core fbg probe 519 into contact with a certain point of a micro part . the equipment based on multi - core fbg probe 519 for measuring structures of a micro part features the photoelectric probing system 58 , which consists of a light source 59 , an optical circulator 510 , a multi - channel optical switch 511 , a multi - core fiber fan - out 512 , multi - core fiber 513 , a multi - core fbg probe 519 consisting of a multi - core fiber stylus 514 and a spherical tip 515 , a reference fbg 516 , a demodulation unit 517 and a signal processing unit 518 . the light source 59 and the optical circulator 510 , the optical circulator 510 and the multi - channel optical switch 511 , the multi - channel optical switch 511 and the multi - core fiber fan - out 512 , the multi - channel optical switch 511 and the reference fbg 516 , and the optical circulator 510 and the demodulation unit 517 are linked with single mode fiber , respectively . the light coming from the light source 59 goes through single mode fiber into a core of the multi - core fiber stylus 514 of the multi - core fbg probe 519 or the reference fbg 516 and then is reflected by fbgs within them . the reflected light signal as the sensing signal enters the demodulation unit 517 through the multi - core fiber 513 , the multi - core fiber fan - out 512 , the multi - channel optical switch 511 and the optical circulator 510 , respectively . the multi - channel optical switch 511 and the measurement computer 520 are linked with electric cable . the multi - channel optical switch 511 is controlled by the measurement computer 520 and the time - division - multiplexing measurement optical paths are formed by switching among fbgs in cores of the multi - core fiber stylus 514 and the reference fbg 516 . when the spherical tip 515 of the multi - core fbg probe 519 gets contact with a micro part , the multi - core fbg probe 519 deforms and consequent stress distributed along the multi - core fiber stylus 514 shifts reflection spectra of fbgs comprised in the multi - core fiber stylus 514 . the reflected light signal is thus changed . the demodulation unit 517 and the signal processing unit 518 , the signal processing unit 518 and the measurement computer 520 are linked with electric cable , respectively . the reflected light signal of fbgs in cores of the multi - core fiber stylus 514 of the multi - core fbg probe 519 and the reference fbg 516 is transformed into electric signal by the demodulation unit 517 ; the electric signal is processed to achieve contact displacements δx 1 , δy 1 and δz 1 of the spherical tip 515 of the multi - core fbg probe 519 relative to its zero - force position uncoupled with environmental temperature drifts by the differential processing in the signal processing unit 518 , and then send to the measurement computer 520 and there linked to coordinate values x , y , z of the multi - core fbg probe 519 relative to the coordinate measuring instrument system 51 , which are determined using the xyz - counter 56 . coordinates of contact points can be calculated from coordinate values x , y , z of the multi - core fbg probe 519 relative to the coordinate measuring instrument system 51 and contact displacements δx 1 , δy 1 and δz 1 of the spherical tip 515 of the multi - core fbg probe 519 relative to its zero - force position measured directly using the photoelectric probing system 58 . from the values computed in this way , structure geometry of a micro part is determined . the diameter d of the multi - core fiber without coating used to fabricate the multi - core fiber stylus 514 is usually in the range of 50 μm to 400 μm . the radii of the multi - core fiber &# 39 ; s cores are r , and r is normally 4 μm to 6 μm . the distance d from the cores to the center of the multi - core fiber should ensure that the multi - core fiber contains the cores , that is d should be less than 0 . 5d − r . the multi - core fbg probe 519 can be 3 ˜ 10 mm long . the diameter ratio of the spherical tip 515 to the multi - core fiber stylus 514 is normally in the range of 1 . 2 ˜ 1 . 