Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
fig1 illustrates an exemplary interactive tv system 10 . in accordance with the present invention , the interactive tv system 10 is generally comprised of a television 12 , a personal digital assistant ( pda ) 14 and at least one disparate media content source . the television 12 is configured to receive audio / visual content from a broadcast source 13 and deliver the audio / visual content to a viewer as is well known in the art . the audio / visual content received from the broadcast source may also be encoded with supplementary broadcast data , including but not limited to electronic program guide data , closed caption data , etc . as will be further described below , at least some of the supplementary broadcast data may be transmitted via a wireless communication link to the pda 14 . while the following description is provided with reference to a pda , it is readily understood that the broader aspects of the present invention are applicable to remote control devices , cellular phones and other portable handheld devices . supplementary broadcast data may also be retrieved by the pda 14 from at least one other disparate media content source . in a preferred embodiment , the pda 14 is configured via a wireless communication link to a home gateway 18 which in turn provides a connection to the internet 20 . in this way , the pda 14 is able to receive electronic program guide data from at least two disparate content sources . it is readily understood that other types of content sources are within the scope of the present invention . for example , an authoring system 102 can deliver digital content for delivery through a variety of different media delivery channels , including broadcast sources 13 , the internet 20 , and through alternate media delivery mechanism 108 . such mechanisms include memory - based storage systems , cd - roms , flash memory , sd media and the like . in the illustrated embodiment the user has a home gateway device 18 communicating via internet 20 . the home gateway thus supplies internet conductivity to personal computers such as computer 110 and also to the hand - held device 14 , preferably via a wireless connection . thus the hand - held device 14 receives digital content from the internet 20 as well as from broadcast source 13 . in the embodiment illustrated in fig1 the set top box 100 and home gateway 18 have been shown as separate units . in practice , the two may be included in a single unit that would supply both broadcast source access ( such as cable television or satellite channels ) as well as high - speed internet access ( such as broadband access ). communication with the hand - held device can be through a variety of different wireless technologies including infrared technology , spread spectrum wireless technology bluetooth technology , ieee 802 . 11 , and the like . this same wireless communication capability can be used to permit the hand - held device to wirelessly communicate with other devices such as diagrammatically illustrated at 112 . these other devices include a diverse list ranging from point - of - sale ( pos ) terminals to global positioning systems , to car navigation systems , vcr and dvd recorders and to other smart appliances . in this way , the hand - held device might be configured to receive information from broadcast source 13 , from portal 106 , and then integrate that information for use in accessing or controlling some other device 112 . alternatively , the other device may be controlled by supplying it with data from some other media , such as media 114 that may be furnished by the other media distribution mechanism 108 . electronic program guide data for media viewable by media delivery device 12 is made available to the viewer at different depth levels via touchscreen 104 of the pda . at the highest level , the program schedule tends to be simple and intuitive as shown in fig2 . a portion of the program schedule for a given time slot may be displayed to the viewer . in operation , the program schedule will default to the current time slot . to view programs at different time slots or for other channels , a stylus may be used to manipulate the displayed portion of the program schedule . this rudimentary epg data is typically encoded with the audio / visual content received from the broadcast source . in a conventional analog domain , the vertical blanking interval ( vbi ) is the portion of the television signal that may be used to carry such epg data . in a digital broadcast domain , mpeg transport stream data packet is able to carry audio , video and such epg data . another alternative to carry data within broadcast signal is based on optical encoding taught by broughton et al in u . s . pat . no . 4 , 807 , 031 . it is readily understood that other encoding techniques are also within the scope of the present invention . when the viewer taps on a particular program , a mini - review of the program 32 may be displayed as shown in fig3 . at this point , the viewer may have the option to watch the program , record the program , or close the pop - up window . the program schedule as well as the pop - up window are displayed using pre - defined templates residing on the pda . however , due to certain bandwidth limitations , vbi does not support delivery of a more robust epg to the viewer . in accordance with the present invention , rudimentary epg data may be enhanced with additional epg data retrieved from another disparate content source , such as the internet . the bandwidth in digital broadcasting domain is significantly higher than that of vbi , however , due to inflexibility of embedding most up to date data once they are authorized at the station , there is still a need to retrieve additional epg data from other sources to supplement broadcast information . epg data downloaded from two or more different sources are synchronized through an easy - to - use interface as further described below . for example , the view may select the “ more details ” option 34 provided on the pop - up window to see more detailed information about the program . for illustration purposes , the additional epg information is a more comprehensive textual review of the program . however , it is envisioned that the additional epg information may include but is not limited to anecdotal information about the program , biographical information for the program &# 39 ; s actors , producer &# 39 ; s commentary , etc . when this option is selected , the additional epg information may be displayed to the viewer in a web page format 42 , such as html , using a web browser as shown in fig4 . thus , the content provider can dictate the display format for the additional epg information . one skilled in the art will readily recognize that the corresponding web pages may be downloaded prior to being selected by the viewer or on an as needed basis at the time they are selected by the viewer . an exemplary system architecture for implementing the present invention in analog broadcast domain , particularly utilizing vbi to carry digital data , is described in relation to fig5 . the architecture for digital domain is similar from the perspective of the current invention . as noted above , the primary components of the system architecture include a television 12 , a pda 14 , and a home gateway 18 . the system architecture further includes a set - top box 52 for decoding vbi data from the broadcast audio / visual content . although a set - top box is presently preferred , this is not intended as a limitation of the present invention . on the contrary , it is readily understood that the decoding function may be incorporated into the tv or another add - on device which may be used in conjunction with the tv , such as a dvd recorder . in a preferred embodiment , the set - top box 52 is adapted to receive the incoming tv signal from the broadcast source . in order to retrieve vbi data , the set - top box 52 includes a vbi decoder 54 and a vbi data grabber 56 . the vbi decoder 54 is a hardware component that pulls vbi data off of the incoming tv signal . the vbi decoder 54 may be configured to read a specified channel and decode the vbi data transmitted in the specified channel . since vbi data is transmitted at only certain time intervals on each channel , it is not instantaneously available upon request from the tv signal . rather , the system is designed to buffer vbi data as it becomes available . the vbi grabber 56 is a software module that constantly retrieves all available vbi data from the tv signal and stores it in a data store 58 residing on the set - top box . the set - top box 52 further includes a user command module 60 and a wireless transceiver device 62 . the user command module 60 processes commands received from the pda . for instance , when a request is received for vbi data , the user command module 60 retrieves the requested vbi data from the vbi data buffer and sends it back to the pda . the vbi data is preferably transmitted by the wireless transceiver device 62 using the bluetooth protocol , ieee 802 . 11b protocol or some other known wireless communication protocol . in another instance , the user command module 60 may receive a command for controlling the tv ( such as change channel , lower volume , and similar commands ) which are in turn passed along to the tv . the set - top box 52 is configured to interface with the television as is well known in the art . the pda 14 serves as the focal point for the viewer &# 39 ; s interactive television watching experience . various user interface applications 70 reside on the pda 14 . amongst other functions , the applications 70 are designed to display and manipulate the enhanced epg data for the viewer . applications are preferably developed using java or some other known application development tool . in one embodiment , vbi data is downloaded to the pda only upon request by the viewer . a software - implemented data request module 72 receives the user requests from one of the applications 70 and sends an appropriate request to the set - top box . socket programming is an exemplary communication protocol for sending request messages which are of xml format . as described above , request messages are transmitted over a wireless communication channel using a wireless transceiver device 74 incorporated into the pda 14 . in order to receive vbi data from the set - top box , the pda further includes a vbi data parser 76 and a vbi database 78 . downloaded vbi data is stored in the vbi database 78 . to ease interaction with other applications residing on the pda , vbi data is preferably stored in xml format . the vbi data parser 76 then serves to retrieve the vbi data from the vbi database 78 and translate it into a format useable by the requesting application . various commercially available xml - based parsers may be used to implement the vbi data parser 76 . in order to retrieve additional epg data from the internet , the pda may include a web browser 82 and one or more secondary epg data source repositories 84 . the web browser 82 may be used to retrieve additional epg data from the internet using retrieval techniques well known in the art . additional epg data is subsequently stored in the secondary epg data repository 84 . in one embodiment , the pda 14 accesses the internet through a home gateway 18 . the home gateway 18 may include a wireless transceiver 92 , a router 94 , and a cable modem 96 as is well known in the art . it is readily understood that the other means may be employed to access the internet . it is further understood that epg data may be retrieved from other local content sources ( e . g ., sd or cf memory cards ) and / or remote content sources . to facilitate seamless synchronization of vbi data and epg data downloaded from the internet , the pda 14 includes a data synchronization engine 86 . the data synchronization engine 86 is primarily responsible for building an epg content directory 88 , which resides locally on the pda 14 . as will be further described below , the epg content directory 88 is used by the data request module 72 to retrieve user requested epg data from the appropriate source . although the preferred embodiment is illustrated for analog broadcast , particularly utilizing vbi to carry digital information , it should be understood that the architecture for digital broadcast may be similar . in digital broadcast , a mpeg transport stream includes audio , video and data packets . instead of vbi data , packets of digital data are carried in the transport stream . instead of a vbi decoder , a transport stream decoder may be used to decode both a / v and data packets . it is readily understood that other encoding techniques are also within the scope of the present invention . in one embodiment , the pda 14 is configured with a table that identifies each available source of epg data . an exemplary source table is shown in fig6 a . to build the epg content directory , the data synchronization engine 86 scans each of the sources identified in the source table . the data synchronization engine 86 parses the contents of each available source . in particular , the data synchronization engine 86 retrieves a corresponding program identifier , viewing level , and timestamp for each available program entry , and then builds the epg content directory 88 . an exemplary epg content directory is shown in fig6 b . the epg content directory 88 is then used by the data request module 72 to retrieve user requested epg data from the appropriate source as shown in fig7 a and 7b . use of the epg synchronization engine to create the epg table and source table is illustrated in fig7 a and 7b . the step of building the epg table at 196 is accomplished by scanning all available epg source devices in the source table at 198 . the content of the source devices is parsed at 200 and used to construct the epg table at 196 . once an epg table has been created , the synchronization engine locates the level 1 program list view for each channel and each program at 210 . the engine scans the available sources to determine if multiple sources exist at 212 . if multiple sources exist , the engine selects the source with the most recent date and time stamp at 214 and retrieves the epg content from the selected source at 216 using the source table . using the retrieved epg content , the engine constructs the epg view on the display of the device 218 and provides a hyperlink on the screen to the next level of epg information . the hyperlink to the next level of epg information is constructed at 220 . more specifically , the source of the next level of epg information is located at 222 using the epg table . if multiple sources are found at 224 , the most recent source is selected at 226 . if multiple sources are not found at 224 but at least source is found at 228 a link is provided to the selected source on the device at 230 . if no source is found at 228 , no link is provided . once a hyperlink has been constructed to the next level at 220 , the above process is repeated for subsequent programs and channels as illustrated at 232 . fig7 b illustrates the creation of a subsequent hyperlink to direct the user to level 3 epg information . as illustrated , once the user selects at 234 the hyperlink created at 220 , the content provided by the linked source is retrieved at 236 and provided on the display of the device at 238 , so as to provide the user with level 2 epg information . at 240 a hyperlink to level 3 epg information is constructed in the same manner as illustrated at 220 . when a multi - level of hyper - links is constructed recursively , some epg contents can be configured to download to the handheld before user requests . this is implemented through pre - fetch hyperlink 231 a as illustrated in fig7 a at 231 a - 231 d . some epg contents can be pre - fetched and stored locally . a particular source for epg can be predefined as pre - fetch or not - pre - fetch depending on the type of connections , for example , wireless lan , fee based mobile network etc . if a source is not fee based , a pre - fetch can be enabled ; therefore contents can be downloaded to local storage when the system is idle . if a source is fee based , pre - fetch will not be enabled . the enabling of pre - fetch can also depend on the depth ( level ) of the link and relativity to the original contents and so on . one skilled in the art will readily recognize that some or all of the functionality embedded in the pda may be performed in one or more other devices associated with the broadcast environment , including but not limited to a digital video recorder , the television , the set to box , the home gateway or other known devices . likewise , it is readily understood that at least some of the functionality embedded in the set top box or the television may be integrated into the pda . the description of the invention is merely exemplary in nature and , thus , variations that do not depart from the gist of the invention are intended to be within the scope of the invention . such variations are not to be regarded as a departure from the spirit and scope of the invention .	7
the invention described herein relates to a force limiter mechanism intervening between force applied by a user at the proximal end of a tool and the transmission of that force to the distal end of a tool . embodiments of the invention may be applied to non - articulating instruments , but many typical embodiments are applied to the operation of articulating tools . steerable articulating instruments are described in u . s . pat . no . 7 , 090 , 637 ; us 2005 / 0107667 ; us 2005 / 0273084 ; us 2005 / 0273085 ; and us 2006 / 0111210 . the articulating mechanisms of the tools described in those publications use multiple pairs of segments or links controlled , e . g ., by multiple sets of cables . depending upon the specific design of the device , the links can be discrete segments ( as described , e . g ., in u . s . pat . no . 7 , 090 , 637 ) or discrete portions of a flexible segment ( as described , e . g ., in us 2005 / 0173085 ). the instrument may also include steerable or controllable links of various types , e . g ., as described in us 2005 / 0273084 , us 2006 / 0111209 , and us 2006 / 0111210 . some articulating or steerable instruments have an articulating capability provided by minimal numbers of link pairs and cables connecting such links , u . s . pat . no . 5 , 916 , 146 of alotta , for example , has a mechanism comprising a single pair of links controlled by a single cable . when using such articulating instruments , a user may manipulate the proximal end of the instrument , thereby moving one or more proximal links of the articulation mechanism . this movement results in relative movement of the distal link ( s ) corresponding to the proximal link ( s ). it may at times be desirable to lock or otherwise maintain the straight or bent shape of the instrument . in certain embodiments of this invention , the shape of the instrument is maintained by preventing movement of at least one of the proximal links with respect to the rest of the instrument . in other embodiments , a friction - based articulation locking mechanism locks all links , proximal and distal ; these embodiments are disclosed in the concurrently filed and hereby incorporated application “ tool with articulation lock ” of hegeman , danitz , hinman , and alvord . many articulating instruments have end effectors controlled by movable actuators ; a movable end effector actuator may be , for example , a moveable portion of the handle of an instrument , or a thumbpiece . in some embodiments , the end effector actuator has an operation state in which movement is permitted in only one direction and an operation state in which the actuator is free to move in two or more directions . certain embodiments of this invention provide methods and devices for changing the operational state of an end effector actuator between a state in which movement of the actuator is permitted in only one direction ; a state in which the actuator is permitted to move in two directions in response to continuous user input to a state changer ; and a state in which the actuator is permitted to in two directions in the absence of user input to a state changer . fig1 - 20 show embodiments or portions of an articulatable tool 100 with an end effector 102 at its distal end and an end effector actuator 104 within a handle 106 at its proximal end . instrument 100 may be used , e . g ., in a laparoscopic procedure requiring grasping or cutting within a patient . proximal articulation links 108 and 110 extend distally from handle 106 , and distal articulation links 112 and 114 extend proximally from end effector 102 . proximal link 108 is connected to and moves with handle 106 . likewise , distal link 112 is connected to and moves with end effector 102 . a bushing 115 separates links 110 and 112 . bushing 115 has convex surfaces at its proximal and distal ends that engage with corresponding concave surfaces on links 108 and 110 . further details of ball and socket links suitable for use with this invention may be found in us 2005 / 0273084 , us 2006 / 0111209 , and us 2006 / 0111210 . an elongated shaft 116 is disposed between the proximal links and the distal links . embodiments of the shaft may either be rigid or flexible , although embodiments shown herein are depicted as being rigid . as seen in fig3 and 4 , a set of control cables 118 is attached to proximal link 108 , extends through proximal link 110 , shaft 116 and distal link 114 , and is attached to distal link 112 . a second set of control cables 120 is attached to proximal link 110 , extends through shaft 116 and is attached to distal link 114 . in this embodiment , there are three control cables 118 in the first set and three control cables 120 in the second set . it should be appreciated , however , that other numbers of control cables may be used to connect corresponding proximal and distal links . in addition , mechanisms other than cables may be used to connect corresponding links . as shown in fig2 , movement of handle 106 and proximal link 108 with respect to proximal link 110 moves end effector 102 and distal link 112 in a relative and corresponding manner . likewise , movement of proximal link 110 with respect to shaft 116 moves distal link 114 with respect to shaft 116 in a relative and corresponding manner , also as shown in fig2 . this relative articulation movement provides a way for a user to remotely manipulate the end effector through movement of the handle . the relative movement of the distal link that corresponds to the proximal link movement may either mirror the movement of the proximal link or be reciprocal to it , depending on whether the cables are strung directly ( for reciprocal movement ), or whether they are rotated 180 degrees ( for mirrored movement ) between the proximal and distal links . in order to maintain a particular position of the end effector with respect to the shaft , the articulating tool of this invention may have an articulation lock . in the embodiment shown in fig1 - 6 , the articulation lock includes a movable rigid sleeve 130 . in the unlocked position shown in fig1 - 5 , sleeve 130 is distal to proximal links 108 and 110 . in the locked position shown in fig6 , however , sleeve 130 has been moved proximally to a position adjacent to and covering links 108 and 110 as well as the proximal end of shaft 116 , thereby blocking relative movement between links 108 and 110 and between link 110 and shaft 116 . in this locked position , relative movement between distal links 112 and 114 and between link 114 and shaft 116 is prevented as well . as shown in fig6 , a sleeve support mechanism 132 extends proximally from shaft 116 to provide sliding support for sleeve 130 . a distal stop 134 provides a limit of distal movement of sleeve 130 ; a similar stop ( not shown ) is provided on or within handle 106 to limit proximal movement of sleeve 130 . detents , ridges or other mechanisms may be provided to maintain the sleeve in its proximal or distal positions and to provide tactile feedback to the user regarding the position of the sleeve . further detail on mechanisms that control permissibility of articulation in articulatable instruments is provided in the concurrently filed and hereby incorporated u . s . patent application entitled “ tool with articulation lock ” of hegeman , danitz , hinman , and alvord . the description now turns briefly to features of tools that include embodiments of an inventive force limiter , such features including rotatability of the distal end effector by proximal mechanisms , and mechanisms by which rotatability is allowed or disallowed by a locking mechanism . provided here will be a brief description of some these embodiments ; a full disclosure of such embodiments is provided in concurrently filed and hereby incorporated u . s . patent application entitled “ tool with rotation lock ” by hinman and danitz . the end effector 102 of tool 100 may be rotated with respect to handle 106 and then locked so that further rotation between end effector 102 and handle 106 is prevented . a rotation knob 101 is disposed at least partially around link 108 . in the locked position , teeth 103 formed on the proximal face of knob 101 engage corresponding teeth 105 formed on a distal face of handle 106 , as seen in fig1 . handle 106 may be made in two pieces ; two views of one of the two pieces are shown in fig9 and 10 .) in this embodiment , the rotation lock is self - locking due to the action of a spring 107 biasing knob 101 proximally into engagement with handle 106 , as shown in fig8 . when moved distally against the bias of spring 107 , the teeth 103 of knob 101 disengage from the teeth 105 of handle 106 . this disengagement permits knob 101 , links 108 and 110 , shaft 106 , links 112 and 114 , and end effector 102 to rotate with respect to handle 106 . this action permits the end effector to be rotated in any articulated configuration . when the end effector has been rotated the desired amount , release of knob 101 permits the two sets of teeth to re - engage , thereby locking the device against further rotation . in one embodiment , knob 101 is made in two pieces , an inner member 109 and an outer member 111 , as shown in fig8 . the teeth 103 are formed on the inner member 109 . indentations or knurls 113 ( fig7 ) may be formed on knob 101 to facilitate grasping . description now turns to consideration of a force limiter that intervenes in the transmission of force from a user to an end effector on a tool . in the embodiments illustrated in fig1 - 20 , the end effector 102 is a pair of jaws . other end effectors ( surgical , diagnostic , non - medical mechanical manipulators , etc .) and end effector actuators may be used with the articulating tool of this invention . actuation force is transmitted from movable end effector actuator 104 through a transmission or linkage that includes a rotatable rod actuator 122 , a movable rod terminator 124 , and a tension bearing member , such as rod 125 connected to rod terminator 124 , as shown in fig3 , 4 , 7 , and 8 . rod 125 passes through link 108 , bushing 115 , link 110 ; the shaft ( not shown in fig8 ) and the distal links ( not shown in fig8 ) to reach and actuate the end effector . rod terminator 124 encases a portion of rod 125 within handle 106 to prevent the rod 125 from buckling under a compressive load . similar features may be provided throughout the tool 100 to laterally constrain rod 125 . ( see further detail in concurrently filed patent application “ articulating tool with improved tension member system ” of hegeman , danitz , bertsch , and alvord ). end effector actuator 104 and rod actuator 122 are both rotatably mounted on a common bushing 202 so as to be able to be rotated with respect to each other to move rod 125 and thereby actuate end effector 102 . a force limiter such as a leaf spring 200 attached to end effector actuator 104 extends to a ledge 204 ( shown best in fig1 and 16 ) formed in rod actuator 122 . the leaf spring 200 needs to be attached only at one end to be functional while providing for force transmission from the end effector actuator 104 to rod actuator 122 as actuator 104 is moved toward handle grip 206 . actuator 104 may be moved until a stop element 208 on a surface of actuator 104 engages a stop element 210 on grip 206 , as shown in fig3 and 4 and in fig1 and 12 . in fig4 , the end effector jaws are closed when actuator 104 engages stop element 210 . in fig1 , on the other hand , the jaws have encountered an object 212 . the force limiter of this invention permits the actuator 104 to continue moving towards stop element 210 even if the jaws have stopped closing while limiting the amount of force applied by the end effector on the object , as explained below . spring or force limiter 200 rotationally biases the rod actuator 122 against the end effector actuator 104 such that surface 250 of rod actuator 122 contacts surface 252 of end effector actuator 104 as shown in fig1 . in this embodiment , force limiter 200 is formed from a shape memory material ( such as nitinol ) that is in its superelastic state . force limiter 200 is pre - biased ( to , e . g ., 1 . 5 % strain ) so that it is at a known state along its stress / strain curve . this pre - loading of spring 200 ensures that , until a predetermined threshold force is reached ( as described below ), end effector 104 , spring 200 , bushing 202 , and rod actuator 122 all move together and act as a rigid body . if the jaws of end effector 102 encounter an obstacle ( as shown in fig1 ) and the force applied through actuator 104 exceeds the threshold force , the stress on force limiter 200 reaches the characteristic plateau of the stress / strain curve , and force limiter 200 bends elastically substantially without delivering any further rotational movement to rod actuator 122 , as shown in fig1 . in one embodiment , the instrument has a force limiter 200 that establishes an upper limit on the actuation force that may be delivered to the end effector by the end effector actuator . in one embodiment , spring 200 may be formed from an elastomeric or spring metal material . in other embodiments , the material used to form spring 200 is selected and / or treated to provide a stress - strain relationship with a characteristic plateau region in which stress does not substantially change over a range of strain values . for example , in the instrument shown in fig1 - 19 , spring 200 is formed from a superelastic shape memory material , such as nitinol . the nitinol is selected and treated so that spring 200 is in the austenitic phase at the temperatures at which the instrument will be used . the material properties when so treated provide for substantially no change in stress over a range of strain values , e . g ., 1 . 5 % to 6 % strain . when assembling the instrument , spring 200 may be pre - loaded so that its strain is at or near the beginning of the stress plateau . in the absence of any counterforce resisting closing of the jaws of end effector 102 , movement of end effector actuator 104 toward handle grip 206 transmits an actuation force through spring 200 to rod actuator 122 , rod terminator 124 , rod 125 , and finally to end effector 102 . as shown in fig1 and 12 , if the jaws of end effector 102 encounter an object 212 , actuator 104 will experience a counterforce as it continues its movement toward grip 206 . when the counterforce exceeds the characteristic plateau stress of spring 200 , spring 200 will deform without substantially increasing the strain of spring 200 , thereby maintaining the actuation force transmitted through spring 200 and the remaining components of the actuation linkage . in the illustrated embodiment , the material comprising spring 200 may be selected and / or treated so that the spring remains in the stress plateau throughout its range of motion up to and including the point at which end effector actuator meets the limit stop 210 on grip 206 . description now turns briefly to an actuator movement controller that may be included in embodiments of the invention depicted in fig1 - 20 . embodiments may include a shaft having a proximal end and a distal end , an end effector at the distal end of the shaft , a movable end effector actuator at the proximal end of the shaft and operably connected to the end effector , and an actuator movement controller operably connectable to the end effector actuator . the actuator movement controller includes a user - activated state changer that is changeable among several states . these states include ones in which the movement controller is ( 1 ) enabled and engaged with the end effector actuator to prevent movement of the end effector actuator in at least one of two opposing directions , ( 2 ) enabled and disengaged from the end effector actuator to permit movement of the end effector actuator in a first direction and a second direction opposite to the first direction in response to continuous user input via the state changer , and ( 3 ) disabled to permit movement of the end effector actuator in a first direction and a second direction opposite to the first direction in the absence of user input via the state changer . in some embodiments , the first state ( enabled and engaged ) may prevent movement of the end effector actuator in both directions . in some embodiments the end effector includes jaws . in some embodiments the actuator movement controller includes a ratchet . in some embodiments the state changer includes a movable trigger . in some embodiments with a trigger , the state changer further includes a toggle operatively connected to the trigger so as to be movable with the trigger and to be rotatable with respect to the trigger . in some of the embodiments with a toggle , the toggle is operatively connected to the trigger so as to move with the trigger without rotating with respect to the trigger when the movement controller is enabled . embodiments of the multi - state ratchet mechanism that controls the end effector and the end effector actuator are disclosed in detail in the u . s . patent application entitled and hereby incorporated “ tool with multi - state ratcheted end effector ” by hinman . the embodiments described herein , by way of example , provide an actuator motion controller using a ratchet mechanism that , when engaged , permits the end effector actuator to be moved in one direction ( to , e . g ., close a pair of jaws ) while preventing the end effector actuator to move in the other direction ( to , e . g ., maintain the jaws in their closed state ). in fig3 , for example , the ratchet is formed from a rack of teeth 220 extending from end effector actuator 104 . a movable pawl 222 is rotatably mounted within handle 106 . a user may change the operation state of the ratchet by operating a trigger 224 which connects to pawl 222 through a toggle 226 . returning now to the force limiter , fig1 and 18 show alternative embodiments of a force limiter according to this invention . elements common to the embodiment shown in fig1 - 20 have been given the same reference numbers . as before , end effector actuator 104 and a rod actuator 502 independently rotate about a common bushing 202 . this embodiment replaces the spring of the embodiment shown in corresponding fig3 and 4 with a spring 500 attached to rod actuator 502 . spring 500 engages end effector actuator at an engagement surface 504 . as in the embodiment shown in fig1 - 16 , spring 500 may be made from a superelastic shape memory material , such as nitinol , and may be configured by design and / or assembly protocol such that it is pre - loaded to be at or near the plateau in its stress / strain curve . in that way , if a threshold actuation force is met , spring 500 deforms to the shape shown , e . g ., in fig1 without any additional stress being transmitted through the device &# 39 ; s linkage to the end effector . fig1 shows yet another alternative embodiment of a force limiter according to the invention in a view that is similar to those of fig1 and 18 . as before , an end effector actuator 104 a and a rod actuator 602 independently rotate about a common bushing 202 . in this embodiment , a coil spring 600 comprising a superelastic shape memory material such as nitinol is pre - loaded and disposed between end effector actuator 104 a and rod actuator 602 . pre - loading stress into the spring can place it at or near the plateau in its stress / strain curve , as described above . consequently , as a threshold actuation force is applied , spring 602 deforms it without transmitting any additional stress through the device &# 39 ; s linkage to the end effector . fig2 shows still another embodiment of a force limiter . in this embodiment , the proximal end of end effector actuation rod 125 ( optionally formed from nitinol ) is held in rod terminator 705 . the distal end of a force limiter 700 is also held in rod terminator 705 , while the proximal end of force limiter 700 is held in a force limiter housing 710 . rod terminator 705 fits into a distal opening of force limiter housing 710 , but the two parts can be separated , as described below . in this embodiment , force limiter 700 is preloaded with a predetermined amount of stress at about or just below the plateau stress of a super elastic material , by , e . g ., providing 1 . 5 % strain in the position shown in fig2 . the distal portion of force limiter housing 710 is attached to a movable slide member 715 , which fits in a fork 720 extending from end effector actuator 704 . when end effector actuator 704 is rotated with a subthreshold force about bushing 702 , fork 720 moves slide 715 , force limiter housing 710 , rod terminator 705 and rod 125 proximally to actuate the end effector . if the force applied to end effector actuator 704 exceeds the threshold force ( due , e . g ., to an object held in end effector jaws ), force limiter 700 will stretch , separating force limiter housing 710 from rod terminator 705 , so that further movement of end effector actuator 704 will not cause any further movement of rod 125 . this feature limits the force delivered by the end effector actuator to the end effector , and consequently the force exerted by the end effector , to the threshold force . in yet another embodiment ( not shown ) similar to that of fig2 , the rod 125 extends back into the linearly movable force limiter housing 710 . by using nitinol for rod 125 , or another suitable super elastic material , if the force applied to rod 125 by end effector actuator 704 induces a stress equal to the plateau stress of rod 125 , then rod 125 will stretch without increasing the force applied to the end effector . while the inventive surgical instruments and devices have been described in some detail by way of illustration , such illustration is for purposes of clarity of understanding only . it will be readily apparent to those of ordinary skill in the art in light of the teachings herein that certain changes and modifications may be made thereto without departing from the spirit and scope of the appended claims . for example , while the force limiter mechanism described herein typically has been in the context of a tool with an articulating mechanism comprising at least two links , the rotation knobs may be used in an instrument comprising only a single link , a multiplicity of links , with any number of cables or cable sets operably connecting the links , or , alternatively , embodiments of the inventive force limiter may be used with surgical instruments that do not articulate at all . further , while the shaft of depicted instruments including embodiments of the force effector have been depicted as rigid , in some variations it may be desirable to have the handle affixed to a shaft that is flexible . still further , while the inventive force limiter has been described in the context of a tool comprising a multi - state ratchet mechanism , some embodiments of the force limiter include tools without a ratchet mechanism . lastly , while the context of the invention is typically understood to be surgical or medical diagnostic procedures , embodiments of the force limiter or tools having such a mechanism may have utility in other , non - medical contexts as well .	0
the portable testing device of this invention , as distinguished from certain other testing devices , has the advantage of being able to test soil samples that have no cohesion since , in the device of this invention , the soil is confined wholly within the device thereby avoiding the need for cohesive samples . the continuous rankine stress monitoring device 10 of fig1 - 4 generally comprises a loading mechanism 12 and a lateral pressure measuring system 14 mounted on the base 20 having handles 21 and 23 secured thereto . mechanism 12 generally comprises a load frame 16 having a plate 18 positioned on the base 20 thereof . a loading cylinder 22 is positioned on the upper end of the load frame 16 and has a cylinder rod 24 extending downwardly therefrom which has a plate 26 secured to the lower end thereof . dial gauge 27 measures vertical deflection while dial gauge 29 measures horizontal expansion . the interior of cylinder 22 is fluidly connected to pressurized container of carbon dioxide 28 by line 30 . the apparatus also includes a pressure regulator 31 and pressure gauge 32 . thus , operation of the container 28 causes pressure to be supplied to the cylinder 22 thereby extending or lowering the cylinder rod 24 . a simplified or modified form of the loading mechanism is illustrated in fig5 by the reference numeral 12 &# 39 ;. mechanism 12 &# 39 ; includes a load frame 16 &# 39 ; having a plate 18 &# 39 ; positioned on the base 20 &# 39 ;. loading cylinder 22 &# 39 ; is mounted on the upper end of load frame 16 &# 39 ; and has a cylinder rod 24 &# 39 ; extending downwardly therefrom which has a plate 26 &# 39 ; secured to the lower end thereof . the interior of cylinder 22 &# 39 ; is fluidly connected to a manually operated hydraulic pump 28 &# 39 ; by line 30 &# 39 ;. pressure gauge 32 &# 39 ; is fluidly connected to the line 30 &# 39 ; as illustrated . thus , manual operation of the foot pedal 35 causes fluid to be supplied to the cylinder 22 &# 39 ; to extend or lower the cylinder rod 24 &# 39 ; and plate 26 &# 39 ;. the lateral pressure measuring system 14 of fig1 - 4 generally comprises a holding bracket 36 designed to support the cylindrical receptacle 38 . receptacle 38 has an open top end 40 and an open bottom end 42 . receptacle 38 has a slit 44 along its entire length parallel to the longitudinal axis of the cylindrical receptacle 38 , which is sometimes referred to hereinafter as a cylindrical sleeve . slit 44 defines side edge portions 46 and 48 as illustrated in fig4 . blocks 50 and 52 are secured to the exterior surface of the receptacle 38 adjacent side edge portions 46 and 48 respectively . a lateral pressure cylinder 54 is mounted on the holding bracket 36 in the manner illustrated in fig1 and has cylinder rod extending from the piston thereof . rod 56 has an adapter 58 on its outer end adapted to engage groove 60 on block 52 . adjustment screws 62 extend through bracket 36 as best seen in fig3 and have an adapter 64 mounted on the inner ends thereof for engagement with groove 66 in block 50 . the cylinder 54 is provided with a fluid compartment therein at one side of the piston contained therein . the fluid compartment is in fluid communication with a pressure gauge 68 . thus , movement of the block 52 towards the pressure cylinder 54 will cause the fluid in the compartment in the cylinder 54 to be compressed thereby causing the increased pressure therein to be registered on the gauge 68 . the modified lateral pressure monitoring system of fig6 is generally referred to by the reference numeral 14 &# 39 ; and is quite similar to the system 14 except that a pair of lateral pressure cylinders 70 and 72 are utilized . cylinders 70 and 72 have cylinder rods 74 and 76 extending from the pistons 78 and 80 respectively . rods 74 and 76 are in an abutting relationship with block 52 as seen in fig6 . the cylinders 70 and 72 have fluid compartments 82 and 84 at one side of the pistons contained therein . fluid compartments 82 and 84 are in fluid communication with each other , by means of line 86 , and with a pressure gauge 88 by means of line 90 . base pressure cell 100 in fig7 has loading cap 101 which is in contact with the soil sample 92 during testing . material receptacle 38 rests on base 100 during loading . fluid compartment 102 is in fluid communication with pressure gauge 103 . water seals 104 and 105 are in contact with plate 26 and plate 18 respectively . these maintain sample pore fluid within receptacle ends 40 and 42 while sample is being loaded . in addition , seal 106 is placed between blocks 50 and 52 , and covers slit 44 to prevent leakage along the split . in actual operation , the continuous k testing device works as follows . a soil sample 92 is placed within cylindrical receptacle 38 with , of course , plate 18 being received by the lower open end of the receptacle 38 . a top closure member is placed within cylindrical sleeve 38 directly on top of soil sample 92 . a vertical applied pressure , as indicated by arrows 94 , is applied downwardly against the top closure member and correspondingly on soil sample 92 by the loading mechanism 12 or 12 &# 39 ;. the vertical applied pressure in the direction of arrows 94 causes an induced lateral pressure on the soil sample 92 and correspondingly on the lateral wall surface of the cylindrical sleeve 38 . the induced lateral pressure causes expansion of sleeve 38 transverse to its longitudinal axis with the result being that the width of the slit 44 is increased . as previously stated , block 50 is prevented from lateral movement by means of the holding bracket 36 and screws 62 so that edge portion 48 moves laterally with respect to edge portion 46 as the width of the slit 44 increases . lateral movement of edge portion 48 causes compression of the fluid in the compartment in cylinder 54 which is registered on the pressure gauge 68 to provide a reading thereon when the embodiment of fig1 - 4 is being employed . when the embodiment of fig6 is being employed , lateral movement of edge portion 48 causes compression of the fluid in the compartments 82 and 84 which is registered on the pressure gauge 88 . by application of a series of predetermined vertical pressures and monitoring of the corresponding developed lateral pressures through the gauges 68 or 88 , one obtains a continuous response record for a particular soil , such that the developed lateral pressure is predicted for any anticipated level of vertical pressure . the apparatus of the invention provides a direct measurement of developed lateral stress and applied vertical stress through fluid pressure . as the soil specimen is compressed vertically in the receptacle 38 , developed lateral stresses create a fluid pressure which is read directly from the pressure gauges 68 or 88 . since the lateral elasticity is now governed by compression of the fluid , it increases in magnitude as the test progresses . this results in an ideally simulated field condition where the in - situ adjacent soil may change properties during loading . for measurement of soil - to - steel coefficient of sliding friction , plate 18 is replaced by cell 100 . with receptacle 38 resting on cell 100 all frictional resistance is directed upward . during testing , when a top vertical pressure is applied a bottom vertical pressure is recorded on gauge 103 . subtracting bottom pressure from top pressure gives amount of stress attributed to side friction on receptacle 38 . as the lateral stress is also known , through mathematical calculations , the coefficient of soil - to - steel friction is obtained . also during loading , seals 104 , 105 and 106 prevent leakage of water giving the shear strength parameters on an undrained basis . the rankine lateral stress ratio is continuously monitored and the portability of the instant invention permits tests to be conducted at a field site on samples obtained therefrom . this is advantageous for control of compacted fills for embankments or filled placement behind retaining structures . shear strength can now be evaluated on site . the cylindrical receptacle 38 provides minimal lateral restraint with the majority of restraint provided by the amount of fluid in monitoring device 10 . in a field loading situation this intensity of lateral confinement varies depending on the soil . a measure of confining soil stiffness is its modulus of elasticity in p . s . i . for a realistic test the typical monitoring device 10 modulus , as measured in p . s . i ., is the following for various types of soil samples . ______________________________________ soil mold expansion modulus , p . s . i . ______________________________________dense gravel , 18 , 000 - 20 , 000sand - gravel , crushedrock , sandloose sand , dense 4 , 000 - 6 , 000silt , claysoft silt , clay 1 , 500 - 2 , 500______________________________________ the stiffness also may be selected to simulate elastic behavior of a confining structure , as a retaining wall . for special purposes , such as comparisons of many soil samples , a constant stiffness may be preferred even though this does not represent a best simulation of field stress conditions . it should be noted that even in this case , the elastic behavior of the k - test is much closer to field conditions than is presented by conventional soil shear strength testing wherein the confining pressure is maintained at an arbitrary constant level which bears little or no relationship to actual stresses occurring in the field . if desired , the mold interior wall surface 43 can be polished and chromeplated or lined with teflon to reduce friction and abrasion . certain other advantages for the structure of this invention are apparent from the very fact that the test is a continuous test which measures developed stresses rather than current engineering practices which measures maximum values . for example , most soils have both internal friction φ and a cohesion intercept c , or shearing strength under zero applied normal stress . mathematically , it can be shown that from a consideration of the changes in the rankine stress ration , k , one may define by mathematical computation both cohesion c and friction angle φ for an individual soil . a particular advantage of the continuous k - test device is that it may be used with either undisturbed field samples or laboratory molded samples , and because of the confined nature of the test and mobility of the test mold practically any pre - treatment may be used which simulates an anticipated environment . this is in contrast to other tests where the lack of confinement may allow samples to fall apart . for example , k - test specimens may be saturated with water prior to testing . not only does this impose an extreme environmental condition that frequently occurs in the field but valuable supplementary data may be obtained on expansive or collapsible character of the particular soil by measuring the specimen height before and after soaking . a realistic surcharge load also may be used during soaking to better simulate field conditions . similarly , specimens may be dried to indicate shrinkage , or they may be frozen and thawed to indicate deleterious frost action , or they may be chemically treated to improve stability . no other test offers these potentials in quite so convenient and controllable a form , because practically all tests which provides c , φ and k data require the use of several different specimens . by preventing escape of pore - water from the soil sample during testing , the undrained or worst condition is simulated . for example , undrained shear strength would be used for design in the case of an embankment constructed rapidly over a soft clay deposit or a strip loading placed rapidly on a clay deposit . it can also be seen that an additional advantage of the structure of the k - test device of this invention is that the testing may be performed under slow or static loading conditions to give a behavior usually identified as soil creep . alternatively , the test may be performed with a cyclical loading and unloading designed to simulate soil stress conditions that are known to occur in soils as a result of vehicular traffic or earthquakes . as heretofore previously mentioned the directness of the soil test is an advantage compared with prior art tests since in use of the device of the present invention the developed k , c , φ and e unit strain are evaluated rather than the maximum or limiting values . in current engineering practice , maxima are obtained and divided by an arbitrary number called a &# 34 ; factor of safety &# 34 ; to assure that the failure stress conditions are never reached . since the limiting conditions are seldom reached simultaneously through a soil mass , most soil mechanics problems are theoretically indeterminate , i . e ., the number of unknowns exceeds the number of variables and critical assumptions must be made for the analysis . these are all covered in the factor of safety . this is to be contrasted with the analysis which can be made utilizing the structure of the present invention wherein the design allows the actual measurement of a developed response rather than a determination of maximum responses . it is therefore much closer to actual environmental conditions . thus it can be seen that the invention accomplishes at least all of its stated objectives .	6
fig1 shows a tomograph or a series of x - rays being taken of a patient 10 that has a surgical dental stent 12 engaging the patient &# 39 ; s jaw . the term , “ jaw ” refers to that part of a patient &# 39 ; s body that comprises one or more of the following : teeth , gums , and / or jawbone ( upper or lower ). stent 12 is a conventional surgical dental stent that mates with the patient &# 39 ; s jaw and can be produced in various ways that are well known to those skilled in the art . a drill bushing 14 is attached to stent 12 in an area of a missing tooth . bushing 14 can help guide a drill bit in drilling a hole into the patient &# 39 ; s jaw . an implant can then be inserted into the hole and anchored to the jaw . bushing 14 is preferably made of a material that can be detected by the x - rays , so at least one overall image 16 a can be created which shows bushing 14 and / or its trajectory ( i . e ., the bushing &# 39 ; s longitudinal centerline ) in relation to the patient &# 39 ; s jaw 18 as shown in fig2 and 3 . overall image 16 a , for example , shows a trajectory image 20 a and a jaw image 22 a that are displayed on a conventional computer monitor 24 controlled by a computer 26 . trajectory image 20 a represents the trajectory of bushing 14 , and jaw image 22 a represents the patient &# 39 ; s jaw . in some cases , monitor 24 also displays a second overall image 16 b where the first overall image 16 a presents a front view of the patient &# 39 ; s jaw , and the second overall image 16 b is a side view . thus , the two views 16 a and 16 b are taken along planes that are intersecting and preferably perpendicular to each other . the equipment and method for taking a tomographical scan is well known to those skilled in the art . tomography generally involves creating a computer - generated image from a plurality of x - rays as indicated by lines 15 and 17 . other terms used for tomography include , but are not limited to , ct scan ( computed tomographical scan ), eit ( electrical impedance tomography ), cat scan ( computerized axial tomography ). system 19 is schematically illustrated to represent all types tomography systems . some examples of system 19 include , but are not limited to a commcat is - 2000 , panorex cmt , and a panorex cmt plus , all of which are products of imaging sciences international , inc ., of hatfield , pa . fig2 shows that the trajectory of bushing 14 is not aimed directly into the patient &# 39 ; s jawbone 30 , so trajectory images 20 a and 20 b can be moved or tilted to correct the misalignment . moving trajectory images 20 a and 20 b can be done in various ways . in some cases , overall images 16 a and 16 b are created by importing , “ cut - and - pasting ,” or otherwise incorporating a tomograph into an appropriate software program . one example of such a program includes , but is not limited to , “ micrografx designer , technical edition ” by micrografx , inc . of richardson , tex . using a standard “ click - and - drag ” technique , a conventional computer mouse 32 ( or keyboard 34 , depending on the software ) can be used to move or tilt trajectory images 20 a and 20 b ( which can be a centerline drawn using the micrografx software ). an angular displacement or degree to which trajectory images 20 a and 20 b are tilted can be displayed in areas 36 and 38 and manually recorded for later reference . next , stent 12 with bushing 14 can be placed onto a model 36 of the patient &# 39 ; s jaw . model 36 can be cast or otherwise made in a conventional manner well known to those skilled in the art . a tool 38 or lever can be inserted into bushing 14 , and tool 38 can then be manually tilted based upon the angular displacement values displayed in areas 36 and 38 . the extent to which tool 38 tilts bushing 14 can be measured using a clinometer 40 ( electronic or otherwise ) that is mounted to or otherwise associated with tool 38 . the term , “ clinometer ” refers to any tool for measuring a change in inclination . in some cases , clinometer 40 comprises two electronic levels 42 and 44 that are perpendicular to each other . the angle readings from levels 42 and 44 can be communicated to computer 26 so that trajectory images 20 a and 20 b tilt in response to tilting tool 38 . the angle reading from level 42 tilts trajectory image 20 b , and the angle reading from level 44 tilts trajectory image 20 a . in effect , tool 38 functions as a joystick with trajectory images 20 a and 20 b following the joystick &# 39 ; s movements . the joystick inserted into bushing 14 can be tilted in various directions and angles until trajectory images 20 a ′ and 20 b ′ point directly into jawbone 30 as shown by images 16 a ′ and 16 b ′ of fig3 . electronic levels 42 and 44 can be any inclination measuring instrument that provides an electronic signal whose value ( analog or digital ) can be inputted into a computer using a conventional appropriate i / o board or module . once drill bushing 14 is properly aimed , bushing 14 can be permanently affixed to stent 12 using a conventional bonding material . stent 12 can then be returned to the patient &# 39 ; s mouth where bushing 14 can help guide the drill bit in drilling the implant hole in the patient &# 39 ; s jawbone . although the invention is described with reference to a preferred embodiment , it should be appreciated by those skilled in the art that various modifications are well within the scope of the invention . therefore , the scope of the invention is to be determined by reference to the following claims .	0
the separated ion source of this invention is generally indicated at 10 and fig1 and 4 . it comprises ion source 12 , which is seen in fig2 , and 4 and ion separator 14 which is seen in fig1 and 4 . magnets 16 and 18 , see fig1 connected to pole pieces 20 and 22 , provide a magnetic field across both the ion source and the ion separator . ion source 12 has a penning discharge type configuration . the cathode 24 has an interior cylindrical cathode surface . anode 26 is positioned within the cathode and is electrically insulated therefrom by means of insulator 27 in the top cover 28 . anode 26 extends through the top - cover insulator 27 to provide a terminal 29 to which the anode voltage is applied . hot filament 31 is positioned adjacent the anode and has terminals 33 for hot filament energization which also extend from the cathode space through the top cover . the gas to be ionized is introduced into the discharge chamber 25 by means of a feed tube 35 . the radii of the anode and cathode surfaces , the gas pressure and the magnetic field strength in the interelectrode spaces are such that a penning low pressure glow discharge is formed . the penning discharge causes ionization and it is from this discharge plasma that the ions are extracted . the magnetic field is supplied in a direction parallel to the anode and has a value of about 1100 gauss at the center of the ion source . in the presence of the gas to be ionized , with a pressure in the discharge chamber in the order of about 100 microns , a penning discharge is sustained in discharge chamber 25 between the anode and cathode with a voltage of 100 to 150 volts . electrons , which ionize the gas molecules , are provided by hot filament 31 . the magnetic field causes the path length of electrons travelling between the cathode and the anode to be much greater than their separation . this increases the probability of ionization and in turn results in a gas consumption which is less than one tenth the gas consumption required without a magnetic field . after ignition , the discharge operates at a voltage in the range of 75 to 125 volts and at a discharge current of 100 to 1000 milliamperes . the discharge is very stable and since the discharge voltage is lower than for most types of cold cathode discharge , sputtering is less of a problem . ions are extracted from the discharge through a high aspect ratio slit 30 in the discharge chamber 25 . the slit 30 has a rectangular cross section whose long dimension is shown in fig3 and whose narrow dimension is shown in fig4 . the extraction geometry is based on the design criteria developed by j . r . pierce . electrodes 32 and 34 adjacent the slit are pierce - type electrodes to prevent space charge effects from spreading the beam . furthermore , the strip beam geometry of high aspect ratio which is typically 50 times higher than its width , reduces space charge effects and it is compatible with the separator geometry . accelerator electrode 36 is positioned adjacent the ion extraction opening and accelerates the ion beam into the ion separator . ion separator 14 comprises separator plates 38 and 40 which are positioned in the magnetic field and oriented parallel to the ribbon beam . a power supply applies a voltage of 1500 volts across the separator plates to provide an electric field at right angles to or crosswise to the magnetic field which is perpendicular to the paper in fig4 . thus , the magnetic field and the electric field define the e × b ion separator . the same permanent magnet is used to provide the magnetic field in the ion source and thus it is possible to reduce the system length as compared to other designs . furthermore , in the present design , the permanent magnet is within the vacuum envelope . thus , permanent magnetic field can be provided at very much lower cost than the customary external electromagnet . the magnetic field in the separator region has a value of 1100 gauss . the main beam is indicated at 42 in fig4 . this beam has been analyzed , with impurity beams 41 and 43 being separated therefrom . aperture plate 44 has analyzing opening 46 therein which permits the main beam to pass through to target holder 48 . the target holder is preferably movable into the path of the beam , and may have an opening therein so that when the opening in the target holder is moved in line with the beam , the beam can pass through to faraday cup 50 . by use of the cup , beam data can be obtained . in a particular embodiment , the slit 30 through which the beam is extracted measures 1 inch by 0 . 020 inches . when the source is operating on argon or bf 3 , with a ten kv extraction voltage , the total current is 2 . 5 milliamperes . when the gas is bf 3 , operating under these conditions , 150 microamperes of boron is delivered through analyzing opening 46 to the target . the ribbon shape of the beam is critical to this invention . in a ribbon shaped beam , a high beam current can be achieved with a narrow beam . the narrow beam configuration very much reduces the spreading of the beam due to space charge effects , as compared to a circular beam of the same current . furthermore , in analyzing the beam , the impurities can be laterally deflected from the ribbon beam , but need only be deflected a small angle because the main beam can pass through an analyzing opening which is in the shape of an elongated slot , having generally the same proportions as the extraction slot at which the ions are extracted from the plasma . thus , by using a beam which is taller than it is thick , and causing analyzing deflections of the impurities in the direction of the thickness direction , a high brightness , high flux density ion beam can be achieved by minimum spreading due to space charge effects and maximized analyzing . this invention having been described in its preferred embodiment , it is clearly susceptible to numerous modifications and embodiments within the ability of those skilled in the art and without the exercise of the inventive faculty . accordingly , the scope of this invention is defined by the scope of the following claims .	1
the following description of the preferred embodiment is merely exemplary in nature and is in no way intended to limit the invention or its application or uses . the present invention discloses a process for manufacturing a thin film resistor in an integrated circuit with the resistor film sandwiched between dielectric layers , which are themselves located between two metal interconnect layers . contact from the upper metal layer to the resistor and to the lower metal layer may be made simultaneously . a thin film resistor 60 according to the invention is shown in fig1 . a first dielectric layer 30 is formed over a semiconductor body 10 . semiconductor body 10 may , for example , comprise a silicon substrate with transistors and other devices formed thereon . a lower metal interconnect layer 40 is shown as contacting a diffused region 20 of semiconductor body 10 . the line of metal interconnect layer 40 shown extends into the page . lower metal interconnect layer 40 typically comprises aluminum . however , other suitable metals are known in the art . separating the lower metal interconnect layer 40 and the upper metal interconnect layer 100 is a multi - level dielectric . two levels 50 , 90 are shown . dielectrics 50 and 90 may , for example , comprise a spin - on - glass . other suitable dielectrics , such as hsq , are known in the art . the combined thickness of dielectric 50 and 90 may be chosen according to the requirements for separating the metal interconnect levels 40 and 100 from etch other . the relative thicknesses of layers 50 and 90 can be determined based on optimizing the formation of the multi - level dielectric . in a preferred embodiment of the invention , the distance from the top of the silicon substrate in semiconductor body 10 to the top of dielectric 50 is chosen such that it &# 39 ; s physical thickness multiplied by its refractive index is equal to an odd integer number of laser quarter wavelengths . this optimizes the accuracy of the laser for laser trimming of the resistor after processing . because the actual thickness of the dielectric varies somewhat , due to deposition errors for example , dielectric 50 may include an additional layer added after measurement of the dielectric thickness as described in co - pending application ser . no . ______ ( ti - 28136 ), filed to bailey et al and assigned to texas instruments incorporated . thin film resistor 60 is sandwiched between dielectrics 50 and 90 . thus , in contrast to the prior art , thin film resistor 60 is located between interconnect levels . although metal interconnect layer 40 is shown as metal level 1 , it may in fact be any metal level except for the topmost metal level . likewise , although second metal interconnect layer 100 is shown as metal level 2 , it may be any metal level other than metal level 1 . conductively filled vias 95 extend from the upper metal interconnect layer 100 to both resistor 60 and lower metal interconnect layer 40 . as discussed further hereinbelow , these vias may be formed simultaneously , with no processing steps being added to contact resistor 60 . vias 95 preferably contact optional portions of hard mask 70 that remain over the ends of resistor material 60 . however , vias 95 may contact resistor material 60 and / or hard mask 70 . optional hard mask portions 70 can protect resistor material 60 during the via etch . in this case , hard mask portions 70 comprise a conductive material such as titanium - tungsten ( tiw ), titanium - nitride ( tin ), or molybendum ( mo ). resistor material 60 typically comprises a material such as tantalum - nitride ( tan ), silicon - chromium ( sicr ), or nickel chromium ( nicr ). resistor material 60 may be , for example , 50 - 2000 å , while hard mask 70 may , for example , be 500 - 3000 å . a method for forming thin film resistor 60 according to the invention will now be discussed with reference to fig2 - 7 . referring to fig2 a semiconductor body 10 is provided having an active region 20 formed therein . active region 20 may , for example , be a n - type of p - type diffusion region of a transistor . semiconductor body 10 is typically a silicon substrate processed through the formation of isolation structures , transistors , and other devices ( all not shown ). deposited over semiconductor body 10 is a dielectric layer 30 . next , a lower metal interconnect layer 40 is formed . lower metal interconnect layer 40 may , for example , comprise aluminum . methods for forming metal interconnect layers are well known in the art . dielectric layer 50 is formed next . dielectric layer 50 may be the first layer of a multi - layer dielectric . dielectric layer 50 is preferably a planarized layer and may be formed in any of a number of ways . some examples include : deposition followed by cmp ( chemical - mechanical - polishing ), resist etch back , deposition of a flowable oxide such as hsq , dep - etch - dep , deposition of a spin - on - glass ( sog ) and etchback . dielectric 50 may be any pianarized dielectric suitable for interlevel dielectric layers , such as sog , bpsg , psg , usg and hsq . after dielectric 50 has been formed , a layer of resistor material 60 is deposited . suitable materials for resistor material 60 are known in the art , such as tan , sicr , or nicr . as an example , sputter deposition may be used . resistor material 60 may be , for example , 50 - 2000 å thick . next , a hard mask 70 is deposited over resistor material 60 . the function of hard mask 70 is to protect resistor material 60 from contaminants during subsequent processing . suitable materials include tiw , tin , and mo . the thickness of hard mask 70 may be , for example , 500 - 3000 å . referring to fig3 a photoresist mask 80 is formed over hard mask 70 . photoresist mask 80 masks those portions of resistor material 60 that will become the thin film resistor . the exposed portions of hard mask 70 and resistor material 60 are then removed using a suitable etchant or combination of wet and dry etchants . suitable wet etchants for nicr , such as ceric sulphate , are known in the art . photoresist mask 80 is then stripped as shown in fig4 . if it is desired to leave portions of hard rnask 70 over areas where interconnect to resistor 60 is to be made ( i . e ., at the ends of resistor material 60 ), a second photoresist mask 85 is formed to produce patterns over the edges of the resistor 60 , as shown in fig5 . the exposed portions of hard mask 70 are then removed with a suitable etchant that does not adversely affect the thin film resistor material 60 , as shown in fig6 . in the case of a tiw hard mask 70 , a suitable etch is a solution of hydrogen peroxide ( h 2 o 2 ). photoresist mask 85 is then stripped . leaving portions of hard mask 70 in this manner is preferred , but optional . the remaining portions of hard mask 70 will protect resistor material 60 during the subsequent via etch . referring to fig7 the remaining portion of the multi - level dielectric layer , dielectric 90 , is formed . dielectric 90 is formed over dielectric 50 , resistor material 60 , and any remaining portions of hard mask 70 . dielectric 90 may comprise a range of materials including , but not limited to , silica , silicate glasses , and spin on glasses ( usg , psg , bpsg , hsq , sog , etc .). next , vias 95 are formed in dielectric 90 and dielectric 50 using a pattern 87 and etch , as shown in fig8 . vias 95 extend through dielectric 90 to hard mask 70 ( or resistor material 60 if hard mask portions do not remain ) and through both dielectric 50 and 90 to the lower metal interconnect layer 40 . all vias 95 may be formed during the same patterned etch step , so no additional steps are needed to connect to the resistor 60 . alternatively , vias 95 to the lower interconnect layer 40 and vias 95 to the resistor 60 may be formed separately . the upper metal interconnect layer 100 is formed and the vias 95 are filled with conducive material . finally , dielectric layer 110 and passivation layer 120 are deposited over the device , resulting in the structure shown in fig1 . while this invention has been described with reference to illustrative embodiments , this description is not intended to be construed in a limiting sense . various modifications and combinations of the illustrative embodiments , as well as other embodiments of the invention , will be apparent to persons skilled in the art upon reference to the description . it is therefore intended that the appended claims encompass any such modifications or embodiments .	7
the present invention will be described more in detail in conjunction with a set of examples and comparative examples . however , it is understood that the present invention is not limited thereto . the term “ part ( s )” and “%” in the description mean “ part ( s ) by weight ” and “% by weight ” unless otherwise specified . in addition , the method of evaluation of the thermal shrinkage force ( r ) is shown as follows : a sample coated paper whose moisture is previously adjusted pursuant to tis - p - 8111 ( moisture adjustment is made under the condition of room temperature of 20 ° c ., relative humidity of 65 %) is cut off to obtain a span of 2 mm wide in the machine direction with a length of 2 cm in the cross direction . then , thus obtained coated paper is set to a thermo mechanical analyzer [ tma / ss6000 : manufactured by seiko electronics industries co ., ltd .] under the initial load of 5 gf . as the pid control value of the terminal probe at the analyzer , p ( proportion ) = 100 , i ( integration ) = 1 , d ( differential )= 100 are used . the shrinkage force “ r ” is obtained by the steps of expanding the span at the rate of 0 . 01 μm / minute under the condition that the initial load of 5 gf is added , rising the temperature from 20 ° c . at a heating speed of 200 ° c ./ minute to the predetermined temperature of 300 ° c ., maintained at the temperature of 300 ° c . for 2 minutes , then reading the shrinkage force generated by drying of 1 . 5 minutes after the commencement of the rise of the temperature . a figure with four colors solid was printed on both sides by using the web - offset printing machine manufactured by komori printing machine co ., ltd . then , the fluting in web - offset printing generated thereby was visually evaluated . the moisture of the coated papers used is fixed in the range of 4 . 5 - 5 . 0 %, at the print speed of 200 rpm and the paper surface temperature of 110 ° c . at the exit of the dryer . to a pulp slurry consisting of lbkp 70 parts ( freeness 410 ml / csf ) and nbkp 30 parts ( freeness 480 ml / csf ), precipitated calcium carbonate was added as a filler to obtain the paper ash of 10 %. then , as a sizing agent to the pulp slurry , 0 . 04 parts of akd sizing agent ( trade name : sks - 293 f / arakawa chemicals co ., ltd .) and 0 . 5 parts of aluminum sulfate were added , respectively . the slurry was then passed through an on - top paper machine to obtain a paper web . the antifoaming agent ( trade name : sn defoamer 777 / sunnopce ltd .) of 0 . 05 % to pva in terms of solid matter and solution of pva ( trade name : pva - 124 , saponification degree : 98 . 5 mol %, polymerizationdegree : 2 , 400 / kuraray co . ltd . ), which was prepared to have 6 % concentration , was applied to both sides of this paper web by a bar coater and after dried , a base paper to make the coated paper was obtained . the viscosity of the pva aqueous solution at 20 ° c . was 450 mpa · s and the coating amount of the pva solution was 2 . 8 g / m 2 per side surface after the coated material was dried . the basis weight of the base paper thus obtained was 52 g / m 2 . slurry of pigment was prepared using cowless dissolver by means of dispersing the pigments consisting of 15 parts ground calcium carbonate ( trade name : fmt - 90 / fimatic corporation ), 20 parts precipitated calcium carbonate ( trade name : tp - 221 gs / okutama industries co ., ltd . ), 40 parts fine kaolin ( trade name : amazon 88 / cadam corporation ) and 25 parts of a kaolin in general use ( trade name : ht / engelhard corporation ). next , 10 parts styrene - butadiene copolymer latex as solid matter ( trade name : sn307 / sumika a & amp ; l co ., ltd . ), 3 parts oxidized starch as solid matter ( trade name : ace a / oji corn starch co ., ltd .) and other agents were added to the slurry so that the coating composition having the solid matter concentration of 63 % was finally prepared . the above mentioned coating composition was applied on both sides of the said base paper by blade coater in an amount of 11 g / m 2 per side surface after being dried . the coated paper obtained in this manner was then passed through the super calender comprised of metal rolls and cotton rolls to obtaina coated paper for printing having a density of 1 . 15 g / cm 3 . the thermal shrinkage force ( r ) and evaluation of the fluting in web - offset printing of the coated paper thus obtained are shown in table 1 : example 1 was repeated to produce a sheet of coated paper except that the coating amount of the pva solution per side surface after being dried was changed to 1 . 5 g / m 2 . the thermal shrinkage force ( r ) and the evaluation of the fluting in web - offset printing of the coated paper thus obtained are shown in table 1 . example 1 was repeated to produce a sheet of coated paper except that the pva solution used in example 1 was replaced by the liquid mixture consisting of 50 parts kaolin ( trade name : uw - 90 / engelhard corporation ) and 50 parts pva ( tradename : pva124 / kuaray co ., ltd .) having a concentration of 11 % solid matter . the thermal shrinkage force ( r ) and the evaluation of the fluting in web - offset printing of the coated paper thus obtained are shown in table 1 . example 1 was repeated to produce a sheet of coated paper except that pva - 124 used in example 1 was replaced by pva ( trade name : pva - 224 , saponification degree : 88 mol %, polymerization degree : 2 , 400 / kuraray co ., ltd .). the thermal shrinkage force ( r ) and the evaluation of the fluting in web - offset printing of the coated paper thus obtained are shown in table 1 . example 1 was repeated to produce a sheet of coated paper except that no size press was used . the thermal shrinkage force ( r ) and the evaluation of the fluting in web - offset printing of the coated paper thus obtained are shown in table 1 . example 1 was repeated to produce a sheet of coated paper except that the size press solution used in example 1 was replaced with an oxidized starch ( trade name : ace a / oji corn starch co ., ltd .) having the concentration of 10 %). the thermal shrinkage force ( r ) and the evaluation of the fluting in web - offset printing of the coated caper thus obtained are shown in table 1 . example 1 was repeated to produce a sheet of coated paper except that the coating amount of the pva solution per side surface after being dried was changed to 0 . 5 g / m 2 . the thermal shrinkage force ( r ) and the evaluation of the fluting in web - offset printing of the coated paper thus obtained are shown in table 1 . after web - offset printing , the surfaces of the coated paper obtained in accordance with the above mentioned examples 1 - 3 , and comparative examples 1 - 2 were made into graphs by using the visible light laser type displacement sensor and waveform observation software . as apparent from fig1 - 3 , the fluting in web - offset printing is negligible in examples 1 - 3 . on the other hand , apparent from fig4 and 5 which show the evaluation results of comparative examples 1 and 2 , considerably severe fluting in web - offset printing was confirmed . in addition , the coated papers obtained in accordance with the aforementioned examples 1 - 5 and comparative examples 1 - 2 were now used for gravure rotary printing . the measurement results of the mis - registration were shown in the rightmost column of table 1 . namely , the evaluation of mis - registration was made as follows : printing was conducted by using a gravure rotary printing machine manufactured by hitachi seiko co ., ltd . the total amount of displacement between yellow ( the first color ) and black ( the fourth color ) of the register - marks on the right edge and the left edge , with an interval of 412 mm , was given as mis - registration . each color was dried with hot air at the fixed temperature of 60 ° c . and no adjustment for mis - registration such as steam addition was made between the colors . example 1 was repeated to produce a sheet of coated paper except that the basis weight of the base paper was changed to 40 g / m 2 by reducing the basis weight of the paper web . the thermal shrinkage force ( r ) and the evaluation of the fluting in web - offset printing of the coated paper thus obtained are shown in table 1 . example 1 was repeated to produce a sheet of coated paper except that the basis weight of the base paper was changed to 83 g / m 2 by increasing the basis weight of the paper web . the thermal shrinkage force ( r ) and the evaluation of the fluting in web - offset printing of the coated paper thus obtained are shown in table 1 . to a pulp slurry consisting of 30 parts lbkp ( freeness 410 ml / csf ), 50 parts deinked pulp ( freeness 200 ml / csf ) and 20 parts nbkp ( freeness 480 ml / csf ), precipitated calcium carbonate was added as a filler to obtain the paper ash of 10 %. then , to the pulp slurry , 0 . 04 parts akd sizing agent ( trade name : sks - 293 f / arakawa chemicals co ., ltd .) and 0 . 5 parts aluminum sulfate were added , respectively . the slurry was then passed through a fourdrinler paper machine , and subsequently was size press coated with a solution of oxidized starch glue liquid ( concentration : 3 . 5 %, trade name : ace a / oji corn starch co ., ltd .) and surface size agent ( concentration : 0 . 1 %, trade name : polymalon 1329 / arakawa chemicals co ., ltd .) by a two roll size press coater to obtain a paper web . the coating amount at the size press was 1 . 2 g / m 2 on both surfaces after the coated material was dried . next , the antifoaming agent ( tradename : sn defoamer 777 / suunpco ltd . ), 0 . 05 % as compared to pva in terms of solid matter , was added to make gelatinized aqueous solution of pva ( trade name : pva - 110 , saponification degree : 98 . 5 mol %, polymerization degree : 1 , 000 / kuraray co ., ltd .). the pva solution was then mixed with kaolin ( trade name : uw - 90 / engelhard corporation ) at a ratio of 50 : 50 as solid matter to obtain an aqueous liquid concentration of 25 %. thus , the obtained liquid was coated to both sides of the paper web by a gate roll coater and then dried to obtain a base paper for coating . the viscosity of the mixture liquid of pva ( at 20 ° c .) ard kaolin was 1 , 300 mpa · s when coated and the amount of the coating was 7 g / m 2 on both surfaces after it was dried . namely , the coating amount per side surface was almost same when coated by the gate roll coater . the basis weight of the base paper was 83 g / m 2 . the coating composition , prepared in the same method as in example 1 , was applied to both surfaces of the base paper and dried . then the paper was put through a super calendar process and a coated paper for printing was obtained . the thermal shrinkage force ( r ) and the evaluation of the fluting in web - offset printing of the coated paper thus obtained are shown in table 1 . example 8 was repeated to produce a sheet of coated paper except that the solution composed of oxidized starch glue liquid and surface size agent applied by the two roll size press coater in example 8 was replaced by the solution of pva ( trade name : pva - 110 / kuraray co ., ltd .) containing the antifoaming agent ( trade name : sn defoamer 777 ) of 0 . 05 % ( as compared to pva in terms of solid matter ) and having a concentration of 3 . 5 %. the thermal shrinkage force ( r ) and the evaluation of the fluting in web - offset printing of the coated paper thus obtained are shown in table 1 . as clearly shown in the measurement results in table 1 , the coated paper for printing according to the present invention generates negligible fluting in web - offset printing and is excellent for high quality printing . in addition to this , because mis - registration rarely occurs , the aforementioned coated paper can also be used for gravure rotary printing with the equivalent standards of high quality printing ..	8
the following description is merely exemplary in nature and is not intended to limit the present disclosure , application , or uses . although the following description is related generally to an outside mirror deploying a deflector for side window buffeting reduction for a mobile platform , such as a motor vehicle , it will be understood that the outside mirror , as described and claimed herein , is used with any appropriate application . therefore , it will be understood that the following discussions are not intended to limit the scope of the appended claims . with reference now to fig1 , 2 and 3 , a motor vehicle 10 is shown with an outside mirror 12 . the outside mirror 12 is generally mounted to an exterior 14 of the motor vehicle 10 adjacent to a front end 16 of the motor vehicle 10 . it will be understood that although the outside mirror 12 is described herein as being mounted near a front end 16 of the motor vehicle 10 , the outside mirror 12 is mounted at any desired location on the motor vehicle 10 that lies upstream of the airflow over the sideglass surfaces of the motor vehicle . the motor vehicle 10 defines a passenger area 18 , which includes at least one or a plurality of rear windows 20 . the outside mirror 12 generally includes a projecting portion or a mirror housing 22 coupled to an attachment portion or support 24 with a deflector system 28 coupled to at least one of the mirror housing 22 and the support 24 , as will be described herein . the deflector system 28 moves from a stowed or non - deployed position ( fig2 ) to a fully deployed position ( fig3 ) to substantially fill a channel 26 defined between the mirror housing 22 and the support 24 . the deflector system 28 generally serves to reduce a buffeting effect that occurs when at least one of the rear windows 20 is moved from a closed position to an open position ( shown in phantom ). with additional reference to fig6 , the mirror housing 22 is generally square or rectangular with a projecting portion defining a first side 30 , a second side 32 , a third side 34 and a fourth side 36 coupled to a mounting plate 38 . typically , the first side 30 , the second side 32 , the third side 34 , and the fourth side 36 are each coupled to the mounting plate 38 to define a cavity for receipt of a mirror 52 , as best shown in fig6 . the mirror 52 will not be described in great detail herein ; however , the mirror 52 is configured to pivot with respect to the cavity as is generally known . with reference back to fig2 and 3 , the first side 30 is generally parallel to the third side 34 and the second side 32 is generally parallel to the fourth side 36 ( fig2 ). the mirror housing 22 is composed of a polymeric material , such as polyester thermoplastic , and is integrally formed through molding . with additional reference to fig5 and 6 , the mounting plate 38 generally has a first side 54 and a second side 64 . a chamber 56 is defined in between a rear side 62 of the mirror 52 and the first side 54 of the mounting plate 38 . the chamber 56 receives at least a portion of the deflector system 28 as will be described in greater detail below . the second side 64 of the mounting plate 38 couples the mirror housing 22 to the support 24 . generally , the second side 64 of the mounting plate 38 includes an attachment portion or an arm 66 , which mates with the support 24 to enable the mounting plate 38 and mirror housing 22 to pivot with respect to the support 24 . the arm 66 is configured to pivot about a pivot p ( fig3 ) allowing the mirror housing 22 and / or arm 66 to fold inboard to a position either fore or aft of its normally functioning position . it should be noted that the pivot p can be positioned at any desired location on the arm 66 , such as pivot p 2 ( as shown in phantom in fig3 ). the arm 66 also defines a slot 72 for receipt of at least a portion of the deflector system 28 , as will be described in greater detail herein . the arm 66 pivotably engages the support 24 . the support 24 includes a first end 76 and a second end 78 , as best shown in fig3 . the support 24 is composed of a polymeric material , such as polyester thermoplastic . the support 24 is generally coupled to the exterior 14 of the motor vehicle 10 . the support 24 is coupled to the exterior 14 through any appropriate technique , such as mechanical fasteners , adhesives or bonding . the support 24 is any appropriate shape , but is typically triangular . the support 24 defines a surface 82 , which pivotably and slideably engages a surface 86 of the arm 66 to enable the mirror housing 22 to pivot with respect to the second end 78 . with additional reference to fig5 , the deflector system 28 includes a flap 88 and a control system 90 . the flap 88 is composed of a polymeric material , however , any material with suitable rigidity is employed . the flap 88 is generally operable in a retracted or stowed position ( fig2 ) and an extended or deployed position ( fig3 ). the flap 88 generally has a first side 92 , a second side 94 , a third side 96 and a fourth side 98 . the first side 92 and third side 96 generally have a length l 5 , which is less than a length l 1 of the mirror housing 22 , but is greater than a length l 8 if desired ( fig5 ). in addition , the first side 92 and third side 96 are configured to slideably engage at least one or a plurality of guides formed in the mirror housing 22 ( not specifically shown ). the flap 88 has a central length l 6 , which is at least equivalent to a distance d of the support 24 , or is greater than the distance d if desired ( fig5 ). in addition , the second side 94 is coupled to or includes a seal 108 to seal the flap 88 against the support 24 when the flap 88 is in the deployed position . in addition , it will be understood that the second side 94 is generally configured to contact the support 24 , and thus has any desired shape , such as angular . a first surface 104 of the flap 88 is generally exposed to a drag force f when the flap 88 is in the deployed position and a second surface 106 of the flap 88 is coupled to the control system 90 . the control system 90 includes a controller 110 configured to receive a signal from a first sensor 112 and a second sensor 114 to operate a motor 116 . the first sensor 112 is a position sensor coupled to both of the rear windows 20 to sense the location of the rear window 20 , and transmit the signal when the rear window 20 enters an open position ( fig1 ). in the alternative , the first sensor 112 is a pressure sensor 112 ′ operable to transmit the signal when a pressure in the passenger area 18 exceeds a pre - selected value ( fig1 ). the second sensor 114 is a vehicle speed sensor that transmits a signal to the controller 110 when the vehicle speed exceeds a threshold ( fig1 ). with reference back to fig4 and 5 , upon receipt of the signals from the first and second sensors 112 , 112 ′, 114 , the controller 110 initiates the motor 116 . the motor 116 is any suitable electric motor , such as a dc motor , and includes an output shaft 118 . the output shaft 118 is a screw drive that engages a bore 120 coupled to the second side 106 of the flap 88 . thus , the rotation of the output shaft 118 translates the flap 88 into and out of the deployed position . it should be noted , however , that various other mechanisms may be employed to translate the flap 88 from the stowed position to the deployed position . when the speed of the motor vehicle 10 falls below the threshold and / or the rear window position is changed , the first sensor 112 or the second sensor 114 sends a second signal to the controller 110 . based on the second signal , the controller 110 drives the motor 116 in the reverse direction to move the flap 88 from the deployed position to the stowed position . in the alternative , with reference now to fig6 and 7 , an alternative deflector system 200 is shown . as the deflector system 200 is similar to the deflector system 28 , the same reference numerals will be used for the same or similar components . the deflector system 200 includes the flap 202 and a control system 204 . the flap 202 is generally operable in a retracted or stowed position and an extended or deployed position ( as shown in phantom in fig6 ). the first side 92 and third side 96 of the flap 202 generally have a length l 7 , which is at least equivalent to a distance d 1 . the second side 94 is coupled to and includes a seal 108 to seal the flap 202 against the support 24 when the flap 202 is in the deployed position . in addition , it will be understood that the second side 94 is generally configured to contact the support 24 . a fourth side 203 of the flap 202 defines a pivot point p at an intersection of the third side 96 and the fourth side 203 . the pivot point p is defined by a geared hinge 206 . the third side 96 is responsive to the control system 204 to enable the flap 202 to move from the stowed position ( fig6 ) to the deployed position ( fig7 ). the control system 204 includes the controller 110 coupled to a motor 212 . the motor 212 includes a drive shaft 214 , which includes a worm ( not shown ) to rotate a first spur gear 216 coupled to a second spur gear 218 formed at the intersection of the third side 96 and the fourth side 203 to pivot the flap 202 from the stowed position to the deployed position upon receipt of the signals from the first and second sensors 112 , 114 . when the speed of the motor vehicle 10 falls below the threshold value , the controller 110 , based on the second signal , actuates the motor 212 to rotate in a reversed direction to move the flap 202 from the deployed position to the stowed position . it will be understood , however , that any device may be used to pivot the flap 202 from the first position to the second position . during the operation of the motor vehicle 10 , if the speed of the motor vehicle 10 exceeds the threshold value , the second sensor 114 sends the signal to the controller 110 . if , during the continued operation of the motor vehicle 10 at this speed , the rear windows 20 of the motor vehicle 10 are moved from the closed position to the open position , or the pressure in the passenger area 18 exceeds the pre - selected amount , the first sensor 112 sends the signal to the controller 110 . based on the signals from the first and second sensors 112 , 114 , the controller 110 activates the motor 116 , 212 to move the flap 88 , 202 from the stowed position to the deployed position . if the controller 110 actuated the motor 116 , the motor 116 rotates the output shaft 118 to translate the flap 88 in the guides 102 from the first position to the second position to fill the channel 26 defined by the distance between the mirror housing 22 and the support 24 . if the controller 110 actuates the motor 212 , the geared hinge 206 pivots the flap 202 from the stowed position to the deployed position . if the speed of the motor vehicle 10 falls below the threshold , the second sensor 114 then sends the second signal to the controller 110 and the controller 110 actuates the motor 116 , 212 to move the flap 88 , 202 from the deployed position to the stowed position . the description of these teachings is merely exemplary in nature and , thus , variations that do not depart from the gist of the teachings are intended to be within the scope of the teachings . such variations are not to be regarded as a departure from the spirit and scope of the teachings .	1
referring to fig1 a trolling ski 10 of the present invention has a long , relatively thin and generally rectangular body 11 . the ski 10 is buoyant and , when properly rigged as will be hereinafter described , is adapted to float on its edge and to move in the direction of its longer dimension . extending laterally from one side of the body 11 at approximately the center is a tow bar 12 . the tow bar is rigid and formed preferably of stainless or plated steel . it is also preferably bent and attached to the body 11 so that its distal end 13 extends upwardly and slightly forwardly , as well as laterally , of the body . the proximal end 14 of the tow bar 12 is attached to the body and held against both lateral displacement and axial rotation . in the preferred embodiment shown , the tow bar 12 is demountably attached to the body by inserting the proximal end 14 into the bore of a bushing 15 which is molded into or otherwise affixed to the body 11 . a suitable locking pin 16 is inserted through aligned holes in the tow bar and bushing wall to hold the bar in operative position . the distal end 13 of the tow bar is provided with a ring or other means to which a tow line 17 extending from a boat 18 may be attached . the body 11 of the ski 10 has a front side 19 away from the boat 18 which side is substantially flat along its entire length and is vertically disposed when the ski is rigged and operating . the second side 20 , nearest the boat , includes a substantially flat forward portion which intersects the first side 19 at the forwardmost edge 21 of the ski and extends rearwardly therefrom and diverges from the first side 19 to form a rudder surface 22 . the remaining rearward portion 23 of the second side 20 is also substantially flat and lies parallel to and closely spaced from the first side 19 . the rearward portion 23 preferably comprises the major portion of the length of the ski with the shorter forward portion disposed so that the rudder surface 22 forms a distinct and relatively sharp acute angle with the first side 19 . on the lower portion of the second side 20 , or the side nearest the boat , and rearwardly of the center of the ski is located the primary fish line holder and release 24 . referring particularly to fig3 the release assembly includes a threaded stud 25 affixed to and extending laterally out from the body 11 . a back up washer 26 and a clip member 27 , each having a bore there through of a diameter slightly greater than that of the stud 25 , are placed on the stud with the washer 26 lying against the side 20 of the body 11 . the clip member 27 is provided with a counterbore 28 in its outer face into which the stud 25 extends when the clip member is placed on the stud and against the washer 26 . a pair of washers 29 , separated by a coil spring 30 , are all inserted into the counterbore 28 and onto the end of the stud 25 . the entire assembly is held together on the stud with a wing nut 31 , the threading of which onto the stud 25 and against the compressive force of spring 30 produces a clamping force between the abutting faces of washer 26 and clip 27 . preferably , the stud 25 does not extend outwardly beyond the clip member , and the wing nut , washer 29 and spring 30 all lie within the counterbore 28 when assembled . extending laterally out from the upper portion of the same side of the body 11 , parallel to and in approximately the same vertical plane as the stud 25 , is a second stud 32 for attachment of a secondary line holder and release 33 . the secondary release 33 includes a flexible rod 34 having means at one end for attachment to the second stud 32 . in the preferred embodiment , the end 35 of the rod 34 is bent to form a u - shape which is adapted to fit around the stud 32 and to be held against the side of the body 11 by a locking washer 36 and a wing nut 37 . as will be explained in greater detail below , the rod 34 must be held against rotation about the stud 32 and preferably held in a nearly vertical position . to hold the rod against rotation , the locking washer 36 is provided with a groove 38 for receipt of the u - shaped end 35 of the rod . the grooved side of the locking washer 36 is further provided with a small protrusion ( not shown ) adapted to be received and seat in a mating depression 39 projecting from the side 20 of the body adjacent the stud 32 . when the locking washer 36 is seated on the stop 39 , and secured with the rod end 35 in the groove 38 by tightening wing nut 37 , the rod 34 extends vertically upward from the top of the ski . the opposite upper end 40 of the rod is bent to form an l - shape and to the end is welded or otherwise affixed a conical coil spring 41 . an adjusting screw 42 carrying a pair of release washers 43 is threaded into the narrower portion of the conical spring 41 . the wider , open end of the spring bears against the face of one of the washers 43 and the compression of the spring created by the tightening of adjusting screw 42 provides a clamping force between the abutting faces of the washers 43 . the body 11 of ski 10 has a hollow interior comprising a series of longitudinally spaced cells 44 . the cells are separated by vertical ribs 45 and access to each cell 44 is provided by means of a small circular opening 46 in the side 20 of the body . the openings 46 are equally spaced along approximately the horizontal centerline of the body and are threaded for receipt of correspondingly threaded plugs 47 . the entire body 11 is preferably molded of plastic with each cell 44 being water tight with respect to adjacent cells and to the outside of the body . thus , any cell or combination of cells may be selectively filled with a ballast , preferably water , by removing the appropriate plug or plugs 47 and immersing the ski in water or otherwise conveniently filling the cells . to rig the ski for fishing , the appropriate number and arrangement of cells 44 are filled with water , in accordance with the weight of the tackle 48 being used , so that the ski operates approximately three - fourths submerged . for example , with light tackle 48 of less than about one - half pound , the ski will operate at the optimum level of three - fourths submerged if all cells 44 are filled . when running heavy tackle 48 of approximately three pounds , only the forwardmost cell , lying immediately behind the rudder surface 22 , is filled . as the weight of the tackle being used decreases , the number of cells filled with water increases . next , the primary fish line holder and release 24 is adjusted to provide the proper clamping force to hold the fish line 49 . the line 49 is inserted between the abutting faces of the back up washer 26 and the clip member 27 , as shown in fig1 by pressing inwardly on the lever 50 to force the back edge of clip 27 to open against the compression of spring 30 . when the lever is released , the line 49 is clamped between the washer 26 and clip 27 , and wing nut 31 is adjusted to provide just enough clamping force to carry the weight of the tackle 49 . with the primary release 24 so adjusted , the line 49 , which is normally attached to a rod and reel or other source 51 in the boat 18 , can be let out to the length desired for fishing and attached at that point to the release 24 . then the flexible rod 34 of the secondary release 33 is bent rearwardly so that its upper portion is disposed at an acute angle to the vertical . the line 49 extending from the primary release 24 back to its source 51 is attached intermediately to the secondary release by slipping it between the faces of washers 43 . adjusting screw 42 is set to clamp the line so that the tension in the portion of the line between the primary and secondary releases is sufficient to hold the rod 34 in its &# 34 ; set &# 34 ; or bent position . with the ski rigged as just described , the tow line 17 , attached to the tow rod 12 , is let out as the boat 18 moves forward , and the movement of the water against the rudder surface 22 of the ski carries it laterally and rearwardly away from the boat , as shown in fig2 . the fish line 49 is let out simultaneously with the tow line and preferably slightly in excess of the length of the tow line such that the tow line tension is not imparted to the fish line . when a fish strikes the baited end of the line 49 , the increase in line tension exceeds the clamping force of the primary release 24 and the line is released therefrom . the resultant momentary loss in tension in the section of line 49 between the primary release and the secondary release 33 causes the flexible rod 34 to snap forward , and the immediately following take - up of line tension caused by the weight of the tackle and bait and the forward movement of the ski , pulls the line 49 free of the clamping force of the secondary release 33 . the line 49 is then free of the ski and the fisherman in the boat may play and land the fish in the usual manner . the flexible rod 34 of the secondary release may be provided with a flag 52 to give a visual indication that a fish is on the line by virtue of its movement from the set to the unflexed position . aslo , the substantial height to which the rod extends above the ski body and the water , even in the bent or set position , aids significantly in keeping the line out of the water and thus avoids or substantially precludes the chance of the line fouling on some part of the ski . to further aid in preventing fouling of the line because of its tendency to occasionally wrap or loop around the secondary release assembly 33 , the washer 43 adjacent to adjusting screw 42 may be of a larger diameter than its mating washer . the enlarged diameter portion is provided with a hole through which is inserted the rod 34 prior to assembly of the release . when so assembled , the space between the assembly 33 and the upper end of the rod 34 is closed against accidental entry and fouling of the line 49 as it sags due to wave action .	0
hereafter , selected embodiments of the present invention will be described according to the following sequence . 1 . 1 . communication device configuration : 1 . 2 . transition to the power saving state : 1 . 3 . return to the normal state : fig1 is a perspective view for describing a communication system 100 . the communication system 100 is equipped with a printer 1 , a pc ( external device ) 3 , and a pc ( external device ) 5 . with this embodiment , we will use the printer 1 to describe an example of the communication device . the printer 1 and the pc 5 are connected to be able to communicate using a network 4 such as a lan ( local area network ), the internet or the like . also , the printer 1 and the pc 3 are connected to be able to communicate using a usb ( universal serial bus ) standard communication path 2 . the communication path 2 or the network 4 are general names of the communication path that is wired or wireless . fig2 is block schematic diagram for describing the constitution of the printer 1 . the printer 1 is constituted equipped with a cpu ( central processing unit ) 10 , a ram ( random access memory ) 11 , a rom ( read only memory ) 12 , a printing mechanism 13 , an nwif 14 , and a usbif 15 . also , the cpu 10 is electrically connected to each part through a bus 16 . the cpu ( calculation unit ) 10 comprehensively controls the driving of the printer 1 by executing on the ram 11 firmware ( hereafter also noted as fw ) recorded in the rom 12 . also , the cpu 10 has respectively independently functioning core ( first functional unit ) 101 , core ( second functional unit ) 102 , and core ( third functional unit ) 103 . a first fw 121 and a second fw 122 which are programs executed by the cpu 10 are recorded in the rom 12 . the first fw 121 is a program executed by the cpu 10 when the printer 1 is in a normal state . also , the second fw 122 is a program executed by the cpu 10 when the printer 1 is in a power saving state . because of that , the recording unit of the present invention is realized using the rom 12 . in addition to this , for example when the printer 1 is equipped with memory such as an hdd ( hard disk drive ) or the like , it is also possible to have the first fw 121 and the second fw 122 recorded in this hdd . also , the first fw 121 and the second fw 122 can also be recorded in respectively different locations ( memory ). fig3 a and 3b are diagrams describing the process executed by each core of the cpu 10 in the normal state and the power saving state . fig3 a shows the functions allocated to each core 101 to core 103 when the cpu 10 executes the first fw 121 ( normal state ). fig3 b shows the functions allocated to each core 101 to core 103 when the cpu 10 executes the second fw 122 ( power saving state ). in fig3 a and 3b , the case of the functioning of the cores stopping is not noted . when the cpu 10 shown in fig3 a is in a normal state executing the first fw 121 , all of core 101 to core 103 are operating . also , the core 101 is allocated for the control of the printing mechanism 13 . also , the core 102 is allocated for the control of the nwif 14 . also , the core 103 is allocated for the process of analyzing the usbif 15 and the print data . with the power saving state shown in fig3 b for which the cpu 10 executes the second fw 122 , only the core 101 functions , and the operation of the other cores 102 and 103 is stopped . here , having the operation stop means that the power consumption of the core becomes low or the driving of the core stops by reducing the drive power supplied from a power supply circuit ( not illustrated ). because of that , in the power saving state , the power consumption of the cpu 10 decreases . also , in the power saving state , the core 103 is allocated for the control of the nwif 14 and for the control of the usbif 15 . here , with this embodiment , the core 101 that is driven in the power saving state has its power consumption in the normal state become the lowest compared to the power consumption of the other cores 102 and 103 . as a result , it is possible to reduce the power consumption in the power saving state . returning to fig2 , in the normal state , the printing mechanism 13 forms an image on paper based on print data decoded by the core 103 of the cpu 10 . this print data is fetched through the nwif 14 or the usbif 15 , for example . the printing mechanism 13 has a conveyance mechanism ( not illustrated ) and a print head ( not illustrated ). the print head for example is connected to a cartridge corresponding to each type of liquid including cyan , magenta , yellow , black , light cyan , light magenta , and gray , and ink supplied from each cartridge is discharged . the conveyance mechanism is equipped with a paper feed motor and a paper feed roller , and in the normal state , by the drive being controlled by the core 101 of the cpu 10 , the matter to be printed is conveyed along the feed direction which is the direction in which the paper is conveyed . the nwif ( network inter face ) 14 is constituted from a well known lan board or a lan card , for example . the nwif 14 functions as an interface according to the tcp / ip protocol that connects the printer 1 to the network 4 . in the normal state , the nwif 14 is controlled by the core 102 of the cpu 10 , and performs data and command communication . also , in the power saving state , the nwif 14 is controlled by the core 101 of the cpu 10 and performs receiving of data and commands . the usbif ( universal serial bus inter face ) 15 is constituted by a well known usb board , for example . the usbif 15 is detachably connected with the communication path 2 using a connector , and functions as the interface according to the usb method that connects the pc 3 and the printer 1 . in the normal state , the usbif 15 is controlled by the core 103 of the cpu 10 , and performs data and command communication . also , in the power saving state , the usbif 15 is controlled by the core 101 of the cpu 10 and performs data and command communication . with this embodiment , the usbif 15 functions as the communication unit . fig4 is a timing chart for describing the transition from the normal state to the power saving state . the left side of the drawing shows communication between the pc 3 and the printer 1 , the right side of the drawing shows the operation or stopping of core 101 to core 103 . in specific terms , the period when the core 101 to the core 103 are operating is marked with a solid line , and the period when they are stopped is not marked with a solid line . first , in the normal state of the printer 1 , when there is sending of a command according to usb standards from the pc 3 through the communication path 2 ( step sa 1 ), the cpu 10 ( core 103 ) of the printer 1 controls the usbif 15 and performs a command response ( step sb 1 ). said another way , when a command is sent , the core 103 executes in cooperation with a mechanism related to commands such as the core 101 , the core 102 , the printing mechanism 13 or the like . after that , the core 103 performs a command response corresponding to the processing results . in the right side of fig4 as well , in the normal state , all of core 101 to core 103 are operating . next , when conditions are established for transitioning to the power saving state , the cpu 10 switches the first fw 121 for the normal state recorded in the ram 11 to the second fw 122 for the power saving state . because of that , each core 101 to core 103 of the cpu 10 stops in sequence . with this embodiment , the stopping sequence of the core 101 to the core 103 is that after the core 101 and the core 102 stop first , and the core 103 stops last . in other words , first , the core 102 that does not operate in the power saving state and the core 101 that does operate in the power saving state stop . next , the core 103 that controls the usbif 15 is the last to stop . next , during the firmware switching period ( transition period to the power saving state , in particular , the period during which at least a portion of the mechanism relating to the process does not operate ), when there has been sending of a command ( signal ) from the pc 3 ( step sa 2 ), the core 103 controls the usbif 15 and performs a null response ( steps sb 2 , sb 3 ). said another way , in this period , when a command has been sent , the core 103 cannot execute the process corresponding to the command . because of that , the core 103 performs a null response regardless of the command process results . the pc 3 counts the period from when the command is sent until there is a response from the printer 1 , so when there is a null response from the core 103 , the count does not time out . after that , just before the end of switching from the first fw 121 to the second fw 122 , the recording destination of the first fw 121 moves from the ram 11 to the rom 12 , so the core 103 stops ( nak response period ). in this state , when there is a command sent from the pc 3 to the printer 1 ( step sa 3 ), the usbif 15 of the printer 1 performs a nak response to the pc 3 ( step sb 4 ). however , after that , the firmware switching period ends , and there is a transition to the power saving state , so the core 101 operates . after that , the core 101 controls the usbif 15 , and performs a command response to the pc 3 ( step sb 5 ). because of that , though there is a period for performing a nak response from the printer 1 to the pc 3 , it is possible to make that period shorter and to suppress pc 3 time outs . here , as a firmware switching method from the first fw 121 to the second fw 122 , various items can be envisioned . for example , in a state with the first fw 121 recorded in the ram 11 , as a background process , it is possible to have the second fw 122 recorded in the ram 11 , and have the core 101 read the second fw 122 from the ram 11 . in addition to this as well , after evacuating the first fw 121 from the ram 11 , it is also possible to have the second fw 122 recorded in the ram 11 , and for the core 101 to read the second fw 122 . fig5 is a timing chart for describing the return from the power saving state to the normal state . the left side of the drawing shows communication between the pc 3 and the printer 1 , and the right side of the drawing shows the functioning or stopping of core 101 to core 103 . in specific terms , the period when core 101 to core 103 are operating is shown with a solid line marked , and the period when they are stopped is shown without a solid line marked . in the power saving state of the printer 1 , when there is sending of a command from the pc 3 through the communication path 2 ( step sa 11 ), the operating core 101 controls the usbif 15 and performs a command response ( step sb 11 ). next , when conditions are established for returning to the normal state , the cpu 10 switches the second fw 122 for the power saving state recorded in the ram 11 to the first fw 121 for the normal state . because of that , each core 102 and core 103 of the cpu 10 return in sequence . with this return to the normal state , first , the core 101 operates until just before the fw switching is completed . after that , after the core 101 has stopped once , all of core 101 to core 103 return . because of that , during the firmware switching period ( period returning to the normal state ), when there has been sending of a command from the pc 3 ( step sa 12 ), the core 101 controls the usbif 15 and performs a null response ( step sb 12 ). the pc 3 counts the period from after the command is sent until there is a response from the printer 1 , so when there is a null response from the core 101 , time out does not occur . after that , just before the end of switching from the second fw 122 to the first fw 121 , the recording destination of the second fw 122 moves from the ram 11 to the rom 12 , so the core 101 stops ( nak response period ). in this state , when there is a command sent from the pc 3 to the printer 1 ( step sa 13 ), the usbif 15 of the printer 1 performs a nak response to the pc 3 ( step sb 13 ). however , after that , the firmware switching period ends , and to return to the normal state , all of core 101 to core 103 return . after that , a command response is performed from the core 101 to the pc 3 ( step sb 14 ). because of that , in a period returned to the normal state as well , though there is a period for which a nak response is performed from the printer 1 to the pc 3 , that period can be made shorter , and it is possible to suppress time out of the pc 3 . because of that , with usb standard communication which does not handle nak response , it is possible to suppress communication failure . here , as a method of switching firmware from the second fw 122 to the first fw 121 , the same as when transitioning to the power saving state , various items can be envisioned . for example , in a state with the second fw 122 recorded in the ram 11 , as the background process , it is possible to have the first fw 121 recorded in the ram 11 , and to have the cores 102 and 103 read the first fw 121 from the ram 11 . in addition to this , it is also possible to have an item for which after the second fw 122 is evacuated from the ram 11 , the first fw 121 is recorded in the ram 11 , and one of the cores 101 to 103 reads the first fw 121 . the item responding with null during the firmware switching period is not limited to being the usbif 15 , but can also be the nwif 14 . also , the number of cores that the cpu 10 has is not limited to being three . also , using the printer as the communication device is merely an example , and it is possible to use various devices as long as it is an item that performs communication with an external device . it goes without saying that the present invention is not limited to the embodiments noted above . even with switching of modes unrelated to power saving , it is possible to operate as with the embodiments noted above during change periods of mode changes such as when it is not possible for the calculation device to deal with the external device . in addition , it is possible to change as appropriate the combinations of members and constitutions and the like that can be mutually interchanged disclosed in the embodiments above and in other embodiments , and to apply those . it is also possible to interchange as appropriate members and constitutions that are known technology that are mutually interchangeable with the members and constitutions and the like disclosed in the embodiments noted above , and to change combinations thereof and apply those . it is also possible to change as appropriate members and constitutions and the like disclosed in the embodiments noted above that would be known by a person skilled in the art based on known technology or the like with members and constitutions and the like that can be assumed to be substitutes , or to change combinations thereof and apply those . in understanding the scope of the present invention , the term “ comprising ” and its derivatives , as used herein , are intended to be open ended terms that specify the presence of the stated features , elements , components , groups , integers , and / or steps , but do not exclude the presence of other unstated features , elements , components , groups , integers and / or steps . the foregoing also applies to words having similar meanings such as the terms , “ including ”, “ having ” and their derivatives . also , the terms “ part ,” “ section ,” “ portion ,” “ member ” or “ element ” when used in the singular can have the dual meaning of a single part or a plurality of parts . finally , terms of degree such as “ substantially ”, “ about ” and “ approximately ” as used herein mean a reasonable amount of deviation of the modified term such that the end result is not significantly changed . for example , these terms can be construed as including a deviation of at least ± 5 % of the modified term if this deviation would not negate the meaning of the word it modifies . while only selected embodiments have been chosen to illustrate the present invention , it will be apparent to those skilled in the art from this disclosure that various changes and modifications can be made herein without departing from the scope of the invention as defined in the appended claims . furthermore , the foregoing descriptions of the embodiments according to the present invention are provided for illustration only , and not for the purpose of limiting the invention as defined by the appended claims and their equivalents .	8
preferred embodiments of the invention include and are practiced in a process and with equipment generally shown as in fig1 - 5 . referring to fig1 a press generally identified by reference numeral 100 includes a base 102 and thereabove a mold table 104 . referring to fig2 the table 104 is circular in plan view , and supports a plurality of glass molds 106 . the glass molds 106 are spaced circumferentially around the table 104 , at equal radii from a central axis 108 , and equal arcs about the table 104 . the axis 108 is the axis of the table 104 , and also an upright central shaft 110 . the table 104 is mounted on the shaft 110 for rotation about the axis 108 . appropriate bearings are employed . the shaft 110 is mounted to the base 102 . referring to fig1 and 3 , two upright side columns 112 , 114 stand alongside the mold table 104 atop the base 102 . the side columns 112 , 114 are spaced perpendicularly an equal distance from a plane extending through the central axis 108 . a yoke 116 is supported between the side columns 112 , 114 and the central shaft 110 . together , the side columns 112 , 114 , central shaft 110 , and yoke 116 comprise and support a press head tower . more specifically , the side columns 112 , 114 , central shaft 110 and yoke 116 support two spaced , vertical rods 118 , 120 , which extend downward from the yoke 116 toward the mold table 104 . the rods 118 and 120 in turn support a cross head assembly 122 , over a molding station 124 . the cross head assembly 122 , at a lower end , and the side columns 112 , 114 , central shaft 110 and yoke 116 , at an upper end , support and guide a drive shaft 125 of a press head drive cylinder 126 . the press head drive cylinder 126 is mounted to the yoke 116 , and its drive shaft 125 extends downward for reciprocation toward and away from the molding station 124 . as seen best in fig4 a load cell 130 is located on the cross head assembly 122 , below the drive shaft 125 . a rod alignment coupler 132 connects the drive shaft 125 to an adapter stud 134 . the adapter stud 134 includes a load cell shaft 136 , which extends into the center of the load cell 130 . a lock nut holds the load cell 130 on the load cell shaft 136 , and the load cell 130 is bolted to the cross head casting 138 . the load cell 130 may be attached to the press head drive cylinder 126 by means of a coupling and a spacer ( not shown ). the load cell 130 responds to force and produces a signal directly related to the force on the load cell 130 . the load cell 130 may be a modified strainsert brand load cell . the load cell 130 is preferably capable of providing a signal having a response time of 1000 - 2000 hz while still providing appropriate shielding from electrical and electromagnetic noise . the load cell 130 includes signal conditioning circuitry ( not shown ) which is preferably assembled with mounting brackets . the load cell 130 and the signal conditioning circuitry are preferably housed inside a metal shielding to maintain appropriate shielding from noise . a shielded cable may also be used as the connection between the load cell 130 and the signal conditioning circuitry . the load cell 130 generally has circuitry for processing of the sensed force and generating the associated electrical signal . in the preferred system , the circuitry of the load cell 130 is structurally reinforced with techniques generally known in the art to sustain stresses due to operation of the press head . for instance , the circuitry of the load cell 130 may be securely soldered , the circuitry may be placed on thicker circuit boards and clamped securely in place . referring to fig6 the signal of the load cell 130 is provided to a force control module (&# 34 ; fcm &# 34 ;) 140 , within a programmable logic controller (&# 34 ; plc &# 34 ;) 142 . the plc 142 may be as shown in any of the following u . s . patents assigned to allen - bradley co . : u . s . pat . nos .! 3 , 810 , 104 ; 3 , 810 , 118 ; 3 , 942 , 158 ; 4 , 118 , 792 ; 4 , 165 , 534 ; 4 , 858 , 101 ; and u . s . pat . no .! 5 , 287 , 548 , and associated issued u . s . patents of allen - bradley co ., inc .,! all of which are incorporated by reference . the plc 142 is preferably an allen - bradley plc 5 / 40 with an allen - bradley slc 5 / 04 as an auxiliary component . the plc 142 , as conventional , is housed in a rack ( not shown ) which includes a series of slots for printed circuit board modules , such as the fcm 140 . all connected modules are interconnected by a series of signal buses to which the modules are connected . the rack further includes a power supply module ( not shown ), a system controller module ( not shown ), a number of program execution modules , and a plurality of input / output scanner modules ( not shown ). scanner modules are connected to sensors 144 , 146 of hydraulic pressure in the press head cylinder hydraulic system , and of press head cylinder position , respectively . the system controller module of the plc 142 supervises communication between the plc 142 and a personal computer workstation shown diagrammatically as a central processing unit (&# 34 ; cpu &# 34 ;) 147 , a monitor 148 and a keyboard 150 . the system controller module exchanges data with the personal computer workstation , providing system reporting , input , and troubleshooting . the plc 142 sequentially operates the mechanisms of the press 100 according to a stored program . the program includes instructions which are read in rapid sequence and interpreted to examine the condition of the sensing devices ( 130 , 144 , and 146 ) on the press 100 , and to energize and de - energize the operating devices of the press 100 based on the conditions of the sensing devices 130 , 144 , and 146 . as with the past glass molding presses of u . s . pat . nos . 3 , 953 , 187 and 4 , 723 , 976 , the preferred press 100 advances and retracts the drive shaft 125 through a cycle of movement for glass molding . the shaft 125 drives a press head ( not shown ) forward and down into association with a glass mold 106 at the molding station 124 , after a glass gob delivery mechanism ( not shown ) delivers a glass gob to a glass mold 106 at the molding station 124 . force on the glass gob is maintained through molding , and the press head is then retracted upward . retraction allows for indexing of the mold table 104 , and delivery of a next glass gob to a next glass mold 106 at the molding station 124 . the motion of the press head drive cylinder 126 is achieved using a hydraulic pump ( not shown ). charted as location over time , the movement of the press head constitutes a profile of movement . charted as force over time , the force of the press head against the glass gob also constitutes a profile of force . in the preferred system with the preferred load cell 130 and associated control , profiles of movement and force are readily selected and adjusted by the press customer and / or operator . the profiles of movement and force are preferably stored in the plc 142 which may contain in memory numerous profiles of movement and force . these profiles may be used by the fcm 140 for controlling the movement and force of the press head drive cylinder 126 . in relation to controlling the press head drive cylinder 126 , the plc 142 preferably operates separately from the fcm 140 . the fcm 140 receives the signal from the load cell 130 , representative of force , and the signal from the presshead cylinder position sensor 146 , representative of press head cylinder position . these signals are then scanned according to the fcm &# 39 ; s own parameters . the fcm 140 communicates with the plc 142 by receiving and sending instructions to the plc 142 . upon start - up of the system , the desired movement and force profiles are loaded into the fcm 140 from the plc 142 . once loaded , the fcm 140 may then operate independently of the plc 142 . if a change in the movement or force profile was required , the fcm 140 may suspend operation of the press head , download the new profile and resume operation of the press head . the plc 142 may at times query the fcm 140 for a status report which may then be supplied in response . based on the status report and information from the hydraulic pressure sensor 144 , the plc 142 may then generate a statistical report of the operation of the press 100 . the fcm 140 is capable of controlling the position and force of the press head drive cylinder 126 by making proper adjustments to a hydraulic pump ( not shown ). the hydraulic pump , which is generally known in the art , serves to operate the press head drive cylinder 126 . generally , press head movement begins with rapid movement toward the mold at the molding station 124 , under control of motion . control is preferably shifted to control of force as soon as the press head reaches a glass gob in a mold at the molding station 124 . thereafter , force is rapidly increased to desired glass molding force . in other words , the system may switch its control of the press head once the press head reaches a predetermined position along its path . the position of the press head is determined by the presshead cylinder position sensor 146 . the presshead cylinder position sensor 146 is preferably a linear transducer which is an lh - type temposonic linear transducer provided by mts systems corporation . for purposes of illustration only , fig7 provides a graph of a typical movement profile and force profile . the movement profile 710 establishes the velocity of the press head as a function of position . the movement profile portion is charted with the origin 720 representing the uppermost position of the press head in its range of motion . the final position 730 represents the point where the press head is in contact with the glass gob . at this point , control of motion may switch to control of force . the force profile 740 may chart force as a function of time . alternatively , the shift from control of motion to control of force may be achieved as a matter of force when the load cell 130 senses the press head force of the press head against a glass gob in a glass mold 106 at the molding station 124 . no spiking or sudden changes of movement or force is utilized , as preferred . particularly , during rapid movement of the press head under control of motion , a sensing of any force spike , indicating an obstruction in the press head path , suspends operation of the press head . similarly , during pressing of the glass glob , sensing of any motion spike suspends operation of the press head . during any part of the press head motion , if the motion of the press head becomes uncontrollable , the force control module 140 disables all motion . also , if the force control module 140 receives information from the press head motion sensor 146 that suggests impossible movement ( such as a motion spike ), the force control module 140 disables all motion . advantages of the preferred press 100 include direct sensing of molding press force , as opposed to hydraulic drive system pressure . direct sensing of molding press force through the load cell 130 eliminates sensing of the effects of the press systems extraneous to molding press force , which may occur with sensing of hydraulic drive system pressure . no extraneous effects of compression in the hydraulic system are sensed . force is sensed and controlled directly . as additional preferred embodiments , the invention comprises methods utilizing the apparatus of the invention , and like aspects of the invention . the preferred embodiments and the invention are now described in such full , clear , concise and exact language as to enable a person of ordinary skill in the art to make and use the invention . to particularly point out and distinctly claim the subject matter regarded as invention , the following claims conclude this specification .	8