5 . the horizontal axis is axis x , the vertical axis is axis y , and the axial direction along the multi - core fiber stylus 514 is axis z . the axes x and y are in the section of the multi - core fiber stylus 514 , and the origin of axes x and y is at the center of the multi - core fiber stylus 514 . the multi - core fbg probe 519 can be embodied in way 1 : the multi - core fiber stylus 514 of the multi - core fbg probe 519 can be a section of eccentric single - core fiber 61 , and the multi - core fiber 513 is the eccentric single - core fiber 61 . as shown in fig6 ( a ) and ( b ) , the core 62 is located on the negative direction of axis x with a distance of d to the center of the eccentric single - core fiber 61 . the multi - core fbg probe 519 fabricated by the eccentric single - core fiber 61 has a two - dimensional measurement capacity in axes z and x . the relationship between spectrum shifts and contact displacements can be analyzed using the theory mentioned in the first purpose of the present invention and expressed as : where , λ is the bragg wavelength of fbg comprised in the core 62 of the eccentric single - core fiber 61 served as the multi - core fiber stylus 514 and the reference fbg 516 ; δλ p is the spectrum shift of fbg comprised in the core 62 of the eccentric single - core fiber 61 served as the multi - core fiber stylus 514 due to contact displacements and environmental temperature drifts ; δλ r is the spectrum shift of fbg comprised in the reference fbg 516 due to environmental temperature drifts ; d is the eccentric distance from the core 62 to the center of the eccentric single - core fiber 61 ; p e is the effective photoelastic constant , typically 0 . 213 for a common fbg ; l is the length of the multi - core fbg probe 519 ; v x and v z is contact displacements in axes x and z , respectively . it can be concluded form eq . ( 6 ) that sensing signal of v x is coupled with v z in the multi - core fbg probe 519 fabricated by the eccentric single - core fiber 61 . contact displacements in axes x and z can be measured in a time - division - multiplexing way using the demodulation unit 517 and the signal processing unit 518 . what is more , the differential calculation of the spectrum shifts of fbgs comprised in the multi - core fiber stylus 514 and the reference fbg 516 can compensate common - mode environmental temperature drifts to ensure measurement results are not influenced by environment . the multi - core fbg probe 519 can be embodied in way 2 : the multi - core fiber stylus 514 of the multi - core fbg probe 519 can be a section of dual eccentric core fiber 63 , and the multi - core fiber 513 is the dual eccentric core fiber 63 . as shown in fig6 ( c ) and ( d ) , the first core 64 and the second core 65 are located on the negative and direction of axes x and y with a distance of d to the center of the dual eccentric core fiber 63 , respectively . the multi - core fbg probe 519 fabricated by the dual eccentric core fiber 63 has a three - dimensional measurement capacity in axes x , y and z . the relationship between spectrum shifts and contact displacements can be analyzed using the theory mentioned in the first purpose of the present invention and expressed as : where , λ is the bragg wavelength of fbgs comprised in the first core 64 and the second core 65 of the dual eccentric core fiber 63 served as the multi - core fiber stylus 514 and the reference fbg 516 ; δλ p1 and δλ p2 is spectrum shifts of fbgs comprised in the first core 64 and the second core 65 of the dual eccentric core fiber 63 served as the multi - core fiber stylus 514 due to contact displacements and environmental temperature drifts , respectively ; δλ r is the spectrum shift of fbg comprised in the reference fbg 516 due to environmental temperature drifts ; d is the eccentric distance from the first core 64 and the second core 65 to the center of the dual eccentric core fiber 63 ; p e is the effective photoelastic constant , typically 0 . 213 for a common fbg ; l is the length of the multi - core fbg probe 519 ; v x , v y and v z is contact displacements in axes x , y and z , respectively . it can be concluded form eq . ( 7 ) that v x and v y can be measured simultaneously . however , sensing signal of v x and v y are coupled with v z in the multi - core fbg probe 519 fabricated by the dual eccentric core fiber 63 . contact displacements in axes x , y and z can be measured in a time - division - multiplexing way using the demodulation unit 517 and the signal processing unit 518 . what is more , the differential calculation of spectrum shifts of fbgs comprised in the multi - core fiber stylus 514 and the reference fbg 516 can compensate common - mode environmental temperature drifts to ensure measurement results are not influenced by environment . the multi - core fbg probe 519 can be embodied in way 3 : the multi - core fiber stylus 514 of the multi - core fbg probe 519 can be a section of eccentric two - core fiber 66 , and the multi - core fiber 513 is the eccentric two - core fiber 66 . as shown in fig6 ( e ) and ( f ) , the first core 67 is located on the negative direction of axis x with a distance of d to the center of the eccentric two - core fiber 66 ; the second core 68 is located in the center of the eccentric two - core fiber 66 . the multi - core fbg probe 519 fabricated by the eccentric two - core fiber 66 has a two - dimensional measurement capacity in axes z and x . the relationship between spectrum shifts and contact displacements can be analyzed using the theory mentioned in the first purpose of the present invention and expressed as : where , λ is the bragg wavelength of fbgs comprised in the first core 67 and the second core 68 of the eccentric two - core fiber 66 served as the multi - core fiber stylus 514 and the reference fbg 516 ; δλ p1 and δλ p2 is spectrum shifts of fbgs comprised in the first core 67 and the second core 68 of the eccentric two - core fiber 66 served as the multi - core fiber stylus 514 due to contact displacements and environmental temperature drifts , respectively ; δλ r is the spectrum shift of fbg comprised in the reference fbg 516 due to environmental temperature drifts ; d is the eccentric distance from the first core 67 to the center of the eccentric two - core fiber 66 ; p e is the effective photoelastic constant , typically 0 . 213 for a common fbg ; l is the length of the multi - core fbg probe 519 ; v x and v z is contact displacements in axes x and z , respectively . it can be concluded form eq . ( 8 ) that v x and v z is not coupled with each other . contact displacements in axes x and z can be measured simultaneously using the demodulation unit 517 and the signal processing unit 518 . what is more , the differential calculation of spectrum shifts of fbgs comprised in the multi - core fiber stylus 514 and the reference fbg 516 can compensate common - mode environmental temperature drifts to ensure measurement results are not influenced by environment . the multi - core fbg probe 519 can be embodied in way 4 : the multi - core fiber stylus 514 of the multi - core fbg probe 519 can be a section of two - core fiber 69 , and the multi - core fiber 513 is the two - core fiber 69 . as shown in fig6 ( g ) and ( h ) , the first core 610 and the second core 611 are located on the negative and positive direction of axis x with a distance of d to the center of the two - core fiber 69 . the multi - core fbg probe 519 fabricated by the two - core fiber 69 has a two - dimensional measurement capacity in axes z and x . the relationship between spectrum shifts and contact displacements can be analyzed using the theory mentioned in the first purpose of the present invention and expressed as : where , λ is the bragg wavelength of fbgs comprised in the first core 610 and the second core 611 of two - core fiber 69 served as the multi - core fiber stylus 514 and the reference fbg 516 ; δλ p1 and δλ p2 is spectrum shifts of fbgs comprised in the first core 610 and the second core 611 of two - core fiber 69 served as the multi - core fiber stylus 514 due to contact displacements and environmental temperature drifts , respectively ; δλ r is the spectrum shift of fbg comprised in the reference fbg 516 due to environmental temperature drifts ; d is the eccentric distance from the first core 610 and the second core 611 to the center of the two - core fiber 69 ; p e is the effective photoelastic constant , typically 0 . 213 for a common fbg ; l is the length of the multi - core fbg probe 519 ; v x and v z is contact displacements in axes x and z , respectively . it can be concluded form eq . ( 9 ) that v x and v z is not coupled with each other . contact displacements in axes x and z can be measured simultaneously using the demodulation unit 517 and the signal processing unit 518 . what is more , the differential calculation of spectrum shifts of fbgs comprised in the multi - core fiber stylus 514 and the reference fbg 516 can compensate common - mode environmental temperature drifts to ensure measurement results are not influenced by environment . the multi - core fbg probe 519 can be embodied in way 5 : the multi - core fiber stylus 514 of the multi - core fbg probe 519 can be a section of eccentric three - core fiber 612 , and the multi - core fiber is the eccentric three - core fiber 612 . as shown in fig6 ( i ) and ( j ) , the first core 613 and the second core 614 are located on the negative direction of axes x and y axis with a distance of d to the center of the eccentric three - core