referring to fig1 and 2 , an improved door assembly 10 comprises a panel - like door 11 which is connectable by bracketry , namely a top pin assembly 12 and a lower bracket 9 ( fig1 and 7 ), which mount to the frame 13 of a doorway 14 . more particularly , the doorway 14 typically extends through a partition wall 15 such as the wall of a building or the wall of a cooler . the doorway 14 is defined by a bottom threshold or floor 15 a ( fig7 ), upright door jambs 16 and a crosswise header 18 . the jambs 16 and the header 18 typically have a side - to - side width which is defined by the thickness of the partition wall and has a conventional rectangular shape . as seen in fig2 , the top pin assembly 12 connects to the respective inside faces 16 a and 18 a of one of the jambs 16 and the header 18 , and to only one face 11 a of the door 11 . the door 11 is pivotally connected to such top pin assembly 12 to permit swinging movement of the door 11 in opposite swinging directions . as such , the top pin assembly 12 permits bi - directional swinging movement of the door 11 between the closed position of fig1 - 3 and a first open position of fig4 wherein the door is at a right , 90 degree angle relative to the closed position . as seen in fig1 , the door 11 includes the top pin assembly 12 in the upper corner thereof which cooperates with the door frame to effect a self - centered closing of the door 11 so as to generally be centered within the doorway 14 widthwise of the partition wall in the closed position of fig1 . the top pin assembly 12 comprises a box - like cover 19 ( fig2 ) which provides selective access to the top pin assembly 12 so that it is accessible from the one side of the door as seen in fig2 - 4 . the top pin assembly 12 not only biases the door 11 to the closed position of fig1 , but also permits the door 11 to open in either the first open position of fig4 or a second open position wherein the door is oriented 180 ° relative to the first open position . in this second open position , the door is still oriented at the right , 90 ° angle relative to the closed position ( fig1 ) after the door 11 has been swung in the opposite direction . more particularly as to the top pin assembly 12 , the top pin assembly 12 ( as seen in fig1 - 3 and 8 ) first comprises a hinge bracket or support bracket 20 which comprises a horizontal leg 21 and a vertical leg 22 which are respectively secured to the header 18 and jam 16 by suitable fasteners 23 , which are preferably screws . the hinge bracket 20 includes a downwardly extending , fixed hinge post or pin 25 which is preferably welded to the horizontal bracket leg 21 . the bottom or terminal end 24 of the hinge pin 25 includes a support head 26 which is enlarged relative to the shaft 27 of the pin 25 to define an upward - facing , annular support surface or ledge 28 which is configured to rotatably support the weight of the door 11 thereon . generally , the top pin assembly 12 further comprises an upper bracket assembly 30 which is affixed to the door face 11 a by a base bracket 31 . the upper bracket assembly 30 comprises a pair of diametrically opposed rollers 33 located on diametrically opposite sides of the pin 25 . the rollers 33 are each rotatably supported upon a respective shaft 34 carried on the bracket assembly 30 , wherein the free ends of the shafts 34 each support a respective one of the rollers 33 thereon . the pin 25 thereby extends downwardly in a vertical orientation and rotatably carry the rollers 33 thereon and in turn supports the upper bracket assembly 30 on the pin 25 . the hinge bracket 20 and hinge pin 25 thereby remain in stationary fixed positions during use while the upper bracket assembly 30 rotates together with the door 11 to which it is affixed . as will be described hereinafter , the upper bracket assembly 30 and the remaining components of the top pin assembly 12 described below are rotatably suspended from the top pin 25 by the rollers 33 and are fastened to the door 11 , which thereby allows the door 11 to swing between the open and closed positions . referring to fig3 , 4 and 6 , the base bracket 31 includes a generally c - shaped bracket wall 40 comprising a bottom wall 41 , side walls 42 and inturned support flanges 43 , which flanges 43 define a space therebetween to accommodate the upper bracket assembly 30 . the bracket wall 41 includes a back wall 44 which faces the door face 11 a for abutment therewith and is fastened or affixed to the door face 11 a by fasteners 46 . the base bracket 31 therefore is stationarily affixed to the door 11 prior to mounting of the door 11 on the support bracket 20 as will be described further . the bottom bracket wall 41 also includes a downwardly - depending connector flange 47 having fastener inserts 48 to which the cover 19 ( fig2 ) is affixed by appropriate fasteners 49 ( fig2 ). to connect the upper bracket assembly 30 to the base bracket 31 , the bracket wall flanges 43 include bore holes through which threaded bolts 51 are provided . the bolts 51 are used to join the upper bracket assembly 30 to the base bracket 31 as the door is being suspended from the upper bracket assembly 30 . in this regard , it has been previously noted that the upper bracket assembly 30 is pre - mounted to the hinge pin 25 in a sub - assembly that is affixed to the door frame by fastening of the support bracket 20 to the door frame . during this initial installation step , the bracket assembly 30 would then be supported on the door frame due to the bracket assembly 30 being pre - assembled with the support pin 25 . the bracket assembly 30 is not yet affixed to the door 11 . for mounting on the door 11 , the upper bracket assembly 30 is then preliminarily engaged with the base bracket 31 and then is affixed thereto by the fasteners 51 . in this manner , the door 11 is pre - mounted on the top pin assembly 12 . to secure the bottom of the door 11 , the bottom hinge assembly 60 ( fig7 ) is provided . the bottom hinge assembly 60 comprises an l - shaped mounting bracket 61 comprising a vertical leg 62 and a horizontal leg 63 which affixes to the door frame 16 and / or floor 15 a by suitable fasteners 62 . this bottom bracket 61 includes an upstanding hinge pin 64 which generally has a constant diameter cylindrical shape which engages a bottom door bracket 65 . the bottom door bracket 65 comprises a mounting leg 66 which is affixed to the door by fastener screws 67 . the lower bracket 65 then is bent outwardly and downwardly and then is turned back horizontally to define a bottom leg 68 formed with a vertical bore which rotatably receives the bottom hinge pin 64 therethrough . the bracket 65 restrains the door 11 relative to a vertical axis extending through the bottom pin 64 and the upper pin 25 , which are vertically aligned with each other , so that the door will rotate or swing about this vertical axis . thus , the lower bracket 65 restrains the bottom door sidewardly relative to the pin 64 while permitting relative rotation therebetween . also , the bracket 65 is displaceable vertically with the door 11 relative to the bottom pin 64 to allow the top pin assembly 12 to function as will be described hereinafter . referring to fig8 - 10 , the top support bracket 20 is shown in greater detail . in this regard , the support head 26 is formed with the support ledge 28 . this support ledge 28 preferably is formed with a pair of v - shaped notches 70 which extend across the diameter of the support head 28 but rise vertically to raised shoulders 71 . when the door 11 is in the closed position of fig3 and 5 , the rollers 33 seat within the centering notches 70 which allows the door to drop vertically downwardly into the notches 70 . however , during rotation of the door 11 , the rollers 33 roll up the inclined faces 72 , which define the notches 70 , which thereby causes the door 11 to rise vertically and ultimately allow the rollers 33 to rest upon the raised shoulder 71 when the door is in the open position of fig4 . hence , the door 11 has some vertical displacement as the rollers 33 travel circumferentially about the support shoulder 28 during door rotation . essentially , the notches 70 provide positive restraining of the door 11 in the closed position and perform a self - centering of the door 11 and automatic return of the door 11 to this closed position as the rollers 33 roll back down the inclined faces 72 of the notches 70 . referring to fig1 - 13 , the upper bracket assembly 30 is illustrated in exploded and assembled conditions . the upper bracket assembly 30 preferably comprises a primary support bracket 80 which is formed with a bottom support plate 81 that is adapted to be positioned below and span the gap between the base bracket wall flanges 43 described above in fig4 . this support plate 81 , when seated below the base bracket flanges 43 , thereby allows the door 11 to be suspended on this support plate 81 . the support plate 81 is provided with a pair of bore holes 82 through which the fasteners 51 are inserted and secured with the associated nuts 51 a . the support plate 81 also includes a central bore 83 which is configured to receive a bolt 84 vertically therethrough as generally seen in fig1 , 13 , 16 and 6 . the bolt 84 is provided with an associated washer 85 and lock nut 86 . next , the support plate 81 is provided with a fixed side bracket 91 having an inturned lower end 92 that is welded or rigidly affixed to the support plate 81 . the side bracket 91 extends vertically upwardly and turns inwardly to define a top flange 92 . the top flange 92 includes a semi - circular notch 93 that is provided so as to extend about the pin shaft 27 and prevent removal of the upper bracket assembly 30 from the hinge pin 25 . the side bracket 91 is also formed with a hole for rotatably mounting the roller 33 thereon near the upper end thereof . as seen in fig1 , the roller comprises a main shaft 95 which includes an annular shoulder 96 that is fixed against an inside face of the side bracket 91 and secured in place by a roller nut 97 . appropriate washers are provided between the nut 97 and shoulder 96 and the opposing faces of the side bracket 91 so that the roller shaft 95 is nonrotatably affixed to the side bracket 91 . the roller 33 is loosely fitted on the shaft 95 and prevented from falling off by the enlarged head 98 of the shaft 95 . the roller 33 is essentially provided with the shaft 95 in a pre - assembled condition as seen in fig1 and then fastened in place with the appropriate washers by the nut 97 . this defines a roller assembly 100 that mounts to the side bracket 91 . a second side bracket 101 is provided which also is provided with its own roller assembly 100 that mounts thereto in the same manner . to affix the second side bracket 101 in place , the side bracket 101 includes a bottom connector flange 102 ( fig1 and 14 ) which is formed with a bore hole 103 that aligns with the fastener hole 83 of the above - described support plate 81 . this connector flange 102 then fits onto the top of the support plate 81 as seen in fig1 to allow the fastener 83 to extend vertically downwardly therethrough as seen in fig1 and 16 so that the bolt 83 maintains these components in alignment and is provided to secure these components together . in particular , when the side brackets 91 and 101 are both provided together as seen in fig1 , the fastener 84 extends through the bracket bore hole 103 and the plate bore hole 83 so that these components can be subsequently and tightly joined together by the nut 86 as seen in fig6 . when the fastener 84 is tightly engaged therebetween , the side brackets 91 and 101 are affixed in non - movable positions in the mated condition of fig1 and 15 . however , by removal of the fastener 84 , the two side brackets 91 and 101 are separable as seen in fig1 and 14 . notably , the side bracket 101 also includes a top flange 105 which is formed with a semi - circular notch 106 that aligns with the aforementioned notch 93 in the side bracket 91 . these aligned notches 93 and 106 thereby define a circular hole 107 through which the pin shaft 27 extends vertically as seen in fig5 and 16 . when assembling the upper bracket assembly 30 to the hinge pin 25 , the side brackets 91 and 101 are positioned on opposite sides of the pin 25 as seen in fig1 . these side brackets 91 and 101 are then moved together as seen in fig1 and 16 with the pin shaft 27 extending through the bracket hole 107 as seen in fig1 . fig1 shows the side brackets 91 and 101 in a loose condition , but it is understood that these two brackets 91 and 101 are then rigidly affixed together by the fastener 84 which would thereby non - removably engage the entire upper bracket assembly 30 in suspended relation on the hinge pin 25 . to provide additional support to this structure , particularly under door loads , a cross bolt 110 ( fig5 , 6 and 8 ) is provided to draw the side brackets 91 and 101 together . the draw bolt 110 includes a head 111 at one end and a nut 112 at the opposite threaded end . a plastic sleeve 113 is provided to prevent the brackets 91 and 101 from bowing inwardly toward each other , and the bolt head 111 and nut 112 along with the associated washer 112 a prevent the side brackets 91 and 101 from bowing outwardly relative to each other . to receive the draw bolt 110 , the side brackets 91 and 101 include appropriate side bores 91 a and 101 a as best seen in fig1 . thus , after pre - assembly of the brackets 91 and 101 , the draw bolt 110 can be inserted through the holes 91 a and 101 a to prevent unwanted bowing of the side brackets 91 and 101 . next , referring to fig1 - 19 , the door 11 also includes an improved construction having a flush - mounted window 120 . the window 120 comprises two sheets 121 of a glass - like material such as plexiglass which each have a window face 122 that lies substantially flush with the door faces 11 a . known window constructions for these types of traffic doors typically have an obtrusive frame or gasket by which the glass sheets are mounted to the door , wherein the inventive window eliminates these frames and gaskets . the improved window construction uses two opposed window sheets 121 which are shown in a generally rectangular shape . the window sheets 121 have a uniform thickness , but are provided with an opaque border 123 , such as a black border , which extends partly into the window area as a marginal edge portion . the central portion of each if the sheets 121 defines a see - through or transluscent window section 124 which is bounded by the opaque border . preferably , the border 123 is formed from coloration of the window sheet 121 and does not use a separate frame structure . as such , the surface of the window sheets 121 is substantially uniform as seen in fig1 and is substantial flush with the door face 11 a . this provides a clean , aesthetically pleasing appearance to the window 122 that avoids any use of separate frames , particularly a frame that projects obtrusively outwardly from the door face 11 a . to mount the window sheets 121 , the door 11 is preferably formed of a door panel have a solid thickness formed of a machinable or modifiable material . the door panel also could be formed of a composite structure defined by multiple layers . the door cross section is shown in fig1 , wherein the door material first has a window opening 130 cut out of it . the window opening 130 has a peripheral edge 131 defining a flat edge face 132 . preferably , the edge 131 is machined to define two edge recesses 134 and 135 that have a rectangular shape defined by a bottom face 136 and side face 137 . the side face 137 extends continuously about the outside of the window opening 130 and is dimensioned to snugly receive the window sheet edges there against . the depth of the recesses 134 and 135 are about the thickness of the window sheets 121 so that the window sheets 121 lie flush with the door face 11 a when the window sheets 121 are pressed into the window opening 130 . while the snug fit may help hold the window sheets 121 in place , preferably a joining material 140 is provided such as an adhesive , tape or the like which is shown in fig1 on the bottom faces 136 . however , the joining material 140 can be provided on both faces 136 and 137 or one or the other to generate a clean appearance to the joint . preferably , the opaque window border 123 extends face - wise inwardly beyond the recesses 134 and 135 to hide the machined door material and any joining material 140 . further , the inside edge face 132 is colored or finished with a material such as paint that preferably matches the color of the border 123 or otherwise provides an aesthetically pleasing appearance . although particular preferred embodiments of the invention have been disclosed in detail for illustrative purposes , it will be recognized that variations or modifications of the disclosed apparatus , including the rearrangement of parts , lie within the scope of the present invention .	4
referring to the drawings , there are two embodiments shown . the first embodiment is shown in fig1 and 9 . referring first to fig2 there is shown a workman 12 on a ladder 14 using the organizer chest 26 of the instant invention . this organizer chest is also seen in fig1 in an upright attitude in which it is easily carried by the handle 34 . the chest includes a top wall 18 , bottom wall 20 , first and second end walls 22 and 24 and sliding side walls one of which is seen at 26 in fig4 and the other of which is seen at 28 in fig1 . preferably , the chest also includes support studs such as 30 on the top and such as at 31 on the bottom walls , 18 and 20 respectively . on the second end wall 24 there are supports 32 which are somewhat longer than those on the top and bottom walls . these supports 32 accommodate clearance for the end of the strap 36 when the chest is positioned in an upright attitude with the second end wall being on a support surface . on the first end wall 22 , a handle 34 is provided for use in carrying the chest as indicated in fig1 . the strap serves as a sling 36 for use as shown in fig2 . within the chest there are a plurality of separate compartments each for a different item to be used by the workman . the compartments are arranged in rows one beneath the top wall , one beneath he bottom wall and one beneath each of the side walls . in use , the workman is able to rotate the chest about its longitudinal axis to gain access to each of the rows of compartments selecting which row desired . as seen in fig6 a view in cross - section taken through the chest , see fig5 the top wall 18 and the bottom wall 20 each includes a slidable wall panel 38 and 40 respectively . these are each adapted to slide longitudinally and , as shown , and are centrally arranged with respect to the top and bottom walls respectively , that is in the central zone between the slidable side walls 26 and 28 . for example , the slidable wall panel 38 in the top wall 18 , see fig1 may be slidably moved as indicated in fig6 to gain access to one or the other of the compartments in the rows beneath it . thus , when slide wall portion 38 is moved in the direction of the arrow 39 , see fig6 then the compartments 41 are accessible ; and , similarly , when the chest has been rotated through 180 ° about its longitudinal axis and the slidable wall panel 40 is moved in the direction of the arrow 42 , the compartments 43 are accessible . referring to fig9 it is seen that , to accommodate the sliding action of the wall panels 38 and 40 , a pair of confronting slide grooves 50 and 52 and 54 and 56 are provided . these may be in the top and bottom walls or in longitudinally extending septums , 58 and 60 . these septums it is seen serve as floors , one for the row of compartments beneath the side wall 26 and one for the row of compartments beneath the slide panel 28 . spanning the septums 58 and 60 , there is another septum 62 , perpendicular to the parallel septums 58 and 60 , which extends between the end walls 22 and 24 and serves as a common floor for the compartment rows 41 and 43 , see fig6 . from the common floor septum 62 there extend compartment sides , such as 64 and 66 , which are each of a common length and separate each of the rows 41 and 43 into the individual compartments shown . in the preferred embodiment , on each of the slidable wall panels there is an operator knob 71 so that it may be used as seen in fig6 and 7 . as indicated in fig1 the side wall 28 as well as the side wall 26 , see fig4 are slidable panels . as seen in fig9 slide grooves 80 and 82 and 84 and 86 are provided to accommodate sliding movement of these sliding side walls 26 and 28 and may be composed of longitudinally extending pairs of confronting grooves in the top and bottom walls 18 and 20 . it is seen that there is one compartment 88 beneath the slide wall 28 and a plurality of compartments 90 beneath slide wall 26 in this preferred embodiment . the compartments in each row are of a common depth but may be separated by elements , such as 92 spaced at the zone or different distances to define different sized compartments . for example , on reference to fig7 it is seen that tools may be conveniently carried in the elongate compartment 88 , while smaller items such as fuses , washers , etc ., may be carried in the compartments such as 90 as well as in the row of compartments 41 and 43 . it is seen that the second end wall 24 serves as a stop means to constrain movement of the slide panels to movement away from and toward it . referring now to fig1 through 19 , a second embodiment of the organizer chest is shown . as seen in fig1 , it is generally designated by the numeral 212 . it includes opposing end walls , one with an opening 218 centrally arranged in it . this end wall is designated 216 and the other , an opposite end wall , is designated 214 , see fig1 . the end walls are spanned by side walls to be described more fully hereinafter . within the organizer chest there is a longitudinally extending centrally located core bounded by a cylindrical septum 218 , see fig1 . this core is sized to receive a slide drawer 222 telescopically , the same being sized for smooth passage in and out of the core . referring more particularly to the outer walls of the organizer chest , it is seen that the end walls 214 and 216 are spanned by opposing side walls 232 and 234 , see figures 10 and 12 , which are generally u - shaped or composed of elements forming the u - shaped side walls shown . these side walls , 232 and 234 , each have a central longitudinally extending opening , each opening being bounded by a pair of slide tracks 236 and 238 and 240 and 242 . slidably received in each of the pair of slide tracks or grooves there is a slide panel , see 244 and 246 . preferably , each has a knob such as 248 to facilitate sliding movement of it . beneath the slide panels there is a row of compartments such as that designated by the numerals 250 and 252 in fig1 . these rows of compartments each have a side defined by a septum such as 260 and 262 in the case of the row 250 which together with the central septum 218 defines the row . the row in turn is separated into compartments by spacer elements such as 263 . it is thus seen that there is a central row of compartments 252 , seen in fig1 , which is accessible when the slide panel 246 is slidably moved to expose them . similarly , when the slide panel 244 is moved , the row of compartments beneath it is exposed . in the preferred embodiment , the top wall 272 , see fig1 , is composed of elements forming what may generally be described as a w - shaped member . this is also true of the bottom . as seen in fig1 , two pairs of slide tracks 280 , 282 , and 284 and 286 are provided in the top wall 272 as well as in the bottom wall , see 280 &# 39 ;, 282 &# 39 ;, 284 &# 39 ; and 286 &# 39 ;. a pair of slide panels is received in each of the four pairs of slide tracks , two in the top wall and two in the bottom wall as designated by the numerals 301 , 303 , 304 and 305 . when any one of these side panels are slidably moved , a row of compartments is exposed beneath it , see fig1 . in use , it is seen that by slidably moving any of the slide panels , the row of compartments beneath it is exposed . as shown in fig1 , the drawer 222 is adapted to be slidably moved into or out of telescopic positionment within the chest organizer , see fig1 . preferably a handle 322 is provided to pull the drawer from the organizer chest . the drawer includes end walls 371 and 373 , side walls 275 , 277 , a longitudinally extending septum 279 , and at the top and bottom edges of the side walls 275 and 277 grooves as at 291 and 293 accommodate slide panels 295 and 297 which may be slidably moved to expose a row of compartments contained in the slide drawer . the compartments may be of different sizes as determined by spacer elements such as 299 . preferably , the box is provided with feet 361 so that it may be stored in an upright position if desired . preferably , it also includes a handle 363 for carrying the box with the slide drawer in it . in use at a work site if desired , the drawer may be removed and utilized to do the required work . on the other hand , the organizer chest may be used separately for a similar purpose . the two embodiments provide a highly useful organizer chest for use by a workman at job sites as is apparent from the foregoing description . in the first preferred embodiment the chest is about 18 &# 34 ; in length and about 4 &# 34 ; thick and 8 &# 34 ; across while in the second preferred embodiment the chest is about 18 &# 34 ; to 20 &# 34 ; in length and about 8 &# 34 ; to 10 &# 34 ; thick and across . while the instant invention has been shown and described in what is considered to be practical and preferred embodiments , it is recognized that departures may be made thereform within the spirit and scope of this invention which is , therefore , not to be limited except as set forth in the claims hereinafter and in accordance with he doctrine of equivalents .	1
it has now surprisingly been found that active - substance combinations of certain polymers ( a ), special alkyl polyglycosides ( b ) and fatty compounds or waxes ( c ) can make a considerable contribution towards solving this problem . the hair treated with such combinations shows very good wet combability while its dry combability is in a very favorable range for style retention without electrostatic charging and hence “ flying ” of the hair being observed to any significant extent . accordingly , the present invention relates to the use of a water - based preparation which is characterized by a content of a ) polymers ( a ) selected from the group of cationic , amphoteric , zwitterionic and nonionic polymers , r is an alkyl radical containing 6 to 22 carbon atoms , or adducts thereof with 1 to 10 molecules of ethylene oxide and / or propylene oxide and for the washing and care of keratin fibers , more particularly human hair . all three classes of active substance are well - known constituents of hair treatment preparations . combinations of two of these three classes of active substance are also known . thus , a shampoo containing a glucoside alkyl ether ( triton cg 110 ) and polyethoxylated lauryl alcohol in addition to a cationic polymer ( gafquat 755 ) is known from an example of de - os 32 16 687 . combinations of cationic polymers and alkyl saccharides are also known from ep - a1 - 337 354 . finally , combinations of alkyl glycosides , cationic or zwitterionic polymers and fatty alcohols or mono - and triglycerides in permanent wave formulations are known from examples of hitherto unpublished german applications p 42 32 512 . 9 , p 42 32 506 . 4 , p 42 34 413 . 1 and p 42 34 405 . 0 . corresponding combinations for shampoos and tinting shampoos are known from examples of p 42 32 506 . 4 . however , there are no indications in this prior art of the advantageous effects obtained by using the three - component combination of active substances according to the invention in preparations for the washing and care of keratin fibers , more particularly hair . in the context of the invention , “ hair - care preparations ” are only understood to be preparations which help to ( re ) establish natural properties of hair , such as good combability , style retention , body , etc . this expression specifically does not include permanent wave preparations , hair dyes , tinting shampoos and hair setting preparations which alter the appearance of the hair for decorative purposes . the preparations used in accordance with the invention preferably contain 0 . 1 to 3 % by weight of polymers ( a ), 0 . 01 to 10 % by weight of alkyl polyglycosides ( b ) and 0 . 5 to 20 % by weight of fatty compounds or waxes ( c ), based on the preparation as a whole . the first component of the active - substance combination according to the invention is selected from the group of cationic , amphoteric , zwitterionic and nonionic polymers . the cationic polymers suitable for use in accordance with the invention contain cationic groups within the polymer skeleton . these groups may be part of the polymer chain , although they may also be positioned inside chains which are attached to a main chain by intermediate members . typical cationic groups contain quaternary nitrogen or phosphorus atoms . groups containing quaternary nitrogen atoms are preferred . the quaternary nitrogen atoms may carry four different substituents or partly the same substituents and may also be part of a ring system . preferred cationic groups are ammonium and imidazolinium groups . if the ionic groups are situated in the side chains , the polymers are synthesized from compounds which , in addition to at least one cationic group , contain at least one polymerizable group and are free from anionic groups . the polymerizable group is preferably a vinyl group . however , cationic polymers in which the main polymer chain is made up , for example , of glycosides or is protein - like in character may also be used . cationic copolymers containing at least one nonionic monomer in addition to the cationic monomers are also preferred for the purposes of the invention . suitable nonionic monomers are , for example , vinyl pyrrolidone , vinyl , acetate , acrylamide , methacrylamide , methyl acrylate , ethyl acrylate , methyl methacrylate and ethyl methacrylate . vinyl pyrrolidone is a particularly preferred nonionic monomer . several cationic polymers suitable for hair - care purposes are known to the expert and are available as commercial products . quaternized cellulose derivatives of the type commercially available as celquat ® and polymer jr ®. the compounds celquat h 100 , celquat l 200 and polymer jr ® 400 are preferred quaternized cellulose derivatives . quaternized guar derivatives of the type commercially available as cosmedia guar ® and jaguar ®. preferred guar derivatives are , for example , cosmedia guar ® c - 261 and jaguars c 13 - s . copolymers of vinyl pyrrolidone with quaternized derivatives of dialkyl aminoacrylate and methacrylate , such as for example vinyl pyrrolidone / dimethyl aminomethacrylate copolymers quaternized with diethyl sulfate . compounds such as these are commercially available as gafquat ® 734 and gafquat ® 755 . copolymers of vinyl pyrrolidone with vinyl imidazolinium methochloride of the type commercially available as luviquat ®. polymeric dimethyl diallyl ammonium salts and copolymers thereof with esters and amides of acrylic acid and methacrylic acid . the polymers commercially available as merquat ® 100 ( poly ( dimethyl diallyl ammonium chloride )) and merquat ® 550 ( dimethyl diallyl ammonium chloride / acrylamide copolymer ) are examples of such cationic polymers . cationically derivatized protein hydrolyzates obtainable , for example , by reaction of alkali -, acid - or enzyme - hydrolyzed proteins with glycidyl trialkyl ammonium salts or 3 - halo - 2 - hydroxypropyl trialkyl ammonium salts . the proteins , which may serve as starting materials for the protein hydrolyzates , may be of both animal and vegetable origin . typical starting materials are , for example , keratin , collagen , elastin , soya protein , milk protein , wheat protein , silk protein and almond protein . the hydrolysis results in the formation of mixtures with molecular weights of around 100 to around 50 , 000 dalton . typical average molecular weights are in the range from about 500 to about 5 , 000 dalton . further particulars of cationic derivatization can be found inter alia in japanese patent application 77 / 73485 ( chemical abstracts , abstract 90 : 174508v ). the cationically derivatized protein hydrolyzates advantageously contain one or two long alkyl chains containing 8 to 22 carbon atoms and , accordingly , two or one short alkyl chain containing 1 to 4 carbon atoms . compounds containing one long alkyl chain are preferred . in which r stands for the side chains of the amino acids of the protein , r 1 and r 2 independently of one another are alkyl chains containing 1 to 4 carbon atoms and r 3 is an alkyl chain containing 8 to 22 carbon atoms . a commercially available product is lamequat ® l ( a product of chemische fabrik grünau ). it has the following structure : in which r stands for the side chains of the amino acids of collagen . a ctfa - analogous name is lauryl - dimonium hydroxypropylamino hydrolyzed collagene . polymeric condensation resins of polyols and polyamines such as , for example , polyglycol / polyamine condensation resins of the type known by the ctfa name of peg - 15 cocopolyamine . the product polyquart ® h 81 ( henkel ), for example , is commercially available . in the context of the present invention , “ amphoteric polymers ” are understood to be polymers which contain both free amino groups and free — cooh — or — so 3 h - groups in the molecule and which are capable of forming inner salts . “ zwitterionic polymers ” are understood to be polymers which contain quaternary ammonium groups and — coo − — or — so 3 − - groups in the molecule . examples of amphoteric polymers suitable for use in accordance with the invention are the acrylic resins commercially available as amphomer ® and amphomer ® lv - 71 , copolymers of tert .- butyl aminoethyl methacrylate , n -( 1 , 1 , 3 , 3 - tetramethylbutyl )- acrylamide and two or more monomers from the group comprising acrylic acid , methacrylic and simple esters thereof . other amphoteric or zwitterionic polymers suitable for use in accordance with the invention are the compounds mentioned in gb - a - 2 , 104 , 091 , ep - a - 47 714 , ep - a - 217 274 , ep - a - 283 817 and de - a - 28 17 369 . particularly preferred zwitterionic polymers are those which are essentially made up of ( α ) monomers containing quaternary ammonium groups corresponding to general formula ( i ): r 1 — ch ═ cr 2 — co — x —( c n h 2n )— n (+) r 3 r 4 r 5 a (−) ( ii ) in which r 1 and r 2 independently of one another represent hydrogen or a methyl group and r 3 , r 4 and r 5 independently of one another represent alkyl groups containing 1 to 4 carbon atoms , x is an nh group or an oxygen atom , n is an integer of 2 to 5 and a (−) is the anion of an organic or inorganic acid and in which r 6 and r 7 independently of one another represent hydrogen or methyl groups . these compounds may be used in accordance with the invention both directly and in the salt form obtained by neutralization of the polymers , for example with an alkali metal hydroxide . particulars of the production of these polymers can be found in de - a - 39 29 973 . polymers based on monomers of the ( α ) type , in which r 3 , r 4 and r 5 are methyl groups , x is an nh group and a (−) is a halide , methoxysulfate or ethoxysulfate ion , are most particularly preferred . acrylamidopropyl trimethyl ammonium chloride and methacrylamidopropyl trimethyl ammonium chloride are particularly preferred monomers ( α ). acrylic acid or an alkali metal salt of acrylic acid , more particularly the sodium salt , is preferably used as the monomer ( β ) for the polymers mentioned . zwitterionic polymers in which the number of monomers of the ( α ) type is greater than the number of monomers of the ( β ) type are also preferred . ratios of ( α ) monomers to ( β ) monomers of greater than 1 . 5 are particularly preferred . polyvinyl pyrrolidones , for example the products commercially available as luviskol ® k 30 and luviskol ® k 90 ( basf ). vinyl pyrrolidone / vinyl acetate copolymers of the type marketed , for example , as luviskol ® ( basf ). luviskol ® va 64 , luviskol ® va 73 and luviskol ® va 37 are preferred nonionic polymers ; luviskol ® va 37 is particularly preferred . vinyl pyrrolidone / dimethylaminoethyl methacrylate / vinyl caprolactam terpolymers of the type commercially available , for example , as copolymer vc - 713 ( gaf ). among the polymers ( a ), amphoteric and zwitterionic polymers are preferred . zwitterionic polymers made up of at least one cationic monomer and at least one anionic monomer have proved to be most particularly suitable for the purposes of the invention . the second component of the active - substance combination according to the invention consists of alkyl polyglycosides corresponding to formula ( i ). the compounds corresponding to formula ( i ) are characterized by the following parameters . the alkyl radical r contains 6 to 22 carbon atoms and may be both linear and branched . preferred alkyl radicals are primary linear and 2 - methyl - branched aliphatic radicals . alkyl radicals such as these are , for example , 1 - octyl , 1 - decyl , 1 - lauryl , 1 - myristyl , 1 - cetyl and 1 - stearyl . 1 - octyl , 1 - decyl , 1 - lauryl and 1 - myristyl are particularly preferred . where so - called “ oxoalcohols ” are used as starting materials , compounds with an odd number of carbon atoms in the alkyl chain predominate . the alkyl glycosides suitable for use in accordance with the invention may contain only one particular alkyl radical r . however , these compounds are normally prepared from natural fats and oils or mineral oils . in this case , mixtures corresponding to the starting compounds or to the particular working - up of these compounds are present as the alkyl radicals r . any mono - or oligosaccharides may be used as the sugar unit z . sugars containing 5 or 6 carbon atoms and the corresponding oligosaccharides are normally used . sugars such as these are , for example , glucose , fructose , galactose , arabinose , ribose , xylose , lyxose , allose , altrose , mannose , gulose , idose , talose and sucrose . preferred sugar units are glucose , fructose , galactose , arabinose and sucrose ; glucose is particularly preferred . the alkyl polyglycosides suitable for use in accordance with the invention contain on average 1 . 1 to 5 sugar units . alkyl glycosides with values for x of 1 . 3 to 2 are particularly preferred . alkyl glycosides in which x = 1 . 4 to 1 . 6 are most particularly preferred . the alkoxylated homologs of the alkyl polyglycosides mentioned may also be used in accordance with the invention . these homologs may contain on average up to 10 ethylene oxide and / or propylene oxide units per alkyl glycoside unit . these compounds also are not normally individual compounds , but have a corresponding homolog distribution according to the ethoxylation process used . alkoxylated compounds of the type in question may be obtained , for example , by using ethoxylated fatty alcohols for the synthesis of the alkyl polyglycosides . it has surprisingly been found that even comparatively small quantities of component ( b ) are sufficient to obtain the effects according to the invention . accordingly , it may be preferable to use component ( b ) in quantities of only 0 . 1 to 0 . 9 % by weight , based on the preparation as a whole . the third component of the active - substance combination according to the invention are fatty compounds and waxes . preferred fatty compounds are fatty alcohols . saturated and unsaturated , linear and branched fatty alcohols containing 8 to 24 carbon atoms are particularly preferred . preferred fatty alcohols include decyl alcohol , lauryl alcohol , myristyl alcohol , cetyl alcohol , stearyl alcohol , oleyl alcohol , isostearyl alcohol and hydroxystearyl alcohol . other preferred fatty compounds are mono -, di - and triglycerides , i . e . the mono -, di - and triesters of glycerol with fatty acids , such as for example lauric acid , myristic acid , palmitic acid , stearic acid , isostearic acid , oleic acid , linoleic acid , linolenic acid , erucic acid , hydroxystearic acid and ricinoleic acid . the diesters and triesters may be both esters containing only one type of fatty acid and esters containing various fatty acids . particularly preferred glycerides are glycerol monostearate and distearate , glycerol monooleate and glycerol monoisostearate and diisostearate . spermaceti , beeswax , montan wax and paraffins are waxes which may be used in accordance with the invention as component ( c ). in addition to the active - substance combination according to the invention , the preparations suitable for use in accordance with the invention may contain any of the constituents typically encountered in such preparations . if the preparations according to the invention are hair - washing preparations , they normally contain surface - active compounds . depending on the formulation , the preparations may contain anionic , zwitterionic , ampholytic , cationic or nonionic surfactants . anionic surfactants suitable for the hair - treatment preparations according to the invention are any of the anionic surfactants which are suitable for use on the human body . they are characterized by a water - solubilizing anionic group , for example a carboxylate , sulfate , sulfonate or phosphate group , and a lipophilic alkyl group containing approximately 10 to 22 carbon atoms . glycol or polyglycol ether groups , ester , ether and amide groups and also hydroxyl groups may also be present in the molecule . the following are examples of suitable anionic surfactants in the form of the sodium , potassium and ammonium salts and also the mono -, di - and trialkanolammonium salts containing 2 or 3 carbon atoms in the alkanol group : ether carboxylic acids corresponding to the formula r — o —( ch 2 — ch 2 o ) x — ch 2 — cooh , in which r is a linear alkyl group containing 10 to 22 carbon atoms and x = 0 or 1 to 10 , acyl sarcosides containing 10 to 18 carbon atoms in the acyl group , acyl taurides containing 10 to 18 carbon atoms in the acyl group , acyl isethionates containing 10 to 18 carbon atoms in the acyl group , sulfosuccinic acid mono - and dialkyl esters containing 8 to 18 carbon atoms in the alkyl group and sulfosuccinic acid monoalkyl polyoxyethyl esters containing 8 to 18 carbon atoms in the alkyl group and 1 to 6 oxyethyl groups , alpha - sulfofatty acid methyl esters of fatty acids containing 12 to 18 carbon atoms , alkyl sulfates and alkyl polyglycol ether sulfates corresponding to the formula r — o ( ch 2 — ch 2 o ) x — oso 3 h , in which r is a preferably linear alkyl group containing 10 to 18 carbon atoms and x = 0 or 1 to 12 , sulfated hydroxyalkyl polyethylene and / or hydroxyalkylene propylene glycol ethers according to de - a - 37 23 354 , sulfonates of unsaturated fatty acids containing 12 to 24 carbon atoms and 1 to 6 double bonds according to de - a - 39 26 344 , esters of tartaric acid and citric acid with alcohols which are adducts of approximately 2 to 15 molecules of ethylene oxide and / or propylene oxide with fatty alcohols containing 8 to 22 carbon atoms . preferred anionic surfactants are alkyl sulfates , alkyl polyglycol ether sulfates and ether carboxylic acids containing 10 to 18 carbon atoms in the alkyl group and up to 12 glycol ether groups in the molecule and also sulfosuccinic acid mono - and dialkyl esters containing 8 to 18 carbon atoms in the alkyl group and sulfosuccinic acid monoalkyl polyoxyethyl esters containing 8 to 18 carbon atoms in the alkyl group and 1 to 6 oxyethyl groups . zwitterionic surfactants are surface - active compounds which contain at least one quaternary ammonium group and at least one — coo (−) or — so 3 (−) group in the molecule . particularly suitable zwitterionic surfactants are the so - called betaines , such as the n - alkyl - n , n - dimethyl ammonium glycinates , for example cocoalkyl dimethyl ammonium glycinate , n - acylaminopropyl - n , n - dimethyl ammonium glycinates , for example cocoacyl aminopropyl dimethyl ammonium glycinate , and 2 - alkyl - 3 - carboxymethyl - 3 - hydroxyethyl imidazolines containing 8 to 18 carbon atoms in the alkyl or acyl group and cocoacyl aminoethyl hydroxyethyl carboxymethyl glycinate . a preferred zwitterionic surfactant is the fatty acid amide derivative known by the ctfa name of cocamidopropyl betaine . ampholytic surfactants are surface - active compounds which , in addition to a c 8 - 18 alkyl or acyl group in the molecule , contain at least one free amino group and at least one — cooh or — so 3 h group and which are capable of forming inner salts . examples of suitable ampholytic surfactants are n - alkyl glycines , n - alkyl propionic acids , n - alkyl aminobutyric acids , n - alkyl iminodipropionic acids , n - hydroxyethyl - n - alkyl amidopropyl glycines , n - alkyl taurines , n - alkyl sarcosines , 2 - alkyl aminopropionic acids and alkyl aminoacetic acids all containing approximately 8 to 18 carbon atoms in the alkyl group . particularly preferred ampholytic surfactants are n - cocoalkyl aminopropionate , cocoacyl aminoethyl aminopropionate and c 12 - 18 acyl sarcosine . suitable cationic surfactants for the hair treatment preparations according to the invention are , in particular , quaternary ammonium compounds , such as alkyl trimethyl ammonium chlorides , dialkyl dimethyl ammonium chlorides and trialkyl methyl ammonium chlorides , for example cetyl trimethyl ammonium chloride , stearyl trimethyl ammonium chloride , distearyl dimethyl ammonium chloride , lauryl dimethyl ammonium chloride , lauryl dimethyl benzyl ammonium chloride and tricetyl methyl ammonium chloride . other suitable cationic surfactants are so - called esterquats ( for example stepantex ® vs 90 , dehyquart ® au 36 and au 56 ) and amidoamines ( for example tegoamid ® s 18 ). nonionic surfactants contain , for example , a polyol group , a polyalkylene glycol ether group or a combination of polyol and polyglycol ether groups as the hydrophilic group . examples of compounds such as these are adducts of 2 to 30 moles of ethylene oxide and / or 0 to 5 moles of propylene oxide with linear fatty alcohols containing 8 to 22 carbon atoms , with fatty acids containing 12 to 22 carbon atoms and with alkylphenols containing 8 to 15 carbon atoms in the alkyl group , c 12 - 22 fatty acid monoesters and diesters of adducts of 1 to 30 moles of ethylene oxide with glycerol , glycerol mono - and diesters and sorbitan mono - and diesters of saturated and unsaturated c 8 - 22 fatty acids and ethylene oxide adducts thereof and adducts of 5 to 60 moles of ethylene oxide with castor oil and hydrogenated castor oil . the compounds containing alkyl groups used as surfactants may be individual substances . however , it is generally preferred to produce the compounds in question from native vegetable or animal raw materials so that mixtures of compounds differing in their alkyl chain lengths according to the particular raw material used are obtained . the surfactants which are adducts of ethylene and / or propylene oxide with fatty alcohols or derivatives of such adducts may be both products having a “ normal - range ” homolog distribution and also products having a “ narrow - range ” homolog distribution . “ normal - range ” products are mixtures of homologs which are obtained in the reaction of fatty alcohol and alkylene oxide using alkali metals , alkali metal hydroxides or alkali metal alcoholates as catalysts . by contrast , narrow - range products are obtained when , for example , hydrotalcites , alkaline earth metal salts of ether carboxylic acids , alkaline earth metal oxides , hydroxides or alcoholates are used as catalysts . it may be preferable to use narrow - range products , particularly where they are ethoxylated fatty alcohols which also act as thickeners . the preparations according to the invention preferably contain the surface - active compounds a in quantities of 0 . 5 to 20 % by weight , based on the particular preparation . the active - substance combinations according to the invention are used with particular preference in hair aftertreatment preparations , i . e . preparations which are used after washing of the hair or any other treatment of the hair , such as permanent waving or dyeing . with preparations such as these , it may be preferable to formulate them without ionic , more particularly cationic and anionic , surfactants . other typical constituents of the preparations used in accordance with the invention may be : thickeners , such as agar agar , guar gum , alginates and xanthan gum or esters of ethoxylated polyols and fatty acids , such as for example polyglyceryl ( 2 )- polyoxyethylene ( 4 ) stearate , protein hydrolyzates , more particularly elastin , collagen , keratin , milk protein , soya protein , almond and wheat protein hydrolyzates and condensation products thereof with fatty acids , solubilizers , such as ethanol , isopropanol , ethylene glycol , propylene glycol , glycerol and diethylene glycol and ethoxylated fatty alcohols , active substances , such as panthenol , allantoin , pyrrolidone carboxylic acids , plant extracts and vitamins , consistency regulators , such as sugar esters , polyol esters or polyol alkyl ethers , superfatting agents , such as polyethoxylated lanolin derivatives , lecithin derivatives and fatty acid alkanolamides , swelling and penetration agents , such as glycerol , propylene glycol monoethyl ether , carbonates , hydrogen carbonates , guanidines , ureas and primary , secondary and tertiary phosphates , propellents , such as propane / butane mixtures , n 2 o , dimethyl ether and air and the preparations suitable for use in accordance with the invention can be formulated as lotions , emulsions , microemulsions , solutions , creams or gels . they are preferably formulated as lotions , emulsions or microemulsions with a water content of 50 to 90 % by weight , based on the preparation as a whole . narrow - range ethoxylated fatty alcohols and esters of ethoxylated polyols and fatty acids and , optionally even metal soaps are preferably used for establishing the required viscosity of the formulation . in another preferred embodiment , the preparations may be formulated as foam aerosols which are packed in aerosol containers with a foam valve together with a liquefied gas , such as for example propane / butane mixtures , nitrogen , co 2 , air , n 2 o , dimethyl ether , fluorocarbon and chlorinated hydrocarbon propellents or mixtures thereof . the combability tests were carried out by the method according to j . soc . cosm . chem . 1973 [ 24 ] 782 . combing work was studied on brown hair ( alkinco # 6634 , tress length 12 cm , tress weight 1 g ). the hair used was lightly predamaged (“ medium - bleached ”) hair which the average consumer would be expected to have . the hairs are treated for 30 minutes with a 6 % h 2 o 2 solution which was adjusted with ammonia to a ph value of 9 . 4 . after the zero measurement , the tresses were soaked with 1 g of the composition to be tested per g of hair . after a contact time of 5 minutes , the tresses were rinsed out for 1 minute in running water ( 1 l / min ., 38 ° c .). to determine wet combing work , the tresses were then remeasured . to determine dry combing work , the tresses were first dried for 12 hours at 30 ° c ./ 20 % relative air humidity and then measured . dry combing work was measured in the presence of electrostatic charging which was determined at the same time as the dry combining work . electrostatic charging was measured via the charge tap of a double faraday cage after 10 combings . the composition of the mixtures tested and the results of the measurements are set out in table 1 . the results represent the average value of 20 measurements with 20 different tresses and are based on the value of the zero measurement . they had a statistical certainty of 99 . 0 or 99 . 99 %.	0
the present invention is an improved needle which would be a part of and typically used with a hypodermic needle . as seen in fig1 a , hypodermic needle 10 has a barrel 11 which typically would be of glass or other clear material in order to see the contents within barrel 11 . the contents would typically be a fluid 12 . a plunger 13 slides within barrel 11 which has at the distal end a plunger head 14 which as known in the art keeps the fluid 12 at the distal side of head 14 within barrel 11 . a thumb rest 15 is at the proximal end of plunger 13 and a finger flange 16 is located at the proximal end of barrel 11 . a needle 20 with a beveled tip 24 is attached to the distal end of barrel 13 at needle hub 17 . needle 20 is a hollow tube having an inner wall 23 within needle 20 . typically needle 20 is made of steel and fluidly communicates with barrel 11 such that when the plunger 13 is urged in the direction of needle 20 any fluid 12 within barrel 11 will be forced out the distal end of barrel 11 , through hub 17 and through hollow needle 20 and disbursed out the distal end 24 of needle 20 at an orifice or opening 22 . as seen in fig1 a , a typical hypodermic needle 10 as known in the art , has a needle 20 . the needle 20 is hollow having a needle barrel 21 , with a single opening 22 at the distal end 24 of needle 20 . the needle 20 of the present invention as seen in fig2 a , provides for multiple openings or holes 25 in the needle barrel 21 of needle 20 . thus the fluid 12 within hypodermic needle 10 is discharged through multiple openings 25 to evenly distribute the fluid 12 in the desired deposit area . as seen in fig2 a , the openings 25 are arranged in a single row and are spaced apart along the length of needle 20 and there is the distal opening 22 at the distal end 24 . fig2 b shows a sectional view of needle 20 taken along lines d - d from fig2 a and further shows the openings 25 in the needle barrel 21 portion of needle 20 . fig2 c is a cross sectional view of an opening 25 taken along lines e - e from fig2 a . in an alternate embodiment shown in fig3 a , needle 20 has three rows of openings 25 where each row is spaced 120 degrees apart from the other adjacent row , and spaced equally around the needle barrel 21 of needle 20 . as in the prior embodiment , there is a terminal end 24 and opening 22 . the needles 20 in fig2 a and 3a may or may not have an opening 22 at terminal end 24 , since there are other openings 25 in the needle 20 . further , the openings 25 may have different diameters with the openings 25 closest to hub 17 having smaller diameters than those closer to the distal end 24 in view of the internal pressures to cause the fluid 12 to flow evenly out of the several openings at the same time . in use , it would be desired to inject a filler fluid 12 into a location or area of a wrinkle line 40 in the facial skin of a patient . as seen in fig4 and 1c , plan views of an area of a wrinkle line 40 extends from a first end 42 to a second end 43 , with a portion of skin 41 that includes the wrinkle 40 . though the fig4 and 6 show wrinkle line 40 to be relatively straight , the wrinkle line 40 could also be curved or have a generally jagged length . cosmetically it is desirable to fill the area below the wrinkle line 40 with a filler to at least have it appear that the wrinkle line 40 is no longer visible . the filler is a viscous fluid 12 and would be injected under the skin generally by use of hypodermic needle 10 . typically , as known in the art , it is desirable to evenly distribute the viscous fluid 12 along wrinkle line 40 . in the prior art , a hypodermic needle 10 would be filled with a viscous fluid , and the needle 20 would be inserted into an injection opening site 30 at a first end 42 of the wrinkle line 40 . wrinkle line 40 may extend from a point 42 to point 43 , a distance marked as a . the needle 20 would be inserted into point 42 at one end of the wrinkle line 40 under the skin 41 and the needle would extend along the wrinkle line 40 to the end of the wrinkle line 43 . then , the person applying the filler would push the plunger 13 to force the viscous fluid 12 out of the single opening 22 of needle 20 and simultaneously begin withdrawing the needle 20 from its injection point 30 , so that the fluid 12 is evenly disbursed and distributed along the wrinkle line 40 below the skin 41 in an even manner . in other words , the desired result would be to have the needle 20 withdrawn from the opening 30 at the injection site , such that the filler fluid 12 has been evenly distributed along the wrinkle line 40 . however , this is extremely difficult in practice , since the operation of the plunger 13 by pushing the thumb rest 15 is very tiring and difficult since the viscous fluid 12 is so difficult to push out of the opening 22 of needle 20 . the advantage of the present invention , by having multiple openings 25 in needle 20 , the needle 20 is inserted at the injection site 30 extending the entire length of the wrinkle line 40 or a desired portion of the wrinkle line 40 . the needle 20 with multiple openings 25 can effectively be used to discharge the entire desired amount of fluid 12 easily through the multiple openings 25 without having to move the needle 20 during the discharge of the fluid 12 . because the openings 25 are evenly spaced , the fluid 12 is disbursed in the desired locations evenly through the multiple openings . fig5 shows in cross section the needle 20 extending below the skin from the injection site 30 a length a from the first opening 42 to the second opening 43 . as seen in fig6 with the needle in the position shown in fig5 , the fluid 12 can be disbursed from the needle without withdrawing the needle and the fluid 12 will be disbursed evenly about the wrinkle line 40 as shown in fig6 . in alternate embodiments , it is possible the wrinkle line 40 will be sufficiently longer than needle 20 and therefore , the above steps may be repeated . in this manner , the wrinkle line 40 may be twice or three times the length of the needle 20 . in this situation , there would be additional injection locations along the wrinkle line 40 . in addition , it is known that the injection of fluids through a needle into the body often causes pain . it is believed the pain is caused likely not only by the insertion of the needle tip 24 into and puncturing the skin , but also as a result of the infusion of the fluid into the body e . g . the muscle where the tip of the needle 22 is located and where the fluid 12 leaves the needle 20 and enters the body . it is now believed that the improved needle tip 22 of the present invention provides a better method of infusing fluids through a needle and into the body by dispersing the fluid not through a single opening of the needle but through several openings of the needle as described herein . the dispersion through a plurality of openings is believed to likely reduce the pain that occurs to the patient when the fluids are injected through a single opening needle . as shown in fig7 a is a needle 20 ′ with alternate embodiments , including a plug 26 ′ or other sealing means to close the terminal end 24 ′ of needle 20 ′. in addition openings 25 ′ are shown in different sizes and shapes to facilitate tuning of the needle 20 ′, so that fluid 12 ′ will disperse from the multiple openings 25 ′ in an even and equal manner . alternatively , the openings 25 ′ may be such that fluid 12 ′ will disperse in an unequal manner depending on the requirements of the plastic surgery . fig7 b is a plan view of the needle 20 ′ showing the plurality of openings 25 ′ with various geometrical configurations . these configurations include , but are not limited to , a circle or an ellipse with an increasing eccentricity . the greater the eccentricity the longer the semi - major axis is , thus producing an ellipse which is longer and thinner . fig7 c is a cross section of the needle 20 ′ in fig7 b taken at line j - j showing a cross section of the hole 25 ′ and barrel of the needle 20 ′. fig8 a is a plan view of still another embodiment of the needle 100 . needle 100 includes a plug 110 or other sealing means to close the terminal end 120 of needle 100 . along the barrel of the needle 100 are a plurality of square apertures 130 . in this particular embodiment the square apertures 130 are separated from each other by 0 . 25 of an inch . the square apertures of this embodiment further measure 0 . 004 of an inch square , each side of the square is 0 . 004 inch . a spotlight blowup 140 of one of the square apertures 130 is shown . the dimensions of the square apertures 130 may vary , and although not shown , one square aperture 130 may have a different side length making the square aperture 130 either larger or smaller . in the embodiment shown in fig8 a , there are four identical square apertures 130 . it can easily be seen that each of the square apertures 130 may be of a different size , or two having one size and the other two having a second size . also , although four square apertures 130 are shown , the number and size of each of them may vary due to specific application . fig9 a is a plan view of still another embodiment of the needle 200 . needle 200 includes a plug 210 or other sealing means to close the terminal end 220 of needle 200 . along the barrel of the needle 200 are a plurality of rectangular apertures 230 . in this particular embodiment the rectangular apertures 230 are separated from each other by 0 . 375 of an inch . the rectangular apertures of this embodiment further measure 0 . 004 of an inch on one side of the rectangle , and 0 . 030 of an inch on the other side of the rectangle . a spotlight blowup 240 of one of the rectangular apertures 230 is shown . the dimensions of the rectangular apertures 230 may vary , and although not shown , one rectangular aperture 230 may have a different side length on one side or the second side making the rectangular aperture 230 either larger or smaller . in the embodiment shown in fig9 a , there are three identical rectangular apertures 230 . it can easily be seen that each of the rectangular apertures 230 may be of a different size , or two having one size and the other one having a second size or visa versa . also , although three rectangular apertures 230 are shown , the number and size of each of them may vary due to specific application . the distance from one aperture to another in all embodiments may be in the range of 0 . 001 inch to 1 . 0 inch . the diameter of the circular apertures may be in the range of 0 . 001 to 0 . 5 inch . the semi - major axis of the elliptical aperture may be in the range of 0 . 001 to 0 . 5 inch . the semi - minor axis of the elliptical aperture may be in the range of 0 . 001 inch to 0 . 5 inch . the square aperture may have a side distance of 0 . 0001 to 0 . 5 inch . the rectangular aperture long side distance may be of 0 . 0001 inch to 0 . 5 inch . the rectangular aperture short side distance may be in the range of 0 . 0001 inch to 0 . 5 inch . in the case where other geometrical apertures are employed , the range of size would be equivalent to the range of the square aperture , which size would permit an equivalent amount of viscous material through . while the invention has been described in its preferred form or embodiment with some degree of particularity , it is understood that this description has been given only by way of example and that numerous changes in the details of construction , fabrication , and use , including the combination and arrangement of parts , may be made without departing from the spirit and scope of the invention .	0
fig1 shows a multi - processor computer system 100 that accesses a shared memory resource and is enhanced by the principles of the present invention . the system 100 includes a plurality of co - processor units 110 connected to each other by a common system bus 113 . each unit 110 includes a processor ( cpu ) 111 . at least one shared memory ( m ) store 112 is provided and each cpu 111 may have its own memory store 112 as shown in fig1 . further at least one input / output interface ( i / o ) 114 may be connected to at least one of the cpus 111 and each cpu 111 may have its own interface 114 as shown in fig1 . the multi - processor computer system 100 can include a homogeneous ( symmetric ) or heterogeneous set of processors such as , for example , alpha microprocessors , provided by compaq , inc ., of houston , tex . further processors 111 can be cisc or risc . the processors 111 can include hardware caches 109 to stored frequently accessed data and instructions . further , the computer system 100 includes a video system 122 , for displaying information to the user , as well as other data output means such as a printer 124 and disc drive 126 . drive 126 can include , but is not limited to , a floppy disc , a cd - rom drive , a hard disc , and other fixed or non - fixed storage media . the memories 112 can be dynamic random access memories ( dram ). the memories 112 store program 115 and data structures 116 . some of the addresses of the memories 112 can be designated as a single set of shared virtual addresses . some of the data structures can include shared data . shared data can be accessed by programs executing on any of the processors 111 using the virtual addresses . each processor 111 further comprises a register 117 , which holds the program queue of steps to be implemented by the processor . the register 117 holds the current program state . the program states include a program counter ( pc ), a stack pointer ( sp ), and additional general purpose registers ( gprs ). the gprs can be used as source / destinations for arithmetic operations , memory reads / writes and for program branches . the buses 113 connect the components of the computer unit using data , address , and control lines . the computer system 110 can be connected to other systems via a network connection 120 that uses network protocols for communicating messages among the workstations 110 , for example , asynchronous transfer mode ( atm ), or fddi protocols . during operation of the system 100 , instructions of the program 115 are executed by the processors 111 . the instructions can access the data structure 116 using load and store instructions . typically , the accessed data are first stored in the caches 109 and then in processor registers 117 while manipulated by the processors . it is desired that any of program 115 executing on any of the processors 111 can access any of shared data structures 116 stored in any of the memories 112 . instrumentation therefore , as it described herein , program 115 avoids instrumentation prior to execution . instrumentation is a process that locates access instructions ( loads and stores ) in the program 115 . once the access instructions have been located , additional instructions , such as , for example , a miss check code , can be inserted into the programs before the access instructions to ensure that the access is performed correctly . the miss check code is optimized to reduce the amount of overhead required to execute the additional instructions . program 115 actually does not utilize instrumentation , but rather , when a virtual access is done by program 115 , a translation lookaside buffer ( tlb ) is checked for a mapping . if no mapping is found , then program execution is sent to the tlb miss flows . these miss flows load the proper page table entry ( pte ) into the tlb and , if needed , perform memory synchronization . the present invention is directed toward a method and system of performing memory synchronization with the pte . as stated above , the program 115 can view some of the addresses of the distributed memories 112 as a shared memory . for a particular target address of the shared memory , an instruction may access a local copy of the data or a message must be sent to another processor requesting a copy of the data . with respect to any processor , the data stored in the shared memory can have any one of three possible states : invalid , shared , or exclusive . in addition , as described below , data states can be in transition , or “ pending .” if the state is invalid , the processor is not allowed to access the data . if the state is shared , the processor has a copy , and other processors may have a copy as well . if the state is exclusive , the processor has the only valid copy of the data , and no other processor can have valid copies of the data . the states of the data are maintained by coherency control messages communicated by the bus 113 which maintains coherency among the symmetric processors . data can be loaded from the shared memory into a local processor only if the data have a state of shared or exclusive . data can be stored only if the state is exclusive . communication is required if a processor attempts to load data that are in an invalid state , or if a processor attempts to store data that are in an invalid or shared stated . these illegal accesses are called misses . the addresses of the memories 112 can be allocated dynamically to store shared data . some of the addresses can be statically allocated to store private data only operated on by a local processor . overhead can be reduced by reserving some of the addresses for private data , since accesses to the private data by the local processor do not need to be checked for misses . as in a hardware - controlled shared memory system , addresses of the memories 112 are partitioned into allocable blocks . all data within a block are accessed as a coherent unit . as a feature of the system 100 , blocks can have variable sizes for different ranges of addresses . to simplify the optimized miss check code described below , the variable sized blocks are further partitioned into fixed size ranges of addresses called “ lines .” state information is maintained in a state table on a per line basis . the size of the line is predetermined at the time that a particular program 115 is instrumented , typically 32 , 64 or 128 bytes . a block can include an integer number of lines . during the operation of the system 100 , prior to executing a memory access instruction , the miss check code determines which line of a particular block includes the target address ( operand ) of the instruction . in addition , the miss check code determines if the target address is in shared memory . if the target address is not in shared memory , the miss check code can immediately complete , since private data can always be accesses by a local processor . the system constitutes the collection of processors 111 , i / o devices 114 , with an optional bridge to connect remote i / o devices , and shared memory resources 112 that are accessible by all processors 111 . direct memory access ( dma ) i / o devices or other components can read or write shared memory locations in the shared memory resources 112 . a shared memory resource is the primary storage place for one or more locations . a location is an unlined quad word , specified by its physical address . multiple virtual addresses can map to the same physical address . ordering considerations are based only on the physical address . a definition of location specifically includes locations and registers in memory map i / o devices , and bridges to remote i / o devices . each processor 111 , which also includes the i / o devices , can generate accesses to the shared memory resource locations . there are six types of accesses : 1 . instruction fed by processor i to location x , returning value a ; 2 . data read by processor i to location x , returning value a ; 3 . data write by processor i to location x , storing value a ; the first access type is also called an i - stream access or i - fetch . the next two are also called d - stream accesses . the first three types collectively are called read / write accesses . the last three types collectively are called barriers or memory barriers . instruction fetches are long word reads . data reads and data writes are either aligned long word or aligned quad word accesses . unless otherwise specified , each access to a given location of the same access size during execution within the system , each processor has a time order issue sequence of all the memory access presented by that processor ( to all memory locations ), and each location has a time ordered access sequence of all the accesses presented to that location ( from all processors ). memory barriers ( mb ) are calls made to order memory access on a particular cpu . there are no implied memory barriers within this system . if an implied barrier is needed for functionally correct access to shared data , it must be written as an explicit instruction . in other words , an explicit instruction for an mb , wmb or call — pal imb instructions are to be provided within the software implemented within this hardware system . within system 100 , one way to reliably communicate shared data is to write the shared data on one processor or dma i / o device , execute an mb , or the logical equivalent if it is a dma i / o device , then write a flag , or the equivalent of sending an interrupt , signaling the other processor that the shared data is ready . each receiving processor must read the new flag , which is equivalent to receiving the interrupt , execute an mb , then read or update the shared data . in the special case in which data is communicated through just one location in memory , memory barriers are not necessary . the first mb assures that the shared data is written before the flag is written . the second mb assures that the shared data is read or updated only after the flag is seen to change . in this case , an early read may see an old memory value , and an early update could have been reoverwritten . this implies that after a dma i / o device has written some data to memory , such as paging in a page from disc , the dma device must logically execute an mb before posting a completion interrupt , and the interrupt handler software must execute an mb before the data is guaranteed to be visible to the interrupted processor . other processors must also execute mbs before they are guaranteed to see the new data . in one special case , a write is done to a given physical page frame , then an mb is executed , next a previously - invalid page table entry ( pte ) is changed to be a valid mapping of the physical page frame that was just written . in this case , all processors that access virtual memory by using the newly valid pte must guarantee to deliver the newly - written data after the translation buffer ( tb ) miss , for both the i - stream and the d - stream accesses . in the above scenario , the translation buffer miss after page fault must be performed for each processor or i / o device within the system . in order to streamline the synchronization step required to resynchronize all the processors to the memory resources , a page table entry ( pte ) bit is used to indicate whether or not a tb - miss must incur the synchronization penalty . since synchronization really is only required when a page is being actively shared among two or more cpus in the multiprocessor system , and only the first tb - miss after a page fault needs to take the synchronization penalty , a bit to signify that synchronization must occur for that processor or to indicate that no synchronization is necessary for that process as the resynchronization had been preformed at a prior step , enables the present invention to eliminate unnecessary synchronization that have otherwise been required . further , the pte bit is set to indicate that when no synchronization for any page is required when that page is not being shared . the pte bit also is set on shared pages when it is known that all cpus already synchronized in a subsequent tb - misses deem not performed further synchronization . a data block illustrating the implementation of the pte bit is shown in fig2 . data block 200 includes various bits that are used for various levels of information . first bit 202 is a valid bit ( v ) bit that indicates the validity of the pfn field . bit 204 is a fault on execute ( fo e ) exception bit that , when set , provides a fault on execute exception on an attempt to execute any location in the page . bit 206 is a fault on read ( fo r ) exception bit and , when set , provides a fault on read exception on an attempt to read any location in the page . next , a fault on write ( fo w ) exception bit 208 provides that , when set , a fault on read exception occurs on an attempt to read any location in the page . bit 210 is a memory ordering ( mo ) which when set , causes the tlb miss flows to issue an mb instruction after fetching pte with the v bit set . lastly , bit 212 provides for a physical page frame number ( pfn ) that identifies the memory resource being upgraded and synchronized within the system . fig3 illustrates a flow chart depicting the method steps in accordance with the present invention for synchronizing the memory resources within the system . in conjunction with fig3 a processing queue table 400 is depicted in fig4 . queue table 400 illustrates n issue slots , one issue slot 402 for each coprocessor or i / o device provided in the system . in this example , a system instruction is provided within adjoining rows for each issue slot 402 for the first two co - processors , labeled cpu 1 and cpu 2 , respectively . in this particular system , cpu 1 is the first processor in sequence within this system , which is a symmetric multiprocessor ( smp ) system . the method starts in step 300 then proceeds to step 302 . in step 302 , the system begins executing each instruction located in the particular issue slots 402 . for example , an initialize page frame for the address virtual “ foo ” may be found in slot 402 for cpu 1 that is then executed . after the instructions continue to be read and executed , the system , in step 304 , may experience a translation look aside buffer ( tlb ) miss based on an mb by cpu 1 , in this case in issue slot 402 for cpu 2 . at this moment , in step 306 , a page table entry ( pte ) fetch occurs as the instruction in issue slot 402 for cpu 1 . this pte instruction traverses all instructions within the queue table 400 for each processor . next , in step 308 , for the processor that had the tlb miss ( cpu 2 ), it is determined if the valid bit was set for the pte in cpu 1 . if not , in step 309 , the cpu starts a page fault . the instructions issued for cpu 3 and cpu 4 are unaffected by cpu 2 resolving the reading of the desired information . if yes , the cpu proceeds to step 310 . neither cpu 3 nor cpu 4 is affected by the tlb miss operation of cpu 2 . also , cpu 1 is unaware that cpu 2 is fetching a pte validated by cpu 1 . moreover , cpu 4 , in this example , is accessing a private page so that no mb is needed . the private page is not available or shared with any of the other cpus . as such , the integrity of the private page is assured . in step 310 , the tb miss is identified to determine if the pte bit has been activated . if the pte bit has been activated , then , in step 312 , the system executes the mb instruction to stall the execution of all instructions until memory synchronization is performed for that page frame . if the pte bit is not present , then , in step 314 , the system disregards the mb request and accesses the data . once the memory resources have been synchronized across the system , the processor having the tb - miss instruction then accesses the data in step 316 . after access is granted , the system resumes executing the instructions in the issue slots like in step 302 . furthermore , once all cpus have synchronized memory , the mo bit my be cleared or disabled , thus eliminating the need to do a subsequent mb on any future tlb misses . this would follow step 312 of fig3 . otherwise , the prior solution has been to require an mb for each tlb misses even after a first mb has cleared the page fault in the first instance . this results in fewer cycles in the states of fig4 thus increasing system performance over previous methods of handling page faults in a smp system such as this one . thus , it has been shown to provide a memory ordering solution to prevent memory errors where data has been corrupted due to a read and then subsequent write . the use of the conditional memory ordering bit found in pte bit 210 allows memory synchronization to occur only in those situations absolutely necessary while avoiding those situations where memory synchronization has already been done or is not necessary , such in the case where the processor is accessing a memory resource that is not being shared . the mo pte bit acts as a flag to signal to the tb - miss flows that memory ordering is needed . the pte_mb bit is set only on ptes that are shared between threads or processes . the purpose of tb - miss mb is to synchronize with other processors , not with the current processor . the mb forces a coherency point between the fetching of the pte and the fetching of the data with the pte . without an mb , the pte can be read and used by the processor prior to any outstanding writes to the data pointed to by the pte . further , the pte - mb bit can be cleared in the pte whenever all processors can safely feed the data associated with the pte , thus rendering synchronization unnecessary . the usefulness of the pte_mb bit increases system performance by avoiding those situations where synchronization is not necessary , but was otherwise performed in the prior art . thus , unnecessary processing steps are eliminated , which leads to faster processing performance . the invention provides for communicating to the tlb miss flows whether memory ordering is needed . just like a pte valid bit is used to communicate to the tlb flows that a pte is valid , or a foe tells the code to fault if the instruction stream tries to execute code pointed to by a pte . a software implementation of the above described embodiment ( s ) may comprise a series of computer instructions either fixed on a tangible medium , such as a computer readable media , e . g . a diskette , cd - rom , rom , or fixed disk for use with any of the computer processors 110 of fig1 or transmittable to a computer system , via a modem or other interface device , such as a communications adapter connected to the network 120 over a medium . the medium can be either a tangible medium , including but not limited to optical or analog communications lines , or may be implemented with wireless techniques , including but not limited to microwave , infrared or other transmission techniques . the series of computer instructions embodies all or part of the functionality previously described herein with respect to the invention . those skilled in the art will appreciate that such computer instructions can be written in a number of programming languages for use with many computer architectures or operating systems . further , such instructions may be stored using any memory technology , present or future , including , but not limited to , semiconductor , magnetic , optical or other memory devices , or transmitted using any communications technology , present or future , including but not limited to optical , infrared , microwave , or other transmission technologies . it is contemplated that such a computer program product may be distributed as a removable media with accompanying printed or electronic documentation , e . g ., shrink wrapped software , preloaded with a computer system , e . g ., on system rom or fixed disk , or distributed from a server or electronic bulletin board over a network , e . g ., the internet or world wide web . although various exemplary embodiments of the invention have been disclosed , it will be apparent to those skilled in the art that various changes and modifications can be made which will achieve some of the advantages of the invention without departing from the spirit and scope of the invention . it will be obvious to those reasonably skilled in the art that other components performing the same functions may be suitably substituted . further , the methods of the invention may be achieved in either all software implementations , using the appropriate processor instructions , or in hybrid implementations which utilize a combination of hardware logic and software logic to achieve the same results . such modifications to the inventive concept are intended to be covered by the appended claims .	6
referring to fig1 , an exemplary environment 100 in which the present invention may operate shall be described with reference to an oil well 102 wherein oil is to be separated from an underground gas formation 110 . the well 102 includes an outer casing 104 and an inner tube 106 that extend from ground level to as much as 1000 feet or more below ground level . the casing 104 has perforations 108 to allow the fluid in the underground formation to enter the well bore . it is to be understood that water and gas can be combined with oil and the pump can be used for other liquids . the control apparatus described herein can also be used for water only . the bottom of the tube generally terminates below the underground formations . a progressing cavity pump ( pcp ) 112 is mounted at the lower end of the tube 106 and includes a helix type of pump member 114 mounted inside a pump housing . the pump member is attached to and driven by a pump rod string 116 which extends upwardly through the tube and is rotated by a drive motor 118 in a conventional well head assembly 120 above ground level . the tube 106 has a liquid outlet 122 and the casing 104 has a gas outlet 124 at the upper end above ground level 126 . these elements are shown schematically in fig1 . the construction and operation of the progressing cavity pump is conventional . an optional check valve 128 may be located either on the suction side , as shown , or the discharge side of the pump 112 to reduce back flow of fluid when the pump is off . the operation of the pump 112 is controlled by a pump control system and method including a stick - slip estimator and controller in accordance with the present invention . for purposes of illustration , the pump control system 130 is described with reference to an application in a pump system that includes a conventional progressing cavity pump . the progressing cavity pump includes an electric drive system 132 and motor 118 that rotates the rod string 116 that includes helix portion 114 of the pump 112 . the rod string 116 is suspended from the well head assembly 120 for rotating the helix 114 that is disposed near the bottom 134 of the well . the rod string 116 is driven by an electric motor 118 , the shaft of which can be coupled to the rod string through a gearbox 136 or similar speed reduction mechanism . the motor 118 can be a three - phase ac induction motor designed to be operated from line voltages in the range of 230 vac to 690 vac and developing 5 to 250 horsepower , depending upon the capacity and depth of the pump . the gearbox 136 converts motor torque and speed input to a suitable torque and speed output for driving the rod string 116 and helix 114 carried thereby . turning now to fig2 , there is shown a simplified representation of the pump control system 130 for the pump 112 in which the stick - slip estimator / control may be implemented . it is to be understood that the estimator and control may be implemented into other control systems or as a separate component . the pump control system 130 controls the operation of the pump 112 . the pump control system 130 includes transducers , such as motor current and motor voltage sensors , to sense dynamic variables associated with motor torque and velocity . the pump control system further includes a controller 140 , a block diagram of which is shown in fig2 . current sensors 142 of interface devices 148 are coupled to a sufficient number of the motor windings — two in the case of a three phase ac motor . voltage sensors 144 are connected across the motor winding inputs . the motor current and voltage signals produced by the sensors 142 and 144 are supplied to a processing unit 150 of the controller 140 through suitable input / output devices 146 . the controller 140 further includes a storage unit 152 including storage devices which store programs and data files used in calculating operating parameters and producing control signals for controlling the operation of the pump system . the storage unit 152 has memory that may be volatile ( such as ram ), non - volatile ( such as rom , flash memory , etc .) or some combination of the two . additionally , the storage unit 152 may also have additional features / functionality . for example , the storage unit 152 may also include additional storage ( removable and / or non - removable ) including , but not limited to , magnetic or optical disks or tapes . computer storage media includes volatile and nonvolatile , removable and non - removable media implemented in any method or technology for storage of information such as computer readable instructions , data structures , program modules or other data . the memory , the removable storage and the non - removable storage are all examples of computer storage media . computer storage media includes , but is not limited to , ram , rom , eeprom , flash memory or other memory technology , cd - rom , digital versatile disks ( dvd ) or other optical storage , magnetic cassettes , magnetic tape , magnetic disk storage or other magnetic storage devices , or any other medium which can be used to store the desired information and which can accessed by the controller 140 . although not required , the stick slip estimator / controller will be described in the general context of computer - executable instructions , such as program modules , being executed by the processing unit 150 . generally , program modules include routines , programs , objects , components , data structures , etc . that perform particular tasks or implement particular abstract data types . moreover , those skilled in the art will appreciate that the invention may be practiced in distributed computing environments where tasks are performed by remote processing devices that are linked through a communications network . in a distributed computing environment , program modules may be located in both local and remote memory storage devices . the self - sensing control arrangement described above provides nearly instantaneous estimates of motor velocity , crank angle , and torque , which can be used for both monitoring and real - time , closed - loop control of the pump , including the stick - slip behavior . voltages and currents are sensed to determine the instantaneous electric power drawn from the power source by the electric motor operating the pump and the crank angle of the motor 118 . as the rod 116 that drives the progressing cavity pump 112 is rotated , the motor 118 is loaded . by monitoring the motor current and voltage , the parameters for the stick - slip estimator / control can be calculated . more specifically , interface devices 148 contain the devices for interfacing the controller 140 with the outside world . sensors in blocks 142 and 144 can include hardware circuits which convert and calibrate the motor current and voltage signals into current and flux signals . after scaling and translation , the outputs of the voltage and current sensors can be digitized by analog to digital converters in block 148 . the processing unit 150 combines the scaled signals with motor equivalent circuit parameters stored in the storage unit 152 to produce a calculation of electrical torque , crank angle , and crank velocity . in one embodiment , values of parameters are derived using measured values of instantaneous motor currents and voltages , together with pump and system parameters , without requiring down hole sensors , flow sensors , etc . turning now to fig3 , which is a functional block diagram of the pump control system 130 , as previously described , the pump 112 is driven by a drive 132 , motor 118 gearbox 136 and rod 116 to transfer fluid within a system 200 . the pump 112 is coupled to the output of the drive motor 118 through a gearbox 136 ( e . g ., gear reducer ) and the output of the gear reducer is referred to as the crank . accordingly , the crank speed ωc is equal to ωm divided by ng , where ωm is the motor speed and ng is the gearbox ratio . the crank torque tc is equal to te multiplied by ng , where te is the electrical torque . the crank torque tc and crank velocity ωc are transmitted to the pump through the rod 116 . the operation of the motor 118 is controlled by the drive 132 and controller 140 which includes a system model 202 , motor vector controller 204 , other controllers 206 , and interface devices 208 . the output of the gearbox is referred to as a crank in the exemplary embodiment shown in fig1 and it drives a long rod 116 . motor vector controller 204 generates motor current commands imc and voltage commands vmc based upon signals from control modules 206 . control modules 206 receives estimates of system parameters from system model 202 and may have , for example , a fluid level feedforward control module that outputs a motor torque feedforward signal and a fluid level feedback control module that outputs a motor speed command . the motor speed command and the motor torque feedforward signal can then be combined to generate motor current commands imc and voltage commands vmc . interface devices in block 208 , which can be digital to analog converters , convert the current commands imc and voltage commands vmc into signals which can be understood by the drive 132 . these signals are shown as ic for motor current commands and vc for motor winding voltage commands . turning now to fig4 , the system model 202 uses a finite difference state estimator 300 to estimate the un - measurable states in the pump 112 . in the embodiment shown in fig4 , the un - measurable states are the pump angle and pump speed . in fig4 , { circumflex over ( b )}{ circumflex over ( 2 )} is an estimate of the motor damping , { circumflex over ( b )}{ circumflex over ( r )} is an estimate of the rod damping , { circumflex over ( n )} ĝ is an estimate of the gear reduction ratio , { circumflex over ( k )}{ circumflex over ( r )} is an estimate of the rod spring stiffness constant , ĵ { circumflex over ( 2 )} is an estimate of motor inertia and gearbox inertia ( as seen at the motor ), { circumflex over ( θ )} c is the crank angle , { circumflex over ( ω )} c is the crank speed , { circumflex over ( t )} e is the electrical torque , { circumflex over ( θ )} p is the estimated pump angle , and { circumflex over ( ω )} p is the estimated pump speed . these estimates can be based upon a user &# 39 ; s intuition based on past experience and manufacturer &# 39 ; s ratings of the components in the system . the estimated angle is derived from the calculation : θ ⁢ ⁢ p ^ ⁢ ( z ) = θ ⁢ ⁢ c ^ ⁢ ( z ) - ng ^ kr ^ ⁢ ( t ^ e ⁡ ( z ) - ( ⁢ b ⁢ ⁢ 2 ^ + br ^ ng ^ ) * ω ^ ⁢ ⁢ c ⁡ ( z ) - ( j ⁢ ⁢ 2 ^ * ng ^ t ) * ( ω ⁢ ⁢ c ^ ⁢ ( z ) - ω ⁢ ⁢ c ^ ⁢ ( z - 1 ) ) where t is the sampling period . the estimated speed is derived from the calculation ω ⁢ ⁢ p ^ ⁢ ( z ) = 1 t ⁢ ( θ ⁢ ⁢ p ^ ⁢ ( z ) - θ ⁢ ⁢ p ^ ⁢ ( z - 1 ) ) note that the { circumflex over ( t )} e ( z ) and ŵ c ( z ) inputs were passed through low pass filters prior to the above calculations . for best performance , the low pass filters on the { circumflex over ( ω )} c and { circumflex over ( t )} e inputs should have the same frequency response and delay as each other . in the embodiment shown in fig4 , { circumflex over ( θ )} c , { circumflex over ( ω )} c , and { circumflex over ( t )} e are measurable . in some applications , only voltage and current is known . in such applications , { circumflex over ( θ )} c , { circumflex over ( ω )} c , and { circumflex over ( t )} e have to be estimated . turning now to fig5 , in an embodiment , the { circumflex over ( θ )} c , { circumflex over ( ω )} c , and { circumflex over ( t )} e parameters are estimated based upon voltage and current measurements . at block 400 , the { circumflex over ( θ )} c , { circumflex over ( ω )} c , and { circumflex over ( t )} e are estimated based upon the calculations : where p is a derivative operator , lpf indicates a low pass filter and p p is motor pole pairs ω ^ s = l m ^ t ^ r ⁢ ( λ dr ^ s ⁢ i qs ^ s - λ qs ^ s ⁢ i ds ^ s λ qr ^ s 2 + λ dr ^ s 2 ) ω ^ r = 1 p p ⁢ ( ω ^ e - ω ^ s ) ω ^ c = lpf ⁡ ( ω ^ r n ^ ⁢ g ) in another embodiment , { circumflex over ( t )} e is estimated while { circumflex over ( θ )} c and { circumflex over ( ω )} c are measured with an encoder . turning now to fig6 , one type of control module that can be used with the finite difference state estimator 300 is a regulator structure 500 . one such regulator structure has gain vectors k cmd and k fbk , each consisting of [ k1 ; k2 ; k3 ; k4 ] and applied to the command vector x =[ θc , ωc , θp , ωp ] and the state estimates { circumflex over ( x )}=[{ circumflex over ( θ )} c , { circumflex over ( ω )} c , { circumflex over ( θ )} p , { circumflex over ( ω )} p ], respectively . the difference between the resulting scaled vectors constitutes the torque command . if the two k vectors are equal , tracking error during changing speed set points is minimized . if the k2 and k4 elements of the k cmd vector are set to zero , overshoot is minimized . the values of the elements comprising the k vectors are calculated by : ( ωn is the regulator closed loop bandwidth or natural frequency . the natural frequency is normally manually chosen and typically set at or below the system resonant frequency .) k ⁢ ⁢ 1 = ⁢ 1 j ⁢ ⁢ 1 ^ ⁢ kr ^ ⁡ ( - b ⁢ ⁢ 1 ^ ⁢ br ^ + j ⁢ ⁢ 1 ^ ⁢ kr ^ ) ⁢ ng ^ ⁢ ( b ⁢ ⁢ 1 ^ 2 ⁢ j ⁢ ⁢ 2 ^ ⁢ kr ^ 2 ⁢ ng ^ 2 + b ⁢ ⁢ 1 ^ ⁢ kr ^ 2 ( - d ⁢ ⁢ 3 ⁢ ω ⁢ ⁢ n ⁢ j ⁢ ⁢ 1 ^ ⁢ j ⁢ ⁢ 2 ^ ⁢ ng ^ 2 + ⁢ br ^ ⁡ ( j ⁢ ⁢ 1 ^ + j ⁢ ⁢ 2 ^ ⁢ ng ^ 2 ) ) - j ⁢ ⁢ 1 ^ ⁢ ( j ⁢ ⁢ 2 ^ ⁢ kr ^ 3 ⁢ ng ^ 2 + j ⁢ ⁢ 1 ^ ⁢ ( kr ^ 3 - ω ⁢ ⁢ n 4 ⁢ br ^ 2 ⁢ j ⁢ ⁢ 2 ^ ⁢ ng ^ 2 + ⁢ d ⁢ ⁢ 1 ⁢ ω ⁢ ⁢ n 3 ⁢ br ^ ⁢ ⁢ j ⁢ ⁢ 2 ^ ⁢ kr ^ ⁢ ng ^ 2 - d ⁢ ⁢ 2 ⁢ ω ⁢ ⁢ n 2 ⁢ j ⁢ ⁢ 2 ^ ⁢ kr ^ 2 ⁢ ng ^ 2 ) ) ) k ⁢ ⁢ 2 = ⁢ - b ⁢ ⁢ 2 ^ ⁢ j ⁢ ⁢ 1 ^ + ( b ⁢ ⁢ 1 ^ - d ⁢ ⁢ 3 ⁢ ω ⁢ ⁢ n ⁢ ⁢ j ⁢ ⁢ 1 ^ ) ⁢ j ⁢ ⁢ 2 ^ ⁢ ng ^ 2 + br ^ ⁡ ( j ⁢ ⁢ 1 ^ + j ⁢ ⁢ 2 ^ ⁢ ng 2 ^ ) j ⁢ ⁢ 1 ^ ⁢ ng ^ k ⁢ ⁢ 3 = ⁢ ω ⁢ ⁢ n 4 ⁢ j ⁢ ⁢ 1 ^ ⁢ j ⁢ ⁢ 2 ^ ⁢ ng ^ kr ^ ⁢ + 1 j ⁢ ⁢ 1 ^ ⁢ kr ^ ⁡ ( - b ⁢ ⁢ 1 ^ ⁢ br ^ + j ⁢ ⁢ 1 ^ ⁢ kr ^ ) ⁢ ng ^ ⁢ ( - b ⁢ ⁢ 1 2 ⁢ j ⁢ ⁢ 2 ^ ⁢ kr ^ 2 ⁢ ng ^ 2 - b ⁢ ⁢ 1 ^ ⁢ kr ^ 2 ⁢ ( - d ⁢ ⁢ 3 ⁢ ω ⁢ ⁢ n ⁢ ⁢ j ⁢ ⁢ 1 ^ ⁢ j ⁢ ⁢ 2 ^ ⁢ ng ^ 2 + br ^ ⁡ ( j ⁢ ⁢ 1 ^ + j ⁢ ⁢ 2 ^ ⁢ ng ^ 2 ) ) + j ⁢ ⁢ 1 ^ ⁢ ( j ⁢ ⁢ 2 ^ ⁢ kr ^ 3 ⁢ ng ^ 2 + j ⁢ ⁢ 1 ^ ⁢ ( kr ^ 3 - ⁢ ω ⁢ ⁢ n 4 ⁢ br ^ 2 ⁢ j ⁢ ⁢ 2 ^ ⁢ ng ^ 2 + d ⁢ ⁢ 1 ⁢ ω ⁢ ⁢ n 3 ⁢ br ^ ⁢ j ⁢ ⁢ 2 ^ ⁢ kr ^ ⁢ ng ^ 2 - d ⁢ ⁢ 2 ⁢ ω ⁢ ⁢ n 2 ⁢ j ⁢ ⁢ 2 ^ ⁢ kr ^ 2 ⁢ ng ^ 2 ) ) ) k ⁢ ⁢ 4 = ⁢ 1 j ⁢ ⁢ 1 ^ ⁢ kr ^ ⁡ ( - b ⁢ ⁢ 1 ^ ⁢ br ^ + j ⁢ ⁢ 1 ^ ⁢ kr ^ ) ⁢ ng ^ ⁢ ( - b ⁢ ⁢ 1 ^ 3 ⁢ j ⁢ ⁢ 2 ^ ⁢ kr ^ ⁢ ng ^ 2 + b ⁢ ⁢ 1 ^ 2 ⁢ ( - 2 ⁢ br ^ + d ⁢ ⁢ 3 ⁢ ω ⁢ ⁢ n ⁢ j ⁢ ⁢ 1 ^ ) ⁢ j ⁢ ⁢ 2 ^ ⁢ kr ^ ⁢ ng ^ 2 - b ⁢ ⁢ 1 ^ ⁢ kr ^ ( - d ⁢ ⁢ 3 ⁢ ω ⁢ ⁢ n ⁢ br ^ ⁢ j ⁢ ⁢ 1 ^ ⁢ j ⁢ ⁢ 2 ^ ⁢ ng ^ 2 + ⁢ j ⁢ ⁢ 1 ^ ⁢ j ⁢ ⁢ 2 ^ ⁢ ( d ⁢ ⁢ 2 ⁢ ω ⁢ ⁢ n 2 ⁢ j ⁢ ⁢ 1 ^ - 2 ⁢ kr ^ ) ⁢ ng ^ 2 + br ^ 2 ⁡ ( j ⁢ ⁢ 1 ^ + j ⁢ ⁢ 2 ^ ⁢ ng ^ 2 ) ) + ⁢ j ⁢ ⁢ 1 ^ ⁢ ( ω ⁢ ⁢ n ⁢ j ⁢ ⁢ 1 ^ ⁢ j ⁢ ⁢ 2 ^ ⁢ kr ^ ⁡ ( d ⁢ ⁢ 1 ⁢ ω ⁢ ⁢ n 2 ⁢ j ⁢ ⁢ 1 ^ - d ⁢ ⁢ 3 ⁢ kr ^ ) ⁢ ng ^ 2 + br ^ ( j ⁢ ⁢ 1 ^ ⁢ kr ^ 2 - ⁢ ω ⁢ ⁢ n 4 ⁢ j ⁢ ⁢ 1 ^ 2 ⁢ j ⁢ ⁢ 2 ^ ⁢ ng ^ 2 + j ⁢ ⁢ 2 ^ ⁢ kr ^ 2 ⁢ ng ^ 2 ) ) ) where ĵ { circumflex over ( 1 )} is an estimate of pump inertia . the damping coefficients d1 , d2 and d3 are set by a desired filter form response from the following table : simulations were performed to analyze and determine which types of regulator schemes would work with respect to stick - slip . all regulation schemes were tuned for a natural frequency equivalent to the plant resonant frequency for consistency . fig7 shows that a conventional pi ( proportional integral ) surface speed regulator does not handle the stick - slip load . as can be seen , the stick - slip condition is never averted . fig8 shows that a linear quadratic regulator handles the stick - slip condition . fig9 shows the same plot as fig8 with the time scale expanded . fig1 shows that a butterworth full state feedback regulator does not handle stick - slip . fig1 shows that a binomial full state feedback regulator handles stick - slip . fig1 shows that a bessel full state feedback regulator handles stick - slip . fig1 shows that an itae ( integral of time multiplied by the absolute value of error ) full state feedback regulator handles stick - slip . table 1 below documents the simulated regulator results . vmax refers to the maximum crank rpm encountered . tmax refers to the maximum electrical torque . pmax refers to the maximum instantaneous horsepower . these maximum values should be minimized to reduce drive sizing requirements . the simulation results show that the linear quadratic regulator exhibits the best stick - slip control response ( i . e ., minimized surface velocity , torque , and power ). one of the drawbacks with the linear quadratic regulator is that tuning of the regulator is a manual weighting process which , while intuitive , is required to be done for each system . the next best alternative to the linear quadratic is the itae full state feedback regulator which has an analytic solution for the regulator gains . from the foregoing , it can be seen that a finite difference state estimator has been described that provides accurate real - time estimates of unmeasurable states . in the embodiments described , the unmeasurable states are down - hole pump states ( e . g ., pump speed and angle ). while a single - section state estimator has been described , a multi - section finite difference state estimator can also be used where each node of the multi - section finite difference state estimator estimates the angle and speed of each section in the multi - section system . an example of this would be in a pumping situation where there are multiple rod sections and the estimated speed and angle of each section is needed with higher precision than a single - section state estimator provides . an example of this would be the multi - spring finite difference state estimator shown in fig1 . the first stage estimator would be the same as the single - stage finite difference state estimator ( see fig4 ) with the exception that the gain { circumflex over ( n )} g /{ circumflex over ( k )} r is replaced by { circumflex over ( n )} g /({ circumflex over ( k )} r nr ) where nr is the number of rod sections in the model and the output is intermediate angle θ ( 2 ) and speed ω ( 2 ) estimates . the remaining estimates of outputs are estimated with inputs of previous estimates and have gains indicated by kfd ( 1 , j ) . . . kfd ( 4 , j ) where j is the j &# 39 ; th section gains . for the example shown in fig1 , the gains are : kfd ⁡ ( 1 , j ) = - ( - 1 t 2 - 3 2 ⁢ br ^ * nr t - 2 ⁢ vr 2 dx 2 ) * dx 2 vr 2 kfd ⁡ ( 2 , j ) = - ( 2 t 2 + 2 ⁢ ⁢ br ^ * nr t ) * dx 2 vr 2 kfd ⁡ ( 3 , j ) = - ( - 1 t 2 - 1 2 ⁢ br ^ * nr t ) * dx 2 vr 2 kfd ⁡ ( 4 , j ) = - 1 dx = xr nr ⁢ ⁢ ( length / section ) making kfd a 4xnr matrix allows that gains to be varied along the rod length , which provides the capability to handle varying diameter rods . while the invention is described herein in connection with certain preferred embodiments , there is no intent to limit it to those embodiments . on the contrary , the intent is to cover all alternatives , modifications and equivalents within the spirit and scope of the invention . the use of the terms “ a ” and “ an ” and “ the ” and similar referents in the context of describing the invention ( especially in the context of the following claims ) is to be construed to cover both the singular and the plural , unless otherwise indicated herein or clearly contradicted by context . the terms “ comprising ,” “ having ,” “ including ,” and “ containing ” are to be construed as open - ended terms ( i . e ., meaning “ including , but not limited to ,”) unless otherwise noted . recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range , unless otherwise indicated herein , and each separate value is incorporated into the specification as if it were individually recited herein . all methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context . the use of any and all examples , or exemplary language ( e . g ., “ such as ”) provided herein , is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed . no language in the specification should be construed as indicating any non - claimed element as essential to the practice of the invention . preferred embodiments of this invention are described herein , including the best mode known to the inventors for carrying out the invention . variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description . the inventors expect skilled artisans to employ such variations as appropriate , and the inventors intend for the invention to be practiced otherwise than as specifically described herein . accordingly , this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law . moreover , any combination of the above - described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context .	5
fig1 is a schematic block diagram of the operation control device according to a preferred embodiment of the invention , which comprises a pump system . in particular , fig1 shows , as indicated by the dashed border line 10 , an operation control device having actuating means 12 , which in one embodiment is a frequency converter , for setting speed and for actuating a screw pump 14 . the screw pump 14 is connected downstream from , and interacts with , a schematically shown machine tool 16 . such machine tools may include drilling or milling machines having changeable tool inserts and correspondingly changeable coolant delivery requirements . as arranged , the screw pump 14 may deliver coolant to the machine tool 16 . in the context of the preferred exemplary embodiment , operating mode means 18 , in the form of a control unit , is connected upstream of the actuating means 12 . the operating mode means 18 may be embodied in hardware or software components , and may take as input calculated and / or predefined threshold values 24 of an operating parameter ( for example , pump pressure p ) to actuate the actuating means 12 . the operating mode means 18 may also take into account a respective unit - specific setpoint value 22 of the operating parameter , which in the illustrated embodiment is setpoint pressure ( pset ). in the manner shown in fig1 , these influencing variables , namely at least one threshold value 24 and the setpoint value 22 ( pset ), are provided to the operating mode means 18 in a suitable manner ( as represented by functional unit blocks 22 , 24 ). alternatively , they may be calculated , as will be described in greater detail later . also illustrated is a state sensor unit 20 , which in the exemplary embodiment is a pressure sensor , for detecting an actual pressure “ pact ” on the output side of the screw pump 14 and providing it to the operating mode means 18 to utilize in further actuation operations . the operation of the device according to fig1 will now be described in relation to the pressure / time diagram of fig2 and the flow chart of fig3 . it is assumed by way of example that a screw pump of type emtec 20 r38 manufactured by the applicant allweiler ag , radolfzell , with a rating of 7 . 5 kw , interacts with a single - screw machine tool 16 , which is configured as a drilling machine and is operated with three different drilling tools . each of these three drilling tools requires a different delivery of coolant / lubricant fluid to be delivered by the pump 14 , it being assumed that this delivery lies between 5 liters / minute ( l / min ) and 35 l / min . an assumed operating pressure at the pump output and unit input side is 80 bar in each case . fig2 illustrates , at step s 10 , an idle state before activating the arrangement . at step s 12 , initial start - up ( go ) then follows by manual or automated actuation . as a comparison of fig2 and 3 shows , the present invention allows the pump motor to be operated in a plurality of operating phases which are clearly separated or delimited from each other by suitable actuation or setting by the operating mode means 18 . it is , therefore , initially provided according to the exemplary embodiment of fig1 to 3 for actuation of the screw pump to take place at maximum electrical actuating power by means of the frequency converter 12 , after initial start - up ( step s 12 ) at time t 0 . this results directly from the decision step e 1 in fig3 , in which the differential pressure pdiff ( which is the difference between the setpoint pressure “ pset ” and the detected actual pressure “ pact ”, in relation to the setpoint pressure , which in the described embodiment is 80 bar ) is determined to be more than 80 % below the setpoint operating parameter value ( pset ). quantitatively , this means the realization of a lower threshold value , in the exemplary embodiment at the 80 % threshold ( in relation to 80 bar pset , that is p2 = 16 bar ). accordingly , the branch in fig3 leads to the operating state of step s 14 “ start ,” corresponding with an initial start - up mode , in this case at full electrical power . as can be seen in fig2 , the pump actual pressure “ pact ” ( shown as the solid line ) reaches the lower threshold p2 value at 16 bar at time t 1 . in the illustrated embodiment , t 1 is about 80 msec . this ends the first mode of operation , at which point the operating mode means applies another actuating mode to the pump motor or the inverter connected upstream . the following then occurs , as shown in fig3 . when the lower threshold value p2 of 16 bar ( corresponding to a pressure difference of less than 80 % in relation to the setpoint pressure value ) is exceeded , a branch is made to the right in decision step e 2 . according to the preferred embodiment , at step s 16 , a parametrization of a control mode in the second operating phase takes place between times t 1 and t 2 ( see fig2 — corresponding to a pressure range of 16 bar as the lower threshold value and 76 bar as the upper threshold value , correspondingly 95 % of pset ). a pi control operation is thus carried out , in which a pressure difference is initially determined per unit time interval by the operating mode means 18 after time t 1 , as a gradient in the pressure curve ( fig2 ). depending on this gradient , the system defines and specifies an amplification value and an integration time for the pi control behavior in the time region between t 1 and t 2 . the system is then operated ( at step s 18 ) with this parameterization , as described by a pi control function . as can also be seen from the feedback of the loop shown in fig3 , a continuous parameterization ( s 16 ) takes place in the time range between t 1 and t 2 . that is , repeated measurements are made of a current increase in the pressure curve , and thereupon p and i values of the closed - loop control are set . in the exemplary embodiment of fig2 , the curve profile shown with a parameterization ( s 16 ) after time t 1 would lead to a typical amplification v = 8 with an integration time i = 5 msec ( for instance , compared to the maximum actuation in the phase t 0 to t 1 , where actuation took place with an amplification v = 1 and an integration time i = 2 msec ). the pressure rise over time then takes place in the manner shown in fig2 until an upper threshold value p1 at 76 bar is reached . in one embodiment , this threshold value is 95 % of pset . this threshold value is reached at time t 2 , in the illustrated embodiment , at approximately 300 msec after t 0 . at this time , the operating open - loop and closed - loop control behavior of the operating mode means 18 also changes , whereby , in accordance with decision step e 3 ( fig3 ), the system executes a final closed - loop operation . in one embodiment , this is a closed - loop operation which has a reduced amplification and / or extended integration time for the pi parametrisation compared to closed - loop operation in the preceding operating phase . in other words , as can be seen starting from the upper threshold value p1 , the operation shows a markedly flatter rising behavior in the direction towards the setpoint value pset . advantageously , this leads to a slowed approach to the setpoint value pset ( at 80 bar ), which takes place in the time interval between t 2 and t 3 reducing or eliminating the chance for disadvantageous overshoot . thus , this final closed - loop control operation , carried out at step s 20 , constitutes an operating state in which the setpoint value can be reached in an optimised time from t 2 . stationary pump operation is then carried out in further stationary operation , even with these stationary pump operation closed - loop control parameters ( typically amplification v = 3 , integration time i = 10 msec ). in the event that an unexpected loading of the system occurs , for example , due to the switching off or failure of the connected machine tool , operating states can occur in which pump pressure exceeds the setpoint value . in principle , it would be possible by means of the final closed - loop control operation ( step s 20 ) to compensate for this ( upwards ) deviation . this may , however , require an undesirably long time . accordingly , as shown in fig3 , following the decision step e 3 in which the pressure setpoint value is exceeded by more than 5 % ( i . e . actual pressure & gt ; 105 % of p ), the system turns to the steep parameterization operation from step s 16 or s 18 ( i . e ., in accordance with the steep behaviour between the time sections t 1 and t 2 ). as soon as the tolerance threshold ( here : 5 %) for the final closed - loop control operation ( step s 20 ) is reached , operation continues accordingly . the flow chart of fig3 additionally shows the introduction of an alarm routine ( step s 22 or s 24 ) if a predetermined alarm condition is detected at decision e 3 . the alarm condition can be a predetermined pressure condition , but it can also be based on other input variables , such as exceeding a critical temperature . various actuating modes and operating phases of the pump motor , generated in the run - up and start - up state , are shown in the curve profiles of fig4 . fig4 shows the operating behavior of an operation control device having the same pump configuration , and which in one example is a pi controller , for use with various tools and various system loads connected therewith . curve 40 , for example , relates to a first drilling tool , in which a low required delivery ( 5 l / min ) leads to a marked overshooting of the system . curve 42 , relates to a large tool having a comparatively high delivery requirement ( delivery rate 35 l / min ) which brings about a very long initial period and clearly exceeds the required 500 msec limit . only the middle tool , represented by curve 44 , and having a delivery rate of 15 l / min , approximately achieves the curve profile of fig2 . as can be seen , curve 44 illustrates only slight overshoot when reaching pset , thus approximating the short curve profile of fig2 . such operation is obtained independently of the respective delivery requirement , and is adaptively set for all required tools , namely by means of appropriate adaptive parametrisation in the range of operating phases below the upper threshold value , and particularly in the middle rise region ( i . e ., step s 18 between t 1 and t 2 ). it will be appreciated that the present invention is not limited to the provision of two threshold values p2 , p1 , which , in the exemplary embodiment are 20 % and 95 % of the setpoint value , respectively . rather , one or both of these threshold values can be set at different values from those explicitly described in relation to the preferred embodiments . in addition , it is contemplated that only a single threshold value may be used . in one embodiment , the single threshold value may be the upper threshold value p1 . alternatively , any desired number of threshold values may be used , as long as such values are appropriately described in a consistent functional context . in addition , setting or adapting the operation of the system can be in accordance with a single or repeated gradient measurement on the pressure profile . this may be done in relation to at least the upper threshold value . it is also contemplated that operating parameters other than pressure may be used in the inventive system and method . for example , the operating parameter may be the rotational speed of the pump motor , with analogous upper and , if appropriate , lower threshold values set , determined or ascertained in some manner as respective fractions . as a result , the present invention makes it possible in a surprisingly effective manner to obtain fast and dynamic run - up behaviour of a screw pump , while at the same time minimizing the required outlay in terms of equipment and hardware . according to one preferred embodiment , the system of fig1 operates without a pressure regulating valve , and thus , operation of the system occurs in an energy efficient manner .	5
an exemplary circuit arrangement according to at least one embodiment of the invention as illustrated in fig1 has an amplifier arrangement 10 having inputs 101 , 102 for feeding in an input signal vin and having outputs 103 , 104 for providing an output signal vout . in the example , the input signal vin and the output signal vout are voltages which are referred in each case to a reference - ground potential gnd . the input 102 and the output 104 are at said reference - ground potential gnd . the amplifier arrangement 10 has a first operational amplifier 11 having inputs 111 , 112 and an output 113 . in the example , the noninverting input 111 of the operational amplifier 11 is connected to the input 101 of the amplifier arrangement 10 via a resistor 14 , and the inverting input 112 of the operational amplifier 11 is connected to the input 102 of the amplifier arrangement 10 via a further input resistor 15 . the output 113 of the first operational amplifier 11 is connected to the output 103 of the amplifier arrangement 10 . the output 113 of the operational amplifier 11 is furthermore feedback - connected to the inverting input 112 of said operational amplifier via a feedback resistor 13 . after application of an input voltage vin , a differential voltage vdiff = 0 is established between the inputs 111 , 112 of the operational amplifier 11 after a settling operation has proceeded . in the case of the circuitry illustrated , the following holds true for the output voltage vout of the operational amplifier 11 : in this case , r 1 designates the resistances of the input resistors 14 , 15 and r 2 designates the resistance of the feedback resistor 13 . for example due to temperature influences or else due to production - dictated variations in the parameters of the components present in the operational amplifier 11 ( not illustrated in greater detail ), an offset , that is to say an input difference vdiff not equal to zero , may be present in the settled state of the operational amplifier 11 . in order to compensate for such an input offset , the first operational amplifier 11 has a compensation input 114 for feeding in a compensation signal . in the example , said compensation signal is a voltage v 12 present across a first capacitive storage element , which in the example is connected between the compensation input 114 and reference - ground potential gnd . said compensation signal v 12 is generated by a compensation circuit 20 connected to the inputs 111 , 112 of the first operational amplifier 11 in order to detect the input voltage difference vdiff thereof and to generate the compensation signal v 12 depending on said input voltage difference vdiff in conjunction with the capacitive storage element 12 . the compensation circuit 20 has a second operational amplifier 21 , which is designed as a transconductance amplifier in the example and which thus generates an output current i 20 dependent on the input voltage difference vdiff in order to charge the capacitive storage element 12 . in principle , the compensation arrangement 20 generates an output current i 20 as long as the input difference vdiff of the first operational amplifier 11 is not equal to zero , in order thereby to change the compensation signal v 12 until it has been adjusted to a value at which the offset or the input voltage difference vdiff is zero . since the transconductance amplifier 21 of the compensation arrangement 20 may also be beset with an offset the compensation arrangement 20 has a further compensation arrangement serving for the offset compensation of the transconductance amplifier 21 . in accordance with the first operational amplifier 11 of the amplifier arrangement 10 , the transconductance amplifier 21 has a compensation input 214 for feeding in an offset compensation signal v 22 . a second capacitive storage element 22 is connected between said compensation input 214 and reference - ground potential gnd , the offset compensation signal v 22 of said transconductance amplifier 21 being present across said second capacitive storage element . said second capacitive storage element 22 is part of the compensation arrangement of said transconductance amplifier 21 . said compensation arrangement additionally has a first switch 23 for interrupting the connection between the first input 211 of the transconductance amplifier 21 and the first input 111 of the operational amplifier 11 , a second switch 24 for short - circuiting the inputs 211 , 212 of the transconductance amplifier 21 , a third switch 25 for connecting the output 213 of the transconductance amplifier 21 to the first capacitive storage element 12 , and also a fourth switch 26 for connecting the output 213 of the transconductance amplifier 21 to the second capacitive storage element 22 . said switches 23 , 24 , 25 , 26 of the compensation arrangement of the transconductance amplifier 21 are driven by switching signals p 1 , p 2 generated by a control circuit 200 , which is merely illustrated schematically . said control signals p 1 , p 2 are complementary to one another and chosen such that the first and fourth switches 23 , 25 are always opened and closed together and that the second and fourth switches 24 , 26 are always opened and closed together . in this case , the first and third switches 23 , 25 , on the one hand , and the second and fourth switches , 24 , 26 , on the other hand , are always driven complementarily to one another . the control circuit 200 controls the offset compensation of the transconductance amplifier 21 by the second compensation arrangement . during a compensation operation in which the compensation signal v 22 is generated , the first and third switches 23 , 25 are opened in order to decouple the transconductance amplifier 21 from the first operational amplifier 11 . the second and fourth switches 24 , 26 are closed in order to short - circuit the inputs 211 , 212 of the transconductance amplifier 21 and in order to connect the output 213 of the transconductance amplifier 21 to the second capacitive storage element 22 . if the transconductance amplifier 21 has an offset , then there is available at its output 213 despite short - circuited inputs 211 , 212 , an output current which charges the capacitor 22 via the fourth switch 26 in order to increase the second compensation signal v 22 . said compensation signal v 22 serves for offset compensation internally in the transconductance amplifier 21 . the offset of the transconductance amplifier 21 is completely compensated for when the output current of said transconductance amplifier becomes zero and , as a result , the compensation signal v 22 does not rise any further . after the conclusion of the compensation operation , the second and fourth switches 24 , 26 are opened and the first and third switches 23 , 25 of the compensation arrangement of the transconductance amplifier 21 are closed . the compensation operation explained above for the transconductance amplifier 21 may suitably be repeated at regular time intervals , in which case , during the compensation operation , in the manner explained , the second and fourth switches 24 , 26 are for example closed for a fixedly predetermined time duration and the other two switches 23 , 25 are opened for this time duration . in a manner that is not illustrated in more specific detail , there is in this connection also the possibility of providing a discharge circuit for the capacitive storage element 22 which completely discharges the capacitive storage element 22 in each case before the beginning of a compensation operation , in order subsequently to generate a second compensation signal v 22 again with the second and fourth switches 24 , 26 closed . it should be pointed out in this connection that the compensation signal v 22 is maintained after the opening of the fourth switch 26 , so that only the first compensation signal v 12 is changed during the compensation operation . an operating state of the transconductance amplifier in which the second and fourth switches 24 , 26 are closed is referred to below as “ compensation operating state ”, while an operating state in which said switches 24 , 26 are open and the other two switches 23 , 25 are closed is referred to as “ normal operating state ”. the task of the first compensation arrangement 20 is , in conjunction with the first capacitive storage element 12 connected to the offset compensation input 114 of the operational amplifier 11 , to generate an offset compensation signal v 12 for the operational amplifier 11 . in order to generate the first offset compensation signal v 12 , the transconductance amplifier 21 is operated in the normal operating mode . the transconductance amplifier 21 then detects the voltage vdiff present between the inputs 111 , 112 of the operational amplifier 11 and generates an output current i 20 at its output 213 , said output current being dependent on said voltage difference vdiff . in the ideal situation , if the operational amplifier 11 is not beset with an offset , this input voltage difference vdiff is zero in the settled state of the operational amplifier 11 . in this case , the output current i 20 of the transconductance amplifier 21 is likewise zero provided that the transconductance amplifier 21 is not itself beset with an offset , which is assumed below . if the first operational amplifier 11 is beset with an offset , then the input voltage difference vdiff is not equal to zero and the transconductance amplifier 21 supplies an output current i 20 not equal to zero , which charges the capacitive storage element 12 in order thereby to increase the offset compensation voltage v 12 . in this case , the compensation voltage v 12 is increased until the input voltage vdiff of the first operational amplifier is zero and the offset of the first operational amplifier 11 has thus been compensated for . the first compensation signal v 12 is maintained if the transconductance amplifier 21 undergoes transition from the normal operating state to the compensation operating state and the third switch 25 is opened . as already explained , the input voltage difference vdiff of the operational amplifier 11 is normally zero . in particular during a settling phase after a change in the input signal vin , however , said input voltage difference vdiff may assume a value not equal to zero . unless additional measures are taken , said input voltage difference vdiff , during the settling phase , would be interpreted as an offset by the compensation arrangement 20 , which would lead to an increase in the offset compensation signal v 12 of the operational amplifier 11 . the compensation arrangement 20 with the capacitive storage element 12 has an integrating behavior , which equivalently means that those input voltage differences vdiff which are not equal to zero would be integrated during the settling operations explained and would lead to a continuous increase in the offset compensation signal v 12 unless additional measures are implemented . input voltage differences vdiff not equal to zero can furthermore also be generated by the input voltage source that generates the input voltage vin , as is explained below with reference to fig2 . fig2 shows , in the left - hand part , a device for generating an input voltage vin of the amplifier arrangement 20 . this arrangement 50 comprises a measuring resistor or shunt resistor , through which a measurement current i 50 flows . it shall be assumed that said measurement current i 50 is a pulsed current that is switched on and off . the amplifier arrangement 10 generates an output signal vout dependent on said measurement current i 50 by means of the measuring resistor 50 . the measuring resistor 50 comprises a nonreactive resistance component r 50 and a parasitic inductance component l 50 . as is illustrated in the right - hand part of fig2 , said parasitic inductance component leads to voltage spikes in the input voltage vin both when the measurement current i 50 is switched on and when the measurement current i 50 is switched off . said voltage spikes likewise lead to an input voltage difference vdiff not equal to zero and would be integrated by the compensation arrangement 20 unless further measures are implemented . in order to avoid a situation in which input voltage differences vdiff not equal to zero which are caused by the parasitic effects explained or by settling operations of the operational amplifier 11 lead to a corruption of the offset compensation signal v 12 , the circuit arrangement has , according to at least one embodiment of the invention , a deactivation circuit 30 , which is designed to temporarily deactivate the first compensation circuit 20 . in the example , said deactivation circuit 30 has a switch 31 , which is connected downstream of an output of the compensation arrangement 20 and which prevents , in the open state , a changing of the offset compensation signal v 12 by the compensation arrangement 20 . a drive circuit 32 is present for driving said switch 31 , which drive circuit is designed to open the switch 31 temporarily , such as during settling operations of the operational amplifier 11 or during predetermined time durations after changes in the input signal vin . input voltage differences vdiff not equal to zero which occur during these time durations thus cannot affect the offset compensation signal v 12 of the operational amplifier 11 . in the example , the compensation arrangement 20 is deactivated when it does not supply an output signal which can change the compensation signal v 21 generated up to that point . in order to afford a better understanding of the function of the offset compensation signal v 12 , fig3 shows a simple exemplary circuitry realization of an operational amplifier having an offset compensation input 114 . this operational amplifier has a differential amplifier stage having first and second input transistors 121 , 122 , the control terminals of which form the inputs 111 , 112 of the operational amplifier . in the example , said transistors 121 , 122 are formed as n - channel mosfets whose source terminals are connected to one another and are connected to reference - ground potential gnd via a current source 126 serving as a load . the drain terminals of said mosfets 121 , 122 are connected to a supply potential vbb via a current mirror having two further transistors 124 , 125 . said current mirror 124 , 125 comprises two p - channel transistors , a first current mirror transistor 124 of which is connected up as a diode . the current mirror 124 , 125 maps a current flowing through the first input transistor 121 onto a current flowing through the second current mirror transistor 125 . an output stage of this operational amplifier is formed by a series circuit comprising a further n - channel mosfet 123 and a further current source 127 . in this case , the output 113 of the operational amplifier 11 is formed by a node common to the further transistor 123 and the current source 127 . a control terminal of said further n - channel transistor 123 is connected to a node common to the second current mirror transistor 125 and the second input transistor 122 . the operational amplifier has a compensation stage having a first compensation transistor 126 , which is formed as a p - channel transistor 126 in the example , and a second compensation transistor 127 , which is formed as an n - channel transistor in the example . the two compensation transistors 126 , 127 are jointly driven by the compensation signal v 12 present at the compensation input 114 . for this purpose , the gate terminals of these two transistors 126 , 127 are connected to the compensation input 114 . the task of the compensation transistors 126 , 127 is to reduce or increase the current i 122 through the input transistor 122 according to the compensation signal v 12 . for this purpose , a node common to the two compensation transistors 126 , 127 is connected to a node common to the current mirror transistor 125 and the input transistor 122 . the functioning of the illustrated operational amplifier having the compensation stage is explained below : this operational amplifier is not beset with an offset when the currents i 121 , i 122 through the input transistors 121 , 122 are of identical magnitude given identical input voltages at the inputs 111 , 112 . identical input voltages are present when the voltage between the two inputs 111 , 112 is zero . the operational amplifier is beset with an offset if these two currents i 121 , i 122 are not identical given identical input voltages . in the case of an input voltage difference equal to zero , an output voltage not equal to zero is available . if such an operational amplifier beset with an offset is connected up in the manner illustrated in fig1 such that the output is feedback - connected to one of the inputs , then such an offset has an effect such that an input voltage difference not equal to zero is established . such an offset is compensated for by the compensation stage 126 , 127 in that , according to the compensation signal v 12 , the current through the second input transistor 122 is increased or decreased in order to adapt the current i 122 through said input transistor 122 to the current i 121 through the other input transistor 121 . if the compensation signal v 12 in the case of this arrangement assumes a first value , at which the two compensation transistors 126 , 127 are driven identically , then a current flowing from the compensation stage 126 , 127 is equal to zero . the compensation current ik is positive in order to increase the current through the input transistor 122 if the compensation signal v 12 falls below the first value . in this case , the first compensation transistor 126 is driven to a greater extent than the second compensation transistor 127 . the compensation current ik is negative in order to reduce the current through the input transistor 122 if the compensation signal v 12 rises above the first value . in this case , the second compensation transistor 127 is driven to a greater extent than the first compensation transistor 126 . fig4 illustrates a use of the circuit arrangement according to at least one embodiment of the invention for determining a load current i 50 flowing through a semiconductor switch 52 of a half - bridge circuit . in the example , the half - bridge circuit has two first and second semiconductor switches 51 , 52 connected in series between a supply potential vcc and reference - ground potential gnd . in the example , said half - bridge circuit serves for driving a load 56 connected between an output 58 of the half - bridge circuit and reference - ground potential gnd . a current measuring resistor 50 is connected in series with the second semiconductor switch 52 . said measuring resistor 50 supplies the input voltage vin for the amplifier arrangement 10 . the driving of the two semiconductor switches 51 , 52 is effected according to control signals s 53 , s 54 provided by a control circuit 55 . driver circuits 53 , 54 serve for amplifying said control signals s 53 , s 54 or for converting the levels of said control signals s 53 , s 54 to levels suitable for driving the semiconductor switches 51 , 52 . fig5 shows , by way of example , the temporal profile of the drive signal s 54 of the semiconductor switch 52 . in this case , the temporal profile of said control signal s 54 corresponds qualitatively to the temporal profile of the current i 50 flowing through the second semiconductor switch 52 if the load 56 is an inductive load , such as a motor for example . fig5 additionally shows the temporal profile of the input voltage vin present across the measuring resistor 50 assuming that the measuring resistor 50 has a parasitic inductance . in the example , the deactivation circuit 30 has an edge detection circuit 33 , to which the control signal s 54 according to which the load current i 50 is generated is fed . the edge detection circuit 33 is designed to detect rising and falling edges of said control signal s 54 and to open the switch 31 after a rising and a falling edge of the control signal s 54 in each case for a predetermined time duration , in order thereby to deactivate the compensation arrangement 20 . the output signal s 33 of said edge detection circuit 33 is likewise illustrated in fig5 . in the example , it is assumed that the switch 31 is closed when said output signal s 33 has a high level and is open when said output signal s 33 has a low level . the time durations for which the output signal s 33 of the edge detector 33 in each case assumes a low level after a rising or falling edge of the control signal s 54 , in order to deactivate the compensation arrangement , may suitably be adapted to the time durations during which the input voltage vin has voltage spikes on account of the parasitic inductance of the measuring resistor 50 , or these time durations are adapted to settling durations of the operational amplifier 11 after a level change of the input signal vin . interference signals may arise during the opening and closing of the switch 31 that deactivates the second compensation arrangement 20 , said interference signals being referred to as so - called “ switching noise ”. in order to prevent said switching noise from adversely affecting the generation of the offset compensation signal v 12 , the operational amplifier 11 may be formed as an operational amplifier with differential offset compensation . fig6 shows a modification of the circuit arrangement illustrated in fig1 , in which the operational amplifier 11 is formed as an operational amplifier with differential offset compensation . the operational amplifier 11 has two offset compensation inputs 114 _ 1 , 114 _ 2 . in this case , the capacitive storage element 12 already explained is connected to the first compensation input 114 _ 1 , said storage element being connected to the output of the first compensation arrangement 20 . a further capacitive storage element 17 is connected between the second compensation input 114 _ 2 and reference - ground potential gnd . said further capacitive storage element 17 is connected to a terminal for a reference potential vref 2 via a second switch 34 of the deactivation circuit . this further switch 34 is opened and closed jointly with the switch 31 connected between the compensation arrangement 20 and the first capacitive storage element 12 . an exemplary circuitry realization of an operational amplifier with differential offset compensation is illustrated in fig7 . the basic construction of this operational amplifier corresponds to the construction of the operational amplifier illustrated in fig3 with the difference that the compensation stage is formed as a differential compensation stage . in the case of this operational amplifier , the compensation stage comprises a first and second compensation transistor 128 , 129 . the first compensation transistor 128 is driven by the first compensation signal v 12 and its load path is connected between a node common to the current mirror transistor 125 and the second input transistor 122 and reference - ground potential . the second compensation transistor 129 is driven by a compensation signal v 17 present across the second capacitive storage element ( 17 in fig6 ) and its load path is connected between a node common to the current mirror transistor 125 and the second input transistor 122 and reference - ground potential . the compensation signal which is present at the input of the second compensation transistor 129 and corresponds to the second reference potential with switches 28 , 34 closed is referred to below as constant compensation signal . in the case of the operational amplifier illustrated , a change in the current i 122 through the second input transistor 122 with respect to the current through the first input transistor 121 is effected by means of a change in the compensation signal v 12 in comparison with the fixed compensation signal v 17 . said fixed compensation signal has the effect that part of the current i 124 flowing through the current mirror transistor 124 flows away to reference - ground potential via the second compensation transistor 129 . if the compensation signal v 12 corresponds to the fixed compensation signal v 17 , then the current i 128 flowing through the first compensation transistor 128 corresponds to the current i 129 flowing through the second compensation transistor 129 . when an offset is not present , the currents i 121 , i 122 through the input transistors are then identical . the operational amplifier is beset with an offset if the currents i 121 , i 122 through the input transistors 121 , 122 are not identical . depending on the type of offset , compensation of said offset necessitates increasing or reducing the current i 121 through the second input transistor 122 in comparison with the current i 121 through the first input transistor 121 . in order to increase the current i 122 through the second input transistor 122 with respect to the current i 121 through the first input transistor 121 , the compensation signal v 12 is increased in comparison with the fixed compensation signal v 17 . in this case , the first compensation transistor 128 is regulated down . in order to reduce the current i 122 through the second input transistor 122 with respect to the current i 121 through the first input transistor 121 , the compensation signal v 12 is reduced in comparison with the fixed compensation signal v 17 . in this case , the first compensation transistor 128 is driven up . common - mode interference signals which are superposed on the two compensation signals v 12 , v 17 do not affect the offset compensation in the case of this compensation arrangement 128 , 129 . if an identical interference signal is superposed on the two compensation signals v 12 , v 17 , then the two compensation transistors 128 , 129 are regulated down or driven up in the same way with the result that the current i 122 through the second input transistor 122 does not change in comparison with the current i 121 through the first input transistor 121 ; a difference between these two currents i 122 and i 121 remains the same and is equal to zero in the case of complete offset compensation . an interference signal which is superposed on the two compensation signals v 12 , v 17 may be for example a switching noise that arises as a result of simultaneous switching of the switches 31 , 34 . referring to fig6 , a fifth switch 28 of the compensation arrangement 20 is connected between the further capacitive storage element 117 and the terminal for reference potential vref 2 . said switch 28 is driven by means of the control signal p 2 jointly with the fourth switch 25 connected between the output of the transconductance amplifier 21 and the first capacitive storage element 12 . in the case where the switches 31 , 34 of the deactivation circuit are closed and the compensation arrangement 20 is changed over from the compensation state to the normal state , and vice versa , the fourth switch 25 is opened or closed in the manner explained . in order to prevent switching noise that occurs during the opening and closing of said fourth switch 25 from adversely affecting the offset compensation of the operational amplifier 11 , the fifth switch 28 is opened and closed in a manner corresponding to said fourth switch 25 . in accordance with the first operational amplifier 11 of the amplifier arrangement 10 , the transconductance amplifier 21 of the compensation arrangement 20 may also be embodied as an operational amplifier with differential offset compensation . in this case , the capacitive storage element 22 that has already been explained previously is connected to a first offset compensation input 214 _ 2 of the transconductance amplifier 21 , and a second capacitive storage element 27 is connected to a second offset compensation input 214 _ 2 of said transconductance amplifier 21 . the second capacitive storage element 27 is connected to a reference potential vref 1 via a sixth switch 29 . said sixth switch 29 is opened and closed synchronously with the fourth switch 26 by means of the control signal p 1 . switching noise that arises as a result of the opening and closing of the fourth switch 26 and could adversely affect the generation of the second compensation signal v 22 is compensated for by synchronous opening and closing of the sixth switch 29 , which is connected to the second capacitive storage element 27 , in such a way that the switching noise does not affect the offset compensation of the transconductance amplifier 21 . the noninverting input of the operational amplifier 11 is connected to a further reference potential vref 1 via a further resistor 16 . in the example , said further resistor 16 has the same resistance r 2 as the feedback resistor 13 of the operational amplifier 11 . the quiescent value output voltage vout , that is to say the value at which the output voltage vout is established in the case of an - input voltage vin = 0 , is set by way of the ratio of said two resistors 13 , 16 . given identical resistors 13 , 16 , said quiescent value corresponds to the further reference potential . upon application of an input voltage vin not equal to zero , the output voltage vout then changes proceeding from said quiescent value . the further reference potential vref 2 may correspond to the reference potential vref 1 present for compensation purposes . in the case of the exemplary embodiments explained above with reference to fig4 and 6 , the compensation arrangement 20 is deactivated depending on a signal s 54 which triggers a level change of the input voltage vin of the amplifier arrangement 10 . fig8 shows an exemplary embodiment of a circuit arrangement according to at least one embodiment of the invention having a deactivation circuit 31 , 60 , in the case of which no “ advance information ” about an imminent level change of the input voltage vin is required for the deactivation of the first compensation arrangement 20 . the deactivation circuit has the switch 31 explained previously , said switch being connected between the output 20 of the compensation arrangement and the first capacitive storage element 12 . a drive signal s 31 is generated by a detector circuit 60 , which detects level changes of the input voltage vin . said detector circuit 60 has an amplifier arrangement constructed in accordance with the amplifier arrangement 10 . this amplifier arrangement of the detector circuit 60 comprises an auxiliary operational amplifier 61 having inputs 611 , 612 and an output 613 . the inputs 611 , 612 of said auxiliary operational amplifier 61 are connected to the inputs 101 , 102 of the amplifier arrangement 10 via input resistors 64 , 65 . the input resistors 64 , 65 may suitably be dimensioned in accordance with the input resistors 14 , 15 of the amplifier arrangement 10 and have a resistance r 1 . the auxiliary operational amplifier 61 is connected up in accordance with the operational amplifier 11 of the amplifier arrangement . for this purpose , the output 613 of said auxiliary operational amplifier is feedback - connected to the inverting input 612 of the auxiliary operational amplifier 61 via a feedback resistor 63 , which is dimensioned in accordance with the feedback resistor 13 of the operational amplifier 11 . the first operational amplifier 11 and the auxiliary operational amplifier 61 are dimensioned such that they have different time constants , and that is to say that they react at different speeds to changes in the input voltage vin . this is explained on the basis of temporal profiles of the output voltages vout of the operational amplifier 11 and vout ′ of the auxiliary operational amplifier 61 with reference to fig9 . fig9 shows , by way of example , a temporal profile of the input voltage vin , which has a rising edge at an instant t 1 and a falling edge at an instant t 2 and which has a constant signal level between these two instants t 1 , t 2 . with the rising edge of the input signal vin , the output voltages vout , vout ′ of the two amplifiers 11 , 61 start to rise , but at different rates on account of the different time constants . in the example , the time constant of the auxiliary operational amplifier 61 is shorter than the time constant of the first operational amplifier 11 , so that the output voltage vout ′ of the auxiliary operational amplifier 61 rises more rapidly than the output voltage vout of the operational amplifier 11 after a rising edge of the input voltage vin and falls more rapidly than the output voltage vout of the operational amplifier 11 after a falling edge of the input voltage vin . the operational amplifiers 11 , 61 are dimensioned and connected up in such a way that the output voltage vout of the operational amplifier 11 corresponds to the output voltage vout ′ of the auxiliary operational amplifier 61 in the settled state . after a rising edge of the input voltage vin and after a falling edge of the input voltage vin , the output voltages vout , vout ′ differ on account of the different time constants in each case for time durations δt 1 , δt 2 . an evaluation circuit having two comparators 66 , 67 and a logic gate 68 evaluates the output voltages vout , vout ′ of the two amplifiers 11 , 61 in order to generate the drive signal s 31 of the switch 31 therefrom . this evaluation circuit 66 , 67 , 68 has the task of opening the switch 31 during the time durations δt 1 , δt 2 after rising and falling edges of the input voltage vin . for this purpose , the output voltage vout of the operational amplifier 11 and the output voltage vout ′ of the auxiliary operational amplifier 61 are in each case fed to the comparators 66 , 67 . during the time durations δt 1 , δt 2 during which these two voltages vout , vout ′ deviate from one another , the output signal of a respective one of these two comparators 66 , 67 has a high level . in this example , the logic gate 68 is formed as an xor gate , which supplies a high level at its output in each case when the two comparator output signals deviate from one another . this output signal of the xor gate is inverted by means of an inverter 69 . the control signal s 31 for the switch 31 is present at the output of said inverter 69 . said control signal s 31 assumes a low level in each case during the time durations δt 1 , δt 2 in order to open the switch 31 and thereby to deactivate the compensation arrangement 20 . the deactivation circuit 60 , 31 explained ensures that the compensation arrangement 20 is deactivated in each case after rising and falling edges of the input voltage vin , as a result of which settling operations of the operational amplifier 11 that follow such a level change of the input voltage vin , by means of the compensation arrangement 20 , do not affect the generation of the offset compensation signal v 21 . while the invention disclosed herein has been described in terms of several preferred embodiments , there are numerous alterations , permutations , and equivalents which fall within the scope of this invention . it should also be noted that there are many alternative ways of implementing the methods and compositions of the present invention . it is therefore intended that the following appended claims be interpreted as including all such alterations , permutations , and equivalents as fall within the true spirit and scope of the present invention .	7