fiber 612 , respectively ; the third core 615 is located in the center of the eccentric three - core fiber 612 . the multi - core fbg probe 519 fabricated by the eccentric three - core fiber 612 has a three - dimensional measurement capacity in axes x , y and z . the relationship between spectrum shifts and contact displacements can be analyzed using the theory mentioned in the first purpose of the present invention and expressed as : where , λ is the bragg wavelength of fbgs comprised in the first core 613 , the second core 614 and the third core 615 of the eccentric three - core fiber 612 served as the multi - core fiber stylus 514 and the reference fbg 516 ; δλ p1 , δλ p2 and δλ p3 is spectrum shifts of fbgs comprised in the first core 613 , the second core 614 and the third core 615 of the eccentric three - core fiber 612 served as the multi - core fiber stylus 514 due to contact displacements and environmental temperature drifts , respectively ; δλ r is the spectrum shift of fbg comprised in the reference fbg 516 due to environmental temperature drifts ; d is the eccentric distance from the fiber cores 613 and 614 to the center of the eccentric three - core fiber 612 ; p e is the effective photoelastic constant , typically 0 . 213 for a common fbg ; l is the length of the multi - core fbg probe 519 ; v x , v y and v z is contact displacements in axes x , y and z , respectively . it can be concluded form eq . ( 10 ) that v x , v y and v z is not coupled with each other . contact displacements in axes x , y and z can be measured simultaneously using the demodulation unit 517 and the signal processing unit 518 . what is more , the differential calculation of spectrum shifts of fbgs comprised in the multi - core fiber stylus 514 and the reference fbg 516 can compensate common - mode environmental temperature drifts to ensure measurement results are not influenced by environment . the multi - core fbg probe 519 can be embodied in way 6 : the multi - core fiber stylus 514 of the multi - core fbg probe 519 can be a section of three - core fiber 616 , and the multi - core fiber is the three - core fiber 616 . as shown in fig6 ( k ) and ( l ), the first core 617 , the second core 618 and the third core 619 are located out the center of the three - core fiber 616 with a distance of d to its center ; the lines from the first core 617 and the second core 618 to the center of the three - core fiber 616 are beveled at an angle of 30 degree and 150 degree to the negative direction of axis x , respectively ; the third core 619 is located on the negative direction of axis y . the multi - core fbg probe 519 fabricated by the three - core fiber 616 has a three - dimensional measurement capacity in axes x , y and z . the relationship between spectrum shifts and contact displacements can be analyzed using the theory mentioned in the first purpose of the present invention and expressed as : where , λ is the bragg wavelength of fbgs comprised in the first core 617 , the second core 618 and the third core 619 of the three - core fiber 616 served as the multi - core fiber stylus 514 and the reference fbg 516 ; δλ p1 , δλ p2 and δλ p3 is spectrum shifts of fbgs comprised in the first core 617 , the second core 618 and the third core 619 of the three - core fiber 616 served as the multi - core fiber stylus 514 due to contact displacements and environmental temperature drifts , respectively ; δλ r is the spectrum shift of fbg comprised in the reference fbg 516 due to environmental temperature drifts ; d is the eccentric distance from the first core 617 , the second core 618 and the third core 619 to the center of the three - core fiber 616 , respectively ; p e is the effective photoelastic constant , typically 0 . 213 for a common fbg ; l is the length of the multi - core fbg probe 519 ; v x , v y and v z is contact displacements in axes x , y and z , respectively . it can be concluded form eq . ( 11 ) that v x and v y can be measured simultaneously . however , sensing signal of v x and v y are coupled with v z in the multi - core fbg probe 519 fabricated by the three - core fiber 616 . contact displacements in axes x , y and z can be measured in a time - division - multiplexing way using the demodulation unit 517 and the signal processing unit 518 . what is more , the differential calculation of spectrum shifts of fbgs comprised in the multi - core fiber stylus 514 and the reference fbg 516 can compensate common - mode environmental temperature drifts to ensure measurement results are not influenced by environment . the multi - core fbg probe 519 can be embodied in way 7 : the multi - core fiber stylus 514 of the multi - core fbg probe 519 can be a section of eccentric four - core fiber 620 , and the multi - core fiber is the eccentric four - core fiber 620 . as shown in fig6 ( m ) and ( n ) , the first core 621 , the second core 622 and the third core 623 are located out the center of the eccentric four - core fiber 620 with a distance of d to its center ; the lines from the first core 621 and the second core 622 to the center of the eccentric four - core fiber 620 are beveled at an angle of 30 degree and 150 degree to the negative direction of axis x , respectively ; the third core 623 is located on the negative direction of axis y ; the fourth core 624 is located in the center of the eccentric four - core fiber 620 . the multi - core fbg probe 519 fabricated by the eccentric four - core fiber 620 has a three - dimensional measurement capacity in axes x , y and z . the relationship between spectrum shifts and contact displacements can be analyzed using the theory mentioned in the first purpose of the present invention and expressed as : where , λ is the bragg wavelength of fbgs comprised in the first core 621 , the second core 622 , the third core 623 and the fourth core 624 of the eccentric four - core fiber 620 served as the multi - core fiber stylus 514 and the reference fbg 516 ; δλ p1 , δλ p2 , δλ p3 and δλ p4 is spectrum shifts of fbgs comprised in the first core 621 , the second core 622 , the third core 623 and the fourth core 624 of the eccentric four - core fiber 620 served as the multi - core fiber stylus 514 due to contact displacements and environmental temperature drifts , respectively ; δλ r is the spectrum shift of fbg comprised in the reference fbg 516 due to environmental temperature drifts ; d is the eccentric distance from the first core 621 , the second core 622 and the third core 623 to the center of the eccentric four - core fiber 620 , respectively ; p e is the effective photoelastic constant , typically 0 . 213 for a common fbg ; l is the length of the multi - core fbg probe 519 ; v x , v y and v z is contact displacements in axes x , y and z , respectively . it can be concluded form eq . ( 12 ) that v x , v y and v z is not coupled with each other . contact displacements in axes x , y and z can be measured simultaneously using the demodulation unit 517 and the signal processing unit 518 . what is more , the differential calculation of spectrum shifts of fbgs comprised in the multi - core fiber stylus 514 and the reference fbg 516 can compensate common - mode environmental temperature drifts to ensure measurement results are not influenced by environment . the multi - core fbg probe 519 can be embodied in way 8 : the multi - core fiber stylus 514 of the multi - core fbg probe 519 can be a section of four - core fiber 625 and the multi - core fiber is the four - core fiber 625 . as shown in fig6 ( o ) and ( p ) , the first core 626 and the second core 627 are located are located on the negative and positive direction of axis x with a distance of d to the center of four - core fiber 625 , respectively ; the third core 628 and the fourth core 629 are located on the negative and positive direction of axis y with a distance of d to the center of the four - core fiber 625 , respectively . the multi - core fbg probe 519 fabricated by the four - core fiber 625 has a three - dimensional measurement capacity in axes x , y and z . the relationship between spectrum shifts and contact displacements can be analyzed using the theory in the first purpose of the present invention and expressed as : where , λ is the bragg wavelength of fbgs comprised in the first core 626 , the second core 627 , the third core 628 and the fourth core 629 of the four - core fiber 625 served as the multi - core fiber stylus 514 and the reference fbg 516 ; δλ p1 , δλ p2 , δλ p3 and δλ p4 is spectrum shifts of fbgs comprised in the first core 626 , the second core 627 , the third core 628 and the fourth core 629 of the four - core fiber 625 served as the multi - core fiber stylus 514 due to contact displacements and environmental temperature drifts , respectively ; δλ r is the spectrum shift of fbg comprised in the reference fbg 516 due to environmental temperature drifts ; d is the eccentric distance from the first core 626 , the second core 627 , the third core 628 and the fourth core 629 to the center of the four - core fiber 625 , respectively ; p e is the effective photoelastic constant , typically 0 . 