a description of preferred embodiments of the invention follows . one embodiment of the invention is illustrated in fig1 - 3 . in step 10 , a commodity is hermetically sealed in a flexible container or enclosure 18 , such as that formed from a 0 . 813 mm ( 0 . 032 inch ), low air - permeable , ultraviolet - resistant food grade polyvinyl chloride sheet ( pvc ) material . in one embodiment , the container can include a pvc enclosure marketed by grainpro , inc . of concord , mass . under the trade name cocoons ™. the commodity can be packaged in individual jute bags 22 and stored on pallets 24 within the enclosure 18 . in the context of a hermetic enclosure , low air - permeable can be defined as low air - permeability through the enclosure compared to the initial consumption of air by the insects . if a vacuum is used , low air - permeable can be defined as low air permeability through the enclosure compared to the pumping capability of the vacuum at a designated pressure . in one embodiment , the enclosure is 15 m 3 with a ten metric ton capacity , and has an infiltration rate of less than about 10 liters / minute at 40 mm hg . even lower infiltration rates can be achieved with different materials that form the low air - permeable enclosures . in step 12 , a vacuum 20 is established in the enclosure by using a conventional commercial vacuum pump and set point regulator . the flexible container or enclosure prevents excessive stresses when evacuated as would occur with a rigid container by conforming to the shape of the enclosed commodity . the vacuum 20 , as shown in fig3 can include a vacuum pump 26 driven by a motor 28 . tubing or hose 38 connects the enclosure 18 to the vacuum pump 26 . an opening in the enclosure 18 , which can be opened or closed by means such as a solenoid - controlled inlet valve , is fed to the vacuum pump 26 with , if needed , an appropriate filter 30 in line 38 to prevent clogging or damage to the pump . in a particular embodiment , the vacuum pump 26 is allowed to run for an extended period of time so that either or both oxygen and interstitial moisture inside are substantially removed , typically down to a vacuum of 25 - 100 mm hg at room temperature representing an oxygen level equivalent to normal pressure of 3 - 13 %. at this time , the inlet valve is closed , and the hermetically sealed enclosure becomes a large “ vacuum pack ” ( step 14 ), with periodic pumping as required to compensate for residual infiltration of air , eliminating any of the respective causes of degradation named above due to either direct or indirect effects of oxygen . further , any residual moisture in the absence of oxygen will not as easily cause moisture - produced damage . the vacuum 20 can be controlled by control panel 34 coupled to a pressure sensor 32 to maintain a desired vacuum level . in alternative embodiments , the vacuum pump 26 runs continuously during storage of the commodity and is turned on and off by an on / off switch . the time , temperature , and vacuum conditions for removing biologically - active contaminants are a function of the type of contaminant , e . g ., the type of insect infestation , temperature , and the desired kill time . for example , it has been found that a 100 % kill of insects in coffee and cocoa beans can be achieved in three days using a vacuum in the range of 30 - 50 mm hg at room temperature . in some applications , it is desirable to remove the oxygen from the stored commodity to preserve the freshness which affects the taste of the commodity . in other applications , it is desirable to remove the oxygen from the stored commodity so that growth of fungi is curtailed and hence the production of aflatoxins . thus , in step 16 , the temperature of the commodity is maintained sufficiently high to ensure substantial kill of infesting insects within a desired time period . generally , the higher the temperature , the faster the insects will die as they respire more rapidly to deplete air within the hermetic enclosure 18 . in alternative embodiments , an insecticidal gas , such as propylene oxide , ozone , etc ., can be injected into the hermetic enclosure 18 , before or after applying a vacuum to the enclosure , to accelerate the kill time of the insects . in a particular embodiment , the insecticidal gas is injected into the hermetic enclosure prior to applying a vacuum to the enclosure 18 . of course , when additional gases are injected into the hermetic enclosure 18 , care must be taken to avoid gas mixtures which are flammable , explosive , etc . removal of the commodity from the sealed enclosure can be made through a commercially available hermetic “ zipper ,” such as the zipper sold by itw maxigrip specialty applications group under the trademark maxigrip , that is provided on the hermetic enclosure . it has been shown experimentally that the kill time for various life stages and species of insects varies as between life stages and species and is a strong function of ambient temperature . as shown in the table below , for 3 common insect pests , the kill time varies between the insects , and between the different life stages of the same insect . in these experiments , a commodity was placed in a hermetic enclosure 18 and a vacuum of 35 mm hg was applied . life insect species stage 25 ° c . 33 ° c . 37 ° c . 40 ° c . tribolium eggs 27 . 62 hours 16 . 31 hours 11 . 17 hours 4 . 12 hours castaneum ( red flour larvae 3 . 46 hours 3 . 29 hours 2 . 56 hours 1 . 94 hours beetle ) pupae 12 . 73 hours 11 . 48 hours 9 . 35 hours 3 . 83 hours plodia eggs 28 . 35 hours 6 . 21 hours 4 . 00 hours 2 . 49 hours interpunctella ( indian meal larvae 3 . 99 hours 2 . 69 hours 2 . 07 hours 2 . 10 hours moth ) pupae 5 . 35 hours 2 . 65 hours 2 . 44 hours 1 . 64 hours rhyzopertha eggs 176 . 32 hours 85 . 98 hours 46 . 32 hours 11 . 24 hours dominica ( lesser grain larvae 83 . 80 hours 49 . 58 hours 19 . 45 hours 6 . 47 hours borer ) pupae 98 . 28 hours 56 . 20 hours 22 . 14 hours 8 . 65 hours it has been discovered that the minimum temperature needed to ensure substantial total kill of all infesting insects within a desired time period is reached at substantially all portions of the commodity . thus , one must maintain the coolest part of the commodity at or above a given temperature , for example , with a heated warehouse , in the hermetic enclosure 18 for the greatest time period of the 3 life stages to kill the desired species . it has been found that a vacuum of between about 35 - 50 mm hg and a temperature above about 18 degrees celsius , and particular in the range of about 25 - 40 degrees celsius , works particularly well in the storage of some commodities . while this invention has been particularly shown and described with references to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims .	0
fig1 depicts the first embodiment 10 of the vacuum cleaner storage housing and vacuum cleaner of this invention disposed upon the floor 70 of a typical hair cutting salon , adjacent a customer &# 39 ; s chair 71 and in plain view . disposed within the top of the apparatus 10 are a plurality of wood chips 72 disposed within a storage area , 22 per fig4 from which extends a pair of preferably silk palm trees . in this view are seen the front wall 12 and the right side wall 15 of the main body 11 . left side wall 13 called out in fig2 is a mirror image of wall 15 . main body 11 sits on a base 25 also visible in fig1 . in fig2 which is a front view of the apparatus , there is shown the main body 11 &# 39 ; s front wall 12 , the spaced side walls 13 and 15 normally disposed thereto and the base 25 . optionally , but preferably the front wall 12 , and / or the two side walls 13 , 15 may employ a two part construction comprising a subwall 20 , usually of wood or perhaps metal or plastic with an overlay 19 of preferably a glass mirror or other laminated material such as formica ® or similar high pressure laminate sheet goods , or even a wood veneer . since the rear wall usually rests near or against a room wall , it need not have the outer layer or skin of the plastic , mirror or veneer . base 25 , which is formed of two pairs of spaced members nailed or otherwise joined together at their corners to form a rectangle , is sized to match the cross section of the main body 11 , and has a front opening 36 . seen in dashed line is top shelf 18 , which is normal to and spaced down from the upper edge of each of the front , side and rear walls . the trim molding 17 is disposed on these upper edges and thus helps to define the storage area 22 , seen in fig4 . see infra . the rear view fig3 is the next view to be discussed . here , rear wall 16 , is seen to have a cutout or opening 26 for access to the vacuum cleaner 27 which rests upon the bottom shelf 21 seen in dashed line in fig2 . opening 26 includes a recessed door jamb 24 , which serves as a stop for removable door 23 seen in fig8 by being recessed in from the exterior face of the wall a distance equal to the thickness of the door to be placed up against it . this is a conventional door opening carpentry technique . vacuum cleaner 27 may be a shop - vac ® or an equally heavy duty canister - type vacuum . vacuum 27 is a conventional unit and which comprises a motorized operational head 28 which is removably attached to a dirt receiving canister 29 . a flexible hose 30 frictionally engaged to , and in fluid communication with head 28 on one end extends downwardly within main body 11 to the bottom shelf 21 . shelf 21 has an opening 34 , or if desired a mere cutout , through which extends the intake opening 31 . flexible hose 30 on its distant end is frictionally engaged to and in fluid communication with intake opening 31 . such unions are conventional . see also fig6 . the reader is now referred to the top perspective view fig4 wherein the storage area 22 is seen . its use is for one or more preferably silk plants , as shown . storage area 22 is defined by the upper surface of the plant ( top ) shelf 18 and a pair of spaced divider members 14 which while shown running horizontally could run from front to back if desired and which are disposed at or near the leading and trailing edges of the shelf 18 . as shown , the divider members 14 are stapled or otherwise secured to the shelf 18 and to the two side walls 13 , 15 . each divider member is seen to be spaced a few inches from its respective front or rear wall to thereby provide a downward extending slot 33 which communicates with interior 46 for airflow . thus heat , which occurs from the vacuum head during periods of operation , can rise and escape to the atmosphere through the aforementioned slots . while a moisture nonpermeable top shelf 18 and divider members 14 are contemplated , for the sake of safety it is urged that only silk or plastic plants be disposed within the storage area 22 to avoid the necessity of adding water which could if murphy &# 39 ; s law is followed , drip down onto the vacuum cleaner and cause damage . we now turn to fig5 which is a sectional view taken along the line iii -- iii of fig3 just below the top shelf 18 . thus vacuum 27 is seen to be disposed upon bottom shelf 21 within interior 46 . each of the front two corners may include an optional stiffener 32 in the form of a 1 × 2 beam member running vertically with the subwall material 20 disposed therebetween . however from the point of view of construction , it may be easier to utilize the stiffeners only between the floor and the bottom shelf 21 ie . within the base 25 .. these stiffeners would help define the opening 36 which communicates with the throat 45 leading to nozzle 31 per fig6 . in fig6 which is a bottom plan view , the area beneath the second shelf 21 , is seen . here , a cross brace 42 is disposed between the two sides , 25a and 25b of the base , slightly distant from the midpoint along the depth of the sides . cross brace 42 may also be connected to the underside of bottom shelf 21 . cross brace 42 includes a central opening 43 into which is fitted the distal end of intake opening 31 , its proximal end being engaged as previously note the flexible tubing 30 . see fig3 . a pair of diverging , throat - defining members 44 , are each connected on one end to opposite sides of opening 43 , and on their other ends to the optional stiffeners 32 if employed , or to the front 25c of said base . thus a path that leads directly to intake opening 31 is seen to have been created , with the floor acting as the bottom surface , and the bottom shelf 21 serving as the upper part of this enclosure . wavy arrow 47 symbolizes the hair that would enter through opening 36 into the throat 45 and onward to the intake opening 31 on its way to the canister 29 . operation of the vacuum 27 is controlled by a conventional toe pedal actuator 39 connected electrically in line with an optional thermal sensor 40 , which is also electrically connected to the line cord 41 . one of each of the two ends of the line cord and the toe pedal actuator line 41 to the vacuum 27 are conventionally attached , but in the current figure they are shown unconnected for ease of depiction . a standard plug 38 is shown at the external end of the line cord 41 . see also fig5 . rear wall 16 is seen to include at least one opening 37 though which pass the wires for 39 and 41 . such openings are normally in the base 25 of the apparatus . fig8 again depicts the rear wall 16 shown with its top molding trim 17 . here , however , door 23 is shown installed in place up against door jamb 24 . door 23 is retained in place by rotatable retainer tabs 50 , which are each held against wall 16 by a single screw 51 . it is readily seen that rear wall 16 need not require the placement of an overlay such as a mirror or high pressure laminate since it normally rests against a wall and is seen only during such time as it is necessary to empty vacuum 47 , at which time the unit 10 , is moved away from the wall . a handle or knob 52 is shown centrally positioned on door 23 . it is within the skill of the art to replace upper retainers 50 with conventional hinges if desired . fig9 serves to merely recap the preferred mode of construction that has been previously discussed . thus a typical wall is seen to comprise a skin such as a mirror 19 adhesed to a wood or other material subwall 20 . to prevent someone from being cut by the mirror edge and to hide the end grain , as well as to enhance the aesthetics , a cap molding 17 may be overlaid on the combined edges of 19 and 20 . molding 17 may be frictionally fit or adhesed into place . solid wall construction without the use of a skin for the two side and front walls is also contemplated . fig1 depicts a second embodiment 100 , of this invention . here the front wall 111 has the access door 112 . door 112 is retained in place by side mounted hinges 122 , and is opened by knob 152 . base 25 and the elements found between the bottom shelf 21 , shown in dashed line , and the floor are the same as in the first embodiment . storage area 22 is also the same as in the first embodiment . rear wall 116 need not have an access door in view of the accessibility to the vacuum through front door 112 . from a sizing point of view , i have found that a unit having a width of about 14 inches , a depth of about the same amount and an overall height of about 2 feet 8 inches is aesthetically pleasing . a unit sized as such will fit easily through doors and will accommodate the preferred model vacuum cleaner recited above . obviously , if a smaller capacity vacuum is used a generally smaller unit could be built . larger units are also contemplated . while the embodiments described above both include a separate base section , it is recognized of course that the base can be integral with and a part of the side , front and rear walls . the use of a separate base is seen to be preferred , since the preferred skin over the wood subwall is glass mirrors . by not having the glass touch the floor , breakage due to impact with brushes , toes , or other implements can be avoided . while not required , it is preferred to line the interior 46 of the unit ( fig2 ) with a sound deadening material 49 , as by stapling it to the interior of the housing &# 39 ; s walls 13 , 15 , and 11 and perhaps the rear wall as well . such material is called out in the right cutaway of fig2 . while the two embodiments shown have the doors that access the interior on either the front or rear wall , obviously if desired , the access door could be placed in one of the side walls . a brief reference is made back now to fig4 . while the two divider members have been shown to be both spaced from the wall to which it is adjacent , it is within the contemplation of the inventor to provide only one of these dividers in a spaced relationship from its adjacent wall . this would provide an off center storage shelf with one large slot and one either small or non - existent slot , depending upon where the divider in question is disposed . books or implements of the trade can be retained hidden from general view within the storage area rather than the artificial plants shown in fig . if so desired . since certain changes may be made in the above apparatus without departing from the scope of the invention herein involved , it is intended that all matter contained in the above description and shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense .	0
referring now to the drawings , a wire harness holder embodying the principles of the present invention is illustrated therein and generally designated at 10 . in fig1 , the wire harness holder 10 is shown mounted to a panel 12 of an automotive the vehicle . more specifically , the wire harness holder 10 is illustrated as being mounted to an interior panel 12 of a vehicle &# 39 ; s passenger door . in this illustration , the presented view is looking exteriorly from the cabin of the vehicle and , accordingly , the top of the vehicle is oriented to the top of the page and the front of vehicle is oriented to the left of the page . received within the wire harness holder 10 is a wire harness 14 . the wire harness 14 itself is a bundle of electrical wires and leads that may be encased within a sleeve 16 . the individual wires and leads of the wire harness 14 extend to various components ( not shown ) of the door , such as a door lock switch , a window switch and a window regulator . as its primary component , the wire harness holder 10 includes a body having a channel 18 into which the wire harness 14 is received . the channel 18 defines a serpentine pathway that is generally of an s - shaped configuration . when mounted to the panel 12 , this configuration of the channel 18 provides the wire harness 14 with a drip loop , which is generally designated at 20 in fig1 and represented by a bend 22 in the channel 18 , and that is provided in a lowermost location in the installed position of the wire harness holder 10 . the drip loop 20 is therefore synonymous with the bend 22 seen in fig2 . this bend 22 of the channel 18 receives the wire harness 14 at a first end 24 of the channel 18 and causes the wire harness 14 to generally undergo a 90 ° upward bend . thereafter , channel 18 may undergo a second bend 26 that causes the wire harness 14 to generally undergo a 180 ° downward bend and exit the channel 18 at its second end 28 . the channel 18 is generally defined by a pair of opposed sidewalls 30 that are connected to one another by a bottom wall 32 . the channel 18 is open on a side opposite from the bottom wall 32 . as such , the wire harness 14 can be inserted into the channel 18 through the open side opposite of the bottom wall 32 , instead of having to be fed through the length of the channel 18 from the first end 24 to the second end 28 . to retain the wire harness 14 within the channel 18 , a retention strap 34 is provided . the retention strap 34 ( perhaps best understood with reference to fig3 and 4 ) is unitarily formed with one side wall 30 of the channel 18 by way of a living hinge 36 . the opposing end of the retention strap 34 is formed with a lip 38 configured to engage with a catch 40 formed on the opposing side wall 30 of the channel 18 . once the wire harness 14 has been positioned within the channel 18 , the retention strap 34 folded over the passageway of the channel 18 such that the lip 38 engages the catch 40 , thereby locking the wire harness 14 in position . as seen in the figures , the retention strap 34 is generally positioned in the second bend 26 of the channel 18 . it will be readily appreciated , however , that the retention strap 34 could alternatively be positioned at other locations along the channel 18 . to secure the body of the wire harness holder 10 to the panel 12 , a mounting flange 42 is provided . the mounting flange 42 in the illustrated embodiment is located along the outer sidewall 30 of the first bend 24 of the channel 18 . the mounting flange 42 is generally an extension adjacent to the bottom wall 32 and has a fastener 44 unitarily formed therewith . the fastener 44 may be one of a variety of fasteners and is generally illustrated as an arrowhead - type fastener 44 having a pair of resilient tangs 46 . in mounting the wire harness holder 10 to the panel 12 , the tangs 46 of the fastener 44 are inserted through a corresponding opening 48 in the panel 12 . as the tangs 46 pass through the opening 48 , the tangs 46 are compressed towards one another and thereafter resiliently expand outward so as to engage the perimeter of the opening 48 and prevent withdrawal of the fastener 44 out of the opening , thereby securing the wire harness holder 10 to the panel 12 . to further secure the wire harness 14 to the body of the wire harness holder 10 , the body is formed with a securement provision 50 located adjacent to one or both of the first and second ends 24 , 28 of the channel 18 . the securement provisions 50 ( two being shown ) are provided as angle brackets having a base wall 52 and a lateral wall 54 oriented at a right angle with respect to one another . the base wall 52 is generally formed as an extension of the bottom wall 32 , while the lateral wall 54 is generally formed as an extension of one of the sidewalls 30 . while provided with a right angle orientation , it will be appreciated that the base wall 52 and lateral wall 54 could be provided with angular orientations that are greater or lesser than 90 °. additionally , the securement provisions 50 could be formed as a single member . in the latter construction , only one of either the base wall 52 or lateral wall 54 is provided and the other is omitted . the free lateral edges of the base wall 52 and the lateral wall 54 are formed with a lip 56 at their distal ends . since the lip 56 is an abutment projecting in the plane of the base wall 52 or lateral wall 54 , it results in the defining of a recessed edge 58 along the free lateral edges , between the lip 56 and the channel 18 . the recessed edges 58 cooperates with the lips 56 to facilitate the application of tape ( not shown ) around the wire harness 14 , thereby securing the wire harness 14 to the securement provisions 50 . the lips 56 and recessed edges 58 minimize the possibility that the applied tape could inadvertently slide or be pulled off of the end of the securement provisions 50 . to facilitate the functioning of the first bend 22 in forming the drip loop 20 , the bend 22 may be provided with drain opening 60 formed in either the bottom wall 32 or lowermost sidewall 30 ( in the installed position ). in conjunction with features of the panel 12 that are beyond the scope of the present disclosure , the drain opening 60 helps to facilitate the handling and management of water that may infiltrate the interior of the door in which the wire harness holder 10 is mounted so as to minimize any potential damage caused by the water . as a person skilled in the art will readily appreciate , the above description is meant as an illustration of implementation of the principles this invention . this description is not intended to limit the scope or application of this invention in that the invention is susceptible to modification , variation and change , without departing from spirit of this invention , as defined in the following claims .	7
referring initially to fig1 a system is diagrammatically represented for operation with a document 11 illuminated by light source 12 . the light source 12 illuminates the rear of the document 11 to provide a translucent image of the fiber material of the document . the document 11 is moved by a transport t so that the document is scanned as it passes the array 15 . the total area to be scanned on the document 11 includes a mark ( in the form of a position reference grid 13 ) and the aperture portion of the document which is to be used for authentication i . e the target area to be scanned as indicated in fig3 . a portion of the total area to be scanned is projected through a lens 14 to a self - scanning detector array 15 . the resulting video signals from the array 15 are then processed by processing electronics 16 , discussed in detail below with reference to fig4 . fig2 illustrates the imaging of the projected document information as it impinges on the surface of a columnar array . each of the individual rectangular areas in the column of fig2 represents a single photosensitive area on the array . the areas each produce a single picture element ( pixel ) which are sequenced to provide a video signal from the array . the array 15 may be a two - dimensional or an area array , in which case the array would be an n × m array where n and m are any desired number or numbers suitable for sensing the desired portion of the document . it should be noted that the array 15 ( fig1 ) senses a narrow elongate light pattern from the document . the total area to be scanned on the document is sensed by scanning the document in the horizontal direction ( see fig1 ) and repeatedly sequencing through the array , vertically from the bottom to the top . thus , the area to be scanned is dissected in a vertical raster pattern to provide a video signal . as the document scanning occurs , the radiant energy impinging on the columnar array ( fig2 ) is divided into two vertical portions to be sensed by the regions 20 and 21 . the absolute position of these regions is determined by the location of the document in front of the imaging lens and as a result may vary from scan to scan . region 20 constitutes those elements of the array which sense the aperture ( fig3 ) of the document , i . e . the area that is to be used to authenticate the document . region 21 ( fig2 ) constitutes those elements of the array to sense the position feature reference grid 13 ( fig3 ) to control the system to consistently sense the aperture in the same location . the position reference grid 13 illustrated in fig3 is used to locate the aperture 33 for authentication of the document . as a moving document carries the position reference grid 13 into the field of view of the detector array 15 ( fig1 ), the start line 30 ( fig3 ) is first sensed by the array 15 . the purpose of the start line 30 is to present a detector in the processing electronics 16 ( see fig1 ) with an identifiable feature signifying that a reference line 31 ( fig3 ) immediately follows and that it lies within the confines of the vertical extent of the start line 30 . the reference line 31 of the grid 13 is used as a reference for determining the vertical position of the aperture 33 during scanning . the reference line 31 of the grid 13 coincides to the length of the aperture 33 for continual updating of the aperture position . tic marks 32 of the grid 13 are used for control of the transport t , velocity verification , sampling control , or further reference grid identification . a block diagram of the output from the detector array 15 ( fig1 ) and processing electronics 16 is illustrated in fig4 . considering that figure , a signal carrying video pixel information is provided from the self - scanning columnar array 50 as an output from the detector array 15 . the signal is amplified by an amplifier 52 , then sent to a position reference feature detector 54 and via a system controller 56 and a programmable pulse generator 57 to two pixel integrators 58 and 59 . those integrators provide digital signals representative of the sensed aperture . for the system to locate the aperture 33 ( fig3 ), the user of the system provides signalrepresented instructions or operation parameters to the system controller 56 through a user interface 60 . the instruction signals specify the type of reference features that are to be recognized and tracked , the position of the aperture 33 relative to the reference grid 13 , aperture dimensions , and so on . essentially , the position reference feature detector 54 is programmed to sense a specific video signal sequence that will be formed when a predetermined form of reference feature appears on a document . the system controller 56 , which may be a computer ( dedicated microprocessor or logic controller ) also sets a master clock 53 ( upper right ) to control the clock signal frequency for driving the array 50 and sequencing the elements to provide a continuous video signal . the scanning frequency is variable to allow compensation for velocity changes in the transport t ( fig1 ) which moves the document relative to the detector array 15 . the clocking circuits 51 ( fig4 top center ) divide the signal from the master clock 53 into various phases to provide a pixel clock signal required for the self - scanning operation of the array 50 to output pixel information in a serial sequence . accordingly , the optical image from the document 11 is dissected and the array 50 provides a clocked video signal of vertical raster - scan pixels . also included in the circuits 51 is a counter that is clocked by the pixel clock signals , which produces a start of scan pulse ( one pixel duration ) after each counting to the total number of elements in the array . the start of scan pulse resets the columnar array 50 to jump back to the first element ( new scan ) and also is supplied to the system controller 56 for synchronization . an item presence detector 55 ( fig4 right central ) receives a signal from the amplifier 52 to sense the presence of a document 11 and actuate the array 50 . when a document 11 is detected , the system controller 56 also is actuated . the item presence detector 55 , in one embodiment , consists of an integrator circuit and a fixed reference comparator . the integrator circuit is in the form of a low pass filter that serves to combine the signal pixel outputs from each scan of array 50 to simulate a single output signal as would be obtained from a single photosensor with a tall and narrow geometry . the integrated , filtered , or composite signal from the filter will have a much lower value when a document is positioned to interrupt the light source 12 ( fig1 ) than when the light source is viewed directly by the array detector 15 . the composite signal drives one input of a comparator circuit ( in the detector 55 , fig4 ) whose second input is adjusted to a reference voltage level . as a document covers the light source , the composite signal will drop below the reference voltage producing a logic level output from the detector 55 to indicate the presence of a document . the position reference feature detector 54 ( fig4 center ) in one embodiment , contains pattern recognition circuits that analyze the video signal from the amplifier 54 ( representing a pixel data stream ) to identify characteristics or features that indicate the reference grid 13 ( fig1 ) is being scanned . examples of features would be tall black lines or short black lines . such features can be detected by circuits that recognize a continuous stream of black pixels of predetermined length in the video signal . initially , the position reference feature detector 54 searches the video signal for the reference feature grid 13 required by the system controller 56 for tracking . the reference feature detector 54 provides the video signal to the system controller 56 indicating the pixel locations in which the position feature resides . for example , considering the reference feature grid 13 shown in fig3 the system controller 56 must be actuated on sensing the start line 30 ( fig3 ). hence , the reference feature detector 54 ( fig4 ) searches for the start line 30 ( fig3 ). once the start line 30 is sensed , the system controller 56 conditions the reference feature detector 54 to search repeatedly for the reference line 31 . an exemplary position reference detector 54 is illustrated in fig5 . operation is briefly as follows . feature data from the system controller 56 is loaded into data latch 1 , a register 36 , when the feature update control signal is received . the latched data is then compared by a digital comparator 37 to the video signal presented from a serial in - parallel out shift register 38 . the register 38 also receives a signal in the form of select video or b / w video which is generated by thresholding the pixel information with a fixed reference voltage in a comparator 39 . when both inputs to the digital comparator 37 are equal , a detection signal is sent to the system controller 56 ( fig4 ) and to a second data latch 40 ( fig5 ) which is driven by a counter 41 so as to register the pixel location where the feature was detected . a programmable pulse generator 57 ( fig4 lower left ) provides a real time signal ( pulse ) for control of the vertical pixel integrator 59 . the start of the pulse relative to the beginning of a line scan cycle of the scanned array determines the bottom position of the aperture 33 ( fig3 ) ( vertically ). the width of the pulse determines the number of pixels that will be included in the integration , i . e . vertical height of the aperture 33 . a digital form of the programmable pulse generator 57 is illustrated in fig6 . the circuit includes two eight - bit registers 61 and 62 . the output of register 61 goes to a comparator 63 and the output of register 62 goes to a comparator 64 . both comparators 63 and 64 receive the pixel count from an eight - bit pixel counter 65 . the results of the comparison of each comparator is input to flip flop 66 . operation of fig6 is briefly as follows . pixel counts , from the system controller 56 , that define the start and stop points of the output pulses are loaded into buffer registers 61 and 62 . buffer registers 61 and 62 each supply one set of inputs to the eight - bit logic comparators ( 63 and 64 ). the other input for each comparator is from pixel counter 65 that is reset at the start of each line scan . when the pixel count reaches the value set in register 61 , comparator 63 will produce an output that sets the output flip flop 66 to &# 34 ; 1 &# 34 ;. this establishes the leading edge of the output pulse . in a similar sequence of operation the pulse width or trailing edge is determined by the count stored in register 62 . a detailed form of the vertical pixel integrator 58 is illustrated in fig7 . the vertical integrator 58 combines the data from a continuous string of pixels through use of an analog integrator circuit . this can be viewed as a summation of the analog signals . the start and length of the integration period is controlled by the pulse signal from the programmable pulse generator 57 . the amplitude of the integrator output at the end of the integration window is sampled and retained for additional processing . one implementation of the circuit , as illustrated in fig7 is a conventional operation amplifier 71 , with a reset switch 74 followed by a tracking analog to digital converter 72 , with an output buffer 73 as the hold circuit . integration control is supplied through inverter 75 . the vertical pixel integrator 58 operates as follows . when the integration control signal is low , the integration reset switch 74 will be &# 34 ; on &# 34 ;, holding the integrator in a reset condition . the output will be near zero . during the integration time ( control high ) switch 74 is open allowing the amplifier 71 to function as an integrator with the pixel signal as an input . the tracking converter 72 will follow the integrated value . at the end of the integration time , the output buffer will be loaded with the signal results from the a / p converter 72 and the switch 74 will be closed to reset the integrator . the results of the pixel integration will be held as a ten - bit digital value until the completion of the next integration time , at which time it will be updated with new results . the function of the horizontal pixel integrator 59 ( fig4 ) is to combine a number of vertical scans to form the complete length of the aperture 33 . the width or horizontal size of the aperture 33 is controlled by the horizontal pixel integrator 59 and the height or vertical size is controlled or formed by the vertical pixel integrator 58 . since the output of the vertical pixel integrator 58 is in a digital word form , the integration or combining is done by adding together the outputs from as many scans as desired . this can be represented by an adder 81 and a buffer 82 that are reset after every &# 34 ; n &# 34 ; scans . the representation is illustrated in fig8 . based on the position ( vertical pixel count and possible horizontal scan count ) the system controller sends out signals controlling the integration of the pixel amplitude information on a scan - by - scan basis . the integration window dimensions ( vertical and horizontal ) are based on information supplied to the system controller by the user . considering the overall operation of the system of fig4 an operator actuates the user interface 60 to program the system controller 56 . specific instructions include : the pattern of the grid 13 ( fig1 ), the vertical displacement of the aperture 33 ( fig3 ) from the reference line 31 , i . e . the aperture position ; and the height of the aperture 33 . with the system prepared , a document 11 ( fig1 ) is received by the transport t for movement across the detector array 15 to accomplish scanning of the document 11 within the sensor field of view ( see fig3 ). it is to be understood that the sensor field of view on the document 11 is scanned pixel - by - pixel in a raster pattern of vertical lines ( bottom to top ) progressing from left to right . it is to be understood that in the course of scanning the document 11 , the detector elements 21 ( fig2 ) sense the grid 13 and thereby define the target area or aperture 33 which is sensed by the detector elements 20 . thus , the aperture 33 can be accurately and consistently sensed for testing the document 11 . to consider an exemplary operation in detail , the presence of a document in the sensor field of view is sensed by the item presence detector 55 . such presence obscures the direct illumination of the array 15 which is manifest as a level shift in the video signal from the amplifier 52 . as the scanning operation progresses , the start line 30 is detected as a continuous series of black - indicating pixels manifest in the observed video signal from the columnar array 50 ( fig4 ). essentially , the position reference detector 54 ( fig4 ) manifests the start line 30 ( fig3 ) as a detected signal on the occurrence of a video signal pattern defined as feature data from the system controller 56 . the presence of the start line ( manifest in the video signal from the amplifier 52 ) defines the leading edge of the aperture 33 ( fig3 ). subsequent operation of the system involves sensing the reference line 31 to locate the vertical displacement of the aperture 33 from that line . specifically , during each vertical scansion , the reference line 31 is manifest as a black - indicating spike or pixel in the video signal . such occurrences are sensed by the detector 54 ( fig4 ) to actuate the controller 56 which responds with a pair of control signals . specifically , an aperture vertical position control ( pulse delay ) signal manifests the vertical displacement of the aperture 33 ( fig3 ) from the line 31 . an aperture vertical size control ( pulse width ) signal manifests the height of the aperture 33 . both signals are applied to the pulse generator 57 to accomplish a vertical integration control signal . that signal is applied to the integrator 58 to gate and integrate sequences of the video signal representative of vertical scansions to form composite digital representations . the series of such digital representations is summarized by the integrator 59 which provides a digital output that is representative of the composite translucency pattern of the aperture 33 . it is to be understood from the above description that the aperture size is variable and is determined by the user of the system . the position reference feature grid is used to inform the system where the target area is located on the document thereby allowing the system to read any desired size target area on any document when scanned on different scanning systems . although specific embodiments have been given for the various parts of the system , changes and modification will be apparent to those skilled in the art , which changes and modifications are deemed to fall within the scope of the invention as defined by the appended claims .	6
fig1 is an overview block diagram illustrating an example communication system 102 in which embodiments of a secure content sharing system may be implemented . it is to be appreciated that fig1 illustrates just one example of a communications system 102 and that the various embodiments discussed herein are not limited to such systems . communication system 102 can include a variety of communication systems and can use a variety of communication media including , but not limited to , satellite wireless media . although various embodiments of the secure content sharing system are discussed with respect to a satellite communication system / network , the various described techniques may apply to other types of content distribution systems , including but not limited to , cable systems , fiber optic systems , telephony systems , and the like . in addition , in various embodiments , a content distribution system may provide various types of content , including , but not limited to , audio ( e . g ., music , audio books , etc . ), video ( e . g ., television programs , movies , user - generated content , etc . ), and other data content . audio , video , and / or data service providers , such as , but not limited to , television service providers , provide their customers located at one or more customer premises 116 a multitude of audio / video and / or data programming ( hereafter , collectively and / or exclusively “ programming ”). such programming is often provided by use of a receiving device 118 communicatively coupled to a presentation device 120 configured to receive the programming . receiving device 118 interconnects to one or more communications media or sources ( such as a cable head - end , satellite antenna , telephone company switch , ethernet portal , off - air antenna , or the like ) that provide the programming . the receiving device 118 commonly receives a plurality of programming by way of the communications media or sources described in greater detail below . based upon selection by the user , the receiving device 118 processes and communicates the selected programming to the one or more presentation devices 120 . for convenience , the receiving device 118 may be interchangeably referred to as a “ television converter ,” “ receiver ,” “ set - top box ,” “ television receiving device ,” “ television receiver ,” “ television recording device ,” “ satellite set - top box ,” “ satellite receiver ,” “ cable set - top box ,” “ cable receiver ,” “ media player ,” and / or “ television tuner .” accordingly , the receiving device 118 may be any suitable converter device or electronic equipment that is operable to receive programming . further , the receiving device 118 may itself include user interface devices , such as buttons or switches . in many applications , a remote 128 is operable to control the presentation device 120 and other user devices 122 . examples of a presentation device 120 include , but are not limited to , a television (“ tv ”), a personal computer (“ pc ”), a sound system receiver , a digital video recorder (“ dvr ”), a compact disk (“ cd ”) device , game system , or the like . presentation devices 120 employ a display 124 , one or more speakers , and / or other output devices to communicate video and / or audio content to a user . in many implementations , one or more presentation devices 120 reside in or near a customer &# 39 ; s premises 116 and are communicatively coupled , directly or indirectly , to the receiving device 118 . further , the receiving device 118 and the presentation device 120 may be integrated into a single device . such a single device may have the above - described functionality of the receiving device 118 and the presentation device 120 , or may even have additional functionality . a plurality of content providers 104 a - 104 i provide program content , such as television content or audio content , to a distributor , such as the program distributor 106 . example content providers 104 a - 104 i include television stations which provide local or national television programming , special content providers which provide premium based programming or pay - per - view programming , or radio stations which provide audio programming . program content , interchangeably referred to as a program , is communicated to the program distributor 106 from the content providers 104 a - 104 i through suitable communication media , generally illustrated as communication system 108 for convenience . communication system 108 may include many different types of communication media , now known or later developed . non - limiting media examples include telephony systems , the internet , internets , intranets , cable systems , fiber optic systems , microwave systems , asynchronous transfer mode (“ atm ”) systems , frame relay systems , digital subscriber line (“ dsl ”) systems , radio frequency (“ rf ”) systems , and satellite systems . further , program content communicated from the content providers 104 a - 104 i to the program distributor 106 may be communicated over combinations of media . for example , a television broadcast station may initially communicate program content , via an rf signal or other suitable medium , that is received and then converted into a digital signal suitable for transmission to the program distributor 106 over a fiber optics system . as another nonlimiting example , an audio content provider may communicate audio content via its own satellite system to the program distributor 106 . in at least one embodiment , the received program content is converted by one or more devices ( not shown ) as necessary at the program distributor 106 into a suitable signal that is communicated ( i . e ., “ uplinked ”) by one or more antennae 110 to one or more satellites 112 ( separately illustrated herein from , although considered part of , the communication system 108 ). it is to be appreciated that the communicated uplink signal may contain a plurality of multiplexed programs . the uplink signal is received by the satellite 112 and then communicated ( i . e ., “ downlinked ”) from the satellite 112 in one or more directions , for example , onto a predefined portion of the planet . it is appreciated that the format of the above - described signals are adapted as necessary during the various stages of communication . a receiver antenna 114 that is within reception range of the downlink signal communicated from satellite 112 receives the above - described downlink signal . a wide variety of receiver antennae 114 are available . some types of receiver antenna 114 are operable to receive signals from a single satellite 112 . other types of receiver antenna 114 are operable to receive signals from multiple satellites 112 and / or from terrestrial based transmitters . the receiver antenna 114 can be located at a customer premises 116 . examples of customer premises 116 include a residence , a business , or any other suitable location operable to receive signals from satellite 112 . the received signal is communicated , typically over a hard - wire connection , to a receiving device 118 . the receiving device 118 is a conversion device that converts , also referred to as formatting , the received signal from antenna 114 into a signal suitable for communication to a presentation device 120 and / or a user device 122 . often , the receiver antenna 114 is of a parabolic shape that may be mounted on the side or roof of a structure . other antenna configurations can include , but are not limited to , phased arrays , wands , or other dishes . in some embodiments , the receiver antenna 114 may be remotely located from the customer premises 116 . for example , the antenna 114 may be located on the roof of an apartment building , such that the received signals may be transmitted , after possible recoding , via cable or other mechanisms , such as wi - fi , to the customer premises 116 . the received signal communicated from the receiver antenna 114 to the receiving device 118 is a relatively weak signal that is amplified , and processed or formatted , by the receiving device 118 . the amplified and processed signal is then communicated from the receiving device 118 to a presentation device 120 in a suitable format , such as a television (“ tv ”) or the like , and / or to a user device 122 . it is to be appreciated that presentation device 120 may be any suitable device operable to present a program having video information and / or audio information . user device 122 may be any suitable device that is operable to receive a signal from the receiving device 118 , another endpoint device , or from other devices external to the customer premises 116 . additional non - limiting examples of user device 122 include optical media recorders , such as a compact disk (“ cd ”) recorder , a digital versatile disc or digital video disc (“ dvd ”) recorder , a digital video recorder (“ dvr ”), or a personal video recorder (“ pvr ”). user device 122 may also include game devices , magnetic tape type recorders , rf transceivers , and personal computers (“ pcs ”). interface between the receiving device 118 and a user ( not shown ) may be provided by a hand - held remote device 128 . remote 128 typically communicates with the receiving device 118 using a suitable wireless medium , such as infrared (“ ir ”), rf , or the like . other devices ( not shown ) may also be communicatively coupled to the receiving device 118 so as to provide user instructions . non - limiting examples include game device controllers , keyboards , pointing devices , and the like . the receiving device 118 may receive programming partially from , or entirely from , another source other than the above - described receiver antenna 114 . other embodiments of the receiving device 118 may receive locally broadcast rf signals , or may be coupled to communication system 108 via any suitable medium . non - limiting examples of medium communicatively coupling the receiving device 118 to communication system 108 include cable , fiber optic , or internet media . customer premises 116 may include other devices which are communicatively coupled to communication system 108 via a suitable media . for example , but not limited to , some customer premises 116 include an optional network 136 , or a networked system , to which receiving devices 118 , presentation devices 120 , and / or a variety of user devices 122 can be coupled , collectively referred to as endpoint devices . non - limiting examples of network 136 include , but are not limited to , an ethernet , twisted pair ethernet , an intranet , a local area network (“ lan ”) system , or the like . one or more endpoint devices , such as pcs , data storage devices , tvs , game systems , sound system receivers , internet connection devices , digital subscriber loop (“ dsl ”) devices , wireless lan , wifi , worldwide interoperability for microwave access (“ wimax ”), or the like , are communicatively coupled to network 136 so that the plurality of endpoint devices are communicatively coupled together . thus , the network 136 allows the interconnected endpoint devices , and the receiving device 118 , to communicate with each other . alternatively , or in addition , some devices in the customer premises 116 may be directly connected to the communication system 108 , such as the telephone 134 which may employ a hardwire connection or an rf signal for coupling to communication system 108 . a plurality of information providers 138 a - 138 i are coupled to communication system 108 . information providers 138 a - 138 i may provide various forms of content and / or services to the various devices residing in the customer premises 116 , such as receiving device 118 , user device 122 , and / or pc 132 . for example , information provider 138 a may provide requested information of interest to such devices , such as audio , video , and / or other types of data . information providers 138 a - 138 i may further perform various transactions on behalf of a user of a receiving device , such as when a user purchases a product or service via a receiving device 118 and / or one or more other devices of the user . the above description of the communication system 102 and the customer premises 116 , and the various devices therein , is intended as a broad , non - limiting overview of an example environment in which various embodiments of a secure content sharing system may be implemented . the communication system 102 and the various devices therein , may contain other devices , systems and / or media not specifically described herein . the customer premises 116 may differ from one customer to another , may contain fewer , more and / or other devices , systems and / or media than those described herein . as noted above , the content providers 104 a - 104 i , the information providers 138 a - 138 i , and / or the program distributor 106 may provide program content and / or various other types of content to a receiving device 118 . in some embodiments , the content providers 104 a - 104 i , the information providers 138 a - 138 i , and / or the program distributor 106 may restrict access to program content and / or other types of content , such that distributed content may only be viewed by and / or otherwise accessed by authorized users . in some instances , access to program content may be controlled by encrypting the program content , such that only authorized devices and / or users may access the program content . for example , if the program distributor provides content via a satellite network comprising antenna 110 and satellite 112 , then any person in possession of a receiving device 118 may receive the signal or signals carrying the program content and thereby access the program content . in order to control access to the program content , the program distributor 106 may encrypt the program content prior to its transmission , such that even if an unauthorized receiving device 118 receives the program content , it cannot access the program content unless it can obtain one or more appropriate decryption keys . the receiving device 118 may store or otherwise have access to program content and / or other types of content received from various sources ( e . g ., content providers 104 a - 104 i , information providers 138 a - 138 i , program distributor 106 ), such as for use by a user of the receiving device . for example , in some embodiments , the receiving device may store program content , such as for playback to a user of the receiving device 118 using dvr / pvr technology , pay - per - view services , and the like . program content may include television programs , movies , etc ., and / or portions thereof ( e . g ., clips ). in addition , the receiving device may store or otherwise have access to various other types of content that may be presented by or otherwise used by a receiving device , such as including other audio / video content ( e . g ., user - generated content ), audio content ( e . g ., music ), image content ( e . g ., photographs ), and / or various other types of information . in various embodiments , such program content and other content may be stored on various storage medium accessible to the receiving device 118 , including one or more hard disks included in the receiving device 118 and / or other devices that the receiving device may access via a communication link ( e . g ., user device 122 , pc 132 ), and / or other storage media ( including removable storage media ). the various embodiments disclosed herein , provide techniques to facilitate secure sharing of program content and / or other content stored on and / or otherwise accessible to a receiving device 118 located at a customer premises 116 with a group of one or more other receiving devices 118 located at one or more other customer premises 116 , such that the group of one or more other receiving devices 118 may present or otherwise utilize the shared content . for example , such techniques may allow a customer a to share such content of a receiving device located at customer a &# 39 ; s premises , with a group of one or more other customers ( e . g ., friends , family , etc .) located at other customer premises , such that the one or more other customers may obtain the shared content for presentation and / or use by receiving devices located at the premises of the one or more other customers . after having received and / or otherwise acquired shared content from customer a &# 39 ; s receiving device , the shared content may be presented by or otherwise used by the receiving devices of the one or more other customers , such as for presentation on an associated presentation device ( e . g ., presentation device 120 ), displaying on a television or other display , playing on a speaker , or the like . shared content of a receiving device located at a first customer premises may be provided to or otherwise obtained by a group of other receiving devices located at other customer premises in various ways in various embodiments . for example , in some embodiments , shared content may be transmitted between receiving devices , such as via a communication network ( e . g ., communication system 108 or portions thereof ). in some embodiments , shared content may be transported between receiving devices using various other data transmission and / or transfer techniques , including via removable storage media and the like . in some embodiments , access to shared content of a customer &# 39 ; s receiving device may be restricted such that only groups of one or more other receiving devices that are authorized to access the shared content may access or otherwise use the shared content . in at least some such embodiments , access to shared content of a first receiving device may be restricted for use by a group of one or more authorized receiving devices by providing access control information to the first receiving device that enables the first receiving device to encrypt content that it shares with the group of one or more authorized receiving devices , and separately providing access control information to the group of one or more other authorized receiving devices that enables such devices to decrypt content that has been encrypted by the first receiving device . thus , in such an embodiment , only receiving devices that have been provided with the appropriate access control information may decrypt content that is shared by the first receiving device . in some embodiments , access control information is provided by a program distributor 106 to the various receiving devices via a satellite network comprising antenna 110 and satellite 112 . in addition , in at least some embodiments , some or all of the described techniques are performed by an embodiment of a secure content sharing system , such as described in greater detail below . example embodiments described herein provide applications , tools , data structures and other support to implement a secure content sharing system . in the following description , numerous specific details are set forth , such as data formats , code sequences , and the like , in order to provide a thorough understanding of the described techniques . various of the embodiments described can be practiced without some of the specific details described herein , or with other specific details , such as changes with respect to the ordering of the code flow , different code flows , and the like . thus , the scope of the techniques and / or functions described are not limited by the particular order , selection , or decomposition of steps described with reference to any particular module , component , or routine . fig2 is a block diagram illustrating an example embodiment of portions of a secure content sharing system 200 . the secure content sharing system 200 enables customers of a program distributor 106 to form secure content sharing groups in which the customers share content stored on and / or accessible to receiving devices of the customers with one or more other customers that are authorized to access such content , such that the one or more authorized customers may access and / or otherwise use the shared content on their own receiving devices . the illustrated secure content sharing system 200 includes a program distributor 106 , a plurality of receiving devices 118 a - 118 i located at respective customer premises 116 a - 116 i , a satellite communication network 210 , and other communication network 212 . a content sharing access service 202 is provided by the program distributor 106 to facilitate secure content sharing between various of the receiving devices 118 a - 118 i , such as by providing capabilities related to specifying secure content sharing groups and enabling the receiving devices 118 a - 118 i within secure content sharing groups to encrypt and / or decrypt content that is shared within the groups . each of the receiving devices 118 a - 118 i is located at a respective one of the customer premises 116 a - 116 i and receives programming and / or other data provided by the program distributor 106 via the satellite network 210 for use of an associated customer of the particular customer premises . for example , the one or more receiving devices 118 a located at customer 1 premises 116 a receive programming and / or other data provided by the program distributor 106 for use of a customer 1 located with the customer 1 premises ; the one or more receiving devices 118 b located at a customer 2 premises 116 b receive programming and / or other data provided by the program distributor 106 for use of a customer 2 located with the customer 2 premises ; and so on . the satellite network 210 is part of a satellite distribution system and may include , for example , the antenna 110 and the satellite 112 described with respect to fig1 . various of the receiving devices 118 a - 118 i are interacting with various other of the receiving devices 118 a - 118 i via the other communication network 212 , such as to securely share content of the receiving devices in accordance with various of the described techniques , as well as interacting with the content sharing access service 202 to specify or otherwise manage secure content sharing groups . the other communication network 212 may be , for example , a publicly accessible network of linked networks , possibly operated by various distinct parties ( e . g ., the internet ), a private network ( e . g ., corporate , university , etc .) that is wholly or partially inaccessible to non - privileged users , one or more private networks with access to and / or from other private and / or public networks , and / or the like . although not illustrated here , the satellite network 210 and the other communication network 212 may be provided as part of the communication system 108 described with respect to fig1 . as previously noted , various of the receiving devices 118 a - 118 i may be grouped into secure content sharing groups . a secure content sharing group may , for example , include a group of two or more receiving devices located at different customer premises wherein at least one of the receiving devices shares content stored on and / or accessible to the receiving device with the other receiving devices in the secure content sharing group , such that only the other receiving devices in the group are authorized to access or otherwise use the shared content . access to shared content may be restricted such that only the receiving devices 118 a - 118 i in the secure content sharing group may access or otherwise use the shared content . a receiving device that shares content with other receiving devices in a secure content sharing group is variously referred to as a “ sharing device ” and / or a “ sharing receiving device ” in various embodiments . in some embodiments , a secure content sharing group may be configured to include only a single sharing device that shares its content with the other receiving devices in the group , with the other receiving devices being authorized to access content shared by the single sharing device . in other embodiments , a secure content sharing group may include multiple sharing devices that share content with the other receiving devices in the group , and / or may be configured such that all receiving devices in the group share content with each other . furthermore , in some embodiments , a receiving device may be included in multiple different secure content sharing groups , such as a receiving device that has been authorized to access shared content of multiple sharing devices . as one illustrative example of a secure content sharing group , the secure content sharing group 250 includes the receiving devices 118 a and 118 b , located at customer premises 116 a and 116 b , respectively . in this group , the receiving device 118 a shares content with the receiving device 118 b , which has been authorized to access or otherwise use shared content of the receiving device 118 a . additional receiving devices may be added or otherwise included in the secure content sharing group 250 , such that the additional receiving device may also be authorized to access or use various shared content of receiving device 118 a . for example , the receiving device 118 i may be added to the secure content sharing group 250 , after which the receiving device 118 i is authorized to access or otherwise use content shared by the receiving device 118 a . although not illustrated in fig2 , various other secure content sharing groups may exist and / or be created . for example , a secure content sharing group may be formed that includes receiving device 118 b as a sharing device and receiving device 118 i and / or any number of other receiving devices ( not shown ) as devices that are authorized to access shared content of the sharing device 118 b , etc . as part of configuring a secure content sharing group 250 , the content sharing access service 202 interacts via the satellite network 210 with the various receiving devices 118 a - 118 b that are included in the secure content group , such as to provide access control information to the receiving devices to enable the secure content sharing group to share encrypted content that only receiving devices in the group 250 may access . the content sharing access service 202 provides access control information to a receiving device 118 a to enable the receiving device to encrypt content that it shares with other receiving devices included in the secure content sharing group . such access control information may cause and / or otherwise allow the receiving device 118 a to determine a cryptographic key to use for encrypting content that it shares with other receiving devices in the group . the content sharing access service 202 also provides access control information to other one or more receiving devices , such as receiving device 118 b , that are included in the secure content sharing group 250 to enable such other receiving devices to decrypt content that has been encrypted by the sharing receiving device 118 a for use by device in the content sharing group . such access control information may cause and / or otherwise allow such receiving devices to determine a cryptographic key to use for decrypting the shared content that the sharing receiving device 118 a has encrypted . of course , if other receiving devices are added to the content sharing group 250 , such as receiving device 118 i , the content sharing access service 202 provides access control information via the satellite network 210 to the other receiving devices to enable such receiving device to decrypt content shared by the receiving device 118 a . after a content sharing group 250 has been configured to share encrypted content that only receiving devices in the group 250 may access , the receiving devices in the group may share the encrypted content in various ways in various embodiments . in some embodiments , the sharing receiving device 118 a may transmit encrypted shared content to one or more other receiving devices in the shared content group ( e . g ., receiving device 118 b ) via a communication network , such as the other communication network 212 and / or the satellite network 210 , such as by using various data transmission protocols ( e . g ., tcp / ip , ftp , http , and the like ). for example , in some such embodiments , the receiving device 118 b in the content sharing group 250 may interact with the sharing receiving device 118 a via the other communication network 212 to request one or more pieces of shared content from the receiving device 118 a , with the receiving device 118 a responding to the request by encrypting the requested content pieces for access by the receiving device 118 b and providing the encrypted content to the receiving device 118 b via the other communication network 212 . after the receiving device 118 b receives the encrypted content from the receiving device 118 a , it may decrypt the content for presentation and / or other use by the content receiving device 118 b . in other embodiments , the sharing receiving device 118 a may store encrypted shared content on a removable storage media ( e . g ., usb , cdrom , etc ) or other storage media that may be provided to or otherwise made accessible to the one or more other receiving devices in the content sharing group . additional details related to configuring receiving devices to share content in a secure content sharing group and related to secure content sharing are described below and with respect to fig3 a - 3b . a secure content sharing group may be created in various ways in various embodiments . in one exemplary embodiment , the content sharing access service 202 provides capabilities that enable customers to specify and / or manage secure content sharing groups via receiving devices of the customers , with the content sharing access service 202 configuring the various receiving devices in the secure content sharing groups according to such customer specification . in some such embodiments , a customer may interact with the content sharing access service 202 to indicate one or more other customers with whom the customer authorizes to share content of a receiving device of the customer . as a result of such interactions , the content sharing access service 202 may determine the various receiving devices that are in the created secure content sharing group ( e . g ., by accessing a customer database that includes such information , etc .) and interact with the various receiving devices in the created secure content sharing group via the satellite network to provide access control information to the receiving devices , such as described above . as one illustrative example , a customer 1 associated with the customer 1 premises 116 a may interact with the content sharing access service 202 via the other communication network 212 to create the secure content sharing group 250 , such as by providing information and / or otherwise indicating that the customer 1 wishes to share content of the receiving device 116 a with the receiving device 118 b associated with a customer 2 associated with the customer 2 premises 116 b . after receiving such indications , the content sharing access service 202 provides access control information to the receiving devices 118 a and 118 b to enable those receiving devices to share encrypted content with the secure content sharing group 250 . at a later time customer 1 may interact with the content sharing access service 202 to add one or more other receiving devices to the group , with content sharing access service 202 providing access control information to the added receiving devices to enable them to share content within the group . the content sharing access service 202 may facilitate the various types of interactions by customers in various ways in various embodiments , such as including programmatic interactions based on an api ( application programming interface ) provided by the content sharing access service 202 and / or interactive interactions based on a graphical user interface provided to customers ( e . g ., via one or more web pages hosted by the content sharing access service 202 , via a client - side application of the executing on a receiving device and / or other computing device of a customer , etc .). although an embodiment has been described that includes a customer interacting with the content sharing service 202 via the other communication network 212 to specify groups of receiving devices that the customer wishes to share content with , other embodiments are possible . for example , in some embodiments , a customer may interact with the content sharing access service 202 to specify secure content sharing groups in other ways , such as by telephoning a customer representative of the program distributor 106 , etc . in some embodiments , the content sharing access service 202 may provide other information to the receiving devices in the secure content group to facilitate formation of a secure content sharing group , such as identifiers that may be used to determine a location of where shared content resides ( e . g ., a network address of a sharing device , etc .) as well as other information that may be used to identify receiving devices that are in the secure content sharing group , etc . such other information may be provided to the receiving devices in various ways , such as via the satellite network 210 , the other communication network 212 , etc . although a satellite network 210 is provided in the illustrated embodiment of fig2 , it will be appreciated that in other embodiments of a secure content sharing system 200 other program distribution systems / networks may be used , such as including , but not limited to , cable systems , fiber optic systems , telephony systems , and the like . in addition , in some embodiments , the content sharing access service 202 may interact with the plurality of receiving devices 118 a - 118 i to facilitate secure content sharing via the other communication network 212 . as previously noted , the content shared may be a recorded video program , a dvd , an audio file or some other electronic content . the following are examples that may be carried out according to various embodiments . customer 1 may have watched a particular program of high interest , for example , the super bowl , the final show of american idol , or a particular classic movie . the program may have been recorded on the local dvr or hard disk located in the receiving device 118 a at customer 1 premises . customer 1 may have indicated that such a recorded program is available for access to receiving devices in a content sharing group . at some later time , customer 2 , who has been authorized to access shared content of customer 1 , may wish to view the program that is stored on customer 1 &# 39 ; s receiving device 118 a . in this case , customer 2 may obtain a copy of the particular recorded program , such as by interacting with customer 1 &# 39 ; s receiving device 118 a via customer 2 &# 39 ; s receiving device 118 b to request access to the particular recorded program , with the particular program being encrypted for use by customer 2 &# 39 ; s receiving device 118 b and then provided to customer 2 &# 39 ; s receiving device 118 b for viewing , such as variously described herein . a particular example of the use of the system is as follows . assume that customer 1 is having a super bowl party at his home . he invites a number of guests , including relatives , neighbors and friends to watch the super bowl together at his home . this is customer premises 116 a . among the guests who attend are his sister and her family , who live a few miles away . the super bowl party is enjoyed by those who attend as they watch the plays , the replays and commercials . customer 1 records the super bowl on his local hard disk or dvd inside his receiving device 118 a while it is being transmitted so it is now stored in his local machine 118 a in his premises for replay when ever he wishes . after the party is over , the guests return to their individual homes . the sister had intended to set her local set - top box to record before going to the super bowl party , but neglected to do so . therefore , when she attempts to watch some of the super bowl events at her own home , she is not able to do so . both have the same satellite network provider , for example , dish network ®, provided by dish network llc of englewood , colo . the sister is customer 2 , at premises 116 b . at sometime prior , the brother and sister had joined a common customer group with the satellite network provider , for which they may have paid a different fee and may have a different monthly payment structure . they are both in the same secure content sharing group 250 . using the content sharing access service 202 as described herein , the sister may obtain a copy of the super bowl recorded on her brother &# 39 ; s receiving device 118 a for viewing on her receiving device 118 b . similarly , customer 2 can send video programs , audio programs , movies and other data from her receiving device 118 b to customer 1 &# 39 ; s receiving device using the system described herein . customers 1 and 2 can exchange various video programs with each other they wish using the system described herein . assume other people at the same super bowl party are not part of the same secure content sharing group 250 . such people will not be able to access the recorded version of the super bowl for customer 1 even if they have the same satellite network provider . unless the proper authorizations have been provided , the customer 1 would not be able to exchange recorded data or video program information with them . without the proper codes and authorization access provided by the program distributor , such sharing is not permitted . fig3 a - 3b illustrate examples of interactions between portions of a secure content sharing system 200 . in particular , fig3 a illustrates a content sharing access service 202 providing access control information via a satellite network 210 to a receiving device 118 a located at a customer 1 premises 116 a , and providing access control information 302 b to a receiving device 118 b located at a customer 2 premises 116 b , such as to enable the receiving device 118 a to securely share content with the receiving device 118 b , such as in a secure content sharing group 250 . in this example , the content sharing access service 202 has received an indication to enable a content sharing group 250 , that includes the receiving device 118 a as a sharing receiving device and the receiving device 118 b as a receiving device that is authorized to access content shared by the receiving device 118 a , such as , for example , in response to an indication by a customer 1 associated with the customer 1 premises 116 a to create such a group . the content sharing access service 202 determines appropriate access control information to provide to the various receiving devices in the secure content sharing group such that the receiving devices may exchange encrypted content that only the receiving devices in the secure content group may access , and provides the appropriate information to the various receiving devices via the satellite network 210 . in this illustrated example , the content sharing access service 202 provides access control information 302 a to the receiving device 118 a that enables or otherwise instructs the receiving device 118 a to determine an appropriate encryption key to use for sharing content with one or more other receiving devices included the secure content sharing group 250 , such as the receiving device 118 b . the content sharing access service 202 also provides access control information 302 b to the receiving device 118 b that enables or otherwise instructs the receiving device 118 b to determine an appropriate decryption key to use for accessing shared content of the receiving device 118 a . in some embodiments , the encryption key and the decryption key may be symmetric keys ( e . g ., such as shared secret keys ), and in such embodiments the receiving device 118 a encrypts content for use by the receiving devices in the secure content sharing group 250 using a symmetric key algorithm , such as des (“ data encryption standard ”), triple des , aes (“ advanced encryption standard ”), blowfish , rc5 , rc5 , rc66 , vernam ciphers , or the like . in other embodiments , the encryption key and the decryption key may be an asymmetric key pair , and in such embodiments the receiving device 118 a encrypts content for use by the receiving devices in the secure content sharing group 250 using an asymmetric algorithm such as rsa (“ rivest , shamir , adelman ”), elgamal , or the like . in some embodiments , the access control information may include an identifier or information that is uniquely associated with the secure content sharing group ( e . g ., such as a randomly generated identifier ; a customer identifier ; an identifier associated with the sharing receiving device ; etc . ), such that the receiving devices may individually generate and / or otherwise obtain an appropriate cryptographic key to use with the secure content sharing group . for example , in some embodiments access control information 302 a and 302 b may include a unique identifier that is associated with the content sharing group 250 , with each of the receiving devices 118 a and 118 b using that information to seed a key generation algorithm to generate an appropriate cryptographic key ( e . g ., receiving device 118 a generates an encryption key , and receiving device 118 b generates a decryption key ). in some such embodiments , the access control information may also include indications of one or more key generation algorithms / techniques to use for generating cryptographic keys . in other embodiments , the access control information may otherwise indicate one or more keys for the receiving devices to use in the secure content sharing group . for example , the access control information 302 a and 302 b may indicate keys that are currently stored ( e . g ., in a cryptographic key storage hardware , in memory , on disk , etc .) or otherwise available to the receiving devices . in some embodiments , the access control information may include the appropriate cryptographic keys , such as access control information 302 a may include the encryption key , and access control information 302 b may include the decryption key . in some embodiments , the access control information may include various other information . for example , in some embodiments , the access control information 302 a and 302 b may include indications of an encryption algorithm to use for encrypting / decrypting shared content , indications of where to obtain shared content ( e . g ., network address of the sharing device 118 a ), access identifiers to use in obtaining / providing shared content , etc . in some situations and embodiments , the access control information 302 a and 302 b may contain the same information and / or may contain different information . as previously noted , the content sharing access service 202 determines appropriate access control information to provide to the receiving devices in a secure content sharing group . in some embodiments , such information may be stored in a database and / or other storage medium in association with the access control group , such that the content sharing access service 202 may obtain appropriate access control information from such storage when configuring various receiving devices to participate in the secure content sharing group . when the content sharing access service 202 receives indications to add other devices ( not shown ) to the content sharing group 250 , the content sharing access service 202 determines the appropriate access control information associated with the secure content sharing group ( e . g ., obtains from storage ) and provides such information to the addition receiving devices via the satellite network 210 . in some embodiments , the access control information 302 a , which enables the receiving device 118 a to encrypt shared content for the secure content sharing group 250 , may be provided to the receiving device 118 a prior to adding other receiving devices , such as the receiving device 118 b , to the secure content group 250 . for example , in some embodiments , the receiving device 118 a may be preconfigured by the content sharing access service 202 to encrypt shared content for other devices in the secure content sharing group 250 . various other embodiments may include various other features and / or functionality . in some embodiments , the access control information itself may be encrypted by the content sharing access service 202 prior to being provided to the various receiving devices in the secure content sharing group , such that only the receiving devices that are intended to receive the access control information may access such encrypted information . for example , the access control information 302 a may be encrypted by way of an identifier or key , such as a subscription key , service key , user key , hardware identifier , or the like , that is uniquely associated with the receiving device 118 a , such that only the receiving device 118 a may decrypt the content . access control information 302 b may be similarly encrypted for access by the receiving device 118 b . in addition , in some embodiments , the access control information and / or cryptographic keys may be periodically changed / updated for a secure content sharing group , and in such cases the content sharing access service 202 may provide new access control information to the various receiving devices in the secure content sharing group . fig3 b continues the example of fig3 a and illustrates a secure content sharing group 250 , with the receiving device 118 a located at customer 1 premises 116 a securely sharing content 372 with the receiving device 118 b located at the customer 2 premises 118 b in accordance with various of the described techniques . the receiving device 118 a includes content sharing logic 302 , content 304 , and content sharing information 306 including an encryption key 308 . the content sharing logic 302 , when executed by the receiving device 118 a , enables the receiving devices 118 a to securely share content 304 of the receiving device 118 a with other receiving devices in a secure content sharing group , such as receiving device 118 b . the content 304 includes programming content and / or other content that is stored on or otherwise accessible to the receiving device 118 a , some of which may be shared by the receiving device 118 a . the content sharing information 306 includes information related to one or more content sharing groups that the receiving device 118 a may be included in . for example , in this illustrated embodiment , the content sharing information includes the encryption key 308 that the receiving device 118 a uses to encrypt content that it shares with receiving devices in the secure content sharing group 250 . the receiving device 118 b includes content sharing logic 312 , content 314 , and content sharing information 316 including a decryption key 318 . the content sharing logic 312 , when executed by the receiving device 118 b , enables the receiving devices 118 b to access or otherwise obtain content shared by the receiving device 118 a . the content 314 includes programming content and / or other content that is stored on or otherwise accessible to the receiving device 118 b , including content that the receiving device 118 b has obtained from one or more other receiving devices , such as receiving device 118 a . the content sharing information 316 includes information related to one or more content sharing groups that the receiving device 118 b may be included in . for example , in this illustrated embodiment , the content sharing information includes the decryption key 318 that the receiving device 118 b uses to decrypt content that the receiving device 118 a shares with receiving devices in the secure content sharing group 250 . in this particular example , the receiving devices 118 a and 118 b have respectively received access control information 302 a and 302 b from the content sharing access service 202 , such as illustrated in fig3 a . in response to receiving access control information 302 a , the receiving devices 118 a has determined the encryption key 308 to use for encrypting content ( such as content 304 ) that the receiving device 118 a shares with other receiving devices in the secure content sharing group 250 , such as receiving device 318 b . for example , the content sharing logic 302 may include logic for generating and / or otherwise obtaining the encryption key 308 based on the received access control information , and may store the encryption key 308 for later use in encrypting shared content . similarly , in response to receiving access control information 302 b , the receiving device 118 b has determined the decryption key 318 to use for decrypting content that the receiving device 118 a shares in the secure content sharing group 250 , and has stored the decryption key 318 for later use in decrypting such content . the receiving device 118 a receives requests and / or other indications to share one or more pieces of content 304 with a receiving device 118 b in the secure content sharing group 250 . in response to such requests , the receiving device 118 a determines an appropriate encryption key to use for encrypting the requested content , such as the encryption key 308 associated with the secure content sharing group 250 . after the appropriate encryption key 308 has been determined , the receiving device encrypts the requested content using the encryption key 308 and provides the encrypted requested content 372 for use by the receiving device 318 b . when encrypting requested shared content , the receiving device 118 a may encrypt some or all of the requested content using the encryption key 308 . for example , in some embodiments , the receiving device may only encrypt audio and / or video tracks of content that includes both audio and video tracks ; may encrypt one or more segments of a video / audio track ( e . g ., every other second ), etc . in some embodiments , the requested content may already be encrypted , such as by the program distributor or other content provider who provided the content to the receiving device 118 a . in some such cases , when the receiving device 118 a shares such requested content , the receiving device may not encrypt the content itself , as it is already encrypted , but may instead encrypt one or more cryptographic keys that may be used to decrypt the requested content using the encryption key 308 , and provides those encrypted keys along with the requested content . the encrypted content 372 may be provided to the receiving device 118 b in various ways in various embodiments . for example , in some embodiments , the receiving device 118 a may send the encrypted content 372 directly to the receiving device 118 a via a communication network , such as by sending , writing , streaming , transmitting , etc . in other embodiments , the receiving device 118 a may post the encrypted shared content 372 to a network server ( e . g ., a file server , etc .) for download by the receiving device 118 a . in still other embodiments , the receiving device 118 a may write the encrypted content onto a removable storage media that may subsequently be transported to the receiving device 118 b . in some embodiments , the content sharing logic 302 and / or 312 enables the receiving devices 118 a and 118 b , respectively , to interactively share content , such as over a communication network ( e . g ., the other communication network 212 of fig2 ). for example , in some such embodiments , the receiving device 118 b may interact via a communication network with the receiving device 118 a to request shared content , with the receiving device 118 a encrypting and providing the requested shared content to the receiving device 118 b in response to such a request . after the receiving device 118 b receives or otherwise obtains the encrypted content 372 , the receiving device 118 b may determine an appropriate decryption key to use with such content 372 shared by the receiving device 118 a , such as the decryption key 318 associated with the secure content sharing group 250 , and decrypts the content 372 . after the content has been decrypted , the receiving device may present and / or otherwise use the content as appropriate . although this embodiment has been described in terms of one - way sharing , from receiving device 118 a to receiving device 118 b , other embodiments are possible . in some embodiments , the access control information provided by the content sharing access service 202 may enable the receiving devices in the content sharing group 250 to share content in a two - way manner , such that each of the devices in the group may encrypt and share content that other receiving devices in the group may decrypt . for example , as illustrated in fig3 b , the receiving device 118 a may optionally obtain shared content 376 from the receiving device 118 b . in some such embodiments , the receiving device 118 a may be able to perform both encryption and decryption using the encryption key 308 , while the receiving device 118 b may be able to perform both encryption and decryption using the decryption key 318 , although in other embodiments other keys ( not shown ) may have been determined from the access control information provided to the respective receiving devices 118 a and 118 b that may be used for such purposes of two - way sharing . in still other embodiments , an additional secure content sharing group may formed ( not shown ), in addition to the content sharing group 250 , that includes the receiving device 118 b as the sharing device and the receiving device 118 a as a device that obtains shared content from the receiving device 118 b , with access control information being provided by the content sharing access service 202 as appropriate to enable such secure sharing between the additional group . in some embodiments , the sharing logic 302 and / or 312 may enable a customer to configure or / other manage secure content sharing groups . for example , the sharing logic 302 may enable a customer to interact with an embodiment of the content sharing access service 202 to specify / manage one or more content sharing groups . in other embodiments , the content sharing logic 302 and / or 312 may enable customers to control access to various content of a receiving device . for example , the content sharing logic 302 may provide functionality that allows a customer / user interacting with the receiving device 118 a to specify or otherwise indicate particular content that the customer / user wishes to share , such as by specifying particular pieces of content ( e . g ., a particular program , album , song , photo album , picture , etc . ), particular categories of content ( e . g ., by type , such as programming , music , photo albums , etc ; by ratings , such as pg , tv - pg , etc ; and the like ), etc . in a similar fashion , the content sharing logic 302 may also enable a customer / user of the receiving device 118 a to mark or otherwise indicate content that is not to be shared . in addition , the content sharing logic 302 may enable the customer / user to provide and / or restrict various shared content for use by particular other receiving devices in a secure content sharing group , such as by enabling the customer / user to specify which of the shared content ( e . g ., particular content , types of content , etc .) each of the one or more of the other receiving devices in the secure content sharing group are allowed to access . for example , the customer may use such functionality to permit customer 2 &# 39 ; s receiving device 118 b to access all shared content , while restricting access to such shared content for another receiving device in the secure content sharing group to children &# 39 ; s programming and / or particular photo albums , etc . in addition , the cryptographic keys ( encryption key 308 and decryption key 318 ) determined respectively by the receiving devices 118 a and 118 b based on the provide access control information ( 302 a and 302 b ) may be used in other ways in other embodiments of a secure content sharing group . for example , in some embodiments , the receiving devices 118 a and 118 b may use their respective cryptographic key for the purposes of authenticating each other and / or other receiving devices in the secure content sharing group 250 . for example , the receiving devices 118 a and 118 b may authenticate the identity of the other device using their cryptographic keys to generate / validate digital signatures . in some such embodiments , after a receiving device 118 a has authenticated the identity of the other receiving device 118 b as being part of the secure content sharing group ( or vice versa ), the receiving device may provide other services and / or functionality for use by the receiving device 118 b . fig4 is a block diagram of example computing systems suitable for executing example embodiments of portions of a secure content sharing system . fig4 shows a receiving device computing system 118 that may be utilized to implement an embodiment of content sharing logic 302 , and a server computing system 460 that may be utilized to implement and embodiment of the content sharing access service 202 . the server computing system 460 may be provided by a program distributor ( e . g ., the program distributor 106 of fig1 and 2 ). in one embodiment , the receiving device computing system 118 is configured to receive and display programming on a presentation device . in addition , the receiving device 118 may comprise one or more distinct computing systems / devices and may span distributed locations . furthermore , each block shown may represent one or more such blocks as appropriate to a specific embodiment or may be combined with other blocks . also , the content sharing logic 302 may be implemented in software , hardware , firmware , or in some combination to achieve the capabilities described herein . in the embodiment shown , the receiving device computing system 118 comprises a computer memory (“ memory ”) 401 , a display 402 , one or more central processing units (“ cpu ”) 403 , input / output devices 404 ( e . g ., keyboard , mouse , crt or lcd display , and the like ), other computer - readable media 405 , and network connections 406 . content sharing logic 302 is shown residing in memory 401 . in other embodiments , some portion of the contents of the content sharing logic 302 may be stored on and / or transmitted over the other computer - readable media 405 . the content sharing logic 302 preferably executes on one or more cpus 403 to securely share and / or access shared content , and / or to configure the receiving device 118 to perform operations related secure content sharing , as described herein . other code or programs 430 ( e . g ., a user interface (“ ui ”) manager , an audio / video processing module , a program guide manager module , a web server , and the like ) and potentially other data repositories , such as data repository 420 , also reside in the memory 401 , and preferably execute on one or more cpus 403 . of note , one or more of the components in fig4 may not be present in any specific implementation . for example , some embodiments may not provide other computer readable media 405 , etc . the other receiving devices 450 may include similar components and / or blocks to those described with respect to the receiving device 116 , although such are not shown in fig4 here . the content sharing logic 302 performs various of the described functionality of the receiving device 118 related to secure content sharing such as describe with respect to fig2 and 3a - 3b above . for example , the content sharing logic 302 may receive and / or otherwise obtain access control information , such as provided via the communication system 108 , and determine based on such information a cryptographic content key to use for secure content sharing and / or access shared content generate , as well as perform encryption / decryption as appropriate for sharing content in a secure content sharing group . in addition the content sharing logic 302 may interact via the communication system 108 with one or more other receiving devices 450 , and possibly with the server computing system 460 , and / or with other computing systems or devices ( not shown ), to perform various of the described operations related to secure content sharing . the data repositories 420 may include content , such as programming content and / or other types of content obtained from a program distributor ( not shown ) and / or one or more other computing systems ( e . g ., content providers 104 a - 104 i , information providers 138 a - 138 i from fig1 ), such as via communication system 108 . the content may be received from various other sources , including the other computer - readable media 405 and / or other computing systems or devices ( not shown ), such as computing systems / devices located at a customer premises with the receiving device 118 , etc . as discussed elsewhere , such content may include programming , clips , audio / video , audio , images , and / or other data files , etc . in at least one embodiment , at least some of the content included in the data repositories 420 may be encrypted for restricted access by the receiving device computing system 118 ( e . g ., by a program distributor or other content provider ) and may include one or more corresponding encryption keys that are usable for decrypting at least portions such content . in this illustrated embodiment , the server computing system 460 comprises a memory 461 , one or more cpus 463 , input / output devices 464 ( e . g ., keyboard , mouse , crt or lcd display , and the like ), and / or various other components ( not shown ), e . g ., computer readable media , network connections , etc . the content sharing access service 202 preferably executes on one or more cpus 463 to configure and / or specify one or more secure content sharing groups , as described herein . furthermore , each block shown may represent one or more such blocks as appropriate to a specific embodiment or may be combined with other blocks . also , the content sharing access service 202 may be implemented in software , hardware , firmware , or in some combination to achieve the capabilities described herein . the content sharing access service 202 performs various of the described functionality , as described in fig2 and 3a - 3b . in particular , the content sharing access service 202 may interact with the receiving device 116 and other receiving devices 450 via the communication system 108 , such as to configure and / or otherwise manage receiving devices to participate in secure content sharing groups . in an example embodiment , components / modules of the content sharing logic 302 and / or the content sharing access service 202 are implemented using standard programming techniques . for example , the content sharing logic 302 and / or the content sharing access service 202 may be implemented as “ native ” executables running on the cpu 403 and cpu 463 respectively , along with one or more static or dynamic libraries . in other embodiments , the content sharing logic 302 and / or the content sharing access service 202 may be implemented as instructions processed by virtual machine . in general , a range of programming languages known in the art may be employed for implementing such example embodiments , including representative implementations of various programming language paradigms , including but not limited to , object - oriented ( e . g ., java , c ++, c #, visual basic . net , smalltalk , and the like ), functional ( e . g ., ml , lisp , scheme , and the like ), procedural ( e . g ., c , pascal , ada , modula , and the like ), scripting ( e . g ., perl , ruby , python , javascript , vbscript , and the like ), declarative ( e . g ., sql , prolog , and the like ). the embodiments described above may also use well - known or proprietary synchronous or asynchronous client - server computing techniques . however , the various components may be implemented using more monolithic programming techniques as well , for example , as an executable running on a single cpu computer system , or alternatively decomposed using a variety of structuring techniques known in the art , including but not limited to , multiprogramming , multithreading , client - server , or peer - to - peer , running on one or more computer systems each having one or more cpus . some embodiments may execute concurrently and asynchronously , and communicate using message passing techniques . equivalent synchronous embodiments are also supported by an hdm implementation . also , other functions could be implemented and / or performed by each component / module , and in different orders , and by different components / modules , yet still achieve the functions of the hdm . different configurations and locations of programs and data are contemplated for use with techniques of described herein . a variety of distributed computing techniques are appropriate for implementing the components of the illustrated embodiments in a distributed manner including but not limited to tcp / ip sockets , rpc , rmi , http , web services ( xml - rpc , jax - rpc , soap , and the like ). other variations are possible . also , other functionality could be provided by each component / module , or existing functionality could be distributed amongst the components / modules in different ways , yet still achieve the functions of an hdm . furthermore , in some embodiments , some or all of the components of the content sharing logic 302 and / or the content sharing access service 202 may be implemented or provided in other manners , such as at least partially in firmware and / or hardware , including , but not limited to one ore more application - specific integrated circuits (“ asics ”), standard integrated circuits , controllers ( e . g ., by executing appropriate instructions , and including microcontrollers and / or embedded controllers ), field - programmable gate arrays (“ fpgas ”), complex programmable logic devices (“ cplds ”), and the like . some or all of the system components and / or data structures may also be stored as contents ( e . g ., as executable or other machine - readable software instructions or structured data ) on a computer - readable medium ( e . g ., as a hard disk ; a memory ; a computer network or cellular wireless network or other data transmission medium ; or a portable media article to be read by an appropriate drive or via an appropriate connection , such as a dvd or flash memory device ) so as to enable or configure the computer - readable medium and / or one or more associated computing systems or devices to execute or otherwise use or provide the contents to perform at least some of the described techniques . some or all of the system components and data structures may also be stored as data signals ( e . g ., by being encoded as part of a carrier wave or included as part of an analog or digital propagated signal ) on a variety of computer - readable transmission mediums , which are then transmitted , including across wireless - based and wired / cable - based mediums , and may take a variety of forms ( e . g ., as part of a single or multiplexed analog signal , or as multiple discrete digital packets or frames ). such computer program products may also take other forms in other embodiments . accordingly , embodiments of this disclosure may be practiced with other computer system configurations . fig5 is a flow diagram of an example content sharing access service process according to one embodiment . in particular , fig5 illustrates a process 500 that may be performed , for example , as part of the content sharing access service 202 executing on the program distributor 106 , such as illustrated with respect to fig2 and 3a , and / or executing in memory 461 on an embodiment of the server computing system 460 of fig4 . the illustrated process 500 starts at 502 . at 504 , the process receives and indication to create a secure content sharing group . typically , this indication is received from a first receiving device located at a first customer premises , so as to configure such a first receiving device to securely share content with other receiving devices located at other customer premises . for example , a customer associated with the first customer premises may be interacting with a user interface provided by the first receiving device to indicate a desire to create a secure content sharing group . although , in other embodiments , such indications may be received from other sources . in some embodiments , the process may further determine the identity and / or location of the first receiving device , such as based on information stored in a customer database , etc . at 506 , the process provides access control information to the first receiving device located at the first customer premises to enable the receiving device to securely share content with other receiving devices that are currently in and / or will be added to the secure content sharing group . the access control information is provided to the first receiving device via a satellite communication network . as discussed elsewhere , such access control information may include various identifiers and / or information associated with the content sharing group that may be used by the first receiving device to determine a cryptographic key with which to encrypt shared content for use by other devices in the secure content sharing group . at 508 , the process receives an indication to add an authorized receiving device located at a different customer premises to the secure content sharing group . typically , this indication is received from the first receiving device , such as in response to a customer associated with the first receiving device indicating another customer and / or another customer &# 39 ; s receiving device with which the first customer desires to share content . in some embodiments , the process may further determine the identity and / or location of the authorized receiving device , such as by searching a database or other information storage that includes information associating one or more customers to receiving devices of those customers . at 510 , the process provides access control information to the authorized receiving device to enable that device to access content shared by the first receiving device . as discussed elsewhere , such access control information may include various identifiers and / or information associated with the content sharing group that may be used by the authorized receiving device to determine a cryptographic key with which to decrypt content shared by the first receiving device . at 512 , the process determines whether to continue . if so , the process returns to step 508 to receive other indications to add additional authorized receiving devices to the secure content sharing group . if not , the process ends at 514 . fig6 a - 6b are flow diagrams of example content sharing client processes . in particular , fig6 a and 6b illustrate processes 600 and 650 , respectively , that may be performed , for example , by the content sharing logic 302 and 312 executing on the receiving devices 118 a and 118 b of fig3 b , and / or execution of the content sharing logic 302 executing in memory 401 of the receiving device 118 of fig4 . although processes 600 and 650 are illustrated in fig6 a and 6b as separate processes , in other embodiments , such processes may be provided as part of a single process executing on a receiving device with steps of the various illustrated processes 600 and 650 being performed as appropriate based on various received indications , information and / or requests . in fig6 a , the illustrated process 600 starts at 602 . at 604 , the process receives access control information via a satellite network to enable the receiving device to securely share content with other receiving devices in a secure content sharing group . such access control information may be provided by execution of step 506 of process 500 ( fig5 ). at 606 , the process determines based on the received access control information an encryption key to use for encrypting content that the receiving device shares with other receiving devices in the secure content sharing group . for example , in some embodiments , the receiving device may generate and / or otherwise obtain the encryption key based on the information included in the provided access control information . at 608 , the process receives and indication to provide content to another receiving device that is in the secure content sharing group . typically , this indication will be received from the other receiving device , such as via a communication network ( e . g ., the internet ), although the indication may be received from other sources in other embodiments . at 610 , in response to the received indication in step 608 , the process encrypts the requested content using the determined encryption key . at 612 , the process provides the encrypted content to the other receiving device in the content sharing group . typically , the encrypted content may be provided to the other receiving device via a communication network ( e . g ., the internet ). at 614 , the process determines whether to continue . if so , the process returns to step 608 to receive additional requests to share content . otherwise , the process ends at 618 . in fig6 b , the illustrated process 650 starts at 652 . at 654 , the process receives access control information via a satellite network to enable the receiving device to access content shared by a sharing receiving device in a secure content sharing group . such access control information may be provided by execution of step 510 of process 500 ( fig5 ). at 656 , the process determines based on the received access control information a decryption key to use for decrypting shared content that the receiving device receives from the sharing receiving device in the secure content sharing group . for example , in some embodiments , the receiving device may generate and / or otherwise obtain the decryption key based on the information included in the provided access control information . in some embodiments , the process may store the determined decryption key . at 658 , the process receives encrypted shared content from the sharing receiving device in the secure content sharing group . for example , such content may be received based on execution of step 612 of the process 600 ( fig6 a ). at 660 , the process decrypts the received shared content using the determined decryption key . at 662 , the process presents the decrypted shared content to a user of the receiving device on a presentation device , such as a television , computer and / or other presentation device . in other embodiments , the received shared content may be used by the receiving device in other manners as appropriate , such as for example , playing the content on an audio device , storing / transmitting to another device ( e . g ., a pc ) for use by that other device , etc . at 664 , the process determines whether to continue . if so , the process returns to step 658 to receive other shared content . otherwise , the process ends at 668 . in other embodiments , the process 650 may perform additional and / or other steps not illustrated . for example , in some embodiments , the process may interact with a sharing receiving device to request and / or otherwise obtain the encrypted shared content from the sharing receiving device . while various embodiments have been described hereinabove , it is to be appreciated that various changes in form and detail may be made without departing from the spirit and scope of the invention ( s ) presently or hereafter claimed .	7
as will be better understood from the following description , the present invention modifies , during flare , an electronic flight control system that , for up - and - away flight , produces commands by integrating control signals that are representative of the deflection of a pilot - operated pitch axis control device . while the electronic flight control system for which the invention was initially developed , and the one described in this application , is based on a pitch attitude control law during up - and - away flight , the flare modification can be used with systems based on other control laws -- gamma dot γ or c star ( c ), for examples . the flare modification comprises eliminating the effect of the integration of the control signals that are representative of the deflection of the pilot - operated pitch axis control device and producing an incremental pitch attitude command , relative to a reference , directly from control signals that are representative of the deflection of the pilot - operated control device during the flare portion of a landing . thus , rather than producing a pitch attitude command as a result of integrating a signal that is representative of the deflection of a pilot - operated control device , the invention produces an incremental pitch attitude command that is proportional to the signal that is representative of the deflection of the pilot - operated control device . the effect of the integration is eliminated during flare by either bypassing the integration function , or differentiating the signal that is representative of the deflection of the pilot - operated control device prior to the signal being integrated . mathematically , the effect of differentiation , of course , counters the effect of the integration . fig1 illustrates an embodiment of the invention wherein the effect of the integrator is eliminated by simply eliminating the integrator function during flare . fig2 illustrates an embodiment of the invention wherein the effect of the integrator is eliminated by differentiating the signal that is representative of the deflection of the pilot - operated pitch axis control device prior to the signal being integrated . fig3 illustrates an embodiment of the invention wherein the effect of the integrator is eliminated in the steady state response but contributes to the dynamics of the system during the initial portion of a maneuver in a manner similar to that designed into the up - and - away response . this effect is achieved by washing out the signal that is representative of the deflection of the pilot - operated pitch axis control device . fig1 includes : a pilot - operated pitch axis control device 11 ; and the pitch axis part of an electronic flight control system 13 . the pilot - operated pitch axis control device 11 is pictorially illustrated as comprising a column and wheel controller 21 . centerstick , side stick , force - sensitive stick and other types of control devices can also be used by the invention . in the illustrated embodiment , a linear transducer 25 attached to the column 23 of the column and wheel controller 21 is oriented such that the position of the column controls the magnitude of an analog signal produced ( or controlled ) by the transducer 25 . obviously , other types of transducers can be used . for example , force transducers can be used . or angular ( rotary ) transducers may be used rather than linear ( displacement ) transducers . further , the analog signals produced by the chosen transducer can be in electric , optic , fluidic , or other form . the analog signal produced ( or controlled ) by the transducer 25 is applied to the input of an analog - to - digital converter 27 . the digital output of the analog - to - digital converter 27 is applied to the electronic flight control system 13 in the manner described below . as will be readily understood by those familiar with transducers , the analog signal producing transducer and the analog - to - digital converter can be replaced with a digital transducer . while , for ease of description , the pitch axis part of the electronic flight control system 13 illustrated in fig1 is shown in control law block form , and the blocks described as circuits , it is to be understood that the control law blocks can be implemented in integrated circuit form , discrete element circuit form , analog circuit form , or software form . preferably , the functions of the control law blocks are implemented in a computer control program the overall purpose of which is to control the aerodynamic operation of an aircraft based on pilot or autopilot inputs in combination with a variety of sensor inputs . that is , preferably , the functions of the illustrated control law blocks form part of the primary flight control / flight management computer complex of an aircraft embodying this invention . the illustrated functional control law blocks include : an integrator 31 ; five gain circuits 33 , 35 , 37 , 39 and 41 , having gain values designated k 1 , k 2 , k 3 , k 4 and k 5 , respectively ; a first order lag filter 43 ; a sample - and - hold circuit 45 ; a two - position switch 47 ; a subtractive summer 49 ; and three additive summers 51 , 53 and 55 . the digital signal produced by the analog - to - digital converter 27 is applied to the input of the integrator 31 and to the inputs of the second and third gain circuits 35 and 37 . the output of the integrator 31 is applied to the input of the first gain circuit 33 and the outputs of the first and second gain circuits are each applied to one of the inputs of the first additive summer 51 . the output of the first additive summer 51 , which is a signal designated up and away pitch attitude command , is applied to one of the remote terminals of the two - position switch 47 . an airplane pitch attitude signal produced by a sensor that senses the pitch attitude of the aircraft ( not shown ) is applied to the input of the first order lag filter 43 , i . e ., a filter having the laplace transform : the output of the first order lag filter is applied to the sample input of the sample - and - hold circuit 45 . when the flare mode becomes active , the control input of the sample - and - hold circuit is set to a hold state that causes the sample - and - hold circuit to store , i . e ., hold , the output of the first order lag filter until the flare mode becomes inactive . during inactive periods , the sample - and - hold circuit tracks , i . e ., samples , the output of the first order lag filter . the outputs of the third gain circuit 37 and the sample - and - hold circuit are each applied to one input of the second additive summer 53 . the output of the second additive summer , which is a signal denoted landing flare mode pitch attitude command , is applied to the other remote terminal of the two - position switch 47 . the common terminal of the two - position switch is connected to the negative input of the subtractive summer 49 . a signal produced by an airplane pitch attitude sensor ( not shown ) is applied to the positive input of the subtractive summer 49 . the output of the subtractive summer 49 is applied through the fourth gain circuit 39 to one input of the third additive summer 55 . a signal produced by an airplane pitch rate - of - change sensor ( not shown ) is applied through the fifth gain circuit 41 to the other input of the third additive summer 55 . the output of the third additive summer 55 is an elevator command signal that is applied through a suitable actuator to the elevators of the aircraft . ( as will be readily appreciated by those skilled in the aircraft control system art , the elevator command signal may be modified by signals produced by other sensors and systems prior to being applied to the elevator actuator .) as will be readily appreciated from the foregoing description and viewing fig1 the state of the two - position switch 47 determines the mode of operation of the pitch attitude command flight control system illustrated in fig1 . the state of the two - position switch is determined by the location of the airplane along its flight path . during up - and - away flight , the common terminal of the two - position switch 47 is connected to the remote terminal connected to the output of the first additive summer 51 . during flare , which commences at an elevation of approximately fifty feet above a runway just prior to touchdown , the common terminal of the two - position switch is connected to the remote terminal connected to the output of the second additive summer 53 . when in the up - and - away position , signals produced by the analog - to - digital converter 27 in response to pilot movement of the controller 21 are integrated by the integrator 31 and amplified by the first gain circuit 33 . simultaneously , the signals are amplified by the second gain circuit 35 . the signal path created by the second gain circuit is a quickening path that causes an immediate elevator command change that compensates for the relatively slow response of the integration signal path . the end result is an up - and - away pitch attitude command signal . this signal is subtractively summed with the signal produced by the pitch attitude sensor of the aircraft in the subtractive summer 49 . the resultant error signal is amplified by the fourth gain circuit 39 . the resulting error signal is combined with a pitch rate damping signal produced by amplifying the output of the aircraft &# 39 ; s pitch rate sensor . the result is the elevator command signal . when the two - position switch 47 is in its flare mode active position , the integrator 31 and the first gain circuit 33 are , in effect , bypassed . in this mode , the pitch controller deflection creates a landing flare mode pitch attitude command signal . preferably , the position of the two - position switch is changed automatically when the aircraft descends during an approach to a particular altitude , such as fifty feet ( 50 &# 39 ;) above the runway . a suitable switch position control signal can be produced by the airplane &# 39 ; s radio altimeter when the desired altitude is reached . simultaneously with the change in position of the two - position switch , the sample - and - hold circuit is commanded to store , i . e ., hold , the output of the first order lag filter . the output of the first order lag filter is an estimate of the trim pitch attitude of the aircraft . adding this signal to the output of the third gain circuit 37 assures that incremental changes of aircraft pitch attitude , relative to trim pitch attitude , will result when the pitch axis control device is moved . when the pitch axis control device is in its detent position , the estimated trim pitch attitude value is commanded . the third gain circuit controls the sensitivity of the system , i . e ., controls the magnitude of the deflection change , required to create a predetermined amount of elevator change during flare . as with the up - and - away mode of operation , in the flare mode of operation , the signal produced at the common terminal of the two - position switch 47 is subtractively summed in the subtractive summer 49 with a signal that denotes the actual pitch attitude of the aircraft . the resultant error signal is amplified by the fourth gain circuit 39 and added to the aircraft pitch rate signal amplified by the fifth gain circuit 41 . as will be readily appreciated by those skilled in the airplane control system art and others , the presence or absence of the integrator 31 in the circuit between the output of the analog - to - digital converter 27 and the common terminal of the two - position switch 39 determines the effect of movement of the pilot - operated control device 21 . when the integrator 31 is in the circuit , which occurs during up - and - away operation , the control device creates a rate signal that is converted to a pitch attitude command signal by the integrator 31 . because the integrator 31 is not present in the circuit during flare , movement of the control device 21 directly creates a pitch attitude command signal . fig4 illustrates the difference in pitch attitude command responses to the same control device movement during up - and - away operation on the one hand and flare on the other hand . it is this difference that allows a pilot to operate the aircraft in a manner that takes advantage of an electronic flight control system during normal flight while allowing conventional piloting techniques to be used during the flare portion of a landing . as a result , the benefits of an electronic flight control system available during up - and - away operation is also available during flare operation . while the embodiment of the invention illustrated in fig1 eliminates the flare problem , discussed above , that occurs in electronic flight control systems that normally control the attitude of an aircraft by integrating pitch attitude rate command signals that are proportional to the position of a pilot - operated pitch axis control device and , thus , is a substantial improvement over the prior art , it has certain disadvantages . the primary disadvantage is that the transition from an approach mode of operation to a flare mode of operation is relatively abrupt . the embodiment of the invention illustrated in fig2 avoids this problem by retaining the integrator 31 in the circuit during flare and compensating for its effect by differentiating the pitch command signal produced by the analog - to - digital converter 27 prior to the signal being integrated . since the fig2 embodiment of the invention is , in many respects , similar to the fig1 embodiment , only the differences between the two embodiments of the invention are described . in this way , unnecessary duplication of descriptive material is avoided . in the embodiment of the invention illustrated in fig2 the sample - and - hold circuit is eliminated and the output of the first order lag filter is applied directly to an input of the second additive summer 53 . rather than being applied to the two - position switch 47 , the output of the second additive summer 53 is applied through an open / closed switch 61 to an initializing input of the integrator 31 . ( the initializing input presets the integrator to a preset value when the open / closed switch is closed .) the output of the third gain circuit 37 is applied through a differentiator 63 to one of the remote inputs of the two - position switch 47 . rather than being connected to the input of the integrator , the output of the first gain circuit 33 is connected to one input of the first additive summer 51 . rather than being connected to an input of the first additive summer , the output of the second gain circuit 35 is applied to the input of a second differentiator 65 , and the output of the second differentiator is applied to an input of the first additive summer 51 . the output of the first additive summer 51 is applied to the other remote terminal of the two - position switch and the common terminal of the two - position switch is connected to the signal input of the integrator 31 . the output of the integrator 31 is applied to the negative input of the subtractive summer 49 . when the two - position switch 47 of the embodiment of the invention illustrated in fig2 is in the up - and - away position , the system illustrated in fig2 is , functionally , identical to the system illustrated in fig1 when the two - position switch 47 is in the up - and - away position . the only difference between the two systems is that the two - position switch 47 in the fig1 embodiment of the invention is located downstream of the integrator 31 . in the fig2 embodiment of the invention , the two - position switch 47 is located upstream of the integrator 31 . in either case , the signal produced by the analog - to - digital converter 27 is integrated by the integrator 31 prior to being applied to the negative input of the subtractive summer 49 . since the second differentiator 65 mathematically cancels the effect of the integrator 31 , the parallel paths through the second gain circuit 35 are also functionally the same . the difference between the fig1 and fig2 embodiments of the invention occurs when the two - position switch 47 is in the flare mode active position . as described above , when the two - position switch 47 is in the flare mode active position , the integrator 31 is bypassed in the embodiment of the invention illustrated in fig1 . in the embodiment of the invention illustrated in fig2 when the two - position switch is in the flare mode active position , the first differentiator 63 is connected in series with the integrator 31 . as a result , rather than bypassing the integrator , the effect of the integrator is mathematically nullified by the first differentiator . while the first differentiator 63 mathematically offsets or negates the effect of the integrator 31 , the synchronization benefits of the integrator are retained . more specifically , as will be readily understood by those skilled in the control system art , when a differentiator and an integrator are serially combined , the function of one cancels the function of the other . while the functions are canceled , synchronization benefits are retained because multiple path command signals are switched upstream of the integrator . because these benefits are retained , the transition between the approach mode of operation and the flare mode of operation of the embodiment of the invention illustrated in fig2 is smoother than in the embodiment of the invention illustrated in fig1 . transition smoothness is further enhanced by initializing the integrator in the manner illustrated in fig2 and described above by closing the open / closed switch 61 at the same time that the two - position switch 47 is switched to the flare mode active position . the integrator initialization is typically performed by linearly changing the value of the integrator to the required value over a short time period -- one or two seconds , for example . the initialization of the integrator has another benefit -- it makes a consistent and predictable amount of control device deflection create a consistent and predictable amount of pitch attitude change . predictability of pitch attitude change is important because flare occurs during a landing when a pilot changes pitch attitude in a manner that raises the nose of the aircraft . if the integrator is not initialized , a large and , thus , abnormal , variation in stick deflection may be required during flare in order to achieve the attitude change needed for a smooth touchdown . this occurs if the reference ( i . e ., stick in detent position ) pitch attitude command value held by the integrator is abnormal due to pilot maneuvering at the instant the flare mode becomes active . in accordance with the invention , if the pitch axis control device 11 is in its detent position , when the position of the two - position switch 47 is changed to the flare mode active position , and the open / closed switch 61 is closed , the integrator 31 is initialized to the trim value of pitch attitude for the current flight condition and airplane configuration . this is accomplished by passing the airplane pitch attitude signal through the first order lag filter 43 , which has a relatively large time constant ( e . g ., 25 seconds ). the effect of the long time constant first order lag filter is to eliminate any short - term changes in pitch attitude trim due to turbulence and / or minor maneuvering . if the pitch axis control device is not in its detent position when the flare mode becomes active , the integrator 31 is initialized to a value such that when the pitch axis control device is moved to its detent position , the pitch attitude command will be at the trim value of pitch attitude for the current flight condition and airplane configuration . in this way , a constant deflection of the pitch axis control device 11 is always required in order to create a given incremental pitch attitude change relative to a trim value . if the integrator is initialized to the trim pitch attitude value when the pitch axis control device is not in its detent position , the nondetent position becomes the &# 34 ; neutral &# 34 ; position rather than the detent position being the neutral position about which incremental pitch attitude values ( relative to trim ) are commanded . initializing for the out - of - detent position of the pitch axis control device 11 is accomplished as shown in fig2 by summing the trim pitch attitude value with a value that is proportional to pitch axis control device deflection that accounts for how much the control device is away from its detent position when flare commences . this value is the output of the third gain circuit 37 . fig3 illustrates an embodiment of the invention that , in many ways , is similar to the fig2 embodiment of the invention . the primary difference is that the two - position switch 47 is eliminated and both the flare and the up - and - away control paths identically feed into a first order filter 71 having the following laplace transform : ## equ1 ## where k 6 is dependent on the position of the aircraft along its flight path . during nonflare ( i . e ., up - and - away ) flight , k 6 equals one ( 1 ) and during flare k 6 equals zero ( 0 ). like the changing of the position of the two - position switch 47 and the closure of the open / closed switch 61 , preferably , the value of k 6 is controlled by a radio altimeter signal that changes state when the aircraft descends to the altitude where flare is to commence . more specifically , in the fig3 embodiment of the invention , the output of the analog - to - digital converter 27 is connected to the input of the first order filter 71 and the output of the first order filter is connected to a parallel network , one leg formed by the integrator 31 and the first gain circuit 33 connected in series , and the other leg formed by the second gain circuit . the outputs of the two legs are summed by the first additive summer 51 and the output of the first additive summer is connected to the negative input of the subtractive summer 49 . the output of a first order lag filter 43 , having a laplace transform identical to the first order lag filters contained in the embodiments of the invention illustrated in fig1 and 2 and described above , is summed in the fig3 embodiment with the output of a second first order lag filter 73 . the second first order lag filter 73 has the laplace transform : ## equ2 ## ( note that the time constant , τ 2 , of equation ( 3 ) is identical to the time constant , τ 2 , of equation ( 2 )). the output of the analog - to - digital converter is applied to the input of the second first order lag filter 73 and the outputs of the first order lag filters are summed in the first additive summer 53 . as in the fig2 embodiment of the invention , the output of the second additive summer is applied through the open / closed switch 61 to an initialization input of the integrator 31 . the open / closed switch is closed when the flare mode becomes active . otherwise , the open / closed switch is open . since k 6 equals one ( 1 ) and the open / closed switch 61 is open for all flight regimes other than flare , the fig3 embodiment of the invention is identical to and operates the same as the embodiments of the invention illustrated in fig1 and 2 when the two - position switch is in its up - and - away position . more specifically , when k 6 equals one ( 1 ), the first order filter 71 has no effect on the signal produced by the analog - to - digital converter 27 . this result occurs because the numerator and denominator of the first order filter laplace transform cancel when k 6 equals one ( 1 ). during flare , the first order filter 71 is a washout term that cancels the effect of the integrator 31 when a steady state is achieved , which occurs after a time period corresponding to several time constants . the net result is that high frequency input components pass through the filter 71 in the same way they pass in the up - and - away mode , while steady input components are attenuated . this causes the pitch attitude command signal to approach a steady state value when a pull - and - hold maneuver typical of flare occurs . see fig4 . at the start of flare , the first order filter 71 functions to create a smooth transition between the approach and flare mode of operation of an electronic flight control system incorporating this invention . in essence , the fig3 embodiment of the invention creates a differentiator - like effect by changing a type zero ( 0 ) filter to a type negative one (- 1 ) filter . the same result , with an even smoother transition , can be accomplished by using a second or higher order filter configured such that the last term of the numerator is zero ( 0 ) during flare and equals the last term of the denominator during other flight regimes . as with the embodiment of the invention illustrated in fig2 the integrator initialization part of the network of the embodiment of the invention illustrated in fig3 initializes the integrator to an appropriate value when flare commences . the second first order lag filter is provided to account for the effect of any stick deflection that exists at the instant the transition to flare occurs . the dynamic response of the second first order lag filter 73 is identical to the dynamic response of the command path formed by the first order filter 71 , the first gain circuit 33 and the integrator 31 . as a result , the integrator is initialized to a value such that when the pitch axis control device is moved to its detent position , the pitch attitude command value will be set to the estimated trim pitch attitude value , as determined by the output of the first order lag filter 43 . as in the embodiment of the invention illustrated in fig2 the initialization of the integrator 31 should be linearly changing the starting integrator value to the initialization value over a short time period -- one or two seconds , for example . the embodiment of the invention illustrated in fig3 has the additional benefit that the transition from the flare mode back to the up - and - away mode , which typically , when a go - around or missed approach occurs , is dynamically very smooth . this result occurs because the past value of the first order filter 21 is not reset when the transition occurs . thus , a steady ( i . e ., pull - and - hold ) pitch axis control device input slowly transitions from commanding an incremental pitch attitude value to commanding a pitch attitude rate - of - change value when a go - around occurs . as a result , this embodiment of the invention does not require a pilot to immediately release the pitch axis control device so that it can move to a detent position when a transition from flare to up - and - away occurs during a go - around in order to prevent over - rotation . rather , pitch axis control device release at the time of the transition can be accomplished in a smooth , natural manner . contrariwise , the embodiments of the invention illustrated in fig1 and 2 require the immediate release of the pitch axis control device if over - rotation is to be prevented during a go - around . while the specific values of the various gain and filter terms will depend upon the specific application of embodiments of the invention , representative values are set forth in the following table . ______________________________________term value ( s ) ______________________________________k . sub . 1 300 / v . sub . t ( where v . sub . t = true airspeed in feet per second ) k . sub . 2 260 / v . sub . t ( where v . sub . t = true airspeed in feet per second ) k . sub . 3 260 / v . sub . t ( where v . sub . t = true airspeed in feet per second ) k . sub . 4 150 / q . sub . c ( where q . sub . c is impact pressure in pounds per square foot ) k . sub . 5 150 / q . sub . c ( where q . sub . c is impact pressure in pounds per square foot ) τ . sub . 1 25 . 0τ . sub . 2 1 . 0______________________________________ as will be readily appreciated by those skilled in this art and others from the foregoing description , the invention provides a flare control modification for a maneuver command pitch axis flight control system that normally controls the attitude of an aircraft by integrating pitch attitude rate command signals that are proportional to the position of a pilot - operated pitch axis control device . in essence , the modification comprises eliminating the effect of the integrator during flare . the effect of the integrator is canceled by either eliminating the integrator function entirely during flare or by compensating for integration by differentiating the signal that is proportional to the position of the pilot - operated pitch axis control device . although various preferred embodiments of the invention have been illustrated and described , it is to be understood that the invention is not limited to these embodiments . thus , it is to be understood that within the scope of the appended claims , various changes can be made in the specifically disclosed embodiments of the invention . for example , depending upon signal level and other relevant factors , one or more of the various gain circuits can be eliminated .	6
the improved process of the present invention is described herein below with examples , which are illustrative only and should not be construed to limit the scope of the present invention in any manner . 0 . 0937 mmol of the palladium complex of formula iv in which r ′ 1 , r ′ 2 , r ′ 3 = phenyl , x = p - toluenesulfonato ( tso − ),= pyridyl - 2 - carboxylate ( prepared as the procedure given in the u . s . pat . no . 6 , 069 , 253 ) was dissolved in methyl ethyl ketone ( mek ) ( 7 ml ) and shaken vigorously with 3 equivalents of tppts { tris ( m - sulfophenyl ) phosphine trisodium salt } in degassed water ( 3 ml ). the yellow colour of the mek layer disappeared and the aqueous layer became yellow in colour indicating the formation of the palladium complex of formula iiia , in water which was added to 1 g of the degassed dehydroxylated ( kept at 523 k under vacuum for 5 - 6 hours ) silica ( bet surface area = 210 m 2 / g ) in a schlenk flask and the wet solid was stirred for 2 h under argon . water was then evaporated under high vacuum at constant stirring . a dry yellow powder was obtained which was stored under argon . the water content of the catalyst thus prepared was found to 10 - 12 % ( w / w ) ( as determined by tga ). pd ( oac ) 2 ( 0 . 094 mmol ) and tppts ( 0 . 376 mmol ) in 3 ml of degassed water were kept for stirring for 1 - 1 . 5 h to form pd ( tppts ) 3 under argon . this solution was then added to 1 g of degassed dehydroxylated ( kept at 523 k under vacuum for 5 - 6 hours ) silica ( bet surface area = 210 m 2 / g ) in a schlenk flask and the wet solid was stirred for 2 h under argon . water was then evaporated under high vacuum at constant stirring . a dry yellow powder was obtained which was stored under argon . the water content of the catalyst thus prepared was found to 10 - 12 % ( w / w ) ( as determined by tga ). a 50 ml stirred autoclave was charged with the following reactants the contents of the autoclave were flushed with nitrogen and then many times with carbon monoxide . thereafter , the contents were heated to 75 ° c . after the temperature is attained , the autoclave was pressurised to 500 psig with carbonmonoxide , stirring started . for preparation of final methyl phenyl propionate product , the pressure in the autoclave was maintained constant and the progress of the reaction was monitored by observing the pressure drop and by liquid sampling . the reaction was continued for 12 hours . the reactor was then cooled and the liquid phase analysed by gas chromatography . the gc analysis showed tof of 2 . 6 h − 1 and 3 . 1 % conversion of styrene with the formation of a mixture of methyl 2 - phenylproprionate and methyl 3 - phenylproprionate with selectivity of 54 . 26 % and 45 . 73 % respectively . the alkoxycarbonylation products were then isolated by separating the catalyst by filteration and removing the solvents and remaining styrene by distillation . a 50 ml stirred autoclave was charged with the following reactants the contents of the autoclave were flushed with nitrogen and then many times with carbon monoxide . thereafter , the contents were heated to 75 ° c . after the temperature is attained , the autoclave was pressurised to 500 psig with carbonmonoxide , stirring started . for preparation of final methyl phenyl propionate product , the pressure in the autoclave was maintained constant and the progress of the reaction was monitored by observing the pressure drop and by liquid sampling . the reaction was continued for 12 hours . the reactor was then cooled and the liquid phase analysed by gas chromatography . the gc analysis showed tof of 2 . 1 h − 1 and 3 % conversion of styrene with the formation of a mixture of methyl 2 - phenylproprionate and methyl 3 - phenylproprionate with selectivity of 54 % and 46 % respectively . the alkoxycarbonylation products were then isolated by separating the catalyst by filtration and removing the solvents and remaining styrene by distillation . a 50 ml stirred autoclave was charged with the following reactants the contents of the autoclave were flushed with nitrogen and then many times with carbon monoxide . thereafter , the contents were heated to 75 ° c . after the temperature is attained , the autoclave was pressurised to 500 psig with carbonmonoxide , stirring started . for preparation of final methyl phenyl propionate product , the pressure in the autoclave was maintained constant and the progress of the reaction was monitored by observing the pressure drop and by liquid sampling . the reaction was continued for 12 hours . the reactor was then cooled and the liquid phase analysed by gas chromatography . the gc analysis showed tof of 1 . 8 h − 1 and 2 . 3 % conversion of styrene with the formation of a mixture of methyl 2 - phenylproprionate and methyl 3 - phenylproprionate with selectivity of 54 . 3 % and 45 . 7 % respectively . the alkoxycarbonylation products were then isolated by separating the catalyst by filtration and removing the solvents and remaining styrene by distillation . a 50 ml stirred autoclave was charged with the following reactants the contents of the autoclave were flushed with nitrogen and then many times with carbon monoxide . thereafter , the contents were heated to 75 ° c . after the temperature is attained , the autoclave was pressurized to 500 psig with carbonmonoxide , stirring started . for preparation of final methyl phenyl propionate product , the pressure in the autoclave was maintained constant and the progress of the reaction was monitored by observing the pressure drop and by liquid sampling . the reaction was continued for 12 hours . the reactor was then cooled and the liquid phase analysed by gas chromatography . the gc analysis showed tof of 1 . 2 h − 1 and 1 . 5 % conversion of styrene with the formation of a mixture of methyl 2 - phenylproprionate and methyl 3 - phenylproprionate with selectivity of 54 % and 46 respectively . the alkoxycarbonylation products were then isolated by separating the catalyst by filtration and removing the solvents and remaining styrene by distillation . a 50 ml stirred autoclave was charged with the following reactants the contents of the autoclave were flushed with nitrogen and then many times with carbon monoxide . thereafter , the contents were heated to 75 ° c . after the temperature is attained , the autoclave was pressurized to 500 psig with carbonmonoxide , stirring started . for preparation of final methyl phenyl propionate product , the pressure in the autoclave was maintained constant and the progress of the reaction was monitored by observing the pressure drop and by liquid sampling . the reaction was continued for 12 hours . the reactor was then cooled and the liquid phase analysed by gas chromatography . the gc analysis showed tof of 1 . 5 h − 1 and 1 . 85 % conversion of styrene with the formation of a mixture of methyl 2 - phenylproprionate and methyl 3 - phenylproprionate with selectivity of 60 . 34 % and 39 . 65 respectively . the alkoxycarbonylation products were then isolated by separating the catalyst by filtration and removing the solvents and remaining styrene by distillation . a 50 ml stirred autoclave was charged with the following reactants the contents of the autoclave were flushed with nitrogen and then many times with carbon monoxide . thereafter , the contents were heated to 75 ° c . after the temperature is attained , the autoclave was pressurized to 500 psig with carbonmonoxide , stirring started . for preparation of final methyl phenyl propionate product , the pressure in the autoclave was maintained constant and the progress of the reaction was monitored by observing the pressure drop and by liquid sampling . the reaction was continued for 12 hours . the reactor was then cooled and the liquid phase analysed by gas chromatography . the gc analysis showed tof of 18 . 9 h − 1 and 23 % conversion of styrene with the formation of a mixture of methyl 2 - phenylproprionate and methyl 3 - phenylproprionate with selectivity of 74 . 16 % and 25 . 83 respectively . the alkoxycarbonylation products were then isolated by separating the catalyst by filtration and removing the solvents and remaining styrene by distillation . a 50 ml stirred autoclave was charged with the following reactants the contents of the autoclave were flushed with nitrogen and then many times with carbon monoxide . thereafter , the contents were heated to 75 ° c . after the temperature is attained , the autoclave was pressurized to 500 psig with carbonmonoxide , stirring started . for preparation of final methyl phenyl propionate product , the pressure in the autoclave was maintained constant and the progress of the reaction was monitored by observing the pressure drop and by liquid sampling . the reaction was continued for 12 hours . the reactor was then cooled and the liquid phase analysed by gas chromatography . the gc analysis showed tof of 15 h − 1 and 20 % conversion of 4 - isobutylstyrene with the formation of a mixture of methyl 2 - phenylproprionate and methyl 3 - phenylproprionate with selectivity of 75 % and 25 respectively . the alkoxycarbonylation products were then isolated by separating the catalyst by filtration and removing the solvents and remaining styrene by distillation . a 50 ml stirred autoclave was charged with the following reactants the contents of the autoclave were flushed with nitrogen and then many times with carbon monoxide . thereafter , the contents were heated to 75 ° c . after the temperature is attained , the autoclave was pressurized to 500 psig with carbonmonoxide , stirring started . for preparation of final methyl phenyl propionate product , the pressure in the autoclave was maintained constant and the progress of the reaction was monitored by observing the pressure drop and by liquid sampling . the reaction was continued for 12 hours . the reactor was then cooled and the liquid phase analysed by gas chromatography . the gc analysis showed tof of 18 h − 1 and 22 % conversion of 4 - methylstyrene with the formation of a mixture of methyl 2 - phenylproprionate and methyl 3 - phenylproprionate with selectivity of 74 % and 26 % respectively . the alkoxycarbonylation products were then isolated by separating the catalyst by filtration and removing the solvents and remaining styrene by distillation . a 50 ml stirred autoclave was charged with the following reactants the contents of the autoclave were flushed with nitrogen and then many times with carbon monoxide . thereafter , the contents were heated to 75 ° c . after the temperature is attained , the autoclave was pressurized to 500 psig with carbonmonoxide , stirring started . for preparation of final methyl phenyl propionate product , the pressure in the autoclave was maintained constant and the progress of the reaction was monitored by observing the pressure drop and by liquid sampling . the reaction was continued for 12 hours . the reactor was then cooled and the liquid phase analysed by gas chromatography . the gc analysis showed tof of 15 h − 1 and 20 % conversion of 4 - chlorostyrene with the formation of a mixture of methyl 2 - phenylproprionate and methyl 3 - phenylproprionate with selectivity of 77 % and 23 % respectively . the alkoxycarbonylation products were then isolated by separating the catalyst by filtration and removing the solvents and remaining styrene by distillation . a 50 ml stirred autoclave was charged with the following reactants the contents of the autoclave were flushed with nitrogen and then many times with carbon monoxide . thereafter , the contents were heated to 75 ° c . after the temperature is attained , the autoclave was pressurised to 200 psig with carbonmonoxide , stirring started . for preparation of final methyl phenyl propionate product , the pressure in the autoclave was maintained constant and the progress of the reaction was monitored by observing the pressure drop and by liquid sampling . the reaction was continued for 12 hours . the reactor was then cooled and the liquid phase analysed by gas chromatography . the gc analysis showed tof of 11 . 8 h − 1 and 14 % conversion of 4 - methylstyrene with the formation of a mixture of methyl 2 - phenylproprionate and methyl 3 - phenylproprionate with selectivity of 60 % and 40 % respectively . the alkoxycarbonylation products were then isolated by separating the catalyst by filtration and removing the solvents and remaining styrene by distillation . a 50 ml stirred autoclave was charged with the following reactants water content of the catalyst = 40 % ( made by controlled addition of water to the catalyst ) the contents of the autoclave were flushed with nitrogen and then many times with carbon monoxide . thereafter , the contents were heated to 75 ° c . after the temperature is attained , the autoclave was pressurized to 500 psig with carbonmonoxide , stirring started . for preparation of final methyl phenyl propionate product , the pressure in the autoclave was maintained constant and the progress of the reaction was monitored by observing the pressure drop and by liquid sampling . the reaction was continued for 12 hours . the reactor was then cooled and the liquid phase analysed by gas chromatography . the gc analysis showed tof of 3 . 53 h − 1 and 4 . 5 % conversion of styrene with the formation of a mixture of methyl 2 - phenylproprionate and methyl 3 - phenylproprionate with selectivity of 51 . 6 % and 48 . 39 % respectively . the alkoxycarbonylation products were then isolated by separating the catalyst by filtration and removing the solvents and remaining styrene by distillation . a 50 ml stirred autoclave was charged with the following reactants the contents of the autoclave were flushed with nitrogen and then many times with carbon monoxide . thereafter , the contents were heated to 75 ° c . after the temperature is attained , the autoclave was pressurised to 500 psig with carbonmonoxide , stirring started . for preparation of final methyl phenyl propionate product , the pressure in the autoclave was maintained constant and the progress of the reaction was monitored by observing the pressure drop and by liquid sampling . the reaction was continued for 12 hours . the reactor was then cooled and the liquid phase analysed by gas chromatography . the gc analysis showed tof of 1 . 01 h − 1 and 1 . 22 % conversion of styrene with the formation of a mixture of methyl 2 - phenylproprionate and methyl 3 - phenylproprionate with selectivity of 61 . 69 % and 38 . 3 % respectively . the alkoxycarbonylation products were then isolated by separating the catalyst by filtration and removing the solvents and remaining styrene by distillation . a 50 ml stirred autoclave was charged with the following reactants the contents of the autoclave were flushed with nitrogen and then many times with carbon monoxide . thereafter , the contents were heated to 100 ° c . after the temperature is attained , the autoclave was pressurised to 500 psig with carbonmonoxide , stirring started . for preparation of final methyl phenyl propionate product , the pressure in the autoclave was maintained constant and the progress of the reaction was monitored by observing the pressure drop and by liquid sampling . the reaction was continued for 12 hours . the reactor was then cooled and the liquid phase analysed by gas chromatography . the gc analysis showed tof of 2 . 6 h − 1 and 3 . 1 % conversion of styrene with the formation of a mixture of methyl 2 - phenylproprionate and methyl 3 - phenylproprionate with selectivity of 48 % and 52 % respectively . the alkoxycarbonylation products were then isolated by separating the catalyst by filtration and removing the solvents and remaining styrene by distillation . a 50 ml stirred autoclave was charged with the following reactants the contents of the autoclave were flushed with nitrogen and then many times with carbon monoxide . thereafter , the contents were heated to 100 ° c . after the temperature is attained , the autoclave was pressurized to 500 psig with carbonmonoxide , stirring started . for preparation of final methyl phenyl propionate product , the pressure in the autoclave was maintained constant and the progress of the reaction was monitored by observing the pressure drop and by liquid sampling . the reaction was continued for 12 hours . the reactor was then cooled and the liquid phase analysed by gas chromatography . the gc analysis showed tof of 3 . 5 h − 1 and 4 . 2 % conversion of styrene with the formation of a mixture of 2 - and 3 - methylphenylpropionates with selectivity of 45 % and 55 % respectively . the alkoxycarbonylation products were then isolated by separating the catalyst by filtration and removing the solvents and remaining styrene by distillation . 1 . employment of supported aqueous phase palladium complexes for alkoxycarbonylation of olefins for the first time	2
in the following description , numerous specific details are set forth such as specific dimensions or materials , etc . to provide a thorough understanding of the present invention . however , it will be obvious to those skilled in the art that the present invention may be practiced without such specific details . in other instances , well - known circuits have been shown in block diagram form in order not to obscure the present invention in unnecessary detail . refer now to the drawings wherein depicted elements are not necessarily shown to scale and wherein like or similar elements are designated by the same reference numeral through the several views . the present invention addresses the foregoing needs by creating narrow cavities directly into a silicon wafer . these cavities can be deeper than 1 micrometer . fig1 illustrates a cross - section of a silicon wafer 100 embossed with cavities 101 each deeper than 1 micrometer . generally , a metal electrode 102 is prepared at the bottom of the cavities 101 . in particular , catalytic metals are used such as iron , nickel or cobalt based for the selective growth of carbon nanostructures in each cavity 101 . at the surface of each cavity , a strong dielectric material , organic or inorganic , is deposited ( see fig4 a – 4o ) with a breakdown voltage of over 1 , 000 , 000 volts / cm . such materials could be silicon nitride , silicon oxide , silioxinitrides , bcb made by dow chemicals , liquid glass or polyimides , or other organic dielectrics . on the top of this dielectric layer a gate metal is formed . another dielectric layer may be formed on top of the gate layer and an anode metal layer is placed on top of this second dielectric layer . by modulating the current between the metal cathode 102 at the bottom of the cavity 101 and the anode on the top of the cavity 101 with the help of the gate metal , transistor operations can be achieved as shown below . an alternative approach ( see fig4 n – 4o ) would be to not deposit a separate anode layer , but to use another silicon wafer or other conducting substrate that is placed next to ( on top of ) the second dielectric layer , opposite the metal gate layer . the anode wafer can be in physical contact to the second dielectric layer or it can be placed some distance away , as much as 1 centimeter or more . in this case , the device needs to be operated in a vacuum chamber or vacuum envelope since the presence of air at atmospheric pressures would interfere with the operation of the device . this structure was used to obtain the data shown in fig2 and 3 . fig2 plots the anode current as a function of gate voltage for a device that is similar to what is shown in fig4 n or 4 o . the gate voltage is the voltage between cathode electrode 415 and gate electrode 416 . the anode current is the current of electrons that strike the anode 414 that is held at a potential of 100v . the graph shows that one can switch the current going to the anode at 100v with swing voltages of 20v or less between the gate and cathode . fig3 shows that the gate is effective in switching the anode current on and off best below 300v . above 300v , the anode field saturates the transistor behavior ; the gate voltage is not as an effective switch to turn off the current to the anode . this behavior is similar to standard microelectronic devices made using hot filament electron sources ( the “ vacuum tube ”). vacuum tubes are still used for certain applications . this structure has the lowest capacitance allowing for higher frequency operation . these transistor structures can be utilized as any transistor in a microelectronic circuit . furthermore , these structures can be utilized for wafer - to - wafer communication for three - dimensional wafer packaging . for example , by creating the cavities in one wafer and having similar cavities and organizations on another wafer , by combining the two wafers and bonding them face - to - face in a vacuum , a very economical and easy communication from wafer - to - wafer can be established . other applications of these cavities can be as smart sensors , utilizing the changes in the pressure in the cavity , for example in space . referring to fig4 a – 4o , an example of a process for fabricating a nanotriode in accordance with the present invention is illustrated . in fig4 a , a silicon wafer 401 is cleaned in a typical manner . in fig4 b , a dielectric layer 402 of approximately 1 micron thick is deposited on top of the silicon wafer 401 . in fig4 c , a metal ( or other conductive material ) gate layer 403 of approximately 1 , 000 angstroms thick is deposited on top of the dielectric layer 402 . in fig4 d , a second dielectric layer 404 of approximately 1 micron thick is placed on top of the metal gate layer 403 . in fig4 e , a sacrificial hard mask layer ( e . g ., aluminum ) 405 of approximately 1 , 000 angstroms thick is deposited on top of the second dielectric layer 404 . in fig4 f , holes 406 are patterned and etched in the hard mask layer 405 all the way through the layer . this may be done using conventional techniques commonly used in the silicon micro - fabrication industry . in fig4 g , using the pattern of the hard mask layer 405 created in fig4 f , holes 407 are etched in the second dielectric layer 404 . in fig4 h , the pattern created through the second dielectric layer 404 in fig4 g is used to etch through the metal gate layer 403 to create holes 408 . in fig4 i , the pattern created through the metal gate layer 403 in fig4 h to create holes 408 is used to etch through the first dielectric layer 402 to create holes 409 . in fig4 j , the pattern created by holes 409 is used to etch deep and narrow holes , or wells , in silicon wafer 401 . these holes can be as deep as 20 microns or more . in fig4 k , a metal layer of iron , nickel or cobalt ( or some other metal layer or an alloy or mixture of these metals ) of approximately 100 angstroms thick is deposited at the bottom of the holes 409 as layer 412 , and on top of the mask layer 405 as layer 411 . in fig4 l , the hard mask layer 405 and layer 411 are etched away . in fig4 m , carbon nanotube material 413 is grown in the holes on top of the layers 412 . various methods can be used to grow carbon nanotubes into the holes . using the thin film catalyst , carbon nanotube material can be grown in a mixture of hydrogen and hydrocarbon gases . these techniques are well known in the state of the art . a high temperature thermal cvd process can be used or one can activate the plasma using radio frequency excitation , dc glow discharge , or hot filament cvd techniques . nanoparticle catalysts can also be used . in this case , the particles are deposited by spraying or other means at the bottom of the holes 410 , replacing the thin film catalyst deposited as shown in fig4 k . one can also print or spray carbon nanotubes directly into the holes . one method involves suspending carbon nanotubes in a solvent such as isopropyl alcohol or acetone and using an airbrush to spray the material into the holes . one can also mix carbon nanotubes in a paste and screen print them into the holes . in fig4 n , an electrical conducting anode 414 is placed some distance away . electrical connections are made to the device electrodes . for example , an electrical connection 415 is made to the silicon wafer 401 , an electrical connection 416 is made to the metal gate layer 403 , and an electrical connection 417 is made to the anode 414 . in this way , voltages ( not shown ) can be applied using the electrical connections to create an electric field to cause emission of electrons from the carbon nanotubes 413 to the anode 414 . the gate electrode 403 can be used to modulate such an electron emission . in fig4 , note that the second dielectric layer 404 is optional , and may be utilized if the conducting anode 414 makes physical contact with the rest of the device . in this case , the anode 414 can be sealed to the device as shown . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims .	8
with reference first to fig5 through 8 , the numeral 10 represents a base or pier block of conventional structure which is commonly used to support decks , carports , etc . this block is generally constructed of concrete and assumes different shapes . in most cases , the block is tapered to a lesser dimension toward the top . the top and bottom surfaces 12 are flat . according to the present invention , a first embodiment of the invention comprises a construction device 14 , fig1 - 8 , which may be molded , stamped , or otherwise formed from a tough plastic or metal . the body member of the device 14 includes a flat bottom wall 16 and four identically shaped or symmetrical upright quarter sections 18 . each of the sections 18 comprises four zig zag panels 18a joined integrally at right angles . these symmetrical quarter sections are shaped to form a recess or opening 20 on each side , with oppositely located recesses being laterally aligned . also , with this quarter section construction , a square central socket 22 is formed . laterally aligned recesses 20 provide a full width slot open at the sides . each of the panel sections 18a has one or more apertures 24 therein provided to receive fasteners , to be seen hereinafter , for securement of building elements to the device 14 . as seen in fig2 cutouts 26 are provided in the bottom wall 16 for reducing the weight of the member as well as for conserving material . also , apertures 28 are provided in the wall 16 for secured attachment of the member 14 to a base , such as to a block 10 , concrete slab , or other support means . fig5 , 7 and 8 show various applications of the construction device 14 with building element such as support members and pillars . fig5 for example shows a horizontal decking surface support member 30 seated edgewise on the bottom wall 16 and extending fully through the device and out both side recesses 20 . fig6 shows a support member 30 similarly supported as in fig5 but also showing a right angle support member 32 extending through a 90 degree side recess 20 and abutted against the support member 30 . fig7 shows a vertical pillar 34 supported on the device 14 and fitted in the central socket 22 . fig8 shows a pillar 34 similarly fitted in the socket 22 as in fig7 but also showing side beams 32 extending in from all four of the side recesses . these members may simply be fitted in the respective recesses 20 or socket 22 but in most cases secured attachment to the member 14 is accomplished by fasteners 36 extending through the apertures 24 . also , device 14 can first be secured to the base member by fasteners extending through the apertures 28 . fig3 is a bottom perspective view of a construction device 14 &# 39 ; having a bottom wall 16 and side walls 18 in an arrangement similar to that shown in fig1 and 2 . this structure , however , is formed , such as by integral molding , with a plurality of depending foot members 38 . four of such foot members are shown , as well as a central foot member , but any number of such foot members may be provided . in the fig3 embodiment , the foot members 38 are hollow whereby long fasteners can be inserted down from the top through the wall 16 and into a base for secured attachment of the construction device 14 &# 39 ; to the base . fig4 shows a structure similar to fig3 except that the outer foot members 38 &# 39 ; are solid and not hollow . this embodiment may be employed in circumstances where it is not necessary to use vertical fasteners around an outer portion of the member . fig9 - 12 illustrate an embodiment of the invention employing means for anchoring the body member against lateral shifting . in this embodiment , the body member 14 &# 34 ; is the same as that shown in fig1 as to quarter panel sections 18a and their formation of aligned recesses 20 and central socket 22 . to accomplish the lateral anchoring feature the outermost panel section 18a of each quarter section has a depending projection or lip 40 defined by a bottom wall portion 42 integral with side extensions 44 and a rear wall portion 46 . rear wall portion 46 preferably angles outwardly toward the bottom whereby to coincide with the angle of the side surfaces of a pier block 10 of the type shown in fig5 - 8 . wall portion 46 can extend at the desired angle , so as to have flush engagement with the pier block sides . fig1 and 12 show application of the device 14 &# 34 ; of fig9 to a pier block . in such arrangement , the device and the building elements therein are anchored or locked against lateral shifting . fasteners extending through the bottom wall of the device are not necessary , although such fasteners can be used if desired . the cross dimension of the device between wall portions 14 &# 34 ; can be preselected according to the size of the pier block so that a snug or frictional fit is provided . with reference to fig1 , 14 and 15 , the concept of the invention utilizes the single pier block 50 as the base or ground support for a deck construction wherein both horizontal and vertical support members provide for a level deck surface on a building site of uneven ground . this is accomplished by the recess of block 50 having a central socket portion 22 &# 39 ; and two equal narrower portions 20 &# 39 ; which extend inward from the outer edges of two opposite sides of the top surface of the block 50 and lead into the central socket portion as best shown in fig1 . the two narrower portions 20 &# 39 ; are for receiving a horizontal decking surface support member 30 which also passes through the central socket portion 22 &# 39 ;, as shown in fig1 . the central socket portion 22 &# 39 ; is for receiving a vertical pillar support 34 , independent of the two equal narrower portions 20 &# 39 ; as shown by fig1 . the horizontal decking surface support member 30 and the vertical pillar support member 34 being mutually exclusive to each other in the single block 50 and also mutually interchangeable with each other in the same block 50 . this is applied to concrete pier blocks designed for constructing a deck on an unprepared and unleveled building site , an example of which is shown by fig1 . such decks on uneven ground , using the present block , are extremly simplified in their construction and can be supplied in preplanned , pre - cut units . other advantages also exist in the structure , as will be apparent hereinafter . the deck shown in fig1 , designated by the numeral 52 , comprises the pier blocks 50 as the base or ground support for the deck , each of the blocks 50 receiving such lumber as a 2 inch thick ( 11 / 2 inch thick nominal ) horizontal decking surface support member 30 in the two narrower portions 20 &# 39 ; and central socket portion 22 &# 39 ; of block 50 , each member 30 in block 50 then supporting the deck surface material 54 which is nailed in place and each block 50 supporting the horizontal decking surface support member and decking surface material 54 , those blocks 50 being on bare or unprepared ground of a building site . the deck shown in fig1 , designated by the numeral 56 , similarly uses some pier blocks 50 as supporting the horizontal decking surface support 30 and decking surface material 54 and also illustrates the use of some blocks 50 as the base or ground support for directly receiving vertical piller 34 set in the central socket 22 &# 39 ; when member 30 is not in block 50 , member 34 then providing support to member 30 by member 30 being on top of member 34 and those blocks 50 then supporting the vertical pillar support 34 and the horizontal decking surface support member 30 and the decking surface material 54 , due to localized variations of the ground within an unprepared and unleveled building site . a deck support member 30 can also be fastened to a building . the particular structure of the manufactured pier block makes it possible to construct an extremely simplified deck and one which can be pre - planned and pre - cut if desired . that is , such lumber as 2 inch thick deck support members 30 and vertical wood pillars 34 which can be used therewith comprise conventional existing material , namely , the 2 inch thick deck support members 30 can comprise 2 × 6 &# 39 ; s or 2 × 4 &# 39 ; s and pillars 34 can comprise 4 × 4 &# 39 ; s . the two equal narrower portions can be 2 inches deep and have a width of 13 / 4 inches . this latter dimension would receive conventional finished 2 × 6 &# 39 ; s ( 11 / 2 inches thick ) and 2 × 4 &# 39 ; s ( also 11 / 2 inches thick ). 2 × 6 &# 39 ; s and 2 × 4 &# 39 ; s have finished height dimensions of 51 / 2 and 31 / 2 inches , respectively , whereby the deck support members , whether 2 × 6 &# 39 ; s or 2 × 4 &# 39 ; s , project to a minimum necessary height above the top surface of the blocks 50 when seated in the recess for supporting the decking thereon . the central socket portion 22 &# 39 ; can be 2 inches deep , similar to the narrower portions 20 &# 39 ;. such socket portion is square , having and can have dimensions of 33 / 4 inches for receiving a conventional finished 4 × 4 ( 31 / 2 inches square ) lumber support pillar . the vertical pillar becomes sufficiently fixed in socket portion 22 , in the block for deck construction purposes , as does the horizontal deck support member in the two narrower portions 20 &# 39 ;, also being within the central socket portion 22 &# 39 ; when the member 34 is not in the block 50 , for lateral stability . pier block 50 is designed to provide support to a deck unleveled on or unprepared building sites with no additional components required . for this purpose , the block is molded into a unitary four sided equal pyramidal body with a truncated apex . it is tapered to a larger dimension toward a flat bottom . the top and bottom surfaces are flat and square . the enlarged bottom surface combined with the mass of the block below the formed recess ; allows the block to serve as its own footing . the design of the concrete block 50 maintains the necessary integral strength , to the deck , without the necessity of re - bar reinforcement and thus contributes to manufacture of a pier block and deck structure in a pre - planned and pre - cut unit which is also sufficiently simplified in its use , standardized in its manufacture , and sufficiently inexpensive for deck construction by the average do - it yourself homeowner , on unprepared and unleveled ground areas such as are typical to the backyard of a suburban residence . since the recess can be two inches deep , that further provides for the block being integrally sufficient to support the deck height from 8 inches to one foot . the recess of the pier block of fig1 automatically and non - mechanically centers the horizontal decking surface support member 30 in the block 50 when the vertical pillar 34 is not in the block , as shown in fig1 , and also does the same for the vertical pillar member 34 when the horizontal member 30 is not in the block , as shown in fig1 , which automates the connection and securement of these support members to the pier block for a deck construction as shown in fig1 . mounted engagement of the horizontal surface support member and vertical pillar with the block is accomplished in a connector - free relationship , namely , without metal brackets , embedded connectors , etc ., thus allowing individual blocks of a deck construction on the uneven ground of an unleveled and unprepared building site to be adjusted without the need of any disassembly of the deck ( i . e . removing bolts , nails or screws ). also the recess of the pier block 50 maintains horizontal and vertical members in parallel which is critical in construction of the deck . it is to be understood that the forms of our invention herein shown and described are to be taken as preferred examples of the same and that other changes in the shape , size and arrangement of parts may be resorted to without departing from the spirit of our invention or the scope of the following claims .	8
the adjustable mechanism for a motor vehicle illustrated in fig1 a to 1 c and 2 , more particularly for adjusting the seat longitudinal position of a motor vehicle seat by a longitudinal guide rail , comprises a fixed ( rotationally secured ) threaded spindle 100 , a spindle nut 1 mounted rotatable thereon and a drive worm 2 driving the spindle nut . the spindle nut 1 and the drive worm 2 are mounted in a gearbox housing 3 , 4 . to use this gearing in a seat longitudinal adjuster which comprises two guide rails which engage in one another and are displaceable relative to each other , the fixed threaded spindle 100 is fixed on one of the two guide rails and the gearbox housing 3 , 4 is mounted together with the spindle nut 1 and worm 2 on the other guide rail through a holder 5 and is connected to this guide rail . the drive worm 2 is assigned a drive ( not shown in the drawings ), e . g . in the form of a drive motor which during actuation triggers a rotational movement of the drive worm 2 which in turn leads to a rotational movement of the spindle nut 1 which engages with the worm toothing 25 through its external toothing 15 . as a result of the interaction of the spindle nut 1 with the rotationally secured threaded spindle 100 there is a displacement of the threaded spindle 100 relative to the spindle nut 1 along the longitudinal axis l of the spindle nut 1 and threaded spindle 100 . this in turn leads to a relative movement of the two guide rails along the direction l since the one guide rail is assigned to the threaded spindle 100 and the other guide rail to the spindle nut 1 and the longitudinal axis l of the spindle nut 1 and threaded spindle 100 corresponds to the adjusting direction of the guide rails which are displaceable relative to each other . adjustable mechanisms of this kind are known for motor vehicle seats . the special features of the adjustable mechanism illustrated in fig1 a to 1 c and fig2 will be explained which result in a particularly compact , lightweight and at the same time stable construction of the adjustable mechanism . the spindle nut 1 has a cylindrical contour ( with an outer surface 10 formed as a cylinder sleeve ) into which an external toothing 15 is worked and which is free of toothed areas at each of its two axial end sections 11 , 12 . the external toothing 15 of the spindle nut 1 is characterised in that compared with the tooth - free axial end sections 11 , 12 of the spindle nut 1 it points inwards in the radial direction r ( perpendicular to the longitudinal or rotational axis l of the spindle nut 1 ). this means the extension of the spindle nut 1 in the radial direction r is in the region of the external toothing 15 smaller or in sections in any case at least as large as in the tooth - free end sections 11 , 12 which each bear against the external toothing 15 in the axial direction a . as an alternative the spindle nut 1 can also have only one end section without external toothing . the at least one tooth - free axial end section 11 , 12 of the spindle nut 1 can thereby be so thin in the axial direction a of the spindle nut 1 that it forms substantially a line around the outer circumference of the spindle nut 1 , the external toothing 15 of the spindle nut 1 extends practically up to the outermost edge of the spindle nut and only changes into an axial end section 11 or 12 without toothed areas directly adjoining this edge . in order to enlarge the support diameter and cross section during interaction of the external toothing 15 of the spindle nut 1 with the worm toothing 25 of the drive worm 2 mounted on a drive shaft 20 , the external toothing 15 of the spindle nut 1 is made like a worm wheel toothing ( globoid toothing ) which means the external toothing 15 is substantially globoidal . however the centre region 16 of the external toothing 15 in the axial direction a is designed in a cylindrical part in the tooth path with a tooth profile ( e . g . in the manner of an involute toothing ) in order to widen the tolerance position of the drive worm 2 axially relative to the spindle nut 1 thereby avoiding problems with noise . on either side of the middle area 16 of the external toothing 15 , the tooth region of the spindle nut 1 changes continuously into the tooth - free end sections 11 , 12 of the spindle nut 1 through a constant radial reduction in the tooth depth ( tooth height ) in the axial edge regions 17 , 18 of the external toothing 15 . in the case of a substantially linear tooth - free end section 11 , 12 of the spindle nut 1 this means that the reduction in the tooth depth or tooth height to zero , corresponding to a transition into a tooth - free end section 11 , 12 only takes place directly at the relevant axial end of the spindle nut 1 . for maximum stability it is thereby advantageous that the tooth depth at at least one axial end of the spindle nut moves towards zero ( assumes the value zero ) so that an end section 11 or 12 without external toothing is formed there ( even if thinner in the axial direction ). overall the design of the outer surface 10 of the spindle nut 1 as described with the inwardly formed external toothing 15 which in the radial direction r does not project over the end sections 11 , 12 helps considerably in increasing the stability of the spindle nut 1 which can consequently be made from plastics as a particularly lightweight material . a special feature lies in the fact that the inner toothing 19 of the spindle nut 1 designed as a thread extends in the axial direction a over a greater length than the external toothing 15 in order to increase the bearing capacity of the thread . the internal toothing 19 ( in the form of an inner thread ) extends over the entire axial length of the spindle nut 1 , thus along the end sections 11 , 12 tooth - free on the outer side ( and where applicable also along the relevant bearing collar 13 , 14 which does not form a constituent part of the spindle nut in the narrower sense ). furthermore the tooth elements ( threaded elements ) of the inner toothing 19 ( in the form of an internal thread ) of the spindle nut 1 have a thickness d ( extension in the axial direction a ) which is greater than the gap width e , and more particularly at least twice as large , e . g . corresponding to a ratio of 70 : 30 . consequently the tooth elements ( threaded elements ) of the outer thread 109 of the threaded spindle 100 are considerably thinner than those of the inner toothing 19 ( inner thread ) of the spindle nut 1 . for the thickness of the toothed elements ( threaded elements ) of the threaded spindle 100 corresponds substantially to the gap width e of the inner toothing 19 of the spindle nut 1 . the spindle nut 1 and associated drive worm 2 are mounted in a gearbox housing 3 , 4 which is made of plastics and which is formed from a bearing constituent part with two bearing plates 31 , 32 and an outer housing component having two housing plates 41 , 42 of substantially u - shaped cross - section . the two bearing plates 31 , 32 which are made of plastics each have a bearing opening 33 , 34 as the bearing point for an associated bearing collar 13 , 14 of the spindle nut 1 which each protrude on the end side axially away from the spindle nut 1 . the two bearing sections 33 , 34 are formed by bearing openings and compared with the thickness of the bearing plates 31 , 32 have an enlarged extension in the axial direction a in that a corresponding wall section 33 a , 34 a which engages round the relevant bearing opening 33 , 34 protrudes away from and in the axial direction a perpendicular to the relevant bearing plate 31 , 32 . ( an axial clearance of the spindle nut can hereby be minimised by sliding the bearing plates 31 , 32 in the axial direction ). the plastics for the bearing plates 31 , 32 , more particularly their bearing points 33 , 34 is selected so that an optimum friction pairing is obtained during interaction with the relevant bearing collar 13 , 14 of the spindle 1 which likewise consists of plastics . the associated drive worm however preferably consists of metal . a reinforcement ring , more particularly in the form of a disc , consisting preferably of metal ( steel ) can be mounted on the relevant bearing collar 13 , 14 and serves to stabilise the spindle nut , more particularly with a very thin axial design of the tooth - free end sections 11 , 12 . the diameter of a ring of this kind is selected as large as possible , more particularly so that it coincides with the diameter of the axial end sections 11 , 12 . the relevant ring is located seen in the axial direction a on the relevant bearing collar 13 , 14 between the associated axial end sections 11 , 12 of the spindle 1 and the associated bearing plates 31 , 32 so that the relevant bearing plate 31 , 32 can be supported through the relevant rings on the associated axial end sections 11 , 12 of the spindle nut 1 . furthermore the plastics used for manufacturing the bearing plates 3 or gearbox housing 3 , 4 can be heat - conductive so that the heat which arises at the bearing points 33 , 34 during operation of the adjustable mechanism can be dissipated . the two outer housing plates 41 , 42 of the gearbox housing 3 , 4 which are likewise made of plastics are each formed with a u - shaped cross - section with a base surface 410 , 420 as well as with side arms 411 , 412 and 421 , 422 which protrude away therefrom . they have at the end sides in their arms 411 , 412 and 421 , 422 recesses 45 which to produce a push - in connection can be pushed ( slid ) over the end sides 35 of the bearing plates 31 , 32 . in addition the u - shaped housing plates 41 , 42 in the assembled state engage with curved recesses 43 , 44 round the bearing sections 33 , 34 of the bearing plates 3 , 4 and help to stabilise same . as is clear from fig1 b and 1 c the bearing plates 31 , 32 are in the assembled state of the gearbox housing 3 , 4 enclosed more or less completely by the u - shaped housing plates 41 , 42 . to support the drive worm 2 the housing plates 41 , 42 have corresponding bearing openings 46 . in a modification of the embodiment described with reference to the figs the spindle nut 1 can also be mounted directly by their end sections 11 , 12 in the gearbox housing , namely directly in circular arcuate recesses 43 , 44 of the u - shaped outer housing plates 41 , 42 . the inner bearing plates 31 , 32 can then be omitted . furthermore each of the two housing plates 41 , 42 has in its base plate 410 and 420 a recess in the form of a window - like opening 48 in which the spindle nut 1 projects radially by its external toothing 15 . the two opposing window - like openings 48 extend parallel to the longitudinal axis l ( rotational axis ) of the spindle nut 1 and are spaced in the radial direction r from same . they are thus aligned substantially perpendicular to the bearing openings 33 , 34 for the spindle nut 1 . in a corresponding way the two u - shaped housing plates 41 , 42 in the assembled state form between their arms 411 , 412 and 421 , 422 a further window - like opening 46 which extends parallel to the axis of rotation ( drive shaft 20 ) of the drive worm 2 and is spaced in the radial direction from same . this enables a radial engagement of the drive worm 2 by its worm toothing 25 in the window - like opening 49 on its side remote from the spindle nut 1 . the window - like openings 48 , 49 further improve the compact structure of the adjustable mechanism . for the space for the spindle nut 1 and the drive worm 2 need not be provided entirely inside the gearbox housing 3 , 4 but the gear elements 1 , 2 can project partially into the side boundary walls ( housing plates 41 , 42 ) of the gearbox housing . at the same time this prevents the development of noises inside the gearbox housing as a result of resonances . resilient elements , e . g . in the form of injection - moulded uncoupling elements can be provided on the two outer housing plates 41 , 42 and where applicable the bearing plates 31 , 32 in order to produce an acoustic uncoupling from the vehicle part ( e . g . a seat part in the form of a guide rail ) on which the gearbox housing 3 , 4 is mounted and fixed . these resilient elements ( decoupling elements ) can when using a multi - component injection moulding process to manufacture the housing parts be made from a different plastics than the housing parts themselves . alternatively corresponding resilient elements can also be mounted as separate component parts on the gearbox housing 3 , 4 . to fix the gearbox housing 3 , 4 on a motor vehicle part in the form of a guide rail for a motor vehicle seat there is used according to fig2 a holder 5 of metal of a substantially u - shaped cross - section with a base 50 and two side arms 51 , 52 which each have through openings 53 , 54 for the threaded spindle 100 . from the two arms 51 , 52 of the holder between which the housing 3 , 4 is housed so that a bearing plate 33 , 34 is opposite each arm ( with the interposition of the arms 411 , 412 ; 421 , 422 of the u - shaped housing plates 41 , 42 ) protrudes a fixing flange 55 , 56 with a fixing point in the form of a fixing opening 57 and 58 respectively which enables the holder 5 to be fixed on a guide rail of a motor vehicle seat . as a result of the stable construction of the adjustable mechanism 1 , 2 and the associated gearbox housing 3 , 4 as well as a result of the stable hold of the adjustable mechanism 1 , 2 and gearbox housing 3 , 4 by the arms 51 , 52 of the u - shaped holder 5 a particularly high resistance of the overall arrangement to external forces , more particularly in a crash situation is reached despite the lightweight and compact structural design of the adjustable mechanism 1 , 2 and the gearbox housing 3 , 4 . in a crash situation , more particularly a front or rear crash of the corresponding vehicle it must be ensured that the spindle nut 1 does not slip through along the longitudinal direction of the threaded spindle 100 , for this would lead to a corresponding acceleration of the associated vehicle seat with an increased risk of injury to the seat occupant . to this end , the spindle nut 1 is held stable between the bearing plates 31 , 32 and the arms 51 , 52 of the u - shaped holder 5 and in a crash situation is reliably supported in the axial direction a so that it cannot slip in the direction of the longitudinal axis l along the spindle 100 . in order to manufacture the adjustable mechanism 1 , 2 shown in fig1 a to 3 with the gearbox housing 3 , 4 a multi component injection moulding process is preferably used whereby all the method steps are preferably carried out in a single injection moulding tool . first the spindle nut 1 is injected in any tool and then the two bearing plates 31 , 32 are injected in the same tool . during injection moulding the spindle nut 1 is hereby mounted in the two bearing plates 31 , 32 so that no subsequent assembling of the bearing plates 31 , 52 and the spindle nut 1 is required . the drive worm 2 is then fitted into the injection moulding tool and the outer u - shaped housing plates 41 , 42 are injected whereby ( as a result of the bearing plates 31 , 32 and drive worm 2 located in the injection moulding tool ) already during injection moulding the connection is made with the bearing plates 31 , 32 in the recesses 45 and the bearing of the drive worm 2 in the associated bearing openings 46 . the complete finished gearbox housing 3 , 4 can then with the adjustable mechanism 1 , 2 mounted therein be removed from the injection moulding tool . with the method steps described here it is possible to change the sequence of the process stages — depending on the design of the adjustable mechanism and the gearbox housing in individual cases —. also the installation of the drive worm 2 can also take place only at a later date by clipping into the gearbox housing 3 , 4 . within the scope of a multi component injection moulding process different plastics can thereby be used for spindle nut 1 , the bearing plates 31 , 32 and the outer u - shaped housing plates 41 , 42 . according to another manufacturing method the bearing plates 31 , 32 and the outer u - shaped housing plates 41 , 42 are made as individual parts separately from plastics ( injection moulded ), fitted together at their push - fit connections 35 , 45 and then in the region of the push - fit connections are fixed against one another through reshaping or thermal processes such as e . g . laser welding , hot caulking , ultrasound welding or in some other way , e . g . through adhesive . in each case the connection of the individual housing parts 31 , 32 ; 41 , 42 ( thus the bearing plates 31 , 32 with the outer u - shaped housing plates 41 , 42 ) takes place solely at the push - fit connections 35 , 45 by which the position of the housing parts 31 , 32 ; 41 , 42 relative to each other along all spatial directions is fixed . as connecting points between the housing parts 31 , 32 ; 41 , 42 serve preferably only the push - fit connections 35 , 45 which are made and fixed either directly during injection moulding of all the housing parts in one injection moulding tool or in the case of separate injection moulding of the individual housing parts are made subsequently by fitting together and then fixed against one another in an additional connecting step . laser welding is particularly suitable as the additional connecting step for connecting the outer u - shaped housing plates 41 , 42 with the bearing plates 31 , 32 in the region of the push fit connections 35 , 45 . for this the outer u - shaped housing plates 41 , 42 preferably consist of a transparent material for the laser beam used whilst the inner bearing plates 31 , 32 absorb the corresponding laser beam and thereby fuse so that a connection is made between the inner bearing plates 31 , 32 and the outer u - shaped housing plates 41 , 42 in the region of the push fit connections . the desired absorption of the laser beam through the inner bearing plates 31 , 32 can be achieved by adding carbon black to the material of these bearing plates . before or during the welding of the housing plates 31 , 32 ; 41 , 42 of the gearbox housing 3 , 4 it is still possible to eliminate axial bearing play between the bearing plates 31 , 32 and the spindle nut 1 by applying a defined axial force to the bearing plates 31 , 32 before the welding process is completed . a particularly advantageous method for reducing or eliminating possible play such as e . g . bearing play of the gearing elements 1 , 2 of the adjustable mechanism in the associated bearing regions of the gearing housing 3 , 4 and / or the play during interaction of the gear elements of the adjustable mechanism 1 , 2 itself or of play in the region of the push fit connections 35 , 45 of the gearbox housing 3 , 4 , will now be explained with reference to fig4 a to 7 . for this according to fig4 a during the fusing of the material in the region of the push fit connections 35 , 45 a tension force f is exerted by a tension device on the external housing part 41 in the form of a housing plate . the tension device comprises a tension plate p bearing against the outer side of the corresponding housing plate 41 on which through an elastic element e in the form of a compression spring a pressure - generating longitudinally movable slider d guided in a guide slide k acts with a defined tension force f . the corresponding housing plate 41 is hereby tensioned relative to the opposing housing plate 42 which is to be spatially fixed in a suitable way or likewise elastically to be pretensioned , and at the same time also tensioned relative to the housing assembly , comprising the two bearing plates 31 , 32 , which lies in between . the tensioning takes place in the embodiment illustrated in fig4 a along the assembly axis a ( see fig1 a ) along which the outer housing plates 41 , 42 can be set onto the bearing plates 31 , 32 for fitting together . the tensioning can however also take place transversely to the installation direction a . as shown with reference to fig5 the bearing plates 31 , 32 preferably have in the installation direction a an oversize ü i . e . the end sides 35 of the relevant bearing plates 31 , 32 serving as push - in sections and formed by projections , have such an extension that the extension of the relevant bearing plate 31 , 32 is greater overall along the installation axis a than provided in the finished assembled gearbox housing . this oversize is according to fig6 a and 6 b reduced to the final size when by a laser beam l the end sides 35 formed by projections of the bearing plates 31 , 32 are melted e . g . through laser or ultra sound welding . a part of the molten material of the corresponding end side 35 of the relevant bearing plate 31 or 32 hereby flows as molten material g into a clearance 45 a of the recess 45 of the corresponding housing plate 41 into which the relevant bearing plate 31 or 32 engages to form an engagement or push - in area 35 , 45 at its associated end side 35 . the formation of the corresponding clearance 45 a is enabled through a shoulder 35 a on the relevant end side 35 of each bearing plate 31 , 32 . the melting process is thereby preferably set in motion after applying the pretension forces onto the elements of the housing 3 , 4 provided for this purpose , e . g . on at least one of the outer housing plates 41 , 42 through starting up a laser which generates the laser beam l . under the action of the pretension force f the housing plate 41 executes a settling movement s in the pretensioning direction along the installation axis a whereby the intended removal or reduction of play in the adjustable mechanism 1 , 2 as well as in the bearing points of the gear elements of the adjustable mechanism 1 , 2 in the housing 3 , 4 can take place . fig7 shows a modification of the end side of a bearing plate 31 which has here a number of projections 35 ′ each forming a shoulder 35 a . so that the laser beam l can act targeted onto the projections 35 of the bearing plates 31 , 32 the housing plates 41 , 42 are preferably made from a material which is transparent to the corresponding laser beam l . to control or regulate the melting process it is possible to define at least one switch - off criterion which when reached stops the melting or welding process . for this it can be proposed by way of example that the speed and / or dynamics of the settling movement s of the housing plate 41 or 42 under pretension is monitored . the switch - off criterion can then exist for example in that the speed of the settling movement s with which the housing plate 41 which is under pretension is moved relative to the opposite housing plate 42 or relative to the bearing plates 31 , 32 falls short of a certain minimum value . this means that any existing play in the adjustable mechanism 1 , 2 and in the gearbox housing 3 , 4 would be removed and a stop would be approached by way of example which no longer permits any further settling movement s . this can be due to the fact for example that the housing plates 41 , 42 are driven into stops of the associated end sides of the bearing plates 31 , 32 . on the other hand the process can also be force - controlled whereby the switch off criterion according to fig4 b is defined by monitoring the reaction force f ( whilst observing the principle of action equal reaction ) which is generated through the action of the tension device on a housing plate 41 . this force f is substantially constant at the start of the melting or welding process since the elastic element e in the form of a compression spring through which the tension device acts on the housing plate 41 permits a tracking of the pressure - generating slider d during the settling movement s of the housing plate 41 in the direction of the settling movement s . if finally the play compensation is concluded in as much as through the interaction of a stop with a counter stop a further settling movement s is no longer possible , then the force f rises steeply whereby reaching a maximum force f max serves as a switch - off criterion for terminating the melting and welding process . furthermore as a switch - off criterion it is also possible to use reaching a specific settling path during the settling movement s e . g . of the housing plate 41 . the switch - off criterion is usually selected so that the settling path which is to be reached corresponds at least to the difference between the oversize u of the bearing plates 31 , 32 along the installation axis a and the target final measurement once the gearbox housing has been assembled , thus in particular also after conclusion of the melting or welding process . furthermore a particularly simple switch - off criterion can also be defined in that a certain time length of the melting and welding process is predetermined , thus the laser triggering the process is only operated for a certain predetermined time span . even if one of the other switch - off criterion which is not based on reaching a certain minimum settling path is used , then also in these cases the reaching of a predetermined minimum settling path can be additionally used as a quality criterion , in that as a pre - requisite for a proper conclusion of the welding process it is seen that the settling movement does not fall short of a predetermined minimum settling path . in order to ensure reaching the predetermined minimum settling path as far as possible , the laser power can be regulated in dependence on the speed of the settling movement , more particularly such that the laser power is increased when the settling speed during the welding process lies below a predetermined normal value , and conversely the laser power is reduced when the settling speed lies above the predetermined normal value . if the predetermined minimum settling path is not reached during the welding process , then this can be a reference to the fact that the endeavoured removal of the play has not taken place to the full extent so that the corresponding gearbox housing has to be refinished or where applicable be discarded as a faulty part .	5
both direct melt and reheat processes are , in this invention , considered to be equivalent methods under the term vacuum formed films ( vff ). since both melt , form , and recrystallize in a three dimensional shape , each of the processes may be used to form films wherein the loft of the cells are robust . polymer webs have a property known as “ memory ” wherein a polymer web will tend to revert to its original shape . therefore , if a polymer web is formed as a flat web and then forced into a three dimensional shape without undergoing melting and recrystallizing , the polymer web will try to revert again to its original flat shape when any stresses are subsequently applied . robustness in the third dimension is critical for obtaining and then maintaining “ loft ”, which prevents rewet . two important variables are commonly discussed when describing a vff , loft and % ao . “ loft ” is defined as the top to bottom thickness of the vacuum formed film , which is typically the required spacial distance between a fluid containing absorbent core and the skin of the user or the thickness of the vacuum formed film . loft is typically measured by the same means used to measure “ embossed thickness ” in the polymer film industry . embossment is merely imparting a third dimension to the film , typically ne with defined pattern and shape . commonly used devices for this measurement are called “ low load micrometers ”. a wide area of displacement with a low compression load is utilized to insure one is measuring the full depth of pattern and one is not compressing the pattern to render a false reading . a tmi ® model 49 - 70 manufactured by testing machines , inc . of amityville , n . y . was used for the loft measurements herein . this relationship of properties ties directly to rewet performance and is a simple calculation of dividing loft , as measured in microns ( μ ), by the percent open area ( 17 . 3 %, for example ). as an example , a packing of 60 mesh round holes on a square pattern packing array , has a percent open area ( oa %) that can be calculated as follows : oa %={ 1 inch ÷[ mesh × mesh ( due to square array )]× area of each hole , in inches }× 100 a 60 mesh hole is 200μ in diameter , 200μ / 25 . 4μ / mil = 7 . 8 mil or 0 . 0078 inch diameter , for this invention it has been surprisingly discovered that by a combination of pattern , plane and texture , a vff providing adequate “ loft to % open area ratio ” for achieving good rewet values can also attain a desirable silky tactile impression ( sti ). it has been discovered that sti may be improved by selecting a specific range of mesh count from about 28 to 60 , preferably 40 . if fewer cells exist , it has been found that users can begin to sense the individuality of cells , which can detract from the sti effect . the sti may be further improved with an oval , boat shaped or elliptical cell having a major axis to minor axis ratio of at least about 1 . 05 : 1 . 0 to as much as about 6 . 5 : 1 , more preferably ranging from about 1 . 5 : 1 to 4 : 1 . the sti may be still further improved by aligning all the major axes substantially in the same direction . for purposes of this application , the stroking direction ( sd ) shall be defined as the direction along a length of an end product , e . g ., feminine napkin or the like . fig1 shows sample product 5 . arrow 7 shows the stroking direction . the stroking direction is typically the direction that a consumer strokes the material when assessing the film . it is desirable to align the stroking direction in a direction most likely to rub back and forth against a user during use , i . e . typically in a front to back orientation . by implementing the above steps , a discernable panel test result may be achieved for sti as compared to other vff topsheets and synthetic silk - like nonwoven materials previously known in the art . further , it is commonly understood by those skilled in the art that the “ machine direction ” ( md ) is the processing direction when manufacturing formed films , and with rare exception , when converting the formed film as a topsheet on an absorptive device . the md is the direction where the web of the material ( s ) moves continuously down a machine . as it relates to the forming screens , the md is the circumference of the screen and the “ transverse direction ” ( td ) is from the end to end length of the screen . as is commonly understood , the forming screen rotates around a stationary seal . therefore , the circumferential direction is the direction of continuous motion feeding film down the machine in the “ machine direction ”. while not typical or commonly used , alterations from this norm will be understood by a man of the art ; therefore , these are not intended as limiting to this invention . on most conversion lines that take the vff and place it as a topsheet , diapers or pads or bandages or whatever absorptive device is being manufactured will align the md of topsheet down the length , or greatest dimension , of the product . especially for feminine napkins , the difference of length to width is significant . in many tests when napkins are handed to women , they will typically stroke the topsheet down the length of the product as shown in fig1 . consequently , it is generally the case that the stroking direction is synonymous with the machine direction , although this need not be the case to fall within the scope of the applicant &# 39 ; s invention . for a consumer , the first perceptive triggers are gained by stroking the topsheet in the fashion described above when a consumer desires to know how the product will feel in use . the length is also aligned with the anatomy of common disposable articles . since disposable articles are typically held in the groin between the legs there is little chance of side to side or td motion . if the product shifts during the natural motions of the user , the shift will almost always occur in the md creating a “ stroking ” action of the topsheet against the skin . as explained above , and from all these correlated factors it can be seen that the term “ md ” and “ sd ” are typically synonymous . the sti effect is gained by a stroking motion . hence , the reference to the “ stroking direction ” ( sd ). for purposes of this application , the term “ oval ” shall relate to a rounded shape with a major and minor axis whose lines along the major axis direction are essentially curved . the term “ ellipse ” shall differ in that the lines along the major axis direction are essentially straight . hereafter , the ratio of major axes to minor axes shall be referred to as the sd : td ratio wherein sd is the stroking direction &# 39 ; s alignment of the major axes , and td is the transverse direction of the minor axes . although not essential for achieving the sti effect , it has been found that the sti effect is enhanced if the centers of major axes are commonly aligned with each other . again , while not essential for attaining sti effect , the sti effect may be further enhanced if the lands in the sd are on a slightly higher plane than the lands in the td . also , the sti can be triggered with this step alone . if sd lands are in a slightly higher plane , higher sti rankings are received when compared to single plane material of the same configuration . it has been found that as little as 15μ variance shows a slight distinction , although a 35μ variance is preferred . if a film has greater than a 145μ variance between the sd lands and the td lands , then problems can occur with the strength of the forming screen , especially in the case of finer mesh counts . winding issues , such as roll blocking due to nesting , may be introduced , as well . since the sd lands are raised , it is less critical to have rounded cell geometries . many polygonal shapes will also function , such as squares , hexagons , pentagons or other shapes . the variance in the height of the planes of the sd land plane and the td land plane can be achieved by machining a forming screen with cutting tools , grinding , etching , cutting with energy beams , or affixing wires to alter the external profile of the screen to form bi - planar lands . additionally , other means may be used for varying the height of sd lands . also non - essential , but preferred , for increasing the sti effect is the addition of various texturizations to the lands . more preferred is the addition of micro - ridges ( mr ) of a specific height and spacing . films having micro - ridges received surprisingly high panel test recognition of sti when the micro - ridges were applied to films having mesh counts of 28 or greater and especially to films having a 40 hex pattern . to form micro - ridge patterns , the pattern is typically etched into the land areas of the screen . the micro - ridges will readily form on the lands of the film , so long as there remains a direct pathway of air evacuation in the spaces between the ridges . the air evacuation requirement applies to all patterns intended for texturization of the lands of the film . if the molten film lays over a cavity and forms a seal around a perimeter of the cavity , thereby sealing off an air evacuation pathway , the film will be prevented from being suctioned into micro - pattern depressions . consequently , the film will be prevented from conforming to the shape of the micro - pattern depressions . all or some of these features and enhancements , e . g , commonly aligned centers of major axes , elevated sd lands , and micro - ridges , may be combined to create a vff material that will exhibit an sti effect among a majority of panelists assembled to test product . other important aspects are maintaining the adequate vff aperture diameter and product quality for transmission of fluids through the topsheet and into the absorbent core ( especially the more viscous menses fluid ), as well as maintaining the desired “ loft to % open area ratio ” of the vff such that good rewet values are achievable . additionally , it has been shown that a preferred range of mesh count can contribute to the desired sti . as stated above , mesh count is the number of cells aligned in an inch of length . the higher the mesh count , the greater the number of cells that are packed together . the lower the mesh count , the fewer the number of cells in a given linear measure and / or square area . cells or three - dimensional apertures may be patterned in any of a variety of arrays that are conducive to the desired objectives . once an array is chosen , cells can then be counted per an inch of length to determine “ mesh ”. referring now to fig1 a , a section of forming screen 10 , which exhibits an oriented ellipse pattern is shown . in the preferred pattern , ellipse shaped cells or apertures 12 have a major axis 14 and a minor axis 16 . the major axis 14 is aligned in the machine direction ( md ), which is indicated by arrow 18 . the transverse direction ( td ), is indicated by arrow 20 . in a preferred embodiment , the ratio of lengths of major axis 14 to minor axis 16 , i . e ., “ sd : td ” is about 3 : 1 . preferably , all major axes 14 are aligned with each other and are aligned in the machine direction 18 . additionally , all minor axes 16 are correspondingly aligned in the td 20 . areas between cells 12 are sd lands 22 and td lands 24 . referring now to fig1 b , a cross - section of forming screen 10 is shown taken along line 2 - 2 of fig1 a . fig1 b is an embodiment of forming screen 10 wherein sd land 22 is on a higher plane than td land 24 . the sd lands may be seen more clearly in fig1 c , which is a cross section of forming screen 10 taken along lines 1 c - 1 c of fig1 a . referring now to fig2 a , a section of forming screen 10 ′, which exhibits an oriented ellipse pattern is shown . in the preferred pattern , ellipse shaped cells or apertures 12 ′ have a major axis 14 ′ and a minor axis 16 ′. the major axis 14 ′ is aligned in the machine direction ( md ), which is indicated by arrow 18 . the transverse direction ( td ), is indicated by arrow 20 . in a preferred embodiment , the ratio of lengths of major axis 14 ′ to minor axis 16 ′, i . e ., “ sd : td ” is about 3 : 1 . preferably , all major axes 14 ′ are aligned with each other and are aligned in the machine direction 18 . additionally , all minor axes 16 ′ are correspondingly aligned in the td 20 . areas between cells 12 are sd lands 22 and td lands 24 . referring now to fig2 b , a cross - section of forming screen 10 ′ taken along lines 2 b - 2 b is shown . fig2 b depicts an embodiment wherein an upper surface of sd land 22 ′ and td land 24 ′ are in the same plane . the sd lands may be seen more clearly in fig2 c , which is a cross - section of forming screen 10 ′ taken along lines 2 c - 2 c of fig2 b . referring now to fig3 a single plane vff 26 is shown . vff 26 is produced from a forming screen having an elliptical pattern with md alignment of the major axes 28 of cells 30 . the pattern shown in fig2 is a 40 mesh pattern when counting cells in the td . apertures 30 of vacuum formed film 26 measures about 750μ in the sd or major axis 28 direction and about 250μ in the td or minor axis 32 direction . the thickness of the cells , which are from top to bottom of the three - dimensional cells 30 , i . e , loft , is about 345μ . the vff 26 has an open area of 14 . 5 %. therefore , the loft to % open area ratio of the vff 26 is about 24 . the vff 26 has a rewet value of 0 . 08 grams . the variance between the upper surface of the sd lands 34 and the td lands 36 in the bi - planar material 26 is about 20μ . referring now to fig4 a multi - plane vff 38 is shown wherein the highest plane is the upper surface of the sd lands 40 . vff 38 is produced from a forming screen having an elliptical pattern with md alignment of the major axes 42 of cells 43 . the pattern shown in fig6 is a 40 mesh pattern . cells 43 of vacuum formed film 38 measure about 750μ in the sd or major axis 42 direction and about 250μ in the td or minor axis 44 direction . the thickness of the apertures 43 , which are from top to bottom of the three - dimensional cells 43 , i . e , loft , is about 345μ . the vff 38 has an open area of 14 . 5 %. therefore , the loft to % open area ratio of the vff 38 is about 24 . the vff 38 has a rewet value of 0 . 08 grams . the variance between the upper surface of the sd lands 40 and the td lands 46 in the bi - planar material 38 is about 20μ . referring now to fig5 a and 5b , fig5 a and 5b show another embodiment of vff that shall be referred to as a vff having “ boat shape cells ” ( bsc ) 50 . the “ boat shaped cell ” embodiment 50 preferably has a mesh count of 40 . “ boat shape cell ” refers to the oval shape apertures 52 having rounded tips . apertures 52 have a major axis 54 and a minor axis 56 . preferably , the ratio of length of major axis 54 to minor axis 56 of the cells is about 1 . 75 : 1 . it has been found that rounding off the extremities of either an oval shaped cell , as shown in fig5 a and 5b , or an ellipse shaped cell , as shown in fig3 and 4 , further enhances the sti , especially in a single plane material . the bsc embodiment 50 of fig5 a and 5b has cells 50 having a length along the major axis 54 of about 425μ and a length along the minor axis of about 240μ . the bsc film 50 has a loft of 315μ and an open area of 22 %, which yields a loft to % open area ratio of 14 and a rewet value of 0 . 15 grams . of course , the above dimensions are illustrative and other dimensions of may be used . an additional feature of the bsc embodiment 50 is that the major axis 54 of the boat shaped cells or three dimensional apertures 52 are aligned in the sd but are not commonly aligned with each other , i . e ., the cells 52 are presented in a “ staggered ” arrangement . consequently , sd lands 58 are not straight as is the case with sd lands 34 ( fig3 ) and 40 ( fig4 ) of vff films 26 and 38 , respectively . a film having bi - planar lands , e . g , the embodiment shown in fig1 a and 1b , are not preferred for the staggered bsc embodiment because it has been found that bi - planar lands are best achieved when all the sd lands , e . g . 34 and 40 are co - aligned with each other . despite these less preferred variations , it has been found that panelists have still been able to derive a noticeable sti from the 40 mesh bsc ( when counting the mesh in the td ) embodiment 50 . application of a random matte texture to the lands further enhances the material and slightly improves a panel &# 39 ; s sti rating of the material . while it is known that the addition of any of the aforementioned vff - capable textures to the lands will contribute to improvement of the tactile impression and eliminate any perceptive triggers that are indicative of a plastic type material , it has surprisingly been found that “ micro - ridges ” ( mr ) alone can create a perceptible sti . referring to fig6 a , 6b and 7 , microphotographs of a top view of vff 100 ( the side to the user ; fig6 a ) and a bottom view of vf 100 ( the side away from the user ; fig6 b ), and an expanded graphic in cross - section of vff 100 ( fig7 ) are given to show the mr of this invention . vff 100 has a 40 hex pattern . to form textures on lands 102 of vff 100 , lands on a forming screen that is used to make vff 100 are ground to be substantially flat to accept the artwork for etching the micro - ridges in the land region of the forming screen . as a result , lands 102 , formed between apertures 104 , are imparted with micro - ridges 106 . the machine direction ( md ) or stroking direction ( sd ) is indicated by arrow 108 . micro - ridges 106 preferably have individual distinction with a range of height and spacing and have an optimum sti effect when aligned on a bias , i . e ., at offset angle 110 to the sd 108 . offset angle 110 may be 5 ° to 80 ° to achieve some effect , but the preferred range for offset angle 110 is from 30 ° to 60 °, and ideally 45 ° is used . the height of the mr 106 can range from 5μ to 75μ , but the preferred range is from 5μ to 35μ . ideally , mr 106 have a height of 20μ . spacing between micro - ridges 106 can range from 25μ to 250μ , but more preferably range from 50μ to 150μ . most preferably , a 95μ spacing is used . the micro - ridges 106 must also maintain “ individuality ”. if micro - ridges 106 become interconnected , then micro - ridges 106 will not create the desired sti but rather the micro - ridges 106 will exhibit a planar and plastic - like feel instead . various formed films were tested by ten panelists for silky tactile impression ( sti ). the results are presented in table 2 , below . the panel method was based upon the aatcc ( 1997 ) evaluation procedure 5 , fabric hand : guidelines for the subjective evaluation of fabric , a technical manual of the american association of textile chemists and colorists , volume 72 ( pp . 352 - 354 ), research triangle park , n . c . ; and , astm ( 1968 ) manual on sensory testing methods . astm special technical bulletin 434 , 1968 , pp . 3 - 5 . the evaluation procedure utilized a common pad of standard thickness and material yielding a standard compressibility . values for thickness and compressibility are not particularly important , so long as the values are consistent . the pad was cut into 1 . 5 ″× 3 . 0 ″ rectangles . the films were wrapped fully around and taped closed , much like wrapping a gift , leaving on one side a continuous , smooth area of material . the continuous , smooth side comprise the tested side . panelists washed their hands so that the samples were not tainted ; tainting potentially creating an anomalous variance between panelist one and panelist ten , as the samples are passed from one panelist to another . the samples were coded by an identifier , such as a number or letter , but no information was provided to avoid any pre - biasing of a panelist . the panelists were asked to rate the samples from 1 to 10 with 1 being the silkiest and 10 being not silky . all but one of the products in the test data of table 2 below are apertured film embodiments , except for “ unicharm &# 39 ; s ts threads on nw ”. the unicharm product is not a formed film product , but it has been added to table 2 because it is recognized as succeeding as a feminine napkin topsheet in asia and is known to be viewed as triggering a favorable sti . it is constructed by an unknown method wherein synthetic silk threads are bonded to a top plane ( skin contact side ) of a nonwoven web . holes are punched through the material , apparently to increase the rate of fluid acquisition . its fluid acquisition rate value is believed to be over 3 . 0 grams . the unicharm product is included here to assist in obtaining a stronger reading on the panel test &# 39 ; s apparent line of separation between sti and non - sti materials . also included for that purpose is comfort silk ®. comfort silk ® is a mechanically formed apertured film but is not a vff . it too has been accepted as “ silky ” in the marketplace . therefore , the inclusion of comfort silk ® aids in making sti and non - sti distinctions . in reviewing the data , it is commonly accepted that an average ranking of a film by ten panelists of a value of ≦ 5 . 0 indicates a sti is discernable . the number of no . 1 rankings given by panelists can also serve as an indication that an sti has been ‘ triggered ’. another important test for comparing various films is a “ rewet test ”. for testing rewet a test fluid comprising two parts pepto - bismol ® and one part distilled water was used . the sample assembly consisted of a 5 × 5 inch piece of vacuum formed film or nonwoven topsheet placed with the user side up and the garment side down over 3 plies of absorbent medium . an amount of 2 - ml test fluid was delivered through a pipette onto the center surface of the topsheet . the time , in seconds , taken for all of the liquid to penetrate through the topsheet was recorded with a stopwatch . this portion of the test indicates the fluid acquisition rate . after the initial insult , an additional 15 - ml of the test fluid was delivered to the center surface of the topsheet . an 8 lbs rewet weight with a 4 × 4 inch footing was placed on the top of the topsheet for 3 minutes for the fluid to thoroughly spread out into the core pads . then , two pre - weighted pickup papers were pressed against the topsheet with the 8 lbs rewet weight for an additional 2 minutes . the amount of weight increase of the pickup papers was measured in grams as the rewet amount , which reflects the amount of fluid that successfully reversed flow and overcame the spatial separation of the topsheet material . it has been found that data using this fluid for both acquisition rate and rewet values correlates well to comparative data generated from the same vff materials tested by this method and by undisclosed methods used by major corporations who produce feminine napkin products . table 3 , below , compares existing products and shows that embodiments of this invention provide a desirable sti , and also maintain a l / oa ratio that exhibits functional rewet : it is thus believed that the operation and construction of the present invention will be apparent from the foregoing description . while the apparatus and compositions shown or described have been characterized as being preferred it will be obvious that various changes and modifications may be made therein without departing from the spirit and scope of the invention as defined in the following claims .	8
the chassis of a so - called large dump truck shown in fig1 comprises a rigid vehicle frame 1 , to which are coupled two front wheels 6 controllable respectively about an axle 5 . a pair of parallel rocker arms 2 projecting backwards are coupled on a rear section of vehicle frame 1 , which are supported in a suitable manner and capable of swivelling , relative to vehicle frame 1 , about a horizontal axis extending at right angles to the travel direction , such as is shown in wo 92 / 04196 . the two rocker arms 2 each carry a pair of rear wheels 8 . as fig1 shows , rocker arms 2 extend in each case between a pair of rear wheels 8 , which are mounted to the right and left on respective rocker arm 2 . the four rear wheels 8 form the drive axle of the vehicle . as fig1 shows , an independent wheel drive 3 is assigned to each of rear wheels 8 , so that rear wheels 8 can be driven independently of one another and at different speeds , which is of advantage particularly when tight bends are taken and prevents grinding of the wheels on account of different curved paths . as fig2 shows , the independent wheel drives are integrated into the interior of the rocker arm and the wheel axles and wheel hubs attached thereto . each of rocker arms 2 widen towards the axis of wheels 8 and forms a central motor casing 9 , in which two separate electric motors 4 are accommodated , which are both arranged coaxial with the rotary axis of the two rear wheels 8 fixed to rocker arm 2 . motor casing 9 formed integrally in one piece on rocker arm 2 has two openings facing the wheels . in the area of these openings , two gear casings 10 lying opposite one another are flange - mounted on motor casing 9 , which gear casings are designed essentially pot - shaped and at the same time form the wheel axles for the two rear wheels 8 . wheel hubs 11 , which carry rear wheels 8 and which will be described in greater detail , are fixed in a rotary manner on gear casings 10 . as fig2 shows , electric motors 4 are air - cooled inside motor casing 9 . the cooling air is fed through the interior of rocker arm 2 , which in the interior has a cooling - air channel or is designed as a cooling - air channel . the cooling air preferably circulates through rocker arm 2 and motor casing 9 . suitable inlet and outlet channels are provided for this . fig2 shows inlet channel 12 , through which the cooling air can be fed . in an alternative embodiment of the invention , electric motors 4 can also be liquid - cooled . here too , it is expedient for the cooling agent channels to be passed inside rocker arm 2 . as fig3 shows , cooling agent channels 13 emerge from rocker arm 2 in the immediate vicinity of the coupling point of rocker arm 2 and are conveyed from there to vehicle frame 1 . the cooling agent is also circulated here . one of cooling agent lines 13 acts as a cooling agent feed and leads to the electric motors , whilst the other of the two cooling agent lines 13 acts as a cooling agent discharge . the two electric motors can be connected in series one after the other as regards the cooling agent circulation . fig4 shows the more detailed structure of each independent wheel drive and the brake assigned to each wheel . electric motor 4 , which can preferably be a frequency - regulated asynchronous motor , is arranged with its motor shaft 14 coaxial with rotary axis 15 of each wheel , whereby motor shaft 14 projects to the exterior , i . e . away from rocker arm 2 through corresponding motor casing opening 9 into gear casing 10 . said gear casing 10 is designed essentially rotation - symmetric and tapers towards the exterior , i . e . away from the rocker arm , step - by - step to a smaller diameter . wheel hub 16 sits in a rotary - mounted manner on the outer periphery of gear casing 10 , in particular on its section with reduced diameter . it is supported on motor casing 9 by means of two inclined cylindrical roller bearings 17 . a two - stage planet gear 18 is provided inside motor casing 9 . a planet carrier 20 sits coaxially above motor shaft 14 and carries a plurality of planet wheels 21 , which are mounted in a rotary manner on planet carrier 20 . planet wheels 21 engage on the one hand with toothed motor shaft 14 of electric motor 4 . on the other hand , they engage with a toothed ring 22 , which is arranged rigid with the gear casing and coaxially surrounds planet carrier 20 . planet carrier 20 is driven by motor shaft 14 of electric motor 4 via planet wheels 21 . as fig4 shows , planet carrier 20 has a toothed shoulder 23 projecting axially over motor shaft 4 , said toothed shoulder engaging with a sleeve 24 arranged coaxial with the rotary axis of wheel 8 . as fig4 shows , sleeve 24 has an external tooth system , with which it sits in an internal tooth system of toothed shoulder 23 . sleeve 24 thus rotates with planet carrier 21 . via sleeve 24 , planet carrier 20 drives a further set of planet wheels 25 , which are arranged distributed around rotary axes 15 and are mounted in a rotary manner on gear casing 10 . gear wheels 25 mesh on the one hand with sleeve 24 . on the other hand , they engage with an internal tooth system of wheel hub 16 , so that they drive wheel hub 16 . as fig4 shows , the internal tooth system of wheel hub 16 is provided between two roller bearings 17 on the inner periphery of the wheel hub . the two - stage design of planet gear 19 between electric motor 4 and wheel hub 11 produces a large transmission ratio in the smallest possible space . in the form of embodiment shown , a transmission ratio of approx . 30 to 35 is provided , i . e . the speed of electric motor 4 is 30 to 35 times as great as the initial speed of wheel hub 16 . brake 26 is designed as a disc brake in the embodiment according to fig4 . brake 26 sits on the outside , i . e . on the side of planet gear 18 facing away from rocker arm 2 . it is arranged inside the inner periphery of wheel hub 16 . as fig4 shows , it is enclosed by a wheel hub cap 27 , which is connected on the end face with wheel hub 16 . disc brake 28 forms the rotating part of the brake . brake disc 28 , however , is not fixed directly to wheel hub 16 , but rotates with the speed of planet carrier 20 . as fig4 shows , brake disc 28 sits torsion - resistant on a sleeve - shaped brake disc carrier 29 , which is mounted in a rotary manner on gear casing 10 by means of two inclined roller bearings 30 and engages with sleeve 24 . brake disc carrier 29 , which is arranged coaxial with rotary axis 15 of the wheels , has an internal tooth system which sits on the external tooth system of sleeve 24 . the stationary part of brake 26 is formed by brake shoes 31 , which are screwed to the end face of motor casing 10 . several brake shoes are preferably provided , in particular service brake shoes and parking brake shoes , which act on common brake disc 28 . gear casing 10 , which is shown in fig4 , sits with its inner flange 32 on motor casing 9 , which is fixed rigidly to rocker arm 2 or is formed by the latter , as shown in fig2 . the operation of brake 26 preferably takes place hydraulically . as fig4 shows , there are incorporated in gear casing 10 hydraulic channels 33 , which connect a hydraulic line 34 inside motor casing 9 with the interior of wheel hub 16 , in particular wheel hub cap 27 , so that the brake shoes can be accordingly closed . the fixing of the wheels on wheel hub 11 takes place in a manner known per se by means of a wheel hub flange 34 and suitable screw - bolt connections . fig5 shows an alternative embodiment of brake 26 . as for the rest , the design of the independent wheel drive corresponds to that of fig4 , so that in this respect reference may be made to the description thereof . brake 26 according to fig5 is designed as a multiple disc brake . on the one hand , a rotating multiple disc carrier 35 is provided . the latter , like the previously described brake disc carrier 29 , is not coupled directly with the wheel hub , but with the planet carrier . in particular , multiple disc carrier 35 engages with sleeve 24 . multiple disc carrier 35 possesses for this purpose a sleeve section 36 , which is mounted in a rotary manner on gear casing 10 by means of roller bearings 30 and sits with an internal tooth system on the external tooth system of sleeve 24 . radially outside multiple disc carrier 35 , the latter carries a set of rotating multiple brake discs 36 . between rotating multiple brake discs 36 are arranged stationery multiple brake discs 37 , which are held in a torsion - resistant manner by a multiple disc carrier 38 . as fig5 shows , multiple disc carrier 38 that is not rotating is screwed down to gear casing 10 on its end face . circular multiple brake discs 36 and 37 arranged axially one behind the other can be pressed next to one another by hydraulic pressure in a manner known per se . the hydraulic supply also takes place here through a hydraulic channel 33 extending through gear casing 10 . in order to be able to uncouple the wheel hub , reduction stage 19 can have a disengageable , in particular axially displaceable , gear element . in particular , provision can be made such that sleeve 24 with the external tooth system is mounted in an axially displaceable manner . for example , provision can be made such that sleeve 24 can be displaced a little far to the right according to fig4 and 5 , so that it becomes disengaged from toothed shoulder 23 of planet carrier 20 . in this way , the wheel hub can rotate with respect to planet carrier 20 and thus with respect to electric motor 4 . on the other hand , the brake still remains engaged with the wheel hub .	1
the bismaleimide compound represented by the general formula ( i ) used in this invention include , for example , the sulfenamide compounds represented by the general formula ( ii ) used in this invention include , for example , the dithiophosphoric acid compounds represented by the general formula ( iii ) used in this invention include , for example , examples of sulfur include various types of sulfur such as powdered sulfur , precipitated sulfur , and insoluble sulfur . examples of aromatic carboxylic acid anhydrides , another important constituent in this invention , include phthalic anhydride , pyromellitic anhydride , benzenehexacarboxylic trianhydride , 4 - methylphthalic anhydride , trimellitic anhydride , and 4 - chlorophthalic anhydride . phthalic anhydride and the like mentioned above have for long been known to the rubber industry as scorch retarders . however , other known scorch retarders than these , namely organic acids such as salicylic acid and benzoic acid , maleic anhydride , n - nitrosodiphenylamine , n - cyclohexylphthalimide and the like do not show such effect as is obtained in this invention even when combined with above - mentioned bismaleimide compounds ( i ). the latter compounds can give a remarkable effect only when used in combination with the above - mentioned aromatic acid anhydride . the examples of sulfur donors include tetramethylthiuram disulfide , tetraethylthiuram disulfide , tetrabutylthiuram disulfide , and pentamethylthiuram hexasulfide . the examples of vulcanization accelerators include dibenzothiazyl disulfide , tetramethylthiuram disulfide , n - cyclohexyl - 2 - benzothiazylsulfenamide , n - oxydiethylene - 2 - benzothiazylsulfenamide , n - t - butyl - 2 - benzothiazylsulfenamide , and n , n - dicyclohexyl - 2 - benzothiazylsulfenamide . examples of rubbers usable in this invention include natural rubber ( nr ), styrene - butadiene rubber ( sbr ), butadiene rubber ( br ), isoprene rubber ( ir ), acrylonitrile - butadiene rubber ( nbr ), chloroprene rubber ( cr ), ethylene - propylene - diene terpolymer ( epdm ), and isoprene - isobutylene rubber ( iir ), used each alone or in combination of two or more thereof . the amount of the bismaleimide compound ( i ), the sulfenamide compound ( ii ), the dithiophosphoric acid compound ( iii ), and sulfur to be compounded with rubber is , based on 100 parts by weight of rubber , usually 0 . 1 to 8 parts by weight , preferably 0 . 3 to 4 parts by weight , for bismaleimide compounds ( i ); usually 0 . 1 to 8 parts by weight , preferably 0 . 3 to 6 parts by weight , for sulfenamide compounds ; usually 0 . 1 to 8 parts by weight , preferably 0 . 3 to 6 parts by weight , for dithiophosphoric acid compounds ; and usually 0 . 1 to 14 parts by weight , preferably 0 . 5 to 8 parts by weight for sulfur . further , the amount of the bismaleimide compound ( i ), the aromatic carboxylic acid anhydride , the sulfur and / or the sulfur donor and the vulcanization accelerator to be compounded with rubber is , based on 100 parts by weight of rubber , usually 0 . 1 to 8 parts by weight , preferably 0 . 3 to 4 parts by weight for mismaleimide compounds ( i ); usually 0 . 1 to 4 parts by weight , preferably 0 . 3 to 3 parts by weight for aromatic carboxylic acid anhydrides ; usually 0 . 1 to 14 parts by weight , preferably 0 . 5 to 8 parts by weight , for sulfur and / or sulfur donors , and usually 0 . 1 to 8 parts by weight , preferably 0 . 3 to 6 parts by weight for vulcanization accelerators . these ingredients may be used as a mixture prepared beforehand or added separately together with , as required , other compounding ingredients at the time of compounding . other compounding ingredients include reinforcing agents , for example carbon black , such as haf , isaf and srf , silica , and calcium carbonate ; stearic acid , zinc white , process oil , tackifiers , waxes , antioxidants , etc . the rubber composition of this invention thus obtained shows excellent scorch stability and resistance to reversion in processing and vulcanization and further , as to rubber properties after vulcanization , shows very excellent resistance to heat aging and to flex cracking . this invention will be explained in detail below with reference to examples , but it is not limited thereto . in a conventional manner , 100 parts of natural rubber , 45 parts of haf carbon , 5 parts of zinc white , 1 part of stearic acid , 1 part of process oil , 3 parts of wax , 2 parts of n - phenyl - n &# 39 ;- 1 , 3 - dimethylbutyl - p - phenylenediamine ( an antiozonant ) and the compounding ingredients listed in table 1 were compounded by using an open roll of 6 inches diameter to prepare various rubber compositions . with each of the rubber compositions thus obtained , scorching property was determined according to jis - k - 6300 , and the maximum cross - linking density ( m h ) and the vulcanization - reverse property ( the time required for torque to decrease by 1 kg . cm from its maximum value ; rt ) were determined according to astm - d - 0284 by using an oscillating disc rheometer at 170 ° c . further , each of the various rubber compositions was vulcanized at 170 ° c . for 20 minutes to prepare prescribed specimens and then subjected to a thermal aging test and a flex cracking test according to jis - k - 6301 . the thermal aging test was conducted by subjecting the specimen to thermal aging at 100 ° c . for 48 hours in a geer oven and then measuring the percentage of retention of tensile strength . the flex cracking test was conducted by subjecting a specimen , on which a crack of 2 mm original length had been made , to 10 , 000 times of flexing and then measuring the length of the crack . the results obtained by these tests are shown in table 1 . in the same manner as in example 1 , 100 parts of styrene - butadiene rubber , 50 parts of haf carbon , 5 parts of process oil , 5 parts of zinc white , 3 parts of stearic acid , 3 parts of wax , 2 parts of 2 , 2 , 4 - trimethyl - 1 , 2 - dihydroquinoline polymer ( an antioxidant ) and the ingredients listed in table 2 were compounded to prepare various rubber compositions and their properties were determined . the results are shown in table 2 . the thermal aging test in this example was conducted at 110 ° c . for 48 hours . in a conventional manner , 100 parts of natural rubber , 5 parts of haf carbon , 5 parts of zinc white , 1 part of stearic acid , 1 part of process oil , 3 parts of wax , 2 parts of n - phenyl - n &# 39 ;- 1 , 3 - dimethylbutyl - p - phenylenediamine ( an antiozonant ) and the ingredients listed in table 3 were compounded by using an open roll of 6 inches diameter to prepare various rubber compositions . with each of the rubber compositions thus obtained , the maximum cross - linking density ( m h ) and the vulcanization - reverse property ( the time required for torque to decrease by 1 kg . cm from its maximum value ; rt ) were determined according to astm - d - 2084 by using an oscillating disc rheometer at 170 ° c . further , each of the various rubber compositions was vulcanized at 170 ° c . for 20 minutes to prepare prescribed specimens and then subjected to a thermal aging test and a flex cracking test according to jis - k - 6301 . the thermal aging test was conducted by subjecting a specimen to thermal aging at 100 ° c . for 48 hours in a gear oven and then measuring the percentage of retention of tensile strength . the flex cracking test was conducted by subjecting a specimen , on which a cut of 2 mm original length had been made , to 10 , 000 times of flexing and then measuring the length of the cut . in the same manner as in example 3 , 100 parts of styrene - butadiene rubber , 50 parts of haf carbon , 5 parts of process oil , 5 parts of zinc white , 3 parts of stearic acid , 3 parts of wax , 2 parts of 2 , 2 , 4 - trimethyl - 1 , 2 - dihydroquinoline polymer ( an antioxidant ), and the ingredients listed in table 4 were compounded to prepare various rubber compositions and their properties were determined . the results obtained are shown in table 4 . the thermal aging test in this example was conducted at 110 ° c . for 48 hours . in the same manner as in example 3 , 100 parts of acrylonitrile - butadiene rubber , 3 parts of stearic acid , 5 parts of zinc white , 10 parts of process oil , 40 parts of light calcium carbonate , 10 parts of titanium oxide , 30 parts of hydrated silica , 2 parts of 2 , 2 &# 39 ;- methylenebis ( 4 - methyl - 6 - t - butylphenol ) ( an antioxidant ) and the ingredients listed in table 5 were compounded to prepare various rubber compositions and their properties were determined . the results obtained are shown in table 5 . the thermal aging test in this example was conducted at 130 ° c . for 48 hours . table 1__________________________________________________________________________ comparative example exampleitem run no . 1 2 3 4 5 6 7 8 9__________________________________________________________________________compounding ingredientssulfur 1 1 1 1 1 1 1 2 1soxinol ® nbs . sup . 1 1 1 1 1 2 . 5 2 . 5soxinol ® ns . sup . 2 1 2 . 5soxinol ® dz . sup . 3 1diethyldithiophosphoric acid disulfide 1 . 5di - iso - propyldithiophosphoric acid disulfide 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5n , n &# 39 ;-- ethylenebismaleimide 1 . 5n , n &# 39 ;-- m - phenylenebismaleimide 1 . 5 2 . 5 1 . 5n , n &# 39 ;--( methylene - di - p - phenylene ) bismaleimide 1 . 5soxinol ® dm . sup . 4propertiesscorching property ( minute ) 56 . 0 56 . 5 57 . 0 58 . 5 51 . 5 38 . 5 45 . 0 38 . 0 42 . 0mh ( kg · cm ) 98 97 97 106 97 96 72 90 70rt ( minute ) & gt ; 15 & gt ; 15 & gt ; 15 & gt ; 15 & gt ; 15 & gt ; 15 1 . 8 1 . 0 1 . 8thermal resistance (%) 75 76 77 78 77 76 50 39 49resistance to flex cracking ( mm ) 9 . 2 9 . 1 9 . 1 9 . 1 9 . 1 9 . 1 9 . 0 13 . 0 9 . 1__________________________________________________________________________ comparative exampleitem run no . 10 11 12 13 14 15 16 17 18 19__________________________________________________________________________compounding ingredientssulfur 1 1 1 1 1 1 1 1 1 1soxinol ® nbs . sup . 1 2 . 5soxinol ® ns . sup . 2 2 . 5soxinol ® dz . sup . 3 2 . 5 2 . 5diethyldithiophosphoric acid disulfide 2 . 5 2 . 5di - iso - propyldithiophosphoric acid disulfide 2 . 5 2 . 5n , n &# 39 ;-- ethylenebismaleimide 1 . 5 1 . 5 1 . 5n , n &# 39 ;--- m - phenylenebismalimide 1 . 5 1 . 5n , n &# 39 ;--( methylene - di - p - phenylene ) bismaleimide 1 . 5soxinol ® dm . sup . 4 2 . 5 2 . 5propertiesscorching property ( minute ) 46 . 0 54 . 0 54 . 0 46 . 0 44 . 0 50 . 5 56 . 0 56 . 5 18 . 5 19 . 0mh ( kg · cm ) 68 53 55 74 78 70 82 88 54 84rt ( minute ) 1 . 4 2 . 2 2 . 2 3 . 1 3 . 2 3 . 1 3 . 2 3 . 3 1 . 5 4 . 0thermal resistance (%) 53 55 56 52 53 52 55 57 39 55resistance to flex cracking ( mm ) 9 . 5 9 . 1 9 . 3 9 . 0 9 . 1 9 . 1 9 . 2 9 . 3 8 . 6 11 . 5__________________________________________________________________________ note :? . sup . 1 soxinol ® nbs : n -- oxydiethylene2 - benzothiazylsulfenamide ( mfd by sumitom chemical co ., ltd .) . sup . 2 soxinol ® ns : n -- tbutyl - 2 - benzothiazylsulfenamide ( mfd . by sumitom chemical co ., ltd .) . sup . 3 soxinol ® dz : n , n -- dicyclohexyl2 - benxothiazylsulfenamide ( mfd . by sumitom chemical co ., ltd .) . sup . 4 soxinol ® dm : dibenzothiazyl disulfide ( mfd . by sumitom chemical co ., ltd .) table 2__________________________________________________________________________ comparative example exampleitem run no . 1 2 3 4 5 6 7 8__________________________________________________________________________compounding ingredientssulfur 2 2 2 2 2 2 3 2soxinol ® cz . sup . 1 1 1 1 2 2 2soxinol ® nbs . sup . 2 1 1soxinol ® dm . sup . 3di - iso - propyldithiophosphoric acid disulfide 1 1 1dibutyldithiophosphoric acid disulfide 1 1n , n &# 39 ;-- p - phenylenebismaleimide 1 . 5 1 . 5 1 . 5n , n &# 39 ;-- m - phenylenebismaleimide 1 . 5 1 . 5n , n &# 39 ;--( oxy - p - phenylene ) bismaleimide 1 . 5propertiesmh ( kg · cm ) 126 127 127 130 128 103 128 104thermal resistance (%) 78 78 79 78 79 61 53 63resistance to flex cracking ( mm ) 13 . 1 13 . 2 13 . 0 13 . 1 13 . 0 12 . 3 19 . 5 12 . 7__________________________________________________________________________ comparative exampleitem run no . 9 10 11 12 13 14 15 16 17__________________________________________________________________________compounding ingredientssulfur 2 2 2 2 2 2 2 2 2soxinol ® cz . sup . 1 2 2soxinol ® nbs . sup . 2 2 2soxinol ® dm . sup . 3 2 2di - iso - propyldithiophosphoric acid disulfide 2 2dibutyldithiophosphoric acid disulfide 2n , n &# 39 ;-- p - phenylenebismaleimide 1 . 5 1 . 5 1 . 5n , n &# 39 ;-- m - phenylenebismaleimide 1 . 5 1 . 5 1 . 5n , n &# 39 ;--( oxy - p - phenylene ) bismaleimide 1 . 5 1 . 5propertiesmh ( kg · cm ) 105 104 100 101 85 86 86 98 119thermal resistance (%) 62 64 62 63 67 67 66 61 51resistance to flex cracking ( mm ) 12 . 8 12 . 7 12 . 2 12 . 3 11 . 4 11 . 5 11 . 3 12 . 0 18 . 6__________________________________________________________________________ note : . sup . 1 soxinol ® cz : n -- cyclohexyl2 - benzothiazylsulfenamide ( mfd . by sumitomo chemical co ., ltd .) . sup . 2 soxinol ® nbs : n -- oxydiethylene2 - benzothiazylsulfenamide ( mfd by sumitomo chemical co ., ltd .) . sup . 3 soxinol ® dm : dibenzothiazyl disulfide ( mfd . by sumitomo chemical co ., ltd .) table 3__________________________________________________________________________ exampleitem run no . 1 2 3 4 5 6 7 8__________________________________________________________________________compounding ingredientssulfur 1 . 0 1 . 0 1 . 0 1 . 0 1 . 0 1 . 0 0 . 5 0 . 5soxinol ® dm . sup . 1 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5soxinol ® nbs . sup . 2 2 . 5 2 . 5n , n &# 39 ;-- hexamethylenebismaleimide 1 . 5n , n &# 39 ;-- p - phenylenebismaleimide 1 . 5n , n &# 39 ;-- m - phenylenebismaleimide 0 . 5 1 . 5 2 . 5 1 . 5 1 . 5 1 . 5n , n &# 39 ;--( methylene - di - p - phenylene ) bismaleimiden , n &# 39 ;--( oxy - di - p - phenylene ) bismaleimidephthalic anhydride 1 1 1 1 1 1 2trimellitic anhydride 1maleic anhydridephthalic acidn -- nitrosodiphenylaminepropertiesmh ( kg · cm ) 113 115 92 116 128 112 98 107rt ( minute ) & gt ; 15 & gt ; 15 & gt ; 15 & gt ; 15 & gt ; 15 & gt ; 15 & gt ; 15 & gt ; 15thermal resistance (%) 63 62 59 64 69 62 71 71resistance to flex cracking ( mm ) 9 . 3 9 . 3 9 . 1 9 . 3 9 . 3 9 . 2 9 . 2 9 . 2__________________________________________________________________________ example comparative exampleitem run no . 9 10 11 12 13 14 15 16 17 18 19 20__________________________________________________________________________compounding ingredientssulfur 0 . 5 0 . 5 1 . 0 2 . 0 1 . 0 1 . 0 1 . 0 1 . 0 1 . 0 1 . 0 1 . 0 0 . 5soxinol ® dm . sup . 1 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5soxinol ® nbs . sup . 2 2 . 5 2 . 5 2 . 5n , n &# 39 ;-- hexamethylenebismaleimide 1 . 5 1 . 5n , n &# 39 ;-- p - phenylenebismaleimide 1 . 5n , n &# 39 ;-- m - phenylenebismaleimide 1 . 5 1 . 5n , n &# 39 ;--( methylene - di - p - phenylene ) bismaleimide 1 . 5n , n &# 39 ;--( oxy - di - p - phenylene ) bismaleimide 1 . 5phthalic anhydride 1 1trimellitic anhydride 1 1maleic anhydride 1phthalic acidn -- nitrosodiphenylamine 1propertiesmh ( kg · cm ) 96 96 68 87 66 63 80 81 78 79 80 58rt ( minute ) & gt ; 15 & gt ; 15 1 . 5 0 . 7 1 . 5 1 . 5 3 . 4 3 . 4 3 . 4 3 . 4 3 . 4 1 . 8thermal resistance (%) 70 70 40 32 40 39 54 53 53 52 53 48resistance to flex cracking ( mm ) 9 . 2 9 . 2 7 . 5 11 . 5 7 . 6 7 . 5 9 . 1 9 . 2 9 . 2 9 . 2 9 . 1 8 . 8__________________________________________________________________________ comparative exampleitem run no . 21 22 23 24 25 26 27 28 29 30__________________________________________________________________________compounding ingredientssulfur 0 . 5 0 . 5 0 . 5 0 . 5 0 . 5 0 . 5 0 . 5 0 . 5soxinol ® dm . sup . 1soxinol ® nbs . sup . 2 2 . 5 2 . 5 2 . 5 2 . 5 2 . 5 2 . 5 2 . 5 2 . 5n , n &# 39 ;-- hexamethylenebismaleimiden , n &# 39 ;-- p - phenylenebismaleimiden , n &# 39 ;-- m - phenylenebismaleimide 1 . 5 1 . 5n , n &# 39 ;--( methylene - di - p - bismaleimide 1 . 5 1 . 5n , n &# 39 ;--( oxy - di - p - phenylene ) bismaleimide 1 . 5 1 . 5phthalic anhydride 1trimellitic anhydride 1maleic anhydride 1phthalic acid 1 1n -- nitrosodiphenylamine 1 1propertiesmh ( kg · cm ) 72 58 57 56 61 62 61 62 61 61rt ( minute ) 0 . 3 1 . 8 1 . 8 1 . 7 2 . 0 2 . 0 2 . 0 2 . 0 2 . 0 2 . 0thermal resistance (%) 39 48 47 47 49 50 49 50 49 49resistance to flex cracking ( mm ) 12 . 0 8 . 9 8 . 8 8 . 8 9 . 0 9 . 0 9 . 0 9 . 1 9 . 1 9 . 1__________________________________________________________________________ note : . sup . 1 soxinol ® dm : dibenzothiazyl disulfide ( mfd . by sumitomo chemical co ., ltd .) . sup . 2 soxinol ® nbs : n -- oxydiethylene2 - benzothiazylsulfenamide ( mfd by sumitomo chemical co ., ltd .) table 4__________________________________________________________________________ comparative example exampleitem run no . 1 2 3 4 5 6 7 8 9__________________________________________________________________________compounding ingredientssulfur 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5 2 . 5soxinol ® cz . sup . 1 2 2 2 2 2 2soxinol ® dm . sup . 2 2 2 2n , n -- ethylenebismaleimide 1 . 5n , n &# 39 ;-- p - phenylenebismaleimide 1 . 5n , n &# 39 ;-- m - phenylenebismaleimide 1 . 5 1 . 5 1 . 5n , n &# 39 ;--( methylene - di - p - phenylene ) bismaleimide 1 . 5n , n &# 39 ;--( oxydi - p - phenylene )- bismaleimide 1 . 5phthalic anhydride 1 1 1 1 1pyromellitic anhydride 1 1phthalic acidn -- cyclohexylthiophthalimidebenzoic acidpropertiesmh ( kg · cm ) 131 132 132 130 121 119 119 98 121thermal resistance (%) 78 78 79 74 73 73 73 68 54resistance to flex cracking ( mm ) 14 . 2 14 . 3 14 . 5 14 . 3 14 . 0 14 . 1 14 . 0 11 . 4 18 . 0__________________________________________________________________________ comparative exampleitem run no . 10 11 12 13 14 15 16 17 18__________________________________________________________________________compounding ingredientssulfur 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5soxinol ® cz . sup . 1 2 2 2 2 2 2 2 2soxinol ® dm . sup . 2 2 2n , n -- ethylenebismaleimiden , n &# 39 ;-- p - phenylenebismaleimide 1 . 5 1 . 5n , n &# 39 ;-- m - phenylenebismaleimide 1 . 5 1 . 5n , n &# 39 ;--( methylene - di - p - phenylene ) bismaleimide 1 . 5 1 . 5n , n &# 39 ;--( oxydi - p - phenylene )- bismaleimidephthalic anhydride 1pyromellitic anhydride 1phthalic acid 1n -- cyclohexylthiophthalimide 1benzoic acid 1propertiesmh ( kg · cm ) 98 98 102 101 102 102 101 102 84thermal resistance (%) 72 73 69 69 69 69 70 70 61resistance to flex cracking ( mm ) 11 . 5 11 . 4 11 . 6 11 . 7 11 . 7 11 . 6 11 . 7 11 . 7 11 . 2__________________________________________________________________________ comparative exampleitem run no . 19 20 21 22 23 24 25 26 27__________________________________________________________________________compounding ingredientssulfur 2 . 5 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5soxinol ® cz . sup . 1soxinol ® dm . sup . 2 2 2 2 2 2 2 2 2 2n , n -- ethylenebismaleimiden , n &# 39 ;-- p - phenylenebismaleimiden , n &# 39 ;-- m - phenylenebismaleimide 1 . 5 1 . 5n , n &# 39 ;--( methylene - di - p - phenylene ) bismaleimide 1 . 5 1 . 5n , n &# 39 ;--( oxydi - p - phenylene )- bismaleimide 1 . 5 1 . 5phthalic anhydride 1pyromellitic anhydride 1phthalic acid 1n -- cyclohexylthiophthalimide 1benzoic acid 1propertiesmh ( kg · cm ) 109 84 83 103 108 107 109 108 108thermal resistance (%) 54 60 59 66 67 67 68 67 68resistance to flex cracking ( mm ) 16 . 9 11 . 2 11 . 3 13 . 8 13 . 9 14 . 0 13 . 8 13 . 8 13 . 9__________________________________________________________________________ note : . sup . 1 soxinol ® cz : n -- cyclohexyl2 - benzothiazylsulfenamide ( mfd . by sumitomo chemical co ., ltd .) . sup . 2 soxinol ® dm : dibenzothiazyl disulfide ( mfd . by sumitomo chemical co ., ltd .) table 5__________________________________________________________________________ example comparative exampleitem run no . 1 2 3 4 5 6 7 8 9__________________________________________________________________________compounding ingredientssulfur 1 . 5 1 . 5 1 . 5 1 . 5 3 1 . 5soxinol ® dm . sup . 1 1 1 1 1 1 1 1 1 1soxinol ® tt . sup . 2 1 1 1 2 2 2 1 1 1n , n &# 39 ;-- hexamethylenebismaleimide 1 . 5 1 . 5n , n &# 39 ;-- m - phenylenebismaleimide 1 . 5 1 . 5n , n &# 39 ;--( methylenedi - p - phenylene ) bismaleimide 1 . 5 1 . 5phthalic anhydride 1 1 1 1 1 1 1n -- cyclohexylthiophthalimidesalicylic acidpropertiesmh ( kg · cm ) 104 105 103 82 84 88 80 104 80rt ( minute ) & gt ; 10 & gt ; 10 & gt ; 10 & gt ; 10 & gt ; 10 & gt ; 10 2 . 0 1 . 1 2 . 0thermal resistance (%) 84 84 83 89 89 88 75 64 75resistance to flex cracking ( mm ) 5 . 1 5 . 1 5 . 1 4 . 4 4 . 3 4 . 2 4 . 9 8 . 2 5 . 3__________________________________________________________________________ comparative exampleitem run no . 10 11 12 13 14 15 16 17 18 19 20__________________________________________________________________________compounding ingredientssulfur 1 . 5 1 . 5 1 . 5 1 . 5 1 . 5soxinol ® dm . sup . 1 1 1 1 1 1 1 1 1 1 1 1soxinol ® tt . sup . 2 1 1 1 1 1 2 4 2 2 2 2n , n &# 39 ;-- hexamethylenebismaleimide 1 . 5 1 . 5 1 . 5n , n &# 39 ;-- m - phenylenebismaleimide 1 . 5 1 . 5 1 . 5n , n &# 39 ;--( methylenedi - p - phenylene ) bismaleimide 1 . 5 1 . 5phthalic anhydride 1n -- cyclohexylthiophthalimide 1salicylic acid 1propertiesmh ( kg · cm ) 91 92 91 93 91 52 64 51 68 69 68rt ( minute ) 7 . 0 7 . 0 7 . 2 7 . 1 7 . 2 4 . 0 3 . 1 4 . 0 8 . 7 8 . 3 8 . 7thermal resistance (%) 80 81 81 80 81 80 72 79 84 88 84resistance to flex cracking ( mm ) 5 . 4 5 . 4 5 . 3 5 . 4 5 . 4 4 . 3 5 . 0 4 . 3 5 . 5 5 . 6 5 . 7__________________________________________________________________________ note : . sup . 1 soxinol ® dm : dibenzothiazyl disulfide ( mfd . by sumitomo chemical co ., lt . sup . 2 soxinol ® tt : tetramethylthiuram disulfide ( mf . by sumitomo chemical co ., lt	2