213 for a common fbg ; l is the length of the multi - core fbg probe 519 ; v x , v y and v z is contact displacements in axes x , y and z , respectively . it can be concluded form eq . ( 13 ) that v x , v y and v z is not coupled with each other . contact displacements in axes x , y and z can be measured simultaneously using the demodulation unit 517 and the signal processing unit 518 . what is more , the differential calculation of spectrum shifts of fbgs comprised in the multi - core fiber stylus 514 and the reference fbg 516 can compensate common - mode environmental temperature drifts to ensure measurement results are not influenced by environment . the multi - core fbg probe 519 can be embodied in way 9 : the multi - core fiber stylus 514 of the multi - core fbg probe 519 can be a section of five - core fiber 630 and the multi - core fiber is the five - core fiber 630 . as shown in fig6 ( q ) and ( r ) , the first core 631 , the second core 632 are located on the negative and positive direction of axis x with a distance of d to the center of the five - core fiber 630 , respectively ; the third core 633 and the fourth core 634 are located on the negative and positive direction of axis y with a distance of d to the center of the five - core fiber 630 , respectively ; the fifth core 635 is located in the center of the five - core fiber 630 . the multi - core fbg probe 519 fabricated by the five - core fiber 630 has a three - dimensional measurement capacity in axes x , y and z . the relationship between spectrum shifts and contact displacements can be analyzed using the theory mentioned in the first purpose of the present invention and expressed as : where , λ is the bragg wavelength of fbgs comprised in the first core 631 , the second core 632 , the third core 633 , the fourth core 634 and the fifth core 635 of the five - core fiber 630 served as the multi - core fiber stylus 514 and the reference fbg 516 ; δλ p1 , δλ p2 , δλ p3 , δλ p4 and δλ p5 is spectrum shifts of fbgs comprised in the first core 631 , the second core 632 , the third core 633 , the fourth core 634 and the fifth core 635 of the five - core fiber 630 served as the multi - core fiber stylus 514 due to contact displacements and environmental temperature drifts , respectively ; δλ r is the spectrum shift of fbg comprised in the reference fbg 516 due to environmental temperature drifts ; d is the eccentric distance from the first core 631 , the second core 632 , the third core 633 and the fourth core 634 to the center of the five - core fiber 630 , respectively ; p e is the effective photoelastic constant , typically 0 . 213 for a common fbg ; l is the length of the multi - core fbg probe 519 ; v x , v y and v z is contact displacements in axes x , y and z , respectively . it can be concluded form eq . ( 14 ) that v x , v y and v z is not coupled with each other . contact displacements in axes x , y and z can be measured simultaneously using the demodulation unit 517 and the signal processing unit 518 . what is more , the differential calculation of spectrum shifts of fbgs comprised in the multi - core fiber stylus 514 and the reference fbg 516 can compensate common - mode environmental temperature drifts to ensure measurement results are not influenced by environment . the equipment based on multi - core fbg probe 519 for measuring structures of a micro part can be embodied in way 1 : the equipment based on multi - core fbg probe 519 for measuring structures of a micro part is shown in fig5 . the light source 59 can be a broadband ase source . when the light source 59 is a broadband ase source , the reflected light signal is reflection spectra of fbgs and the demodulation unit 517 can be an optical spectrum analysis device 71 as shown in fig7 ( a ) . the optical spectrum analysis device 71 has an optical input port 72 and an electric output port 73 . the reflected spectra of fbgs comprised in the multi - core fbg probe 519 and the reference fbg 516 are analyzed by the optical spectrum analysis device 71 , and the spectrum signal is transformed into electric signal ; the electric signal is received and processed in the signal processing unit 518 using the eq . ( 6 )˜( 14 ) according to the embodiments of the multi - core fbg probe 519 to achieve contact displacements δx 1 , δy 1 and δz 1 of the spherical tip 515 of the multi - core fbg probe 519 relative to its zero - force position uncoupled with environmental temperature drifts . the equipment based on multi - core fbg probe 519 for measuring structures