fig1 is a schematic diagram of a number of components in accordance with an embodiment of the invention . a mobile computing device 104 is shown in communication via radio frequency to a cell tower 108 , which is , in turn , connected to the internet 112 via some wireless network infrastructure ( not shown ). a server 116 is also connected to the internet 112 , and is additionally coupled to a word database 120 and a user database 124 . the word database 120 stores a plurality of words that correspond to a number of categories and / or locations , and a number of other metrics corresponding to each word . a word as used herein refers to a word , an acronym , an abbreviation , a phrase , etc . employed by users to communicate . for example , the words “ football ”, “ nfl ”, “ superbowl ”, “ touchdown ”, “ referee ” and “ ref ” could be associated with a “ sports ” category . additionally , some words in the word database 120 are related to locations , such as cities . for example , the words “ washington ”, “ d . c .”, “ president ”, “ white house ” and “ smithsonian ” and “ pennsylvania avenue ” could be associated with the city of washington , d . c . words can be added to or deleted from the word database 120 . for example , where a user has selected the “ sports ” category , the rise of a new star nfl football player could cause his name to be added to the category . in an embodiment , the player &# 39 ; s name is added , along with the date . the user database 124 stores user preferences for each user including the currently selected categories , the date the categories were last updated , the date that the computing device was last updated , the last detected location of the computing device , and the date since which the computing device has been at that location . the server 116 executes a user manager that is operable to retrieve user preferences from the user database 124 , a query module to retrieve words corresponding to the user preferences from the word database 120 , and a communications module to communicate the retrieved words to the computing device 104 . fig2 shows an exploded view of a mobile computing device 104 having a text input interface 24 , a display 32 , a processor 48 , memory 52 and at least one communications interface 56 . the text input interface 24 comprises a set of keys via which a user can input text . the display 32 allows the user to view the inputted text and any options provided to the user . the memory 52 comprises non - volatile memory in which an operating system , applications and persistent data are stored , and volatile memory to provide adequate temporary memory registers for the applications and operating system to use during execution . the processor 48 executes the operating system and applications . the communications interface 56 of the mobile computing device 104 is comprised of a wireless radio and antenna and is operable to communicate with the cell tower 128 . the mobile computing device 104 executes any of a number of applications , such as a wireless application protocol ( wap ) browser , an email application , a short message service ( sms ) application , a notes application , etc . in addition , the mobile computing device 104 executes a predictive text application for receiving keystrokes from a user , determining what character strings the keystrokes can represent , and comparing the character strings to words in a predictive text dictionary maintained in non - volatile memory . the predictive text dictionary is a list of words maintained by the computing device 104 . the predictive text dictionary maintains the categories and locations ( if any ) to which each word is associated . metrics can also be stored in the predictive text dictionary by the predictive text application . the metrics can correspond to the number of times each word is actively selected by the user of the computing device . additionally or alternatively , the metrics can correspond to the number of times each word is used by the user , or is even present in a document , email , etc . received by the user . a number of non - user - specific metrics can also be stored in the predictive text dictionary , including general likelihoods used to determine priority between two words not previously used by a user . further , a number of words in the predictive text dictionary that are intended to be permanently located in the dictionary can be marked as such using the metrics . fig3 shows an exemplary user interface 80 for allowing a user to select which categories are relevant to the user . the user interface 80 can be provided via a web page , a client application or the like . in order to change preferences , the user launches the user interface 80 and selects or deselects the categories he deems as relevant . the “ sports ”, “ finance ” and “ location - specific ” categories are shown as being selected . the general updating of the predictive text dictionary on the computing device 104 is shown in fig4 . in an embodiment , this process occurs once per day and every time the device or its communication interface 56 is turned on . if the communication interface 56 of computing device 104 was turned off and is then turned on , such as is done when a user of the computing device boards and disembarks from an airplane , the device 104 registers itself with the cell tower 108 . at step 210 , upon registration with the cell tower 108 , the computing device 104 makes a request to the server 116 for any words to be received . the request is sent to the cell tower 108 , which , in turn , forwards the request to the server 116 over the internet 112 . the request received by the server 116 includes information regarding the identity of the computing device 104 and the location of the cell tower 108 . at step 220 , the server 116 determines if there are words to be transferred to the computing device 104 . the user manager executing on the server 116 retrieves the user preferences from the user database 124 and determines what queries will need to be run on the word database 120 . fig5 shows the method of determining if there are words to be transferred to the computing device 104 . at step 221 , it is determined whether there are any new words in the word database 120 corresponding to the existing categories a user has selected . for example , where a user has selected the “ sports ” category , and the addition of a new nfl football player &# 39 ; s name to the word database occurred after the computing device &# 39 ; s last update , the player &# 39 ; s name could be flagged for transfer to the device at step 222 . at step 223 , it is determined whether the user has selected new categories . at step 224 , the words corresponding to the new categories are added to the list of words to be transferred to the computing device 104 . then , at step 225 , it is determined whether the computing device is in a new location and whether the user preferences indicate that the user selected to receive location - specific words . if the answer to both questions is yes , the words associated with the new location in the word database 120 are added to the list of words to be transferred to the computing device 104 at step 226 . while the flow chart of fig5 shows three distinct groups of words being determined , those of skill in the art will appreciate that there may be overlap between the three groups and that the determination of the words to be transferred can typically be performed with a single query . the single query is formulated by the query module of the server 116 and made of the word database 120 . the word database 120 , in turn , returns a set of words that correspond to at least one of the three steps 231 , 233 and 235 above . returning to fig4 , the method proceeds to step 230 , where the list of words is transferred to the computing device 104 by the server 116 . in the implementation being described , the words are transferred via a proprietary protocol . upon receipt of the words , the device updates the predictive text dictionary by appending the words to the dictionary . the method of updating the computing device is then complete . it can be desirable to remove words from the predictive text dictionary of the computing device 104 for a number of reasons . where the computing device may have limited memory , words can be removed from the predictive text dictionary by examining the metrics associated with each word and discarding those words with the lowest values determined by a function of those metrics . the predictive text dictionary may also be pared - down by the user or system operator in recognition that over - population of the dictionary with words that are not likely to be used can lead to poor suggestions being provided to the user upon entering a number of keystrokes . in the current implementation , this is performed in two ways . when a user selects to remove a category from his user preferences via the user interface 80 , the server 116 can transmit this information to the computing device 104 . in response , the computing device can purge some or all of the words associated only with the removed category . where a word in the predictive text dictionary associated with the category to be removed has been used by the user according to the metrics maintained by the dictionary , the word can be left in the dictionary . further , when a user has selected to receive location - specific words , and has brought the computing device 104 to a new location , the server can direct the computing device to purge all of the words associated with a prior location from the predictive text dictionary . where a word in the predictive text dictionary associated with the previous location to be removed has been used by the user according to the metrics maintained by the dictionary , the word can be left in the dictionary . while the invention has been described with specificity to mobile devices , other types of computing devices with which the invention can be used will occur to those of skill in the art . for example , a personal computer can benefit from the invention , as the predictive text dictionary of an application executing thereon could be populated with words relevant to the interests , profession , etc . of the user of the personal computer to provide for enhanced word completion capabilities . further , where the computing device is a wireless device that occasionally connects to a networked computer via a cable or other local networking means such as wifi or bluetooth , the invention can benefit from reduced rates for data communications via landline by connecting to the server at least partially exclusively through the networked computer . while the illustrated embodiment discusses the use of user options , these user options may be implicit or provided in some other manner . for example , upon subscribing to a wireless access service , a user may be asked if he would like to receive location - specific information . the computing device he receives can be preconfigured to always receive location - specific words upon detection that he is in a different location . the user can be provided the option of updating the predictive text dictionary for a location to which the computing device has yet to go . this can be advantageous where a user is preparing for a business trip . words in the word database can be selected to correspond to a specific category and location at the same time . as a result , the predictive text dictionary of a computing device may only be updated with the appropriate words when a user of the device selected the appropriate category and is in the specific location . the server can be a cluster of servers in a single location or can be two or more servers situated in a number of locations . where a computing device is memory - restricted , the server can selectively forward words to the computing device . also , the computing device can delete a group of words from the predictive text dictionary to allow for newer words . also , the words can be forwarded to the computing device via other means of communication apart from a proprietary protocol , such as email , mms , wap push and the like . while the location of the computing device is determined by determining which cell tower the computing device is connected through , other methods of locating the computing device known to those skilled in the art can be used . for example , the computing device can , in some circumstances , be located by determining the node on the internet closest to the cell tower , generally associated with a wireless gateway for the cellular service provider . cellular triangulation can also be used . further , if the computing device is equipped with a gps receiver , the device can communicate the gps - received location along with the request for new words . the words provided to the computing device for population of its predictive text dictionary can be set to expire after a period of time and / or period of non - use . this could be advantageous with current event items . in such a case , the server can selectively retransmit a word previously transmitted to a computing device if it is believed the word will be used again . additionally , location - specific words could be set to expire upon relocation of the computing device . the user database can alternatively reside either on the computing device and be transmitted to the server when requesting updates or can reside on a computer associated with the computing device . additionally , the words can be provided to the computing device by other means . for example , the words can be placed on a subscriber identity module (“ sim ”) card which are incorporated in the predictive text dictionary upon insertion of the sim card and initialization of the computing device or predictive text application thereon . other methods will occur to those skilled in the art . the above - described embodiments of the invention are intended to be examples of the invention and alterations and modifications may be effected thereto , by those of skill in the art , without departing from the scope of the invention which is defined solely by the claims appended hereto .	6
the invention described herein is directed to an scr system that does not require urea as the reductant . the system uses diesel fuel instead of urea , which eliminates the requirement for a second supply tank and the need for a urea supply infrastructure . fig1 and 2 describe two different embodiments of the invention . both use an oxidation unit 10 a and a hydrogen selective catalytic reduction ( h - scr ) unit 10 b , but in different configurations . both embodiments are used with diesel engines , which do not run rich . the oxidation unit 10 a acts as a hydrogen generator , and runs “ offline ” of the main exhaust gas stream so that it may operate in a rich fuel environment . the hydrogen from oxidation unit 10 a is fed to the h - scr catalyst 10 b , which continuously converts no x to n 2 and h 2 o . an optional water gas shift ( wgs ) catalyst 10 c may be interposed between the partial oxidation unit 10 a and the h - scr catalyst 10 b , to generate additional hydrogen . as explained below , diesel fuel is partially oxidized by oxidation unit 10 b to produce a combination of hydrogen ( h 2 ) and carbon monoxide ( co ), with traces of carbon dioxide ( co 2 ) and water ( h 2 o ) produced as by products . the hydrogen is then used by an h - scr catalyst 10 b to convert the no x in the exhaust stream into nitrogen . the h - scr catalyst 10 b is selected specifically to use hydrogen to reduce exhaust - borne no x emissions , and operates under net oxidizing conditions ( lambda & gt ; 1 ). fig1 illustrates one embodiment of an h - scr ( hydrogen scr ) system 10 in accordance with the invention . partial oxidation unit 10 a receives a fraction of the diesel fuel , relative to the fuel flow to engine 12 , from tank 11 . partial oxidation unit 10 a may be any type of catalyst or non - stoichiometric burner , suitable for partial oxidation of hydrocarbons . in general , partial oxidation unit 10 a operates by converting diesel fuel into a gas mixture containing hydrogen as one of its primary components . in the embodiment of fig1 , partial oxidation unit 10 a receives diesel fuel from an auxiliary fuel line 15 off the main fuel line 13 and air from an air input line 16 . an output line 17 delivers the gas mixture to the main exhaust line 14 . partial oxidation catalysts exist that can convert hydrocarbons with conversion efficiency greater than 90 percent and selectivity to hydrogen in excess of 90 percent . certain catalysts have already been proven effective at converting natural gas to hydrogen , namely nickel - based and rhodium - based formulations . these include ni / al 2 o 3 , ni / la / al 2 o 3 , and rh / al 2 o 3 . although nickel - based catalysts may produce carbon , they are less expensive than rhodium - based catalysts . catalytic partial oxidation is a high space velocity process ( e . g ., 500 , 000 per hour ), with residence times typically in the range of 10 to 1000 microseconds . thus , the catalysts do not need to be large to have high efficiency and selectivity . partial oxidation catalysts operate under reducing gas conditions , and the lambda in the partial oxidizer may be about 0 . 3 to 0 . 6 . in the embodiment of fig1 , an optional wgs catalyst 10 c is interposed directly downstream of the partial oxidation unit 10 a and upstream of h - scr catalyst 10 b . wgs catalyst 10 c uses carbon monoxide ( co ) generated by the partial oxidation unit 10 a to form additional hydrogen . to enable this reaction , supplemental water may be added to the gas mixture entering wgs catalyst 10 c . an advantage of using wgs catalyst 10 c is that more hydrogen can be produced from the same amount of fuel . in other words , less fuel is needed to generate the same amount of hydrogen . the gas mixture from wgs catalyst 10 c is injected into the main diesel exhaust line 14 , upstream of h - scr catalyst 10 b . in embodiments not having wgs catalyst 10 c , the gas mixture from partial oxidation unit 10 a would be injected into the main exhaust line 14 at the same point . in all embodiments , h - scr catalyst 10 b then uses the hydrogen in the gas mixture to convert no x into nitrogen and water . fig2 illustrates a second embodiment of the invention , an h - scr system 20 , whose partial oxidation unit 10 a is positioned on a branch line 22 off the main exhaust line . the partial oxidation unit 10 a receives a portion of the exhaust diverted from the exhaust line , as well as diesel fuel from an auxiliary fuel line 21 . under net reducing conditions , diesel fuel is converted into hydrogen , carbon monoxide and traces of carbon dioxide and water . like system 10 , system 20 may have an optional wgs catalyst 10 c downstream of the partial oxidation unit 10 a . the hydrogen - enhanced gas mixture flows back into the main exhaust line , via an output branch line 23 , upstream of an h - scr catalyst 10 b , which uses the hydrogen to convert no x into nitrogen and water . for system 20 , effective partial oxidation is achieved by controlling the diesel injection rate . when no supplemental diesel fuel is being injected into the exhaust stream , such as when no x emissions from engine 12 are low , the partial oxidation unit 10 a acts as a full oxidation catalyst , converting unburned hydrocarbons and carbon monoxide into water and carbon dioxide . with the partial oxidation unit 10 a located in a branch off the main exhaust gas stream , a portion of the exhaust flows through the partial oxidation catalyst . as a result , less diesel fuel is required to enrich the gas entering the partial oxidation catalyst . also , the partial oxidation catalyst can be smaller . at the same time , sufficient hydrogen must be generated to obtain effective reduction of the no x in the h - scr catalyst 10 b . this design has the advantages that the heat required to activate the partial oxidation catalyst may be provided by the exhaust gas instead of by an external heat source , and it may be possible to use the heat generated by the partial oxidation reaction to accelerate heating of the h - scr catalyst lob during cold - start operation . for both system 10 and system 20 , the products of partial oxidizer 10 a are metered into the diesel exhaust gas , upstream of h - scr catalyst 10 b . the amount of gas injected should ideally be proportional to the amount of no x in the exhaust . a 1 : 1 molar ratio of h 2 : no is expected for efficient conversion of no to n 2 in accordance with equation ( 1 ) below . however , no 2 exists in the diesel exhaust simultaneously with no , either from the combustion process ( approximately 15 percent ) or from oxidation in a passive particulate trap such as a crt ( approximately 40 percent ). a 2 : 1 ratio of h 2 : no 2 is expected for efficient conversion of no 2 to n 2 in accordance with equation ( 2 ) below . results of experimentation with ruthenium - based h - scr catalysts using ru / mgo and ru / al 2 o 3 have been reported by hornung , et al . in a paper entitled “ on the mechanism of the selective catalytic reduction of no to n 2 by h 2 over ru / mgo and ru / al 2 o 3 catalysts ”, in topics in catalysis , 2000 , 11 / 12 ( 1 - 4 ), 263 - 70 . the reports are of 100 percent selectivity to n 2 . another possible candidate for h - scr catalyst 10 b is a platinum titania - zirconia catalyst , pt / tio 2 — zro 2 . potential fuel penalties may be calculated based on the no : no 2 ratio in the exhaust . if a range of no 2 content is considered from 15 to 100 percent , the fuel economy penalty is calculated to be in a range from two to four percent . to estimate a realistic fuel economy penalty , a worst case scenario was used with a system containing a passive pm trap , such as a crt , which creates high levels of no 2 . based on a 60 : 40 no : no 2 exhaust gas mixture , and using equations ( 1 ) and ( 2 ), approximately 1 . 4 moles of h 2 are required per mole of no x . assuming ideal conditions of 100 percent efficient partial oxidation , 100 percent selectivity to h 2 , and 100 percent no x conversion efficiency of the h - scr catalyst , it was calculated that fuel economy would be reduced by 2 . 5 percent . an advantage of the invention is that the invention effectively reduces tailpipe oxides of nitrogen emissions without the need for a reductant other than diesel fuel . it continuously converts no x to nitrogen , by first generating hydrogen from the diesel fuel and then using the hydrogen in a hydrogen - based scr catalyst . the system does not require adjustment of the engine air / fuel ratio , of engine combustion , or of any other engine functionality . although the present invention has been described in detail , it should be understood that various changes , substitutions , and alterations can be made hereto without departing from the spirit and scope of the invention as defined by the appended claims .	8
throughout all the figures , same or corresponding elements may generally be indicated by same reference numerals . these depicted embodiments are to be understood as illustrative of the invention and not as limiting in any way . it should also be understood that the figures are not necessarily to scale and that the embodiments are sometimes illustrated by graphic symbols , phantom lines , diagrammatic representations and fragmentary views . in certain instances , details which are not necessary for an understanding of the present invention or which render other details difficult to perceive may have been omitted . turning now to the drawing , and in particular to fig1 , there is shown a detail of an automobile column 1 . as can be seen , a region of the second type 3 according to the invention is formed in a region of the first type 2 . a transition region 4 is arranged between the region of the first type 2 and the region of the second type 3 . a material structure having a tendency to be ductile is produced in the region of the first type 2 , whereas a hard material structure is produced in the region of the second type 3 . within the context of the present invention , the transition region 4 has essentially a width which is quite small compared to the region of the first type 2 . fig2 shows an automobile column 1 in form of an a - column 5 of an automobile body which is not shown in detail . the a - column 5 has joining flanges 6 at its respective sides 5 a , 5 b , which have a higher ductility than a center profile section 7 . the a - column 5 has therefore , due to its center profile section 7 , high strength and hardness which guarantees the protection of the passenger compartment in a crash , whereas the joining flanges 6 produce a rather ductile material property compared to the center profile section , so that components ( not shown in detail ) attached to the joining flanges 6 remain connected with the a - column 5 , and the connections , indicated by the joining flanges 6 , do not tear off . fig3 shows a time - temperature diagram of an exemplary steel , without limiting the field of the present invention . several structures are indicated which are formed in the material at various cooldown speeds as a function of temperature . the lower part of the fig . shows the martensite formation . above , in the center region of the fig ., the bainite formation is shown , and there above the perlite and / or ferrite formation . in the illustrated exemplary embodiment , three different curves for the different cooldown processes are shown . curve k 1 shows the course of the temperature for a first region according to the invention , wherein this region is first heated to a temperature above the ac3 temperature . from this temperature , the material is cooled down to an intermediate temperature of about 520 ° c . with a cooldown speed which in this case is greater than the upper critical cooldown speed ok for the bainite formation of the illustrated material . when the cooldown temperature of the intermediate cooling of about 520 ° c . is reached , the first region is held substantially isothermally at a temperature for the time t 1 . the temperature thereby decreases from about 520 ° c . to about 480 ° c . due to heat loss in form of , for example , heat radiation , convection or heat conduction . an austenitic structure is produced at the time z 1 of the intermediate cooling , and a bainitic - austenitic mixed structure is produced at the time p 1 , corresponding to the start of press - hardening in the first embodiment . in the first embodiment , quenching thereafter occurs in the press - hardening process from the time p 1 , such that the bainitic - austenitic mixed structure in the first region is transformed to a bainitic - martensitic mixed structure . in parallel , the second region according to the invention is quenched from a temperature above ac3 by press - hardening , producing a martensitic structure directly from an austenitic structure ; however , this is not illustrated in detail for sake of clarity . the second embodiment of the method according to the invention is illustrated with the cooldown sequence according to curve 2 of the first region . the cooldown sequence of the curve 2 is similar to the cooldown sequence of the curve k 1 , wherein the cooldown temperature is held for a longer time from a time z 2 ( equal to z 1 ), so that the press - hardening process starts at a time p 2 . the time interval t 2 is therefore greater than t 1 . the structure in the first region is completely transformed to bainite at the time p 2 and therefore does not undergo any further structural transformation after the time p 2 due to the cooldown speed . in a third embodiment according to the present invention , a cooldown speed from a temperature above the ac3 temperature according to curve 3 is selected , so that a transformation occurs directly into the bainitic intermediate structure during the cooldown process of the intermediate cooling . in the first region , an austenitic - bainitic intermediate structure was adjusted , so that when the press - hardening process starts at the time p 3 , this bainitic - austenitic mixed structure in the first region is transformed to a bainitic - martensitic mixed structure . in the embodiments according to curves 2 and 3 , the second region which was held above the ac3 temperature during the intermediate cooling , is in both cases transformed from the austenitic region directly to martensite by the cooldown during the press - hardening process . in the embodiment according to curve 3 , the temperature is selected according to the invention to be always greater than the lower critical cooldown speeds uk of the corresponding employed material . while the invention has been illustrated and described in connection with currently preferred embodiments shown and described in detail , it is not intended to be limited to the details shown since various modifications and structural changes may be made without departing in any way from the spirit and scope of the present invention . the embodiments were chosen and described in order to explain the principles of the invention and practical application to thereby enable a person skilled in the art to best utilize the invention and various embodiments with various modifications as are suited to the particular use contemplated . what is claimed as new and desired to be protected by letters patent is set forth in the appended claims and includes equivalents of the elements recited therein :	2
the present invention describes the use of multiple stabilizing compounds molecularly dispersed in a polymeric phase of a polymeric layer , where at least one is an acid scavenger and two others form a synergistically effective combination of two radical scavenger antioxidants . the stabilizing radical scavengers consist of at least one hindered amine compound and at least one hindered phenol compound . hindered amine light stabilizers ( hals compounds ) useful in the stabilized polymer components of this invention are known compounds and include , e . g ., 2 , 2 , 6 , 6 - tetraalkylpiperidine compounds , or the acid addition salts or complexes with metal compounds thereof , as described in u . s . pat . no . 4 , 619 , 956 , columns 5 - 11 , and u . s . pat . no . 4 , 839 , 405 , columns 3 - 5 , the disclosures of which are incorporated by reference . such compounds include those of the following formula i : wherein r1 and r2 are h or substituents . specific examples of hindered amine light stabilizer compounds include 4 - hydroxy - 2 , 2 , 6 , 6 - tetramethylpiperidine ; 1 - allyl - 4 - hydroxy - 2 , 2 , 6 , 6 - tetramethylpiperidine ; 1 - benzyl - 4 - hydroxy - 2 , 2 , 6 , 6 - tetramethylpiperidine ; 1 -( 4 - tert - butyl - 2 - butenyl )- 4 - hydroxy - 2 , 2 , 6 , 6 - tetramethylpiperidine ; 4 - stearoyloxy - 2 , 2 , 6 , 6 - tetramethylpiperidine ; 1 - ethyl - 4 - salicyloyloxy - 2 , 2 , 6 , 6 - tetramethylpiperidine ; 4 - methacryloyloxy - 1 , 2 , 2 , 6 , 6 - pentamethylpiperidine ; 1 , 2 , 2 , 6 , 6 - pentamethylpiperidin - 4 - yl - beta ( 3 , 5 - di - tert - butyl - 4 - hydroxyphenyl )- propionate ; 1 - benzyl - 2 , 2 , 6 , 6 - tetramethyl - 4 - piperidinylmaleinate ; ( di - 2 , 2 , 6 , 6 - tetramethylpiperidin - 4 - yl )- adipate ; ( di - 2 , 2 , 6 , 6 - tetramethylpiperidin - 4 - yl )- sebacate ; ( di - 1 , 2 , 3 , 6 - tetramethyl - 2 , 6 - diethyl - piperidin - 4 - yl )- sebacate ; ( di - 1 - allyl - 2 , 2 , 6 , 6 - tetramethyl - piperidin - 4 - yl )- phthalate ; 1 - acetyl - 2 , 2 , 6 , 6 - tetramethylpiperidin - 4 - yl - acetate ; trimellitic acid - tri -( 2 , 2 , 6 , 6 - tetramethylpiperidin - 4 - yl ) ester ; 1 - acryloyl - 4 - benzyloxy - 2 , 2 , 6 , 6 - tetramethylpiperidine ; dibutyl - malonic acid - di -( 1 , 2 , 2 , 6 , 6 - pentamethyl - piperidin - 4 - yl )- ester ; dibenzyl - malonic acid - di -( 1 , 2 , 3 , 6 - tetramethyl - 2 , 6 - diethyl - piperidin - 4 - yl )- ester ; dimethyl - bis -( 2 , 2 , 6 , 6 - tetramethylpiperidin - 4 - oxy )- silane ; tris -( 1 - propyl - 2 , 2 , 6 , 6 - tetramethylpiperidin - 4 - yl )- phosphite ; tris -( 1 - propyl - 2 , 2 , 6 , 6 - tetramethylpiperidin - 4 - yl )- phosphate ; n , n ′- bis -( 2 , 2 , 6 , 6 - tetramethylpiperidin - 4 - yl )- hexamethylene - 1 , 6 - diamine ; n , n ′- bis -( 2 , 2 , 6 , 6 - tetramethylpiperidin - 4 - yl )- hexamethylene , 1 , 6 - diacetamide ; 1 - acetyl - 4 -( n - cyclohexylacetamide )- 2 , 2 , 6 , 6 - tetramethyl - piperidine ; 4 - benzylamino - 2 , 2 , 6 , 6 - tetramethylpiperidine ; n , n ′- bis -( 2 , 2 , 6 , 6 - tetramethylpiperidin - 4 - yl )- n , n ′- dibutyl - adipamide ; n , n ′- bis -( 2 , 2 , 6 , 6 - tetramethylpiperidin - 4 - yl )- n , n ′- dicyclohexyl -( 2 - hydroxypropylene ); n , n ′- bis -( 2 , 2 , 6 , 6 - tetramethylpiperidin - 4 - yl )- p - xylylene - diamine ; 4 -( bis - 2 - hydroxyethyl )- amino - 1 , 2 , 2 , 6 , 6 - pentamethylpiperidine ; 4 - methacrylamide - 1 , 2 , 2 , 6 , 6 - pentamethylpiperidine ; alpha - cyano - beta - methyl - beta -[ n -( 2 , 2 , 6 , 6 - tetramethylpiperidin - 4 - yl )]- amino - acrylic acid methyl ester . examples of preferred hindered amine light stabilizers include hals - 1 and hals - 2 : hindered phenols antioxidant compounds useful in the stabilized polymer components of this invention are also known compounds , and include , e . g ., 2 , 6 - dialkylphenol derivative compounds such as described in u . s . pat . no . 4 , 839 , 405 columns 12 - 14 , the disclosure of which is incorporated by reference . such compounds include those of the following formula ii : wherein r1 , r2 and r3 represent further substituted or unsubstituted alkyl substituents . specific examples of hindered phenol compounds include n - octadecyl 3 -( 3 , 5 - di - t - butyl - 4 - hydroxyphenyl )- propionate ; n - octadecyl 3 -( 3 , 5 - di - t - butyl - 4 - hydroxyphenyl )- acetate ; n - octadecyl 3 , 5 - di - t - butyl - 4 - hydroxybenzoate ; n - hexyl 3 , 5 - di - t - butyl - 4 - hydroxyphenylbenzoate ; n - dodecyl 3 , 5 - di - t - butyl - 4 - hydroxyphenylbenzoate ; neo - dodecyl 3 -( 3 , 5 - di - t - butyl - 4 - hydroxyphenyl ) propionate ; dodecyl beta ( 3 , 5 - di - t - butyl - 4 - hydroxyphenyl ) propionate ; ethyl alpha -( 4 - hydroxy - 3 , 5 - di - t - butylphenyl ) isobutyrate ; octadecyl alpha -( 4 - hydroxy - 3 , 5 - di - t - butylphenyl ) isobutyrate ; octadecyl alpha -( 4 - hydroxy - 3 , 5 - di - t - butyl - 4 - hydroxyphenyl ) propionate ; 2 -( n - octylthio ) ethyl 3 , 5 - di - t - butyl - 4 - hydroxy - benzoate ; 2 -( n - octylthio ) ethyl 3 , 5 - di - t - butyl - 4 - hydroxy - phenylacetate ; 2 -( n - octadecylthio ) ethyl 3 , 5 - di - t - butyl - 4 - hydroxyphenylacetate ; 2 -( n - octadecylthio ) ethyl 3 , 5 - di - t - butyl - 4 - hydroxybenzoate ; 2 -( 2 - hydroxyethylthio ) ethyl 3 , 5 - di - t - butyl - 4 - hydroxybenzoate ; diethyl glycol bis -( 3 , 5 - di - t - butyl - 4 - hydroxy - phenyl ) propionate ; 2 -( n - octadecylthio ) ethyl 3 -( 3 , 5 - di - t - butyl - 4 - hydroxyphenyl ) propionate ; stearamido n , n - bis -[ ethylene 3 -( 3 , 5 - di - t - butyl - 4 - hydroxyphenyl ) propionate ]; n - butylimino n , n - bis -[ ethylene 3 -( 3 , 5 - di - t - butyl - 4 - hydroxyphenyl ) propionate ]; 2 -( 2 - stearoyloxyethylthio ) ethyl 3 , 5 - di - t - butyl - 4 - hydroxybenzoate ; 2 -( 2 - stearoyloxyethylthio ) ethyl 7 -( 3 - methyl - 5 - t - butyl - 4 - hydroxyphenyl ) heptanoate ; 1 , 2 - propylene glycol bis -[ 3 -( 3 , 5 - di - t - butyl - 4 - hydroxyphenyl ) propionate ]; ethylene glycol bis -[ 3 , 5 - di - t - butyl - 4 - hydroxyphenyl ) propionate ]; neopentylglycol bis -[ 3 -( 3 , 5 - di - t - butyl - 4 - hydroxyphenyl ) propionate ]; ethylene glycol bis -[ 3 , 5 - di - t - butyl - 4 - hydroxyphenylacetate ); glycerine - 1 - n - octadecanoate - 2 , 3 - bis -( 3 , 5 - di - t - butyl - 4 - hydroxyphenylacetate ); pentaethylthritol - tetrakis -[ 3 -( 3 ′, 5 ′- di - t - butyl - 4 ′- hydroxyphenyl ) propionate ]; 1 , 1 , 1 - trimethylol ethane - tris - 3 -( 3 , 5 - di - t - butyl - 4 - hydroxyphenyl ) propionate ]; sorbital hexa -[ 3 -( 3 , 5 - di - t - butyl - 4 - hydroxyphenyl ) propionate ]; 2 - hydroxyethyl 7 -( 3 - methyl - 5 - t - butyl - 4 - hydroxyphenyl ) propionate ; 2 - stearoyloxyethyl 7 -( 3 methyl - 5 - t - butyl - 4 - hydroxyphenyl ) heptanoate ; 1 , 6 - n - hexanediol - bis [( 3 ′, 5 ′- di - t - butyl - 4 - hydroxyphenyl ) propionate ]; pentaerythritol - tetakis ( 3 , 5 - di - tert - butyl - 4 - hydroxy hydrocinnamate ). hindered phenolic antioxidant compounds of the above types are available commercially , such as from ciba specialty chemicals under the general trade designations “ irganox 1076 ” and “ irganox 1010 ”. acid scavengers useful in the stabilized polymer components of this invention preferably comprise epoxy compounds such as those acid accepting epoxy compounds described in u . s . pat . no . 4 , 137 , 201 , the disclosure of which is incorporated by reference herein . such acid accepting epoxy compounds are known to the art and include diglycidyl ethers of various polyglycols , particularly those polyglycols that are derived from condensation of say 8 to 40 moles of ethylene oxide or the like per mole of polyglycol product ; diglycidyl ethers of glycerol and the like ; metallic epoxy compounds ( such as those conventionally utilized in and with vinylchloride polymer compositions ); epoxidized ether condensation products ; diglycidyl ethers of bisphenol a ( i . e ., 4 , 4 ′- dihydroxy diphenyl dimethyl methane ); epoxidized unsaturated fatty acid esters , particularly 4 to 2 carbon atom or so alkyl esters of 2 to 22 carbon atom fatty acids such as butyl epoxy stearate and the like ; and various epoxidized long chain fatty acid triglycerides and the like , such as the epoxidized vegetable and other unsaturated natural oils ( which are sometimes referred to as being epoxidized natural glycerides or unsaturated fatty acids , which fatty acids generally contain between 12 and 22 carbon atoms ) that may be specifically typified and particularized by such compositions as epoxidized soya bean oil . particularly preferred is commercially available epoxy group containing epoxide resin compound epon 815c , and other epoxidized ether oligomeric condensation products of formula iii where n equals from 0 to 12 . additional possible acid scavengers , which may be employed , include those described in japanese kokai jp 05194788 a2 , paragraphs 87 - 105 , the disclosure of which is incorporated by reference . a ratio of the acid scavenger to the total concentration of hindered amine compound and hindered phenol compound is 10 : 1 to 1 : 10 by weight , preferably 4 : 1 to 1 : 5 and especially in the range of 2 : 1 to 1 : 2 . the ratio of hindered amine light stabilizer ( hals ) to hindered phenol ( hp ) in accordance with the invention lies in the range of 1 : 20 to 20 : 1 ( hals : hp ) by weight , preferably in the range of 1 : 10 to 10 : 1 , and especially in the range of 1 : 5 to 5 : 1 . examples of polymers employable for the polymer phase of the elements of the invention include polyesters ( e . g ., polyethylene terephthalate and polyethylene - 2 , 6 - naphthalate ); cellulose esters ( e . g ., cellulose diacetate , cellulose triacetate , cellulose acetate propionate and cellulose acetate butyrate ); polyolefins ( e . g ., polypropylene and polyethylene ); polymers derived from vinyl chloride ( e . g ., polyvinyl chloride and vinyl chloride / vinyl acetate copolymer ); acrylic resins ( e . g ., polymethyl methacrylate ); polycarbonate esters ( e . g ., polycarbonate ); norbornene resins ; and water soluble resins ( e . g ., polyvinyl alcohol , gelatin ). with respect to the application of this invention in a polymer component of a liquid crystal display , several display elements can be considered including ; a polarizing sheet , a polarizing sheet protective film , phase shift sheet , deflector , view angle enhancing film , abrasion resistant film , antiglare film , brightness enhancing film , antireflection film , and antistatic film . in a particularly preferred embodiment , the polymer component of a display related to the current invention is in the form of a polymer film wherein the polymer is a cellulose ester , such as a cellulose acetate , particularly cellulose triacetate . the polymer component in such embodiment may be advantageously employed as a protective film of a polarizing sheet , the polarizing sheet comprising a polarizing plate and the protective film provided on one side or both sides of the polarizing plate . further , as cellulose triacetate , the known materials can be employed . the acetyl value of cellulose triacetate preferably is in the range of 35 to 70 %, especially in the range of 55 to 65 %. the weight average molecular weight of cellulose acetate preferably is in the range of 70 , 000 to 200 , 000 , especially 80 , 000 to 190 , 000 . the polydispersity index ( weight average divided by number average molecular weight ) of cellulose acetate is in the range of 2 to 7 , especially 2 . 5 to 4 . cellulose acetate may be obtained from cellulose starting materials derived from either wood pulp or cotton linters . cellulose acetate may be esterified using a fatty acid such as propionic acid or butyric acid so long as the acetyl value satisfies the range . otherwise , cellulose acetate may contain other cellulose esters such as cellulose propionate or cellulose butyrate so long as the acetyl value satisfies the range . cellulose acetate film generally contains a plasticizer . examples of the plasticizers include phosphate esters such as triphenyl phosphate , biphenylyl diphenyl phosphate , tricresyl phosphate , cresyl diphenyl phosphate , octyl diphenyl phosphate , trioctyl phosphate , and tributyl phosphate ; and phthalate esters such as diethyl phthalate , dimethoxyethyl phthalate , dimethyl phthalate , and dioctyl phthalate . preferable examples of glycolic acid esters are triacetin , tributyrin , butyl phthalyl butyl glycolate , ethyl phthalyl ethyl glycolate , and methyl phthalyl ethyl glycolate . two or more plasticizers shown above may be combined . the plasticizer is preferably contained in the film in an amount of not more than 20 weight %, especially of 5 to 15 weight %. films prepared from polymers other than cellulose triacetate may also contain appropriately the above plasticizer . in preferred embodiments of the invention , the stabilized polymer phase , and in particular a stabilized cellulose acetate film , may contain one or more uv absorbing compounds to provide uv filter element performance and / or act as uv stabilizers for the polymer . ultraviolet absorbing compounds are generally contained in the polymer in an amount of 0 . 01 to 20 weight parts based on 100 weight parts of the polymer containing no ultraviolet absorber , and preferably contained in an amount of 0 . 01 to 10 weight parts , especially in an amount of 0 . 05 to 2 weight parts . any of the various ultraviolet light absorbing compounds , which have been described for use in various polymeric elements , may be employed in the polymeric elements of the invention , such as hydroxyphenyl - s - triazine hydroxyphenylbenzotriazole , formamidine , benzophenone , or beuzoxazinone compounds . as described in copending , commonly assigned u . s . ser . no . 10 / 150 , 634 , filed concurrently herewith ( based on u . s . provisional application ser . no . 60 / 326 , 853 filed oct . 3 , 2001 ) and incorporated by reference above , the use of dibenzoylmethane ultraviolet absorbing compounds in combination with a second uv absorbing compound such as those listed above have been found to be particularly advantageous with respect to providing both a sharp cut off in absorption between the uv and visible light spectral regions as well as increased protection across more of the uv spectrum . additional possible uv absorbers which may be employed include salicylate compounds such as 4 - t - butylphenylsalicylate ; and [ 2 , 2 ′ thiobis -( 4 - t - octylphenolate )] n - butylamine nickel ( ii ). most preferred are combinations of dibenzoylmethane compounds with hydroxyphenyl - s - triazine or hydroxyphenylbenzotriazole compounds . dibenzoylmethane compounds , which may be employed , include those of the formula ( iv ) where r1 through r5 are each independently hydrogen , halogen , nitro , or hydroyxl , or further substituted or unsubstituted alkyl , alkenyl , aryl , alkoxy , acyloxy , ester , carboxyl , alkyl thio , aryl thio , alkyl amine , aryl amine , alkyl nitrile , aryl nitrile , arylsulfonyl , or 5 - 6 member heterocylce ring groups . preferably , each of such groups comprises 20 or fewer carbon atoms . further preferably , r1 through r5 of formula iv are positioned in accordance with particularly preferred are compounds of formula iv - a where r1 and r5 represent alkyl or alkoxy groups of from 1 - 6 carbon atoms and r2 through r4 represent hydrogen atoms . representative compounds of formula ( iv ) which may be employed in accordance the elements of the invention include the following : hydroxyphenyl - s - triazine compounds which may be used in the elements of the invention , e . g ., may be a derivative of tris - aryl - s - triazine compounds as described in u . s . pat . no . 4 , 619 , 956 , the disclosure of which is incorporated by reference . such compounds may be represented by formula v : wherein x , y and z are each aromatic , carbocylic radicals of less than three 6 - membered rings , and at least one of x , y and z is substituted by a hydroxy group ortho to the point of attachment to the triazine ring ; and each of r1 through r9 is selected from the group consisting of hydrogen , hydroxy , alkyl , alkoxy , sulfonic , carboxy , halo , haloalkyl and acylamino . particularly preferred are hydroxyphenyl - s - triazines of the formula v - a : hydroxyphenylbenzotriazole compounds , which may be used in the elements of the invention , e . g ., may be a derivative of compounds represented by formula vi : wherein r1 through r5 may be independently hydrogen , halogen , nitro , hydroxy , or further substituted or unsubstituted alkyl , alkenyl , aryl , alkoxy , acyloxy , acyloxy , alkylthio , mono or dialkyl amino , acyl amino , or heterocyclic groups . specific examples of benzotriazole compounds which may be used in accordance with the invention include 2 -( 2 ′- hydroxy - 3 ′- t - butyl - 5 ′- methylphenyl )- 5 - chlorobenzotriazole ; 2 -( 2 ′- hydroxy - 3 ′, 5 ′- di - t - amylphenyl ) benzotriazole ; octyl 5 - tert - butyl - 3 -( 5 - chloro - 2h - benzotriazole - 2 - yl )- 4 - hydroxybenzenepropionate ; 2 -( hydroxy - 5 - t - octylphenyl ) benzotriazole ; 2 -( 2 ′- hydroxy - 5 ′- methylphenyl ) benzotriazole ; 2 -( 2 ′- hydroxy - 3 ′- dodecyl - 5 ′- methylphenyl ) benzotriazole ; and 2 -( 2 ′- hydroxy - 3 ′, 5 ′- di - t - butylphenyl )- 5 - chlorobenzotriazole . formamidine compounds which may be used in the elements of the invention , e . g ., may be a formamidine compound as described in u . s . pat . no . 4 , 839 , 405 , the disclosure of which is incorporated by reference . such compounds may be represented by formula vii or formula viii : wherein r1 is an alkyl group containing 1 to about 5 carbon atoms ; y is a h , oh , cl or an alkoxy group ; r2 is a phenyl group or an alkyl group containing 1 to about 9 carbon atoms ; x is selected from the group consisting of h , carboalkoxy , alkoxy , alkyl , dialkylamino and halogen ; and z is selected from the group consisting of h , alkoxy and halogen ; wherein a is — coor , — cooh , — conr ′ r ″, — nr ′ cor , — cn , or a phenyl group ; and wherein r is an alkyl group of from 1 to about 8 carbon atoms ; r ′ and r ″ are each independently hydrogen or lower alkyl groups of from 1 to about 4 carbon atoms . specific examples of formamidine compounds which may be used in accordance with the invention include those described in u . s . pat . no . 4 , 839 , 405 , and specifically 4 -[[( methylphenylamino ) methylene ] amino ]-, ethyl ester . benzophenone compounds which may be used in the elements of the invention , e . g ., may include 2 , 2 ′- dihydroxy - 4 , 4 ′ dimethoxybenzophenone , 2 - hydroxy - 4 - methoxybenzophenone and 2 - hydroxy - 4 - n - dodecyloxybenzophenone . the polymer component of the invention may contain particles of an inorganic or organic compound to provide surface lubrication . examples of the inorganic compound include silicon dioxide , titanium dioxide , aluminum oxide , zirconium oxide , calcium carbonate , talc , clay , calcined kaolin , calcined calcium silicate , hydrate calcium silicate , aluminum silicate , magnesium silicate , and calcium phosphate . preferred are silicon dioxide , titanium dioxide , and zirconium oxide , and especially silicon dioxide . examples of the organic compound ( polymer ) include silicone resin , fluororesin and acrylic resin . preferred is acrylic resin . polymer components in accordance with the invention preferably are in the form of a polymer film . the polymer film is preferably prepared by utilizing a solvent casting method . in more detail , the solvent casting method comprises the steps of : casting the polymer solution fed from a slit of a solution feeding device ( die ) on a support and drying the cast layer to form a film . in a large - scale production , the method can be conducted , for example , by the steps of casting a polymer solution ( e . g ., a dope of cellulose triacetate ) on a continuously moving band conveyor ( e . g ., endless belt ) or a continuously rotating drum , and then vaporizing the solvent of the cast layer . in a small - scale production , the method can be conducted , for example , by the steps of casting a polymer solution fed from a slit of a solution feeding device on a fixed support having a regular size , such as a metal plate or glass plate by moving the device , and then vaporizing the solvent of the cast layer . any support can be employed in the solvent casting method , so long as the support has property that a film formed thereon can be peeled therefrom . therefore , supports other than the metal and glass plates ( e . g ., plastic film ) are also employable , so long as the supports have the above property . any die can be employed , so long as it can feed a solution at a uniform rate . further , as methods for feeding the solution to the die , a method using a pump to feed the solution at a uniform rate can be employed . in a small - scale production , a die capable of holding the solution in an appropriate amount can be utilized . a polymer employed in the solvent casting method is required to be capable of dissolving in a solvent . further a film formed of the polymer is generally required to have high transparency and to have little optical anisotropy for application in optical products . furthermore , the polymer preferably has compatibility with the stabilizers . as the polymer employed in the solvent casting method , preferred is cellulose triacetate . however , other polymers can be employed so long as they satisfy the above conditions . as a method for the formation of polymer display components other than the solvent casting method , there can be mentioned the known extrusion molding method comprising the steps of mixing the polymer and the stabilizers with melting , and extruding the mixture . the method is generally applied to polymers that cannot utilize the solvent casting method . a process for the preparation of a polymer display component in the form of an optical polymer film in accordance with preferred embodiments of the invention is explained in detail referring to a cellulose triacetate film . in a mixing vessel , a solvent , cellulose triacetate and a plasticizer are placed , and cellulose acetate is dissolved by stirring ( under heating , if desired under pressure ) to prepare a dope . in another mixing vessel , a solvent , acid scavenger and antioxidants stabilizers are placed , and are dissolved by stirring . in the case that particles to improve surface lubrication are added , the particles may be placed in the resultant stabilizer containing solution and the mixture is dispersed using a dispersing machine to prepare a dispersion . an appropriate amount of the stabilizer containing solution is fed to the vessel holding the dope , and they are mixed . the mixture ( dope ) is fed to a casting head appropriately through a filter for dope , and is cast from the casting head on a drum or continuous belt of metal ( support ). the cast film is dried during one rotation of the support to form a film having self - bearing properties , and the dried film is separated from the support , and then the film is sufficiently dried to be wound . the dope and the stabilizer containing solution can be mixed by the use of a static mixer which is mounted in the piping before the casting head , fed to the casting head and cast from the casting head on a metal drum ( support ). any solvent can be employed in the solvent casting method so long as the polymer used ( e . g ., cellulose triacetate ) can be dissolved . the solvent may be a single solvent or a combination of solvents . examples of solvents employed in the solvent casting method include aliphatic hydrocarbons such as pentane , hexane , heptane , octane , isooctane and cyclohexane ; aromatic hydrocarbons such as benzene , toluene and xylene ; chlorinated hydrocarbons such as chloromethane , dichloromethane , carbon tetrachloride and trichloroethane ; alcohols such as methanol , ethanol , isopropyl alcohol and n - butyl alcohol ; ketones such as acetone , methyl ethyl ketone , and cyclohexanone , and esters such as methyl formate , ethyl formate , methyl acetate and ethyl acetate , or dioxalane . in the case of employing cellulose triacetate as the polymer , a mixed solvent of dichloromethane and methanol is generally employed . other solvents such as isopropyl alcohol and n - butyl alcohol can be employed so long as cellulose triacetate is not deposited ( e . g ., during the procedure of preparing the dope or adding the particles to the dope ). a ratio of cellulose triacetate and solvent in the dope is preferably 10 : 90 to 30 : 70 by weight ( cellulose triacetate : solvent ). in the procedure of preparing the dope or the dispersion , various other additives such as a dispersing agent , a fluorescent dye , an antifoamant , a lubricant , uv absorbing dyes can be added to the dope or the dispersion . in a particularly preferred embodiment , a stabilized polymer component in accordance with the invention comprises a cellulose triacetate film containing from 0 . 01 to 5 wt % ( based on total weight ) of compound uv - 1 ( parsol 1789 ) as a first uv absorbing compound , from 0 . 01 to 5 wt % tinuvin 326 ( uv - 3 ) and from 0 . 01 to 5 wt % tinuvin 328 ( uv - 2 ) as second uv absorbing compounds , from 0 . 01 to 10 wt % of a hindered amine light stabilizer compound such as tinuvin 622 ( hals - 1 ), from 0 . 01 to 10 wt % of a hindered phenol compound such as irganox 1010 ( hp - 1 ), and from 0 . 01 to 10 wt % of an epoxy containing acid scavenger compound such as epon 815c ( epoxy group containing oligomeric epoxide resin obtained from monomers of formula e - 1 ), with 0 . 1 - 20 wt % of a plasticizer such as triphenylphosphate . polymer film example 1 was prepared employing a combination of an acid scavenger compound , a hindered amine light stabilizer compound and a hindered phenol antioxidant compound in accordance with the invention . comparison film examples 2 - 7 were prepared similarly , but in the absence of one or more of such compounds . in a mixing vessel for a polymer dope , 100 weight parts of cellulose acetate ( cta ) ( combined acetic acid value : 60 . 8 %), 11 . 8 weight parts of triphenyl phosphate ( tpp ), 399 weight parts of dichloromethane , 33 . 4 weight parts of methanol , and 9 . 3 weight parts of n - butanol were placed , and the cellulose acetate was dissolved by stirring under heating to prepare a dope . in another mixing vessel , 3 . 3 weight parts of ultraviolet absorber uv - 1 , 27 . 3 weight parts uv - 2 , 5 . 2 weight parts uv - 3 , 8 . 4 weight parts of hals - 1 , 1 . 7 weight parts of hindered phenol ( hp - 1 ), and 8 . 4 weight parts of epoxide ( e - 1 ), having the above structures , 145 weight parts of dichloromethane , 12 weight parts of methanol , and 3 . 4 weight parts of n - butanol were placed , and stirred to prepare a solution . to the cta dope ( 302 weight parts ), 10 weight part of the stabilizer containing solution was added , and they were sufficiently mixed to prepare a uniform solution ( dope ). the mixed dope was fed to an extrusion die and cast on a moving metal support . after the cast film was separated from the casting surface , the film was dried by passing through a heating zone to prepare a cellulose acetate film having a thickness of 80 μm providing a polymer film suitable for the protective component of a polarizing plate . in another mixing vessel , 3 . 3 weight parts of ultraviolet absorber v - 1 , 27 . 3 weight parts uv - 2 , 5 . 2 weight parts uv - 3 , 145 weight parts of dichloromethane , 12 weight parts of methanol , and 3 . 4 weight parts of n - butanol were placed , and the uv absorbers were dissolved by stirring to prepare a solution . the same procedure as in example 1 for mixing with cta dope was then used and a cta film was prepared in the same manner . in another mixing vessel , 3 . 3 weight parts of ultraviolet absorber uv - 1 , 27 . 3 weight parts uv - 2 , 5 . 2 weight parts uv - 3 , 10 . 1 weight parts of hals - 1 , 145 weight parts of dichloromethane , 12 weight parts of methanol , and 3 . 4 weight parts of n - butanol were placed , and stirred to prepare a solution . the same procedure as in example 1 for mixing with cta dope was then used and a cta film was prepared in the same manner . in another mixing vessel , 3 . 3 weight parts of ultraviolet absorber uv - 1 , 27 . 3 weight parts uv - 2 , 5 . 2 weight parts uv - 3 , 8 . 4 weight parts of hals - 1 , 1 . 7 weight parts of hindered phenol ( hp - 1 ), 145 weight parts of dichloromethane , 12 weight parts of methanol , and 3 . 4 weight parts of n - butanol were placed , and stirred to prepare a solution . the same procedure as in example 1 for mixing with cta dope was then used and a cta film was prepared in the same manner . cta films were prepared as described in example 4 , however the weight ratio of hals - 1 to hp - 1 were varied as shown in table 1 while maintaining the combined total weight percent in cta film constant . the effectiveness of the stabilized polymer film components prepared as described in the examples above were evaluated both under initial conditions after preparation of the films as well as under environmental stress . transmission spectra of the example films were obtained versus an air reference over the wavelength range 220 nm to 800 nm by usual procedures . determination of the cie human perception color parameters l , a , and b * were made using the d65 illumination standard . for environmental stress testing samples were held between 1 . 1 mm thick pieces of coming type 1737 - g glass at either 85 ° c ., 90 % relative humidity for 600 hours ( after conditioning at 90 % rh for 2 hours ) or 150 ° c . ambient humidity for 200 hours . transmission spectra as above were obtained periodically to observe the stability of uv light blocking and perceived color ( cie ). note that parameter values shift relative to free standing films ( table 2 ) due to the presence of two pieces of 1 . 1 mm coming 1737 type g glass intended to entrap volatile degradation components and thereby more closely simulate display device performance conditions . note that the addition of the stabilizers show no deliterious effects on the spectral response parameters . note that samples stored at high relative humidity were preconditioned for 2 hours at 90 % rh to simulate equilibrium conditions produced during actual long term device usage . clearly the performance of the example 1 film incorporating an acid scavenger and combination of a hindered amine compound and a hindered phenol compound are far superior to all of the other example films shown . this statement is true both in terms of maintenance of transmittance spectral performance as well as maintenance of l * a * b * color and mechanical integrity . the combination of hindered amine compound and hindered phenol compound employed in accordance with the invention provides a synergistic effect with respect to enhanced color stability under high temperature and humidity conditions . fig1 demonstrates such synergistic effect . the line depicted in fig1 represents the best fit through cie b * d65 color parameter data from 12 replicate aged samples after 500 hours at 85 ° c ., 90 % rh using cta films prepared in accordance with examples 3 through 7 . the lowest cie b * value is obtained with the combination of stabilizers , relative to increased levels of either stabilizer alone . it should be noted in the results shown in table 3 that although moderate improvement in some of the spectral parameters is observed in comparison to the uv absorber only film ( example 2 ) due to the addition of a hals compound only ( example 3 ) or due to addition of a synergistically effective combination of a hals compound and a hindered phenol compound ( example 4 ), a further dramatic improvement is found for the full stabilizer formulation in accordance with the invention ( example 1 ). these results demonstrate the improvement provided by the invention described . the invention has been described in detail with particular reference to certain preferred embodiments thereof , but it will be understood that variations and modifications can be effected within the spirit and scope of the invention .	2
two hsv - 1 specific glycoproteins , gh and gl , form a molecular complex which is present on the virion envelope . this complex is essential for viral infectivity in that it is required for entry of virus into cells and for cell to cell spread of virus which is believed to occur via membrane fusion . in the experiments described below , gh and gl have been stably expressed in and secreted from mammalian cells in culture . this complex so secreted , may be obtained in large quantities for use as a candidate vaccine for protection of individuals against infections by hsv - 1 , or for eliminating or diminishing the frequency of reactivation of the virus from the latent state thus , reducing the severity of recurrent infections . the complex may also be useful as a diagnostic reagent for assessing the presence or absence of a herpesvirus infection in a human . such an assessment is made by obtaining serum from the individual and reacting it with the complex in a standard immunoassay such as radioimmunoassay or enzyme linked immunoadsorbent assay ( elisa ). homologs of the genes encoding hsv - 1 gh and gl have been identified in several other herpesviruses including human cmv ( cranage et al ., 1988 , j . virol . 62 : 1416 ), vzv ( davison and scott , 1986 , j . gen . virol . 67 : 1759 ) and ebv ( mcgeoch and davison , 1986 , nucl . acids res . 4 : 4281 ). the cmv ul115 gene , a positional homolog of the hsv - 1 gl gene , encodes a secreted protein which forms a complex with cmv gh and is therefore a positional and likely functional ( although not a sequence ) homolog to hsv - 1 gl ( kaye et al ., 1992 , j . gen . virol . 73 : 2693 ; spaete et al ., 1993 , virology 193 : 853 ). hhv - 6 ( josephs et al ., 1991 , j . virol . 65 : 5597 ), pseudorabies virus ( klupp et al ., 1991 , virology 182 : 732 ) and herpesvirus saimiri ( gompels et al ., 1988 , j . gen . virol . 69 : 2819 ) also each encode homologs of hsv - 1 gh . cells and viruses . mouse ltk - cells ( l cells ) were propagated in α - minimal essential medium ( gibco ) supplemented with 10 % heat - inactivated fetal calf serum ( fcs , obtained from hyclone laboratories ), gentamicin , amphotericin b , vitamins , and n - 2hydroxyethypiperazine - n &# 39 ;- 2 - ethanesulfonic acid ( hepes ) buffer solution . hsv - 1 strain ns was propagated as described ( cines et al ., 1982 , j . clin . invest . 69 : 123 ). antibodies . polyclonal antibodies and mabs used in this study were as follows : rabbit polyclonal anti - gh antibody preparations r82 and r83 ( roberts et al ., 1991 , virology 184 : 609 ); anti - gh mabs include 37s ( showalter et al ., 1981 , infn . immun . 34 : 684 ), 53s ( american type culture collection ), and lp11 ( buckmaster et al ., 1984 , virology 139 : 408 ); rabbit antiserum raised against the gl ul1 - 2 peptide ( anti - gl serum ; hutchinson et al ., 1992 , j . virol . 66 : 2240 ). plasmids expressing gh . plasmid pcmv3gh - 1 contains a 3 . 1 kb hindiii fragment obtained from psr95 ( roberts et al ., 1991 , virology 184 : 609 ), which fragment contains the entire hsv - 1 strain ns gh coding region ligated into the hindii site in the polylinker of pcmv3 ( andersson et al ., 1989 , j . biol . chem . 264 : 8222 ). thus , plasmid pcmv3gh - 1 encodes gh under the control of the human cytomegalovirus immediate early promoter . a second plasmid , pcmv3gh ( 792 ) encodes gh - 1 ( 792 ) which is a truncated form of the wild type protein terminating at amino acid 792 and was constructed by insertion of an spel linker containing termination codons within the gh coding region as described by roberts et al . ( 1991 , virology 184 : 609 ). plasmids expressing gl . the ul1 open reading frame which encodes gl ( mcgeoch et al ., 1988 , j . virol . 62 : 1486 ) was amplified from viral dna using the polymerase chain reaction ( pcr ). the following synthetic oligonucleotide primers containing the underlined xbai restriction enzyme sites were designed to facilitate cloning : 5 &# 39 ;- tgctctagagcgctatggggattttgggt - 3 &# 39 ; ( upstream primer ) and 5 &# 39 ;- tgctctagaggtttccgtcgaggcatcgt - 3 &# 39 ; ( downstream primer ) seq . id . nos ; 1 and 2 , respectively !. to prepare the template for amplification , approximately 10 5 hsv - 1 virions were lysed by heating to 95 ° c . for 10 minutes . the lysate was added to a 100 μl pcr reaction mixture containing 2 . 5 units of taqi dna polymerase ( perkin elmer , cetus ), 10 mm tris - hcl ( ph 8 . 3 ), 50 mm kcl , 1 . 5 mm mgcl 2 , 0 . 001 % gelatin ( wt / vol ), the four deoxyribonucleotides each at a concentration of 200 μm , and 1 . 0 μm of each of the primers . the pcr mixture was subjected to 35 cycles of amplification ( 94 ° c . for 1 minute , 55 ° c . for 1 minute , and 72 ° c . for 1 . 5 minutes ). the product , a 718 bp fragment was digested with xbai in order to generate cohesive termini and was then gel purified and ligated into the xbai sites of both pcmv3 ( andersson et al ., 1989 , j . biol . chem . 264 : 8222 ) and pmmtv ( friedman et al ., 1989 , mol . cell . biol . 9 : 2303 ) generating the plasmids pcmv3gl - 1 and pmmtvgl - 1 , respectively . transcription of the gl gene is thus under the control of the cmv immediate early promoter in pcmv3gl - 1 and under the control of the inducible dexamethasone mouse mammary tumor virus promoter in pmmtvgl - 1 . transfection of cells . transient transfections were performed using calcium phosphate ( graham and van der eb , 1973 , virology 52 : 456 ). in co - transfection assays , 4 μg / well of plasmid was used ; for single plasmid transfections , 8 μg / well was used . at 42 hours post - transfection , cell supernatants were collected and assayed by immunoprecipitation and / or cells were harvested for immunofluorescence studies . immunoprecipitation and gel electrophoresis of proteins . at 18 hours post - transfection , l cells transfected with plasmid dna as described above were washed twice in dulbecco &# 39 ; s modified eagle medium lacking cysteine ( dmem / cys -; gibco brl ). the cells were incubated in dmem / cys - supplemented with 200 μci per well of 35 s - cysteine and 10 % fcs for 24 hours . cell supernatants were collected , centrifuged to remove any non - adherent cells and concentrated 10 - fold by centrifugation at 5520 × g for 1 hour in centricon - 10 concentrator tubes ( amicon , inc .). concentrated supernatants were treated with 1 mm each of nα - p - tosyl - l - lysine chloromethyl ketone ( tlck ) and n - tosyl - l - phenylalanine chloromethyl ketone ( tpck ) and were stored at - 20 ° c . for immunoprecipitation , supernatants were thawed and mixed with a buffer containing 10 mm tris - hcl , ph 8 . 0 , 100 mm nacl , 1 mm edta . 0 . 5 % noniodet p - 40 ( wt / vol ), and 0 . 25 % gelatin ( wt / vol ) . supernatants were incubated with 3 μl of either r83 or anti - gl serum and pansorbin staphylococcus aureus cells ( calbiochem ). following precipitation , immunoprecipitates were washed three times in high salt buffer ( 10 mm phosphate buffer , ph 7 . 2 , containing 0 . 65m nacl , 1 mm edta , 1 % triton x - 100 ) and once in low salt buffer ( 10 mm phosphate buffer , ph 7 . 2 , containing 0 . 15m nacl , 1 mm edta , 1 triton x - 100 ). the immunoprecipitates were then solubilized in dissolution buffer ( 100 tris hcl , ph 6 . 8 , 4 % sds , 0 . 2 % bromophenol blue , 20 % glycerol and 10 % β - mercaptoethanol ), and the proteins were resolved by sds - page under denaturing conditions as described ( cohen et al ., 1986 , j . virol . 60 : 157 ). proteins in the gel were fixed in a mixture of glacial acetic acid and methanol , the gel was impregnated with autofluor ( national diagnostics ) and was exposed to x - ray film at - 70 ° c . enzymatic treatment of cytoplasmic extracts and immunoprecipitates . cytoplasmic extracts were prepared from infected or transfected cells as described ( cohen et al ., 1986 , j . virol . 60 : 157 ). extracts were treated with 5 mu of endo - β - n - acetylglucosaminidase ( endo h ; boehringer mannheim biochemicals ) or 250 mu of endoglycosidase f / n - glycosidase f ( endo f ; boehringer mannheim biochemicals ) for 2 hours at 37 ° c . immunoprecipitates were eluted from pansorbin cells by boiling in buffer containing 0 . 1m sodium phosphate ( ph 7 . 5 ), 0 . 5 % β - mercaptoethanol and 0 . 1 % sds , and were diluted 2 - fold in 0 . 1 m sodium phosphate buffer containing 1 % octyl glucoside , 150 μm phenanthroline and 10 mm edta . samples were then treated for 2 hours at 37 ° c . with 5 mu of endo h or 250 mu of endo f . western blot analysis . following enzymatic treatment of cytoplasmic extracts , proteins were resolved by sds - page under denaturing conditions and transferred to a nylon membrane which was incubated in the presence of r82 . bound antibody was detected using goat anti - rabbit horseradish peroxidase conjugate ( boehringer mannheim biochemicals ) and a chemiluminesccent substrate solution ( new england nuclear ). the membrane was exposed at room temperature to kodak x ray film . immunofluorescence . to examine expression of gh and gl on the cell surface , cells transfected with plasmids expressing either protein were suspended in phosphate - buffered saline ( pbs ) containing 0 . 005m edta , washed by centrifugation and resuspended in pbs containing 1 % bovine serum albumin ( bsa ). the cells were incubated at 4 ° c . for 30 minutes in the presence of gh mab alone , anti - gl - 1 serum alone , or in the presence of both antibodies ( for double label immunofluorescence studies ). the cells were washed and further incubated in the presence of goat anti - mouse igg f ( ab &# 39 ;) 2 fluorescein - labeled conjugate ( to detect gh ) and / or goat anti - rabbit igg f ( ab &# 39 ;) 2 fluorescein - labeled or rhodamine - labeled conjugate ( to detect gl ). cells so stained were visualized using a leitz epifluorescence microscope . for double - label fluorescence studies , the same microscopic fields were viewed under fluorescein and rhodamine filters . additional immunofluorescence studies were performed on acetone fixed cells . transfected cells suspended in pbs containing 1 % bsa were allowed to adhere to glass microscope slides and were fixed in acetone prior to incubation in the presence of antibody and conjugate as described above . requirement of gl for normal processing of gh in transfected cells . normal processing of gh requires addition of n - linked carbohydrates to the nascent molecule ( buckmaster et al ., 1984 , virology 139 : 408 ). however , in the absence of other hsv - 1 glycoproteins , processing of gh is incomplete . in order to establish a definitive role for gl in processing of gh , gh produced in the presence or absence of gl was analyzed for sensitivity to endo h or endo f . treatment of incompletely processed glycoproteins with either enzyme results in cleavage of the carbohydrate moiety and a subsequent reduction in the molecular weight of the glycoprotein compared with the completely processed glycoprotein . glycoproteins which contain complex , fully processed carbohydrate moieties are resistant to cleavage by endo h , but remain sensitive to endo f . cytoplasmic extracts were prepared from cells which were either infected with hsv - 1 or were cotransfected with pcmv3gh - 1 and pcmv3gl - 1 , or simply transfected with pcmv3gh - 1 alone , which extracts were either subsequently untreated or were incubated in the presence of endo h and endo f . it is evident from the data presented in fig1 that gh exhibits sensitivity to both endo h and endo f when expressed in the absence of gl . in contrast , when gl is present either during infection or during cotransfection , the molecular weight of gh following endo h treatment is essentially unchanged indicating that gl is required for complete processing of gh in transfected cells . expression of gl is required for correct folding of gh . to determine whether gh is folded correctly in gl - negative cells , reactivity of gh with the conformation - dependent gh - mab , 53s , was examined by immunofluorescence . extracts of l cells transfected with pcmv3gh - 1 did not react with 53s ( fig2 a ), whereas extracts of cells transfected with both pcmv3gh - 1 and pcmv3gl - 1 exhibited strong reactivity ( fig2 b ). similar results were observed using lp11 , a gh mab which reacts with a distinct conformational phenotype of gh ( gompels et al ., 1991 , j . virol . 65 : 2393 ) . these results indicate that , in transfected cells , folding of gh is normal in the presence of gl but is abnormal in the absence of gl . expression of gl is required for intracellular transport and cell surface expression of gh in transfected cells . to examine the effect of expression of gl on intracellular transport and cell surface expression of gh , l cells were transfected with pcmv3gh - 1 either alone or in combination with pcmv3gl - 1 . the intracellular localization of gh in cells so transfected was assessed by immunofluorescence using the mab 37s , a mab which binds to gh irrespective of its structural conformation ( roberts et al ., 1991 , virology 184 : 609 ). in the absence of gl , the intracellular distribution of gh was cytoplasmic and included some perinuclear localization suggesting retention of this glycoprotein in the endoplasmic reticulum ( fig3 a ). however , in the presence of gl , gh was distributed throughout the cell in a uniform manner with some localization at the cell perimeter suggesting cell surface expression ( fig3 b ). to examine cells surface expression in more detail , these studies were repeated using unfixed cells . in this instance , gl was expressed from the dexamethasone - inducible plasmid pmmtvgl - 1 . thus , cells were cotransfected with pcmv3gh - 1 and pmmtvgl - 1 and were subsequently incubated either in the presence or absence of dexamethasone . cells so transfected were treated with the gh mab 37s , and with anti - gl serum , and were then stained with fluorescein - labeled conjugate ( to detect gh ) and rhodamine - labeled conjugate ( to detect gl ). in cells incubated in the presence of dexamethasone , both gh and gl co - localized to the cell surface ( fig4 a and b ) . this was also true when cells were cotransfected with pcmv3gh - 1 and pcmv3gl - 1 ( fig4 e and f ) . however , in the absence of dexamethasone , neither glycoprotein was found at the cell surface . thus , gl is required for intracellular processing of gh . membrane association of gl results from its association with gh . the predicted amino acid sequence of gl suggests that it is a secreted rather than a membrane associated glycoprotein ( mcgeoch et al ., 1988 , j . gen . virol . 69 : 1531 ). to investigate whether gl is capable of independent association with the cell membrane ( i . e ., in the absence of membrane association by gh ), gl was co - expressed with a mutant of gh , which mutant lacks the membrane spanning domain of the glycoprotein ( gh792 ). in cells transfected with a plasmid encoding gl , or with a plasmid encoding gl and the truncated form of gh , gl was not detected on the cell surface ( fig5 b and d ) ; however , in cells transfected with plasmids encoding gl and full length wild type gh , gl was detected on the cell surface ( fig5 f ). that gl was actually expressed in each of these sets of transfected cells was confirmed by immunofluorescence of permeabilized cells ( fig5 a , c and e ). these data demonstrate that cell surface expression of gl is dependent upon expression of wild type gh . secretion of gl . to examine secretion of gl from transfected cells , cells were transfected with the following combinations of plasmids : pcmv3gl - 1 alone ; pcmv3gl - 1 plus pcmv3gh ( 792 ); or , pcmv3gl - 1 plus pcmv3gh - 1 . in each instance , proteins synthesized by these cells were labeled with 35 - cysteine , they were extracted from the cell supernatants and were analyzed by immunoprecipitation using anti - gl serum . a 30 kda protein ( gl ) was identified in supernatants from cells transfected with pcmv3gl - 1 alone and in cells transfected with pcmv3gl - 1 plus pcmv3gh ( 792 ). this protein was not identified in supernatants from cells cotransfected with pcmv3gl - 1 and pcmv3gh - 1 ( fig6 ). a protein of 105 kda in size was also immunoprecipitated by anti - gl serum and by r83 ( anti - gh mab ) in cells cotransfected pcmv3gl - 1 plus pcmv3gh ( 792 ) suggesting that both gl and the truncated form of gh are secreted from these cells as a complex ( fig6 and 7 ). neither the 30 nor the 105 kda proteins were evident in supernatants from cells transfected with pcmv3gh ( 792 ) alone . thus , these experiments demonstrate that gl and gh are capable of forming a complex at the cell surface and that gl does not independently associate with the cell membrane , rather , its association with this membrane is dependent upon the presence of the membrane anchor portion of gh . the finding that gl is secreted from cells independent of gh was unexpected since previous studies suggested that processing of gl required the presence of gh ( hutchinson et al ., 1992 , j . virol . 66 : 2240 ). confirmation that gh is not required for processing of the carbohydrate moiety of gl . to further investigate the role of gh in processing of gl , cells were transfected with either pcmv3gl - 1 alone or were cotransfected with pcmv3gl - 1 and pcmv3gh ( 792 ) . supernatants were collected from cells so transfected and any gl present therein was examined for sensitivity to either endo h or endo f . the same pattern of enzyme sensitivity was evident irrespective of the presence or absence of gh ( fig8 ). therefore , gh is not required for either the addition or processing of n - linked carbohydrates on gl expressed in transfected cells . the region of gh required for complex formation with gl . as described above , coexpression of gl with the truncated form of gh gh ( 792 )! results in a complex comprising the two proteins , which complex is secreted from cells . to determine which domains of gh are required for complex formation , additional mutants of gh , expressing further truncated forms of this glycoprotein , were tested in the transfection assay described above . the mutants tested were as follows : gh ( 648 ), gh ( 475 ), and gh ( 102 ), each of which expresses a protein of 648 , 475 and 102 amino acids in length . the plasmids encoding these mutated forms of gh are designated psr124 ( 648 ), psr123 ( 475 ) and psr125 ( 102 ). each plasmid encodes the truncated form of gh under the control of the rous sarcoma virus promoter ( roberts et al ., 1991 , virology 184 : 609 ). cells were cotransfected with pcmv3gl - 1 and with one of the mutant plasmids described above and were incubated in medium containing 35 s - cysteine . at 18 hours post - transfection , cell supernatants were harvested and the proteins contained therein were immunoprecipitated with anti - gh serum as described above . immunoprecipitates were resolved by sds page and the results are shown in fig9 . mutant forms of gh which terminate at amino acid residues 792 , 648 and 475 were secreted from cotransfected cells in a complex with gl . however , when a mutant encoding only 102 amino acid residues of gh was used , a gh / gl complex was not detected in cell supernatants . additional experiments have been conducted in a similar manner to that described above and it is now believed that a region of gh comprising amino acids 1 - 324 and a region comprising amino acids 1 - 275 are capable of forming a complex with gl . thus , the region of gh required for interaction with gl resides in the amino - terminal portion of the molecule between residues 1 - 275 . as noted above , the membrane anchor region of gh resides in the carboxy terminus of the molecule between amino acid residue 792 and the last amino acid residue at the carboxy terminus . for the purposes of vaccine production , generation of a gh / gl complex in the cell lines described below has significant advantages over other methods of production of this complex which methods may involve for example , extraction of a gh / gl complex from infected cells . in the latter case , since wild type gh comprises a hydrophobic membrane anchor region , it is necessary to use detergents during extraction to remove the membrane portion . such treatment may in fact alter the conformation of the complex and thereby alter its immunogenic properties . by using the cell lines described below , a secreted form of gh is produced as a complex with gl and thus , further extraction and purification prior to use as a vaccine is minimized . in addition , the use of mammalian cells is advantageous in that both insect and lower eukaryotic cells each process carbohydrates somewhat differently than do mammalian cells . thus , the use of mammalian cells ensures correct processing of the components of the complex and thereby ensuring preservation of the immunologically protective epitopes within the complex . cell lines which constitutively express and secrete gh / gl as a complex were constructed as follows . l cells were cotransfected with pcmvgh ( 792 ) and pcmvgl - 1 and with the plasmid px343 which encodes a gene conferring resistance of cells to hygromycin b ( blochlinger et al ., 1984 , mol . cell . biol . 4 : 2929 ). cells so transfected were incubated in the presence of hygromycin b ( 200 μg / ml ). twenty four clones of hygromycin b resistant cells were selected and supernatants therefrom were first screened for production of gh by western blot analysis . of these , two clones were further tested for production of both gh and gl by immunoprecipitation . both of these clones expressed and secreted the gh / gl complex . one of these clones , designated hl - 7 , produced large amounts of the complex and was therefore selected for additional studies . the gh / gl complex secreted by hl - 7 cells was found to be immunoprecipitable by gh mabs 52s , 53s , and lp11 ( fig1 ). since these mabs are dependent upon correct folding of gh in that they react with distinct structural epitopes on the molecule , the gh / gl complex secreted by hl - 7 cells appears to have a structure similar to that of the wild type complex . purification of gh / gl complex from hl - 7 cells . preparations of gh / gl complex secreted from hl - 7 cells were purified by immunoaffinity chromatography using the gh - specific mab , 53s as follows . the mab was purified from mouse ascites using a protein a agarose column and was then covalently linked to a cyanogen bromide - activated sepharose 4b immunoadsorbant column at a concentration of approximately 4 mg of igg per ml of packed sepharose . to purify the gh / gl complex ( i ) hl - 7 supernatant was passed over the 53s affinity column to absorb the complex ; ( ii ) the column was washed with tris - hcl , ph 8 . 0 ; ( iii ) adsorbed proteins were eluted from the column in fractions using a 50 mm glycine buffer ( ph 2 . 5 ) containing 0 . 5 m nacl and 0 . 1 % triton x - 100 ; ( iv ) fractions so eluted were immediately neutralized with tris - hcl , ph 9 . 0 ; ( v ) fractions were analyzed by sds - page and proteins were visualized by silver staining to identify the gh / gl complex ; and , ( iv ) fractions which contained the complex were pooled and concentrated approximately 20 - fold in centricon - 10 concentrator tubes . to quantitate the amount of complex obtained in the concentrated samples , the intensity of staining of the gh and gl bands on sds - page was compared with known quantities of protein standard ( bovine serum albumin ). these data are presented in fig1 . it is estimated that each sample contained approximately 0 . 5 μg / gl of gh / gl complex . it is possible to purify 0 . 5 mg of gh / gl complex from approximately 1 liter of hl - 7 supernatant using the procedures described herein . further , densitometric analysis of the silver stained gel indicates that gh and gl are present in the complex at a purity of approximately 90 %. in addition , approximately 50 % of the gh / gl complex secreted from hl - 7 cells possess a conformation which is indistinguishable from that of the native molecule as assessed by binding to the 53s mab . identification of a putative membrane fusion region of gh . a computer - based analysis of the amino acid sequence of gh was performed and revealed a region of the protein predicted to form an amphophilic α - helix extending from approximately amino acid residues 280 - 310 , which helix is indicative of a membrane fusion region in influenza virus ( white , 1992 , science 258 : 917 ). a gh expression plasmid ( derived from pcmv3gh - l ) was constructed wherein amino acid residues 275 - 324 were deleted ( i . e ., the deleted amino acid residues encompass the putative membrane fusion region ) and a linker encoding 5 amino acids was inserted at the site of the deletion to re - establish the correct reading frame . the resulting gh mutant , pcmvghδ ( 275 - 324 ), encodes a protein which folds correctly and is transported to the cell surface when expressed in cells also expressing wild type gl . furthermore , this deleted gh retains the ability to form a complex with gl as assessed in the co - immunoprecipitation assay described above . the ability of the deleted gh to rescue a gh negative virus was determined in a complementation assay as follows . l cells were transiently transfected with pcmvgh - 1 or pcmvghδ ( 275 - 324 ), or were mock transfected . at 18 hours post - transfection , cells were infected with a gh negative mutant virus and incubation was continued for an additional 24 hours . the amount of virus produced was then assessed by plaque assay . cells transfected with pcmvgh - 1 produced 2 . 5 × 10 5 infectious virus per ml while mock transfected cells produced less than 1 . 5 × 10 2 virus per ml . cells which were transfected with pcmvghδ ( 275 - 324 ) also produced negligible amounts of infectious virus i . e ., less than 1 . 5 × 10 2 virus per ml , indicating that this plasmid was incapable of rescuing the gh negative phenotype exhibited by the gh negative virus . thus , deletion of gh in the region of amino acid residues 275 - 324 renders the protein non - functional . additional gh / gl complexes . based upon the experiments described herein , it is well within the skill of those in the art to take plasmids encoding hsv - 1 truncated gh and full length gl and introduce them into a mammalian cell such that the cells become stably transfected with these plasmids and are caused to express and secrete a soluble form of gh / gl complex as described herein . it is also well within the skill of those in the art to take yet other plasmids encoding gh and gl ( i . e ., dna obtained from other strains of hsv - 1 or various strains of hsv - 2 , vzv , ebv , cmv , hhv - 6 or hhv - 7 , which dna encodes gh and gl ) and generate cell lines which secrete soluble gh / gl complex following the teaching contained herein . further , the invention should not be construed to be limited to the particular method of introduction of herpesvirus dna into mammalian cells described herein . rather , other methods may be used to generate cells which express a soluble form of gh / gl complex . such methods include , but are not limited to , the use of retroviral and other viral vectors for delivery of herpesvirus - specific gh / gl encoding dna into cells and the use of other chemical means of transfection . in addition , the complex to be formed by cells encoding gh / gl may include a mixture of gh derived from one virus strain and gl derived from yet another virus strain . generation of such mixed complexes is accomplished using the protocols described above and other protocols available to virologists , described for example in sambrook et al . ( 1989 , molecular cloning : a laboratory manual , cold spring harbor , n . y .). immunization of mice with gh / gl . it has been possible to generate antibodies against the gh / gl complex in a mouse . a balb / c mouse was immunized at biweekly intervals with 5 doses of approximately 10 μg of gh / gl per dose . serum obtained from the mouse post - immunization contained a high titer of antibody which reacted with the complex in an elisa . thus , the purified complex is immunogenic in mice with regard to the humoral immune response . it is likely that a cellular immune response to the gh / gl complex may also play a role in the protective response to this complex . to determine the efficacy of the gh / gl complex as a vaccine , hl - 7 cell secreted gh / gl complex is administered intraperitoneally to mice using the ribi adjuvant system ( ras ; ribi immunochemical research , hamilton , mont . ), or other suitable adjuvant . both pre - and post - immune serum is obtained from the mice and the presence or absence of antibodies is determined in the standard assays described herein . the ability of anti - gh or gl antibodies to neutralize hsv is determined in a standard viral neutralization assay , such as but not limited to , a plaque reduction neutralization assay . mice are administered a range of concentrations of gh / gl complex from 0 . 1 to 20 μg per dose , using several different immunization schedules , i . e ., weekly , biweekly , in order to determine the optimum conditions for effective immunization of the mice against hsv . sera obtained from mice so immunized are tested for the ability to neutralize hsv - 1 strain ns ( that strain from which the complex is derived ) and other strains of both hsv - 1 and hsv - 2 in addition to other herpesviruses such as vzv , cmv , ebv , hhv - 6 and hhv - 7 . since the ability of an antibody to neutralize virus in culture is predictive of the protective activity of that antibody , neutralization of any one of the viruses listed above by antibody raised against hl - 7 cell secreted gh / gl is predictive of the ability of gh / gl complex to serve as a subunit vaccine candidate against that virus . to assess whether antibody raised against gh / gl protects mice against in vivo challenge with virus , immunized and non - immunized mice are administered various concentrations of virus intraperitoneally at a time post - immunization when peak antibody levels are apparent following the experiments described above . the number of immunized animals which survive challenge by virus is indicative of the efficacy of the gh / gl complex as a vaccine candidate . although these studies will be initially conducted using an intraperitoneal route , subsequent studies will involve all possible routes of administration including , but not limited to , intramuscular , subcutaneous and even oral routes of administration . in addition , these studies will be expanded to include other animal models for herpesvirus infections , such as guinea pigs . furthermore , studies may be conducted to examine viral latency in gh / gl immunized animals surviving virus challenge . such studies will be performed according to published protocols , such as that described by stanberry ( pathogenesis of herpes simplex virus infection and animal models for its study . in : current topics in microbiology and immunology , 179 : herpes simplex virus : pathogenesis and control , springer verlag ( berlin ), 1992 , pp 15 - 30 ). administration to humans . the gh / gl complex is administered to a human either subcutaneously , intramuscularly , orally , intravenously , intradermally , intranasally or intravaginally , the complex is first suspended in a pharmaceutically acceptable carrier which is suitable for the chosen route of administration and which will be readily apparent to those skilled in the art of vaccine preparation and administration . the dose of vaccine to be used may vary dependent upon any number of factors including the age of the individual and the route of administration . typically , the gh / gl complex is administered in a range of 1 μg to 50 mg of protein per dose . approximately 1 - 10 doses are administered to the individual at intervals ranging from once per week to once every few years . while this invention has been disclosed with reference to specific embodiments , it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit of the invention . the appended claims are intended to be construed to include all such embodiments and equivalent variations . __________________________________________________________________________sequence listing ( 1 ) general information :( iii ) number of sequences : 2 ( 2 ) information for seq id no : 1 :( i ) sequence characteristics :( a ) length : 29 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : dna ( genomic )( iii ) hypothetical : no ( iv ) anti - sense : no ( xi ) sequence description : seq id no : 1 : tgctctagagcgctatggggattttgggt29 ( 2 ) information for seq id no : 2 :( i ) sequence characteristics :( a ) length : 29 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : dna ( genomic )( iii ) hypothetical : no ( iv ) anti - sense : no ( xi ) sequence description : seq id no : 2 : tgctctagaggtttccgtcgaggcatcgt29__________________________________________________________________________	2
the components used and their interaction are explained below on the basis of fig1 through fig3 . first , the terminology used will be reviewed . a context object 6 contains a filtered data record from a database 7 , e . g ., a data bank , allowing access to information 8 and functions 9 . the context objects 6 are generated from the real context by context registering 21 , 22 . context manager 23 is the central element of the context navigator 30 and is used to manage the context objects 6 . the context manager 23 is responsible for new context objects 6 being transferred into context display 29 for the user 3 . granularity regulator 24 functions as an additional filter . the objects in the context display 29 are presented to the user 3 in the form of context - specific menus 20 . through references , the user 3 has the opportunity to activate a given instruction and thus generate a new context object 6 . [ 0023 ] fig1 gives an overview of the functioning of the context navigator 30 . there are basically two types of registering of context objects 6 : automatic and manual context registering . automatic context registering 21 generates context objects 6 when new objects in the real context are recognized by rough tracking 25 or by fine tracking 26 or by a workflow engine 27 . the context objects 6 thus generated are managed in the context manager 23 and are filtered through granularity regulator 24 . here the user 3 can select the “ resolution ” with which the system is to present him with context objects 6 ( e . g ., only major components vs . individual parts of subcomponents ). in a dialog , the user 3 can decide whether he wants to include the recognized object in his context display 29 . through manual context registering 22 , also known as user - guided context registering , the user 3 has an opportunity to generate in a controlled manner context objects 6 which are not currently being detected by the automatic system . the individual parts of the context navigator 30 will be discussed in greater detail below . context objects 6 differ in their properties with regard to type , whether they can be generated automatically , whether they are granulable ( scalable ) and which information 8 and functions 9 can be retrieved for them . four types of context objects 6 are to be differentiated ( see also table 1 ): room , work object , communication , workflow . the context display 29 may contain any number of context objects 6 of any types . all the displayed context objects 6 must be removed explicitly by the user 3 , but they differ in how they are included in the context display 29 . table 1 below gives an overview of the various types of context objects 6 , their specific properties and the respective information 8 and functions 9 . column a shows the respective types of context objects 6 , and column b shows the respective subtypes . columns c , d and e contain information about specific properties of the context objects 6 , namely whether they are generated automatically ( column c ), displayed automatically ( column d ) or are granulable ( column e ). column f lists the respective information 8 , and column g lists the respective functions 9 . the context of the user 3 is monitored continuously and checked for whether the system can offer specific information 8 or functions 9 . automatic context registering 21 monitors the data generated by rough tracking 25 and by fine tracking 26 as well as by the workflow engine 27 . as soon as the automatic context recording 21 registers a new object , it generates a context object 6 , which is received into the context manager 23 . new objects occur when , due to movement of the user 3 , the actual spatial context and / or viewing field of the user 3 changes or the workflow engine 27 specifies the next work step . automatic context recording 21 is also responsible for generating a reference for certain objects that can be used by the user 3 for manual context registering 22 . context can be registered manually if the user would like to retrieve , e . g ., information 8 about the neighboring room , a functionally related component , a certain person or a work sequence . manual input 31 , search function 32 and the selection of references 33 are used as input for manual context registering 22 . with manual input 31 , only the ( known ) component number and / or designation is entered ; then manual context registering 22 generates the corresponding context object 6 , which is transferred to the context manager 23 . when using the search function 32 , the context object 6 is generated as soon as the desired object has been found . the same thing also applies to the selection of references 33 . references are generated either in the context display 29 of a context object 6 or by automatic context registering 21 . they provide the user 3 with the option of making a selection , but the corresponding context object 6 is generated only when an explicit selection is made . references are presented to the user 3 as entries into the context - specific menus 20 or as a virtual mark (“ flag ”) on a real object . the user 3 can select a menu entry or a list entry , e . g ., on a touchscreen , with a rotary pushbutton or by voice . a flag on a component can be selected by fixing it for a certain period of time or by fixing and confirmation by pushing a button or by voice command . barcodes or labels that can be attached directly to components and can be read with a hand scanner , for example , are another type of references . the variable ( real ) context acts like a dynamic filter which is applied to the database 7 of the total available information 8 . the context manager 23 holds all the data that could be of interest to the respective user 3 at the given location and at the given point in time , while the context display 29 allows the user 3 access to the context objects 6 currently available . the context manager 23 manages the context objects 6 that are generated automatically or manually . depending on the application case and / or configuration , the system notifies the user 3 that he can retrieve context - specific content ( i . e ., if he wants to “ change the context ”) or it automatically presents this content to him . in any case , certain context objects 6 are automatically accepted into the current context and thus into the context display 29 without confirmation by the user 3 . in this way , the user 3 can directly retrieve the required information 8 ( e . g ., safety requirements for the room he has just entered ). with other context objects 6 , the user 3 is presented with a dialog in which he can decide whether he will accept the particular object into his context display 29 . the granularity regulator 24 functions as an upstream filter here . context objects 6 of a higher granularity than that selected are not presented to the user 3 . new objects are presented to the user 3 when the actual spatial context changes due to movement or when the granularity changes . for the user 3 , the current context objects 6 in the context display 29 are available at any time and can be selected directly . on a display device 1 which is designed as a hand - held display , for example , they appear as an object 28 in the bar at the lower edge of the display screen ( see fig3 ), or on a display device 1 in the form of a head - mounted display , they appear as a numbered object 34 in a vertical bar on the left edge of the display ( see fig4 ). each of the context - specific menus 20 selectable via the objects 28 , 34 contains three groups of entries : information 8 , functions 9 and the removal 35 of the object from the current context . although objects remain in the context display 29 until they are removed by the user 3 , the context manager 23 always contains only currently “ valid ” context objects 6 . for example , when an object is not displayed because of the granularity settings and it is no longer in the actual spatial context due to movement of the user 3 , this context object 6 is deleted automatically . context is basically subdivided into three levels : level 1 is the coarsest subdivision and level 3 is the finest . context can thus be determined and retrieved in different levels of granularity ( fineness ). in addition , there is a level 0 for characterizing objects which are displayed to the user in any case without demand . table 1 shows which types of objects can be influenced by the granularity settings ( i . e ., are “ granulable ”). when moving inside a building , individual rooms ( or subareas in large buildings ) represent the context units at level 1 . level 2 pertains to major components , and level 3 pertains to smaller ( sub -) components . the granularity is determined either automatically ( e . g ., according to workflow context ) or manually . [ 0031 ] fig5 through fig8 illustrate the functioning of the context navigator 30 . these do not represent visualizations of the actual user interface . they show the interaction of the context manager 23 , granularity regulator 24 and user dialog 36 for receiving context objects 6 into the context display 29 . not shown are the actual context registering 21 , 22 and the automatic display of level 0 objects . in fig5 the granularity has been set at level 1 , and thus the objects designated with reference notation 37 and 38 have been recognized . the left area in fig5 through fig8 illustrates the recognizable objects in the actual environment . the size and structuring characterize the assigned granularity . in the situation illustrated in fig6 the user 3 has moved , so that now an additional level 1 object ( reference number 39 ) has been detected by the automatic context registering 21 and has been generated as context object 6 . the change in granularity to level 2 ( fig7 ) results in additional objects ( reference numbers 40 , 41 and 42 ) again being offered in the user dialog 36 . it should be noted that with a higher granularity , the selection range 43 monitored by the context manager 23 is reduced to keep the quantity of objects recognized within a manageable range . in the example , this results in the object which is labeled with reference number 39 no longer being detected by the context manager . finally , in the situation illustrated in fig8 the granularity has been further refined . the objects labeled with reference numbers 44 and 45 in the context manager 23 appear as new objects , while the object labeled with reference number 40 is deleted . however , when objects in context manager 23 are no longer detected in context manager 23 ( due to movement or due to a change in granularity with a subsequently restricted range of vision ), they disappear only from the “ offering ” made by the context manager 23 to the user 3 . all the objects in the context display 29 remain there until the user 3 removes them manually ( regardless of the content currently in the context manager 23 ). the notes function is not an actual component of context navigator 30 , but it is included here because notes 46 involve content , where the context relevance plays a major role . the user 3 can make notes 46 on any objects at any point in time . notes 46 already acquired are retrievable at any time , either as a “ context - free ” acquisition via a general search list or as a context - specific acquisition , directly via context - specific menus 20 . notes 46 are subdivided into three classes and can be characterized by the user 3 accordingly at the time of creation : private notes 46 can be retrieved only by the user 3 who created them . public notes 46 are accessible for all users 3 . notes 46 relevant to data maintenance characterize instructions for required corrections to or changes in the database . in another exemplary embodiment , fig9 shows as user 3 of the context navigator 30 a service technician who is performing a vibration measurement on the spindle on machine xb420 ( labeled with reference number 4 ). he is receiving information via a display device 1 ( user interface ) of his mobile computer system 2 . he is using a tracking system 5 . [ 0034 ] fig1 shows a diagram of the display device 1 at this point in time . fig1 through fig2 show corresponding diagrams of the display device 1 in other steps . at the beginning , the user 3 is in the main context “ machine xb 420 ” ( shown by button 10 in taskbar 14 ), i . e ., all the data ( e . g ., machine documentation , error history , etc .) that can be retrieved with button 12 in the main menu , for example , is based on this machine 4 . the navigation options 11 which are also displayed remain the same over all contexts . the current job context of the user 3 is the vibration measurement at the moment ( symbolized by the button labeled with reference number 13 ). the process of calling up the main menu is illustrated in fig1 through fig1 . with the help of the corresponding button 10 , the user 3 selects the main context ( see fig1 ). in the next step , he calls up the menu 15 for the main context with the button 12 provided for this ( fig1 ). this menu 15 is shown in fig1 . all the entries in this menu 15 are based on the current main context . instead of the machine and the job context , a room or a certain component of a machine is also conceivable as a context that is potentially detectable by the tracking system 5 . [ 0035 ] fig1 through fig2 show diagrams of the display device 1 for the case when a change in the context object 6 is induced by external information and / or an external event . an error occurs on another machine . the error is relayed to the mobile computer system 2 of the user 3 , whereupon the current context object 16 changes , namely , to the faulty machine having the designation xhc 241 ( see fig1 ). all relevant retrievable information is now based on this machine , but the previous context objects selectable via buttons 10 , 13 are still represented in taskbar 14 and can also be activated . in the scenario just described , the context changes due to an event ( the error ). however , it is also conceivable for the user 3 to leave the first machine 4 and to approach another , for the tracking system 5 to detect this and for the new context object 16 to be registered in this way . the user 3 wants to view information 17 about the error . through context registering , the information system filters for him the information 17 relevant for the current context ( see fig1 ). this information is the result of a database query , filtered through a fitting context query for the main context object . in the next step , the user 3 wants to order replacement parts for the faulty machine . he activates the context object 16 “ machine ” ( see fig1 ) and calls up the main menu with the corresponding button 19 ( see fig1 ). the context - specific menu 20 ( see fig1 ) is now based on the context object 16 of the machine xhc 241 as the new main context . fig2 shows the displayed list 18 of the replacement parts . the user 3 can thus manage a variety of information without having to conduct a lengthy search and / or having to overload his user interface . therefore , he uses the dynamic and context - dependent display surface 1 described here and information systems for mobile computing , such as the context navigator 30 . a variety of technologies and information are available today to support the user 3 in tasks involved in service , maintenance and preduction . the decisive step represented by the context navigator 30 is based largely on the innovation of integrating the various available technologies and standardization of information access in a manner that actively supports the user 3 . technologies such as ar tracking and workflow management systems offer a great potential for user - friendly access to information 8 and functions 9 through context acquisition in a manner consistent with demand . the context navigator 30 ensures rapid , intuitive and user - friendly navigation and orientation in the information space and in actual space through the design and structuring of the user interface . in summary , the present invention thus relates to a system and a method of representing information as well as a computer program product for implementing the method , which will improve the acquisition of information 8 and functions 9 from a database 7 from the standpoint of making it user friendly . this system for representing information contains a display device 1 for displaying information 8 and functions 9 that are retrieved as a function of a context of a user 3 . the above description of the preferred embodiments has been given by way of example . from the disclosure given , those skilled in the art will not only understand the present invention and its attendant advantages , but will also find apparent various changes and modifications to the structures and methods disclosed . it is sought , therefore , to cover all such changes and modifications as fall within the spirit and scope of the invention , as defined by the appended claims , and equivalents thereof .	6
the plant illustrated in fig1 and 2 has a carbon molecular sieve section comprising two adsorbent beds c1 and c2 and a zeolite molecular sieve section comprising two adsorbent beds z1 and z2 . a first pump p1 serves the purpose of evacuating the beds of the carbon sieve section at the appropriate stages of their operating cycles and delivering the desorbed components to gas holders g1 and g2 as more fully described below . a second pump p2 serves the purpose of drawing the feedstock for the zeolite sieve section through its beds z1 and z2 at the appropriate stages of their operating cycles and delivering the high purity oxygen product through the outlet line l1 . a third pump p3 serves the purpose of evacuating the beds of the zeolite sieve section and passing the feedstock for the carbon sieve section through its beds c1 and c2 at the appropriate stages of the operating cycles of the beds . with reference to fig2 and 3 , the operation of the plant is as follows . dealing first with the carbon sieve section , valves v1 , v3 , and v21 open so that pump p3 draws in feed air , which is pretreated in an adsorbent bed b to remove carbon dioxide and moisture , and passes the air through bed c1 of the carbon sieve section where oxygen is preferentially adsorbed . the unadsorbed gas , largely nitrogen and argon , passes out of the plant to waste via line l2 . after a predetermined time period valve v21 closes and valve v20 opens so that an oxygen rich gas drawn from gas holder g2 passes through bed c1 purging out air from the interstices of the bed and providing more oxygen for adsorption by the carbon sieve . after another predetermined time period valve v20 closes and v19 opens ( as also does valve v16 ) so that the pump p3 begins to evacuate bed z2 of the zeolite section and passes the desorbed gas from that bed , which also has an enhanced proportion of oxygen in comparison with the original air feedstock , through bed c1 . valves v1 , v3 and v19 then close , valve v5 opens , and bed c1 goes on to its evacuation ( desorption ) step . with the mode of operation proposed , the proportion of oxygen in the gas evacuated from the bed c1 by pump p1 gradually rises to a peak and then decreases again . during the middle part of the evacuation step valve v17 is open so that the desorbed gas is fed to gas holder g1 for use as feedstock for the zeolite section . the proportion of oxygen in this stream averages about 80 % with the balance being nitrogen and argon approximately in their atmospheric ratio , i . e . about 19 . 75 % nitrogen and 0 . 25 % argon . during the other parts of the evacuation step the valve v18 is open so that the desorbed gas is fed to gas holder g2 for eventual recycling to the carbon sieve section . the proportion of oxygen in this stream averages about 50 % with the balance again being nitrogen and argon approximately in the atmospheric ratio , i . e . about 49 . 4 % nitrogen and 0 . 6 % argon . at the end of the evacuation step for bed c1 , valve v5 closes , valves v1 , v3 and v21 reopen , and the whole cycle of operation is repeated . it will be appreciated that bed c3 of the carbon sieve section undergoes a similar cycle to bed c1 but sequenced to be out of phase by 180 ° with the bed c1 . in other words while bed c1 is undergoing its feed step bed c2 is undergoing its evacuation step , and vice versa . turning now to the zeolite sieve section , valves v9 and v11 open so that pump p2 draws gas from gas holder g1 through bed z1 and delivers the product obtained from that bed through outlet line l1 . it will be remembered that gas holder g1 contains the middle cut product from the carbon sieve section which is enriched in oxygen and depleted in nitrogen and argon . the remaining nitrogen in this mixture is adsorbed in bed z1 to leave an oxygen product with a purity up to 99 . 7 %, the balance being the small amount of argon passed from the carbon sieve section . after a predetermined delay valves v9 and v11 close and valves v15 and v19 open so that pump p3 evacuates bed z1 and passes the desorbed gas to the carbon sieve section , where bed c2 is on its feed step at this time . by virtue of the enhanced oxygen content of the feedstock passed through bed z1 the gas evacuated from that bed will also have an oxygen content in excess of the atmospheric proportion and the gas is therefore useful as additional purge / feed gas for the carbon sieve section . to complete the cycle of operation for bed z1 valves v15 and v19 close and valve v13 opens to allow the bed to backfill with product quality gas withdrawn from bed z2 , via a permanently open throttle valve v22 set to permit the desired flow of backfill gas . valves v9 and v11 then reopen and the whole cycle of operation is repeated . it will be appreciated that bed z2 of the zeolite sieve section undergoes a similar cycle to bed z1 but sequenced to be out of phase by 180 ° with bed z1 . in other words when bed z1 is undergoing its feed step bed z2 is undergoing its evacuation and backfilling steps , and vice versa . it will also be appreciated that the cycle times for the beds in the zeolite sieve section are exactly the same as for the beds in the carbon sieve section but , as indicated in fig3 the cycles are suitably out of phase to achieve the required integration of the carbon and zeolite sieve processes . in particular , the sequencing of the cycles is such as to allow pump p3 to perform its dual function of evacuating the beds of the zeolite section and feeding the beds of the carbon section , so that the plant requires a total of only three pumps ; normally two pumps are needed for each section so that running the two processes separately would require the provision of four pumps . a valuable power saving in running the integrated process is thereby achieved in addition to the increased oxygen purity obtained . to assist in the understanding of the process the proportions of oxygen , nitrogen and argon in gas holders g1 and g2 and in outlet line l1 are marked on fig1 . the ratio of oxygen to argon at other parts of the plant are also marked , the figure indicated for the line from pump p3 to the carbon sieve section representing the average of the three different feed / purge streams passed to that section . with minor modification this process can be operated without the pre - treatment bed b , i . e . with feed air containing carbon dioxide and moisture . a proportion of the carbon dioxide and moisture in the air fed to the carbon sieve section will pass out to waste via line l2 , but the rest will be adsorbed and passed to the gas holders g1 and g2 during the evacuation steps of the beds . that fed to g1 will subsequently be adsorbed in the zeolite sieve section and contamination of the oxygen product with carbon dioxide and moisture can be effectively precluded by passing a proportion of the gas evacuated from the zeolite section out to waste via line l3 indicated in fig1 and / or passing some or all of the 50 % oxygen cut evacuated from the carbon sieve section out to waste via line l4 indicated in fig1 . the effect of these modifications is to reduce the equipment needed by omitting the adsorbent bed b , but at the expense of a certain amount of product gas . the plant illustrated in fig4 and 5 has a zeolite molecular sieve section comprising two adsorbent beds z1 &# 39 ; and z2 &# 39 ; and a carbon molecular sieve section comprising two adsorbent beds c1 &# 39 ; and c2 &# 39 ;. a pump p1 &# 39 ; serves the purpose of drawing the feedstock for the zeolite section through its beds z1 &# 39 ; and z2 &# 39 ; and delivering the unadsorbed gas obtained to a gas holder g1 &# 39 ; thereby to act as feedstock for the beds c1 &# 39 ; and c2 &# 39 ; of the carbon section at the appropriate stages of the operating cycles of the beds . a second pump p2 &# 39 ; serves the purpose of evacuating the beds of the zeolite section during he appropriate stages of their operating cycles and a third pump p3 &# 39 ; serves the purpose of evacuating the beds of the carbon section , delivering the high purity oxygen product through the outlet line l1 &# 39 ; and recycling a portion of the desorbed gas back to the carbon section via a gas holder g2 &# 39 ;, as more fully described below . with reference to fig5 and 6 , the operation of the plant is as follows . dealing first with the zeolite sieve section , valves v1 &# 39 ; and v5 &# 39 ; open so that pump p1 &# 39 ; draws feedstock through bed z1 &# 39 ; and delivers the product obtained from that bed to the gas holder g1 &# 39 ;. during an initial part of the feed step for bed z1 &# 39 ; valve v22 &# 39 ; is open so that the feedstock comprises an oxygen rich gas recycled from the carbon section , thereafter valve v22 &# 39 ; closing and valve v24 &# 39 ; opening to admit atmospheric air as the feedstock . the air need not be pretreated to remove carbon dioxide and moisture as these components are adsorbed on the zeolite bed along with the major proportion of the nitrogen present in the feedstock , and subsequently passed out to waste . the composition of the gas fed to the gas holder g1 &# 39 ; is approximately 90 % oxygen , 5 % nitrogen and 5 % argon , the latter component being substantially unadsorbed by the zeolite bed . after a predetermined time period valves v1 &# 39 ; and v5 &# 39 ; close and valve v3 &# 39 ; opens so that pump p2 &# 39 ; evacuates bed z1 &# 39 ; and passes the desorbed gas out to waste via line l2 &# 39 ;. to complete the cycle of operation for bed z1 &# 39 ; valve v3 &# 39 ; closes and valve v7 &# 39 ; opens to allow the bed to backfill with the oxygen enriched gas being withdrawn from bed z2 &# 39 ;, via a permanently open throttle valve v23 &# 39 ; set to permit the desired flow of backfill gas . valves v1 &# 39 ; and v5 &# 39 ; then reopen and the whole cycle of operation is repeated . as before it will be appreciated that bed z2 &# 39 ; of the zeolite sieve section undergoes a similar cycle to bed z1 &# 39 ; but sequenced to be out of phase by 180 ° with bed z1 &# 39 ; so that when the first bed is undergoing its feedstep the second bed is undergoing its evacuation and backfilling steps and vice versa . turning now to the carbon sieve section , valves v9 &# 39 ; and v15 &# 39 ; open so that the oxygen enriched gas obtained from the zeolite sieve section passes from gas holder g1 &# 39 ; through bed c1 &# 39 ; where the oxygen is preferentially absorbed . after a predetermined time period , valve 9 &# 39 ; closes and valve v11 &# 39 ; opens , with valve v15 &# 39 ; remaining open , so that an oxygen rich , argon depleted gas from gas holder g2 &# 39 ; passes to bed c1 &# 39 ;. during the initial part of this combined feeding step for bed c1 &# 39 ; valve v21 &# 39 ; is opened so that the unadsorbed gas which passes through the bed , being rich in nitrogen and argon , is passed out to waste via line l3 &# 39 ;. during the final part of the feed step , however , after the feed source has been changed over to gas holder g2 &# 39 ;, the proportion of argon in the stream issuing from bed c1 &# 39 ; decreases and the proportion of oxygen increases . accordingly valve v21 &# 39 ; is closed and valve v22 is opened to recycle this oxygen rich gas back to the zeolite sieve section , where bed z2 &# 39 ; has just commenced its feed step . valves v11 &# 39 ;, v15 &# 39 ; and v22 &# 39 ; then close , valve v13 &# 39 ; opens , and bed c1 &# 39 ; goes on to its evacuation ( desorption ) step . with the mode of operation proposed the purity of the oxygen product desorbed from bed c1 &# 39 ; by pump p3 &# 39 ; gradually rises to a peak and then decreases again . thus during the middle part of the evacuation step valve v20 is open so that the desorbed gas passes out through product supply line l1 &# 39 ;. during the other parts of the evacuation step valve v19 &# 39 ; is open so that the desorbed oxygen rich gas is fed to gas holder g2 &# 39 ; for recycling to the carbon sieve section as required . at the end of the evacuation step for bed c1 &# 39 ; valve v19 &# 39 ; closes , valves v9 &# 39 ; and v15 &# 39 ; reopen , and the whole cycle of operation is repeated . once again it will be appreciated that bed c2 &# 39 ; of the carbon sieve section undergoes a similar cycle to bed c1 &# 39 ; but sequenced to be out of phase by 180 ° with bed c1 &# 39 ;, so that while the first bed is undergoing its feed step the second bed is undergoing its evacuation step , and vice versa . also the cycle times for the beds in the carbon sieve section are exactly the same as for the beds in the zeolite sieve section but , as indicated in fig6 the cycles are suitably out of phase to achieve the required integration of the zeolite and carbon sieve processes . in particular , the sequencing of the cycles is such as to give the maximum benefits to the zeolite section from the use of recycle gas from the carbon section , i . e . it is fed in at the beginning of the respective feed steps for beds z1 &# 39 ; and z2 &# 39 ;. again , the plant requires a total of only three pumps whereas each section operating alone would require two pumps to give a total of four . to assist in the understanding of the process the ratio of oxygen to argon at various parts of the plant are marked on fig4 .	2
as discussed above , embodiments of the present invention relate to a wheelbarrow device and more particularly to a fold - away wheelbarrow as used to reduce the storage footprint when placed in an in - storage condition . referring generally to the present invention , the fold - away wheelbarrow is designed to assist users in transporting heavy loads and then folds down into a compact unit for easy storage . fold - away wheelbarrow of the present invention provides consumers with a more compact wheelbarrow design with hinges for easier storage . this novel device is ideal for consumers that may not have a garage or a shed or be otherwise limited in storage space because its slim design can be tucked away in a utility closet or hung on a wall between uses . further , the wheelbarrow comprises various features such as a swinging front panel door that may rotate open making it ideal for men , women and children who are looking for a simpler method of transporting and unloading items . in certain embodiments this wheelbarrow may be constructed out of heavy - duty plastic or other lightweight but suitably durable material ( s ). handles may also be hinged thereby enabling them to fold inwardly for storage . also , on the underside of the belly pan may be a wheel located in the front and two legs located in the back useful during transporting and resting conditions , respectively . for storage , the wheel may swivel - rotate and the legs fold under to provide a compact profile . referring now to the drawings by numerals of reference there is shown in fig1 , a perspective view illustrating fold - away wheelbarrow 110 of fold - away wheelbarrow system 100 in an in - use condition 150 according to an embodiment of the present invention . fold - away wheelbarrow 110 within this particular embodiment shown comprises : at least one body 120 having at least one inner volume 130 . inner volume 130 is defined by bottom planar surface 132 ; front planar surface 134 ; rear planar surface 136 ; first side planar surface 138 ; and second side planar surface 140 . inner volume 130 comprises the general shape of a rectangular parallelepiped devoid a top - surface . no top - surface is present making the present invention easy to fill , however in certain embodiments a hinged lid may be used for transport of materials that may need protection from environmental elements . upon reading this specification , it should be appreciated that , under appropriate circumstances , considering such issues as user preferences , design preference , structural requirements , marketing preferences , cost , available materials , technological advances , etc ., other inner volume shapes and arrangements such as , for example , cubed - square , oval , etc ., may be sufficient . fold - away wheelbarrow 110 may also comprise a plurality of hinges 160 to provide a pinned - hinging means whereby front planar surface 134 ; rear planar surface 136 ; first side planar surface 138 ; and second side planar surface 140 are movable in relation to each other . fold - away wheelbarrow 110 may also comprise at least one wheel 170 mounted on fork - mounted axle 180 to provide a rollable transport means whereby a load may be efficiently carried via a levering means . fold - away wheelbarrow 110 is preferably carried by fork - mounted axle 180 designed to distribute a carried - weight - load between wheel 170 and the operator , thereby enabling convenient carriage of the carried - weight - load by the operator . in this way fold - away wheelbarrow 110 comprises an efficient second - class lever means whereby strain of the operator while moving loads is greatly reduced . fold - away wheelbarrow 110 may further comprise at least one lower frame 190 ; and handle - stand 210 . body 120 is preferably mounted on lower frame 190 to provide a structural means whereby body 120 is suitably strengthened and supported . in this way fold - away wheelbarrow 110 is able to carry a substantial load . handle - stand 210 provides a lifter ( hand - grippable lifting means ) whereby an operator may manipulate fold - away wheelbarrow 110 during a load - moving period ( as shown in the present figure ) and handle - stand 210 provides a rester while in a stationary position , as shown in fig2 . fold - away wheelbarrow 110 preferably comprises plastic within the embodiment shown , thereby providing a lightweight construction ( for hanging and pushing ). upon reading this specification , it should be appreciated that , under appropriate circumstances , considering such issues as user preferences , design preference , structural requirements , marketing preferences , cost , available materials , technological advances , etc ., other structural materials such as , for example , composites , ferrous or non - ferrous materials , alloyed elements , etc ., may be sufficient . as shown in the present figure fold - away wheelbarrow 110 comprises front planar surface 134 which is rotatable about / via hinge 160 such that front planar surface 134 comes into a parallel relationship adjacent first side planar surface 138 and away from second planar surface 140 . when front planar surface 134 comes into a parallel relationship adjacent first side planar surface 138 an unimpeded dumping side is thereby provided , as shown . in this way the present invention is easy to unload ( dump ), thereby providing convenience for the operator . referring now to fig2 , a perspective view illustrating fold - away wheelbarrow 110 in an at - rest stationary condition 200 according to an embodiment of the present invention of fig1 . fold - away wheelbarrow 110 as stated previously comprises bottom planar surface 132 ; front planar surface 134 ; rear planar surface 136 ; first side planar surface 138 ; and second side planar surface 140 comprises a lidless box profile when in at least one load - moving period . front planar surface 134 is adjacent and perpendicularly relationally removably connected to first side planar surface 138 and second side planar surface 140 is adjacent and perpendicularly relationally removably connected to rear planar surface 136 when in a load - moving period . hinges 160 are located on at least one edge of front planar surface 134 ; rear planar surface 136 ; first side planar surface 138 ; and second side planar surface 140 such that front planar surface 134 ; rear planar surface 136 ; first side planar surface 138 ; and second side planar surface 140 are able to be relationally - rotatably manipulated . it should be appreciated that hinges 160 may be suitably connected to other portions to provide the desired folding / using actions . bottom planar surface 132 preferably comprises a flat - bottom belly pan measuring approximately 3 feet wide by 3 feet long , two sloping slides 3 feet long and 1 foot high ( near the handles — handle - stand 210 ) and 1½ feet tall near front planar surface 134 ( the front panel ). the front and back panels ( front planar surface 134 and rear planar surface 136 , respectively ) may measure 1½ feet tall and 2 feet 11½ inches long . all components of body 120 may be approximately ¼ inch thick to keep the device suitably light , yet sufficiently durable . two metal handles ( handle - stand 210 ) may be secured to the underside of body 120 running 1½ feet along the underside of bottom planar surface 132 and protruding outwardly about 2 feet for easy usability ( thereby increasing effective lever length ). in certain embodiments the lengths , widths , heights may be different according to user / manufacturer preference . relatively speaking , bottom planar surface 132 is adjacent front planar surface 134 ; rear planar surface 136 ; first side planar surface 138 ; and second side planar surface 140 at perpendicular orientations . front planar surface 134 is opposed to rear planar surface 136 ; first side planar surface 138 is opposed to second side planar surface 140 when in the load - moving period , thereby creating a substantially rectangular parallelepiped ( not including a lid portion ) for effectively enclosing / holding materials being transported within fold - away wheelbarrow 110 . in this way the present invention comprises a structurally secure form . referring now to fig3 - 5 , showing perspective views illustrating fold - away wheelbarrow 110 in a folded storage - ready condition according to an embodiment of the present invention of fig1 . fig4 a specifically shows a perspective view illustrating the relative rotation of front planar surface 134 of body 120 of fold - away wheelbarrow 110 , fig4 b is a perspective view of handle - stand 210 as rotated into a storage ready condition according to an embodiment of the present invention as shown in fig3 , fig4 c illustrating a perspective view of fork - mounted axle 180 and wheel 170 front - swivelly - mounted to lower frame 190 of fold - away wheelbarrow 110 according to an embodiment of the present invention as shown in fig1 - 3 . fig5 is a perspective view illustrating fold - away wheelbarrow 110 of fold - away wheelbarrow system 100 in a storage condition . fork - mounted wheel 182 ( assembly of wheel 170 and fork - mounted axle 180 ) is preferably front - swivelly - mounted to lower frame 190 . lower frame 190 comprises a wishbone profile in this particular embodiment . upon reading this specification , it should be appreciated that , under appropriate circumstances , considering such issues as user preferences , design preference , structural requirements , marketing preferences , cost , available materials , technological advances , etc ., other framing arrangements such as , for example , boxed , linear , non - linear , etc ., may be sufficient . handle - stand 210 is rotatable about a centerline axis between an in - use condition and a storage condition . fold - away wheelbarrow 110 to be relationally - rotatably manipulated such that fold - away wheelbarrow 110 is foldable . fold - away wheelbarrow 110 is able to be folded into a flat profile to provide a suitable storage condition . handle - stand 210 preferably comprises two hand - grippable handles in the particular embodiment shown . in other embodiment handle - stand 210 may comprise one or multiple hand - grippable handles . further , handle - stand 210 may comprise a u - shaped stand , as shown , thereby providing greater surface contact area between handle - stand 210 and ground , thereby enabling larger loads to be carried and rested by fold - away wheelbarrow 110 without sinking into a ground surface . within the particular embodiment shown handle - stand 210 preferably comprises two hand - grippable handles and a u - shaped stand rotatable in relation to each other , forming an assembly that is both functional while using and may be easily folded into a storage condition . in this way the present invention occupies a smaller footprint of storage space . a method for using a fold - away wheelbarrow 110 may comprise the steps of : step one unfolding fold - away wheelbarrow 110 into an in - use condition ; step two receiving a carried - weight - load ; step three carrying the carried - weight - load using fold - away wheelbarrow 110 as a second - class lever ; step four rotating a front planar surface 134 into a parallel relationship adjacent first side planar surface 138 and away from second planar surface 140 to provide an unimpeded dumping side ; and step five unloading the carried - weight - load . the method may further comprise the step six of folding fold - away wheelbarrow 110 into a storage profile . it should be noted that steps four and five are optional steps and may not be implemented in all cases . it should also be noted that the steps described in the method of use can be carried out in many different orders according to user preference . upon reading this specification , it should be appreciated that , under appropriate circumstances , considering such issues as design preference , user preferences , marketing preferences , cost , structural requirements , available materials , technological advances , etc ., other methods of use arrangements such as , for example , different orders within above - mentioned list , elimination or addition of certain steps , including or excluding certain maintenance steps , etc ., may be sufficient . the embodiments of the invention described herein are exemplary and numerous modifications , variations and rearrangements can be readily envisioned to achieve substantially equivalent results , all of which are intended to be embraced within the spirit and scope of the invention . further , the purpose of the foregoing abstract is to enable the u . s . patent and trademark office and the public generally , and especially the scientist , engineers and practitioners in the art who are not familiar with patent or legal terms or phraseology , to determine quickly from a cursory inspection the nature and essence of the technical disclosure of the application .	1
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . a digital cable broadcast under an open cable and a cable ready standards observes an atsc standard . therefore , the caption_service_descriptor the eit or the pmt within the psip , included in the digital cable broadcast signal is prescribed by the atsc standard ( a65 , program and system information protocol for terrestrial broadcast and cable ). fig2 is a view showing a syntax of the caption_service_descriptor under the open cable and the cable ready standards according to the present invention . “ descriptor_tag ”, which is a parameter for checking a type of a descriptor , is described by 8 bits . “ descriptor_length ”, which is a parameter representing a length of the whole structure , is described by 8 bits . “ number_of_services ” represents a number of provided caption services and is described by 5 bits . “ language ” represents language information of a relevant caption , such as english for a service 1 and spanish for a service 2 , and is a 3 - byte language code under iso 639 . 2 / b , each letter of which is coded with 8 bits and inserted into a 24 - bit field . “ cc_type ” represents a kind of caption . if cc_type == 1 , it is a digital caption ( advanced caption ) and if cc_type == 0 , it is an analog caption ( analog caption under the eia 708 or the scte 20 ( dvs 157 )). the “ cc_type ” is described by 1 bit . “ analog_cc_type ” represents a kind of an analog caption . if analog_cc_type == 1 , it means caption data transmitted through a line 21 of the vbi under the eia 708 , and if analog_cc_type == 0 , it means caption data transmitted through other line except the line 21 of the vbi according to the scte 20 or the dvs 157 . “ line_offset ” represents a number of the vbi line including the caption data in case caption data under the scte 20 or the dvs 157 is transmitted , namely , in case the analog_cc_type == 0 , and is described by 5 bits . “ line_field ” represents whether the caption data is included in an even field or an odd field . that is , if line_field == 0 , it means the caption data is included in an odd field and if line_field == 1 , it means the caption data is included in an even field . “ caption_service_number ” represents 1 - 63 caption service numbers in case it is a digital caption , namely , in case cc_type == 1 . and is described by 6 bits . “ easy_reader ” is a flag representing whether it is a caption easily read by a user or not . “ wide_aspect_ratio ” is related to a screen ratio , and more particularly , is a flag representing whether a received caption data is intended for a 16 : 9 screen or not . if cc_type == 0 , a received caption is an analog caption . as described above , for the analog caption , there exist an analog caption under the eia 708 standard , and an analog caption under the scte 20 or the dvs 157 standard . however , since the analog caption under the eia 608 standard is a pure analog caption , not a closed caption for a digital tv mentioned in the present invention , the analog caption under the eia 608 standard is excluded . therefore , an analog caption for the case cc_type == 0 , is either an analog caption under the eia 708 standard or an analog caption under the scte 20 or the dvs 157 standard . “ analog_cc_type ” represents whether a received caption is an analog caption under the eia 708 standard or an analog caption under the scte 20 or the dvs 157 standard . if analog_cc_type == 0 , it means that the relevant caption is included in a video data region in form of user data under the scte 20 or the dvs 157 , which are standards on the digital cable broadcast . in that case , since to which line of the vbi the received caption is assigned , is not known in view of characteristics of the cable broadcast , the line_offset describes to which line of the vbi the received caption is included . if analog_cc_type == 1 , it means that an analog caption under the eia 708 standard is included in a video data region in form of user data . in that case , since the caption is assigned to a 21 st line of the vbi , a line_offset value is not required . therefore , 5 bits assigned to the line_offset becomes a reserved bit and 1 bit is assigned to the line_field representing whether a caption is a caption included in an even field or a caption included in an odd field . if line_field == 0 , it means a caption is included in an odd field and if line_field == 1 , it means a caption is included in an even field . as described above , whether a caption included in the digital cable broadcast is an analog caption or a digital caption is judged on the basis of information included in the caption_service_descriptor . further , if the received caption is an analog caption , whether the caption is an analog caption under the eia 708 standard or a caption for a cable broadcast under the scte 20 or the dvs 157 standard , is judged . if the received caption is a caption under the scte 20 or the dvs 157 standard , in which line of the vbi the caption data is included , is judged . if the received caption is a digital caption , information as to which service the caption includes among sixty - three services , is checked . a broadcast station generates caption information including the above described various information and adds the caption information to a broadcast signal . a broadcast receiver detects caption information included in a broadcast signal provided from the broadcast station , and judges various characteristics of the received caption data on the basis of parameter values included in the detected caption information . fig3 is a block diagram illustrating a construction of a digital broadcast receiver according to the present invention . referring to fig3 , a mpeg demultiplexer 501 receives a mpeg - 2 transport stream from a cable and decodes the transport stream so as to extract video data , audio data , and supplementary information . further , the mpeg demultiplexer 501 detects an eit and a pmt included in the supplementary information . the detected pmt is stored in a pmt buffer 502 and the detected eit is stored in an eit buffer 503 . here , the detected pmt or eit includes caption information , namely , a caption_service_descriptor . a controller 504 receives caption information from the pmt buffer 502 or the eit buffer 503 and detects caption data included in the transport stream on the basis of the caption information . a video parser 505 receives video data decoded by the demultiplexer 501 and separates the video data into user_data and mpeg - 2 video data . an analog caption decoder 506 receives user_data from the video parser 505 and detects analog caption data from the user_data on the basis of a signal outputted from the controller 504 . a digital caption decoder 507 receives the user_data from the video parser 505 and detects digital caption data from the user_data on the basis of a signal outputted from the controller 504 . a mpeg - 2 video decoder 508 decodes mpeg - 2 video data generated by the video parser 505 . a graphic block 510 outputs a signal for generating a gui ( graphic user interface ) such as an osd ( on screen display ) menu including information provided from the controller 504 . the graphic block 510 displays , on a screen , various characteristics of the received caption data , for example , a number of caption services , a national language of a caption , a type and a standard of the received caption data , vbi line information and field information that correspond to the caption data , a difficulty level of the caption , a picture ratio of the caption . a video combiner 509 receives analog caption data from the analog caption decoder 506 or receives digital caption data from the digital caption decoder 507 . further , the video combiner 509 receives video data from the mpeg - 2 video decoder 508 and receives a signal outputted from the graphic block 510 . the video combiner 509 combines the received signals so as to generate data that will be possibly displayed . a video reconstructor 511 encodes an analog caption data decoded by the analog caption decoder 506 , at a 21 st line of the vbi . operation of the digital broadcast receiver as described above according to the present invention will now be described . fig4 illustrates a method for processing a caption according to the present invention . if a mpeg - 2 transport stream transmitted through a cable is received , the mpeg demultiplexer 501 divides the received transport stream into video data , and audio data , supplementary information . the supplementary information includes a psip defining electronic program guide ( epg ) and system information ( si ). the psip includes a plurality of tables including information for transmitting / receiving a / v ( audio / video ) data made in a mpeg - 2 video and ac - 3 ( audio coding - 3 ) audio formats , and information regarding channels of each broadcast station and information regarding each program of channel . among them , information regarding the pmt and information regarding the eit are stored in the pmt buffer 502 and the eit buffer 503 , respectively . under the atsc standard , the digital cable broadcast signal must include a caption_service_descriptor in its pmt or eit . the controller 504 reads a caption - related option stored in a memory ( not shown ) and determines a caption - related option selected by a user ( s 11 ). for example , the caption - related option includes various options such as “ caption off ”, “ caption service selection ( cc1 , cc2 , cc3 , . . . )”, “ english caption display ”, “ korean caption display ”, “ size of caption ”, “ color of caption ”. if a user selects “ caption off ”, the controller 504 does not display the received caption . if a user selects “ english caption display ”, the controller 504 controls the caption decoders 506 and 507 so that only the caption written in english may be displayed on a screen . further , the controller 504 controls the caption decoders 506 and 507 so that the received caption data may be processed according to a set size and a set color of a caption . the controller 504 receives the caption information and judges characteristics of the received caption data on the basis of parameter values included in the caption information ( s 12 ). the controller 504 judges a number of caption services on the basis of the caption information . for example , the controller 504 judges whether a synchronous caption , an asynchronous caption service , a letter information service are provided . the controller 504 judges a language of the received caption on the basis of the caption information . for example , the controller 504 judges whether the received caption is english , japanese , or korean . the controller 504 judges a type of the received caption data on the basis of the caption information . for example , the controller 504 judges whether the received caption data is digital caption data or analog caption data ( s 13 ). the controller 504 determines a standard of the received caption data on the basis of the caption information . for example , if the received caption data is analog caption data , the controller 504 judges whether the received caption data is caption data under the eia 708 standard or the scte 20 or the dvs 157 standard . further , the controller 504 judges a vbi line number and a field including the received caption , a difficulty level of the received caption , and a picture ratio of the received caption on the basis of the caption information . to judge whether the received caption data is digital caption data in the step of s 13 , the controller 504 judges whether the digital caption data is included in the video data on the basis of the caption information . if digital caption data under the eia 708 is included in the video data ( if cc_type == 1 ), the controller 504 detects a service id that corresponds to the caption data from the caption information ( s 14 ) and transmits the detected service id to the digital caption decoder 507 . the service id can be known from a capto_service_number included in the caption information . the digital caption decoder 507 extracts and decodes caption data that corresponds to the service id from user_data of a picture header transmitted from the video parser 505 ( s 15 ). subsequently , the extracted caption data is transmitted to the video combiner 509 . the video combiner 509 combines the extracted caption data , video data outputted from the mpeg - 2 video decoder 508 , and signals outputted from the graphic block 510 . if analog caption data is included in the video data ( if cc_type == 0 ), the controller 504 judges whether the received caption data is analog caption data ( analog_cc_type = 1 ) under the eia 708 standard or analog caption data ( analog_cc_type == 0 ) under the scte 20 or dvs 157 standard ( s 16 ). at this point , the controller 504 determines a standard of the received analog caption data on the basis of the caption information . if the received caption data is analog caption data under the scte 20 or the dvs 157 , the controller 504 checks vbi line information described in 5 bits by a line_offset included in the caption information . the vbi line information represents a position of the caption data . further , the controller 504 judges a field where the caption data exists on the basis of line_field information included in the caption information . if line_field == 0 , the caption data exists in an odd field and if line_field == 1 , the caption data exists in an even field . after that , the controller 504 transmits the above checked vbi line information and the line field information to the analog caption decoder 506 . if the received caption data is analog caption data , user_data outputted from the video parser 505 is not processed by the digital caption decoder 507 . the analog caption decoder 506 finds out ( s 18 ) analog caption data made in the scte 20 or the dvs 157 standard from user_data inputted from the video parser 505 on the basis of the vbi line information and the line field information , and decodes the analog caption data ( s 19 ). the analog caption data found by the analog caption decoder 506 is transmitted to the video combiner 509 . the video combiner 509 combines the analog caption data , video data outputted from the mpeg - 2 video decoder 508 , and signals outputted from the graphic block 510 . signals outputted from the video combiner 509 are transmitted to the video reconstructor 511 . the video reconstructor 511 reconstructs a caption by encoding analog caption data outputted from the analog caption decoder 506 , at a vbi 21 st line . the reconstruction of a caption is to prevent analog caption data from being an open caption in case of storing data , as it is , outputted from the video combiner 509 in a storage medium such as a vcr ( video cassette recorder ). if the received caption data is analog caption data under the eia 708 standard ( if analog_cc_type == 1 ), the controller 504 transmits line_field information included in the caption information to the analog caption decoder 506 . since analog caption data under the eia 708 standard is positioned at a vbi 21 st line , a line_offset value is not required . at this point , the digital caption decoder 507 extracts a 2 - byte analog data in user_data including digital caption data from the video parser 505 and transmits the analog data to the analog caption decoder 506 . subsequently , the analog caption decoder 506 finds out ( s 17 ) analog caption data present in a vbi 21 st line from the 2 - byte analog data on the basis of the line_field information and decodes the analog caption data ( s 19 ). the found analog caption data is combined with video data from the mpeg - 2 video decoder 508 and signals from the graphic block 510 by the video combiner 509 . the video reconstructor 511 reconstructs a caption by encoding analog caption data from the analog caption decoder 506 at a vbi 21 st line . if analog caption data under the eia 708 and analog caption data under the scte 20 and the dvs 157 are all present in the user_data , the analog caption data under the eia 708 is processed . further , if digital caption data under the eia 708 and analog caption data under the eia 708 are all present in the user_data , the digital caption data is processed . as described above , the present invention judges a type of caption data on the basis of caption information included in the received broadcast signal and automatically processes the caption data according to the type , thereby providing convenience to a user . further , the present invention judges various characteristics of the received caption data such as a standard of caption data , a number of caption services being received and provides the characteristics to a user . furthermore , the present invention can store caption - related options selected by a user and display the caption being received according to the caption - related options . it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention . thus , it is intended that the present invention covers the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents .	7
in the following , the embodiments of the present invention are described in reference to the drawings . here , the present invention is not limited to the below described embodiments but of course includes various types of modification as long as the gist of the present invention is not deviated from . fig1 is a schematic diagram showing the structure of an example of the liquid chromatograph mass spectrometer using an esi method according to one embodiment of the present invention . fig2 is a diagram showing the structure of the heater block provided on the partition 26 of the ionization chamber 100 in fig1 . fig3 a is a side diagram showing the flow of the atomized liquid sample that has been sprayed from the nozzle 152 . fig3 b is a cross section diagram showing the xy plane in fig3 a . here , the same symbols are attached to the same components as in the above described conventional liquid chromatograph mass spectrometer 101 . a liquid chromatograph mass spectrometer 1 is provided with a liquid chromatograph unit ( lc unit ) 60 , an ionization chamber 100 and amass spectrometer unit 50 . in addition , a first middle chamber 12 that is located adjacent to the ionization chamber 100 , a second middle chamber 13 that is located adjacent to the first middle chamber 12 and a mass spectrometer chamber ( ms unit ) 14 that is adjacent to the second middle chamber 13 are provided sequentially with partitions in between them in the mass spectrometer unit 50 . the ionization chamber 100 is provided with a sub - chamber 110 in a rectangular parallelepiped form of 13 cm × 13 cm × 12 cm . the sub - chamber 110 has an upper surface , a front surface , a right - side surface , a rear surface ( partition 26 ), a left - side surface and a lower surface . thus , an internal space surrounded by six surfaces — upper , lower , left , right , front and rear — is formed in the ionization chamber 100 . in addition , a circular opening ( not shown ) that runs through in the upward and downward directions ( z direction ) is created in the upper surface so that a spray 15 can be attached to the opening from the top . furthermore , a drain 111 is formed on the lower surface so that the unnecessary liquid sample can be discharged to the outside through the drain 111 . moreover , the partition 26 is provided so as to separate the inside of the sub - chamber 110 from the inside of the first middle chamber 12 . a heater block 20 in a rectangular parallelepiped form into which a temperature adjusting mechanism ( not shown ) is incorporated is fixed in the center portion of the partition 26 . a first desolvation pipe 19 a , a second desolvation pipe 19 b and a third desolvation pipe 19 c , which are ion introducing pipes of which the entrance is placed inside the sub - chamber 110 and of which the exit is placed inside the first middle chamber 12 are formed in the heater block 20 . each desolvation pipe 19 a to 19 c is in a circular pipe form having the center axis in the x direction ( having an outer diameter of 1 . 6 mm and an inner diameter of 0 . 5 mm , for example ). as shown in fig2 , the first desolvation pipe 19 a , the second desolvation pipe 19 b and the third desolvation pipe 19 c are aligned in this order side by side in the y direction in the same xy plane . as in fig3 a and 3b , the entrance of the first desolvation pipe 19 a , the entrance of the second desolvation pipe 19 b and the entrance of the third desolation pipe 19 c are provided in the same zy plane . however , the flow of the atomized liquid sample that has been sprayed from the nozzle 152 is in a circular form in the xy plane , and therefore the entrance of the first desolvation pipe 19 a and the entrance of the third desolvation pipe 19 c may be located so as to protrude from the entrance of the second desolvation pipe 19 b in the − x direction . in addition , four dry gas pipes 118 of which the exits are provided inside the sub - chamber 110 are formed in the heater block 20 . each dry gas pipe 118 is in a circular pipe form having the center axis in the x direction ( having a diameter of 0 . 5 mm , for example ). two dry gas pipes 118 are aligned side by side in the y direction above the desolvation pipes 19 a to 19 c and at the same time two dry gas pipes 118 are aligned side by side in the y direction beneath the desolvation pipes 19 a to 19 c . the partition 26 of the thus formed sub - chamber 110 allows the flow of the atomized liquid sample that has been sprayed from the nozzle 152 having an inner diameter of 0 . 5 mm to spread as the flow progresses in the z direction and ultimately increase in size to a diameter of approximately +/− 2 mm to 4 mm . the ions that pass through the left end portion of the flow of the atomized liquid sample (− y side ) are drawn into the first desolvation pipe 19 a having an inner diameter of 0 . 5 mm . the ions that pass through the center portion of the flow of the atomized liquid sample are drawn into the second desolvation pipe 19 b having an inner diameter of 0 . 5 mm . the ions that pass through the right end portion of the flow of the atomized liquid sample ( y side ) are drawn into the third desolvation pipe 19 c having an inner diameter of 0 . 5 mm . as described above , in the liquid chromatograph mass spectrometer 1 according to the present invention , three desolvation pipes ( ion introducing pipes ) 19 a to 19 c are placed for better coordination with the form of the sprayed flow , so that almost all of the charged droplets can be brought into the three desolvation pipes 19 a to 19 c . as a result , the detection sensitivity can be increased . in addition , the three desolvation pipes ( ion introducing pipes ) 19 a to 19 c are aligned in parallel so that the total area of cross - section of the inside of the desolvation pipes 19 a to 19 c can be increased . thus , the total amount of ions that can be introduced into the first middle chamber 12 can be increased and at the same time ions can be efficiently introduced without disturbing the flow through the inside of each desolvation pipe 19 a to 19 c . as a result the detection sensitivity can be increased . fig4 a and 4b are diagrams showing the ionization chamber of the liquid chromatograph mass spectrometer using an esi method according to the second embodiment . fig4 a is a side diagram showing the flow of the atomized liquid sample that has been sprayed from the nozzle 152 and fig4 b is a cross section diagram showing the xy plane in fig4 a . here , the same symbols are attached to the same components in the above described conventional liquid chromatograph mass spectrometer 1 . an ionization chamber 100 is provided with a sub - chamber 110 in a rectangular parallelepiped form of 13 cm × 13 cm × 12 cm . the sub - chamber 110 has an upper surface , a front surface , a right - side surface , a rear surface ( partition 26 ), a left - side surface and a lower surface . the partition 26 is provided so as to separate the inside of the sub - chamber 110 from the inside of the first middle chamber 12 . a heater block 20 in a rectangular parallelepiped form into which a temperature adjusting mechanism ( not shown ) is incorporated is fixed in the center portion of the partition 26 . one desolvation pipe ( ion introducing pipe ) 219 of which the entrance is placed inside the sub - chamber 110 and of which the exit is placed inside the first middle chamber 12 are formed in the heater block 20 . the desolvation pipe 219 is a rectangular pipe having its center axis in the x direction ( having long sides of 1 . 6 mm and short sides of 0 . 5 mm ) and is provided so that the long sides are directed in the y direction . the partition 26 of the thus formed sub - chamber 110 allows the flow of the atomized liquid sample that has been sprayed from the nozzle 152 having an inner diameter of 0 . 5 mm to spread as the flow progresses in the z direction and ultimately increase in size to a diameter of approximately +/− 2 mm to 4 mm . the ions that pass through the left end portion of the flow of the atomized liquid sample are drawn into the left end portion of the desolvation pipe 219 . the ions that pass through the center portion of the flow of the atomized liquid sample are drawn into the center portion of the desolvation pipe 219 . the ions that pass through the right end portion of the flow of the atomized liquid sample are drawn into the right end portion of the desolvation pipe 219 . fig5 a and 5b are diagrams showing the ionization chamber of the liquid chromatograph mass spectrometer using an esi method according to the third embodiment . fig5 a is a side diagram showing the flow of the atomized liquid sample that has been sprayed from the nozzle 152 and fig5 b is a cross section diagram showing the xy plane in fig5 a . here , the same symbols are attached to the same components in the above described conventional liquid chromatograph mass spectrometer 1 . an ionization chamber 100 is provided with a sub - chamber 110 in a rectangular parallelepiped form of 13 cm × 13 cm × 12 cm . the sub - chamber 110 has an upper surface , a front surface , a right - side surface , a rear surface ( partition 26 ), a left - side surface and a lower surface . the partition 26 is provided so as to separate the inside of the sub - chamber 110 from the inside of the first middle chamber 12 . a heater block 20 in a rectangular parallelepiped form into which a temperature adjusting mechanism ( not shown ) is incorporated is fixed in the center portion of the partition 26 . a first desolvation pipe 319 a to a sixth desolvation pipe 319 f , which are ion introducing pipes of which the entrance is placed inside the sub - chamber 110 and of which the exit is placed inside the first middle chamber 12 are formed in the heater block 20 . each desolvation pipe 319 a to 319 f is in a circular pipe form having the center axis in the x direction ( having an outer diameter of 1 . 6 mm and an inner diameter of 0 . 5 mm , for example ). the first desolvation pipe 319 a to the third desolvation pipe 319 c are aligned in this order side by side in the y direction in a first xy plane , and the fourth desolvation pipe 319 d to the sixth desolvation pipe 319 f are aligned in this order side by side in the y direction in a second xy plane that is located beneath the first xy plane . the flow of the atomized liquid sample that has been sprayed from the nozzle 152 is in a conical form having the nozzle 152 as its apex , therefore the entrances of the first desolvation pipe 319 a to the third desolvation pipe 319 c are placed so as to protrude from the entrances of the fourth desolvation pipe 319 d to the sixth desolvation pipe 319 f in the − x direction . the partition 26 of the thus formed sub - chamber 110 allows the flow of the atomized liquid sample that has been sprayed from the nozzle 152 having an inner diameter of 0 . 5 mm to spread as the flow progresses in the z direction and ultimately increase in size to a diameter of approximately +/− 2 mm to 4 mm . first , in the first xy plane , the ions that pass through the left end portion of the flow of the atomized liquid sample are drawn into the first desolvation pipe 319 a having an inner diameter of 0 . 5 mm , the ions that pass through the center portion of the flow of the atomized liquid sample are drawn into the second desolvation pipe 319 b having an inner diameter of 0 . 5 mm , and the ions that pass through the right end portion of the flow of the atomized liquid sample are drawn into the third desolvation pipe 319 c having an inner diameter of 0 . 5 mm . next , in the second xy plane , the ions that pass through the left end portion of the flow of the atomized liquid sample are drawn into the fourth desolvation pipe 319 d having an inner diameter of 0 . 5 mm , the ions that pass through the center portion of the flow of the atomized liquid sample are drawn into the fifth desolvation pipe 319 e having an inner diameter of 0 . 5 mm , and the ions that pass through the right end portion of the flow of the atomized liquid sample are drawn into the sixth desolvation pipe 319 f having an inner diameter of 0 . 5 mm . fig6 a and 6b are diagrams showing the ionization chamber of the liquid chromatograph mass spectrometer using an esi method according to the fourth embodiment . fig6 a is a side diagram showing the flow of the atomized liquid sample that has been sprayed from the nozzle 152 and fig6 b is a cross section diagram showing the xy plane in fig6 a . here , the same symbols are attached to the same components in the above described conventional liquid chromatograph mass spectrometer 1 . an ionization chamber 100 is provided with a sub - chamber 110 in a rectangular parallelepiped form of 13 cm × 13 cm × 12 cm . the sub - chamber 110 has an upper surface , a front surface , a right - side surface , a rear surface ( partition 26 ), a left - side surface and a lower surface . the partition 26 is provided so as to separate the inside of the sub - chamber 110 from the inside of the first middle chamber 12 . a heater block 20 in a rectangular parallelepiped form into which a temperature adjusting mechanism ( not shown ) is incorporated is fixed in the center portion of the partition 26 . a first desolvation pipe 419 a to a seventh desolvation pipe 419 g , which are ion introducing pipes of which the entrance is placed inside the sub - chamber 110 and of which the exit is placed inside the first middle chamber 12 are formed in the heater block 20 . each desolvation pipe 419 a to 419 g has a circular pipe form ( having an outer diameter of 1 . 6 mm and an inner diameter of 0 . 5 mm , for example ). the first desolvation pipe 419 a to the third desolvation pipe 419 c are provided in a first xy plane , the fourth desolvation pipe 419 d and the fifth desolvation pipe 419 e are provided in a second xy plane that is located beneath the first xy plane , and the sixth desolvation pipe 419 f and the seventh desolvation pipe 419 g are provided in a third xy plane that is located beneath the second xy plane . in addition , the first desolvation pipe 419 a , the second desolvation pipe 419 b and the third desolvation pipe 419 c are in a circular pipe form having its center axis in the x direction ( having an outer diameter of 1 . 6 mm and an inner diameter of 0 . 5 mm , for example ), and are aligned in this order side by side in the y direction in the first xy plane . that is to say , the entrance of the first desolvation pipe 419 a , the entrance of the second desolvation pipe 419 b and the entrance of the third desolvation pipe 419 c are directed so as to face the x direction in the first xy plane . in addition , the entrance of the fourth desolvation pipe 419 d is directed so as to face the y direction and at the same time the entrance of the fifth desolvation pipe 419 e is directed to face the − y direction in the second xy plane . furthermore , the entrance of the sixth desolvation pipe 419 f is directed so as to face the − x direction and at the same time the entrance of the seventh desolvation pipe 419 g is directed to face the − x direction in the third xy plane . the partition 26 of the thus formed sub - chamber 110 allows the flow of the atomized liquid sample that has been sprayed from the nozzle 152 having an inner diameter of 0 . 5 mm to spread as the flow progresses in the z direction and ultimately increase in size to a diameter of approximately +/− 2 mm to 4 mm . first , in the first xy plane , the ions that pass through the left end portion of the flow of the atomized liquid sample are drawn into the first desolvation pipe 419 a having an inner diameter of 0 . 5 mm , the ions that pass through the center portion of the flow of the atomized liquid sample are drawn into the second desolvation pipe 419 b having an inner diameter of 0 . 5 mm , and the ions that pass through the right end portion of the flow of the atomized liquid sample are drawn into the third desolvation pipe 419 c having an inner diameter of 0 . 5 mm . next , in the second xy plane , the ions that pass through the center left portion of the flow of the atomized liquid sample are drawn into the fourth desolvation pipe 419 d having an inner diameter of 0 . 5 mm , and the ions that pass through the center right portion of the flow of the atomized liquid sample are drawn into the fifth desolvation pipe 419 e having an inner diameter of 0 . 5 mm . finally , in the third xy plane , the ions that pass through the rear left portion of the flow of the atomized liquid sample are drawn into the sixth desolvation pipe 419 f having an inner diameter of 0 . 5 mm , and the ions that pass through the rear right portion of the flow of the atomized liquid sample are drawn into the seventh desolvation pipe 419 g having an inner diameter of 0 . 5 mm . while the liquid chromatograph mass spectrometer 1 has such a configuration that an esi method is used as described above , an apci method or other ionization techniques may be used in the configuration . the present invention can be applied to a mass spectrometer and the like having an ionization chamber .	7
referring first to fig1 of the drawings , a spectrophone assembly includes a cell or chamber 3 which in use is illuminated by two lasers 1 , 2 with different wavelengths λ 1 , λ 2 respectively . the chamber 3 is formed by two cylindrical tubes with internal length and diameter l 1 , d 1 and l 2 , d 2 respectively , the two tubes being internally connected and vacuum closed to the outside . the lasers 1 , 2 are power modulated at frequencies ω 1 and ω 2 by modulators 1 a and 2 a respectively and , as references , these frequencies are sent to separate phase - lock amplifiers 10 , 11 . the laser beams are guided into the chamber 3 by fiber optics or wave guides 4 and the two beams are combined by a dichroic mirror 5 which transmits the beam from laser 1 and reflects the beam from laser 2 . the chamber 3 is closed by two radiation transmitting windows 6 through which the laser beams pass before being received by a radiation power meter 7 adjacent the exit window 6 . a single power meter 7 is used to measure the exit powers for both power beams simultaneously . thus , the power meter 7 must have a response time fast enough to detect beams at both modulation rates ω 1 and ω 2 . alternatively , separate power meters each sensitive to a corresponding modulation rate may be used . the exit power p measured by power meter 7 is separated by a filter 8 into power components for ω 1 and 107 2 which are then sent to a computer 14 for signal normalization purposes . a gas sample containing trace amounts of the species of interest is passed into and out of the chamber 3 through valved ports 9 . the gas sample is typically air at a pressure of about 1 atmosphere . the sample may be a static gas fill or may be continuously flowed through the chamber 3 . the necessary electric power supplies are of course provided as will be readily apparent to a person skilled in the art . the chamber 3 is provided with microphones m 1 , m 2 . the acoustic responses chosen for operation should be sufficiently separated in frequency space such that there will be no overlap in the response from the microphones . this can be effected by proper design and selection of the internal geometry of the chamber 3 . fig2 illustrates a typical frequency separation of the two acoustics resonances in this embodiment . such frequency separation provides a basic filter between the responses of the microphones and also filters substantially all acoustic noise and / or erroneous signals arising from outside the bandwidths of the subject resonances . referring now again to fig1 , if the specie to be detected has an absorptivity at λ 1 , the absorption will produce gas heating which , because of the fixed chamber volume , causes a pressure change modulated at a frequency of ω 1 which is sensed by internal microphone m 1 . the resulting electronic signal e s1 , from microphone m 1 is fed to and measured by lock - in amplifier 10 . the modulation rate ω 1 corresponds to an acoustic resonance frequency at ω 1 which amplifies the pressure changes at this modulation rate . the frequency bandwidth of the resonance is sufficiently narrow to effectively prevent frequency overlap , within its bandwidth , with other resonances and thereby filters out acoustic signals from any source at frequencies outside the bandwidth of the resonance at ω 1 . the resonance frequency is determined by the internal geometry of the chamber 3 . microphone m 1 is located at or near a maximum of the pressure standing wave 12 , the amplitude of which is shown in fig1 . in a similar manner , microphone m 2 is located near a maximum of pressure standing wave 13 in the side arm with length and diameter l 2 , d 2 . the resonance in this case is at frequency ω 2 and outside the bandwidth of the resonance at ω 1 . the signals e s1 and e s2 from microphones m 1 and m 2 respectively are fed for processing to separate phase - locked ( lock - in ) amplifiers 10 , 11 , each referenced to the corresponding frequencies ω 1 and ω 2 respectively . the phase - locked amplifiers evaluate the microphone signals , convert them into direct current values and subsequently feed them into the computer 14 . the exit powers of the two beams p ( ω 1 ) and p ( ω 2 ) required for normalization of the microphone signals are also fed into the computer 14 . the computer analyzes the computer data and produces the specie identifications and their concentrations for display . the acoustic resonances of the chamber 3 are defined by its internal geometry in accordance with the following equation : ω kmn = πc [ ( k / l ) 2 +( β mn / r ) 2 ] 1 / 2 ( 1 ) where ω kmn is the acoustic resonance frequency , the in radians per second , defined by a cylindrical section of length l between the end boundaries and of internal radius r , c is the velocity of sound for the gas at the pressure and temperature inside the chamber 3 , k is an integer having values corresponding to longitudinal harmonics , and β mn is the n th root of the derivative of the bessel function j m ( πβ ), of order m , with respect to β . it should be noted that the acoustic resonance is a pressure standing wave where the boundaries defining the length l can be any discontinuity in the cross section , such as the window boundary at each end of the chamber 3 . the windows need not even be present , i . e . the ends of the cell may be open . the basic fact is that these boundaries define the standing wave nodes of zero pressure . each tubular section of the cell ( as shown being utilized by microphones m 1 and m 2 ) has available to it a number of resonances defined by the values of k , m and n and the sum and difference resonance frequencies by various combinations of resonances arising from the two sections shown in fig1 . all of the differing resonances can be used to increase the number of radiation sources of different wavelengths illuminating the chamber 3 where each source is modulated and its microphone response is processed at its resonance frequency . there are many internal geometrical configurations of the chamber 3 which promote acoustic resonances . to illustrate the principles involved , fig3 a , 3 b , 4 a , 4 b , 5 a and 5 b show schematics of some configurations ( with the pressure profile indicated by dotted lines ) for some resonant pressure standing waves . the maxima are the most desirable locations for a microphone . fig3 a and 3 b show fundamental resonance modes available with the geometry illustrated . the expansion bulbs 16 , 17 , 18 define the lengths to determine the resonance frequency by equation ( 1 ) for each case . the expansion bulbs 16 , 17 , 18 provide an abrupt change in the tube cross section which is sufficient to force a pressure node ( zero pressure point ) within the vicinity of the entrance to the bulb . the chamber 15 need not be closed at both ends . as shown , one end is open . fig3 shows the best locations x for a microphone for each resonance . a single microphone of sufficient frequency bandwidth can be located in an overlapping region of two or more resonances where the pressure value in each case is non - zero . fig4 shows a configuration with two resonance side arms 19 , 20 to provide difference resonance frequencies , the side arms 19 , 20 having non - equal length and / or diameters as illustrated . various other resonances , all of different frequencies , can of course be obtained from the geometry shown . fig5 shows a configuration similar to that of fig4 except that the side arm tubes 19 , 20 are replaced by the geometries of disks 21 , 22 of radii r 1 , r 2 respectively . the acoustic resonances in these disks will be dominated by the second term ( πc β min / r ), i . e . the radial patterns of standing pressure waves , of equation ( 1 ). additional resonance frequencies are also obtainable from harmonics or overtones and combinations in terms of sums and difference frequencies of these fundamental resonances . further , the same principles apply to rectangular cross sections or any geometry where there will be points between which pressure standing waves can be produced . thus , as described above , a photo acoustic cell can be simultaneously illuminated by a number of radiation sources , each of different wavelength , and simultaneously analyzing a gas sample in the cell for its specie identifications and concentrations . the gas pressure in the chamber may be in the range of from about 0 . 1 torr to as high as practically possible , and the detectable concentration of a specie may range from a trace to 100 %. the advantages and other embodiments of the invention will now be readily apparent to a person skilled in the art , the scope of the invention being defined in the appended claims .	6
although the following description will identify the item being sliced as an onion , it should be understood that the slicer may be used to slice other items , such as apples , pears , bell peppers , oranges , tomatoes , etc . the secure restraining and holding action and the gentle slicing action of the slicer facilitate it for use in cutting a wide variety of items . the improved feeder comprises conveyors 12 and 14 , sensor actuating stop members 16 and 18 extending across the conveyors , and power cylinders 20 and 22 having cylinder rods 24 provided with pusher plate elements 26 and trailing arm members 28 . the positioning and hold - down means of the improved machine comprise housings 30 formed of pairs of walls 32 and 34 , power cylinders 36 supported by frames 37 attached to housings 30 , cylinder rods 38 for cylinders 36 attached to trap doors 40 slidably disposed in grooves 42 in the housing walls , power cylinders 44 mounted on top of housings 30 and having cylinder rods 46 which carry onion hold - down discs 48 . the slicing means of the improved machine comprises drive motor 50 , motor output shaft 52 , shaft coupling 54 , driven shaft 56 , shaft bearing 58 carried by support means 60 , a stop shim 62 fixedly attached to shaft 56 , a sleeve 64 on the end of shaft 56 fixedly connected with flange 66 , a plate 68 removably attached to flange 66 , a nut 70 on the threaded end of shaft 56 to maintain the collar 72 of flange 66 against stop shim 62 , curved knife blades 74 removably attached to plate 68 and provided with arcuate cutting edges 76 , and onion slice passage slots 78 formed in plate 68 . the operation of the improved feeder and slicer is as follows . onions which have been peeled and have had the root and crown surfaces well - defined by cutting are fed along the conveyors 12 and 14 until the leading onions engage stop members 16 and 18 , whereupon sensing means , not shown , actuate cylinders 20 and 22 to cause pusher elements 26 to move the lead onions off of the conveyors and into the housings 30 where they are supported by trap doors 40 . during such movement of the onions the hold - down discs 48 remain in an elevated condition out of engagement with the onions . while the onions are being so moved into place , the trailing arm elements 28 prevent the movement of the rest of the onions on the conveyors 12 and 14 . after delivering of onions to the housings 30 , the cylinders 20 and 22 are automatically actuated to fully retract cylinder rods 24 . these rods remain retracted until other onions are in place along the conveyors opposite the housings and the housings are ready to receive other onions . the feeder cycle then repeats itself . when the cylinder rods 24 of feeder cylinders 20 and 22 are retracted and when onions are in place on the trap doors 40 , cylinders 36 and 44 are actuated to retract the trap doors and thereby drop the onions onto the plate 68 and to engage the tops of the onions with the hold - down discs 48 . the withdrawal of the trap doors and the rotational movement of plate 68 causes the onions in the housings 30 to bear against a pair of corner walls where they are held by the discs 48 while the slices are removed by the knives 74 . the rods 46 move downwardly as the onions are depleted by slicing and when the discs have reached low points indicating that the onions have been fully sliced the cylinders 36 and 44 are reversely operated to pull up the discs 48 and move the trap doors 40 back into the housings . the machine is then ready for the next cycle of operation . it will be appreciated that the curved knives effect a progressive type of cut - slicing action rather than a chopping type of slicing action . there is a lesser degree of knife impact on the onions than there is in the machine of the co - pending application . there is therefore a lesser tendency on the part of the knives to tear the onions free from the overhead hold - down means . in any event , the knives are unable to flip the onions out of the housings 30 in the direction of the conveyors 12 and 14 because the onions reside within four - sided , or complete , wells once the trap doors have been retracted and the onions drop onto the plate 68 . the walls 32 adjacent the conveyors are opened for the passage into the housings of the onions , but the barrier elements 33 at the conveyor sides of the housings serve to close the housings on their four sides against onion flip - out . the hold - down discs 48 are preferably provided with irregular rubber surfaces to hold the onions against turning while they are being sliced .	1
referring now to the accompanying drawings , an embodiment of the invention will be described below . [ 0021 ] fig1 is a perspective view showing a connector for wiring connection according to an embodiment of the invention , fig2 is a front view showing a first connector of the connector for wiring connection , and fig3 is a longitudinal sectional view showing a half fitted state of two connectors . a connector for wiring connection 10 of this embodiment is composed of , for example , a first connector ( plug connector ) 20 and a second connector ( receptacle connector ) 30 each having connection terminals for a large electric power load disposed in two stages in the vertical direction . the first connector 20 is composed as follows . that is , in a first connector housing 21 formed of a synthetic resin or the like , plural terminal accommodating holes 22 extending in the connector fitting direction are formed in two stages in the vertical direction of the first connector housing 21 , and a first connection terminal 25 press - fitted to a leading end of an electric wire 24 branched off from a harness ( not shown ) for connection of a large electric power load is accommodated in the terminal accommodating holes 22 . in the housing frame portion between the terminal accommodating holes 22 , a magnetic member ( a rectangular permanent magnet 28 in this embodiment ) is incorporated . this permanent magnet 28 is preferably disposed at a position exposed to the strongest magnetic force in a place where arc discharge occurs , for example , between the first and second connection terminals 25 and 35 . the magnet 28 is incorporated in the housing frame portion so that , for example , the upper direction may be the s pole and the lower direction may be the n pole in fig1 . a stopping pawl 26 having an elastic stopping piece is formed on outer wall of the first connector housing 21 in the upper direction in fig1 . on the other hand , the second connector 30 is composed as follows . that is , in a second connector housing 31 formed of a synthetic resin or the like , a second connection terminal 35 press - fitted to a leading end of an electric wire 34 branched off from a harness ( not shown ) for connection of a large electric power load is formed in two stages in the vertical direction of the second connector housing 31 , corresponding to the first connection terminal 25 of the first connector 20 , and is accommodated in plural terminal accommodating holes 32 extending in the connector fitting direction . on the outer wall of the second connector housing 31 in the upper direction in fig1 a stopping portion 36 is formed for stopping and fixing the both connectors 20 , 30 as being engaged with the stopping pawl 26 formed in the first connector housing 21 when the both connectors 20 , 30 are fitted completely . together with the stopping pawl 26 , it composes a lock mechanism of the connector for wiring connection 10 . according to the connector for wiring connection 10 having such configuration , when engaging / disengaging the first connector 20 with / from the second connector 30 , as shown in fig3 lorentz force is generated by the action of a magnetic field t generated in a direction orthogonal to the direction in which the both connection terminals 25 , 35 are fitted by the permanent magnet 28 disposed in the first connector housing 21 . accordingly , for example , as depicted by parabola a in fig4 the electron of arc generated between the both connection terminals 25 and 35 is bent , and the trajectory of the arc discharge is drawn very far from the direct distance between the two connection terminals 25 and 35 . therefore , destructive effects of the arc discharge on the connection terminals 25 and 35 can be decreased , so that melting of connection terminals can be prevented effectively . in the case of the connector for wiring connection without permanent magnet 28 , usually , arc discharge is terminated when the both connection terminals are apart from each other by a specified distance . however , when the permanent magnet 28 is provided in the first connector housing 21 as in the case of the connector for wiring connection 10 of this embodiment , the specified distance can be instantly reserved on the moment of change from contact to separation , or from separation to contact of the two connection terminals 25 , 35 . the difference in effects on the arc whether or not the permanent magnet 28 is provided in the first connector housing 21 is known from the graph in fig5 . that is , according to the experiment by the applicant of the invention , without the permanent magnet 28 , the discharge continuation time was t , and the terminal melt loss degree was u , and with the permanent magnet 28 , the discharge continuation time was about { fraction ( 1 / 16 )} or less , and the terminal melt loss was about { fraction ( 1 / 10 )} or less . this difference is variable by adjustment of the magnetic force of the permanent magnet 28 , change of arrangement position or the like , and further better results may be obtained . also depending on the mode of arrangement of the connection terminal 25 ( 35 ), the effect of the permanent magnet 28 varies . thus , as shown in fig6 for example , the connection terminal 25 ( 35 ) may be disposed in a symmetrical state to the permanent magnet 28 ( for example , in a confronting state of plate faces of the connection terminals 25 a and 25 b ). in this configuration , since the connection terminals 25 a , 25 b can be further brought closer to the permanent magnet 28 , and a strong magnetic field is realized by the connection terminals 25 a , 25 b . destructive effects of arc discharge on the connection terminal 25 ( 35 ) can be further decreased , thereby melting of connection terminals can be effectively prevented . in this embodiment , the permanent magnet 28 is disposed in the first connector housing 21 . to the contrary , as shown in fig7 the permanent magnet 28 may be disposed in the second connector housing 31 . as the magnetic member , instead of the permanent magnet 28 , for example , an electromagnet or the like may be also used . [ 0029 ] fig8 is a perspective view showing a connector for wiring connection according to another embodiment of the invention , and fig9 is a schematic front view showing a magnetic field generated in a first connector of the connector for wiring connection . the connector for wiring connection 10 ′ of this embodiment is composed of a first connector ( plug connector ) 20 ′ and a second connector ( receptacle connector ) 30 ′, for example , having connection terminals for large electric power load disposed in two stages in the vertical direction . the first connector 20 ′ is composed as follows . that is , in a first connector housing 21 ′ formed of synthetic resin or the like , plural terminal accommodation holes 22 ′ extending in the connector fitting direction are formed in two stages in the vertical direction of the first connector housing 21 ′, and a first connection terminal 25 ′ crimped to the leading ends of wires 24 ′ branched off from a connection harness ( not shown ) for large electric power load is accommodated in the terminal accommodation holes 22 ′. in the housing frame portion between these terminal accommodation holes 22 ′, a magnetic member ( a rectangular permanent magnet 28 ′ in this embodiment ) is incorporated . the permanent magnet 28 ′ is preferably disposed at a position exposed to the strongest magnetic force , for example , where arc discharge occurs between the first and second connection terminals 25 ′, 35 ′, and specifically incorporated in the housing frame portion such that the upper direction is the s pole and the lower direction is the n pole in fig8 . in the outer walls at upper and lower positions in fig8 of the first connector housing 21 ′, engagement recesses 52 for engaging with a yoke 50 are formed , respectively . the yoke 50 is a u - shaped ferromagnetic element composed of an annular portion 55 formed along an outer periphery of a front side of the first connector housing 21 ′, and an engaging piece 51 extending at right angle to the annular portion 55 from the upper and lower parts of the annular portion 55 . the engaging piece 51 of the yoke 50 is engaged with the engagement recess 52 of the first connector housing 21 ′, and an engaging projection 53 of the engagement recess 52 is fitted into an engaging hole 54 of the engaging piece 51 , so that the yoke 50 is attached to the first connector housing 21 ′. the yoke 50 is disposed such that the magnetic field t generated by the permanent magnet 28 ′ having the first connection terminal 25 ′ pinched by the engaging pieces 51 is concentrated on the first connection terminal 25 ′ as shown in fig9 . on the outer wall in the direction of a in fig8 of the first connector housing 21 ′, a locking claw 26 ′ having an elastic stopping piece is formed . on the other hand , the second connector 30 ′ is composed as follows . that is , in a second connector housing 31 ′ formed of synthetic resin or the like , in correspondence to the first connection terminal 25 ′ of the first connector 20 ′, a second connection terminal 35 ′ crimped to the leading ends of wires 34 ′ branched off from a connection harness ( not shown ) for large electric power load is formed in two stages in the vertical direction of the second connector housing 31 ′, and accommodated in plural terminal accommodation holes 32 ′ extending in the connector fitting direction . on the outer wall in the direction of a in fig8 of the second connector housing 31 ′, a locking portion 36 ′ is formed for locking and fixing the both connectors 20 ′, 30 ′ by engaging with the both connectors 20 ′, 30 ′ ( it , together with the locking claw 26 ′, composes a lock mechanism of the connector for wiring connection 10 ′). according to the connector for wiring connection 10 ′ thus configured , when fitting / separating the first connector 20 ′ and second connector 30 ′, a lorentz force is generated by the action of the magnetic field t generated so as to be concentrated in a direction orthogonal to the engaging direction of the both connection terminals 25 ′, 35 ′ by the permanent magnet 28 ′ and yoke 50 disposed in the first connector housing 21 ′. then , the electron of the arc generated between the both connection terminals 25 ′, 35 ′ is bent , and the trajectory of arc discharge is drawn far remote from the linear distance between the connection terminals 25 ′, 35 ′. this makes it possible to reduce destructive effects of the arc discharge on the both connection terminals 25 ′, 35 ′, and melting loss of connection terminals can be prevented further effectively . also in this embodiment , the permanent magnet 28 ′ is disposed in the first connector housing 21 ′. to the contrary , the permanent magnet 28 ′ may be disposed in the second connector housing 31 ′, and aside from the permanent magnet 28 ′, for example , an electromagnet may be also used . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents .	7
referring now to the drawing figures , fig1 illustrates schematically one embodiment of the process and apparatus in accordance with the present invention for inerting solid or molten metals . fig1 illustrates a bulk liquid cryogen storage tank , where the cryogen is preferably n 2 , ar , co 2 . the liquid cryogen is preferably in a saturated liquid state , where the saturated liquid is in equilibrium with vapor phase at an elevated pressure . liquid bulk storage tank 2 feeds liquid cryogen via a shut - off valve 4 through distribution piping 8 , where distribution pipe 8 preferably includes a safety pressure relief valve 6 to relieve in case of overpressure . distribution piping 8 is generally outdoors , originates at ground level , and generally and preferably is routed to an elevated header inside of a melt shop or other building , and then has individual “ drop legs ” as explained herein . the drop legs are typically flex hoses which are routed to each furnace or pair of furnaces . the distribution piping can have one or more drop legs from each header . the system in fig1 preferably includes a shut - off valve 10 which connects the distribution piping to a gas liquid separation device 12 , which preferably includes a chamber with an internal float connected to an internal upper gas vent valve . a safety pressure relief valve 14 can also be included as shown . liquid cryogen flows through piping 11 through a flex hose 18 , liquid shut - off valve 20 , a metering orifice 21 , and piping connection 24 , and eventually exits through a diffuser 26 which is located inside cryogen inerting nozzle 28 . preferably , the piping connection 24 is a double wall lance pipe as described in u . s . pat . no . 4 , 848 , 751 , incorporated herein by reference . gas liquid separation device 12 could be also a simple pipe “ tee ,” ( preferably larger than piping 11 in diameter ), installed at or near the highest point , with a gas vent pointing vertically . following the gas flow through the system illustrated in fig1 a pressure regulator or in - line pressure relief valve 16 is preferably provided . pressure regulator 16 maintains the desired back pressure to the gas liquid separation device 12 , and to distribution piping 8 , rather than allowing the gas vent 12 to discharge to atmosphere , which can reduce system pressure . a flex hose 34 connects with a gas adjusting valve 36 , piping connection 31 , and nozzle 33 for allowing gaseous cryogen to be routed toward the molten or solid metal 1 , being held in container 32 . preferably , an adjusting valve or orifice can be provided as indicated at 38 , to allow additional gas purged from the liquid line 18 and 24 into the gas line 31 . valve 38 preferably includes a check valve ( one - way valve ) to allow gas to flow into the gas system , but not to allow gas to flow back into the liquid piping system 18 and 24 . valve connection 38 may also include a pressure regulator or in - line relief valve , to maintain pressure in liquid lines 11 , 18 , and 24 . also indicated in fig1 is a connection 40 for routing liquid cryogen to another furnace , and a connection 42 for routing gaseous cryogen to another container . distribution pipe 8 can be a header pipe to distribute cryogen to multiple furnace containers 32 . cryogen can be supplied to each furnace via its own nozzles 28 , 31 and 33 , and diffuser 26 . hence , items 10 - 38 can be replicated as needed for multiple furnaces . referring now to fig2 illustrated is another embodiment of a method and apparatus suitable for practicing the invention . the system illustrated in fig2 differs only from that illustrated in fig1 in the construction of cryogen inerting nozzle 28 , which has also a gas providing connection 35 taking feed from gaseous cryogen conduit 31 . this version of the nozzle 28 and connection 35 is better viewed with reference to fig3 and 4 . fig3 is a side elevation cross - sectional view of the nozzle 28 and connection 35 , illustrating certain dimensions . liquid cryogen enters at 27 , while gaseous cryogen enters at 29 . the internal diameter of liquid cryogen nozzle 28 , denoted as d , preferably ranges from about 2 cm up to about 10 cm , more preferably ranging from about 2 cm to about 5 cm , depending on the amount of cryogen desired . the exit end of nozzle 28 has a larger diameter d ′, than the internal diameter d of nozzle 28 . this slight flaring of the exit of the nozzle provides certain advantages , for example , the liquid may have a better drip characteristic , and the gaseous cryogen may spread to a wider area of the molten or solid metal in container 32 . the ratio of a diameter d divided by d ′ typically and preferably ranges from about 0 . 5 to 1 , up to 1 to 1 . fig3 also illustrates diameter d of diffuser 26 , with diameter d ranging from about 5 % up to about 90 % of the diameter d . it should be recognized by those skilled in the art that diffuser 26 need not be cylindrical or round in construction but could be rectangular or any other shape including a t - shaped element . a distance l from terminal tip of diffuser 26 to the entrance of connection 35 typically ranges from about 0 to about 3 diameters equal to d , the diameter of diffuser 26 . lengths denoted as l d and l n are also illustrated in fig3 . the dimension l d corresponds to the axial length of diffuser 26 , while the length denoted l n denotes the distance from the end of diffuser 26 to the exit of nozzle 28 . preferably , the distance l d ranges from about 0 . 5 to about 3 times the diameter d , while the length dimension l n is preferably 0 . 1 to 1 . 5 times the length dimension l d . [ 0042 ] fig4 illustrates the end view along the view a - a denoted in fig3 illustrating that diffuser 26 is substantially centered within a cylindrical cryogen inerting nozzle 28 . it should be noted that this is preferred only and that diffuser 26 could be located in a non - central location in reference to the axial center line of nozzle 28 . also as illustrated in fig4 gaseous cryogen connection 35 is indicated as being connected non - tangentially to nozzle 28 , however , connection 35 could be tangentially connected as indicated in fig4 a . fig4 a shows an alternate embodiment where gas connection 35 is tangentially connected to cryogen delivery nozzle 28 . the embodiment of fig4 a would tend to give a swirling motion to the gaseous cryogen as it exits nozzle 28 . it can also be envisioned to install swirling elements on an internal surface of nozzle 28 to create more swirl for gaseous cryogen . with either fig4 or 4 a , it can also be envisioned to utilize a substantially larger diameter d of the nozzle 28 , to provide broader gas coverage in the furnace 32 . [ 0043 ] fig5 illustrates an alternate embodiment 50 of a nozzle useful for delivering liquid and gaseous cryogen for the purposes of the invention . a nozzle 28 as in previous embodiments is fitted with an annular section 52 basically surrounding the nozzle 28 , and creating an annular space for gaseous cryogen to enter through a piping connection 54 . thus , only liquid would exit through the nozzle 28 via diffuser 26 , whereas , gaseous cryogen would exit the annular region formed between nozzle 28 and annular section 52 . annular section 52 may be connected to nozzle 28 such as by welds 56 and 58 . piping connection 54 may be non - tangentially connected to annular connection 52 or it may be tangentially connected to provide a swirling flow of cryogen . at initial startup of liquid cryogen flow ( such as after a weekend shutdown or the like ), valves 4 , 10 , 20 , and 21 are fully opened . since the piping ( 8 , 11 , etc .) is initially warm ( room temperature ), liquid cryogen will be vaporized as it travels through the pipe . typically , several minutes are required in order to cool the piping system to cryogenic temperatures , and attain steady state flow conditions . hence valve 21 is kept full open , initially , while 100 % gas discharges through the diffuser 26 and nozzle 28 . as liquid begins to appear out the nozzle 28 , this is an indication that the piping is beginning to cool , and valve 21 is gradually closed in order to maintain the desired ( small ) liquid flow rate . at steady state conditions , when the piping system has fully cooled to its ultimate steady state temperature , ideally valve 21 will be fully closed , and the desired liquid flowrate is maintained through the fixed metering orifice hole in valve 21 . valve 36 ( gas vent line ) is opened at some point during this cool down process ( either at beginning or after some time ). once the system has reached steady state with respect to piping cool down , then valve 36 and / or regulator 16 can be adjusted , along with valve 21 , in order to provide optimum performance ( consistent , stable liquid flow , without surging or sputtering , at minimum flowrate ). without the gas vent line 34 and / or gas vent device 12 , in many cases , total cryogen flow is increased unnecessarily ( by opening valve 21 ) in order to maintain consistent , stable liquid flow without surging . by opening and adjusting the ( optional ) one - way valve 38 , further fine - tuning can be accomplished , by creating an additional “ gas escape path ” for vapor generated in the piping in close proximity to the hot furnace , i . e . pipe 24 . in one experimental setup , at steady state flow conditions , when valve 36 ( gas vent valve ) was closed , it was observed that valve 21 had to be opened wider in order to maintain stable , consistent liquid flow without surging . when valve 36 was opened , creating an escape path for gas generated in the piping , then stable liquid flow ( no surging ) could be maintained with valve 21 in a more closed position . this suggests that by segregating the liquid and gas flow in this manner , the required overall flowrate of cryogen for a given system potentially can be reduced . or , at minimum , the consistency and quality of liquid cryogen delivered to the furnace is improved , thereby increasing inerting effectiveness . and with the novel technique of utilizing the vented gas in the furnace ( via nozzle 33 or connection 35 ), as opposed to wasting it by venting to atmosphere , efficient utilization of cryogen is further improved . recognizing that in the absence of a gas vent line 34 or a gas vent device 12 , a certain percentage of the cryogen discharging from the diffuser 26 and nozzle 28 will always be gas , the novelty is that , first , the gas and liquid flow is segregated , in order to provide greater uniformity , stability and consistency of liquid flow ( with potentially reduced overall flow requirement ), and second , the vented gas is now routed back to the furnace in order to utilize its inerting value , rather than wasting it by venting to atmosphere , which further contributes to increased efficiency of cryogen utilization . this apparatus and method , therefore , can provide greater economy ( reduced overall cryogen consumption ) with improved inerting effectiveness ( through more consistent , stable liquid flow ) while improving operator safety ( minimized liquid flowrate reduces risk of explosion from liquid “ pooling ” on molten metal surface ). preferred processes for practicing the present invention have been described . it will be understood and readily apparent to the artisan that many changes and modifications may be made to the above - described embodiments without departing from the spirit and the scope of the present invention . the foregoing is illustrative only and that other embodiments of the integrated process can be employed without departing from the true scope of the invention defined in the following claims	2
a document shredder 11 comprises the following main components : a self - supporting casing 12 , a cutting mechanism 13 , which is connected by means of a gear 14 to an electric motor 15 and a hood 16 . this unit is mounted on a container 17 . the casing 11 is made in one piece from plastic and has the basic structure of a rectangular frame with side and end walls 18 , 19 running around three outside and extending virtually over the entire height of the shredder . adjacent to a wall 18 , a channel or trough - like motor chamber 20 is constructed , in which are located the electric motor 15 and optionally circuitry components and the like , so as to be protected from the cutting mechanism area . the trough reinforces the casing . parallel thereto is formed a cutting mechanism chamber 21 , which is on the casing side open at the top and bottom . the cutting mechanism 13 is located in the chamber 21 and comprises two horizontal , parallel , juxtaposed cutting rollers 2 , whose cooperating cutting disks 23 engage in one another . the cutting disks 23 are worked from the cutting roller material with the spacing of the strip width to be cut and have in each case a substantially radially directed face or edge 24 and a bevelled face or edge 25 . the cutting rollers 22 are arranged in such a way that in each case two radial faces are adjacent or engage with one another in such a way that they can make a cut in the manner of scissors . the cutting rollers are mounted at their two ends in bearing inserts 26 , which can be made from a high - grade , elastic plastic with bearing characteristics . they are inserted from above in u - shaped recesses 27 in the rear end wall 19 and a partition 28 opposite thereto and terminating the motor and cutting mechanism chambers 20 , 21 and are fixed by screws 29 . fig1 shows that the bearing inserts have all - round rib 30 in the vicinity of the recess and engage in a corresponding groove shaped into the recess 27 . as can be gathered from fig3 each bearing insert has on the inside facing the cutting mechanism a strong flange 31 , which is supported on the partition 28 and can absorb axial forces . thus , the bearing inserts form a radial and axial bearing for the cutting rollers 22 and are so intrinsically elastic that they can absorb the necessary axial pressing forces or bring about the corresponding positioning of the cutting rollers . they form a prefittable unit together with the two cutting rollers and the synchronization gear wheels 32 mounted on the shaft journals projecting on one side through the bearing insert 26 . the prefittable unit can only be inserted from above in the corresponding casing recesses 27 and requires fixing . one of the two identical synchronization gear wheels , ensuring the contrarotating drive of the cutting rollers 22 , engages in a pinion of the final gear step 35 . the gear 14 has three gear steps 33 , 34 , 35 in each case comprising a plastic pinion / gear wheel combination and which in each case is fitted to a metal pivot pin 36 . they are mounted on one side in bearing depressions of the partition 28 and on the other side in bearing depressions in a gear cover 37 , supported and fixed on a strong edge 39 of the casing surrounding a gear chamber 38 . the gear chamber 38 is adapted to the gear shape and perfectly reinforced as a result of a strong construction of the partition 38 , edge 39 and cover 37 . this also contributes to the reinforcement of the overall casing , which is also assisted by the trough shape of the motor chamber 20 . the driving pinion 40 of the motor 15 engages in the gear wheel of the first gear step 33 . thus , in all , the gear forms four transmission steps . it can therefore be brought with favorable individual transmissions of around 1 : 4 with good efficiency and in low wear and noise manner to overall transmission ratios of 1 : 200 to 1 : 300 , which permits a high motor speed of up to 20 , 000 r . p . m . the high motor speed of 12 , 000 to 20 , 000 r . p . m . ( usually around 15 , 000 r . p . m .) is reached by the motor in idle running . when coupled to the cutting rollers via a preferably four step reduction gear , with a gear reduction ratio of more than 100 : 1 ( preferably 130 : 1 ), the motor speed is reduced to the range of 4 , 000 to 8 , 000 r . p . m . because the cutting rollers run with friction between their cutting disks . in operation , i . e . when shredding a higher number of sheets , this speed is further reduced . the motor does , however , constantly increase it torque while reducing the speed , so that even a substantial overloading of the shredder usually does not stop the cutting mechanism but only reduces the cutting speed . this is completely different to industrial ac motors used before , which run at a lower constant speed of maximal 3600 r . p . m . and have a good and constant torque but stop completely after exceeding a certain break down torque . the lowering of speed with increasing load also has the advantage that the user gets an acoustical signal from the motor noise that the shredder is approaching its cutting capacity and can therefore accordingly adjust the amount of goods to be simultaneously shredded accordingly . the motor used is a universal motor energized by ac outlet supply . such motors are usually alternating current series commutator motors . in the cutting mechanism chamber 21 under the cutting rollers 22 , transverse beams 41 run in one piece with the casing and which on their top surface form , by corresponding shaping , strippers 42 ( cf . fig2 and 4 ). they have a profiling adapted to the cutting mechanism profile , i . e . serrated in a slightly sawtooth manner and engage in gaps between the cutting disks 23 and prevent the paper adhering to the cutting disks from being drawn around the cutting rollers . under normal conditions , the cutting mechanism operates without any need for a stripper . however , the stripper serves as a security measure against strongly adhering papers and the like . the strippers have a segmental construction and extend over an angle of approximately 45 to 60 degrees about the lower cutting roller circumference and in each case displaced from the centre outwards . the cross - sectionally , inverted u - shaped transverse beams 41 additionally reinforce the casing in the most highly loaded areas . it is therefore clear that the casing is a self - supporting , highly stable unit , which combines in one piece the motor , cutting mechanism , gear , chassis , stripper and outer casing . it is manufactured as an injection molding , preferably from a plastic , which is internally given a sandwich structure by slight foaming and is not critical with respect to larger wall thicknesses or wall thickness jumps . the top of the elongated , relatively flat casing is covered by the hood 16 , which has a substantially planar upper surface 43 and a downwardly directed , all - round edge 44 . as can also be gathered from fig6 it is supported by the inner ribs 45 provided in the marginal area on an outwardly directed flange 46 of the casing 12 . however , the edge 44 engages over the flange 46 at the bottom and forms there a groove - like , all - round recess 48 bounded by the edge 44 , the underside of the flange 46 and the lateral surface 47 of the lower casing portion which widens slightly upwards . in the vicinity thereof the noses 49 of a snap connection are fitted to the edge 44 and by means of these the hood 16 is snapped onto the casing flange 46 . in the embodiment the container 17 is made from a high - grade corrugated paper material . the upper container edge 50 has an open corrugated paper cut edge , because on mounting the shredder on the container it engages in the recess 48 and is covered by the latter . thus , the hood 46 engages over and beyond the outer edge of the container rim , sot hat it is the only surface visible from the outside . thus , in the case of different colorings , there is no need to give a different color to the casing and it can be made from the most favorable material for the particular purpose without any special requirements extending regarding the appearance . fig2 and 6 show that on mounting the container rim widens somewhat as a result of the slope of the outer wall portion 47 and therefore permits a reliable , tight connection . fig2 and 5 show that on the upper face 43 of the hood 16 there are two bead - like , parallel protuberances 51 which , between them , define an insertion slot 52 , which runs at right angles to the engagement area 53 of the cutting rollers 22 . the beads , whose arcuate structure mainly has a decorative function , are also used for reinforcing the walls 54 bounding the insertion slot and as an insertion aid . in the variant of fig5 on the lower edges thereof reverse strippers 55 are provided , i . e . teeth roughly corresponding to those of fig4 and which engage in the gaps between the cutting disks 23 . during the return of the cutting rollers ( opposite to rotation direction 56 ), which e . g . takes place in the case of blockages , they serve to prevent any winding round the cutting rollers . thus , as a result of its integral , self - supporting casing construction , the described document shredder is easy to manufacture and assemble , while having a stable , durable construction .	1
the present invention pertains to a method for accelerating oxidation of a fat comprising the steps of : a ) hydrolyzing the fat to form a hydrolyzed fat composition ; b ) activating the hydrolyzed fat composition in the presence of a seaweed for a time period from 1 to 6 hours at a temperature from 100 ° c . to 140 ° c ., preferably from 110 ° c . to 130 ° c . the term “ seaweed ” refers herein to macroscopic , multicellular marine algae and includes members of the red algae ( rhodophyta ), the brown algae ( phaeophyta ) and the green algae ( chlorophyta ). the fat of the present invention can be an animal fat , e . g . selected from beef fat ( tallow ), chicken fat , mutton fat or lamb fat , pork fat such as lard . the fat can also be of animal milk origin as for example milk fat , cream , butter , cheese , anhydrous milk fat . the fat of the present invention can also be an oil from plant origin as for example sunflower oil , peanut oil , walnut oil , rattan pepper oil , rap oil , soya oil , corn oil , olive oil or sesame oil . it can also be for example cocoa butter or other solid fats from plant origin . preferably , however , the fat is an animal fat . more preferably , the fat is selected from beef fat , chicken fat , lamb fat and pork fat . those fats are advantageously used in the present invention , as activated fats are mostly used in the preparation of flavoring and seasoning compositions for culinary food products where they provide an enhanced organoleptic experience of meaty and fatty flavors . such flavors are best provided by fats originating from such meat origins like beef , chicken , lamb or pork , where they contribute additionally also with their intrinsic flavor profiles . preferably , the hydrolysis in step a ) of the present method is an enzymatic hydrolysis , preferably with making use of a lipase enzyme . thereby , the hydrolysis in this step a ) may be at a temperature from 40 ° c . to 60 ° c ., preferably from 45 ° c . to 55 ° c . the advantage of using enzymatic hydrolysis over e . g . chemical or other physical hydrolysis methods is that a substantially complete hydrolysis of the fat material can be obtained and this without the use of any harsh chemicals or other dangerous interventions . furthermore , the hydrolysis reaction can be kept at relatively low temperatures to minimize the loss of any volatile low molecular weight flavor compounds present in the reaction and limiting the costs of heating such reaction volumes . the lipase enzyme for this enzymatic hydrolysis step may be for example lipases lipozyme tl from novozymes , validase lipase an or validase lipase mj from dsm . the enzymes are typically added to the hydrolysis reaction in an amount from 100 to 1500 mg per 100 g of fat . in a preferred embodiment , the seaweed in step b ) of the method of the present invention is present in an amount of at least 0 . 5 wt % of the total hydrolyzed fat composition . typically , the amount of seaweed is not more than about 20 wt % of the total hydrolyzed fat composition . preferably , the amount of seaweed is in an amount from 1 . 0 to 10 wt %, more preferably in an amount from about 3 wt % to 7 wt % of the total hydrolyzed fat composition . the optimal catalytic efficiency , i . e . between costs of adding seaweed and oxidative yield , is between 3 and 7 wt % as exemplified below . preferably , the seaweed in step b ) of the present method is added in a powdered or paste form to the fat or to the hydrolyzed fat composition . this is the most industrially practical and cost effective way . thereby , the powdered or pasty seaweed can already be added to the fat either before , during or after the hydrolysis step a ) of the present method ; or to the hydrolyzed fat composition in step b ) either before or during the reaction time period . the seaweed in step b ) of the method of the present invention is a green algae ( chlorophyta ), a brown algae ( phaeophyta ), or a red algae ( rhodophyta ). the seaweed can also be a combination of members of either two or all three of these algae groups . in a preferred embodiment , the seaweed in step b ) of the method of the present invention is a green algae , i . e . a chlorophyta , and preferably selected from the genus ulva or enteromorpha . most preferably , the seaweed is enteromorpha prolifera or enteromorpha clathrata . in a further preferred embodiment , the time period in step b ) of the method of the present invention is from 1 . 5 to 3 . 5 hours , preferably from 1 . 5 to 3 . 0 hours . even more preferably the time period is from about 2 . 0 to 2 . 5 hours . the shorter the time period , the less volatile compounds are lost during the heating step and the less the process costs money . another aspect of the present invention pertains to an activated fat composition obtainable by the method of the present invention . a still further aspect of the present invention pertains to a method for improving the flavor of a food composition comprising the step of adding the activated fat composition of the present invention to said food composition . preferably , the food composition comprising the added activated fat composition is further processed in a flavor reaction process , preferably in a maillard reaction process , to result in a flavor reaction product . the present invention also pertains to a food product comprising the activated fat composition or the flavor reaction product of the present invention as described above . the food product can be a concentrated seasoning or flavoring product , a condiment , a sauce , a gravy or a ready - to - eat food product . those skilled in the art will understand that they can freely combine all features of the present invention disclosed herein . in particular , features described for the method for accelerating oxidation of a fat of the present invention can be combined with the method for improving the flavor of a food composition and with the product claims of an activated fat composition and the food product of the present invention ; and vice versa . further , features described for different embodiments of the present invention may be combined . further advantages and features of the present invention are apparent from the figures and following examples . in a first step : enzymatic hydrolysis of beef fat ( tallow ) was carried out after the addition of 10 wt % water and 0 . 5 wt % lipase ( lipozyme tl 100 l from novozymes ) to the fat and incubation at 45 ° c . for 2 . 5 hours in a temperature controlled reaction vessel . in a second step : catalysts were added to the hydrolyzed beef fat as specified in table i . the mixture was then thermally treated under the conditions as specified in table i . thereafter , the mixture , i . e . the activated fat composition , was cooled to room temperature . the degree of fat oxidation in the activated fat composition was then determined according to the official method provided by the international organization for standardization ( iso 6885 : 2006 ( e )), i . e . by measuring the presence of secondary oxidation products such as aldehydes and ketones by reacting them with p - anisidine to form products that absorb at 350 nm wavelength of light . p - av absorption values of the different mixtures were then determined , whereby the p - av value is higher the more secondary oxidation products have been built in the fat composition . a p - av value close to 0 ( zero ) indicates an absence of secondary oxidation products and hence very little to no fat oxidation . a high p - av value is indicative to the amount of secondary oxidation products present in the fat mixtures and hence the degree of fat activation . all samples were reacted under air pumping of 2 . 5 l / min per 100 g fat . for each catalyst used in the present example , the proper content of iron was determined according to standard technique and is as shown in table ii . hence , samples 2 , 5 , 6 , 7 and 9 all comprise about equimolar amounts of iron in the fat activation reaction . however , samples 3 and 4 comprise significantly less total amounts of iron . the results indicate that free iron ions can act as a fat oxidation catalyst : p - av value of sample 6 , which comprises ferrous gluconate , is clearly elevated in comparison to the negative control sample 1 , which does not comprise added iron . red mushroom powder ( sample 7 ), although comprising about the same amount of iron as sample 6 does not substantially act as a catalyst in this reaction . it is evident from the above results , that powders from the different seaweeds as indicated in table i ( i . e . samples 2 - 5 ) and comprising similar or even lower amounts of iron as samples 6 and 7 , act as catalyst in the fat activation process . particularly , it is evident from samples 2 and 5 , that seaweed powder from enteromorpha , i . e . enteromorpha prolifera and enteromorpha clathrata , perform very well as catalyst and are the most preferred solutions of the present invention . seaweed powder from the brown algae laminaria ( sample 4 ) performs also clearly above the negative and the red mushroom powder control samples 1 and 7 , as well as the powder from porphyra ( a red algae type ); and this despite the fact that those seaweed powders comprise much lesser amounts of iron . hence , all tested seaweed powders perform better as a catalyst in the presented method for accelerating oxidation of a fat , than the use of another biological material , red mushroom powder , which has about the same equimolar amount of iron as those powders from the green algae seaweeds . these results are further confirmed at a reaction temperature of 125 ° c ., where sample 9 is still providing a better fat oxidation result than sample 8 . effect of seaweed as a catalyst as to reaction temperature in the fat oxidation reaction the effect of the reaction temperature as to the acceleration of the oxidation reaction with and without the presence of seaweed was determined . the same experimental process as described in example 1 was used . the experiment was repeated in the same way as for sample 1 and 2 in example 1 , with the exception that the temperature of the activation reaction was varied between 100 ° c . and 160 ° c . the p - av value of the different reaction end - products were then determined as described above . the results are shown in fig1 . it can be concluded from those results that the sample without a catalyst only started to generate secondary oxidation products when heat - treated for 2 . 5 hours from about 130 ° c . temperature upwards . the sample with seaweed as a catalyst , however , started to generate such secondary oxidation products when heat - treated under the same conditions already at about 110 ° c . at 125 ° c . already a very substantial part of secondary oxidation products is generated , superior as to what the control samples can generate at e . g . 160 ° c . effect of seaweed as a catalyst as to the time requirement for the fat oxidation reaction the effect of the reaction time period as to the acceleration of the oxidation reaction with and without the presence of seaweed was determined . the same experimental process as described in example 1 was used . the experiment was repeated in the same way as for sample 1 and 2 in example 1 , with the exception that the reaction time period was varied from 1 to 6 hours . the p - av value of the different reaction end - products were then determined as described above . the results are shown in fig2 . it can be concluded from those results that the sample without a catalyst only started to generate secondary oxidation products when heat - treated for at least 2 hours or longer . the sample with seaweed as a catalyst , however , started to generate such secondary oxidation products when heat - treated under the same conditions already earlier and produced already after 1 . 5 hours a p - av value higher than what can be observed with the control sample after 2 . 5 hours . at 2 . 5 hours , the sample with the presence of seaweed already generated substantial amounts of secondary oxidation products , whereas the sample without a catalyst is still in the early phase of starting to generate such compounds . the effect of different amounts of seaweed added to the fat activation reaction was determined . the same experimental process as described in example 1 was used . the experiment was repeated in the same way as for sample 2 in example 1 , with the exception that the amount of added seaweed was varied between 0 . 5 and 9 wt %. the p - av value of the different reaction end - products were then determined as described above . the results are shown in fig3 . it can be concluded from those results that the samples with an amount of 0 . 5 wt % seaweed or more are generating secondary oxidation products . it further can be seen that in this specific experimental set - up a saturation of the catalytic effect is reached with the addition of about 9 wt %, or slightly above , of added seaweed to the reaction mixture . an optimal amount of seaweed can be determined to be between ca . 3 wt % and 7 wt % of added seaweed . to verify the influence of the activated fat composition when further used as an ingredient into a maillard process flavor reaction , an activated beef fat composition , i . e . sample 2 of example 1 , as well as a chicken fat composition , prepared in the same way as sample 2 but with chicken fat instead of beef fat , was added to the reaction mixture of a maillard flavor reaction and further processed . for this , 4 wt % of the activated fat compositions per total reaction mixture was integrated into a beef or chicken flavor seasoning reaction mixture as disclosed in document wo2012 / 080175a1 , example 1 and 2 respectively , and further processed as described in said document to obtain a savory thermal base ( stb ). comparative results , with and without added activated fat compositions , were then evaluated by a professional sensory panel and by gc - ms analysis . the results are shown in fig4 and 5 , respectively . as can be seen from fig4 a , the beef flavor reaction product with the corresponding activated beef fat expresses a significantly stronger and more pronounced meaty and fatty note than the corresponding reaction product without the addition of the activated beef fat . the same is true for the chicken flavor reaction product as can be seen in fig4 b . therein , the activated chicken fat contributed significantly to the stronger chicken flavor note , full body and mouth coating , and meaty note than the corresponding reaction product without the addition of the activated chicken fat . the samples as prepared for example 5 were further analyzed for volatile compounds using gc - ms technology . the volatiles compounds were sampled with an spme - fibre ( 75 μm , carboxen / polydimethylsiloxane ) and separated with a gas chromatograph - mass spectrometer ( finnigan trace gc / ms , finnigan , usa ). first , the beef stb was dissolved with water at the dosage of 1 . 2 g / 100 ml hot water . 3 g solution was weighted and placed in a 15 ml vial . the vial was sealed with ptfe / bytl septum and equilibrated at 55 ° c . for 30 min , with the presence of spme - fibre in the headspace . after the equilibration time , the injection was conducted in a split less mode for 3 min at 250 ° c . the volatile compounds were separated with a capillary column db - wax ( 30 m × 0 . 25 mm × 0 . 25 μm ; j & amp ; w scientific , folsom , calif ., usa ). the separation was performed as follows : the oven temperature was held at 40 ° c . for 3 min , ramped to 100 ° c . at the rate of 5 ° c ./ min and then to 230 ° c . at 12 ° c ./ min and maintained at 230 ° c . for 10 min . helium ( 99 . 999 %) was used as carrier gas at a linear velocity of 1 . 8 ml / min . the compounds were analysed by ms . mass spectra was obtained in the electron impact mode with an energy voltage of 70 ev and emission current of 35 ua . the detector was set at a scanning range of 35 - 450 m / z at a rate of 4 . 45 scans / s . identification of the volatile compounds was carried out by comparison of their mass spectra with the wiley , nist and replib libraries and also by comparing their kovats indices ( kis ) with those of standard compounds and data from the literature . linear kis of the compounds were calculated , using a series of n - alkanes injected under the same chromatographic conditions and compared with available literature data . the identified volatile compounds were quantified by gc / ms . the areas of the peaks were measured by calculating the total ion current . these findings are confirmed in the gc - ms results as presented in fig5 a and 5b . the volatile flavour compounds of beef stb with 6 % raw beef fat as a control are shown in fig5 a , while the beef stb with 4 % activated beef fat according to the present invention are shown in fig5 b . the results showed that more volatile flavor compounds with stronger flavor intensity are released from the beef reaction product with the added activated beef fat composition ( fig5 b ), than where not activated beef fat was added ( fig5 a ). particularly , it could be observed that more aldehyde and furan compounds which contribute to a fatty and meaty flavor were released from the reaction product with the activated fat .	0
an understanding of the detailed description of the invention is facilitated by reference to the drawings , fig1 through 7 . each of the four embodiments of the invention solves the problem of reducing cost of producing lead frames for ic chip packaging . additionally , at least two of the embodiments improve the following characteristics : cte matching of the lead frame , silicon , and adhesive , anti - corrosion , anti - oxidation , and in - line cure of the die attach adhesive . drawing fig1 shows the preferred embodiment of the inventive plastic lead frame 10 as envisioned for application in a loc packaging configuration . the lead fingers 12 of the plastic lead frame 10 ( not completely shown ) are positioned over die bond pads 14 . the lead fingers 12 are directly connected to the die bond pads 14 by an adhesive 16 consisting of a conductive epoxy or z - axis conductive material . the ic chip or die 18 is suspended by the adhesive 16 connecting the lead fingers 12 of the plastic lead frame 10 . drawing fig2 depicts an enlarged cross - sectional view of the preferred embodiment showing a lead finger 12 as attached to a die bond pad 14 on the ic die 18 . the cross - section of the lead finger 12 is also shown with the inner lead frame structure 20 coated with a conductive coating 22 . the conductive coating 22 could be a conductive epoxy , z - axis conductive material , or any other suitably conductive adhesive known in the art . the die bond pad 14 is connected to a circuit trace 24 leading to components ( not shown ) on the ic die 18 . the circuit trace 24 will typically be underneath a passivation layer of oxide 26 on the ic die 18 . drawing fig3 shows a perspective view of the preferred embodiment in a loc configuration which utilizes conventional wire bonding . in drawing fig3 lead fingers 12 of the plastic lead frame 10 ( not completely shown ) are located over an adhesive tape 28 which holds the ic die 18 to the plastic lead frame 10 . die bond pads 14 are connected to lead fingers 12 by means of wires 30 . the wires 30 can be aluminum or gold and are attached using wire bonding machines ( not shown ) well established in the art . drawing fig4 shows a magnified cross - section of a plastic lead finger 12 of the preferred embodiment of the inventive plastic lead frame 10 ( not shown ). the inner plastic lead frame structure 20 is made of a conventional plastic or polymer material . the surrounding conductive coating 22 is an intrinsic conductive polymer , such as polyaniline , or copper . the polyaniline layer is of thickness “ d .” the minimum thickness “ d ” necessary for suitable electrical conductivity is governed by the following equation : where f is the maximum frequency of the electrical device , μ is the permeability of the polyaniline layer , and σ is the conductivity of the polyaniline layer . for example , where f is 1 × 10 9 hz , σ is 1 × 10 5 ( ohm · m ) − 1 and μ is 1 . 26 × 10 − 6 henry / m , a thickness of 50 μm is needed for the polyaniline coating . drawing fig5 shows a perspective view of the preferred embodiment in a conventional type lead frame configuration which utilizes conventional wire bonding . in drawing fig5 lead fingers 112 of the plastic lead frame 100 ( not completely shown ) are located adjacent the sides 116 which hold the ic die 118 to the lead frame 100 . die bond pads 114 are connected to lead fingers 112 by means of wires 130 . the wires 130 can be aluminum or gold and are attached using wire bonding machines ( not shown ) well established in the art . the ic die 118 is supported by the die paddle 120 of the lead frame 100 and is adhesively secured thereto by means of a suitable epoxy adhesive or , alternately , by means of a double - sided adhesively coated tape . drawing fig6 shows an ic die 218 encapsulated by material 230 connected to a loc type lead frame 200 having lead fingers 212 connected to the bond pads on the active surface of the ic die 218 and connected to electrical circuits ( not shown ) on a substrate 220 , such as a printed circuit board or the like . the lead fingers 212 may be shaped in any suitable type configuration for connection to the ic die 218 and the electrical circuits of substrate 220 . the encapsulating material 230 may be of any well known suitable type and may include suitable filler material therein . drawing fig7 shows an ic die 318 encapsulated by material 340 connected to a conventional type lead frame 300 having lead fingers 312 and a die paddle 316 supporting the ic die 318 . the lead fingers 312 are connected to the bond pads 314 on the active surface of the ic die 318 by wires 330 and are connected to electrical circuits ( not shown ) on a substrate 320 . the lead fingers 312 may be shaped in any suitable type configuration for connection to the ic die 318 and the electrical circuits of substrate 320 . the encapsulating material 340 may be any well known suitable type and may include suitable filler material therein . in the preferred embodiment , plastic lead frames can be dipped in an intrinsically conductive polymer , such as polyaniline , to form a conductive layer . the polyaniline dip could be a dispersion of polyaniline in a mixture of organic solvents . the coating is finished by drying the coating with infrared heating or baking using techniques well known in the art . this dip coating process can be repeated as necessary to attain the desired thickness . alternatively , the polyaniline can be applied in a lacquer dispersion , again using techniques well known in the art . in a second embodiment , the polyaniline could be dispersed throughout the plastic lead frame structure using commercially available polyaniline polymer dispersions such as those offered by zipperling kessler & amp ; co . the composite lead frame could be formed by injection molding or stamping a sheet of the composite polymer containing polyaniline . in both the preferred and second embodiment , such plastic lead frames described have less cte mismatch with respect to the silicon ic die , plastic mold compounds , and die attach materials relative to traditional metal alloys . furthermore , conductive plastic lead frames are more flexible than metal alloy lead frames to resist bent leads . the inventive plastic lead frames can also be made transparent to enable ultraviolet radiation cure ( or other light source cure ) of die attach materials . this is a distinct advantage over metal alloys which are not transparent . in a third embodiment , the plastic lead frame is formed from an injection molded or stamped plastic or polymer based sheet of material to form a lead frame structure . the plastic lead frame structure would then be coated with copper , using electroless copper plating techniques well - known in the industry . alternatively , the plastic lead frame structure could be coated with copper using chemical vapor deposition or other plating techniques known in the art . after the copper coating has been applied to the plastic lead frame , the copper may have one or more coatings or layers of coatings of other conductive metal thereon , such as a layer of nickel , palladium , silver , gold , other precious metals , etc . in this third embodiment , the resulting low - cost plastic lead frame has a conductive layer of copper with suitable electrical and thermal characteristics for ic packaging . however , the cte mismatch between the copper plated plastic lead frame and the silicon ic die should be comparable to that associated with traditional copper - clad lead frames . plastic lead frames can be manufactured by injection molding , compression molding or stamping to form complex and intricate shapes . there is no particular limitation on the lead frame shape complexity other than the tools used to perform the injection molding or stamping . furthermore , by reducing the number of steps necessary to produce the plastic lead frame , relative to a metal lead frame , a lower cost can be achieved . although the present invention has been described with reference to particular embodiments , the invention is not limited to these described embodiments . rather , the invention is limited only by the appended claims , which include within their scope all equivalent devices or methods which operate according to the principles of the invention as described .	7
in accordance with the invention , an amorphous metal strip can be sharpened to form razor blades of excellent edge characteristics : high resistance to mechanical damage and superior corrosion resistance . in production , for example , an amorphous metal strip which is 0 . 002 inch thick and about 1 / 4 inch wide can be sharpened on one edge and then cut into lengths of about 1 . 75 inches . alternatively , strips of greater width can be sharpened on both edges . strips of many different alloy compositions can be used for razor blades . the preferred alloys will consist of primarily iron , nickel , cobalt , chromium , vanadium and mixtures thereof . alloys of particular interest contemplated by the invention are those having the general formula m a x b wherein m may be any combination of ni , fe , co , cr and / or v , x will be elements such as p , b , c , si , al , sb , sn . in , ge and / or be and a and b represent atomic percent in which a will generally range from 90 to 65 atomic percent and b will range from 10 to 35 atomic percent . preferably , a will vary from about 84 to about 73 atomic percent while b will vary from about 16 to about 27 atomic percent . examples of some of the preferred compositions include ni 75 p 16 b 6 al 3 ; ni 50 fe 28 p 14 b 6 al 2 ; cr 24 fe 24 ni 30 p 14 b 4 c 2 si 2 ; fe 38 cr 38 p 15 c 4 b 2 al 3 ; fe 40 ni 40 p 14 b 6 ; and fe 30 co 20 cr 28 p 14 b 6 al 2 . the alloying elements normally used in steels , such as mo , mn , ti , w and cu , can also be included in these compositions as a partial replacement for any of the metals ni - fe - cr - co - v . in replacing the latter with the former , preferably not more than about one - third of the latter metals in atomic percent is replaced with the former . an alternate embodiment of the invention resides in coating a metal substrate with an amorphous metal layer such as by the sputtering of a thin film ( about 50 to 300a . thick ) of metal which is at least 50 % amorphous onto the edge of an already sharpened amorphous or crystalline razor blade . the general compositions of such coating alloys are essentially those listed above in connection with the amorphous strips . preferred coating compositions are , for example , cr 80 p 15 b 5 ; fe 20 cr 60 p 20 ; cr 65 ni 10 p 15 si 10 and cr 77 p 13 b 5 si 5 . still another embodiment resides in the deposition of an amorphous coating of the general compositions listed above on various articles of cutlery . for example , a composition such as ni 80 p 20 can be electro - deposited onto a formed utensil such as a knife or instead a composition such as cr 60 ni 20 p 15 b 5 can be sputtered thereon . the invention will be further described by reference to the following specific examples . it should be understood , however , that although these examples may describe in detail certain preferred operating conditions and / or materials and / or proportions , they are provided primarily for purposes of illustration and the invention , in its broader aspects , is not limited thereto . parts expressed are parts by atomic percent unless otherwise stated . a molten alloy of composition ni 18 fe 30 p 14 b 6 al 2 at a temperature of 1 , 050 ° c . is quenched to the amorphous state by using the rotating double roll apparatus described by chen and miller in rev . sci . instrum . 41 1237 ( 1970 ). an argon pressure of 8 psi is used to squirt the molten metal through a 0 . 010 inch hole in the bottom of a fused silica tube into the nip of the 2 inch diameter , 3 inch long double rolls which are at room temperature and rotating at about 1 , 400 rpm . a force of about 100 lbs . is applied so as to push the rolls towards each other . the molten metal is thus quenched to a 0 . 002 inch thick ribbon of amorphous metal of the same composition . the edge of the ribbon is sheared off so as to provide a straight edge and a cutting edge is ground and honed on the sheared edge of the strip in a manner conventionally used to sharpen razor blades . in sharpening , care is taken such that any part of the metal strip does not reach a temperature above 340 ° c . the strips are cut to the desired length for individual blades . the blade may be suitably employed at this juncture . however , the blade may be further processed after sharpening such as by the deposition of an amorphous or crystalline metal film of about 150 ° a . on the cutting edge . this coating may be applied by sputtering or vapor deposition , as descrbed in the aforementioned maissel and glang text . a fluorocarbon coating may also be applied such as disclosed in u . s . pat . no . 3 , 071 , 856 -- care again being taken to avoid excess temperature which would cause crystallization of the amorphous metal . a 0 . 004 inch thick strip of stainless steel is ground and honed to produce a razor blade with a conventionally shaped edge . an alloy of composition cr 78 p 14 b 5 si 3 is sputtered onto the edge of the blade which is kept at a temperature below 100 ° c . in the manner described in chapter 4 of the maissel and glang text , so as to produce a metal film of this alloy composition which is more than 50 % amorphous and has an average thickness of 200 a . on the edge of the blade . a fluorocarbon coating in the manner disclosed in example 3 of u . s . pat . no . 3 , 071 , 856 is applied to the blade . a similar procedure was followed for a 0 . 002 inch thick blade of amorphous ni 50 fe 28 p 14 b 6 al 2 . similarly , cr 58 ni 18 p 14 b 6 si 4 is sputtered onto other ground stainless steel and amorphous ni 50 fe 28 p 14 b 6 al 2 blades which are then coated with a fluorocarbon . following the procedure of example 1 , amorphous strips suitable for forming of razor blades are prepared from the alloys shown in table 1 . some examples , as indicated , are coated . table i______________________________________ coatingex . alloys ( atomic %) ( if any ) ______________________________________3 fe . sub . 39 ni . sub . 39 p . sub . 16 b . sub . 4 si . sub . 24 fe . sub . 39 ni . sub . 39 p . sub . 16 b . sub . 4 si . sub . 2 cr . sub . 80 p . sub . 15 b . sub . 5 ( sputtered ) 5 fe . sub . 30 ni . sub . 20 cr . sub . 28 p . sub . 14 b . sub . 6 al . sub . 2 cr . sub . 65 ni . sub . 10 p . sub . 15 si . sub . 10 ( sputtered ) and thereafter coated with polytetrafluoro - alkylene ) 6 fe . sub . 38 cr . sub . 38 p . sub . 15 c . sub . 4 b . sub . 2 al . sub . 3 cr . sub . 80 p . sub . 15 b . sub . 5 ( sputtered ) and thereafter coated with polytetrafluoro - ethylene7 ni . sub . 75 p . sub . 16 b . sub . 6 si . sub . 1 al . sub . 2 cr . sub . 80 p . sub . 15 b . sub . 5 ( sputtered ) and thereafter coated with polytetrafluoro - ethylene8 cr . sub . 40 co . sub . 36 p . sub . 14 b . sub . 6 al . sub . 4 cr ( sputtered ) ______________________________________ a stainless steel knife with a high polish is cleaned by washing with trichloroethylene and dried . an amorphous film of cr 80 p 15 b 5 is sputtered on the entire blade . the film thickness is 1 , 000 a . a relatively tough and durable mar - resistant coating is produced .	8
a housing is thus used in accordance with various embodiments which is subject to shrinkage and mounts the armature such that it changes its rotational position at rest in the case of a housing shrinkage . the magnet yoke is mounted such that it likewise absorbs forces in the case of a housing shrinkage . it is molded such that the absorbed forces effect a change in the position of the bimetallic element and the field line outlet plate such that the change in the rotational position at rest of the armature is compensated for . this change ( complete , as far as is possible with a rotation ) is preferably compensated for . the troublesome shrinkage is thus not intentionally uncoupled from the armature , but instead the shrinkage is also exploited on the part of the magnet yoke such that the shrink effect on the armature and the shrink effect on the magnet yoke act in a precisely opposite fashion . a magnet yoke according to an embodiment can be preferably used in the case of the line circuit breaker . such a magnet yoke for a line circuit breaker has the property of a conductive bimetallic element being fastenable thereto . it has a base body , which is designed to guide magnetic field lines emanating from a bimetallic element fastened to the magnet yoke during current flow to a flat field line outlet plate , through the surface normal of which a first direction is defined . mounting sections are defined on two sides of the magnet yoke which are arranged opposite to one another , with which the magnet yoke can be mounted in a housing . the mounting sections also allow the introduction of forces from the housing into the magnet yoke in a second and third direction ( which are generally essentially opposite to one another ). these directions are essentially perpendicular to the first direction , namely by definition at an angle of 75 ° to 105 ° ( preferably 85 ° to 95 °, particularly preferably 90 °) in respect of the first direction . the magnet yoke according to an embodiment is characterized in that an elastic element is arranged between one of the two mounting sections and the base body , said elastic element bending in the case of the introduction of forces acting in the second and third direction and as a result enabling a movement of the field line outlet plate in one direction , which is essentially identical to the first direction . by definition , it deviates by at most 20 ° ( preferably by at most 10 °) from this direction ( with it being possible for this deviation to be arbitrary as viewed from the deviation direction ). in simple terms , it is possible to say that the magnet yoke receives forces in one dimension and converts said forces in one movement into one dimension which is perpendicular hereto . to this end , the elastic element is preferably embodied in the manner of a rod and has two rod points with ( by comparison with the remaining rod shape ) a reduced cross - section , which are used as desired flexion points . the prespecification of the desired flexion points allows the type of bending to be defined in a particularly clear fashion , so that the movement of the field line outlet plate can take place in a well - defined fashion and the object can be achieved of very precisely counteracting the change in the rotational position of the armature at rest . with a preferred embodiment , the rod - shaped elastic element extends linearly at an angle of 35 ° to 55 ° ( preferably of 45 °) in respect of the first direction on the one hand and in respect of the second direction on the other hand from a mounting section to the base body . in other words , the rod - shaped elastic element runs “ diagonally ”. as a result , the acting forces are conveyed in an optimum fashion . one of the two mounting sections , between which and the base body the elastic element is arranged , is preferably embodied as a t - shaped foot . the foot allows the engagement of a screw on a first limb in order to define a position of the foot and thus of the magnet yoke and on another ( opposite ) limb an abutment to stop the foot when the screw is in different positions . with a further preferred embodiment , the magnet yoke is embodied as a stamped bending part . it can as a result be produced in a particularly cost - effective fashion . a line circuit breaker shown in fig1 and designated as a whole by the number 8 has a housing 10 , which consists of a material like a duroplast for instance , which is subject to a housing shrinkage . the actual switching device includes a fixed contact 12 and a moving contact which can be pivoted onto the fixed contact 12 . the moving contact 14 is moved into the switching - on position shown in fig1 with the aid of a handle 16 , with the handle 16 moving the moving contact 14 by way of a bracket 18 and a contact support 20 . a catch 22 engages with the contact support 20 , said catch 22 engaging in an armature 24 in the basic state , i . e . if the switched - on state is to be maintained , see in particular the representation in fig2 . if the armature 24 pivots in the clockwise direction , the catch 22 disengages and this effects , by way of the contact support 20 , a release of the moving contact 14 from the fixed contact 12 and thus an interruption in the switched - on state . such a rotation of the armature 24 can be introduced in two different ways . a bimetallic element 26 is first provided , which is fastened to a magnet yoke 28 . the fastening can be seen particularly well in fig4 . in the rest state , the bimetallic element 26 is to have a gap a from the armature 24 . current passes through the bimetallic element when in the switched - on state . with overcurrents , the bimetallic element heats up and thereby bends . the bimetallic element 26 bends here in respect of armature 24 , overcomes the gap a and finally presses on the armature 24 , so that this moves in the clockwise direction . this is thus a mechanism for overcurrent tripping . at the same time , a tripping can occur with the aid of the magnet yoke 28 also in the case of short circuit currents . to this end , a field line outlet plate 30 is embodied on the magnet yoke 28 , namely on precisely the other side of the armature 24 in comparison with bimetallic element 26 , in fig1 , in other words to the left of the armature 24 instead of like the bimetallic element 26 to the right of the armature 24 . in the base position , a gap b is defined between the field line outlet plate 30 and the armature 24 . in the case of a short circuit current a significantly increased current flows through the bimetallic element 26 . the magnet yoke 28 guides the magnet field lines , which emerge from the bimetallic element 26 through which the current is flowing to the field line outlet plate 30 , so that a magnetic attraction force is exerted by the field line outlet plate 30 on the armature 24 and attracts this . it then rotates in the clockwise direction . this is thus a short circuit tripping mechanism in addition to the thermal tripping mechanism . while with a thermal tripping mechanism , the bimetallic element 26 overcomes the gap a and presses on the armature 24 , in the case of the short circuit the magnet yoke 28 attracts the armature 24 from the opposite side so that the gap 24 is overcome and precisely effects a rotation of the same in the clockwise direction . the catch 22 then disengages and the electrical contact between the moving contact 14 and the fixed contact 12 is released , which also interrupts the current . with both types of tripping , it depends on the respective gap a and / or b being set precisely , so that the tripping is well - defined . a locking screw 32 , which engages in a t - shaped foot 34 of the magnet yoke 28 , in more precise terms in a limb 36 of the foot 34 , is used to adjust the gaps a and b . the magnet yoke is mounted and held in a recess 40 in the housing the opposite limb 38 . the position of the screw 32 is defined . with a rotation of the screw 32 , the position of the screw thus does not change , instead that of the magnet yoke 28 , into which the screw 32 engages . accordingly , the gap a can be reduced and increased and at the same time the gap b can be enlarged and / or reduced in size . the shrinkage of the housing 10 after a longer housing service life can now lead to the gaps a and b changing so that the tripping no longer takes place in a well - defined manner . the construction , as shown in the fig , causes the shrinkage to have opposing effects . the armature 24 is mounted in a bearing 41 on the housing 10 . with a shrinkage of the housing 10 , the armature rotates in the clockwise direction , however not so far that the catch 22 is tripped . in this way the gap a is increased and the gap b is reduced . the construction now makes provision for the magnet yoke 28 to balance out these changes in the gaps a and b precisely . the magnet yoke shown as a whole in fig3 has a base body 42 , which has the function of guiding magnetic field lines . the magnetic field lines which emerge from the bimetallic element 26 are guided . to fasten the bimetallic element 26 , a fastening element 44 ( fig4 ) is used , for which space is available on an upper section 46 of the magnet yoke 28 . the upper section 46 functions as a mounting section . as shown in fig4 , the mounting section 46 engages in a recess 48 in the housing 10 . the foot 34 functions as an opposite mounting section , said foot engaging as mentioned above into the housing in the recess 40 . an elastic element 50 is arranged between the base body 42 and the foot 34 . the elastic element 50 consists of a rod 52 , which tapers in at the foot 34 at on point 54 , which simultaneously forms the lower limb of the t - shape of the foot 34 . at the base body 42 , the rod - shaped element 52 likewise tapers at one point 56 , which is located at approximately the height of the field line outlet plate 30 . the tapered points 54 and 56 are used as target bending points . the whole rod 52 is essentially at an angle of α on the foot 34 and at an angle of β on a surface normal 58 of the field line outlet plate 30 . α and β both amount to approximately 45 °. this is enabled in that the foot 34 is approximately vertical to the field line outlet plate 30 . with the shrinkage of the housing , the forces f shrinkage now act on the mounting sections 34 and / or 46 by way of the brackets 40 or 48 . the forces f shrinkage define two directions of the force effect , which are approximately vertical to the surface normal 58 . the actual angle deviates slightly from 90 °, but moves however within a range of 75 ° to 105 °. the magnet yoke 28 is now pressed together by the forces f shrinkage . the weakest points bend as a result . these are the points 54 and 56 . the rod - shaped element 52 thus bends , in the image to the left , so that the base body 42 with the field line outlet plate 30 moves in accordance with the arrow 60 . the movement direction according to arrow 60 is almost the same as a direction which is predetermined by the surface normal 58 . the movement direction 60 does not deviate from the direction predetermined by the surface normal 58 by more than 20 °. the dimensions of the magnet yoke parts are selected with the magnet yoke 28 such that the afore - mentioned rotational movement of the armature , which is introduced by way of the bracket 40 from the housing 10 during its shrinkage , is counteracted . as mentioned above , the armature 24 moves slightly in the clockwise direction during shrinkage and therewith enlarges the gap a and reduces the gap b . the forces f shrinkage introduced at the same time during the shrinkage allow the movement to be produced in accordance with the case 60 . the movement 60 again increases the gap b . the dimensions are to be such that the gap b corresponds again to the gap which is defined in the basic state . the movement 60 once applies to the overall base body 42 and thus also to the upper part 46 . the bimetallic element 26 thus also moves in the direction specified by the arrow 60 . the enlargement of the gap a is thus also counteracted by the rotation of the armature 24 in the clockwise direction when the housing 10 shrinks . the construction also expressly takes account of the fact that the armature 24 moves in a shrink - related fashion . the magnet yoke 28 is embodied such that this has no effect however , but instead that the housing shrinkage simultaneously brings about a second effect ( on the magnet yoke 28 ) which counteracts the first effect ( on the armature 24 ). this counter effect is enabled in particular by the provision of the elastic rod - shaped element 52 , in particular by the two desired flexion points 54 and 56 .	7
a balloon novelty device will be described . in the following description , for the purposes of explanation , specific construction details , arrangements , and component descriptions are set forth in order to provide a more thorough understanding of the present invention . it will be apparent to those skilled in the art , however , that the present invention may be practiced without these specific details . in other instances , well known components and structures have not been described in detail so as not to obscure the present invention unnecessarily . referring first to fig1 a perspective view of the preferred embodiment of the novelty device 10 . the primary elements of the novelty device 10 is the stationary base 12 and the floating display member 14 which are coupled together by a suitable flexible cord or wire 16 . fig1 shows that a plurality of balloons 20 are each connected to the floating member 14 by a string . it would understood that it is not necessary to use the present invention with any specific number of balloons 20 . it has been determined that a plurality of balloons is most desirable , due to the extra upward force that they exert on the ornamental or display member 14 to pull it upwardly above the base member 12 so that it appears to float . however , a single balloon may be used if it is large enough so that it will lift the floating member . therefore , whenever this description indicates that a plurality of balloons is to be used , it should be understood that no specific number is indicated , and as few as a single balloon may be connected to the floating member . in the operation of the present invention , the floating member 14 is coupled to the balloons 20 by means of a string . the balloons are typically filled with a lighter - than - air gas , such as helium . this will result in the balloons exerting an upward force on the floating member , causing the floating member to be suspended above the stationary base 12 . the floating member is restrained by means of a flexible wire or cord 16 . the cord is fixedly attached to both the stationary base and the floating member . it will be readily apparent to those skilled in the art that a variety of different materials can be utilized for the cord 16 . for example , an elastic cord can be used . if it desired that the cord not be visible to the user of the novelty device , a transparent material such as nylon thread can be used . the stationary base in the preferred embodiment is manufactured from made from a suitable material such as cardboard . it is anticipated that the base member will have a decorative design or a written message printed or drawn on it for decorative or advertising purposes . thus , the material for the stationary base 12 should be chosen accordingly . in addition , the base should be of sufficient weight to anchor the floating member and balloons in place . the stationary base also has formed into it a receptacle 18 for supporting the floating member 14 when the floating member is not coupled to a balloon . the receptacle in the preferred embodiment takes the form of at least one longitudinal slit 18 that is formed into the top surface of the stationary base . the receptacle allows the floating member to be displayed in an upright position , and not laid flat , when not attached to a balloon 20 . it is anticipated that the stationary base in the preferred embodiment will be sold or provided in a flat configuration . the base will then be folded into its final shape by the user of the novelty device . the floating member 14 is made from a suitable material that is preferably lightweight . a lightweight material will allow the floating member to be suspended above the stationary base 12 by means of the upward force exerted by the lighter - than - air balloons . in the preferred embodiment , the floating member is made from a thin cardboard material . it will be apparent to those skilled in the art , however , that alternative materials can be used with equal effectiveness . for example , the floating member 14 can be manufactured from foam , heavy paper or other similar materials . a means for connecting the balloons 20 to the novelty device 10 is incorporated into the floating member . this attachment means can take a variety of arrangements . in the preferred embodiment , the attachment means consists of a small slit cut into the floating member . the slit is adapted to accept the string that is typically tied to the balloon . in an alternative embodiment , the attachment means may take the structure of a simple hole that passes through the floating member . the string may be tied to the floating member by the use of the hole . an example of this alternative embodiment of the attachment means is illustrated in fig4 . as with the stationary base 12 , the floating member 14 can be printed with a decorative design or message ( not shown ). in addition , the floating member can be cut to virtually any shape that is desired . the only limitation on the shape and arrangement of the floating member is that it not be too large so that it cannot be lifted by the balloons 20 . in the preferred embodiment of the present invention , the novelty device 10 consists of a single floating member 14 that is tethered to the stationary base 12 . it will be apparent to those skilled in the art , however , that multiple floating members 14 can be utilized within the scope and spirit of the present invention . for example , an alternative embodiment of the present invention may employ multiple floating units that are connected to the base . the floating units can be connected to the base by means of differing lengths of flexible cord 16 , if desired . fig3 shows this type of an alternative embodiment of the present invention . the description of the present invention has been made with respect to specific arrangements and constructions of a balloon novelty device . it will be apparent to those skilled in the art that the foregoing description is for illustrative purposes only , and that various changes and modifications can be made to the present invention without departing from the overall spirit and scope of the present invention . the full extent of the present invention is defined and limited only by the following claims .	0
the invention relates to a method and an apparatus for detecting labeled biopolymers , in particular nucleic acid fragments , in a gel matrix , with parallel fractionation being carried out in a multiplicity of microcapillaries filled with a gel matrix . two methods for dna sequencing are generally known , namely the chemical degradation method according to maxam and gilbert ( proc . natl . acad . sci . usa 74 ( 1977 ), 560 ; meth . enzymol . 65 ( 1980 ), 499 ) and the enzymatic chain termination method according to sanger et al . proc . natl . acad . sci . usa 74 ( 1977 ), 5463 ). in the maxam - gilbert method labeled dna molecules are chemically modified in a base - specific manner , partial strand termination is effected , the fragments obtained in this way are size - fractionated and the sequence is determined on the basis of said labeling . in the method according to sanger , starting from a dna template , a multiplicity of labeled nucleic acid fragments of different lengths are prepared by enzymatic elongation or extension of a synthetic oligonucleotide primer with the aid of polymerase and a mixture of deoxyribonucleoside triphosphates and chain termination molecules , in particular dideoxyribo - nucleoside triphosphates . the labeled nucleic acid fragments generated according to these and other techniques are usually fractionated via polyacrylamide gel electrophoresis in slab gels or individual capillaries using automatic sequencers . however , this entails the problem that only a limited number of sequencing reactions can be analyzed in parallel . it was the object of the present invention to provide a method for fractionating labeled biopolymers and , in particular , labeled nucleic acid fragments , which , at least partially , eliminates the disadvantages of the prior art and which makes possible in particular parallel fractionation and detection of a multiplicity of lanes . this object is achieved by a method for fractionating labeled biopolymers in a gel matrix , said method being characterized in that parallel fractionation is carried out in a multiplicity of microcapillaries filled with a gel matrix . the method of the invention makes possible the fractionation of labeled biopolymers , for example nucleic acid fragments , in particular dna or rna molecules , but also of other biopolymers such as peptides , proteins , saccharides . particular preference is given to using the method for fractionating nucleic acid fragment mixtures of different lengths , as are produced during a sequencing reaction . fractionation in the gel matrix is preferably according to size or / and charge of said biopolymers . suitable labels of said biopolymers are in particular nonradioactive labeling groups and particularly preferably labeling groups detectable by optical methods , such as , for example , dyes and in particular fluorescent labeling groups . examples of suitable fluorescent labeling groups are rhodamine , texas red , phycoerythrin , fluorescein and other fluorescent dyes common in sequencing . the labeled biopolymers are fractionated in parallel in a multiplicity of microcapillaries which may be integrated in a compact body , for example a plate or a block . in this connection , preference is given to using at least 10 3 microcapillaries and particularly preferably at least 10 5 microcapillaries , for example about 10 6 microcapillaries . the diameter of said microcapillaries is preferably essentially identical and may be in the range from preferably 0 . 5 μm to 10 μm and particularly preferably from 1 μm to 5 μm . furthermore , said microcapillaries have preferably essentially the same length which may be in the range from 5 mm or longer , preferably from 5 mm to 200 mm and particularly preferably from 5 mm to 100 mm and which is thus considerably shorter than in the case of conventional sequencing gels . examples of suitable arrangements which contain a sufficient number of microcapillaries are microchannel plates made of glass , as are employed as photomultipliers in nightsight detectors . these microchannel plates can be filled by capillary forces with a solution forming said gel matrix . the gel can be formed inside the capillaries after filling . a particularly preferred gel matrix is a denaturing polyacrylamide gel , for example a polyacrylamide urea gel . the biopolymers are fractionated in the micro - capillaries of the gel matrtix by electrophoretic and / or electroosmotic methods , applying , for example , an electric field between the two ends of the microchannel plate . owing to the short length of the microcapillaries , fractionation in the gel matrix may be , for example , in the range from 10 to 100 v , using a considerably lower voltage than for conventional sequencing gels . in a preferred embodiment , the fractionation method of the invention is carried out in combination with automatic sample application with positional addressing of the individual samples . for this purpose , it is possible to use , for example , appropriate inkjet or micropipetting apparatuses which are used to apply the mixtures to be fractionated in the particular microcapillaries , for example mixtures from a nucleic acid sequencing reaction , to individual openings of the microchannel plate . typically , a sample volume of from 10 − 12 to 10 − 6 per microchannel is applied . the method of the invention furthermore comprises preferably an automatic position - specific detection of the nucleic acid fragments fractionated in the microchannels . this position - specific detection may comprise confocal or / and time - resolved detection . in the case of the preferred fluorescent labeling groups , the fluorescent labels may be excited via an optical dot matrix , for example a dot matrix of laser dots generated by diffraction optics or a quantum well laser . the excited fluorescent groups can be detected by using a confocal detector matrix which may be an arrangement of fiber - coupled avalanche photodiodes or an avalanche photodiode matrix . as an alternative , it is also possible to use an electron detector matrix , for example a ccd camera , which makes time - resolved detection possible . the method of the invention makes possible parallel evaluation of up to more than 10 6 , for example 107 , individual channels . it is possible , for example , to carry out detection according to the method of fluorescence correlation spectroscopy ( fcs ) described in european patent 0 679 251 . this method preferably comprises measuring one or a few sample molecules in a measuring volume , the concentration of the molecules to be determined being & lt ; 10 − 6 mol / l and the measuring volume being preferably & lt ; 10 − 14 1 . for details of carrying out the method and details of the apparatuses used for said method , reference is made to the disclosure of european patent 0 679 251 . as an alternative , detection may also be carried out by time - resolved decay measurement , so - called time gating , as described , for example , by rigler et al : picosecond single photon fluorescence spectroscopy of nucleic acid , in : “ ultrafast phenomena ”, d . h . auston , ed . springer 1984 . in this case , the fluorescent molecules are excited in a measuring volume followed by , preferably with a time interval of & gt ; 100 ps , opening a detection interval on the photodector . in this way it is possible to keep background signals generated by raman effects sufficiently low in order to enable essentially interference - free detection . the invention further relates to an apparatus for size fractionation of labeled nucleic acid fragments , comprising ( b ) means for automatic sample application into said microcapillaries with positional addressing and ( c ) means for automatic position - specific detection of nucleic acids in said microcapillaries . the apparatus may furthermore comprise automatic manipulation devices for positioning microchannel plates in automatic sequencers , heating or cooling equipment such as peltier elements in order to keep the temperature essentially constant , reservoirs and , where appropriate , supply lines for sample fluids and reagents and also electronic evaluation devices . the method of the invention and the apparatus of the invention may be used for all electrophoretic and electroosmotic methods , for example for fractionating products of a nucleic acid sequencing reaction , for analyzing protein fragments or for genome , transcriptome or proteome analysis . furthermore , the present invention is intended to be illustrated by the following figures and examples in which : [ 0024 ] fig1 shows the diagrammatic representation of an apparatus suitable for carrying out the method of the invention . the apparatus contains a microchannel plate ( 2 ) with about 10 6 microchannels ( 4 ) for fractionating nucleic acid fragments . the apparatus furthermore contains an inkjet apparatus ( 6 ) for automatic sample application into individual microcapillaries with positional addressing and an automatic position - specific detector ( 8 ) which can be used to detect labeled nucleic acids which have migrated through said microcapillaries . the nucleic acids migrate in an electric field ( from minus to plus ). [ 0025 ] fig2 shows a cross section through a microchannel plate . the microchannels ( 4 ) are filled with a gel matrix , for example a polyacrylamide / 6 m urea gel .	2
referring to fig1 it is possible to view the various major elements constituting the present invention ( 10 ). the present invention has four major elements . these elements are the substrate ( 20 ), the current supply means ( 30 ), the current receiving means ( 40 ) and the sensor bridge ( 50 ). the substrate ( 20 ) is an electrically non - conductive material such as glass . however , any electrically non - conductive material may be used . any substrate which can support a uniform high quality film could be used for the manufacture of the polymer based bolometers . for example , the bolometers could be made on aluminum oxide , quartz , a variety of polymers , or even conductive substrates , such as metals or semiconductors , which have an insulating layer deposited on them . this freedom and flexibility allows the ability to choose a substrate which has a low thermal conductivity which would result in better detector response . the current supply means ( 30 ) is an electrically conductive pathway such as gold . a variety of conductive materials may be used , such as metals , highly conductive polymers , highly doped semiconductors , or any method of forming electrical interconnects or pathways which would be familiar to one skilled in the art . similar to current supply means ( 30 ) is the current receiving means ( 40 ). the current receiving means is also an electrically conductive pathway such as gold . the current supply means ( 30 ) and current receiving means ( 40 ) are electrically isolated from each other . connecting the supply and receiving means is the sensor bridge ( 50 ). this element is connected to the supply means at ( 51 ) and ` bridges ` over the substrate ( 20 ) to connect with the receiving means at ( 52 ). it is desirable for the bridge to avoid contact with the substrate so as to decrease loss of heat from thermal conduction to the substrate . the sensor bridge of the present invention is a polymer which has been made electrically conductive by ion implantation . the polymers for implantation can be copolymers of styrene with nitrile - containing acrylic polymers such as polyacrylonitrile or polymethacrylonitrile . other polymers which can be conveyed in an organic solvent or water can be used . they include soluble acrylic polymers , polyethers , and polyimides and their precursors , polyesters , polyurethanes , polysulfones , polybenzocyclobutanes , phenolformaldehyde resins , or soluble versions of polyaniline or other intrinsically conductive polymers . while the term polymer is used throughout , it is understood that oligomers , thermosetting polymer precursors , or other organic compounds which can form a continuous , high quality film on a substrate , or those materials which can form free - standing films , can be employed . implantation is conducted using positive ions ( preferably nitrogen , but other ions can be used ). the conductivity of the implanted polymer is a strong function of the fluence , the ion energy , the polymer type , and polymer thickness . using 50 kev ions , fluences greater than 1 × 10 15 ions / cm 2 can be used , with the preferred fluence being greater that 1 × 10 16 ions / cm 2 . ion energy can range from 25 kev to 20 mev , with the preferred range from 35 - 250 kev . the implanted films are highly resistant to corrosive chemicals , organic solvents , and moisture , and do not change resistance on exposure to chemicals which are solvents for the unimplanted , precursor polymer . the excellent solvent resistance enables the spincoating , exposure , and patterning of photoresist , and the etching of underlying layers without changing the resistance of the polymer film . another advantage to the polymer composition is that such a bolometer is unaffected by magnetic interferences . this is due to the organic nature of the polymer sensor bridge . to test the level of magnetic inference of the present invention the resistance of a 1 - inch × 1 - inch sample was measured when exposed to a magnetic field of 10 , 000 gauss . less than 1 % change in resistance occurred . this obviates the need for complex film arrangements as disclosed in u . s . pat . no . 4 , 371 , 861 . additionally , fig3 is a graph which shows the resistance - temperature ( r / t ) behavior of a nife permalloy and several ion implanted films . the steepness of the resistance - temperature curve in all cases is equivalent to or greater than the ni - fe permalloy material which is magnetic field sensitive and has the low resistance limitations discussed in the previous section . polysilicon has been used in the prior art as the sensing material . the ion implanted polymer materials have several advantages over doped polysilicon . polysilicon is typically deposited by chemical vapor deposition at a temperature greater than 600 ° c . doping is achieved by ion implantation or by diffusion . doping of polysilicon by ion implantation requires a high temperature annealing step . the high temperature processing required for polysilicon deposition is not compatible with cmos circuitry which may be needed on the same chip as the ir detector . in addition , doping of polysilicon by diffusion to an intermediate conductivity is extremely difficult to control and the resulting conductivity may not be uniform , as described in s . ghandi , vlsi fabrication principles , 2nd ed . ( 1994 ). finally , polysilicon deposition requires the handling of silane gas , which is highly flammable . the ion implanted polymer process is a low - temperature , safe process which results in highly uniform properties . furthermore , the present invention has a higher resistivity . tests have shown a sheet resistivity from 200 to 2 × 10 7 ohms / square . when compared to detectors using permalloy materials ( e . g ., u . s . pat . no . 5 , 300 , 915 ), which typically have a resistance of 13 ohms / square , the advantages of the present invention are significant . to achieve a resistance of 50 , 000 ohms , for example , the detector of u . s . pat . no . 5 , 300 , 915 would require a length to width ratio of 1 to 0 . 00026 ( a line 15 microns wide and 57 , 700 microns long !). the present invention would require a length / width ratio of 1 to 1and would exhibit a much improved tcr . also , there are several advantages to using a polymer - based sensor bridge . specifically , a polymer has a lower detector mass and therefore a lower heat capacity . this means that the detector will exhibit a larger temperature change when exposed to the same ir radiation than will a detector with a larger heat capacity . also , since the polymer is also the bridge structure , thermal losses due to thermal conductivity of the bridge itself is minimal / miniscule . thermal conductivity can be further reduced by using the conductive polymer as the supply and receiving means . as an example , compare a bolometer made using the materials of the present invention as opposed to the design in u . s . pat . no . 5 , 260 , 225 . for a fair comparison , using the equations quoted in the patent and replacing the values of heat capacity , thermal conductivity , and tcr as appropriate for the present materials ( 2 . 8 × 10 - 10 j / k , 8 . 8 × 10 - 8 w / k , 2 %/ k , respectively ), gives a factor of seven improvement in the figures of merit ( responsivity and detectivity ). although polymers are intrinsically good infrared absorbers , additional improvements can be realized by coating the sensor bridge with an ir absorber or by loading the polymer itself with an ir absorbing dye which would simplify processing even further . furthermore , since the values of interest ( tcr , resistance , etc .) occur on plateaus for the polymeric materials , not on steep curves as for the doped polysilicon , they are much more stable to process variations which vastly improves their manufacturability and uniformity over any existing detector materials . consider as a further example a four - inch diameter silicon wafer with a two - micron thick oxide layer . four resistors measuring approximately 2 mm by 2 mm patterned from implanted poly ( styrene - co - acrylonitrile ) distributed over a several square inch area exhibited a temperature coefficient of resistance of 2 %/ k ± 0 . 03 %/ k . the 1 . 5 % variation attributable to temperature measurement errors . finally , the materials of the present invention strongly adhere to the substrate and the bridge and the detector elements are all fabricated from the same material , obviating concerns about delamination or adhesion which plague multilayered structures . to manufacture the present invention , conventional photolithographic techniques may be utilized . the manufacture of the present invention includes steps common in the semiconductor industry . the electrical interconnects ( the current supply means and the current return means ) are deposited on a silicon wafer substrate on which a 2 micron thick silicon oxide has been grown . the interconnects or pathways are then patterned by photolithography . a polymer film is deposited by spin coating or other techniques , such as roller coating or meniscus coating , which can be used to form a high quality thin film . the film is then implanted with energetic ions to a fluence of preferably 5 × 10 16 ions / cm 2 . the sensor bridge is patterned by coating with photoresist and imaging the resist to form an etch mask . the implanted polymer film is removed , where not protected by the photoresist mask , by reactive ion etching . the photoresist may then be removed by an appropriate solvent . the sensor bridge may be released from the substrate to form a free standing bridge by dissolving the silicon oxide in hydrofluoric acid . the detector elements are released before significant undercutting of the interconnects or pathways occurs . albeit this is the preferred method of forming the sensor , it is not the only method available to those skilled in the art and a variety of methods may be used to form the sensor bridge utilizing a variety of substrates and pathways . a single detector can range from approximately 5 microns by 5 microns in size to 50 microns to 50 microns . the patterned devices may be packaged by standard techniques . it will be obvious to those skilled in the art that various changes may be made without departing from the scope of the invention and the invention is not to be considered limited to what is illustrated in the drawings and described in the specification .	8