of a micro part can be embodied in way 2 : the equipment based on multi - core fbg probe 519 for measuring structures of a micro part is shown in fig5 . the light source 59 can be a broadband ase source . when the light source 59 is a broadband ase source , the reflected light signal is reflection spectra of fbgs and the demodulation unit 517 can be also a matching fbg pair demodulation system 74 which consists of a 50 : 50 coupler 75 , a demodulation fbg 76 and a multi - channel optical power measuring device 77 as shown in fig7 ( b ) . the matching fbg pair demodulation system 74 has an optical input port 78 and an electric output port 79 . when the measured spectrum 710 enters the optical input port 78 of the matching fbg pair demodulation system 74 , the measured spectrum 710 is divided by the 50 : 50 coupler 75 into two parts , one part 711 is received by a detector of the multi - channel optical power measuring device 77 , and the other part 711 ′ enters the demodulation fbg 76 with a fixed reflection spectrum 712 . the spectrum 711 ′ is filtered and then reflected by the demodulation fbg 76 , and the spectrum overlap 713 of the spectrum 711 ′ and the spectrum 712 enters the other detector of the multi - channel optical power measuring device 77 . when the measured spectrum shifts to 714 , the optical power ratio of the spectrum overlap 713 and 716 of the spectrum 715 ′ and the spectrum 712 to the spectrum 715 related to the measured spectrum 714 changes and is not affect by the input optical power . therefore , the optical power ratio of the multi - channel optical power measuring device 77 can be used to measure the shift of the measured spectrum . reflected spectra of fbgs comprised in the multi - core fiber stylus 514 of the multi - core fbg probe 519 and the reference fbg 516 are analyzed by the matching fbg pair demodulation system 74 , and the spectrum signal is transformed into electric signal ; the electric signal is received and processed in the signal processing unit 518 using the eq . ( 6 )˜( 14 ) according to the embodiments of the multi - core fbg probe 519 to achieve contact displacements δx 1 , δy 1 and δz 1 of the spherical tip 515 of the multi - core fbg probe 519 relative to its zero - force position uncoupled with environmental temperature drifts . the equipment based on multi - core fbg probe 519 for measuring structures of a micro part can be embodied in way 3 : the equipment based on multi - core fbg probe 519 for measuring structures of a micro part is shown in fig5 . the light source 59 can be a narrowband laser source . when the light source 59 is a narrowband laser source , the demodulation unit 517 can be a multi - channel optical power measuring device 717 as shown in fig7 ( c ) . the multi - channel optical power measuring device 717 has two optical input ports 718 and 719 , and an electric output port 720 . the spectrum 721 of the narrowband laser source 59 is located in the range of reflection spectra of fbgs comprised in the multi - core fiber stylus 514 of the multi - core fbg probe 519 and the reference fbg 516 . the light spectrum 721 of the narrowband laser source 59 is reflected by the measured fbg spectrum 722 and enters the multi - channel optical power measuring device 717 through the port 718 . a part of light coming from the narrowband laser source 59 enters the multi - channel optical power measuring device 717 through the port 719 for optical power reference . the optical power of the reflected light signal is in related to the reflectivity of the measured fbg at the spectrum wavelength 721 of the narrowband laser source , and varies with the spectrum shift of the measured fbg from 722 to 723 . therefore , the optical power ratio of the multi - channel optical power measuring device 717 can be used to measure the shift of the measured spectrum . reflected spectra of fbgs comprised in the multi - core fiber stylus 514 of the multi - core fbg probe 519 and the reference fbg 516 are analyzed by the multi - channel optical power measuring device 717 , and the spectrum signal is transformed into electric signal ; the electric signal is received and processed in the signal processing unit 518 using the eq . ( 6 )˜( 14 ) according to the embodiments of the multi - core fbg probe 519 to achieve contact displacements δx 1 , δy 1 and δz 1 of the spherical tip 515 of the multi - core fbg probe 519 relative to its zero - force position uncoupled with environmental temperature drifts . | 6 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.