although only two preferred embodiments of the invention are explained in detail , it is to be understood that the invention is not limited in its scope to the details of construction and arrangement of components set forth in the following description or illustrated in the drawings . the invention is capable of other embodiments and of being practiced or carried out in various ways . also , in describing the preferred embodiments , specific terminology will be resorted to for the sake of clarity . it is to be understood that each specific term includes all technical equivalents which operate in a similar manner to accomplish a similar purpose . referring now more specifically to the drawings , and to fig1 in particular , the reference numeral 10 generally designates a basically conventional lip die including a lower lip 12 which is to be considered substantially rigid and an upper lip 14 which includes a longitudinally extending groove defining a flexure zone 16 . the flexible or upper lip 14 includes longitudinally spaced mounting bosses 18 from which physical pressure developing thrust elements 20 are adjustably supported . the thrust elements 20 may comprise thermobolts or servomotor controlled threaded bolts or the like . the lips 12 and 14 define an extrusion opening in the form of a slot or slit 22 therebetween through which heated polymers may be extruded in order to extrude a thin polymer web 24 from the exit opening 26 of the die 10 . the extruded web 24 may be acted upon by a calender roll stack referred to in general by reference numeral 28 in the manner illustrated and a downstream gauge scanning mechanism referred to in general by the reference numeral 30 is provided for monitoring the thickness of the web 24 at position points spaced along the width of the web 24 corresponding to the spacing of the thrust elements 20 along the lip 14 . feedback signals from the gauge scanner mechanism 30 are fed to a computer 32 which in turn supplies electrical current through wires 34 to the thrust elements 20 via the latter servomotor driven threaded bolts or electrically heated thermobolts . the foregoing is conventional lip die and lip die controlling structure for the production of polymer webs such as the web 24 . in some instances , the calender roll stack 28 and die 10 may be mounted for relative horizontal movement toward and away from each other and also for relative vertical shifting . the modified form of the conventional structure incorporating the present invention , as illustrated in fig1 and 1a , includes a first set of higher wattage rod heaters 36 embedded in the lip 14 in alignment with the thrust elements 20 and a second set of lower wattage rod heaters 38 embedded in the lip 14 adjacent the exit opening 26 at points spaced preferably equidistant between the larger wattage rod heaters 36 . preferably , the larger wattage heaters 36 are 50 watt rod heaters and the lower wattage heaters 38 are 25 watt rod heaters . the rod heaters 36 and 38 are actuated by wires 40 and 42 extending from the computer 32 . in operation , the modified scanner mechanism 30 measures the thickness of the web 24 downstream from the calender roll stack 28 and provides signals to the computer 32 . the signals provided to the computer 32 are then processed and the thrust elements 20 , whether thermobolts or bolts under the control of servomotors or other similar elements , are actuated in order to maintain at least a coarse uniform thickness of the web 24 . in addition , the rod heaters 36 and 38 are actuated in order to achieve finer adjustments in the web thickness . the larger wattage rod heaters 36 registered with the thrust structures 20 are used to achieve slight adjustments in the web thickness achieved by the thrust elements 20 while the lower wattage rod heaters 38 , spaced intermediate adjacent rod heaters 36 , are used to make fine adjustments in the web thickness intermediate the areas of the web controlled by the thrust elements 20 and the higher wattage rod heaters 36 . the polymer extruded from the die 10 to form the web 24 is maintained , substantially , at a predetermined temperature as it enters the slot or slit 22 to be extruded between the lips 12 and 14 . the thrust elements 20 are spaced apart preferably about 1 inch longitudinally along the lip 14 . inasmuch as the rod heaters 36 are preferably aligned with the thrust elements 20 , the heaters 36 are spaced apart longitudinally along the lip 14 the same distance as elements 20 . inasmuch as the rod heaters 38 are preferably spaced centrally intermediate adjacent rod heaters 36 and equidistant between the latter , the spacing between the centers of adjacent rod heaters 36 and 38 is generally ½ inch . if the computer senses a longitudinal zone of the web 24 which is thinner than desired , the rod heater 36 or 38 corresponding to that longitudinal zone of the web 24 is actuated , or has its heat output increased , with the result that extra heat , a matter of a few degrees increase , will allow some lateral flow of polymer into the hotter areas , as polymer being extruded from the die 10 follows the path of least resistance with the additional heat providing the reduction in resistance to polymer flow . the actuation and control of the rod heaters 36 and 38 along the lip 14 drastically reduce response time as well as provide a higher degree of point - to - point gauge variation control of the polymer sheet in extrusion . in areas of low gauge thickness the application of power to the lip heater in line with the mechanical die lip thrust element speeds the flow of polymer into the lip area in question to more quickly force the die lip open and at the same time build up the low gauge area due to the lateral flow of polymer into the lower gauge area . the smaller wattage rod heaters 38 located halfway between the larger wattage heaters 36 allow for greater point - to - point gauge control by enhancing lateral “ fill in flow ” between the primary mechanical lip thrust elements 20 . a modified form of the present invention is illustrated in fig2 . die 110 corresponds to the die 10 of fig1 in every respect except that the lip 114 of the die 110 includes a second groove or flexure zone 117 , in addition to the flexure zone 116 corresponding to the zone 16 , extending longitudinally of the lip 114 . the various components of the die 110 corresponding to similar components of the die 10 illustrated in fig1 being designated by numerals in the 100 &# 39 ; s series corresponding to the numerals appearing in fig1 . as may be seen from fig3 a first set of higher wattage rod heaters 136 are embedded in the lip 114 in alignment with the thrust elements 120 and a second set of lower wattage rod heaters 138 are embedded in the lip 114 adjacent the exit opening 126 at points spaced equidistant between the higher wattage rod heaters 136 . similar to the rod heaters 36 and 38 actuated by wires 40 and 42 , the rod heaters 136 and 138 are actuated by corresponding wires 140 and 142 , with the thrust elements 120 being actuated by wires 134 corresponding to the wires 34 . the operation of the die 110 is substantially identical to the die 10 , with the exception that the second flexure zone 117 in the lip 114 operates in addition to flexure zone 116 . the rod heaters 136 and 138 increase or decrease the lip temperature in various longitudinal zones of the web 124 depending upon the signal transmitted based upon measuring the downstream gauge thickness of the extruded web 124 . by increasing the temperature , the lateral “ fill in flow ” is increased which enables a higher pressure of the polymer being extruded to act upon the opposing surfaces of the die lips 112 and 114 in the area of higher temperature . this causes a very slight additional flexure in the flexure zone 117 of the die lip 114 in the affected area to extrude more polymer therethrough and thus increase the extruded web gauge . since the rod heaters 136 and 138 operate in a separate flexure zone 117 in the fig2 - 3 embodiment , closely adjacent the exit 126 , this is an advantage of the die lip 114 over the die lip 14 . while heaters 36 and 38 in die 10 and heaters 136 and 138 in die 110 are illustrated in the drawings and described herein as rod heaters , other type heaters could be used at spaced locations along die lips 14 and 114 , respectively . similarly , while higher and lower wattage rod heaters are preferred with the wattage ratio preferably about 2 : 1 , and 50 watts and 25 watts , respectively , most preferred , single sized heaters could be employed at selected locations along the die lip to be heated in accordance with the present invention . such selected locations also do not have to coincide with the thrust elements 20 and 120 so long as the locations are coordinated with the gauge monitoring locations for activating and deactivating the appropriate heating element or elements . further , while the generally 45 ° positioning of the heaters 36 and 38 in the upper lip 14 , as well as the similar mounting of the heaters 136 and 138 in the lip 114 , enable the tip dies 10 and 110 to be positioned with the exit openings 26 and 126 closely adjacent the pinch areas between the upper two rolls of the corresponding calendar roll stack , the heaters 36 , 38 , 136 and 138 may be disposed at other angles , including vertically , or even oppositely inclined , if desired . still further , the use of the heaters in the die lip to control the gauge distribution of polymers extruded from flat sheet or film dies may for certain applications also be used as a “ stand alone control ”, exclusive of any mechanical assemblies discussed above as part of the prior art . thus , the heaters 36 , 38 , 136 and 138 may be used in conjunction with appropriate controls and gauge scanner mechanism without any thrust elements 20 or 120 as disclosed herein . the use of the heaters 36 , 38 , 136 and 138 in the die lip also can apply to any flat extrusion die , whether in a sheet application associated with calendar rolls , or in a cast film application in association with a single chill roll . moreover , the use of the heaters in the die lip to control the distribution of polymers extruded from the die in accordance with the present invention may also be employed in other extrusion processes , with a variation in the placement of the heaters in the lip according to the type of die in question . for example in the case of blown film dies , the heaters would be placed in a circular arrangement around the outer ( or even the inner ) section of the annular blown film die adjacent the die lip . in this arrangement , heat applied to the die lip via a feedback signal from the gauge scanner mechanism would allow some lateral flow of polymer into the heated areas , as the polymer follows the path of least resistance with the additional heat providing the reduction in resistance . the increased polymer flow would not increase the die opening in the heated area but would increase the web thickness in the desired location . in addition , the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and , accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .	1
in one aspect , an embodiment of the present invention described below applies field weakening control in an ac motor drive system to maximize efficiency and power density by fully utilizing available dc bus voltage and minimizing the inverter current dynamically , and to ensure stable system operation when in a voltage limiting mode . in one embodiment , field weakening is initiated at a point that is adjusted , “ on line ,” based on dc link voltage , which is typically not fixed in certain environments , such as on aircraft . in one implementation , transition to field weakening is achieved automatically and smoothly , without the need for a look - up table or knowledge of system parameters . in an embodiment of the present invention described below , a field weakening reference current is always maintained under the voltage limit condition , while a torque reference current is controlled with the limit of available dc bus voltage and the voltage that has already been used for generating the required field generating current . thus , the field current demand has higher priority than the torque current under the limitations of both dc link voltage and inverter maximum current . in this way , a stable field is always guaranteed , which is a basic condition of a stable operation for a motor drive system . fig1 illustrates an exemplary voltage source inverter feed vector controlled ac motor drive to which principles of the present invention may be applied . as illustrated , the ac motor drive system 10 includes : a dc link voltage input 15 ; a voltage source inverter 20 receiving dc power from the dc link voltage input 15 ; a pulse width modulation unit 35 , which controls gating of the voltage source inverter 20 ( e . g ., utilizing a configuration of insulated - gate bipolar transistors ( igbts )) so that the inverter 20 converts supplied dc voltage to multi - phase ac power ; an ac motor 30 , which is supplied multi - phase ac power via the inverter 20 ; and a control unit 100 for generating direct -, quadrature - axis inverter command reference voltages ( v d , v q ). an lc filter 25 may be included on the ac side of the inverter 20 . the system 10 includes a transforming unit 60 for transforming multi - phase line current values i a , i b , i c to d - q reference frame quantities i q , i d ( e . g ., using well known clark and park transforms ), which are input to the control unit 100 . an additional transform unit transforms voltage reference signal v d , v q output by the control unit 100 to multi - phase voltage commands v a , v b , v c or stationary stator frame voltage commands v α , v β . a speed sensor or speed estimator 50 determines rotor positioning / speed of the rotor of the ac motor 30 . vector control or field - oriented control is one technique used in motor drives to control the speed and torque of ac motors . the control is conducted in a synchronous reference frame , i . e ., the d - q frame . with this technique , motor stator current is resolved into a torque producing ( q - axis ) component of current , i q , and a field producing ( d - axis ) component of current , i d , where the q - axis leads the d - axis by 90 degrees in phase angle . the terminal voltage of the inverter is also resolved into the d - axis and q - axis components . as shown in fig1 , the phase angle of the synchronous reference frame can be from a speed / position sensor or from a speed estimator ( i . e ., for a speed sensorless controlled system ). the q - axis current reference is typically output by a speed controller or a torque controller . the d - axis current reference is typically output from a field - weakening controller . the error signals between reference current and actually detected current are fed into a regulator to create inverter output voltage reference signal or modulation index . in the system 10 illustrated in fig1 , it should be apparent to those of ordinary skill in the art that different pwm techniques may be used to generate pwm gatings . the dc link voltage input 15 may be from a dc power supply or battery unit . the torque current reference could be from a speed controller , a torque controller or a torque current profile . the current regulation performed by the control unit 100 could be applied with or without feedforward terms . the voltage source inverter 20 could be any topology inverter that converts dc voltage to variable frequency and amplitude ac voltage . the system 10 could be with or without the ac side output lc filter 25 . the ac motor 30 could be permanent magnet , wound - field , synchronous reluctance motor or induction motor . the control unit 100 may be implemented using digital signal processing circuitry , analog circuitry , application specific integrated circuit ( s ) ( asic ), various combinations of hardware / software , etc . the achievable output voltage and current of the inverter 20 are determined by the physical power ratings of the inverter 20 and the motor 30 and dc link voltage input 15 . this relationship is illustrated mathematically as follows : v d 2 + v q 2 ≦ v max 2 , i d 2 + i q 2 ≦ i max 2 where v max and i max are maximum inverter voltage and current . as explained in detail below , embodiments of the present invention provide a voltage limit mechanism and a close - loop field weakening control loop . no lookup table and no system parameters are required in the field - weakening loop . fig2 is a general block diagram illustrating functional components of the control unit 100 in accordance with an embodiment of the present invention . as illustrated , the control unit 100 includes : a d - axis ( field ) current regulating unit 110 ; a q - axis ( torque ) current regulating unit 120 ; and a field weakening control unit 140 . the control unit 100 further includes : a d - axis voltage reference limiter 130 , which limits a d - axis current regulator output voltage ( v d ′) generated by the d - axis current regulating unit 110 , thereby outputting the d - axis inverter command reference voltage ( v d ); and a q - axis voltage reference limiter 160 , which limits a q - axis regulator output voltage ( v q ′) output by the q - axis current regulating unit 120 , thereby outputting the q - axis inverter command reference voltage ( v q ). the control unit 100 further includes : a q - axis voltage limit calculator 150 ; and a q - axis current component limit calculator 152 . fig3 is a block diagram illustrating , in greater detail , an arrangement for the control unit 100 according to an embodiment of the present invention . as illustrated , the d - axis current regulating unit 110 includes : a summing element 112 for summing a field weakening reference signal ( i d ″) output by the field weakening control unit 140 and the rated field current ( i dr ), thereby generating a d - axis current reference signal ( i d ); a comparing element 114 for generating an error signal based on the difference between the d - axis current reference signal ( i d ) and the detected d - axis inverter output current ( i d ); and a regulator 116 for generating the d - axis current regulator output signal ( v d ′) based on the error signal . as illustrated , the q - axis current regulating unit 120 includes : a speed or torque control element 122 for generating a speed or torque control loop output signal ( i q ′); a q - axis torque current reference signal limiter 124 for limiting i q ′, thereby outputting the q - axis current reference signal ( i q ); a comparing element 126 for comparing the q - axis current reference signal ( i q ) with a detected q - axis inverter output current ( i q ) to generate an error signal ; and a regulator 128 for generating the q - axis current regulator output signal ( v q ′) based on the error signal . the field weakening control unit 140 includes : an absolute value calculator 142 for calculating the amplitude of the q - axis current regulator output signal v q ′; a comparing element 144 , which produces a q - axis voltage error signal as the difference between the output of absolute value calculator 142 and the output of the q - axis voltage limit calculator 150 ; a polarity calculator 145 for determining the polarity ( sign ) of the error signal generated by the comparing element 144 ; a regulator 146 for regulating a field weakening control signal based on the output of the polarity detector 145 , thereby generating a field weakening current reference signal ( i d ′); and a limiter 148 for limiting the field weakening current reference signal ( i d ′) based on a field weakening current limit ( i dl ), thereby generating the field weakening reference signal ( i d ″) that is output to the d - axis current regulating unit 110 . in the embodiment illustrated in fig3 , the d - axis voltage reference limiter 130 includes a max voltage calculator 132 for calculating maximum voltage available to the inverter 20 as a ratio ( k ) of the dc link voltage ( v dc ) from the dc link voltage input 15 ; and a limiter 134 for limiting the d - axis current regulator output signal ( v d ′) based on v max , thereby outputting the d - axis inverter command reference voltage ( v d ). this embodiment assumes the dc link voltage v dc changes dynamically . it should be recognized , however , the principles of the present invention are applicable to the simpler case in which v dc is fixed . in such as case , it is not necessary to dynamically calculate v max , which instead will be a constant value . although elements of the control unit 100 are shown as discrete elements , it should be recognized that this illustration is for ease of explanation and that functions of these elements may be combined in the same physical element , e . g ., in the same microcontroller or in one or more application - specific integrated circuits ( asic ). additional aspects of the operation of the elements illustrated in fig2 and 3 will become apparent from the following description . the d - axis current regulating unit 110 generates the d - axis current reference signal i d based on the result of the field weakening control loop implemented by the field weakening control unit 140 . the q - axis current regulating unit 120 generates the q - axis current reference signal i q * from the speed or torque control loop output signal i q ′ ( from the speed or torque control unit 122 ) through the limiter 124 , which applies a limit level (√{ square root over ( i max 2 − i d * 2 )}) calculated by the q - axis current component limit calculator 152 . i max is the maximum current the inverter 20 can provide . both of the d - axis and q - axis current reference signals i d * and i q * are compared , by comparing elements 114 , 126 , respectively , with detected d - axis and q - axis inverter output current signals i d and i q to produce current error signals . the current error signals are fed into d - axis and q - axis current regulators 116 , 128 to generate d -, q - axis current regulator output signals v d ′ and v q ′. the d - axis current ( field generating component of the stator current ) regulator output signal v d ′ is sent to the limiter 134 , with limit level ± v max , to create final d - axis inverter command reference voltage v d . v max is the maximum voltage the inverter 20 can create , which is proportional to the dc link voltage v dc . the ratio k between v dc and v max depends on the pwm method adopted . since v d ′ is usually far away from v max , d - axis current actually can be controlled without voltage limit . in this way the d - axis current is always under control , i . e ., a solid air gap flux can be achieved in transient and steady state , which is advantageous to motor stable operation . the q - axis current ( torque generating component of the stator current ) regulator output signal v q ′ is sent to the limiter 160 , with the limit level ±√{ square root over ( v max 2 − v d 2 )} calculated by the q - axis voltage limit calculator 150 , to create the final q - axis inverter command reference voltage v q . this limit mechanism 160 can ensure that there is no over modulation during transient and steady state , if required , which can prevent high frequency resonance for the drive systems with ac side output lc filters 25 . the field weakening control unit 140 is part of an outer q - axis voltage regulation loop to generate a field - weakening current reference signal . the goal of this loop is to output a signal that allows the d - axis current regulating unit 110 to adjust the d - axis current reference signal i d to make the amplitude of the output signal of the q - axis current regulator \| v q ′\| lower or equal than limit level √{ square root over ( v max 2 − v d * 2 )}. in this way , there is √{ square root over ( v d ′ 2 + v q ′ 2 )}≦ v max i . e ., d - axis and q - axis current loops can be fully controlled without voltage limit . to achieve this , the comparing element 144 of the field weakening control unit 140 compares the amplitude of the q - axis current regulator output signal \| v q ′\| with √{ square root over ( v max 2 − v d * 2 )} to produce a q - axis voltage error signal . this error signal , or the sign of this error signal as determined by the polarity calculator 145 ( optional ), is fed into the regulator 146 to generate the field weakening current reference signal i d ′. i d ′ is sent into the limiter 148 with limit level − i dl to 0 to create the field weakening reference signal i d ″ that is sent to the d - axis current regulating unit 110 . i dl is the field weakening current limit to prevent deep demagnetization of rotor permanent magnets . the sum of the field weakening reference signal i d ″ and the rated field current i dr , as calculated by the summing element 112 , is the final d - axis current reference signal i d . for an induction motor , the rotor magnetizing field is excited by stator current , i dr is the rated field current . when motor speed is lower than base speed , i d ″ is zero and i d will be i dr . after motor speed is higher than base speed , i d ″ is a negative value and i d * will be lower than i dr . field will be weakened to lower down back emf to achieve field weakening operation . for synchronous motors , rotor magnetizing field is excited by the rotor itself . i dr is set to zero . when motor speed is lower than base speed , i d ″ is zero and i d ′ will be zero i . e ., no field weakening is applied . after motor speed is higher than base speed , i d ″ is a negative value and i d * will also be negative , i . e ., field weakening will be applied . if the error signal output by the comparing element 144 of the field weakening control unit 140 is used by the regulator 146 to generate field - weakening current , the field weakening control loop parameters will be important for the stability of the system . better dynamic performance , however , can be achieved . for the system with lenient dynamic performance requirements , the sign of the error signal for field weakening current adjustment , as calculated by the polarity detector 145 of the field weakening control unit 140 , is more preferable because the tuning of the field weakening control is simplified . in the above - described embodiment , the field weakening reference current is always maintained under the voltage limit condition , while the torque reference current is controlled with the limit of available dc bus voltage and the voltage that has already been used for generating the required field current . thus , the field current demand has higher priority than the torque current under the limitations of both dc link voltage and inverter maximum current . in this way , a stable field is always guaranteed , which is a basic condition of a stable operation for a motor drive system . the above - described embodiment achieves this effect by applying the following logic : 1 ) first , the field weakening i d * is only limited by i dl , which is maximum allowable field weakening defined by the system . 2 ) second , v d ′ required by i d * is only limited by v max , which is defined by the system ( max . available dc bus ). 3 ) then , the torque i q * is limited by √{ square root over ( i max 2 − i d * 2 )}, where i max is defined by the inverter capability . 4 ) fourth , v q * required by i q * is limited by √{ square root over ( v max 2 − v d * 2 )}. as described above , the embodiment illustrated in fig3 assumes that the dc link voltage v dc changes dynamically . it should be recognized , however , the principles of the present application are applicable to the simpler case in which v dc is fixed . in such as case , it is not necessary to dynamically calculate v max , which instead will be a constant value , and there is no need for dc link voltage detection . in such an implementation , a maximum modulation index ( d max ) for the inverter can be adopted for control , instead of the dynamically changing v max . in this scheme , the output signals of the d - axis and q - axis current regulating units , 110 , 120 , are inverter modulation index signals d d ′ and d q ′, instead of v d ′ and v q ′. the limits imposed on d d ′ and d q ′ are d max and √{ square root over ( d max 2 − d d 2 )}, respectively , instead of v max and √{ square root over ( v max 2 − v d * 2 )}. the field weakening control error signal is √{ square root over ( d max 2 − d d 2 )}−\| d q ′\| instead of √{ square root over ( v max 2 − v d * 2 )}−\| v q ′\|. other aspects remain the same . this simplified embodiment may be applied , for example , to a battery fed system .	7
fig1 shows a disc 1 . 1 which is manufactured according to known manufacturing techniques that have been in use for many years now in the manufacture of conventional records . the disc 1 . 1 is provided with an absolute time - code signal by making use of a time - code generator 1 . 2 controlling a modulator 1 . 3 which supplies a carrier frequency modulated by the time - code generator 1 . 2 and which is applied to the disc 1 . 1 as the only signal . block 1 . 4 shows the conventional manufacturing method of recording , making of the master disc , and pressing the final vinyl disc 1 . 1 . the disc 1 . 1 can be placed on a turntable 1 . 5 of a record player 1 . 6 , which is further provided with an arm 1 . 7 and a pick - up element 1 . 8 . the pick - up element 1 . 8 can follow the groove in the disc 1 . 1 that comprises the absolute time - code signal , and the pick - up element 1 . 8 is connected to the apparatus part 1 . 9 for demodulating the carrier signal in order to provide the ( digital ) time - code signal , which serves for the control of the digital audio source 1 . 10 , for instance a cd player , a dvd player , an mp3 reproduction device , or the like . the operation of the apparatus part 1 . 9 according to fig1 will hereafter be further elucidated with reference to fig2 . the operation of the digital audio source 1 . 10 which stands under control of the time - code signal will hereafter be further elucidated with reference to fig3 . referring now first to fig2 , it is shown that the signal that is derived from the pick - up element 1 . 8 according to fig1 , is fed to a input buffer 2 . 1 from which a signal may be finally led to a mixing table 2 . 2 in order to provide for the situation that the turntable 1 . 5 according to fig1 carries a conventional analogue vinyl record . the just - mentioned input buffer 2 . 1 feeds a preamplifier 2 . 3 , provided with a low rejector circuit , and which feeds in turn an analogue / digital converter 2 . 4 , for instance a 16 - bit or 20 - bit converter , depending on the desired resolution . the reference numerals 2 . 5 , 2 . 6 and 2 . 7 refer to a digital filter , the operation of which depends on , inter alia , the speed of movement of the disc 1 . 1 according to fig1 vis - a - vis the pick - up element 1 . 8 . the apparatus part 2 . 7 of fig2 may comprise a phase - locked loop circuit for detecting and following the carrier frequency which is provided on the disc 1 . 1 according to fig1 . in the current implementation , however , use is made of a moving average filter supplemented with detection means for detecting a stand - still of the disc 1 . 1 . furthermore , demodulation takes place in the circuit of apparatus part 2 . 6 for demodulating the time - code signal that is modulated on the carrier frequency . although the above subject matter is shown and explained as the signal in a single channel , it is preferable according to the invention that a left and a right channel is present , and that the detection apparatus which forms part of the digital filter 2 . 5 , 2 . 6 , 2 . 7 is made in duplicate so as to allow a phase difference between the left and the right channel carrying the demodulated time - code signal to be determined . in this manner , the correct place and direction of movement of the disc 1 . 1 in relation to the pick - up element 1 . 8 according to fig1 can be determined with high resolution . the phase difference between the left and right channel is useful to extract the directional information very quickly when the pick - up element 1 . 8 is suddenly lowered onto the rotating disc 1 . 1 . the absolute time - code which is determined from the carrier frequency is subsequently used together with the relative time - code , which is based on the difference between the left and the right channel , to determine an accurate time - code signal 2 . 10 which serves to control the digital audio source 1 . 10 as shown in fig1 . the time - code signal 2 . 10 of fig2 is therefore read into apparatus part 3 . 1 ( see fig3 ) of the digital audio source , wherein same provides a direct control of a digital audio reader 3 . 2 reading the desired digital information from the correct place of for instance a cd disc . this digital audio information is being transferred from apparatus part 3 . 2 to a digital output filter 3 . 5 which is being controlled by control logic 3 . 4 , and which determines from the time - code signal which is read into apparatus part 3 . 1 , the speed of change of the time - code signal . this speed of change signal which is derived from the time - code signal , determines the parameters of the digital output filter 3 . 5 . in a manner known to the expert , the digital output filter 3 . 5 can then feed a digital electric output socket , a digital optical signal output , or a d / a converter . this last provision is shown in the figure with reference numeral 3 . 6 . the present invention has been described in terms of preferred embodiments , however , it will be appreciated that various modifications and improvements may be made to the described embodiments without departing from the scope of the invention .	6
the present invention is described with reference to the enclosed figures . fig1 illustrates the support 10 for a tissue or toilet paper box of the present invention . the support 10 comprises a horizontal platform 12 suspended by two arms 13 . the two arms 13 extend upward and are bent outward at an angle . the arms 13 support the platform 12 and connect to a toilet paper holder 18 . this is the critical element . the platform has a flat bottom 15 with side walls 17 which hold and support a box 14 . it is to be realized that the box 14 is not an essential part of the invention . the tissue box 14 encloses tissues to be dispensed . the box which will dispense toilet paper or standard facial tissue 14 has at least two apertures 16 which permit tissues to be loaded and dispensed . the box 14 and supports may be constructed from a variety of materials , including metal , wood and plastics . in operating the supports attributed to a toilet paper holder via the arms 13 . the arms are angled 13 a and 13 b and remain angled when attached . the ends of the arms have pins 19 for locking with a toilet paper roll dispenser . the box 14 is inserted into the support 10 where tissues can be easily dispensed . as noted , the holder of the invention thus holds a box of toilet tissue which is very similar to a box of facial tissue . the holder will hold a new type of toilet tissue product in a decorative box and eliminates the urine , feces and accompanying bacteria and viruses which can land on a roll of toilet paper . the invention provides improved decorativeness for toilet paper . aesthetically minded homemakers like to decorate their bathrooms in certain themes and colors . plain , bland , white rolled toilet paper is not decorative . the boxed toilet tissue holder of the present invention allows the homemaker to enhance the bathroom &# 39 ; s color and even display an image on the box to tie in with the room &# 39 ; s color and theme . the invention is also pet and child proof . conventional tissue rolls can get unrolled by small children and pets . this creates a huge mess and further presents a potential health risk to the child or pet . the present invention solves this problem . this invention ends the problem of “ fighting ” to find the end of the roll . people often jiggle a toilet paper roll , spinning it one way then the other , trying to find the end so they can use the tissue . the invention tissue solves this problem . the invention facilitates ease of replacement . replacing rolled toilet paper requires fumbling around with the spring - loaded cylinder , sliding it through the roll without dropping the roll to the floor and getting the cylinder ends in the correct slots while the roll blocks your vision and your fingers get pinched . the boxed toilet tissue and box easily slips in and out with no pain or problems . the boxed toilet tissue holder of the present invention can hold different products . the boxed toilet tissue can be colored , scented , thicker , pre - moistened , lotioned , plain , etc . finally , the invention is particularly suited for the handicapped and elderly . simply lifting the pre - separated toilet tissue out of a box is much easier for handicapped and elderly users than fighting with a roll to find the end and then tearing the tissue to separate it . replacing the boxed toilet tissue is also much easier than replacing a roll for such a person . the present invention has been described with reference to the enclosed figures . it is to be appreciated that the true nature and scope of the invention is to be determined with respect to the claims appended hereto .	0
relative to fig1 pressed pulp bales b 1 and b 2 are formed by a process independent of the present invention which briefly comprises the steps of charging a fixed volume with a substantially uniform quantity of bulk dried wood pulp and pressing the quantity of pulp into a &# 34 ; wafer &# 34 ; or &# 34 ; cookie &# 34 ; w . these steps are repeated with each wafer w being pressed against the face of the previous wafer until the desired size of a bale is accumulated . although each wafer w is distinct with random fiber orientation between respective wafer faces , the shear strength between such faces is considerably greater than between individual sheets of machine laid web . consequently , such wafers are not easily delaminated , each from the other . in planes perpendicular to the wafer planes , the consolidated strength of a bale is extremely high as provided by a 1500 psi compressive pressure . such is the nature of bales b 1 and b 2 which are fed in a series succession by suitable means such as feed pinions 100 to a shredding plane traversed by the raker claws of a reciprocating device 200 . coarse particles of pulp p torn from a bale face are directed into a mulching means 300 for further disintegration into fiber sized particles f . in detail , the bales b 1 and b 2 are oriented to approach the reciprocation plane of the raker claws with the interfacial planes of the pulp wafers w parallel to the reciprocation plane . a matched set of feed pinions comprising cogs 101 and 102 mounted on a common shaft 103 are positioned on both sides of the bale b 1 at positions lateral of the bale sides so that the cog teeth will penetrate the bale for a positive grasp of the bale . the drive for the feed pinions 100 , not shown is drawn from a primary power source and coordinated with the reciprocating device 200 to advance the bale b 1 into the reciprocation plane by a desired increment , 1 / 4 inch ( 0 . 635 cm ) for example , with each reciprocation stroke . reciprocating device 200 comprises a raker bar 201 having claws 202 secured thereto . the claws 202 are positioned back - to - back in pairs spaced approximately 2 to 3 inches ( 5 to 7 . 6 cm ) apart . opposite ends of the raker bar 201 are secured to link chains 203 . not shown but preferably provided are guide means to secure the raker bar 201 translational plane and prevent torque movements about the longitudinal axis of the bar . chains 203 are wrapped about respective sprocket pairs 204 which are rotatively secured together by shafts 205 . power is delivered to the chain sprockets 204 through any suitable direction reversing mechanism not shown so that when the claws 202 have raked the face of the bale b 1 in one direction , rotation of the drive shaft 205 will reverse to drive the raker bar 201 back in the opposite direction . a suitable alternative raker bar drive may include a double acting hydraulic cylinder arrangement . at the end of a reciprocation stroke , the feed pinions 100 are rotated by an arc portion to advance the bale b 1 by the desired amount into the translational plane raked by the points of claws 202 . the mulching mechanism 300 which receives the rough shredded pulp particles p comprises a hopper trough 301 which funnels the particles p onto stator tines 302 . rotor tines 303 secured to a rotatively driven drum 304 stroke the particles p at high velocity , driving them between adjacent stator tines 302 to shatter the particles p into fibers f . the detailed enlargement of fig2 shows the nature of the shredding action of claws 202 on the pulp bale b 1 . it should first be noted that the translation plane t of the claw points 208 does not necessarily coincide with the interfacial planes between wafers w . accordingly feed rate increments of the feed pinion mechanism 100 need not be related to the depth of such wafers w . due to the pulp pressing action , it is likely that most individual fibers within the bale b are longitudinally aligned with wafer planes . accordingly few fibers are length aligned perpendicular to the wafer planes thereby lending little strength to the bale composition in that direction . consequently the claws 202 may plow along the center of a wafer section almost as easily as long the interface between wafers w . an additional note of interest to the disposition of claws 202 concerns the angle of the claw shoe surface 206 between the point 208 and the heel 207 . to minimize the power requirements , this shoe surface 206 should approach the point 208 in approximate tangency ( 0 degrees ) with the surface of the translational plane t . an angular approach of the shoe surface 206 to the point 208 from either side of the plane t will cause the point to either dig for greater depth or plane away from the bale . either result is undesirable due to the resulting unproductive expenditure of energy . in a specific design example , a 15 in . × 30 in . × 36 in . pressed pulp bale layered in planes parallel with the 30 in . × 36 in . edge plane was shredded with a raker bar apparatus such as that disclosed . lateral claw spacing was 3 in . along the 36 in . face dimension . advancement velocity of the raker bar 201 along the 30 in . face dimension was 40 fpm over a 48 in . stroke and against a 1 / 4 inch bale thickness increment . this arrangement shredded 310 lb ., 33 lb ./ ft . 3 bales with 60 strokes in 6 minutes and consumed 3 hp in the process . the entire apparatus including raker bar drive , bale in - feed mechanism , and mulching apparatus drive consumed 7 . 5 hp .	3
refer to fig1 and fig2 diagrams schematically showing the process of a method for modulating refractive indices of optical fiber gratings according to the present invention . as shown in fig1 , the present invention provides an optical fiber grating 10 . a plurality of locations x 1 , . . . , xn is equidistantly assigned in the optical fiber grating 10 and divides the optical fiber grating 10 into a plurality of grating sections . the total exposure intensity at each location is written by two beams — uv beam 1 and uv beam 2 . uv beam 1 and uv beam 2 have a gaussian shape , and the phases and intensities of them are adjustable . uv beam 1 and uv shot 2 are sequentially projected on locations x 1 , . . . , and xn section by section . in other words , uv beam 1 and uv beam 2 are sequentially projected on location x 1 ; then , uv beam 1 and uv beam 2 are sequentially projected on locations x 2 , . . . , and xn respectively . the total exposure intensity at each location is identical . uv beam 1 and uv beam 2 are equidistantly - spaced and partially - overlapped in exposing locations x 1 , . . . , and xn , as shown in fig2 . uv beam 1 and uv beam 2 have continuous phases in the grating sections so as to form the fiber bragg grating having the predetermined index profile by generating a constructive superposition . as uv beam 1 and uv beam 2 are equidistantly - spaced in exposing locations x 1 , . . . , and xn , the dc index maintains fixed along the optical fiber grating 10 , and the ac index can be modulated via changing the intensities and phases of uv beam 1 and uv beam 2 . below are disclosed two approaches of controlling the intensities and phases of uv beam 1 and uv beam 2 to modulate the ac index according to the present invention . in approach i of the present invention , it is supposed that the total exposure intensity at each location is 2i 0 , and that the gaussian - shaped uv beam 1 and uv beam 2 have an identical intensity i 0 . the phase differences between one location ( x 2 , . . . , or xn ) and the positions where uv beam 1 and uv beam 2 for the location are projected on the optical fiber grating 10 are respectively δθ and − δθ . in other words , uv beam 1 and uv beam 2 have symmetric phase shifts . thus , the phase difference between the fringe distribution created by a superposition of uv beam 1 and uv beam 2 and the corresponding grating section will be zero . then , the ac index can be modulated via modulating the phase difference δθ and − δθ . as the ac index n ac of the optical fiber grating varies linearly with the intensities of uv light , the ac index is proportional to the fringe distribution created by a superposition of uv beam 1 and uv beam 2 . refer to fig3 ( a ) a diagram schematically showing the ac indices at one location for different δθ &# 39 ; s when uv beam 1 and uv beam 2 has an identical intensity i 0 . when δθ = π / 2 , complete destructive interference occurs , and the amplitudes thereof mutually cancel out , and n ac is minimum . when δθ = π / 3 , the amplitudes thereof partially cancel out . when δθ = 0 , complete constructive interference occurs and generates the greatest amplitude , and n ac is maximum . refer to fig4 a diagram schematically showing the amplitudes and phases of uv beam 1 and uv beam 2 . uv beam 1 and uv beam 2 can be respectively expressed by equation ( 1 ) and equation ( 2 ): wherein i 1 and i 2 are respectively the intensities of uv beam 1 and uv beam 2 , and θ 1 and θ 2 are respectively the phase differences with respect to one location . the phase and amplitude of the interference fringe distribution created by a superposition of uv beam 1 and uv beam 2 can be expressed by equation ( 3 ): i ( x )= i 1 e i ( kx + θ 1 ) + i 2 e i ( kx + θ 2 ) ( 3 ) as uv beam 1 and uv beam 2 have an identical intensity i 0 and respectively have phase differences δθ and − δθ , equation ( 4 ) can be derived from equation ( 3 ) and expressed by i ( x )= 2 i 0 e ikx cos ( δθ ) ∝ n ac ( 4 ) wherein the ac index is proportional to the interference fringe distribution . refer to table 1 and fig3 ( a ) for the normalized ac indices with respect to several phase differences δθ ( 0 , π / 3 , π / 2 ). refer to fig5 ( a ) and fig5 ( b ) for the profiles of the normalized ac indices and the relationship between the phase difference and the normalized ac index . in approach ii of the present invention , it is supposed that the total exposure intensity at each location is 2i 0 , and that uv beam 1 and uv beam 2 have different intensities . in other words , uv beam 1 and uv beam 2 sequentially expose one location respectively with an intensity mi 0 and an intensity ( 2 31 m ) i 0 . further , the phase differences between one location and the positions where uv beam 1 and uv beam 2 for the location are projected on the optical fiber grating 10 are respectively 0 and π . thus , the phase difference between the fringe distribution created by a superposition of uv beam 1 and uv beam 2 and the corresponding grating section will be zero . then , the ac index can be modulated via modulating the intensities of uv beam 1 and uv beam 2 . refer to fig3 ( b ) a diagram showing the ac indices at one location for different intensities of uv beam 1 and uv beam 2 when the phase differences of uv beam 1 and uv beam 2 with respect to the location are respectively 0 and π . when uv beam 1 and uv beam 2 have an identical intensity i 0 , complete destructive interference occurs , and the amplitudes thereof mutually cancel out , and n ac is minimum . when uv beam 1 has an intensity 1 . 5i 0 and uv beam has an intensity 0 . 5i 0 , the amplitudes thereof partially cancel out . when uv beam 1 has an intensity 2i 0 and uv beam has an intensity 0 , the resultant amplitude is completely contributed by uv beam 1 , and n ac is maximum . the phase and amplitude of the interference fringe distribution created by a superposition of uv beam 1 and uv beam 2 can be expressed by equation ( 5 ): i ( x )= 2 i 0 e ikx ( m − 1 ) ∝ n ac ( 5 ) refer to table 1 and fig3 ( b ) for the ac indices with respect to different intensities in approach ii . refer to fig6 ( a ) and fig6 ( b ) for the profiles of the normalized ac indices when the phase difference is π in approach ii and the relationship between the intensity ratio and the normalized ac index . from fig5 ( a ) and fig6 ( a ), it is known that an optical fiber grating with a bell - shaped ac index distribution is obtained via controlling the intensities or phases of two uv beams . the method for modulating refractive indices of optical fiber gratings of the present invention can apply to an optical fiber grating in any location where a refractive index modulation is intended . for example , when the refractive index modulation is only needed in one grating section , a location is assigned to the grating section , and two beams of uv beams are projected on the location with the phases or intensities of uv beams being varied according to one of the approaches of the present invention . thus , the refractive index modulation is realized in the grating section . therefore , the present invention can indeed modulate the profile of the ac index into an arbitrary shape . in conclusion , the method for modulating refractive indices of optical fiber gratings of the present invention controls the phases and intensities to maintain the dc index fixed with the ac index independently adjustable without using additional optical elements . the method of the present invention is simple and cost - efficient . further , the present invention can apply to the phase - mask and double beam interference technologies . the embodiments described above are only to exemplify the technical thoughts and characteristics of the present invention to enable the persons skilled in the art to understand , make , and use the present invention . however , it is not intended to limit the scope of the present invention . any equivalent modification or variation according to the spirit of the present invention is to be also included within the scope of the present invention .	6
referring to fig1 a block diagram of a receiver 100 is shown in accordance with the present invention . a radio frequency signal is received at an antenna 102 is filtered by a filter 104 and amplified by an amplifier 106 . the amplified radio frequency signal is applied to a demodulator 108 where it is demodulated . the demodulator 108 is coupled to a power amplifier 110 , a squelch circuit 118 , and a controller 116 . the controller 116 controls the operation of the demodulator 108 and the squelch circuit 118 . coupled to the controller 116 is a memory block 114 which provides storage means for the controller 116 . the squelch circuit 118 provides squelch control for the demodulator 108 and hence the receiver 100 . a speaker 112 is coupled to the output of the power amplifier 110 to present demodulated audio signals to a user . the operation of receivers having squelch circuits is well known in the art . generally , the squelch circuit 118 evaluates the level of noise being received by the antenna 102 and determines if signal is being received . this provides the user with the benefit of not having to continuously listen to noise while awaiting intelligent data to arrive . the controller 116 controls the operation of the squelch circuit 118 automatically . the settings of the squelch circuit 118 are stored in the memory block 114 and dictated to the squelch circuit 118 via the controller 116 . the information contained in the memory 114 include threshold hysteresis that are used by the squelch circuit 118 to avoid instability . to provide manual control of the squelch circuit 118 an optional manual squelch control 120 can be coupled to the controller 116 . the manual squelch control 120 allows the squelch circuit 118 to be manually set to particular levels as deemed desirable by the user . referring to fig2 a block diagram of the internal elements of the squelch circuit 118 is shown in accordance with the present invention . signals from the demodulator 108 are amplified by the squelch amplifier 202 . a noise shaping block 204 receives the amplified squelch signal from the squelch amplifier 202 . the noise shaping 204 includes such circuits as pre - emphasis filters and rectifiers . the noise shaping is accomplished to facilitate a determination as to whether the receiver 100 is receiving a signal . in other words , the received noise is shaped to quickly determine as to whether the receiver 100 should be quieted . the output of the noise shaping 204 is coupled to an attenuator 206 where it is attenuated . the attenuated signal is filtered by a low pass filter 208 and coupled to a squelch detect 210 . the attenuator 206 is a step attenuator and preferably a programmable one . the controller 116 controls the operation of the squelch amplifier 202 , the noise shaping 204 , the attenuator 206 , and the squelch detect circuit 210 . the squelch setting of the receiver 100 is determined by the attenuation setting of the attenuator 206 . the attenuation setting is either dictated by the manual squelch control 120 or automatically set by the controller 116 . in either case the attenuation level of the attenuator 206 provides the means for sensing the squelch state of the receiver 100 . the attenuator 206 communicates the squelch state to the controller 116 . note that it is feasible to use the attenuator 206 only as the means to dictate the squelch setting of the receiver 100 . in this case the controller 116 will sense the squelch state based on the setting of the attenuator 206 . when threshold squelch is desired , the squelch control either manually or from the controller 116 adjusts the attenuation of the attenuator 206 at an optimal place sufficient to achieve threshold squelch . in the event that tight squelch is desired , the attenuation of the attenuator 206 is reduced to minimum . in other words , the noise signal at the output noise shaping circuit 204 is applied to the low pass filter 208 with minimum or no attenuation . the squelch detect circuit 210 includes hysteresis circuits with controllable windows . the width of these windows are controlled by the controller 116 in response to the squelch information available from the attenuator 206 and from the strong signal condition available from the squelch detector 210 . the instantaneous setting of the attenuator 206 is communicated to the various elements of the receiver 100 via the controller 116 . with the knowledge of the instantaneous setting of the attenuator 206 , the controller 116 can determine whether the squelch circuit 118 is in tight or threshold squelch . in the preferred embodiment , upon detecting the tight squelch condition the controller 116 proceeds to vary the hysteresis window to prevent squelch chatter this is discussed in more details in association with the flow chart of fig3 . those skilled in the art appreciate the use of other squelch circuits to achieve similar results . indeed , an amplifier circuit could be used in place of the attenuator 206 to provide the sensing means for the squelch circuit 118 . the elements of the receiver 100 and the squelch circuit 118 are presented here to provide the preferred embodiment of the invention . however , they should not be construed as limitations . nor shall they be held as the only possible means of putting the present invention to work . changes are possible without significant departure form the spirit of the invention as claimed . referring now to fig3 a flow chart of the operation of the squelch circuit 118 in setting the hysteresis windows is shown in accordance with the principles of the present invention . from a start block 302 , the operation sets the hysteresis at normal as indicated by block 304 . with the hysteresis at normal , a condition block 306 determines if the squelch setting is at threshold . the yes output of the block 306 is coupled to a leave hysteresis at nominal block 310 . the output of block 310 is coupled to a condition block 312 where the presence of a strong signal condition is questioned . the no output of the condition block 306 indicating that the squelch setting is not at threshold is coupled to a widen hysteresis block 308 . at the block 308 , the hysteresis is widened to accommodate tight squelch conditions . the output of this block is coupled to the input of the condition block 312 . the no output of the condition block 312 indicating the absence of a strong signal condition is coupled to a block 316 where the hysteresis remains unchanged . the yes output of the condition block 312 is coupled to a block 314 where the hysteresis is narrowed . as an example , the hysteresis is narrowed to half of the nominal hysteresis window . with the hysteresis window narrowed , the short squelch tail is guaranteed for strong signal conditions at either threshold or tight squelch . the wide or nominal hysteresis conditions as dictated by block 316 assure that no chatter is present at tight squelch . to summarize , a circuit is shown to prevent chatter at tight squelch settings while still maintaining reasonable threshold hysteresis and short tail ends during strong signal conditions . with the inclusion of the attenuator 206 in the squelch circuit 118 it is possible to widen or constrict squelch hysteresis as a function of the attenuator setting and the magnitude of the incoming signal at the antenna 102 . the flow chart 300 will ensure a short squelch tail for strong signal conditions at either threshold or tight squelch by narrowing up the squelch hysteresis . in addition , the squelch circuit 118 prevents chatter at tight squelch settings without sacrificing threshold or strong signal performance .	7
an aluminum composite material is used to make the squirrel cage for the rotor application . the aluminum composite cage has high electrical conductivity for high motor performance , high mechanical properties ( strength , fatigue and creep resistances ) for machine durability and design flexibility , and a lower scrap rate for lower manufacturing cost . specifically , the cage bars are made of an aluminum matrix / carbon nanotube ( cnt ) composite , or a combination of the aluminum matrix / carbon nanotube ( cnt ) composite and pure aluminum ( for example , the inner layer is the al - cnt composite and the outer layer is pure al ). the ends can be made of pure aluminum , cast aluminum alloys , such as a380 , a356 , a319 , etc ., or an aluminum composite , including , but not limited to , aluminum carbon nanotubes composites . cast aluminum alloys are preferred , the whole structure can be manufactured using a cast - in - place process , for example . in the cast - in - place process , the bars are premade and then placed in the casting mold along with steel laminations . this structure takes full advantage of the high electrical and thermal conductivities , high bar strength and end plate strength , and good castability of the cast aluminum alloy in comparison with a traditional single - piece pure aluminum die cast cage manufacturing process . it can also keep the casting defects , including porosity , at a minimum , which is important to high electrical conductivity . the al - cnt composite bars can be made via powder metallurgy , and hot pressing or extrusion . they can be made of a single material or a composite structure . the composite structure can include two materials , an inner layer 10 of the bar made of the al - cnt composite and an outer layer 15 made of pure aluminum , as shown in fig2 . the bars can be assembled in the cast mold . a die casting , sand casting , or other casting method can be used to cast in - place these bars along with the steel laminations . this method can also eliminate the lamination steel soldering issues often accompanying the die - casting process . soldering is a common problem because molten aluminum sticks to steel during casting and reacts to form an intermetallic compound layer . carbon nanotubes ( cnts ) offer significant advantages over most existing materials , including attractive mechanical properties . the in - plane graphitic c — c bonds in cnts are one of the most stabilized chemical bonds , and make cnts exceptionally strong and stiff against axial strains . cnts have very high strength and toughness . the young &# 39 ; s modulus of single - wall carbon nanotube ( swcnt ) is theoretically estimated to be as high as 5 tpa ( 1 t = 10 12 ). the average value of young &# 39 ; s modulus of isolated multi - wall cnt ( mwcnt ) was measured to be 1 . 8 tpa , with a bending strength as high as 14 . 2 gpa . the tensile strength of cnts is 100 times higher than steel , while the specific gravity is only ⅙ that of steel . in addition , cnts have a high corrosion resistance in strong basic or acid solutions . therefore , cnts can be used as the reinforcing phase for strong composites . various metal - based composites with cnts , such as fe - cnts , al -, ni - cnts and cu - cnts , have been investigated . fabrication of aluminum - carbon nanotube composites and their electrical properties , c . l . xu , b . q . wei , r . z . ma , j . liang , x . k . ma , and d . h . wu , carbon , volume 37 , issue 5 , 9 apr . 1999 , pages 855 - 858 , which is incorporated herein by reference . for example , a method of infiltrating iron with carbon nanotubes and then consolidation to provide a 45 % enhancement of the yield strength of the composite containing 2 . 2 % by volume of nanotubes relative to a similarly fabricated part of pure iron was described . a similar infiltration technique was used for aluminum parts . there has been considerable interest in the electrical conductivity of cnts . it has been reported that cnts with particular combinations of n and m values , which are structural parameters indicating how much the nanotube is twisted , can be highly conducting , and can be said to be metallic . their conductivity has been shown to be a function of their chirality ( degree of twist ), as well as their diameter . cnts can be either metallic or semi - conducting in their electrical behavior . swcnt ropes are the most conductive carbon fibers known . the achievable current density was 107 a / cm 2 ; however in theory , the swcnt ropes should be able to sustain much higher stable current densities , as high as 1013 a / cm 2 . ultra - small swcnts have even been shown to exhibit superconductivity below 20k . ( cheap tubes , inc . at cheaptubes . com ). preliminary experiments and simulation studies on the thermal properties of cnts show very high thermal conductivity . cnts can be made by well - known processes , including synthesis by chemical catalytic pyrolysis of acetylene using a co — mg complex oxide as a catalyst . the catalyst can be prepared from co ( no 3 ) 2 and mg ( no 3 ) 2 by a sol - gel method . an acetylene - nitrogen mixture ( c 2 h 2 : n 2 = 1 : 5 ) is introduced into the quartz chamber at a flow rate of 600 ml min − 1 at about 923 k for 30 min . the as - prepared carbon nanotubes are purified by immersing in nitric acid for about 48 hours and washing with de - ionized water . the purified cnts are suspended in a mixture of concentrated sulfuric and nitric acids ( 1 : 3 ) and then sonicated at room temperature for 48 hours . the al - cnt composite typically can contain about 0 . 1 wt . % to about 5 wt . % carbon nanotubes . the cnts , ( e . g ., about 0 . 1 to about 300 micrometer in length ) and pure aluminum powder ( e . g ., between about 5 and about 70 micrometer ) are mixed , for example , by ball milling the mixture under inert gas at about 100 to about 5000 rpm for about 10 minutes to about 10 hours , typically about 10 min . to about 2 hour . the process parameters control the uniformity and purity of the mixture . higher speed and longer length can improve uniformity , but increase oxidation tendency . the mixtures are then hot - pressed at about 573k to about 873k under a pressure of about 15 - 50 mpa for more than about 10 min ., typically about 10 min . to 2 hours . the hot - pressed bars are machined to size . hot extrusion and powder metallurgy can also be used to manufacture the al - cnt bars . in a hot extrusion process , the powders are mixed and pressed into the shape at room temperature , and then extruded at about 623k to about 873k through an extrusion die . the extrusion bar is cut into pieces and machined . in the powder metallurgy process , the powders are mixed and pressed into the shape at room temperature , and then sintered at about 673k to about 873k for about 10 minutes to about 5 hours . hot isostatic pressing or hot pressing can be used to eliminate porosity after sintering . in order to improve the dispersion of carbon nanotubes , a surface agent , including , but not limited to , c 19 h 42 brn , may be added in solution . the surface agent can be absorbed significantly onto the surfaces of the cnts , modifying the cnt dispersion . another method to help disperse the cnts is to mix the cnts with nitric acid ( hno 3 ), sulfuric acid ( h 2 so 4 ), ethylene glycol , or a 1 : 1 mixture of nitric acid and sulfuric acid via ultrasonic waves . to encapsulate the cnts within aluminum , about 3 - 30 wt % cnts is premixed with aluminum powder to form a master alloy powder for further mixing with pure al powder to a desired composition , and ball milled under an inert gas atmosphere at about 100 to about 5000 rpm for about 30 minutes to about 10 hours . it is noted that terms like “ preferably ,” “ commonly ,” and “ typically ” are not utilized herein to limit the scope of the claimed invention or to imply that certain features are critical , essential , or even important to the structure or function of the claimed invention . rather , these terms are merely intended to highlight alternative or additional features that may or may not be utilized in a particular embodiment of the present invention . for the purposes of describing and defining the present invention it is noted that the term “ device ” is utilized herein to represent a combination of components and individual components , regardless of whether the components are combined with other components . for example , a “ device ” according to the present invention may comprise an electrochemical conversion assembly or fuel cell , a vehicle incorporating an electrochemical conversion assembly according to the present invention , etc . for the purposes of describing and defining the present invention it is noted that the term “ substantially ” is utilized herein to represent the inherent degree of uncertainty that may be attributed to any quantitative comparison , value , measurement , or other representation . the term “ substantially ” is also utilized herein to represent the degree by which a quantitative representation may vary from a stated reference without resulting in a change in the basic function of the subject matter at issue . having described the invention in detail and by reference to specific embodiments thereof , it will be apparent that modifications and variations are possible without departing from the scope of the invention defined in the appended claims . more specifically , although some aspects of the present invention are identified herein as preferred or particularly advantageous , it is contemplated that the present invention is not necessarily limited to these preferred aspects of the invention .	7
turning now to the drawings where like numerals depict like structures and particularly to fig1 , there is schematically represented a diagramatic view illustrating a compression - ignition internal combustion engine system 10 incorporating various features according to the present invention is shown . the engine 12 may be implemented in a wide variety of applications including on - highway trucks , construction equipment , marine vessels , stationary generators , pumping stations , and the like . the engine 12 generally includes a plurality of cylinders disposed below a corresponding cover , indicated generally by reference numeral 14 . in a preferred embodiment , the engine 12 is a multi - cylinder compression ignition internal combustion engine , such as a 3 , 4 , 6 , 8 , 12 , 16 , or 24 cylinder diesel engine . however , the engine 12 may be implemented having any appropriate number of cylinders 14 , the cylinders having any appropriate displacement and compression ratio to meet the design criteria of a particular application . moreover , the present invention is not limited to a particular type of engine or fuel . the present invention may be implemented in connection with any appropriate engine ( e . g ., otto cycle , rankin cycle , miller cycle , etc .) using an appropriate fuel to meet the design criteria of a particular application . a controller 16 preferably comprises a programmable microprocessor 18 in communication with ( i . e ., coupled to ) various computer readable storage media 20 via at least one data and control bus 22 . the computer readable storage media 20 may include any of a number of devices such as read only memory ( rom ) 24 , random access memory ( ram ) 26 , and non - volatile ( keep - alive ) random access memory ( nvram ) 28 . the various types of computer - readable storage media 20 generally provide short - term and long - term storage of data ( e . g ., at least one lookup table , lut , at least one operation control routine , at least one mathematical model for egr control , etc .) used by the controller 16 to control the engine 10 . the computer - readable storage media 20 may be implemented by any of a number of known physical devices capable of storing data representing instructions executable by the microprocessor 18 . such devices may include prom , eprom , eeprom , flash memory , and the like in addition to various magnetic , optical , and combination media capable of temporary and permanent data storage . the computer - readable storage media 20 may include data representing program instructions ( e . g ., software ), calibrations , routines , steps , methods , blocks , operations , operating variables , and the like used in connection with associated hardware to control the various systems and subsystems of the engine 10 , and the vehicle . the computer readable storage media 20 generally have instructions stored thereon that may be executable by the controller 16 to control the internal combustion engine 10 . the program instructions may direct the controller 16 to control the various systems and subsystems of the vehicle where the engine 12 is implemented , with the instructions being executed by microprocessor 20 , and optionally , instructions may also be executed by any number of logic units 28 . the input ports 30 may receive signals from the various engine and vehicle systems , including sensors and switches generally designated at 32 , and the controller 16 may generate signals ( e . g ., the signals act and adj ) at output ports 34 . the output signals are generally presented ( or transmitted ) to the various vehicle components . a data , diagnostics , and programming interface 36 may also be selectively connected to the controller 32 via a bus and connector 38 to exchange various information therebetween . the interface 36 may be used to change values within the computer readable storage media 20 , such as configuration settings , calibration variables , and the like . as used throughout the description of the present invention , at least one selectable ( i . e ., programmable , predetermined , modifiable , etc .) constant , limit , set of calibration instructions , calibration values ( i . e ., threshold , level , interval , value , amount , duration , etc .) or range of values may be selected by any of a number of individuals ( i . e ., users , operators , owners , drivers , etc .) via a programming device , such as the device 36 selectively connected via an appropriate plug or connector 38 to the controller 16 . rather than being primarily controlled by software , the selectable or programmable constant and limit ( or range ) values may also be provided by an appropriate hardware circuit having various switches , dials , and the like . alternatively , the selectable or programmable limit and range may also be changed using a combination of software and hardware without departing from the spirit of the present invention . however , the at least one selectable value or range may be predetermined and / or modified by any appropriate apparatus and method to meet the design criteria of a particular application . any appropriate number and type of sensors , indicators , actuators , etc . may be implemented to meet the design criteria of a particular application . in at least one mode of operation , the controller 16 may receive signals from the various vehicle sensors and switches , and execute control logic embedded in hardware and software to control the engine 12 , various engine and vehicle systems 32 , and the like . in one example , the controller 16 is implemented as at least one implementation of a ddec controller available from detroit diesel corporation , detroit , mich . various other features of the ddec controller are described in detail in a number of different u . s . patents assigned to detroit diesel corporation . however , the present invention may be implemented in connection with any appropriate controller to meet the design criteria of a particular application . control logic may be implemented in hardware , firmware , software , or combinations thereof . further , control logic may be executed by the controller 16 , in addition to and by any of the various systems and subsystems of the vehicle or other installation where the controller 16 is implemented . yet further , although in a preferred embodiment , the controller 16 includes the microprocessor 20 , any of a number of known programming and processing techniques , algorithms , steps , bocks , processes , routines , strategies and the like may be implemented to control the engine 12 , and the various engine and vehicle components 32 . further , the engine controller 16 may receive information in a variety of ways . for example , engine 12 systems information may be received over a data link , at a digital input , or at a sensor input of the engine controller 16 . fig2 is a schematic representation of the controller 16 of the present invention . the controller has a motor control module 40 and a common powertrain controller 42 . each of the common powertrain controller and the motor control module has memory for storage and retrieval of operating software and faults . the motor control module and the common powertrain controller communicate with each other via the electronic controller area network ( ecan ) 44 . it is contemplated that any electronic communication between the motor control module ( mcm ) and the common powertrain controller is acceptable to communicate static faults stored in either , so that each has the most current version of the faults in the other module at any time . the common powertrain controller communicates with the vehicle systems such as lamps and gauges 46 , instrument cluster 48 , tool / instrument 50 . the cpc2 communicates with the instrument cluster and the tool / instrument via an sae data link j1939 and j1587 , ( 52 and 54 , respectively ). cpc2 outputs 56 are communicated t the lamps and gauges , and the cpc2 communicates with the diagnostic tool 36 over a uds / cpc2 link 58 . the cpc2 further acts as a gateway for the mcm to communicate with the diagnostic tool 36 over a uds link / mcm 60 through the mcm gateway 62 in the cpc2 . the mcm communicates to the gateway via a uds cpc / mcm tunnel 64 and from there , communication is possible with the diagnostic tool . fig3 is a schematic representation of the fault code memory manager resident in the cpc2 . a similar fault code memory manager module may be resident in the mcm . the fault code memory manager tracks and stores faults in memory that are received by each mpu 18 ( as seen in fig1 ) and a system that the mpu is monitoring . those skilled in the art will recognize that while only one mpu is schematically presented in fig1 , it is understood that multiple mpus may be present , each mpu monitoring a different system of the vehicle or engine , such as egr , engine speed , engine torque , engine coolant temperature , engine boost pressure , engine percent load , vehicle speed as well as other engine operating systems and parameters . the fault code manager administrator module 65 interfaces to the individual features 66 through an interface 68 to evaluate conditions and periodically provide status of each individual fault condition . these fault conditions are indicated by fault condition status flags , and are then processed and debounced in the fault code module 70 internal logic based upon a configurable set or other rules . once the faults are logged , they are kept and maintained in memory in a fault table which can then sent out on all communication links through the communications link 72 to the modules such as the cpc2 , or the mcm , or both , designated as 76 . this communication may be is over j1587 / j1939 sae data links , or the ecan , or a uds link . additional interfaces back to features and lgr module allows the engine system behavior to change depending on the active faults . the fcm system component may include any number of monitoring units ( mu ) and preferably , the cpc2 fault control module contains approximately 200 cpc2 defined mus and any number of monitoring units ( mu ) in the mcm , and preferably approximately 500 mcm defined mus . the faults are debounced prior to being transmitted to ensure that each fault is indicative of current operating conditions , and not an error or an anomaly . the mcm debounced faults are updated once per second via the ecan , and the cpc2 mus are internally evaluated 10 times per second . the system has a range of fault logging and handling capabilities , including at least one of fault identification , such as monitoring unit identifier internally unique fault identifier , kwp path / type , universal diagnostic service identification , spn ( j1939 id )/ fmi , flash code ( lamp blink code ) and fault name / description via a uds tool , environmental conditions such as specified feature sponsor , exclusion conditions , fault debounce timer types , such as none , or ramp / rest or integrating , debounce timers , such as debounce time ( fault activation ) recovery time ( fault deactivation ) healing time ( inactive fault self deletion ) lamp control for each mu , such as a buzzer , sel , cel , mil , and engine control , such as torque reduction and engine protection shutdown protection . low priority faults are not sent to the lamps over the communications links . normally , these low priority faults are used in internal control logic but should not necessarily be shown to the vehicle operator . preferably , lamp control on the dash board is handled separately and defined individually on per fault / per lamp basis . preferably the system contemplates the following communications visibility semaphore : active fault sent , inactive fault sent results in full visibility for a majority of faults . active fault not sent , inactive fault sent result sin fault which do not illuminate the lamps . active fault sent , inactive fault not sent results in no fault defined at the moment . active faults not sent , inactive faults not sent results in full invisibility of faults , indicative of none for the moment . the architecture of the present invention provides a snapshot of data record that includes , but is not limited to seconds active counter , seconds inactive counter , first occurrence date / time stamp ( 1 second ), first occurrence engine hour stamp ( 1 second ), last occurrence date / time stamp ( 1 second ) last occurrence engine hour stamp ( 1 second ) engine and vehicle data , including engine rpm , engine torque , engine coolant temperature , engine boost pressure , engine percent load , vehicle speed , and number of seo events . the present invention further indicates communications link failures , fault code memory mcm link failure faults , non volatile storage rated failures , such as checksum faults , engine data faults based upon the mcm warning level information , including oil level , oil pressure , coolant temperature , input / output related faults , such as analog inputs such as shorted or open circuit detection ( both ground and battery ), digital outputs such as open circuit , short to battery , short to ground , and rationality faults , such as the diesel particulate filer switch , and remote power take off request switch . while one aspect of the invention has been described , it is understood that the words used are words of description , and not words of limitation . many variations and modifications are possible without departing from the scope and spirit of the invention as set forth in the appended claims .	6
the invention will be described in more detail with reference to the following examples . an alloy having the composition as shown in table 1 was made into powder finer than 60 mesh by atomizing . the resulting alloy powder was formed into a discoid molded piece c ( as shown in the figure ) by compression molding under a pressure of 5 ton / cm 2 . in examples 1 , 3 , 6 , 10 , and 12 , the alloy powder was incorporated with a flux . on the other hand , an annular molded piece a and a discoid molded piece b ( as shown in the figure ) were produced by compression molding under a pressure of 6 ton / cm 2 from a powder mixture composed of 0 . 8 wt % of carbon powder ( finer than 350 mesh ), 2 wt % of electrolytic copper powder ( finer than 250 mesh ), 0 . 8 wt % of zinc stearate , and the balance of atomized iron powder . the annular molded piece a was placed on the discoid molded piece b as shown in the figure . the discoid molded piece c was inserted into the hole of the molded piece a . the assembly was heated at 700 ° c . for 30 minutes for dewaxing and then at 1120 ° c . for 30 minutes for soldering in ax gas . the soldered assembly was vertically cut into two parts along the line d -- d . after polishing , the section was microscopically examined to see if the molded piece c infiltrated into and corroded the molded piece b . neither infiltration nor corrosion were noticed in examples 1 to 12 . table 1__________________________________________________________________________exam - composition ( wt . %) solder flux solder + dewax - solder - ple ni cu mn fe cr si b (%). sup . 1 (%). sup . 2 flux . sup . 3 ing ing__________________________________________________________________________1 32 35 25 8 -- -- -- 98 2 0 . 2 a a2 36 27 27 10 -- -- -- 100 -- 0 . 4 a a3 35 30 26 7 -- 1 1 97 3 0 . 3 a a4 30 40 12 15 -- 1 2 100 -- 0 . 2 a a5 30 25 19 22 -- 2 2 100 -- 0 . 5 a a6 31 . 5 24 10 30 -- 2 2 . 5 96 4 0 . 4 a a7 32 35 25 -- 8 -- -- 100 -- 0 . 6 a a8 36 27 27 -- 10 -- -- 100 -- 0 . 2 a a9 35 30 24 -- 8 2 1 100 -- 0 . 3 a a10 30 40 12 -- 15 1 2 95 5 0 . 5 a a11 30 25 19 -- 22 2 2 100 -- 0 . 2 a a12 31 . 5 24 10 -- 30 2 2 . 5 97 3 0 . 3 a a__________________________________________________________________________ . sup . 1 the ratio ( wt . %) the solder component accounts for in the total amount of the solder material . . sup . 2 the ratio ( wt . %) the flux accounts for in the total amount of the solder material . . sup . 3 the total amount ( g / cm . sup . 2 ) of the solder and flux on the joinin area . the same procedure as in examples 1 to 12 was repeated for the preparation of molded pieces a , b , and c and the dewaxing and soldering , except that the composition for the molded piece c and the dewaxing and soldering conditions were changed as shown in table 2 . after soldering , the samples were examined for infiltration and corrosion . in table 2 , the dewaxing conditions are indicated by &# 34 ; a &# 34 ; ( at 700 ° c . for 30 minutes in ax gas ), &# 34 ; b &# 34 ; ( at 700 ° c . for 30 minutes in nitrogen gas ), and &# 34 ; c &# 34 ; ( at 700 ° c . for 30 minutes in butane - modified gas ). also , the soldering conditions are indicated by &# 34 ; a &# 34 ; ( at 1120 ° c . for 30 minutes ) and &# 34 ; b &# 34 ; ( at 1130 ° c . for 60 minutes ). in examples 13 to 16 and 22 to 33 , the molded piece c was produced from an alloy powder finer than 42 mesh , and in examples 17 to 21 , the molded piece c was produced from an alloy powder finer than 60 mesh . table 2__________________________________________________________________________exam - composition ( wt . %) solder flux solder + dewax - solder - ple ni cu mn fe cr si b (%). sup . 1 (%). sup . 2 flux . sup . 3 ing ing__________________________________________________________________________13 87 -- -- -- 10 2 1 100 -- 0 . 3 b b14 77 -- -- -- 20 3 -- 100 -- 0 . 2 b b15 64 . 5 -- -- -- 30 3 2 . 5 98 2 0 . 4 b b16 52 -- -- -- 40 6 2 100 -- 0 . 3 b b17 34 31 25 8 -- 1 1 97 3 0 . 2 c a18 31 40 11 15 -- 1 2 96 4 0 . 3 c a19 32 23 19 8 14 2 . 5 1 . 5 98 2 0 . 2 c a20 31 . 5 25 9 15 15 2 . 5 2 97 3 0 . 4 c a21 33 34 22 9 -- 1 1 96 4 0 . 3 c a22 23 59 8 6 1 2 1 100 -- 0 . 5 a a23 30 41 10 10 5 2 . 5 1 . 5 100 -- 0 . 3 a a24 25 25 15 . 5 20 10 2 2 . 5 97 3 0 . 2 a a25 27 33 15 15 5 3 . 5 1 . 5 100 -- 0 . 4 a a26 52 -- 10 30 -- 6 2 97 3 0 . 3 b b27 72 -- 15 -- 10 2 1 100 -- 0 . 2 b b28 49 -- 20 15 10 4 2 96 4 0 . 5 b b29 30 -- 25 20 20 4 1 100 -- 0 . 3 b b30 50 15 -- 30 -- 3 2 100 -- 0 . 3 b b31 44 20 -- -- 30 4 2 96 4 0 . 4 b b32 54 30 -- 5 5 5 1 100 -- 0 . 2 b b33 22 30 0 40 -- 7 1 98 2 0 . 4 b b__________________________________________________________________________ . sup . 1 , . sup . 2 , and . sup . 3 are the same as in table 1 . examples 1 to 12 and 17 to 25 deal with solders 1 and 2 , examples 13 to 16 deal with solders 3 and 4 , examples 26 to 29 deal with solders 5 and 6 , and examples 30 to 33 deal with solders 7 and 8 . in all the examples , there were no instances where the molded piece c infiltrated into and corroded the molded piece b and the molded piece c remained partly unmelted . good joining was obtained in all the examples . by contrast , unsatisfactory results were produced in comparative examples . in comparative examples 1 and 4 , in which the content of fe or cr is as low as 3 . 5 %, and in comparative examples 3 and 6 , in which the content of ni is as low as 9 %, infiltration and corrosion were noticed . in comparative examples 2 and 5 , in which the content of mn is low and the content of fe or cr is high , the solder remained partly unmelted . in comparative example 7 , in which the content of cr is low and the content of si or b is excessively high , infiltration and corrosion were noticed . in comparative examples 8 , in which the content of cr is excessively high , the solder remained partly unmelted . in comparative example 9 , in which the content of mn is excessively high , the content of copper is low , and the amount of solder and flux on the joining area is small , infiltration and corrosion were noticed and joining was poor . in comparative example 10 , in which the content of mn , si , or b is excessively low , the solder remained partly unmelted . in comparative example 11 , in which the content of b and si is excessively high and the content of ni is low , infiltration and corrosion occurred and joining was poor . in comparative example 12 , in which the amount of solder and flux on the joining area is excessively high , the solder oozed out of the edge . in comparative example 13 , in which the content of mn and fe is low and the content of b and si is excessively high , infiltration and corrosion occurred . in comparative examples 14 , in which the content of fe and cr is excessively high , the solder remained partly unmelted . in comparative example 15 , in which the content of cu , fe , and cr is low and the content of b and si is excessively high , infiltration and corrosion occurred . in comparative example 16 , in which the content of fe and cr is excessively high , the solder remained partly unmelted . table 3__________________________________________________________________________comp . composition ( wt . %) solder flux solder + dewax - solder - exam . ni cu mn fe cr si b (%). sup . 1 (%). sup . 2 flux . sup . 3 ing ing__________________________________________________________________________1 43 17 33 3 . 5 -- 2 1 . 5 100 -- 0 . 2 a a2 30 . 7 25 2 42 -- 0 . 2 0 . 1 100 -- 0 . 4 a a3 9 . 5 53 20 10 -- 5 2 . 5 97 3 0 . 3 a a4 41 19 33 -- 3 . 5 2 . 5 1 100 -- 0 . 4 a a5 29 . 6 26 3 -- 41 0 . 2 0 . 2 98 2 0 . 5 a a6 9 54 20 -- 10 5 2 100 -- 0 . 2 a a7 85 -- -- -- 2 8 5 96 4 0 . 3 b b8 39 . 5 -- -- -- 60 0 . 5 -- 100 -- 0 . 4 b b9 42 18 32 4 . 5 -- 2 1 . 5 96 4 0 . 05 c a10 31 . 7 24 3 20 21 0 . 1 0 . 2 98 . 8 1 . 2 0 . 5 c a11 10 52 . 5 16 11 -- 7 3 . 5 99 . 3 0 . 7 0 . 3 c a12 30 35 15 10 7 2 1 98 2 0 . 9 c a13 83 -- 3 3 -- 7 4 100 -- 0 . 3 b b14 24 . 5 -- 15 30 30 0 . 5 -- 97 3 0 . 2 b b15 80 6 -- 3 -- 8 3 100 -- 0 . 4 b b16 19 . 5 20 -- 30 30 0 . 5 -- 97 3 0 . 5 b b__________________________________________________________________________ . sup . 1 , . sup . 2 , and . sup . 3 are the same as in table 1 .	1
referring to fig1 an exhaust system into which a catalytic converter of the present invention is applied comprises a bifurcated exhaust pipe comprising two upstream exhaust pipes 2 and 3 which are connected to a pair of exhaust ports of the engine 1 and a common downstream exhaust pipe 4 . such a bifurcated exhaust pipe , for example , is used in the horizontal opposed - cylinder type engine . at the concourse portion or bifurcation of the exhaust pipes , a catalytic converter 5 of the present invention is provided , connecting each end of the exhaust pipes 2 and 3 to an inlet of the catalytic converter and connecting the end of the common exhaust pipe 4 to an outlet thereof . the catalytic converter 5 comprises a monolithic catalyst element 6 provided in a cylindrical shell 7 having an oval cross section , as shown in fig5 and 6 . the catalyst is a monolithic three - way catalyst , but other types of catalyst may be used as the converter . the shell 7 comprises a pair of half shells 8 and 9 and a funnel - like outlet shell 10 , each of which is made of stainless steel . each of half shells 8 and 9 includes a body shell 11 , a tapered inlet shell 12 , and a pair of semicircular inlet portions 13 and 14 . thus , by joining both half shells 8 and 9 together , a catalyst chamber is formed by the body shells 11 , an inlet chamber 15 is formed by the tapered inlet shells 12 , and inlet ports 16 and 17 are formed by the semicircular inlet portions 13 and 14 . each axial line of the inlet ports 16 and 17 forms an angle with the axial line of the catalyst chamber , as shown in fig2 so that the axial lines of both inlet ports cross each other in the inlet chamber 15 . the funnel - like outlet shell 10 forms an outlet chamber and has an outlet port 18 which is off - set from the axial line of the catalyst chamber and makes an angle with the axial line . the monolithic catalyst element 6 is wrapped by a wire mesh 19 and is maintained by a damper member 20 made of wire and an annular rim 22 , which are disposed between the shoulder 23 of the body shell 11 and the catalyst element 6 and also is maintained by a damper member 24 disposed between the flange 25 which inwardly projects from the inner end of the outlet shell 10 and the catalyst element . in assembly , the damper member 20 combined with the annular rim 22 and the catalyst member 6 wrapped by the wire mesh 19 are engaged with one of the half shells 8 and 9 and the other half shell is joined and welded to the first - mentioned half shell . the damper member 24 is then inserted in the joined shell , and thereafter the outlet shell 10 is inserted into the joined shell so that the catalyst element 6 may be urged and pressed toward the damper member 20 by the flange 25 and the damper member 24 . in the compressed condition , the half shells 8 , 9 and the outlet shell 10 are welded to each other . thus , the catalyst element 6 is supported in the shell 7 with the wire mesh 19 , and the damper members 20 , 24 , so that movement of the catalyst member is prevented and the damper member 20 and the annular rim 22 serve as sealing members for preventing the exhaust gases from passing through the space between the catalyst element and the inner wall of the shell 7 . the upstream exhaust pipes 2 and 3 engage the inlet ports 16 and 17 and are welded thereto , respectively and the downstream exhaust pipe 4 engages the outlet port 18 of the outlet shell 10 . the converter shell 7 is covered by a protective cover 26 comprising half members 27 and 28 . the half members 27 and 28 are joined at the portions surrounding the exhaust pipes 2 , 3 and 4 and are secured thereto by bolts 29 . peripheral edges of both half members 27 , 28 are disposed apart from each other and there is provided a space 30 between the cover 26 and the shell 7 . thus , air may enter into the space 30 from the gap 33 between the edges of the half members 27 and 28 , thereby cooling the converter during the operation . further , a reinforcement 31 is provided in the inlet chamber 15 and a temperature sensitive element 32 is provided in the outlet shell 10 for detecting the temperature of the converter to prevent the burning of the catalyst element . in operation , exhaust gases alternately enter into the inlet chamber 15 from the inlet ports 16 and 17 . since the axial lines of the inlet ports cross each other in the inlet chamber 15 as described above , exhaust gases from both inlet ports collide with each other to effect mixing of the gases . in addition , since each axial line of the inlet ports makes an angle with the end plane of the catalyst element 6 , turbulence of the exhaust gases may occur to reduce the flow rate of the gases . therefore , sufficient contact of the gases with the catalyst element may be accomplished . further , the exhaust gases pass through each passage of the catalyst element with a zigzag flow pattern , because the exhaust gases enter the passage having an angle with the axial line of the passage , whereby exhaust gases are deflected by the inner wall of the passage and the deflection is repeated . the zigzag flow pattern will enhance the catalytic reaction in the converter as compared with a conventional converter in which the gases pass straight through the passage . in the outlet shell 10 , the exhaust gas flow rate is reduced , since the outlet port 18 is off - set , whereby the residence time of the gases in the catalyst element may be further increased . thus , a sufficient residence time of the exhaust gases in the catalyst element may be obtained to reduce the amount of noxious components to the required level . the present invention provides further an advantageous converter which may be easily manufactured , which has a high gas sealing property and a large supporting force on the catalyst element as compared with the conventional converter as described hereinafter . the conventional converter comprises four shell parts , namely a pair of half inlet shells corresponding to the tapered inlet shell 12 of the illustrated embodiment of the present invention , a cylindrical body shell corresponding to the body shell 11 , and an outlet shell corresponding to the outlet shell 10 . the converter of the present invention comprises three shell parts , and hence the welded length is shorter than the conventional one . in the conventional converter , the catalyst element must be inserted into the body shell , so that the wire mesh covering the catalyst element might be deformed during insertion . therefore , the supporting force of the wire mesh on the element is decreased thereby deflecting the position of the element , which results in a decrease in the sealing effect for the gas flow . in accordance with the present invention , the catalyst element can engage one of the half shells before assembling , after which the half shell may be joined to the this other one . accordingly , the catalyst element may be positioned in the desired location without deformation of the wire mesh , thereby eliminating disadvantages due to the decrease of the sealing effect as in the conventional converter .	5
the syringe of the present invention , a preferred embodiment of which is illustrated in fig1 includes a body 10 having a barrel portion 1 which outwardly is generally configured as a right circular cylinder for most of its length and has a frusto - conical portion 2 near the distal end , where the body diameter reduces down to the diameter of a conventional hub 3 , upon which is mounted ( preferably detachably ) a conventional hollow needle 4 . the body 10 includes a hollow bore ( shown in phantom ) which is open at the proximal end to receive a plunger member 20 . the bore within the barrel portion of the syringe body is generally configured , according to convention , as a right circular cylinder so dimensioned that the plunger shaft 23 , with the piston 21 at its distal end , fits closely but slidably therein . the syringe body 10 is preferably made of moldable plastic in a single piece , but any of a number of other materials would also be suitable , including for example glass or metal , and the body could be made in multiple pieces which could then be fused , cemented or otherwise joined together by conventional means . on the barrel portion 1 of the syringe body 10 , at diametrically opposed positions , is a pair of finger - stop structures 5 , 5 . in the preferred embodiment shown in fig1 and 9 , each of the finger - stop structures has a distal barrier 6 and a proximal barrier 7 which define a region 8 therebetween , which region 8 is sufficiently wide and deep to accommodate an adult finger or thumb , so that the syringe barrel can easily be grasped in region 8 between the index and middle fingers ( if the practitioner chooses to operate the plunger with the thumb as shown in fig1 ) or between the middle finger and thumb ( if the practitioner chooses to operate the plunger with the index finger as shown in fig1 ). when the syringe barrel is grasped in region 8 between said fingers ( or between said finger and thumb ), slippage of the fingers down the barrel in a distal direction is blocked by the distal barrier 6 , while slippage up the barrel in a proximal direction is blocked by the proximal barrier 7 . thus the finger - stops are dual - directional : they impede slippage of the barrel - grasping fingers in both the distal and the proximal direction . in this they differ from the flange often seen at the proximal end of a conventional molded syringe barrel , which flange is designed to block slippage of the fingers in the proximal direction only . the finger - stop structures 5 , 5 need not be positioned at the extreme proximal end of the syringe body 1 , but may be positioned longitudinally at some intermediate place between the proximal and distal ends of the barrel portion 1 of the syringe body 10 . the finger - stop structures preferably are molded integrally with the rest of the syringe body 10 , as this avoids the extra manufacturing steps of separately making the finger - stop structures and of affixing them to the barrel ; but they can be made separately and affixed by conventional means such as bonding by heat or any suitable glue or cement . as is most clearly seen in fig1 , 9 and 11 , the finger - stop structures 5 , 5 do not occupy the entire circumference of the barrel in the longitudinal region thereof at which they are placed . instead they leave part of that circumference unobstructed , so that a calibration scale 11 can be inscribed longitudinally along the barrel continuously without hindrance or interruption , and without compromise to its legibility where the calibration scale passes into or through the longitudinal region of the barrel at which the finger - stop structures are placed . as is best seen in fig1 and 9 , the calibration scale does enter the longitudinal region where the finger - stop structures are , but the calibration scale occupies a different radial position than do the finger - stop structures , thus avoiding interference . this arrangement affords the practical advantage of avoiding unduly lengthening the barrel , as would be necessary if the entirety of the calibration scale had to be located distally of the finger - stop structures . unnecessary barrel length is undesirable for several reasons , including these : it compromises the goal of compactness of packaging , storage and shipping of the syringes , a consideration particularly important in disposable syringes , which are typically sold and used in large quantities and as to which the costs associated with packaging , shipping and storage are typically a more important consideration than with syringes designed to be reused ; it requires more material to manufacture a longer syringe barrel ( and a longer plunger assembly to cooperate with the longer barrel ), thus increasing cost and waste ; and a longer barrel requires greater length of travel of the plunger during the stroke , making the syringe less easily controllable and the plunger member ergonomically harder to operate in both directions with one hand . it will be appreciated that finger - stop structures much different from those shown in fig1 and 9 may be used instead . any pair of structures formed upon , attached to or impressed into diametrically opposed places on the barrel may serve the purpose of dual - directional finger - stops as long as those structures serve to inhibit slippage of the syringe - holding fingers in both the proximal and the distal direction along the barrel . among the alternative structures that could be employed as finger - stops at diametrically opposed places on the barrel are , for example , the following : patches of knurled , scored or otherwise roughened surface upon the exterior of the barrel ; dimples or depressions or other concavities in the exterior surface of the barrel ; or a pair of parallel , interrupted rings occupying a portion of the circumference of the barrel . even a single such interrupted ring , if located at a suitable longitudinal position intermediate between the proximal and distal ends of the barrel ( such as at region 8 indicated in fig1 and 9 ), would serve as an adequate dual - directional finger - stop , although some convenience would be sacrificed by the operator &# 39 ; s need to perform a grip - shifting maneuver in transitioning from the upward ( aspiration ) stroke to the downward ( injection ) stroke ; that is , the syringe - grasping fingers would have to be positioned above ( i . e ., proximally from ) the single interrupted ring so that it would serve as a barrier against slippage in the distal direction during the upward ( aspiration ) stroke but then shifted to a position below (( i . e ., distally from ) the ring so that it would serve as a barrier against slippage in the proximal direction during the downward ( injection ) stroke of the plunger . as seen in fig3 the plunger member 20 includes at its distal end a piston 21 , preferably made of rubber or other resilient material and preferably having at least one ring 22 which , when the plunger shaft 23 is inserted into the bore , forms a seal with the wall thereof which is impermeable to liquids and gases . at the proximal end of the plunger shaft 23 is a plunger button 24 , having associated therewith an inferior loop member 25 and a superior loop member 26 . the loop members are preferably made of a flexible plastic material and are preferably integrally molded with plunger button 24 , which in turn is preferably integrally molded with plunger shaft 23 . upon the superior surface of inferior loop member 25 , and preferably molded integrally therewith , are a series of whisker - like projections 27 . it will be appreciated that they do not project perpendicularly from the surface of said inferior loop portion , but at a slightly backward slant with reference to the distal end thereof . a corresponding series of whisker - like projections 28 is formed on the inferior surface of the superior loop member 26 . if desired , the inferior loop member 25 may be biased upwardly and the superior loop member 26 biased downwardly , so that in the structure &# 39 ; s resting state the superior surface of inferior loop member 25 bears against the inferior surface of superior loop member 26 , causing whisker - like projections 27 to engage the whisker - like projections 28 . alternatively , the two loop members may be biased so that they are spaced apart , as seen in fig3 but may be urged together to form a closed aperture which is tightened around , and securely holds , a finger or thumb inserted therethrough , as seen in fig4 . it will be appreciated that when the whisker - like projections 27 and 28 are engaged with each other , they cooperate in a ratchet - like manner , such that the loop aperture which loop members 25 and 26 define can be made smaller by sliding the superior loop member 26 distally ( leftwardly in fig3 ), but the structure resists sliding in the opposite direction . hence , the whisker - like projections cause the superior and inferior loop members to cooperate with each other in such a manner that the loop aperture can easily be made smaller but will resist being made larger when the whisker - like projections 27 and 28 are engaged with each other . as can best be seen in fig4 superior loop member 26 can be closed down upon inferior loop member 25 and , either by pulling superior loop member 26 in its distal ( i . e ., leftward , in fig4 ) direction or by pinching together the left and right sides of the loop formed by loop members 25 and 26 , a finger or thumb t can be snugly embraced within the loop aperture formed by the cooperation of said loop members . as can readily be seen , the two loop members may be slipped and slid with respect to each other so as to adjust the size of the aperture they form , thereby to accommodate a variety of differently - sized fingers and thumbs , making the loop adjustable to accommodate different practitioners &# 39 ; different finger sizes , and to accommodate each practitioner &# 39 ; s personal preference whether to operate the plunger with the index finger or with the thumb . it will also be appreciated that when the finger or thumb t exerts force upwardly in the direction indicated by arrow a1 in fig4 as it would if the finger or thumb t were being used to withdraw the plunger from the syringe barrel , as in performing the aspiration test , the whisker - like projections 27 , 28 will be pressed forcibly against each other , causing the loop aperture to resist opening . when the injection procedure is completed , finger or thumb t can be easily released simply by lifting up the distal end of superior loop member 26 in the direction of arrow a2 , shown in fig4 thereby disengaging the whisker - like projections 27 , 28 from each other and permitting the opening of the loop aperture and the easy release of the thumb or finger held within that aperture . alternatively , the finger or thumb may simply be withdrawn from the aperture of the loop without opening the loop . hence , an adjustable and easily releasable plunger loop is provided which serves to facilitate one - handed performance of the aspiration step . as should be apparent from the foregoing description , whisker - like projections 27 , 28 function as means for fastening loop members 25 and 26 together in a conveniently adjustable and releasable way . other means are available which are equivalent to , and may readily be substituted for , whisker - like projections 27 , 28 to achieve the adjustable and releasable fastening function thereof . for example , cooperating velcro ® fastener strips could be applied to the superior surface of loop member 25 and to the inferior surface of loop member 26 , in lieu of whisker - like projections . for another example , a strip coated on both sides with a pressure - sensitive adhesive could be applied to the superior surface of loop member 25 , or to the inferior surface of loop member 26 , or to both surfaces , in lieu of whisker - like projections . such adhesive strips are readily obtainable in the market . for instance , tape with pressure - sensitive adhesive on both sides , and flat , rectangular patches coated on both sides with pressure - sensitive adhesive , are widely available under brands including the scotch ® brand . these and virtually any like material could readily be adapted , by a person skilled in the art , to provide the desired adjustable and releasable fastening means . fig5 shows an alternative embodiment of an adjustable and easily releasable plunger loop . it is preferably made of a resilient , elastomeric plastic and is preferably molded of a single piece with the plunger shaft 23 , although it can be made separately and affixed at the proximal end of the shaft 23 by conventional means such as gluing , cementing or heat bonding . if desired , a plunger button 24 ( not shown in fig5 but indicated in fig1 and 3 ) can be provided in association with the plunger loop . the plunger loop of fig5 comprises an inferior loop member 40 and a superior loop member 41 which are biased to return to their resting state , as shown , and to form a loop which defines an aperture through which a thumb or finger can be inserted . preferably the diameter of the aperture thus defined is , in the loop members &# 39 ; resting state , small enough to fit snugly a small adult index finger . when the operator &# 39 ; s thumb or finger is inserted into the aperture , loop members 40 and 41 are displaced in a manner that expands the aperture to accommodate the thumb or finger ; but because the loop members are biased to return to their resting state , they exert springing forces which hold the finger or thumb securely , and the plunger loop they form resists opening and prevents escape of the thumb or finger during performance of the upward ( aspiration ) stroke of the plunger . when the injection procedure is complete , the thumb or finger is released simply by withdrawing it from the loop . it will be appreciated that whereas the embodiment of the adjustable plunger loop shown in fig3 and 4 employs whisker - like projections 27 , 28 to provide adjustability of the loop and resistance against opening during the aspiration step , the embodiment of fig5 depends principally on the springing forces exerted by loop members 40 and 41 to accomplish these purposes . another alternative adjustable plunger loop structure is illustrated in fig1 where loop members 30 and 31 , preferably formed integrally with plunger button 24 , are generally configured as overlapping arcs of a circle when in their resting state . loop members 30 and 31 are made of a resilient material , biased to return to their resting state after a load is withdrawn . in their resting state , loop members 30 and 31 define an aperture that is preferably no larger than a small adult index finger . when an index finger or thumb that is larger than the aperture is attempted to be inserted therein , loop members 30 and 31 are displaced sufficiently to accommodate the finger or thumb ; but because they are biased to return to their resting state , they exert a springing force upon the finger or thumb , embracing it snugly . when the thumb or finger so embraced is then lifted to exert a withdrawing force upon the plunger , loop members 30 and 31 retain it , enabling the accomplishment of the aspiration test . after that test , or the injection procedure , is complete , the thumb or finger may be withdrawn . loop members 30 and 31 in the embodiment shown in fig1 thus act similarly to loop members 40 and 41 in the embodiment shown in fig5 a difference , however , being that loop members 40 , 41 overlap in an &# 34 ; over - and - under &# 34 ; fashion while loop members 30 and 31 overlap in a &# 34 ; side - by - side &# 34 ; fashion . it will be appreciated that a single - arm loop structure could be employed , instead of either the two - overlapping - loop - members structure described above and shown in fig1 or the two - overlapping - loop - members structure described above and shown in fig5 . such a single - arm loop structure is shown in fig6 where single loop member 50 defines an aperture open at one side , rather than aperture closed on all sides . loop member 50 is preferably molded integrally with , but may be formed separately and affixed at the proximal end of , plunger shaft 23 . if desired , a plunger button 24 ( not shown in fig6 but indicated in fig1 and 3 ) may be provided in association with loop member 50 . loop member 50 is preferably made of a resilient , elastomeric plastic and it preferably forms an aperture which , in the resting configuration shown in fig6 has a diameter not larger than that of a small adult index finger . when the operator &# 39 ; s thumb or finger is inserted into the aperture , loop member 50 is displaced to accommodate that thumb or finger ; but because loop member 50 is biased to return to its resting configuration , it captures and snugly holds the finger or thumb and resists further opening when the finger or thumb is raised to perform the upward ( aspiration ) stroke . loop member 50 is preferably provided , at the free end thereof , with a detent 51 which serves to prevent escape of the thumb or finger from the open side of the aperture when the loop is under load , as when the captured finger or thumb is being used to apply a plunger - withdrawing force . yet another alternative for constructing an adjustable plunger loop is shown in fig7 and 8 . single loop member 60 is made of a flexible material , preferably a plastic , and is fixed at one end to the proximal end of plunger shaft 23 . it is preferably molded of a single piece with the plunger shaft , although it can be formed separately and attached to the plunger shaft by conventional means . loop member 60 may , if desired , be provided in association with a plunger button 24 ( not shown in fig7 and 8 , but indicated in fig1 and 3 ). at least the portion near the free ( distal ) end of loop member 60 has upon its superior surface , and preferably formed integrally therewith , a series of sawtooth projections 61 . ratchet housing 62 is preferably molded integrally with plunger shaft 23 but may be formed separately and attached by conventional means . when the free end of loop member 60 is conducted through ratchet housing 62 , a closed loop is formed through which the operator &# 39 ; s thumb or finger may be inserted . ratchet housing 62 is provided with a pawl 63 which comprises one or more sawtooth projections configured to mesh with those on loop member 60 . preferably , pawl 63 is also provided with a releasing tang 64 . pawl 63 is pivotably mounted within the ratchet housing and is biased to contact loop member 60 so that the sawtooth projections on loop member 60 mesh with one or more sawtooth projections on the pawl . preferably the mounting of the pawl , and its bias to engage the sawtooth projections on the loop member , are accomplished by making the pawl of a flexible material and forming it integrally with the ratchet housing . it will be appreciated that the cooperation of the loop member 60 with the pawl 63 provides a snare - like action , such that the loop can be easily adjusted to make the aperture smaller and tighten it around a finger or thumb which is inserted therethrough , but the loop resists opening under load . the tightening adjustment is accomplished by pushing or pulling the free end of the loop member 60 farther through the ratchet housing 62 . the pivotably mounted pawl rides over the sawtooth projections on the loop member and permits its passage so as to decrease the size of the aperture ; but when a withdrawing force is applied , the sawtooth projections on the loop member engage with one or more corresponding projections on the pawl and resist the enlargement of the loop aperture . after the injection procedure ( or the use of the syringe in a venous catheter - insertion procedure ) has been completed , the operator may simply withdraw the finger or thumb from the aperture . alternatively , the pawl may be provided with a tang 64 which affords the operator a convenient means to disengage the pawl from the loop member so as to permit the latter &# 39 ; s withdrawal from the ratchet housing and the enlargement of the plunger loop so as to facilitate withdrawal of the operator &# 39 ; s finger or thumb . it is within the skill of the art to devise a snare - like loop - size adjustment means which is simpler than that shown in fig7 and 8 but which will still work adequately for the purpose . for example , it is possible to dispense with the pivotably - mounted pawl and use instead a single ratchet tooth , mounted in or formed integrally with the roof ( that is , the side facing sawtooth projections 61 ) of the ratchet housing 62 , and to dimension the ratchet housing and tooth so that the tooth engages the sawtooth projections 61 on the loop member 60 . by varying the flexibility if the materials , or by varying the pitch of the ratchet tooth and the sawtooth projections 61 or the dimensions thereof , or the degree of interference therebetween , practitioners of skill in the art can readily arrive at a configuration which affords acceptable ease of closing the loop and an acceptable amount of resistance by the loop against opening under load . if both great ease of closing the loop and high resistance to opening are desired , the pitch of the sawtooth projections 61 and the ratchet tooth can be varied so that the pitch of the proximally - facing ( i . e ., toward the fixed end , and away from the free end , of loop member 60 ), sides of the sawtooth projections on the loop member 60 is much steeper than the pitch of the distally - facing ( i . e ., toward the free end of loop member 60 ) sides thereof . it will be appreciated that if the projections on the loop member are so configured they will cooperate with the ratchet tooth to provide a snare - like loop size adjustment means , in that the loop may easily be tightened by pulling on the distal end of loop member 60 to conduct it through ratchet housing 62 , but may not easily be loosened . thus the finger or thumb t may be secured snugly within the aperture defined by the loop member and may be withdrawn from the aperture thereafter without loosening it ; or , by applying sufficient force , the loop member may be made to withdraw partially from the ratchet housing so that the plunger loop loosens to facilitate withdrawal of the finger or thumb . as will be evident from the foregoing description , a practitioner using the syringe here disclosed for the injection of medicaments can easily and conveniently perform the aspiration test with a single hand , by performing the following steps : first the practitioner picks up the syringe by grasping the barrel between thumb and middle finger as shown in fig1 ( or , if preferred , between index and middle fingers as shown in fig1 ) in the region of the finger - stop structures . next , the practitioner inserts the index finger ( if the thumb is being used to grasp the barrel ) or the thumb ( if the index finger is being used to grasp the barrel ) through the loop aperture . next , the aperture is adjusted if necessary , as described above , to secure the plunger - operating finger ( or thumb ) snugly within it . the practitioner then loads the medicament into the syringe , measuring its amount with the syringe &# 39 ; s calibration scale if desired . using one hand to stabilize the patient &# 39 ; s arm ( or other injection site ), the practitioner then inserts the needle with the other hand . because the plunger - operating finger ( or thumb ) is secured within the adjustable loop aperture atop the syringe &# 39 ; s plunger member while the barrel is being securely grasped by other fingers of the same hand through the use of the finger - stops , the practitioner can easily draw the plunger backward to perform the aspiration test simply by raising the plunger - operating finger or thumb . if the test indicates that a blood vessel has been punctured , and intravenous injection of the medicament is not desired , then the practitioner withdraws the needle and starts over ; but if a blood vessel has not been punctured , then the practitioner proceeds with the injection in the usual way . a practitioner who desires to insert a catheter or tube into the lumen of a blood vessel can manipulate the syringe here disclosed in a similar manner , so far as the techniques of grasping the syringe barrel and engaging the plunger - operating finger or thumb with the plunger are concerned . the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . the presently disclosed embodiments are therefore to be considered in all respects as being examples only , the scope of the invention being indicated by the appended claims rather than by the foregoing description , and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein .	0
fig1 shows a noninvasive liquid level indicator 2 made in accordance with the present invention mounted about an exterior sidewall 6 of a reservoir 10 . the indicator 2 includes a transducer housing 14 , one side of which is held against the sidewall 6 of the reservoir 10 by a tether or strap coupler 18 . the tether or strap coupler 18 includes a strap 22 joined to the sides of the housing 14 in any conventional fashion , such as by the loops 26 . the strap 22 can be made of a single resilient piece , or can have two pieces , each piece being connected at one end to the transducer housing 14 , and at least one of the pieces having an attachment / adjustment mechanism , such as a cam buckle 30 ( fig2 ), at the opposite end . referring to fig2 the cam buckle 30 is attached to the end 24a of a first piece 22a of the strap 22 and has a channel 32 for receiving an end 24b of a second piece 22b of the strap 22 . a lever 34 with a cam 36 or some other projection is attached to the cam buckle 30 above the channel 32 . when in use , the end 24b is slid into the channel 32 until the strap 22 is sufficiently taut . the lever 34 is then pressed toward the strap 22 , and the cam 36 contacts the portion of the second piece 22b which is in the channel 32 , forcing it against the base 38 of the cam buckle 30 and holding the second piece 22b firmly in place . those skilled in the manufacture and various uses of straps will recognize the numerous different modifications that can be made to such a cam buckle 30 to achieve desired pressure limits , etc . referring now to fig3 the transducer housing 14 includes a transducer assembly 40 , a portion of which extends out of an opening 44 on one side of the housing 14 . an enlarged view of the transducer assembly is shown in fig4 . the transducer assembly 40 includes an ultrasonic transducer 50 and a base element 52 disposed on a rearward side of the transducer 50 . as will be appreciated by those skilled in the art , the transducer 50 will be made of piezoelectric material or other material conventionally used for ultrasonic transducers . the base element 52 is made of any convenient support material such as plastic . the transducer 50 and the base element 52 are covered with an elastomeric sleeve 54 which extends about the sides of the transducer 50 and the base element 52 , over a forward side of the transducer 50 and partially covers a rearward side of the base element 50 . the elastomeric sleeve 54 can be made of numerous elastomeric materials such as rubber , silicone or urethane . the elastomeric sleeve 54 has a face 56 which is positioned outside the housing 14 so as to firmly contact a reservoir when the indicator 2 is in place on the sidewall 6 of the reservoir 10 shown in fig1 . preferably , the face 56 should be made of polyurethane , as polyurethane provides a superior transfer of the ultrasonic signal between the transducer 50 and the reservoir 10 . the face 56 is adhesively attached to an epoxy layer 58 which , in turn , is attached to the forward side of the transducer 50 . this epoxy layer 58 can serve as a &# 34 ; matching layer &# 34 ; to enhance the effectiveness of acoustic energy transmission from the transducer 50 into the reservoir ( not shown ). this is done by providing an epoxy layer 58 having a thickness which is an odd quarter of an ultrasonic signal wavelength thick . thus , the thickness of the epoxy layer 58 is optimally 1 / 4 , etc . the wavelength of the ultrasonic signal . these thicknesses provide an optimal transfer of the ultrasonic signals . however , the epoxy layer 58 can be omitted , e . g . to reduce costs , and the transducer 50 would still operate satisfactorily . a conductor cable 60 made of conventional materials extends through the base element 52 and connects the transducer assembly 40 to an electronic processing circuit 66 ( fig3 and 4 ). the circuit 66 may utilize a conventional microprocessor or analog circuitry . a person skilled in the art of transducer assemblies will recognize the method of using either type of processing circuit and the relative advantages and disadvantages of each . in use , the elastomeric facing 56 is firmly held against a sidewall of the reservoir 10 by the strap 22 ( fig1 ). the electronic processing circuit 66 , powered by a power source , such as a battery 68 , sends an electrical actuation signal to the transducer 50 through the cable 60 . preferably , this signal is high frequency a / c voltage . in response to the electrical actuation signal , the transducer 50 emits an ultrasonic signal through the epoxy layer 58 and elastomeric facing 56 into the reservoir . because of the elastomeric facing 56 , the ultrasonic signals pass into the reservoir 10 without the need for gel or other couplant , decreasing cost , mess and wasted time as the indicator is moved from one reservoir to another . if there is liquid within the reservoir , some of the ultrasonic signals will reflect off the liquid / surface interface on an opposing sidewall 64 of the reservoir 10 ( fig1 ), and the reflected signals pass back through the liquid , elastomeric facing 56 and the epoxy layer 58 , to stimulate the transducer 50 . in response , the transducer 50 sends an electrical response signal through the cable 60 to the electronic processing circuit 66 ( as shown in fig3 ). the circuit 66 is either programmed or wired to monitor the signals by measuring the time between supply of the actuation signal to the transducer and the receipt back of the transducer &# 39 ; s response signal . the return signal will occur within a predetermined time parameter , and the circuit 66 will actuate a visual display 70 or some other perceptible indicator , such as an audio signal generator 74 , to inform the user that the liquid level is adequate . alternatively , the circuit 66 could be programmed or wired to not emit any indication signals until the liquid level passes below the desired point . if the liquid level has passed below the point along the reservoir at which the indicator 2 is placed , the lack of liquid can be measured by one of two different ways . first , because air is not an effective carrier of ultrasonic signals , signals will not effectively propagate into the reservoir 10 , thus no energy or signal will reflect off the opposing portion 64 of the sidewall 6 of the reservoir 10 ( shown in fig1 ) as discussed above . thus , the transducer 50 will not be stimulated by a return signal within the defined parameters and will not provide the response signal back to the circuit 66 within the same parameters as when the liquid level within the reservoir 10 is above the position of the indicator 2 . when the signal is not returned within the proper time , the circuit 66 ( shown in fig3 ) is programmed or wired to an indicator signal activating a visual display 70 or some other perceptible indicator , such as an audio signal generator 74 so as to warn the user that the liquid in the reservoir is below the desired level . the visual display 70 , shown in fig3 can be an led , liquid crystal or similar display device . the housing 14 will likely contain a window 72 to protect the visual display 70 while allowing the user to see the display clearly . the audio signal generator 74 can utilize any of numerous commercially available audible signalling devices . additionally , a volume control can also be added to control the volume of the audio signal . alternatively to the above mentioned method , the circuit 66 can be programmed or wired to respond to an early receipt of a response signal from the transducer 50 to the circuit 66 . when a sidewall of a reservoir is covered with liquid , an ultrasonic signal sent into the sidewall from the side opposite the liquid will pass through the wall and into the liquid . when the opposing side of the sidewall is no longer covered in liquid , a detectible amount of the ultrasonic signal will be reflected back towards its source rather than entering the reservoir . thus , when the transducer 50 sends an ultrasonic signal into an empty reservoir 10 , it will be stimulated by a small reflected signal before a signal reflected off the opposing sidewall 64 could have returned . therefore , the circuit 66 can also be programmed or wired to send an indication signal when it detects a response signal from the transducer 50 prior to the time parameters of a signal reflected off the opposing sidewall 64 of the reservoir 10 . while the integrated housing 14 , represented in fig3 is a preferred embodiment of the indicator 2 , the transducer assembly 40 need not be contained within a housing containing the circuit 66 and the signal indicators 70 , 74 . for example , the transducer assembly 40 can be connected to an elongate conductor cable 160 such as that shown in fig5 . the conductor cable 160 connects to a monitor 168 such as that shown in fig5 . the monitor 168 can contain the electronic processing circuit ( not shown ), as well as the visual display 170 and the audio signal generator 174 for generating a perceptible audio alarm . the separate monitor 168 allows for the indicator 2 to use a conventional a / c voltage line 176 rather than a battery , as shown in fig3 . additionally , the separate monitor 168 could easily be modified to monitor several reservoirs and contain a display for each reservoir . when using the detached monitor 168 shown in fig5 the transducer assembly ( not shown in fig5 ) can be adjustably held against the reservoir in several different ways . for example , fig6 shows another embodiment in which the transducer assembly 240 is positioned along a reservoir ( not shown ) by a clamp 230 having two handles 232 and two arms 234 - 234a . the handles 232 are pivotally attached so that movement of the handles closer to one another causes the arms 234 - 234a to move away from each other . the clamp 230 also comprises a biasing force positioned such that when no external pressure is placed on the handles 232 , the handles are forced apart and the arms 234 - 234a are forced into a closed position . as demonstrated in fig6 this is accomplished by a hinge 238 serving as the pivotal attachment and a spring 236 positioned between handles 232 provides the biasing force . the preferred size of the hinge 238 and spring 236 will depend largely on the size of the clamp 230 . the arms 234 - 234a of the clamp have interior , concave walls 244a , and exterior , convex walls 244b . on the interior , concave walls 244a is attached a plurality of gripping elements 248 . the gripping elements are preferably made from elastomeric materials , such as silicone , polyurethane , or rubber , so that they will grip glass , metal and other smooth surfaces . as the spring 236 forces the arms 234 - 234a into a closed position , the gripping elements 248 come into firm contact with a liquid accommodating reservoir , such as reservoir 10 in fig1 . the position of the clamp 230 along the reservoir can be adjusted by applying pressure to the handles 232 in a direction opposite to the force of the spring 236 . once the gripping elements 248 are no longer in forceful contact with the reservoir , the clamp 230 can be moved to another position along the reservoir . located within one arm 234a of the clamp 230 is a receptacle 242 for securely holding the ultrasonic transducer assembly 240 . when the clamp 230 closes about a reservoir , such as reservoir 10 of fig1 the transducer assembly 240 is held firmly against the sidewall of the reservoir . an elongate conductor cable 260 extends from the transducer assembly 240 to a monitor such as that shown in fig5 . the cable 260 conveys the actuation and response signals between the transducer assembly 240 and electronic processing circuit ( not shown in fig6 ) in the same manner described above . a change in the timing of the response signal from the transducer assembly 240 to the circuit is signaled to the visual display 170 and / or audio signal generator 174 on the monitor 168 ( fig5 ). fig7 shows yet another embodiment of the present invention attached to a sidewall 306 of a reservoir 310 . an ultrasonic transducer assembly 340 , made in a manner described above , is attached to the sidewall 306 by means of removable strips of adhesive 330 , such as tape . attachment of the adhesive 330 to the transducer assembly 340 can be facilitated by adding a flange 332 or some similar device to sides of the transducer assembly 340 . the transducer assembly 340 is positioned in such a way as to keep a side 358 of the elastomeric facing layer 356 in intimate contact with and parallel to a sidewall portion 306a of the reservoir 310 so that the transducer assembly 340 can receive signals reflected off an opposing sidewall portion 306b . as discussed earlier , the electronic processing circuit ( not shown in fig7 ) can also be programmed or wired to indicate when return signals are received off the adjacent sidewall 306a , indicating that the liquid level has fallen below the position of the transducer assembly 340 . in some instances , it may be desirable for the adhesive material 330 to be removable so that the transducer assembly 340 can be used with different reservoirs , or placed at varying positions along a reservoir at different times during use . the ultrasonic transducer assembly 340 will almost always be attached to a monitor which contains the electronic processing circuit and displays such as that shown in fig5 . fig8 shows an additional embodiment of the invention attached to an underside 408 of the reservoir 410 . as in fig7 strips of adhesive material 430 , such as tape , are used to secure the transducer assembly 440 to the reservoir 410 in such a way as to keep the elastomeric facing layer ( not shown ) in intimate contact with and relatively parallel to the underside 408 of the reservoir 410 . such an adhesive attachment can be facilitated by adding one or more flexible flanges 432 extending from the transducer assembly 440 and attaching the adhesive strips 430 to the flanges 432 as shown in fig8 . rather than measuring when a liquid has fallen below some desired horizontal point , the ultrasonic transducer assembly 440 of the instant embodiment ultrasonically measures the height of the liquid in the reservoir 410 . an actuation signal is sent from the electronic processing circuit ( not shown in fig8 ), through the cable 460 , to the transducer positioned in the transducer assembly 440 . in response , the transducer emits an ultrasonic signal into the reservoir 410 . the ultrasonic signal travels through the liquid in the reservoir 410 and is reflected off of a liquid - surface interface 462 between the liquid in the reservoir and the air above it . the reflected signal travels through the liquid , and into the transducer , stimulating the transducer to send a response signal through the cable 460 to the electronic processing circuit in the same manner as discussed above . as the liquid level falls , the time between emission of the actuation signal and receipt of the response signal decreases . thus , the circuit can be programmed or wired to monitor the response signal and to send an indication signal to a visual display or audio signal generator when the response signal is received before a specified time , thereby indicating that the liquid level has passed below a predetermined desired level . in the manner described , a noninvasive ultrasonic liquid level indicator is provided . it is to be understood that the above - described arrangements are only illustrative of the application of the principles of the present invention . numerous modifications and alternative arrangements may be devised by those skilled in the art without departing from the spirit and scope of the present invention , and the appended claims are intended to cover such modifications and arrangements .	8
referring to the drawings wherein like reference characters designate like or corresponding parts throughout the several views and referring particularly to fig1 there is shown a housing 17 in the interior of which there is arranged a cartridge composed of a plurality of blades 21 in spaced relation from one another along a shaft 37 on which the blades are swingable by manipulation of disc - shaped operators 19 . a preferred embodiment is illustrated and in it the cartridge is maintained in the housing by means of keepers on the shaft ends , one of which keepers is shown in fig1 and designated by the numeral 23 . in general , the operation of the device is that one or more of the blades are rotated into the exposed cutting position shown at the left of fig3 that is with a cutting edge or edges exposed beneath the housng while the other blades are protectively within the housing as shown by the blade at the right in fig3 . referring more specifically to the housing 17 , it is seen that it has an upper wall which is adapted to be hand - held or grasped . to this end , the upper wall includes downwardly tapering portions and a front wall 53 and rear wall 54 spaced apart from one another a predetermined distance and end walls 52 and 52 &# 39 ;. the housing defines an open bottom of predetermined dimension between the front and rear wall . the walls terminate so as to define a tool which can be moved smoothly over a surface with the open bottom slidably confronting the surface . within the housing and more specifically the upper wall there is provided an access window 51 and structure within the housing on opposite sides of that window is provided to hold a blade cartridge . preferably this structure includes a pair of spaced blocks 27 secured to the interior of the housing with each of the blocks having a downwardly opening recess 55 with the block recesses being in aligned relation with one another . a threaded hole 57 is provided in each block to receive a companionately sized threaded screw . preferably a detent bar 33 is arranged in the housing between the end walls adjacent the access window . it is parallel to the axis defined by the aligned recesses . additionally , a stop bar 31 is arranged between the side walls in depending relation from the top wall . a portion of the top wall 71 also constitutes a stop means in the preferred embodiment as will be explained . a blade cartridge , now to be described , is received within the housing with the cartridge preferably including a shaft 37 with end zones 61 and 62 each of which is sized to be nestingly received within one of the recesses and maintained therein by means of keeper means 23 , such as that shown in fig1 and designated by the numeral 23 . in assembly a threaded screw 27 is utilized as best seen in fig7 . along the shaft 37 the plurality of blade members 21 are separated from one another by a plurality of spacer means 19 . the spacer means of the preferred embodiment is best seen in fig5 . the spacer means and blade members are maintained on the shaft by tension washer , see fig6 and fig9 and a bushing 29 , see fig8 is utilized at the right - hand side of the shaft shown in fig6 . each of the blades 21 is of a predetermined length and is provided with a hole 81 adjacent one end to accommodate swinging movement of the blade in the directions of the arrowed line shown in fig3 . each of the spacer means is provided with a pattern of dimples or spacer pins designated by the numeral 39 which are adapted to drive the blade when the spacer means in the form of a disc is rotated holding the blades in a fixed angular position with respect to the discs . detent means are provided on the peripheral surface of the spacer means as seen in fig3 and designated by the numeral 6 . preferably along a chord of the disc there is a cutout so that the portion 6 is somewhat flexible . when the blade is in the position shown at the right in fig3 this detent 6 will engage the detent bar 33 holding it in the retracted position yet yieldable for swinging movement into the exposed position as at the left in fig3 . each of the blade members is of a size and shape such that the cutting edge is exposed beneath the bottom of the tool housing when in a first position , the position shown at the left in fig3 and each of the blade members is completely within the housing when the blade member is in the second position , such as at the right in fig3 . the periphery of the disc - shaped members project from the window opening 51 in the housing in the preferred embodiment and can be manipulated to accommodate the swinging movement of the blades . in operation , one desiring to cut strips from a piece of mat board , for example , merely selects the blades which he wishes to use by rotating them to the exposed position as shown at the left in fig3 and , thereafter , drawing the tool over the surface . if one wishes , one may remove the cartridge utilizing longer blades or different spacing between the blades and in any event , replace the cartridge when the blades become dulled in use . while the instant invention has been shown and described herein in what is conceived to be the most practical and preferred embodiment , it is recognized that departures may be made therefrom within the scope of the invention , which is therefore not to be limited to the details disclosed herein but is to be accorded the full scope of the claims so as to embrace any and all equivalent apparatus and articles .	1
in exemplary embodiments , the asymmetric soi sram cell structure addresses the variability problems due to the floating body nodes as described above . in exemplary embodiments , selective implementation of asymmetric devices lessens the floating body impact while retaining performance . in one example , implementing asymmetric devices in the four transistors of the two inverters of the soi sram engineer a lower floating body potential . conventional techniques , such as mapping the sram devices to either fully deplete undoped devices or bulk cmos devices , present process complexity and cost if they need to be built in the same silicon wafer as high performance planar soi fets in logic . furthermore , in a soi fet , in addition to conduction through the channel under the gate , there is also a path from the drain diffusion to the floating body ( n type in the drain , p type in the body for an nfet ), which is a diode . similarly , there is a diode connecting the body node to the source diffusion node . this configuration results in two diodes in series ( but ‘ back to back ’, i . e ., one operates in a forward mode , one in a reverse mode , assuming a positive bias on the floating body , and the body is p type and both diffusion nodes are n type [ for an nfet example ]). in typical floating body soi , reverse leakage from the drain diffusion to body diode raises the body voltage , as the drain is connected to v dd in an nfet . as this event happens , the body node potential with increase , as it &# 39 ; s not grounded as in bulk . eventually , the diode from the body to source turns on , as it &# 39 ; s forward biased , limiting the body potential typically to on the order of ˜ 300 - 400 mv . in a body tied soi device , the body node is either explicitly grounded in some fashion , which effectively overrides the ‘ floating ’ effect and the impact of the drain diode reverse leakage . in exemplary embodiments , in asymmetric soi fets , the emphasis of the halo implant can be primarily into the source side of the device results , which in a different body to source diode . higher doping on the source side reduces the turn - on voltage of the diode , which in turn limits the floating body voltage to something on the order of 0 - 100 mv . in exemplary embodiments , selected devices can be mapped to asymmetric devices in the sram cell to lower floating body variability without the additional cost and complexity . as such , some gates are kept asymmetric ( i . e ., the pass gates ) for both floating body performance and the others asymmetric for variability reduction and stability . in exemplary embodiments , by implementing masking and implants , halo implants can be performed on one side ( e . g ., the source side ) of selective fets . as such , masking techniques can be implemented , which do not require body tie formation or complex integration of alternate device silicon thicknesses ). fig2 illustrates a plan view of an exemplary 6t sram cell 200 . access transistors 202 , 204 can be n - fet pass gate symmetric fet devices , whereas at least a pair of pull - down transistors 206 , 208 disposed between the access transistors 202 , 204 are asymmetric fet devices . in exemplary embodiments , there can be at least one pair of pull - up transistors 210 , 212 , which can be either floating body or non - floating body devices , disposed between the access transistors 202 , 204 and pull - down transistors 206 , 208 . in exemplary embodiments , the pull - up devices 210 , 212 are fabricated over an n - doped well , and are p - fets , whereas the other transistors are n - fets . in exemplary embodiments , several mask steps can be implemented to achieve the halo implants as described above . in one example , to achieve either nfet or pfet halos , several mask steps can be implemented . four masks can first be implemented to expose the devices selected to asymmetric devices . in the exemplary embodiments described herein , the pull - down transistors 206 , 208 are selected to be the asymmetric devices . as such , one mask is used for each of the “ source up ” ( the sources oriented up on the wafer ) regions of the pull - down transistors 206 , 208 , and one mask is used for each of the “ source down ” ( the source oriented down on the wafer ) regions . the four masks are used for both the nfet and pfet halos . fig3 illustrates a side structural view of an example of an asymmetric nfet 300 undergoing a halo implant in accordance with exemplary embodiments . fig4 illustrates further details of the region shown in fig2 . in exemplary embodiments , a gate 328 of the symmetric access transistor 202 , 204 is disposed over a semiconductor layer 313 . in addition , a gate 329 of the asymmetric pull - down transistor 206 , 208 is disposed over the semiconductor layer 313 . the semiconductor layer 313 can be disposed over a layer of buried oxide 314 . the asymmetric nfet 300 can further include source and diffusion regions 340 , 350 . in exemplary embodiments halo implants are selectively performed to reduce the overall floating body impact . in exemplary embodiments , selected gates have halo implants performed on only one side , such as the source region 340 . the resulting asymmetry generates a larger body to source leakage , and reduces both the magnitude and full swing of the floating body potential , which clamps the swing of the floating body potential to a lower value . as such , in the exemplary embodiments described herein , the asymmetric devices are designed and fabricated to have a lower floating body effect than the symmetric devices . the masking steps as described herein block the symmetric transistor 305 with resist 320 and expose the asymmetric transistor 310 to prepare it for the implant . in exemplary embodiments , standard masking , photolithography and implanting techniques are performed . as illustrated , a single - sided implant 315 is performed on one side of the asymmetric transistor 310 , thereby generating a first single sided halo implant . in exemplary embodiments , the single - sided halo implant 315 is performed on one side at either 0 or 180 degrees depending on the source orientation of the wafer . as described herein the single sided halo implant 315 lowers the floating body potential in the off state ( i . e ., vb off ). in exemplary embodiments , as described herein , additional halo implants are performed on the symmetric transistor 305 . in exemplary embodiments , the halo implants for the symmetric transistor 305 are conventionally implemented with 0d / 180d ( dual ) symmetric halo implants . fig4 illustrates a side structural view of an example of a symmetric nfet 400 undergoing a halo implant in accordance with exemplary embodiments . fig4 illustrates that the asymmetric device 310 is covered with resist 420 . as discussed herein , standard masking , photolithography and implanting techniques are performed . as illustrated , a first of the dual sided halo implant 415 is performed on one side of the symmetric transistor 305 , thereby generating a first of the dual - sided halo implant . fig5 illustrates a side structural view of an example of a symmetric nfet 500 undergoing a halo implant in accordance with exemplary embodiments . fig5 illustrates that the asymmetric device 310 is covered with resist 520 . as discussed herein , standard masking , photolithography and implanting techniques are performed . as illustrated , a second of the dual sided halo implant 515 is performed on one side of the symmetric transistor 305 , thereby generating the second of the dual - sided halo implant . in exemplary embodiments , standard fabrication techniques can be performed to generate the devices ( e . g ., conventional bulk soi devices ) as described herein . fig6 illustrates a flow chart of a method 600 for fabricating an asymmetric soi sram cell in accordance with exemplary embodiments . the exemplary masking and halo implantation techniques for fabricating the symmetric and asymmetric devices are described in the method 600 . at block 605 , the masking and patterning of the symmetric device 305 is performed . at block 610 , the single - sided halo implant ( see the single - sided halo implant 315 in fig3 ) is performed , which provides the asymmetry as described herein . as described herein the first halo implant can be directed at either 0 degrees or 180 degrees depending on the orientation of the wafer . at block 615 , the masking and patterning of the asymmetric device 310 is then performed . it is appreciated that the asymmetric device includes only one halo implant 315 , and is subsequently masked , thus creating the asymmetry as described herein . at block 620 , the dual - sided halo implant is performed , which provides the symmetry as described herein ( see the first and second of the dual sided halo implants 415 , 515 in fig4 and 5 respectively ). as described herein the dual sided halo implants 415 , 515 are conventional dual ( 0d / 180d ) halo implants . as described herein , the soi devices described herein can be fabricated with conventional fabrication techniques . for example , the method 600 can include doping a first region of a semiconductor substrate with at least one of an n - type and a p - type dopant and doping a second region of the semiconductor substrate with at least one of the n - type and the p - type dopant , and forming a pair of symmetric access transistors over the first region . the method 600 can further include forming at least one pair of pull - down transistors that are at least one of symmetric and asymmetric over the first region and forming at least one pair of pull - up transistors that are symmetric or asymmetric over the second region . in addition , the method 600 can further include coupling the pair of pull - down transistors and the pair of pull - up transistors between the pair of access transistors to form a memory cell . the memory cell described herein can include a static random access memory cell . as such , the coupling of the pair of pull - down transistors and the pair of pull - up transistors between the pair of access transistors can be performed by coupling each gate of the pull - down transistors and each gate of the pull - up transistors to a channel of at least one of the access transistors . as described herein , in a standard 6t - sram layout , with m 2 and m 4 as pull - up transistors , m 1 and m 3 as pull - down transistors , and m 5 and m 6 as pass gate or access transistors . in the embodiments described herein , various combinations of the symmetric and asymmetric transistors are contemplated . in exemplary embodiments , the m 1 and m 3 are asymmetric . in exemplary embodiments , m 2 and m 4 can be asymmetric . in exemplary embodiments , m 1 / m 3 / m 2 / m 4 are asymmetric . in exemplary embodiments , m 5 and m 6 are symmetric in the embodiments described herein . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one ore more other features , integers , steps , operations , element components , and / or groups thereof . the corresponding structures , materials , acts , and equivalents of all means or step plus function elements in the claims below are intended to include any structure , material , or act for performing the function in combination with other claimed elements as specifically claimed . the description of the present invention has been presented for purposes of illustration and description , but is not intended to be exhaustive or limited to the invention in the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the invention . the embodiment was chosen and described in order to best explain the principles of the invention and the practical application , and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated the flow diagrams depicted herein are just one example . there may be many variations to this diagram or the steps ( or operations ) described therein without departing from the spirit of the invention . for instance , the steps may be performed in a differing order or steps may be added , deleted or modified . all of these variations are considered a part of the claimed invention . while the preferred embodiment to the invention had been described , it will be understood that those skilled in the art , both now and in the future , may make various improvements and enhancements which fall within the scope of the claims which follow . these claims should be construed to maintain the proper protection for the invention first described .	7
an embodiment of the present invention provides a method for transition of processor performance levels in a demand - based system . a performance level is a specified operating frequency and its associated voltage . automatic transition may use less transition overhead , thereby extending battery life . an embodiment of the invention provides for the automatic adjustment of processor frequency while preserving system responsiveness . in one embodiment of the invention the processor may be transitioned to multiple performance levels . fig1 is a diagram illustrating an exemplary computer system 100 for implementing one embodiment of the present invention . the sampling of processor utilization , the detection of a change in processor utilization , and the transition of the processor to a different performance level , described herein , may be implemented and utilized within computing system 100 . computing system 100 may represent a general - purpose computer , portable computer , or other like device . the components of computing system 100 are exemplary in which one or more components may be omitted or added . referring to fig1 , computing system 100 includes a central processing unit 102 coupled to a display circuit 105 , main memory 104 , static memory 106 , and mass storage device 107 via bus 101 . computing system 100 may also be coupled to a display 121 , keypad input 122 , cursor control 123 , hard copy device 124 , and input / output ( i / o ) devices 125 via bus 101 . computing system 100 may contain frequency and voltage regulation circuitry as described below . bus 101 is a standard system bus for communicating information and signals . processor 102 is a processing unit for computing system 100 . processor 102 may be used to process information for computing system 100 . processor 102 includes a control unit 131 , an arithmetic logic unit ( alu ) 132 , and several registers 133 , which are used to process information . main memory 104 may be , e . g ., a random access memory ( ram ) or some other dynamic storage device , for storing information or instructions ( program code ), which are used by processor 102 . main memory 104 may also store temporary variables or other intermediate information during execution of instructions by processor 102 . static memory 106 , may be , e . g ., a read only memory ( rom ) and / or other static storage devices , for storing information or instructions , which may also be used by processor 102 . mass storage device 107 may be , e . g ., a hard or floppy disk drive or optical disk drive , for storing information or instructions for computing system 100 . display 121 may be , e . g ., a cathode ray tube ( crt ) or liquid crystal display ( lcd ). display device 121 displays information or graphics to a user . computing system 100 may interface with display 121 via display circuit 105 . keypad input 122 is a alphanumeric input device for communicating information and command selections to computing system 100 . cursor control 123 may be , e . g ., a mouse , a trackball , or cursor direction keys , for controlling movement of an object on display 121 . hard copy device 124 may be , e . g ., a laser printer , for printing information on paper , film , or some other like medium . a number of input / output devices 125 may be coupled to computing system 100 . in one embodiment of the invention , processor 102 may also contain power management software 134 to allow user control of operating voltage and operating frequency . the power management software 134 may configure an i / o controller 150 to facilitate voltage and frequency scaling upon the occurrence of specified conditions . i / o controller 150 programs a register 136 within a clock generation circuit 135 . the programmed information indicates how the operating frequency of the clocking signal is to be altered . the clock generation circuit 135 monitors the register 136 and modifies the frequency of the clocking signals accordingly . after determining that the operating frequency has been reduced the i / o controller 150 generates a voltage modification control signal to a power supply circuit , not shown . the power supply circuit then reduces the voltage accordingly . the processor performance level transition policy algorithm , described herein , may be implemented by hardware and / or software contained within computing system 100 . for example , processor 102 may execute code or instructions stored in a machine - readable medium , e . g ., main memory 104 , to decide when to transition the processor performance level on a processor that supports multiple performance levels . the machine - readable medium may include a mechanism that provides ( i . e ., stores and / or transmits ) information in a form readable by a machine such as computer . for example , a machine - readable medium may include a read only memory ( rom ), random access memory ( ram ), magnetic disk storage media , optical storage media , flash memory devices . the code or instructions may be represented by carrier wave signals , infrared signals , digital signals , and by other like signals . pms may have several inputs into the software . the software may use these inputs to determine a performance level for the processor . typically , the inputs include “ power source ”, high performance level for ac and low performance level for dc ; “ thermal ”, an overriding environmental concern which will transition the processor to a lower ( i . e ., cooler ) performance level if the processor overheats ; and “ user preference ”, whereby a user may chose between conserving energy and increased performance . a demand - based pms includes the input of “ processor utilization ” to allow for a transition to a higher performance level if the user has need of a higher level of performance . an embodiment of the present invention employs a fast up / slow down ( fusd ) transition policy to monitor user demand upon the processor ( i . e . processor utilization ). an alternative embodiment may employ a slow up / fast down ( sufd ) transition policy . the monitoring may be done by periodically reading the processor &# 39 ; s time stamp counter ( tsc ) and a high - resolution timer or utilizing existing native os mechanisms . the tsc provides information about processor activity when the processor is not in a sleep state . the calculation of processor activity and frequency provides the utilization over a given period . exemplary graphs of processor utilization for some typical workloads are shown in fig2 . fig2 a shows the processor utilization graph of , for example , a rendering . as shown the processor utilization rises quickly to near 100 % and remains at a high level until the processing is complete . fig2 b shows the processor graph for a digital video disc ( dvd ). the processor utilization rises to a high level for extended periods and occasionally drops to significantly lower levels . fig2 c shows the processor graph for an idle system . as shown the processor utilization is at low level with the exception of spikes due to periodic os housekeeping . an embodiment of the present invention will quickly detect a high processor utilization level and automatically switch the system to a high frequency performance level . when processor utilization drops off , the system is automatically switched to a low performance level . the ability to quickly transition between performance levels is not critical for a workload having a processor utilization graph as shown in fig2 a and 2 c . for workload such as that shown in fig2 b , however , quickly detecting changes in processor utilization and transitioning to an optimum performance level , may significantly improve energy efficiency . in accordance with on embodiment of the present invention , processor utilization is measured every t seconds . the processor - utilization monitoring period , t , should be small enough so that increased processor utilization is detected quickly , this maintains the responsiveness of the system . t should not be so small , however , as to overly tax the processor resources . when processor utilization is detected above a given threshold the system is automatically switched to a higher performance level . when processor utilization is detected below a given threshold the system is automatically switched to a lower performance level . frequent switching between higher and lower performance levels taxes the processor , therefore the fusd transition policy allows for less frequent switching from a high performance level to a lower one so that quick reversals in processor utilization will not result in frequent switching . for example , as shown in fig2 b the processor utilization reaches a switch - up threshold of , for example , 95 % at time t 1 . the system automatically transitions to a higher performance level . at time t 2 the processor utilization drops below a switch - down threshold , for example 75 %, but the system does not transition to a lower performance level . instead , current performance level is maintained until processor utilization is monitored at time t 3 . at time t 3 the processor utilization is again above the switch - up threshold so the higher performance level is maintained . when , at time t 4 – t 6 the processor utilization level remains below the switch - down threshold for 3t seconds , the system is then transitioned to a lower performance level . the system remains at this lower performance level until the processor utilization once again rises above the switch - up threshold ( i . e ., until time t 9 ). fig3 is a process flow diagram in accordance with one embodiment of the present invention . the process 300 , shown in fig3 begins at operation 305 in which the processor utilization is calculated for the current performance level ( i . e ., at the current frequency ). this calculation may be completed every t seconds . as described above , t is selected to be small enough to quickly detect an increase in processor utilization while not being so small as to unduly tax processor resources . empirically , for one embodiment , a value of 150 milliseconds ( ms ) for t has been found to be adequate for typical systems with typical processor utilization graphs . at operation 310 the system determines if processor utilization is above a specified switch - up threshold . for one embodiment of the present invention the switch - up threshold is specified as 95 % of the current performance level . if processor utilization is above the specified switch - up threshold , the system determines if processor utilization has been above this threshold longer than the switch - up period at operation 315 . the switch - up period may be equal to one or more processor - utilization monitoring periods t . for one embodiment the processor monitoring period is equal to 150 ms and the switch - up period is equal to 300 ms . if processor utilization has not been above the switch - up threshold longer than the switch - up period , the system waits until the next processor - utilization monitoring period , t , expires at operation 325 and returns to operation 305 . if processor utilization has been above the switch - up threshold longer than the switch - up period the system automatically transitions to the next higher performance level at operation 320 and then proceeds to operation 325 as described above . referring again to operation 310 , if the system determines that processor utilization is not above the switch - up threshold , the system determines if processor utilization is below a specified switch - down threshold at operation 330 . for one embodiment of the present invention the switch - down threshold is specified as 95 % of the next lower performance level . if processor utilization is below the specified switch - down threshold , the system determines if processor utilization has been below the switch - down threshold longer than the switch - down period at operation 335 . the switch - down period may be different than the switch - up period . for one embodiment the switch - up period is equal to 300 ms and the switch - down period is equal to 1000 ms . if processor utilization has not been below the switch - down threshold longer than the switch - down period , the system waits until the next processor - utilization monitoring period , t , expires at operation 325 and returns to operation 305 . if processor utilization has been below the switch - down threshold longer than the switch - down period the system automatically transitions to the next lower performance level at operation 340 and then proceeds to operation 325 as described above . referring again to operation 330 , if the system determines that processor utilization is not below the switch - down threshold , the system waits until the next processor - utilization monitoring period , t , expires at operation 325 and returns to operation 305 . in the foregoing specification , the invention has been described with reference to specific exemplary embodiments thereof . it will , however , be evident that various modifications and changes may be made thereto without departing from the broader spirit and scope of the invention as set forth in the appended claims . the specification and drawings are , accordingly , to be regarded in an illustrative sense rather than a restrictive sense .	6
hollow fiber membranes combine the features of microporous membrane films with the advantages of hollow fiber geometry . hollow fiber geometry offers the advantages of compact size because of high membrane surface area to volume ratio , a self - supporting structure , and the ability to group numerous fibers together in a small module or cylinder . unlike solid polymer membranes where transport of permeants is controlled by a diffusion mechanism , permeant transport in microporous hollow fibers is controlled by connective mass transfer . the fiber wall is composed of a series of parallel interconnected pores providing a tortuous path from one side of the membrane fiber wall to the opposite side . these pores readily allow the flow of gases , but since the wall surfaces are hydrophobic , a barrier is formed to the aqueous solvent and dissolved solutes . hollow fiber modules are generally constructed of polyethylene or polypropylene , although other construction materials may be used . hollow fibers may be made by methods well - known in the art , such as those disclosed in u . s . pat . nos . 4 , 020 , 230 and 4 , 055 , 696 , the disclosures of which are incorporated herein by reference . the fibers may have wall thicknesses varying from about 20 microns to about 50 microns , different pore sizes , different interior diameters and varying porosity . hollow fibers have inner diameters of about 200 to 800 microns , wall thicknesses of about 20 microns to about 50 microns , pore size of about 0 . 01 to about 0 . 05 microns , and porosity generally ranging between 20 % and 40 %. the ability to place 10 , 000 or 20 , 000 or more of these hollow fibers within a fiber module permits large transfer surface areas within a small module . for instance , a celanese hollow fiber module trademarked celgard x - 10 contains 15 , 000 fibers with a total transfer surface area of 10 square feet in a cylindrical module that is 9 inches long with a 1 . 5 inch outer diameter . the porosity of the fibers is 20 % with an average pore size of about 0 . 1 microns . interior diameter of the fibers ranges from about 100 to 400 microns and the wall thickness is about 25 microns . the invention may be carried out by pumping aqueous polymer solution from a reservoir into microporous hollow fibers grouped in at least 1 module and then back into the reservoir . the polymer solution is repeatedly cycled through the hollow fiber module or pumped through multiple modules set up in series . for most enhanced oil recovery uses , the polymer solution should be recirculated until the oxygen content of the solution falls below about 5 ppb . in some cases , this recirculation should be continued until oxygen content falls to about 1 ppb . an oxygen meter may be placed somewhere in the flow cycle of the polymer solution to measure the oxygen content of the fluid . an ideal location is between the hollow fiber module and the reservoir . optionally , an oxygen scavenging chemical may be added to the polymer solution during recirculation or after recirculation through the fiber module . polymer fluid in the reservoir should also be blanketed by an oxygen - stripped , inert gas such as nitrogen . the speed with which oxygen is removed from the polymer solution can be increased by increasing the temperature of the solution . oxygen has a lower aqueous solubility at increased temperature . thus , the polymer fluid will release oxygen at a faster rate if its temperature is increased to above 40 ° c ., for example . the following examples further illustrate the novel method for lowering the oxygen content of polymer solutions of the present invention . these examples are given by way of illustration and not as limitations on the scope of the invention . thus , it should be understood that the invention process may be varied to achieve similar results within the scope of the invention . a recirculating fluid cycle was set up in the laboratory with a fluid reservoir , a recirculating pump , a microporous hollow fiber module , and an oxygen meter , all in series . a 2 liter polymer fluid reservoir was blanketed with oxygen - stripped nitrogen gas . a magnetic gear pump manufactured by ismatec / cole palmer was used to pump polymer solution from the reservoir to a microporous hollow fiber module and then back to the fluid reservoir after passing through an oxygen meter . the oxygen meter flow cell was manufactured by orbisphere labs . the hollow fiber module was a g - 200 / 28 module manufactured by celanese corp . the module contained 18 , 500 fibers having a 200 micron inner diameter , a 28 micron wall thickness , and an average 0 . 03 micron pore size . the total surface area of the fibers in the module was 2 . 6 m 2 . the polymer solution to be deoxygenated was 1000 g of an aqueous 2000 ppm synthetic polymer trademarked he polymer b sold by drilling specialties inc . it is designed to be used in a high temperature environment . the makeup water contained 12 . 5 % sodium chloride by weight . the oxygen content of the polymer solution was initially 7 . 15 ppm . after recirculating the 1000 g of polymer solution at a rate of 120 ml per minute for 5 . 5 hours with a 1 ml vacuum applied to the interior shell side of the hollow fiber module , the oxygen level of the polymer solution dropped to 1 . 6 ppb . this low oxygen level of the polymer solution indicates that the microporous hollow fiber technique may be used to deoxygenate polymer solutions to an extremely low oxygen level . the interim and final oxygen concentrations of the polymer solution in this experimental run are indicated below in table 1 . table 1______________________________________flow time o . sub . 2______________________________________ -- 7 . 15 ppm 15 min . 400 ppb 30 min . 120 ppb 90 min . 30 ppb180 min . 17 . 5 ppb240 min . 3 ppb310 min . 1 . 7 ppb330 min . 1 . 6 ppb______________________________________ the same procedure and apparatus of example 1 was employed to deoxygenate a different aqueous polymer solution in example 2 . 1000 g of an 800 ppm solution of a polysaccharide trademarked flocon mt sold by pfizer inc . was prepared in 12 . 5 % sodium chloride by weight makeup water . the solution was circulated through the said hollow fiber module as example 1 at a flow rate of 120 ml per minute . table 2 below indicates that the oxygen content of the polysaccharide polymer solution dropped to 6 . 9 ppb after three and a half hours . after six and two - thirds hours , the oxygen content dropped to an extremely low 1 . 7 ppb . table 2______________________________________flow time o . sub . 2______________________________________ -- 7 . 15 ppm 10 min . 410 ppb 30 min . 80 ppb 60 min . 30 ppb150 min . 10 . 8 ppb210 min . 6 . 9 ppb290 min . 3 . 2 ppb350 min . 2 . 2 ppb400 min . 1 . 7 ppb______________________________________ many other variations and modifications may be made in the concepts described above by those skilled in the art without departing from the concepts of the present invention . accordingly , it should be clearly understood that the concepts disclosed in the description are illustrative only and are not intended as limitations on the scope of the invention .	2
in making and using aspects and embodiments of this invention , one skilled in the art may employ conventional techniques and components available to one skilled in the art . furthermore , one of skill in the art may rely upon and use documents and available commercial or research products to make and use aspects of this invention , including the selection of polymer layers of the bite forms . patent and other documents referred to in this disclosure are specifically incorporated herein by reference and the teachings therein can be used for the purpose of making certain embodiments of the invention . to manufacture the device of the invention , impressions are taken of a patient &# 39 ; s dentition and maxillary and mandibular master casts are fabricated from these impressions . the master casts are then mounted to an articulator , which is adjusted to establish the proper closed position of the two master casts . as will be appreciated by those skilled in the art , this may be accomplished with proper bite registration techniques , which allows the determination of the proper , predetermined position of the mandibular cast with respect to the maxillary cast and the minimum vertical spacing between the casts . typically , a george gauge can be used for accurate bite registration . vent holes may then be drilled into these casts . a dual laminate material may then be attached ( with heat ) to the dentition of the master casts such that the harder layer of the laminate is on the outside . in a preferred embodiment , a triple - laminated appliance is constructed . the first two layers comprise a dual - laminated blank or rigid vinyl , which is pressure formed over the model of the patient &# 39 ; s mouth . a third and outer layer of ethylene acrylic is then used by heat curing the pressure packed thermoplastic material . the buttons can be easily placed at the desired positions into this outer layer while it is setting . in operation , a user whose dentition is mirrored by the bite forms inserts each bite form in his mouth and bites down . the user closes his mouth and attaches the top and bottom buttons on each side with an elastic band . this prevents mouthleaks and helps to alleviate snoring and sleep apnea when used with available positive airway pressure or continuous positive airway pressure ( cpap or pap ) devices . the maximum intercuspal distance spacing of the bite forms described will make the use of negative pressure or suction in the oral cavity unnecessary , and there is no requirement to retain or hold the tongue in position to achieve beneficial results . one method to determine beneficial effects in using the devices of the invention is to record the respiratory disturbance index ( rdi ), as known in the art . the rim can be measured in patients , for example male patients , during three separate conditions : 1 ) while wearing a cpap device alone at prescribed pressure ; 2 ) while wearing a cpap at prescribed pressure with the simultaneous use of a chin strap ; and 3 ) while wearing a cpap at prescribed pressure with the simultaneous use of the intraoral mouth closure device of the invention . in the data of fig1 , the results show the rdi obtained from six patients ( mean ± 1 sd ). the first bar shows the cpap only treatment , with an rdi of 16 . 1 ± 9 . 66 . a significant reduction in values of rdi occurs when the intraoral mouth closing device of the invention ( cpap + iomcd ) is fitted and worn in conjunction with the cpap ( from 16 . 1 ± 9 . 66 to 8 . 72 ± 7 . 81 , p = 0 . 033 , paired samples t - test ). there was no difference between rdi values recorded when the cpap is used alone versus when the cpap is used with the elastic chin strap ( cpap + cs ) simultaneously ( 16 . 1 ± 9 . 66 versus 15 . 5 ± 10 . 0 , p = 0 . 919 ). clearly , the use of the mouth closing device of the invention improves over other available methods and devices . the mouth closing devices of the invention are also more comfortable to use with cpap , perhaps because the vertical dimension is not altered and rather is designed to be the maximal intercuspal distance of the patient . in addition , the devices of the invention do not require the use of negative pressure in the mouth . furthermore , the devices have an open palate and are not designed to hold , interfere with , or impede the movement of the tongue . the connection points , or in some embodiments the buttons , as shown in the figures are designed to be placed in positions that maintain a space substantially equal to the maximum intercuspal distance or space when the connection points between maxillary and mandibular bite forms are attached . in some circumstances , the comfort of the patient may also dictate the position or dictate some movement of the connection point placement . in addition or in the alternative , connection points of the maxillary bite form can be approximately interproximal to the cuspid and 1st bi - cuspid , and placement of the connection points on the mandibular bite form can be approximately below the maxillary connection points and not more than one tooth width away from directly below the maxillary connection point . more than one connection point may be used on each side of each bite form if desired , and the bite forms need not take the form of the buttons shown in the drawings . multiple sized connection points or different shapes of forms of connection points can also be used . while a standard dental rubber or elastic band can generally be used to connect the mandibular and maxillary connection points , other or more rigid devices can be used . for example , wires or coated wires , springs or coated springs , and polymeric bars or rods can be used to attach the connection point , or a subset of the connection point used in two bite forms of the invention . preferably , the devices used to attach connection points are flexible or elastic . in addition , or in the alternative , one or more connection points may be in the interior ( lingual ) side of the bite forms rather than all being placed on the exterior ( facial ) side as shown in the drawings . accordingly , one of skill in the art has many options in positioning the connection points on the bite form in order to achieve the one or more advantages of the invention . any of the embodiments described or exemplified can be used in conjunction with a cpap treatment and in methods to treat disorders in breathing during sleep . thus , the invention specifically includes methods to improve an existing or available cpap treatment device or the treatment of breathing disorders during sleep . generally , the use of the devices of the invention is associated with improved cpap results , higher satisfaction , and patient compliance levels than the prior or existing methods or devices . the examples presented above and the contents of the application define and describe examples of the many products and methods for using them according to the invention . none of the examples and no part of the description should be taken as a limitation on the scope of the invention as a whole or of the meaning of the following claims .	0
fig1 depicts an electricity generating apparatus 100 according to one embodiment of the present invention . the apparatus 100 as depicted includes an elongated central member 110 . the central member 110 serves in part to provide a mounting point for the foil 120 , as well as to interconnect the apparatus 100 between connecting nodes 200 . additionally , the central member 110 may serve as an axle about which the apparatus 100 may rotate . for example , the central member 110 may be disposed in rotatable relation to the connecting nodes 200 . the foil 120 of the present invention is an at least partially rigid structure connected to or disposed on or about the central member 110 . the foil 120 serves to transmit force to the central member 110 via interaction with a fluid travelling past the foil 120 . for purposes of the present invention any of a variety of foil shapes or configurations may suffice , such as a traditional airfoil or other shape . however in the depicted embodiment , the foil 120 is comprised of at least one helical surface 121 which is disposed about the central member 110 . as such , at least a portion of the foil is always presented to the passing fluid , which allows for smoother force input to the central member , and accordingly , smoother power input . additionally , the foil 120 may comprise a tapered configuration , as at 122 , such that adjacently disposed foils 100 of adjacently disposed apparatus 100 do not collide , as will be explained further below . fig2 provides a top plan view of a foil 110 in accordance with one embodiment of the present invention such that the general shape and configuration may be presented . fig3 presents a section plan view of a foil 120 in accordance with one embodiment of the present invention along line 3 - 3 of fig1 , such that the general shape and configuration may be similarly presented . accordingly , a cross - section of the foil 120 is presented . as can be seen , in the depicted embodiment , the cross - sectional area 123 of the foil 120 comprises a central portion 124 that substantially conforms to the central member 110 and gradually tapers toward a trailing edge 125 that is substantially thinner in cross section . it should be appreciated that the depicted embodiment is but one of many possible configurations encompassed by the present invention . one benefit of the depicted embodiment however , is that the enlarged central portion 124 of the foil 120 increases the bending moment resistance of the apparatus 100 . additionally , the depicted embodiment is capable of producing a low pressure lifting force on the leeward side of the foil 120 , which supplements pressure on the windward side of the foil 120 , thereby increasing the amount of torque produced by the apparatus 100 as it rotates . as another feature of the present invention , a plurality of apparatus 100 may be assembled into an assembly as exemplified in fig4 through 7 . with continuing reference to fig1 and 4 through 7 , the connecting nodes 200 may serve as junctions with which to interconnect the plurality of apparatus 100 . as such , one embodiment of a connecting node 200 may include a connecting node collar 210 into which an end 130 , 140 may be disposed . as can further be seen , the tapered configuration 122 , which in the depicted embodiment comprises a reduced radial dimension at the first end 130 and second end 140 , serves to provide clearance between immediately adjacent apparatus 100 . additionally , the connecting nodes 200 may take any of a variety of desired configurations , as depicted in fig4 - 7 , such configurations being mainly dictated by the shape of the desired assembly , as depicted in fig5 and 7 . now turning to fig8 , depicted is one embodiment of an apparatus 100 according to the present invention that includes a stator 111 and a shell 112 within the central member 110 . as such , at least a portion of the structure required for an electric generator may be disposed within the central member 110 . accordingly , the stator 111 , even though stationary in the present invention , may correspond structurally to a rotor as generally implemented in electric motors or generators , as it is centrally located within the central member 110 . similarly , the shell 112 , even though dynamic , may correspond structurally with a stator as generally implemented in electric motors or generators , as it is disposed about the stator 111 of the present invention . thus , the stator 111 and shell 112 are comprised of such electrically and / or magnetically conductive material so as to form an electric generator or otherwise take advantage of the known effects of induction when the shell 112 is rotated about the stator 111 in order to produce electricity . it should be understood that the depicted structure merely depicts one embodiment of the present invention and many other embodiments are suitable . for example , any number of electrical generator structure may be disposed within the connecting node 200 . for example , the central member 110 may be configured to rotate within at least a portion of the connecting node 200 , thereby providing a rotor as commonly implemented in electric generators . additionally , substantially all of the electrical generator structure may be disposed within the connecting node 200 , and the central member 110 rigidly attached to the rotor therein , thereby driving the rotor when the central member 110 is rotated . furthermore , at least a portion of the central member 110 and connecting node 200 may be fabricated of electrically conductive material and having electrical contacts for electrical interconnection between adjacent central members 110 and connecting nodes 200 . as such , when deployed as an assembly 1000 with a plurality of apparatus 100 , electricity may be drawn from and conducted through each apparatus 100 such that only one exterior electrical connection need be made in order to draw electricity from the assembly . this may be accomplished , for example , by disposing a single electrical receptacle on a predetermined connecting node 200 of the assembly 1000 , and constructing the assembly 1000 such that each successive apparatus 100 and connecting node 200 is disposed in electrical interconnection with the predetermined connecting node 200 . of course , in alternative embodiments , it may be desirable to utilize multiple electrical receptacles and / or other exterior electrical connections . since many modifications , variations and changes in detail can be made to the described preferred embodiment of the invention , it is intended that all matters in the foregoing description and shown in the accompanying drawings be interpreted as illustrative and not in a limiting sense . thus , the scope of the invention should be determined by the appended claims and their legal equivalents .	5
a preferred embodiment of the present invention will now be described with reference to the accompanying drawings , wherein like reference numerals refer to like components . fig1 and 2 show a preferred embodiment of a beam deflector 100 constructed according to the present invention . a beam reflecting body 110 , preferably provided in the form of a planar glass mirror ( of dimensions , for example , of 25 mm width , 12 . 5 mm height , and 6 mm thickness ) includes a reflective coating 112 on its front surface . the contemplated mirror thickness is preferably selected in order to maintain a 1 / 10th wave surface quality with respect to the incident light beam 114 . the back of the reflecting body 116 is rough polished for better bonding to first and second very thin piezoelectric plates 120 ( each of dimensions , for example , of 4 mm width , 15 mm length , and 1 mm thickness ) constructed of piezoelectric material 122 sandwiched between first and second electrodes 124 , 126 pairs . the piezoelectric material 122 is selected as one having a relatively high piezoelectric constant operable in the d 33 mode , which is characterized as having a piezoelectric polarization axis that is coaxially aligned with the predominant axis of the piezoelectric motion ( expansion or contraction ) of the piezoelectric material . such piezoelectric material is commercially available in the form of lead zirconate titanate , from morgan matroc , inc . as item pzt - 5h . each plate 120 is mounted to a supporting platform 128 at a first plate electrode 124 via a first bonding layer 130 formed of conductive adhesive such as conductive silver - filled epoxy . the reflecting body 110 is bonded to the second ( opposing ) electrode 126 of each plate 120 via a second bonding layer 132 of flexible adhesive , such as a silicone rubber compound . the thickness of the second bonding layer 132 is preferably established at approximately 25 to 75 micrometers . as will be appreciated further in the description below , this construction allows the second bonding layer 132 to flex a small amount when the reflecting body is rotated . nonetheless , the overall structure 134 formed of the combination of a piezoelectric plate 120 and first and second bonding layers 130 , 132 is relatively stiff because of its minimal thickness , and the expansion or contraction of each piezoelectric plate 120 with respect to the platform 128 is well - coupled to the reflecting body . the second bonding layer 132 also provides a small damping effect , for better control of the resultant rotation of the reflecting body about the rotation axis . the first and second plates 120 are mounted with respect to the platform 128 in opposing piezoelectric polarity , that is , the first plate would be poled up if the second plate is poled down , or vice - versa . as further shown in fig2 each piezoelectric plate 120 is electrically driven in parallel with the other . connections from the plates 120 to a plate driving means 140 are made at the protruding ends of the plates via a first binding post 141 and at the platform via a second binding post 142 the platform 128 includes an integral conductive surface 144 that interfaces with the first plate electrode 124 . the platform 128 is preferably formed of a solid conductive material , such as aluminum . the plate driving means 140 includes a suitable high voltage field source and other control circuit components that are selectable as known in the art and thus are not discussed here . it is contemplated that both piezoelectric plates 120 are constructed and operated to effect a selected piezoelectric mode wherein an electric field applied along vector z results in an expansion or contraction of the plate along the same vector direction . accordingly , with application of an electric field between the first and second plate electrodes 124 , 126 ( i . e ., along the z direction ) of each plate 120 , the thickness of a first plate will expand while the same dimension of a second plate contracts , or vice versa depending upon the polarity of the applied field . the reflecting body 110 will then tilt about a rotation axis 150 , depending on the direction and magnitude of the applied voltage . as shown in fig3 and according to a particular feature of the invention , the reflecting body 110 may be considered to move as a free - free beam subject to deflection such that it exhibits first and second nodal points 161 , 162 in a first mode of vibratory movement . as shown in fig4 and according to another particular feature of the invention , the first and second piezoelectric plates 120 are located respectively at these first and second nodal 161 , 162 points such that the resonant frequency of the system f n is maximized to its optimal extent f max . in contrast to the desired configuration shown in fig4 and as shown in fig5 and 6 , the resonant frequency f n is lessened considerably when the piezoelectric plates are located at points other than the first mode nodal points 161 , 162 . the reflecting body can therefore be driven at a higher frequency than heretofore experienced in prior art beam deflectors . a beam deflector 100 constructed according to the arrangement of fig4 is also capable of driving a reflecting body of larger than usual dimensions at a higher than usual frequency . as evidenced by the frequency response plot in fig7 experimental versions of the contemplated beam deflector have been found to provide a first resonant frequency f n of over 40 khz . further , such extended resonant frequency is high enough for the beam deflector 100 to be used in either a closed loop or an open loop servo system . the contemplated beam deflector is also easy to assemble at a low cost , and due in part to the flexibility of the second bonding layer 130 , achieves a low resonant system quality factor q . the contemplated beam deflector 100 is therefore more easily controlled and offers greater beam positioning accuracy than prior art devices . the invention has been described in detail with particular reference to a preferred embodiment thereof , but it will be understood that variations and modifications can be effected within the spirit and scope of the invention .	6
fig1 illustrates a block diagram of a motor control processor 10 in a motor drive for practicing the present invention . the motor control processor 14 is connected to supply three phase voltage signals , va , vb and vc to a pwm voltage inverter 11 in the motor drive , which in turn supplies current to an ac motor 12 . current feedback devices 13 are placed in the lines going to the motor 12 and provide current feedback signals , i a fdbk , i b fdbk and i c fdbk to the motor control cpu 14 . the motor control cpu 14 is preferably a microelectronic cpu operating according to instructions in a stored control program 19 . the program includes instructions for performing regulation of a dc bus voltage and regulation of current supplied to the motor 12 . the pwm inverter 11 receive power from a dc bus 15 , which receives power from an ac source 16 that is rectified by rectifier 17 to provide dc voltage on the dc bus 15 . a capacitor 18 ( here specify function of the capacitor .) execution of the control program 14 results in a nominal dc bus reference value ( v bus ref ), which is one input to the dc bus regulator loop 20 . a dc bus feedback voltage ( v bus fdbk ) sensed from the dc bus 15 by an appropriate sensor is algebraically summed ( in this case , subtracted ) from this nominal dc bus reference value . the result is multiplied by an adjustable gain function ( gain ) and processed through a proportional - integral ( pi ) loop of a type well known in the art to produce a frequency command ( f e ). this frequency command ( f e ) is integrated , as represented by the “ 1 / s ” function to provide a reference angle command ( θ ) for a motor controlled in the d - q synchronous reference frame , where current and voltage commands are resolved along a d - axis and a q - axis and where the conversions from 2 - phase to 3 - phase and from 3 - phase to 2 - phase represent vector multiplications by sin θ and cos θ . for further information on reference frame theory , reference is made to u . s . pat . no . 5 , 140 , 248 , assigned to the assignee of the present invention . although the current regulator shown in fig1 , is a synchronous current regulator , the present invention could be practiced with several other ways to regulate current . for example , the current regulator could operate in the stationary reference frame , or it could be operated by using the magnitude of current . the execution of the control program 19 also provides a current regulator loop 21 in which current commands in the d - q synchronous reference frame , i q ref and i d ref are algebraically summed ( actually , by subtracting ) feedback signals i q fdbk and i d fdbk , which are the result of processing feedback signals , i a fdbk , i b fdbk and i c fdbk through a 3 - phase to 2 - phase converter 22 . this produces two differences that are processed through respective pi ( proportional - integrator ) control loops to produce , v q and v d commands to a 2 - phase to 3 - phase converter 23 . this converter also receives the reference angle command ( θ ) and together with the v q and v d commands , produces the phase voltage outputs v a , v b and v c to the pwm inverter 11 . the present invention assumes the motor 12 is being operated at some forward motoring speed . at base speed , the motor 12 would operate at a rated frequency of 60 hz . above base speed the frequency could increase with speed up to as high as 90 hz and even higher provided the inverter could supply the frequency . below base speed , the frequency could be lower than 60 hz . according to the invention , if it is now desired to stop the motor , a program routine represented by the flow chart in fig2 is executed . referring to fig2 , the entry into the routine is represented by decision block 30 , which is executed to check for a stop command through a user - operable push button or other suitable control . if the result of this test is negative , as represented by the “ no ” result , then the program returns to a “ run mode ” represented by process block 31 . if the result of this test is positive , as represented by the “ yes ” result , then the program proceeds to executes an instruction represented by decision block 32 to determine which type of stopping has been selected by a user . as explained in more detail below , the user can select from among the stopping method of the present invention , or dc braking or dynamic braking , the latter two methods being described in the background section herein . assuming that the method of the invention has been selected then the program proceeds to executes an instruction represented by decision block 33 to determine whether the level of flux in the motor has been reduced . if the level of flux has not yet been reduced , then the routine proceeds to a flux down process represented by process block 34 . during the flux - down process the motor control functions as seen in fig6 . the current regulator and dc bus regulator loops shown in fig1 only relate to the actual braking process , which takes place after the flux - down has been completed . as seen in fig6 , a conventional volts - per - hertz type control is executed during normal running ( before flux - down and subsequent braking ). the frequency ( fe ) command comes from the frequency reference ( the speed command for the motor ) and the voltage command ( v ) comes from a value proportional to the frequency command . when stopping is initiated , flux - down occurs . this is accomplished by holding the frequency at its last running value and then reducing the q - axis voltage command ( vq ) to near zero as fast as possible without the motor current going too high . when the voltage gets near zero , flux - down is considered complete . with this explanation , please refer back to fig2 where decision block 35 is then executed to check for completion of this flux - down step . upon reaching the flux - reduced state , the output frequency is reduced by an amount in a range from 40 % to 57 %. for example , if the motor were running at 60 hz , frequency would be reduced to about 30 hz . if the motor were operating at 90 hz , the frequency would be reduced to about 45 hz . upon reaching the flux - reduced state , the motor current regulator loop 21 is also provided with initial current commands that provide braking torque to the motor . the initial changes in frequency and current commands are represented by process block 36 . the routine will then proceed to activate the motor current regulator loop 21 as represented by process block 37 . at that point the routine will loop back to the decision block 30 and start over . one pass through the routine will be completed in a predetermined interrupt cycle time . after many cycles through the routine , the level of flux in the motor determined in decision block 33 will have been reduced and the routine will activate the dc bus regulator ( block 38 ) designed to continuously adjust the frequency as a function of dc bus voltage and allow maximum braking torque while preventing power regeneration back into the dc bus and subsequent bus over voltage faults . the frequency generated by block 38 may initially increase if the original frequency step from block 36 was too large , but the frequency will eventually decrease as the dc bus regulator brings the motor to a final stop . the control will continue to loop through the process , running the dc bus regulator and the current regulator until any one of the following three conditions occur : 1 ) the frequency command drops below 3 hz ; 2 ) a frequency trend shows an increase instead of a decrease ; or 3 ) the frequency command reaching the flux - reduced operating frequency . the conditions are tested for as represented by decision blocks 39 , 40 and 41 . if any of these tests is positive , the frequency is set to zero and a check will be made the next time through the routine for complete shut - off as represented by process block 42 . the next time that decision block 33 is reached , the shut - off state will be active and the routine will branch to a dc braking routine represented by timing check block 43 and two timing process blocks 44 , 45 in which dc is applied to completely stop the motor . the advantageous operation of the present invention is further illustrated in the curves in fig3 . after flux - down is completed , the sharp decrease in output frequency ( f ) 50 can be seen . at the same time , the current ( i ) 53 is increased to apply braking torque . since the initial frequency reduction was too large , the dc bus voltage ( v ) 51 is below its nominal dc bus reference value , causing dc bus regulator to increase the output frequency ( f ) 50 . eventually the dc bus voltage ( v ) 51 rises , causing the dc bus regulator to decrease the output frequency ( f ) 50 . the decreasing operating frequency will cause the speed 52 of the motor to follow an increasingly downward sloping curve ( as opposed to a ramp function ) to zero . fig4 illustrates a screen display on a personal computer used to configure the motor drive control in which three instances 61 , 62 and 63 of a data dialog box are shown , representing regenerative ramp braking , dc braking and the flux - down braking of the present invention . this is user - selectable parameter # 155 . if a “ 1 ” is inserted in the data entry location , then regenerative ramp braking is selected . if a “ 2 ” is inserted in the data entry location , then dc braking is selected . if a “ 3 ” is inserted in the data entry location 64 , then flux - down braking is selected . this parameter or a corresponding value is stored in memory for access by the cpu 14 to carry out the selected mode of braking . fig5 a and 5 b illustrate a curve 70 for the higher braking torque available with the present invention as compared with a curve 71 for dc braking as taught in the prior art . fig5 a shows this result for a 5 hp motor braked from a speed corresponding to a frequency of 60 hz . fig5 b shows a curve 73 for the higher braking torque available with the present invention as compared with a curve 74 for dc braking as taught in the prior art for a 5 hp motor braked from a speed corresponding to a frequency of 90 hz . this has been a description of several preferred embodiments of the invention . it will be apparent that various modifications and details can be varied without departing from the scope and spirit of the invention , and these are intended to come within the scope of the following claims .	6
the invention will now be described in reference to the following non - limiting examples . saccharomyces cerevisiae skq2n , bataille et al . ( 1987 ) identification of polypeptides of the carbon metabolism machinery on the two - dimensional map of saccharomyces cerevisiae . location of 23 additional polypeptides . yeast . 3 , 11 - 21 ,. s . cerevisiae ys18 ( matα ; his3 - 11 , 3 - 15 ; leu2 - 3 , 2 - 112 ; ura3δ5 ; canr ) and s . cerevisiae ymr4 were used in most experiments as indicated . ys18 and ymr4 were previously constructed by riederer and hinnen ; riederer et al . ( 1991 ) removal of n - glycosylation sites of the yeast acid phosphatase severely affects protein folding . j . bacteriol . 173 , 3539 - 3546 . ys18 and ymr4 were in the present work both transformed with a pho5 containing plasmid ( see below ) and the resulting transformant strains were designated ys - p5 and ym - p5 , respectively . strain ys - p5 was deposited with dsmz — deutsche sammilung von mikroorganismen und zellkulturen gmbh , mascheroder weg 1b , 38124 braunschweig , germany on apr . 18 , 2002 and was assigned accession number dsm - no . 14929 . ys18 and ymr4 were further deleted for pho10 yielding strains named ys10 and ym10 , respectively . ys18 was also used for construction of the pho80δ strain labeled yd80 . in addition , pho80δ , pho85δ and pho2δ mutant strains were retrieved from the german euroscarf collection . pho80 ( yol001w ), pho85 ( ypl031c ) and pho2 ( ydl106c ) strains originates from the laboratory by4741 strain ( mata ; his3δ1 , leu2δ0 , met15δ0 , ura3δ0 ). the pho80 , pho85 and pho2 genes were deleted with kan :: mx4 disruption cassette . yeast cultures were maintained on ypd - plates ( yeast extract 10 g , peptone 20 g , glucose 20 g and agar 20 g in one liter of water ) and stored long - term in glycerol at − 70 ° c . escherichia coli dh5α was used for propagating the plasmid containing the inserted pho5 ( see below ). the yeast strains and their expression profiles of relevant genes are listed in table 1 . the growth medium used in most experiments was a modified version of the defined yeast minimal medium developed by cbs ( centralbueau voor schimmelcultures , delft , the netherlands ) which has been described previously , albers et al . ( 1996 ) influence of the nitrogen source on saccharomyces cerevisiae anaerobic growth and product formation . appl . environ . microbiol . 62 , 3187 - 3195 using ammonium sulfate ( 7 . 5 mg / ml ) as nitrogen source . as phosphorus source , either ip6 in the form of sodium phytate ( c 6 h 6 ( opo 3 na 2 ) 6 : 0 . 5 or 0 . 25 mg / ml ), inorganic phosphate ( kh 2 po 4 : 3 . 5 mg / ml ), para - nitrophenyl phosphate ( pnpp ; to a final concentration of 2 . 25 or 0 . 25 mm ), or combinations of these were used . depending on the phosphorous source used the media were designated cbsip6 , cbsp i , cbsip6 + p i and cbspnpp . cbsip6 and cbspnpp were supplemented with kcl ( 3 mg / ml ) to compensate for the potassium present in the inorganic p - source ( kh 2 po 4 ), but absent in the organic p - sources . in all experiments glucose ( either 2 % ( w / v ) or 1 % ( w / v ) as indicated ) was used as carbon and energy source . when appropriate , histidine , leucine and uracil were supplied at 120 mg / l . most experiments were also performed in ypd media ( per liter : yeast extract , 10 g ; peptone 20 g and glucose 20 g ) supplemented with the appropriate p - sources as indicated in results and figure legends . succinic acid / naoh , ph 5 . 3 , was used as buffer in the cbs based media . medium components were autoclaved , with the exception for ip6 , pnpp , vitamins , growth factors and fecl 2 , which were sterilized by filtration through a 0 . 2 μm filter . experimental cultures containing 100 ml in 250 ml e - flasks were inoculated with primary cultures grown for approximately 20h in medium of the same composition as the respective experiment culture . the inoculation level was set to od 610 = 0 . 2 . the experimental cultures were grown at 30 ° c . in a rotary shaker set to 210 rpm . the growth was monitored as optical density at 610 nm ( od 610 ) using a spectrophotometer ( hitachi , model u - 100 ). experiments aimed at pho3 expression were performed in cbs medium as described above with the exception of excluding thiamine ( to avoid repression of the thiamine phosphatase pho3 ), with and without addition of thiamine monophosphate . chemicals and enzymes for the procedures were purchased from new england biolabs inc ., usa , and the pcr primers used for amplification of pho5 were purchased from life technologies ab , täby , sweden . extraction of genomic dna from s . cerevisiae ys18 was carried out according to standard procedures . the nucleotide sequences of the primers are shown in upper case letters and the added restriction enzyme sites are shown in lower case letters . forward primer : 5 ′: cg gaattc atgtttaaatctgttgtttattc , appended as seq id no : 1 backwards primer : 3 ′: cg ctcgag ctattgtctcaatagactggc , appended as seq id no : 2 underlined sequences are ecori and aval ( yields end compatible to xhoi used to cut the pyx212 plasmid ) restriction sites , respectively . the remaining sequences complement the beginning ( from atg ) and end of pho5 . the pcr reaction was performed in 100 μl reaction mixtures , using vent polymerase and was carried out according to standard procedures . the pcr produced pho5 was purified with a pcr purification kit ( qiagen , cat , no . 28104 , merck eurolab ab , sweden ) according to the manufacturer &# 39 ; s protocol and 50 μl was cut with avai and ecori in ecori buffer for 12 h at 37 ° c . the cut pcr product was loaded on a preparative agarose gel and run together with a dna ladder in tae buffer . the appropriate band was cut out and purified using dna gel extraction kit ( qiagen , cat . no . 28704 ). a 20 μl ligation mixture was prepared by mixing 16 μl purified insert ( pho5 ), 2 μl t4 dna ligase buffer ( 10 ×) 1 μl ligase and 2 μl vector dna ( pyx212 ). the plasmid pyx212 containing the selection markers amp r for e . coli and ura3 for s . cerevisiae had previously been cut with ecori and xhoi ( yields ends compatible with avai ). two μl of the dna construct was added to 40 μl of cold competent e . coli dh5α . and transformed by electroporation using a gene pulser ii ( biorad ) set to the 25 μf capacitator , 2 . 5 kv and the pulse controller to 200 ω . cells were plated on nb plates containing 100 μg / ml ampicillin . clones were cultivated over night in liquid nb medium and plasmids were prepared according to standard procedures . gaattcatgtttaaatctgttgtttattc aattttagccgcttctttggc caatgcaggtaccattcccttaggcaaactagccgatgtcgacaagattg gtacccaaaaagatatcttcccatttttgggtggtgccggaccatactac tctttccctggcgactatggtatttctcgtgatttgcctgaaggttgtga aatgaagcaactgcaaatggttggtagacatggtgaaagataccctactg tcagtctggctaagactatcaagagtacatggtataagttgagcaattac actcgtcaattcaacggctcattgtcattcttgaacgatgattacgagtt tttcatccgtgatgacgatgatttggaaatggaaaccacttttgccaact cggacgatgttttgaacccatacactggtgaaatgaacgccaagagacat gctcgtgacttcttggctcaatacggttacatggtcgaaaaccaaaccag tttcgccgtttttacctctaattctaagagatgtcatgacactgctcaat atttcattgatggtttaggtgaccaattcaacatcaccttgcagactgtc agtgaagctgaatccgctggtgccaacactttgagtgcttgtaactcatg tcctgcttgggactacgatgccaatgatgacattgtaaatgaatacgaca caacctacttggatgacattgccaagagattgaacaaggaaaacaagggt ttgaacttgacctcaactgacgctagtactttattctcgtggtgtgcatt tgaagtgaacgctaaaggttacagtgatgtctgtgatattttcaccaagg atgaattagtccattactcctactaccaagacttgcacacttattaccat gagggtccaggttacgacattatcaagtctgtcggttccaacttgttcaa tgcctcagtcaaattattaaagcaaagtgagattcaagaccaaaaggttt ggttgagttttacccacgataccgatatcctaaactttttgaccaccgct ggtataattgacgacaaaaacaacttaactgccgaatacgttccattcat gggcaacactttccacagatcctggtacgttcctcaaggtgctcgtgtct acaccgaaaaattccaatgttctaacgacacctacgtcagatacgtcatt aacgatgctgttgttccaattgaaacctgttccactggtccagggttctc ttgtgaaatcaatgacttctacgactatgctgaaaagagagtagccggta ctgacttcctaaaggtctgtaacgtcagcagcgtcagtaactctactgaa ttgaccttctactgggactggaacactactcattacaac gccagtctatt gagacaatag cccgggtatccgtatgatgtgcctgactacgcatgatatc tcgagctcagctagctaactgaataaggaacaatgaacgtttttcctttc tcttgttcctagtattaatgactgaccgatacatccctttttttttttgt ctttgtctagctccagcttttgttccctttagtgagggttaattcaattc actggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttaccc aacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagc gaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatgg cgaatggcgcgacgcgccctgtagcggcgcattaagcgcggcgggtgtgg tggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgct cctttcgctttcttcccttcctttctcgccacgttcgccggctttccccg tcaagctctaaatcgggggctccctttagggttccgatttagtggtttac ggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtggg ccatcgccctgatagacggtttttcgccctttgacgttggagtccacgtt ctttaatagtggactcttgttccaaactggaacaacactcaaccctatct cggtctattcttttgatttataagggattttgccgatttcggcctattgg ttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaat attaacgtttacaatttcctgatgcggtattttctccttacgcatctgtg cggtatttcacaccgcatagggtaataactgatataattaaattgaagct ctaatttgtgagtttagtatacatgcatttacttataatacagtttttta gttttgctggccgcatcttctcaaatatgcttcccagcctgcttttctgt aacgttcaccctgtaccttagcatcccttccctttgcaaatagtcctctt ccaacaataataatgtcagatcctgtagagaccacatcatccacggttct atactgttgacccaatgcgtctcccttgtcatctaaacccacaccgggtg tcataatcaaccaatcgtaaccttcatctcttccacccatgtctctttga gcaataaagccgataacaaaatctttgtcgctcttcgcaatgtcaacagt acccttagtatattctccagtagatagggagcccttgcatgacaattctg ctaacatcaaaaggcctctaggttcctttgttacttcttctgccgcctgc ttcaaaccgctaacaatacctggccccagcacaccgtgtgcattcgtaat gtctgcccattctgctattctgtatacacccgcagagtactgcaatttga ctgtattaccaatgtcagcaaattttctgtcttcgaagagtaaaaaattg tacttggcggataatgcctttagcggcttaactgtgccctccatcgaaaa atcagtcaatatatccacatgtgtttttagtaaacaaattttgggaccta atgcttcaactaactccagtaattccttggtggtacgaacatccaatgaa gcacacaagtttgtttgcttttcgtgcatgatattaaatagcttggcagc aacaggactaggatgagtagcagcacgttccttatatgtagctttcgaca tgatttatcttcgtttcctgcaggtttttgttctgtgcagttgggttaag aatactgggcaatttcatgtttcttcaacactacatatgcgtatatatac caatctaagtctgtgctccttccttcgttcttccttctgttcggagatta ccgaatcaaaaaaatttcaaagaaaccgaaatcaaaaaaaagaataaaaa aaaaatgatgaattgaattgaaaagctgtggtatggtgcactctcagtac aatctgctctgatgccgcatagttaagccagccccgacacccgccaacac ccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacaga caagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtc atcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttat aggttaatgtcatgataataatggtttcttagacgtgcggccgctctaga actagtggatcaattccacggactatagactatactagtatactccgtct actgtacgatacacttccgctcaggtccttgtcctttaacgaggccttac cactcttttgttactctattgatccagctcagcaaaggcagtgtgatcta agattctatcttcgcgatgtagtaaaactagctagaccgagaaagagact agaaatgcaaaaggcacttctacaatggctgccatcattattatccgatg tgacgctgcagcttctcaatgatattcgaatacgctttgaggagatacag cctaatatccgacaaactgttttacagatttacgatcgtacttgttaccc atcattgaattttgaacatccgaacctgggagttttccctgaaacagata gtatatttgaacctgtataataatatatagtctagcgctttacggaagac aatgtatgtatttcggttcctggagaaactattgcatctattgcataggt aatcttgcacgtcgcatccccggttcattttctgcgtttccatcttgcac ttcaatagcatatctttgttaacgaagcatctgtgcttcattttgtagaa caaaaatgcaacgcgagagcgctaatttttcaaacaaagaatctgagctg catttttacagaacagaaatgcaacgcgaaagcgctattttaccaacgaa gaatctgtgcttcatttttgtaaaacaaaaatgcaacgcgagagcgctaa tttttcaaacaaagaatctgagctgcatttttacagaacagaaatgcaac gcgagagcgctattttaccaacaaagaatctatacttcttttttgttcta caaaaatgcatcccgagagcgctatttttctaacaaagcatcttagatta ctttttttctcctttgtgcgctctataatgcagtctcttgataacttttt gcactgtaggtccgttaaggttagaagaaggctactttggtgtctatttt ctcttccataaaaaaagcctgactccacttcccgcgtttactgattacta gcgaagctgcgggtgcattttttcaagataaaggcatccccgattatatt ctataccgatgtggattgcgcatactttgtgaacagaaagtgatagcgtt gatgattcttcattggtcagaaaattatgaacggtttcttctattttgtc tctatatactacgtataggaaatgtttacattttcgtattgttttcgatt cactctatgaatagttcttactacaatttttttgtctaaagagtaatact agagataaacataaaaaatgtagaggtcgagtttagatgcaagttcaagg agcgaaaggtggatgggtaggttatatagggatatagcacagagatatat agcaaagagatacttttgagcaatgtttgtggaagcggtattcgcaatat tttagtagctcgttacagtccggtgcgtttttggttttttgaaagtgcgt cttcagagcgcttttggttttcaaaagcgctctgaagttcctatactttc tagagaataggaacttcggaataggaacttcaaagcgtttccgaaaacga gcgcttccgaaaatgcaacgcgagctgcgcacatacagctcactgttcac gtcgcacctatatctgcgtgttgcctgtatatatatatacatgagaagaa cggcatagtgcgtgtttatgcttaaatgcgtacttatatgcgtctattta tgtaggatgaaaggtagtctagtacctcctgtgatattatcccattccat gcggggtatcgtatgcttccttcagcactaccctttagctgttctatatg ctgccactcctcaattggattagtctcatccttcaatgctatcatttcct ttgatattggatcatatgcatagtaccgagaaactagtgcgaagtagtga tcaggtattgctgttatctgatgagtatacgttgtcctggccacggcaga agcacgcttatcgctccaatttcccacaacattagtcaactccgttaggc ccttcattgaaagaaatgaggtcatcaaatgtcttccaatgtgagatttt gggccattttttatagcaaagattgaataaggcgcatttttcttcaaagc tgcggccgcactctcactagtacgtcaggtggcacttttcggggaaatgt gcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatc cgctcatgagacaataaccgtgataaatgcttcaataatattgaaaaagg aagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgc ggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaa aagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggat ctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttcc aatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgta ttgacgccgggcaagagcaactcgctcgccgcatacactattctcagaat gacttggttgagtactcaccagtcacagaaaagcatcttacggatggcat gacagtaagagaattatgcagtgctgccataaccatgagtgataacactg cggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgct tttttggacaacatgggggatcatgtaactcgccttgatcgttgggaacc ggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctg tagcaatggcaacaacgttgcgcaaactattaactggcgaactacttact ctagcttcccggcaacaattaatagactggatggaggcggataaagttgc aggaccacttctgcgctcggcccttccggctggctggtttattgctgata aatctggagccggtgagcgtgggtctcgcggtatcattgcagcactgggg ccagatggtaagccctcccgtatcgtagttatctacacgacggggagtca ggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcac tgattaagcattggtaactgtcagaccaagtttactcatatatactttag attgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcct ttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccact gagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttt tttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagc ggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaa ctggcttcagcagagcgcagataccaaatactgtccttctagtgtagccg tagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgc tctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtc ttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcg ggctgaacggggggttcgtgcacacagcccagcttggagcgaacgaccta caccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttc ccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaaca ggagagcgcacgagggagcttccagggggaaacgcctggtatctttatag tcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgct cgtcaggggggcggagcctatggaaaaacgccagcaacgcggccttttta cggttcctggccttttgctggccttttgctcacatgttctttcctgcgtt atcccctgattctgtggataaccgtattaccgcctttgagtgagctgata ccggtcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaa gcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgat tcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtg agcgcaacgcaattaatgtgagttacctcactcattaggcaccccaggct ttacactttatgcttccggctcctatgttgtgtggaattgtgagcggata acaatttcacacaggaaacagctatgaccatgattacgccaagctcgaaa tacgactcactatagggcgaattgggtaccgggccggccgtcgagcttga tggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccg gttcccaacgatcaaggcgagttacatgatcccccatgttgtgaaaaaaa gcggttagctcttcggtcctccgatcgttgtcagaagtaagttggccgca gtgttatcactcatggttatggcaggaactgcataattctcttactgtca tgccatccgtaagatgcttttctgtgactggtgtactcaaccaagtcatt ctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaacac gggataataccgcgccacatagcagaactttaaaagtgctcatcattgga aaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatc cagttcgatgtaacccactcgtgcacccaactgatcttcagcatctttta ctttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgca aaaaagggaataagggcgacacggaaatgttgaatactcatactcttcct ttttcaatattattgaagcatttatcagggttattgtctcatgagcgata catatttgaatgtatttagaaaaataaacaaataggggttccgcgcacat ttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgaca ttaacctataaaaataggcgtatcacgaggccctttcgtcttcaagaatt ggggatctacgtatggtcattcttcttcagattccctcatggagaagtgc ggcagatgtatatgacagagtcgccagtttccaagagactttattcaggc acttccatgataggcaagagagaagacccagagatgttgttgtcctagtt acacatggtatttattccagagtattcctgatgaaatggtttagatggac atacgaagagtttgaatcgtttaccaatgttcctaacgggagcgtaatgg tgatggaactggacgaatccatcaatagatacgtcctgaggaccgtgcta cccaaatggactgattgtgagggagacctaactacatagtgtttaaagat tacggatatttaacttacttagaataatgccatttttttgagttataata atcctacgttagtgtgagcgggatttaaactgtgaggacctcaatacatt cagacacttctgacggtatcaccctacttattcccttcgagattatatct aggaacccatcaggttggtggaagattacccgttctaagacttttcagct tcctctattgatgttacactcggacaccccttttctggcatccagttttt aatcttcagtggcatgtgagattctccgaaattaattaaagcaatcacac aattctctcggataccacctcggttgaaactgacaggtggtttgttacgc atgctaatgcaaaggagcctatatacctttggctcggctgctgtaacagg gaatataaagggcagcataatttaggagtttagtgaacttgcaacattta ctattttcccttcttacgtaaatatttttctttttaattctaaatcaatc tttttcaattttttgtttgtattcttttcttgcttaaatctataactaca aaaaacacatacagg appended as seq id no : 3 . underlined sequences show sites for primers bolded nucleotides represent the inserted pho5 the presence of pho5 was verified by pcr using the same primers as described above as well as by cutting with ecorv followed by gel electrophoresis , then transformed into yeast strains ys18 and ymr4 using a standard lioac s . cerevisiae transformation protocol . yeasts containing the vector with insert were selected for on uracil negative ynb plates ( difco , usa ) containing the appropriate amino acids . the resulting transformant strains were named ys - p5 and ym - p5 , respectively . the pho10 deletions were generated by pcr - mediated gene replacement , baudin et al . ( 1993 ) a simple and efficient for direct gene deletion in saccharomyces cerevisiae . nucleic acids res . 21 , 3329 - 3330 using his5 from saccharomyces pombe ( corresponding to his3 in saccharomyces cerevisiae ) as the selectable marker . as template dna the plasmid pfa6a - his3mx6 ; wach et al . ( 1994 ) new heterologous modules for classical or pcr - based gene disruptions in saccharomyces cerevisiae . yeast . 10 , 1793 - 1808 was used . 5 ′: cgatagattcaagctcagtttcgccttggttgtaaagtagg cagctg aagcttcgtacgc - 3 ′, appended as seq id no : 4 5 ′: ggtctatttactgttttaataaagtgtcgttgtagtgcttgg ggcag atgatgtcgaggcg - 3 ′, appended as seq id no 5 these oligonucleotides were used as primers for construction of deletion cassettes . underlined sequences are complementary to his5 in the template , and non - underlined parts to flanking regions of pho10 . the pho10 deletions were generated by pcr - mediated gene replacement using his5 from saccharomyces pombe ( corresponding to his3 in s . cerevisiae ) as the selectable marker . as template dna the plasmid pfa6a - his3mx6 was used . sequence of the resulting pcr product used for deletion of pho10 by homologous recombination : cgatagattcaagctcagtttcgccttggttgtaaagtagc cagctgaag cttcgtacgc tgcaggtcgacggatccccgggttaattaaggcgcgccag atctgtttagcttgcctcgtccccgccgggtcacccggccagcgacatgg aggcccagaataccctccttgacagtcttgacgtgcgcagctcaggggca tgatgtgactgtcgcccgtacatttagcccatacatccccatgtataatc atttgcatccatacattttgatggccgcacggcgcgaagcaaaaattacg gctcctcgctgcagacctgcgagcagggaaacgctcccctcacagacgcg ttgaattgtccccacgccgcgcccctgtgagaaatataaaaggttaggat ttgccactgaggttcttctttcatatacttccttttaaatcttgctagga tacagttctcacatcacatccgaacataaacaaccatgggtaggagggct tttgtagaaagaaatacgaacgaaacgaaaatcagcgttgccatcgcttt ggacaaagctcccttacctgaagagtcgaattttattgatgaacttataa cttccaagcatgcaaaccaaaagggagaacaagtaatccaagtagacacg ggaattggattcttggatcacatgtatcatgcactggctaaacatgcagg ctggagcttacgactttactcaagaggtgatttaatcatcgatgatcatc acactgcagaagatactgctattgcacttggtattgcattcaagcaggct atgggtaactttgccggcgttaaaagatttggacatgcttattgtccact tgacgaagctctttctagaagcgtagttgacttgtcgggacggccctatg ctgttatcgatttgggattaaagcgtgaaaaggttggggaattgtcctgt gaaatgatccctcacttactatattccttttcggtagcagctggaattac tttgcatgttacctgcttatatggtagtaatgaccatcatcgtgctgaaa gcgcttttaaatctctggctgttgccatgcgcgcggctactagtcttact ggaagttctgaagtcccaagcacgaagggagtgttgtaaagagtactgac aataaaaagattcttgttttcaagaacttgtcatttgtatagttttttta tattgtagttgttctattttaatcaaatgttagcgtgatttatatttttt tt cgcctcgacatcatctgcc ccaagcactacaacgacactttattaaaa cagtaaatagacc appended as seq id no : 6 underlined sequences represent primers ( or complementary strand to primer ) used italic shows sequence corresponding to pho10 ( sgd ) the pcr reactions were performed in 100 μl using vent polymerase , the crude pcr product was purified by cutting the appropriate band from a preparative agorase gel - electrophoresis and ymr4 and ys18 were transformed by the lithium acetate method resulting in strains named ym10 and ys10 , respectively . the deletions were verified by pcr on whole yeast colonies as well as on extracted dna . deletion of pho80 was performed by pcr - based gene disruption , mainly according to baudin et al ., ( 1993 ) “ a simple and efficient for direct gene deletion in saccharomyces cerevisiaw .” nucleic acids res . 21 , 3329 - 3330 , and goldstein and mccusker , ( 1999 ) “ new heterologous modules for classical or pcr - based gene disruptions in saccharomyces cerevisiae .” yeast , 10 , 1793 - 1808 . a deletion fragment consisting of a selectable marker flanked by 5 ′ and 3 ′ flanking sequences of pho80 was constructed . at transformation , the pho80 orf was exchanged for hygromycin b phosphotransferase ( hph ) by homologous recombination . the plasmid pag32 goldstein et al ., containing the selectable marker hph ( hygromycin b phosphotransferase ) was used as template for the pcr based construction of the pho80 deletion fragment . for the pho80 region , primers were designed according to sgd and for the hph region according to gritz and davis ( 1983 ) “ plasmid encoded hygromycin b resistance : the sequence of hygromycin b phosphotransferase gene and its expression in escherichia coli and saccharomyces cerevisiae .” gene . 25 , 178 - 188 . forward primer : 5 ′: cagcgtatattggctttcctttaatctaatgccccaagcc cacatac gatttaggtgacac - 3 ′ appended as seq id no : 10 backwards primer : 5 ′- ggagttctcaagctcatctcgaagtgttttctgtcgcttatg aatac gactcactatagggtg - 3 ′ appended as seq id no : 11 underlined sequences complement hph in pag32 ( goldstein and mccusker , 1999 , yeast 15 : 1541 - 1553 ) the rest are deleting sequences that complement regions flanking pho80 ( sgd ). the plasmid pag32 ( goldstein and mccusker , 1999 ), containing the selectable marker hygromycin b phosphotransferase ( hph ), was used as template . fw primer complements to non - coding strain . starting at ˜ 483 bp upstream hph start ( atg ) in pag32 and 315 bp upstream pho80 start . bw primer complements to coding strand . oligo . ( 63 bp .) starts 311 bp downstream hph end in pag32 , and 267 bp downstream pho80 end in s . cerevisiae . the pcr mix consisted of thermopol buffer , 0 . 1 μg / pl acetylated bsa ( bovine serum albumin ), 0 . 2 mm dntps , 0 . 5 μm of each primer and 2 units of vent polymerase . to each reaction approximately 0 , 7 μg / ml template dna was added . following the pcr reaction , products were separated by agarose gel electrophoresis ( 0 . 7 % agarose in tbe buffer . 100v ) and purified by qiaquick gel extraction kit ( qiagen ). resulting pcr product used for deletion of pho80 by homologous recombination : cagcgtatattggctttcctttaatctaatgccccaagcccacatacgat ttaggtgacac tatagaacgcggccgccagctgaagcttcgtacgctgca ggtcgacggatccccgggttaattaaggcgcgccagatctgtttagcttg cctcgtccccgccgggtcacccggccagcgacatggaggcccagaatacc ctccttgacagtcttgacgtgcgcagctcaggggcatgatgtgactgtcg cccgtacatttagcccatacatccccatgtataatcatttgcatccatac attttgatggccgcacggcgcgaagcaaaaattacggctcctcgctgcag acctgcgagcagggaaacgctcccctcacagacgcgttgaattgtcccca cgccgcgcccctgtagagaaatataaaaggttaggatttgccactgaggt tcttctttcatatacttccttttaaaatcttgctaggatacagttctcac atcacatccgaacataaacaaccatgggtaa aaagcctgaactcaccgcg acgtctgtcgagaagtttctgatcgaaaagttcgacagcgtctccgacct gatgcagctctcggagggcgaagaatctcgtgctttcagcttcgatgtag gagggcgtggatatgtcctgcgggtaaatagctgcgccgatggtttctac aaagatcgttatgtttatcggcactttgcatcggccgcgctcccgattcc ggaagtgcttgacattggggaattcagcgagagcctgacctattgcatct cccgccgtgcacagggtgtcacgttgcaagacctgcctgaaaccgaactg cccgctgttctgcagccggtcgcggaggccatggatgcgatcgctgcggc cgatcttagccagacgagcgggttcggcccattcggaccgcaaggaatcg gtcaatacactacatggcgtgatttcatatgcgcgattgctgatccccat gtgtatcactggcaaactgtgatggacgacaccgtcagtgcgtccgtcgc gcaggctctcgatgagctgatgctttgggccgaggactgccccgaagtcc ggcacctcgtgcacgcggatttcggctccaacaatgtcctgacggacaat ggccgcataacagcggtcattgactggagcgaggcgatgttcggggattc ccaatacgaggtcgccaacatcttcttctggaggccgtggttggcttgta tggagcagcagacgcgctacttcgagcggaggcatccggagcttgcagga tcgccgcggctccgggcgtatatgctccgcattggtcttgaccaactcta tcagagcttggttgacggcaatttcgatgatgcagcttgggcgcagggtc gatgcgacgcaatcgtccgatccggagccgggactgtcgggcgtacacaa atcgcccgcagaagcgcggccgtctggaccgatggctgtgtagaagtact cgccgatagtggaaaccgacgccccagcactcgtccgagggcaaaggaa t aatcagtactgacaataaaaagattcttgttttcaagaacttgtcatttg tatagtttttttatattgtagttgttctattttaatcaaatgttagcgtg atttatattttttttcgcctcgacatcatctgcccagatgcgaagttaag tgcgcagaaagtaatatcatgcgtcaatcgtatgtgaatgctggtcgcta tactgctgtcgattcgatactaacgccgccatccagtgtcgaaaacgagc tcgaattcatcgatgatatcagatccactagtggcctatgcggccgcgga tctgccggt ctccctatagtgagtcgtattcataagcgacagaaaacact tcgagatgagcttgagaactcc , appended as seq id no : 12 nucleotides in bold show the orf of the hgh gene . underlined sequences shows the pcr primers , partly complementary to the pho80 gene the purified deletion fragment was transformed into ys18 by electroporation . the protcol for transformation was mainly based on a protocol at gottschling lab website . transformants were incubated in 30 ° c . in 1 ml 1m sorbitol + 1 ml 2 × ypd for 2 h to allow expression of the drug resistance marker , then spread onto selective growth medium ( ypd , 0 . 9 mg / ml hygromycin b ). colonies appeared after a few days and putative transformants were tested for accuracy by pcr . the resulting strain was designated yd80 ( matα ; his3 - 11 , 3 - 15 ; leu2 - 3 , 2 - 112 ; ura3δ5 ; canr ; pho80δ :: hph ) 2 . 5 . construction of combined pho80δ deletion and pho4 and pho5 overexpressing strains . the plasmid pyx212 containing the insert pho5 ( described above ) was transformed into strain yd80 using a standard lioac s . cerevisiae transformation protocol . furthermore , pho4 was pcr cloned as described above using the primers : forward primer ( jp42 ) 5 ′- cg gaattc atgggccgtacaacttctgagg - 3 ′, appended as seq id no : 7 backwards primers ( jt42 ) 5 ′- cg ctcgag tcacgtgctcacgttctgcag - 3 ′, appended as seq id no : 8 underlined sequences complement ecori and xhoi restriction sites in pyx212 and the rest are sequences that complement start and end regions in pho4 ( sgd ). gaattcatgggccgtacaacttctgagg gaatacacggttttgtggacga tctagagcccaagagcagcattcttgataaagtcgcagactttatcaccg taaacacgaaacggcatgatgggcgcgaggacttcaacgagcaaaacgac gacctgaacagtcaagagaaccacaacagcagtgagaatgggaaccagaa tgaaaatgaacaagacagtctcgcgttggacgacctagaccgcgcctttc agctggtggaaggtatgcatatcgactgcatgatgccctcgcatgcgcac cactccccagctacaactgctacaatcaagccgcggctattatattcgcc gctaatacacacgcaaactgcgcttcccgtaaccatttcgccgaacttgg tcgctactgctacttccaccacatccgctaacaaagtcactaaaaacaag agtaatagtagtccgtatttgaacaagcgcagaggtaaacccgggccgga ttcggccacttcgctgttcgaattgcccgacagcgttatcccaactccga aaccgaaaccgaaaccaaagcaatatccgaaagttattctgccgtcgaac agcacaagacgcgtatcaccggtcacggccaagaccagcagcagcgcaga aggcgtggtcgtagcaagtgagtctcctgtaatcgcgccgcacggatcga gccattcgcggtcgctgagtaagcgacggtcatcgggcgcgctcgtggac gatgacaagcgcgaatcacacaagcatgcagagcaagcacggcgtaatcg attagcggtcgcgctgcacgaactggcgtctttaatccccgcggagtgga aacagcaaaatgtgtcggccgcgccgtccaaagcgaccaccgtggaggcg cctgccggtacatccgtcaccta cagcagaacgtgagcacgtga ctcgag ctcagctagctaactgaataaggaacaatgaacgtttttcctttctcttg ttcctagtattaatgactgaccgatacatccctttttttttttgtctttg tctagctccagcttttgttccctttagtgagggttaattcaattcactgg ccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaactt aatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaaga ggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaat ggcgcgacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggtt acgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctccttt cgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaag ctctaaatcgggggctccctttagggttccgatttagtggtttacggcac ctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatc gccctgatagacggtttttcgccctttgacgttggagtccacgttcttta atagtggactcttgttccaaactggaacaacactcaaccctatctcggtc tattcttttgatttataagggattttgccgatttcggcctattggttaaa aaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaa cgtttacaatttcctgatgcggtattttctccttacgcatctgtgcggta tttcacaccgcatagggtaataactgatataattaaattgaagctctaat ttgtgagtttagtatacatgcatttacttataatacagttttttagtttt gctggccgcatcttctcaaatatgcttcccagcctgcttttctgtaacgt tcaccctgtaccttagcatcccttccctttgcaaatagtcctcttccaac aataataatgtcagatcctgtagagaccacatcatccacggttctatact gttgacccaatgcgtctcccttgtcatctaaacccacaccgggtgtcata atcaaccaatcgtaaccttcatctcttccacccatgtctctttgagcaat aaagccgataacaaaatctttgtcgctcttcgcaatgtcaacagtaccct tagtatattctccagtagatagggagcccttgcatgacaattctgctaac atcaaaaggcctctaggttcctttgttacttcttctgccgcctgcttcaa accgctaacaatacctggccccagcacaccgtgtgcattcgtaatgtctg cccattctgctattctgtatacacccgcagagtactgcaatttgactgta ttaccaatgtcagcaaattttctgtcttcgaagagtaaaaaattgtactt ggcggataatgcctttagcggcttaactgtgccctccatcgaaaaatcag tcaatatatccacatgtgtttttagtaaacaaattttgggacctaatgct tcaactaactccagtaattccttggtggtacgaacatccaatgaagcaca caagtttgtttgcttttcgtgcatgatattaaatagcttggcagcaacag gactaggatgagtagcagcacgttccttatatgtagctttcgacatgatt tatcttcgtttcctgcaggtttttgttctgtgcagttgggttaagaatac tgggcaatttcatgtttcttcaacactacatatgcgtatatataccaatc taagtctgtgctccttccttcgttcttccttctgttcggagattaccgaa tcaaaaaaatttcaaagaaaccgaaatcaaaaaaaagaataaaaaaaaaa tgatgaattgaattgaaaagctgtggtatggtgcactctcagtacaatct gctctgatgccgcatagttaagccagccccgacacccgccaacacccgct gacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagc tgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcac cgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggtt aatgtcatgataataatggtttcttagacgtgcggccgctctagaactag tggatcaattccacggactatagactatactagtatactccgtctactgt acgatacacttccgctcaggtccttgtcctttaacgaggccttaccactc ttttgttactctattgatccagctcagcaaaggcagtgtgatctaagatt ctatcttcgcgatgtagtaaaactagctagaccgagaaagagactagaaa tgcaaaaggcacttctacaatggctgccatcattattatccgatgtgacg ctgcagcttctcaatgatattcgaatacgctttgaggagatacagcctaa tatccgacaaactgttttacagatttacgatcgtacttgttacccatcat tgaattttgaacatccgaacctgggagttttccctgaaacagatagtata tttgaacctgtataataatatatagtctagcgctttacggaagacaatgt atgtatttcggttcctggagaaactattgcatctattgcataggtaatct tgcacgtcgcatccccggttcattttctgcgtttccatcttgcacttcaa tagcatatctttgttaacgaagcatctgtgcttcattttgtagaacaaaa atgcaacgcgagagcgctaatttttcaaacaaagaatctgagctgcattt ttacagaacagaaatgcaacgcgaaagcgctattttaccaacgaagaatc tgtgcttcatttttgtaaaacaaaaatgcaacgcgagagcgctaattttt caaacaaagaatctgagctgcatttttacagaacagaaatgcaacgcgag agcgctattttaccaacaaagaatctatacttcttttttgttctacaaaa atgcatcccgagagcgctatttttctaacaaagcatcttagattactttt tttctcctttgtgcgctctataatgcagtctcttgataactttttgcact gtaggtccgttaaggttagaagaaggctactttggtgtctattttctctt ccataaaaaaagcctgactccacttcccgcgtttactgattactagcgaa gctgcgggtgcattttttcaagataaaggcatccccgattatattctata ccgatgtggattgcgcatactttgtgaacagaaagtgatagcgttgatga ttcttcattggtcagaaaattatgaacggtttcttctattttgtctctat atactacgtataggaaatgtttacattttcgtattgttttcgattcactc tatgaatagttcttactacaatttttttgtctaaagagtaatactagaga taaacataaaaaatgtagaggtcgagtttagatgcaagttcaaggagcga aaggtggatgggtaggttatatagggatatagcacagagatatatagcaa agagatacttttgagcaatgtttgtggaagcggtattcgcaatattttag tagctcgttacagtccggtgcgtttttggttttttgaaagtgcgtcttca gagcgcttttggttttcaaaagcgctctgaagttcctatactttctagag aataggaacttcggaataggaacttcaaagcgtttccgaaaacgagcgct tccgaaaatgcaacgcgagctgcgcacatacagctcactgttcacgtcgc acctatatctgcgtgttgcctgtatatatatatacatgagaagaacggca tagtgcgtgtttatgcttaaatgcgtacttatatgcgtctatttatgtag gatgaaaggtagtctagtacctcctgtgatattatcccattccatgcggg gtatcgtatgcttccttcagcactaccctttagctgttctatatgctgcc actcctcaattggattagtctcatccttcaatgctatcatttcctttgat attggatcatatgcatagtaccgagaaactagtgcgaagtagtgatcagg tattgctgttatctgatgagtatacgttgtcctggccacggcagaagcac gcttatcgctccaatttcccacaacattagtcaactccgttaggcccttc attgaaagaaatgaggtcatcaaatgtcttccaatgtgagattttgggcc attttttatagcaaagattgaataaggcgcatttttcttcaaagctgcgg ccgcactctcactagtacgtcaggtggcacttttcggggaaatgtgcgcg gaacccctatttgtttatttttctaaatacattcaaatatgtatccgctc atgagacaataaccgtgataaatgcttcaataatattgaaaaaggaagag tatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcat tttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagat gctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaa cagcggtaagatccttgagagttttcgccccgaagaacgttttccaatga tgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgac gccgggcaagagcaactcgctcgccgcatacactattctcagaatgactt ggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacag taagagaattatgcagtgctgccataaccatgagtgataacactgcggcc aacttacttctgacaacgatcggaggaccgaaggagctaaccgctttttt ggacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagc tgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagca atggcaacaacgttgcgcaaactattaactggcgaactacttactctagc ttcccggcaacaattaatagactggatggaggcggataaagttgcaggac cacttctgcgctcggcccttccggctggctggtttattgctgataaatct ggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccaga tggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaa ctatggatgaacgaaatagacagatcgctgagataggtgcctcactgatt aagcattggtaactgtcagaccaagtttactcatatatactttagattga tttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttg ataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcg tcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttct gcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtgg tttgtttgccggatcaagagctaccaactctttttccgaaggtaactggc ttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagtt aggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgc taatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttacc gggttggactcaagacgatagttaccggataaggcgcagcggtcgggctg aacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccg aactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaa gggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggaga gcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctg tcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtca ggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggtt cctggccttttgctggccttttgctcacatgttctttcctgcgttatccc ctgattctgtggataaccgtattaccgcctttgagtgagctgataccggt cgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcgga agagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcatt aatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgc aacgcaattaatgtgagttacctcactcattaggcaccccaggctttaca ctttatgcttccggctcctatgttgtgtggaattgtgagcggataacaat ttcacacaggaaacagctatgaccatgattacgccaagctcgaaatacga ctcactatagggcgaattgggtaccgggccggccgtcgagcttgatggca tcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcc caacgatcaaggcgagttacatgatcccccatgttgtgaaaaaaagcggt tagctcttcggtcctccgatcgttgtcagaagtaagttggccgcagtgtt atcactcatggttatggcaggaactgcataattctcttactgtcatgcca tccgtaagatgcttttctgtgactggtgtactcaaccaagtcattctgag aatagtgtatgcggcgaccgagttgctcttgcccggcgtcaacacgggat aataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacg ttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagtt cgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttc accagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaa gggaataagggcgacacggaaatgttgaatactcatactcttcctttttc aatattattgaagcatttatcagggttattgtctcatgagcgatacatat ttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccc cgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaac ctataaaaataggcgtatcacgaggccctttcgtcttcaagaattgggga tctacgtatggtcattcttcttcagattccctcatggagaagtgcggcag atgtatatgacagagtcgccagtttccaagagactttattcaggcacttc catgataggcaagagagaagacccagagatgttgttgtcctagttacaca tggtatttattccagagtattcctgatgaaatggtttagatggacatacg aagagtttgaatcgtttaccaatgttcctaacgggagcgtaatggtgatg gaactggacgaatccatcaatagatacgtcctgaggaccgtgctacccaa atggactgattgtgagggagacctaactacatagtgtttaaagattacgg atatttaacttacttagaataatgccatttttttgagttataataatcct acgttagtgtgagcgggatttaaactgtgaggacctcaatacattcagac acttctgacggtatcaccctacttattcccttcgagattatatctaggaa cccatcaggttggtggaagattacccgttctaagacttttcagcttcctc tattgatgttacactcggacaccccttttctggcatccagtttttaatct tcagtggcatgtgagattctccgaaattaattaaagcaatcacacaattc tctcggataccacctcggttgaaactgacaggtggtttgttacgcatgct aatgcaaaggagcctatatacctttggctcggctgctgtaacagggaata taaagggcagcataatttaggagtttagtgaacttgcaacatttactatt ttcccttcttacgtaaatatttttctttttaattctaaatcaatcttttt caattttttgtttgtattcttttcttgcttaaatctataactacaaaaaa cacatacag appended as seq id : 9 bolded sequence shows ph04 underlined sequences represent sites for primers . also pyx212 with pho4 was transformed into yd80 using the methods already described . 1 . 5 ml of cell suspension was withdrawn at intervals during the growth and centrifuged for 3 minutes at 13000 rpm to pellet the cells . one ml of the supernatant was transferred to a new micro - tube and acidified by adding 150 μl of 4 m hcl . this yields approximately 0 . 5 m hcl , which is enough to inactivate all enzymatic activity potentially left in the supernatant . chemical acid hydrolysis of inositol phosphates does not take place in such solutions without strong heating . these samples were stored in freezer until use for analysis of ip : s and pnpp . a reference sample for identification of peaks was prepared by chemically hydrolyzing 1 mm sodium phytate ( na - ip6 ) in 2 ml of 0 . 5 m hcl . the solution was heated to 110 ° c . for 15 h yielding a mixture of isomers of ip : s that was stored in freezer until used as reference sample . to analyze the p i and ip6 content in a typical environment , baker &# 39 ; s yeast are exposed to during bread leavening two simple doughs were mixed , in which two types of flour were used : whole meal wheat flour ( 100 % extraction rate ; i . e . the proportion of the whole wheat grain obtained as finished flour ), and normal wheat flour ( extraction rate 60 %). the dough mixture contained : 300 g flour , log sucrose , 3 g nacl , 20 g commercial baker &# 39 ; s yeast ( swedish yeast company ) and 200 g tap - water . at time zero and thereafter every 15 min , 20 g of dough was withdrawn and mixed with 40 ml 0 . 5 m hcl ( at room temperature this hcl concentration will not hydrolyze ip6 , but is sufficient to inactivate enzymatic activity ). inorganic phosphate ( p i ) and ip6 were extracted by magnetically stirring the mixture for three hours at room temperature . the extracts were centrifuged , the supernatant collected and frozen until use . for analysis , the samples were thawed and 1 ml was centrifuged in a micro - tube for 5 min at 13000 × g . the resulting supernatants were appropriately diluted with mq - water and inositol phosphates were analyzed by hpic chromatography as described in previous paragraph . the ion chromatographic analysis of p i were performed using a dionex ( sunnyvale , calif ., usa ) model 4500i equipped with a 50 μl loop injector , pax - 100 guard and analytical column , anion micro membrane supressor and a conductivity detector . the samples were eluted with a linear gradient of water and increasing portion of 200 mm naoh , starting with 6 % naoh and ending after 35 min at 50 % naoh ip6 is efficiently degraded by yeast in a synthetic medium with ip6 as the sole phosphorous source . tüirk et al . ( 2000 ) inositol hexaphosphate hydrolysis by baker &# 39 ; s yeast . capacity , kinetics , and degradation products . j . agric . food chem . 48 , 100 - 104 in order to test whether extracellular ip6 hydrolysis by s . cerevisiae was repressed by inorganic phosphate ( p i ), synthetic yeast minimal medium containing p i ( 26 mm ) was supplemented with ip6 ( cbsip6 + p i ). for all s . cerevisiae tested , that is skq2n , cbs 7764 , cbs 7765 , ys18 , by4741 and ymr4 virtually no breakdown of ip6 was detected in the ip6 + p i cultures , showing an efficient repression of phytase activity by high levels of extracellular p i . referring to fig1 , growth of s . cerevisiae skq2n ( squares ) and extracellular concentration of inositol hexaphosphate ( ip6 ; triangles ), measured by hpic , as a function of time is shown . growth was performed in synthetic cbs medium with 2 % ( wt / vol ) glucose as carbon and energy source . filled symbols : inositol hexaphosphate ( ip6 ) as the sole phosphorous source ; open symbols : inositol hexaphosphate plus inorganic phosphate ( p i ) as combined phosphorous sources . data are from a representative experiment performed many times . error bars on ip6 data show maximum variation between repeated hpic analysis . the typical pattern for the ip6 concentration in the medium during growth in the absence and presence of p i is depicted for strain skq2n in fig1 . in this experiment , all the ip6 was depleted before 20 h of growth in the cbsip6 culture , while in the cbsip6 + p i culture no ip6 was degraded at that time . for all strains , the growth rates , as calculated by regression in the exponential respiro - fermentative phase ( glucose growth ), were as rapid in cbsip6 medium as compared with cbsip6 + p i or cbsp i media , showing efficient utilization of ip6 as p - source for growth by s . cerevisiae . the same type of experiments were performed also in complex and rich ypd medium , either with the addition of only ip6 ( ypdip6 ) or with the addition of ip6 and pi ( ypdip6 + p i ). the ypd experiments yielded data consistent with the cbs cultures , that is ip6 degradation without loss in growth rate in ypdip6 medium and repression of phytase activity in ypdip6 + p i medium ( data not shown ). however , the p i induced repression was for some strains ( e . g . ys18 ) less pronounced in ypd as compared with cbs medium , that is a certain constitutive , not negligible , phytase activity was detected . ip6 and the breakdown products formed as a result of ip6 hydrolysis by the yeast were identified and quantified by hpic . referring to fig2 , chromatographic profiles ( hpic ) of chemical acid hydrolysate of sodium phytate ( first line ), and supernatant from s . cerevisiae cultures ( second and third lines ) after 15 h of growth is shown . s . cerevisiae was cultured in cbs medium containing either ip6 as the sole p - source ( second line , thick ) demonstrating yeast phytase activity , or in cbs medium with ip6 and p i as combined p - sources ( third line ) showing p i - induced repression of phytase activity . numbered peaks : 1 : so 4 − 2 ; 2 : ins ( 1 , 2 , 6 ) p 3 ; 3 : ins ( 1 , 2 , 5 , 6 ) p 4 ; 4 : ins ( 1 , 2 , 4 , 5 , 6 ) p 5 ; 5 : ip6 . the chromatographic profile showed that the enzymes exerting the yeast phytase activity are very specific with respect to position on the inositol ring . only one isomer of each ip 5 , ip 4 and ip 3 was detected for samples withdrawn during growth of s . cerevisiae in cbsip6 medium ( fig2 , second line ). these isomers aligned with an acid chemical hydrolysate ( fig2 , first line , in which all peaks previously have been identified ) proved to be i ( 1 , 2 , 4 , 5 , 6 ) p 5 , i ( 1 , 2 , 5 , 6 ) p 4 , i ( 1 , 2 , 6 ) p 3 , respectively . it is known that peak 2 in the hydrolysate may contain a mixture of i ( 1 , 2 , 6 ) p 3 and i ( 1 , 2 , 3 ) p 3 . however , the i ( 1 , 2 , 3 ) p 3 isomer can be excluded in the yeast samples since position 3 was already missing . the same pattern of ip isomers was obtained for all strains tested in our collection , including laboratory strains and several wild - types . the lower , third line in fig2 shows the extracellular composition of ip : s from a s . cerevisiae cbsip6 + pi culture at 15 hrs of growth . in such cultures no lower inositol phosphates were detectable and the concentration of ip6 ( peak 5 ) remained high through out the experiment proving the p i induced repression of extracellular phytase activity . the major secretory acid phosphatase , encoded by pho5 , may be involved in phytate hydrolysis . a pho5 deletion mutant may be less efficient in degrading extracellular ip6 as compared with the corresponding parent strain . for this purpose the pho3δpho5δ double mutant ymr4 was used . by using this mutant the effect of missing pho3 , in addition to pho5 , was assessed . however , this gene may be less important since it has been shown to be repressed by thiamine , ( which is present in the cbs medium ) and its product is mainly a thiamine phosphatase , praekelt et al . ( 1994 ) regulation of th14 ( mol1 ), a thiamine - biosynthetic gene of saccharomyces cerevisiae . yeast . 10 , 481 - 490 . contrary to expectation , the mutant was not affected . referring to fig3 a and 3b , growth ( squares ) of s . cerevisiae parent strain ys18 ( open symbols ) and s . cerevisiae ymr4 pho5δpho3δ double deletion mutant ( filled symbols ) and extracellular concentration of ip6 ( circles ) as determined by hpic . fig3 a shows synthetic cbs medium with glucose as carbon and energy source and ip6 plus p i as phosphorous sources ( repressing conditions ). fig . b shows synthetic cbs medium with glucose as carbon and energy source and ip6 as the sole phosphorous source ( de - repressing conditions ). represented data are means of double samples from a representative experiment run twice . in repeated experiments strain ymr4 hydrolyzed extracellular ip6 at a rate equal to its parent strain ys18 ( fig3 b ). in addition , fig3 a shows that in cbsip6 + p i medium ( repressing conditions ), the pattern of growth and the p i induced repression was unaffected in the mutant strain ymr4 , which closely follows the pattern for ys18 . for both strains at time 24 h after inoculation , 94 % of the initial amount of ip6 was still present in the cbsip6 + p i cultures ( fig3 a ). at this time , neither ip6 nor any other lower ip : s were detectable in the medium of the parallel cbsip6 culture ( fig3 b ). additional evidence for independence of pho5 in this context was provided by the rate of growth for the mutant in cbsip6 medium . the calculated growth rate in the exponential respiro - fermentative phase ( growth on glucose , cbsip6 medium ) was 0 . 33 h − 1 ( generation time of 2 . 1 h ) for both ymr4 and its parent strain ys18 . this is not evidence that pho5p and pho3p are unable to hydrolyze ip6 , it is only evidence that shows that they are not needed by the yeast for intact phytase activity . by pcr and homologous recombination pho10 was deleted in ymr4 and ys18 thereby obtaining a pho5δpho3δpho10δ triple mutant and pho10δ single mutant labeled ym10 and ys10 , respectively . referring to fig4 , concentration of inositol hexaphosphate ( ip6 ) in yeast culture supernatant as a function of growth in cbs medium with ip6 as the sole phosphorous source is shown . grey circles : ys18 parent strain with all pho genes intact ; filled squares : ymr4 pho3δapho5δ double mutant ; filled triangles : ym10 pho3δpho5δpho10δ triple mutant ; and open diamonds : ys10 pho10δ single deletion mutant . data are means of double samples from separate cultures and error bars show the variation between those . these strains were cultured in cbsip6 and ypdip6 medium , and the medium concentration of ip6 was monitored by hpic during growth . in cbs , the rate of ip6 degradation was unaffected in ys1o showing that also pho10 was superfluous ( fig4 ) for intact phytase activity . even in ym10 , in which the only remaining secretory phosphatase is pho11p , the net extracellular phytase activity was unaffected as compared with ys18 and ymr4 . only a slight , but significant , decrease in the rate of ip6 degradation was in cbs detected in this mutant ( fig4 ). however , in the complex medium ypd , the triple mutant showed a strong reduction in rate of extracellular ip6 ( fig5 ) with maintained growth rate , suggesting phytase activity for pho10p and at least one more enzyme . referring to fig5 , concentration of inositol hexaphosphate ( ip6 ) in yeast culture supernatant as a function of growth in complex ypd medium with ip6 as the added phosphorous source is shown . grey circles : ys18 parent strain with all pho genes intact ; filled squares : ymr4 pho3δpho5δ double mutant ; filled triangles : ym10 pho3δpho5δpho10δ triple mutant ; and open diamonds : ys10 pho10δ single deletion mutant . data are means of double samples from separate cultures and error bars show the variation between those . referring to fig6 , a vector construct consisting of plasmid pyx212 containing the insert pho5 used for transformation of ys18 and ymr4 . the glycolytic promoter triose phosphate isomerase ( tpi1 ) controlling expression of pho5 , the yeast selection marker ura3 and the amp r gene are depicted . in order to assess the impact of exclusively pho5 expression on the extracellular ip6 degradation ymr4 and ys18 were both transformed with pyx212 containing the insert pho5 controlled by the constitutive glycolytic promoter tpi1 ( fig6 ). the resulting strains were designated ym - p5 and ys - p5 , respectively ( table 1 ). the experiments with these mutants were performed in ypd medium with the addition of the appropriate phosphorous source . growth and extracellular ip6 concentration were assessed as a function of time . referring to fig7 a and 7b , extracellular concentration of ip6 as a function of growth time of s . cerevisiae ymr4 ( a ) and ys18 ( b ), with and without the pho5 containing plasmid pyx212 . open symbols : strains without plasmid ; solid symbols : strains containing the plasmid pyx212 - pho5 . the experiment was performed in ypd medium with 2 % glucose supplemented with either only ip6 ( circles ) or with both ip6 and p i ( triangles ). represented data are means from two to three independent experiments with a standard deviation never exceeding 5 %. from both ym - p5 and ys - p5 data it is evident that pho5 encodes an enzyme with phytase activity ( fig7 a and b ). under normally repressing conditions ( ypdip6 + pi ) ip6 was by ym - p5 and ys - p5 degraded at a fairly high rate ( filled triangles in fig7 a and 7b ), demonstrating that phytase activity was in these mutants constitutively expressed . the corresponding parent strains lacking the plasmid are shown as controls ( open triangles ). these controls were in ypd somewhat lesser repressed as compared with cbs medium , however , much more repressed than the cells with plasmid . after 24 h of growth strain ym - p5 had degraded 63 % of the initial ip6 whereas in the ymr4 control strain the corresponding value at 24 h was only 22 . 5 % ( fig6 ). the rate of ip6 degradation in ypdip6 non - repressing medium was also analyzed . during these conditions pho10 and pho11 plus the introduced pho5 would be expressed in ym - p5 , and pho5 , pho10 and pho11 plus the introduced pho5 in the ys - p5 strain . the data show that the plasmid located pho5 indeed increased the net rate of ip6 degradation ( fig7 a and 7b ) in both strains . the effect was more pronounced in ys - p5 , in which the pho5 gene is present both in the genome and on the plasmid . the combined data from the pho5 overexpression experiments and the experiments with deletion strains compared with their parent strains ( fig3 and 4 ) shows that pho5p , pho10p and at least one more enzyme , believed to be pho11p , are by definition all phytases . the pho system is involved in the yeast phytase activity . accordingly , deletions in the regulatory genes pho80 and pho85 yield constitutive phytase activity . referring to fig8 , a direct comparison of phytate degrading capacity between pho5 overexpressing strains , and pho80δ and pho85δ deletions mutants . extracellular concentration of ip6 is plotted as a function of growth time of s . cerevisiae ys18 - p5 ( triangles ) with the pho5 containing plasmid pyx212 , s . cerevisiae pho80δ deletion mutant ( squares ) and pho85δ deletion mutant ( circles ) is shown . the experiment was performed in ypd medium with 2 % glucose supplemented with either only ip6 ( solid symbols ) or with both ip6 and p i ( open symbols ). data are means from two independent experiments with a standard deviation never exceeding 5 %. as shown in fig8 these mutants were highly effective in degrading ip6 , and completely constitutive demonstrating that the pho system indeed is involved in s . cerevisiae phytase activity . since the net rate of ip6 degradation was very rapid , these strains were compared with the ys18 - p5 ( pho5 overexpressing ) strain . both strain pho80δ and pho85δ showed a higher net rate in ip6 degradation as compared with the ys18 - p5 ( fig8 ). the growth rate was unchanged in strain pho80δ , however significantly reduced in strain pho85δ . in addition to the pho80δ and pho85δ strains retrieved from by4741 ( euroscarf collection ), another pho80δ , referring to fig1 , mutant was constructed by deletion in ys18 , yielding strain yd80 . the highly efficient extracellular phytase activity was reconfirmed in this strain . referring to fig9 , phytate degrading capacity of pho2δ deletion mutant is shown . for comparison , pho80δ deletion strain and by4741 with all pho genes intact are also shown . extracellular concentration of ip6 is plotted as a function of growth time in ypd . for explanation of symbols see figure . the p - source used is shown within parenthesis . in addition to ip6 data , growth data as od610 , are shown for the pho2δ deletion mutant and for its parent strain by4741 . data are means from two independent experiments with a standard deviation never exceeding 5 %. pho2 is together with pho4 known to positively regulate the expression of the secretory phosphatases pho5 , pho10 and pho11 . in a direct comparison the pho2 deletion mutant was demonstrated to lack virtually all phytase activity , demonstrating that yeast phytase activity is largely a matter of its pho system . the phytase activity may therefore be further increased by overexpressing pho2 and / or pho4 . the expression of pho3 , in addition to expression of pho5 , pho10 and pho11 may increase the rate of extracellular ip6 degradation . for this purpose the parent strain ys18 was used in a cbs medium excluding thiamine , which is known to repress pho3 expression , nosaka et al . ( 1989 ) a possible role for acid phosphatase with thiamin - binding activity encoded by pho 3 in yeast . fems microbiol . lett . 51 , 55 - 59 ; nosaka ( 1990 ) high affinity of acid phosphatase encoded by pho 3 gene in saccharomyces cerevisiae for thiamin phosphates . biochim . biophys . acta . 1037 , 147 - 154 . as controls normal cbsip6 medium ( with thiamine ) was used , with and without thiamine phosphate to ensure that the yeast was not negatively affected by the missing thiamine . growth rates and ip6 degradation were by ys18 not different between the three media used , indicating that pho3 is of no or minor significance for yeast phytase activity ( data not shown ). the pho system in s . cerevisiae has frequently been studied using phenyl phosphate and para - nitrophenyl phosphate ( pnpp ) as substrates . monod et al . ( 1989 ) functional analysis of the signal - sequence processing site ofyeast acid phosphatase . eur . j . biochem . 182 , 213 - 22 1 ; shnyreva et al . ( 1996 ) biochemical properties and excretion behavior of repressible acid phosphatases with altered subunit composition . microbiol . res . 151 , 291 - 300 ; martinez et al . ( 1998 ) identification , cloning and characterization of a derepressible na + - coupled phosphate transporter in saccharomyces cerevisiae . mol . gen . genet . 258 , 628 - 638 . these compounds are used as model organic phosphorous source . yeasts are often exposed to several organic phosphorous sources . accordingly , the impact of adding a second organic phosphorous compound ( pnpp ) on the rate of ip6 degradation was studied . both compounds are readily degraded by s . cerevisiae and since the pho system is involved in both cases a competitive situation arose . referring to fig1 , extracellular concentration of para - nitrophenyl phosphate ( pnpp , squares ) and ip6 ( triangles ) as a function of growth of s . cerevisiae skq2n in cbs medium with 2 % glucose as carbon and energy source is shown . the cbs medium was supplemented either with ip6 as the sole p - source ( open triangles ), with pnpp as the sole p - source ( open squares ) or with both ip6 and pnpp as combined p - sources ( solid symbols ). in the experiment , with both ip6 and pnpp present and p i absent , the rate of ip6 degradation was completely unchanged as compared with ip6 alone ( fig1 ). however , the rate of pnpp was delayed by presence of ip6 compared to pnpp alone . most of the degradation of pnpp occurred after ip6 was depleted from the medium . at 12 h of growth , ip6 was depleted in both cultures , whereas only 17 % of the initial pnpp was used in the mixed culture , and 49 % in the sole pnpp culture . the experiment was also performed with the pnpp concentration set to 6 times the concentration of ip6 ( 2 . 25 mm ) to obtain equal stoichiometry in number of available phosphate groups . six times more frequently pnpp randomly met the enzymes . the experiment yielded similar data , that is no change in rate of ip6 hydrolysis in the presence of pnpp and delayed pnpp degradation as compared with pnpp alone was observed ( data not shown ). to understand the yeast environment during bread making , relative to the pho system , the p i and ip6 content were analyzed in two types of wheat based bread doughs . in both doughs the level of p i increased and the level of ip6 decreased as a function of leavening time ( fig1 ). referring to fig1 , the content of inositol hexaphosphate ( ip6 , triangles ) and inorganic phosphate ( p i ; squares ), expressed as μmol per gram wet dough , as a function of leavening time in two types of wheat based doughs is shown . solid symbols : whole meal wheat flour ( 100 % extraction rate ; i . e . the proportion of the whole wheat grain obtained as finished flour ), and open symbols : white wheat flour ( extraction rate 60 %). error bars indicate the maximum variation between double samples . the concentration of p i was higher in the whole wheat flour dough starting at 4 μmol / g wet dough ( approximately equal to mm ), and ending after 60 min of leavening at 11 . 8 μmol / g dough , while in the white wheat flour the start and end concentrations were 1 . 7 μmol / g and 5 . 8 μmol / g , respectively . the initial concentrations of ip6 were 9 μmol / g and 3 μmol / g for whole - wheat flour and white wheat flour , respectively , decreasing to 4 . 8 and 0 . 4 μmol / g after 60 minutes of leavening . this demonstrates that phytases are active in the dough . most previous investigations in the context of yeast degrading ip6 refer to a “ yeast phytase ”, frequently distinguishing it from phosphatases , without identifying genes and enzymes . nayini et al . ( 1984 ) the phytase of yeast . lebensm . wiss . u - technol . 17 , 24 - 26 ; harland et al . ( 1989 ) effects of phytase from three yeasts on phytate reduction in norwegian whole wheat flour . cereal chem . 4 , 357 - 358 ; nair et al . ( 1991 ) phytic acid content reduction in canola meal by various microorganisms in a solid state fermentation process . acta biotechnologica . 11 , 211 - 218 . lambrechts et al . ( 1992 ) utilization of phytate by some yeasts . biotechnol . lett . 14 , 61 - 66 attempts to assess the yeast contribution to the observed phytase activity during bread leavening has sometimes been performed in conditions such as starvation in combination with 50 ° c ., harland et al . ( 1989 ) effects of phytase from three yeasts on phytate reduction in norwegian whole wheat flour . cereal chem . 4 , 357 - 358 . the yeast phytase activity in conditions suitable for yeast growth were studied and it was observed that , provided absence of p i , s . cerevisiae is well adapted to utilize extracellular ip6 as a phosphorous source . the rate of ip6 degradation was rapid and supplied the yeast metabolic machinery with phosphorous without a decrease in growth rate , that arose from the increased energy cost of synthesizing the degrading enzymes . the phosphate - induced repression of phytase activity indicated that the pho gene family in s . cerevisiae is involved . in low concentrations of inorganic phosphate s . cerevisiae is known to induce the synthesis of at least three phosphatases that are exported out through the cellular membrane . it appears that the enzymes work best in oligomeric organization , as studied by shnyreva et al . shnyreva et al . ( 1996 ) biochemical properties and excretion behavior of repressible acid phosphatases with altered subunit composition . microbiol . res . 151 , 291 - 300 , composed of a specific ratio between pho5p ( 86 %), pho10p and pho11p ( 14 % together ). the so - called “ yeast phytase ” may be the concerted action of the components in this oligomeric enzyme . however , when using pnpp as substrate shnyreva et al ., shnyreva et al . ( 1996 ) biochemical properties and excretion behavior of repressible acid phosphatases with altered subunit composition . microbiol . res . 151 , 291 - 300 have shown that also homopolymers of the individual secretory acid phosphatases have significant and different activities . in addition to being present in the largest amount , pho5p was found to exert the highest specific activity . fifteen times higher activity was obtained for pho5p expressed alone as compared with pho10p and pho11p , respectively . the pho5 deletion did not yield a less efficient strain with respect to ip6 degradation . several explanations could fit the data : ( i ) pho5 was not important for phytase activity or ( ii ) the remaining level of pho10p and pho11p , organized without pho5p , was sufficient for unchanged phytase activity . it may be that ( iii ) pho10 and pho11 became unregulated in the absence of pho5 . in fact , the absence of pho10 or pho11 has been shown to increase the pho5p level shnyreva et al . ( 1996 ) biochemical properties and excretion behavior of repressible acid phosphatases with altered subunit composition . microbiol . res . 151 , 291 - 300 and hence , the opposite may also be true . a ( iv ) different as yet unidentified phytase enzyme may exist . the s . cerevisiae gene dia3 for instance , encodes a protein largely related to pho3 , pho5 , pho10 and pho11 ( see e . g . the ypd database ). dia3p may be extracellular . since the significance of the different secretory phosphatases in ip6 specific degradation is not known a strain was created lacking only pho10 ( ys10 ). using strain ys10 it was demonstrated that pho10 was also dispensable for yeast phytase activity , shown by intact growth - and ip6 degradation rate . thus , neither of pho3 , pho5 or phojo was essential for high phytase activity . however , in a triple mutant ( ym10 ), a very small , but significant decrease in rate of ip6 degradation was observed in cbs and a pronounced decrease in ypd , demonstrating two things . first , pho10p is an enzyme with phytase activity since a change was observed when pho10 was the only difference and second , a strain with only pho11p alone ( or an unknown phytase ) still has a remarkable phytase activity in defined medium . for all these deletion strains the growth rate remained unchanged , so the net phytase activity is comparable also if expressed as biomass specific phytase activity . this further means that phosphorous never became limiting , even in a strain lacking three secretory phosphatases during growth on ip6 . it is interesting that the main secretory phosphatase ( pho5p ) is dispensable and that a strain encoding only one of two so - called minor secretory phosphatases , ( pho11p ), is alone able to keep almost unchanged phytase activity . to assess the phytase potential of solely pho5p , two strains were constructed which expressed almost exclusively pho5 during growth in repressing medium . the data obtained using these strains show that pho5 by itself encodes a protein with phytase activity and is therefore likely to participate when a wildtype strain degrades ip6 . when growing ym - p5 and ys - p5 in de - repressing media , additional phytase activity was observed as compared with the corresponding strains lacking the plasmids ( fig6 ). this was not necessarily expected since the increased rate of ip6 degradation leads to increase in p i concentration which in turn have a repressing impact on the genomic phytase encoding genes . the data reveals that yeast phytase activity is not the action of one gene product . however , simply by overexpressing one single gene strains were obtained with improved net phytase activity under both repressing and de - repressing conditions . furthermore , the regulatory components pho80p and pho85p are known to phosphorylate pho4p in conditions of high medium pi levels . the phosphorylated pho4p retrieves affinity for a transporter and leaves the nucleus instead of acting as a transcription activator for several pho genes , including the secretory phosphatases . if one or both of pho80p and pho85p is missing its kinase activity on pho4p is lost and pho4p will together with pho2p remain active as transcriptional activators for the sectretory phosphatases . the resulting mutant constitutively expresses pho5 , pho10 and pho11 . since deletions of pho80 or pho85 both yielded very strong constitutive phytase activity the involvement of the pho system was again demonstrated . it has previously been shown that the contribution of yeast to the phytase activity observed during bread leavening is very small , and not sufficient for a significant increase in iron and zinc absorption , harland et al . ( 1989 ) effects of phytase from three yeasts on phytate reduction in norwegian whole wheat flour . cereal chem . 4 , 357 - 358 ; türk et al . ( 1992 ) phytate degradation during bread making : effect of phytase addition . j . cereal science . 15 , 281 - 294 ; türk et al . ( 1996 ) reduction in the levels of phytate during wholemeal bread making ; effect of yeast and wheat phytases . j . cereal science . 23 , 257 - 264 . the ip6 level and mineral uptake in human intestine was , however , improved when adding commercial aspergillus phytase to dough or wheat rolls , respectively , türk et al . ( 1992 ) phytate degradation during bread making : effect of phytase addition . j . cereal science . 15 , 281 - 294 ; türk et al . ( 1996 ) reduction in the levels of phytate during wholemeal bread making ; effect of yeast and wheat phytases . j . cereal science . 23 , 257 - 264 . it has been shown that the phytase activity is p i repressed . the concentration of p i was shown to be in the millimolar range which is above the level known to induce repression , yoshida et al . ( 1989 ) function of the pho regulatory genes for repressible acid phosphatase synthesis in saccharomyces cerevisiae . mol . gen . genet . 217 , 40 - 46 . ( 10 mm p i is often used as “ high ” and 0 . 2 mm as “ low ”; ogawa et al . ( 2000 ) new components of a system for phosphate accumulation and polyphosphate metabolism in saccharomyces cerevisiae revealed by genomic expression analysis . mol . biol . cell . 11 , 4309 - 4321 ). hence , in the typical bread making situation the pho genes encoding pho5p , pho10p and pho11p are not very active and , as shown , phytase activity is not substantially expressed . furthermore , it has been shown that the ip6 degradation in cereals must be extensive to improve the iron absorption , brune et al . ( 1992 ) human iron absorption from bread : inhibiting effects of cereal fibre , phytate and inositol phosphates with different numbers of phosphate groups . j . nutr . 122 , 442 - 449 . as little as 0 . 5 μmol / g dry sample of ip6 and ip5 is inhibitory , sandberg et al . ( 1999 ) inositolphosphates with different number ofphosphate groups influence iron absorption in humans . am . j . clin . nutr . 70 , 240 - 246 . the data on the content of ip6 in dough were expressed per wet weight ( i . e . the dry content is higher ), and even at the end of the fermentation it exceeds iron inhibitory levels . the reduction in ip6 taking place during dough fermentation with commercial baker &# 39 ; s strains has been shown to be almost exclusively due to plant phytases present in the flour . a constitutively expressing yeast strain is desirable . it has further been demonstrated herein an apparent preference for ip6 over pnpp when these were given together . in nayaini et al ., nayini et al . ( 1984 ) the phytase of yeast . lebensm . wiss . u - technol . 17 , 24 - 26 . yeast phytase and phosphatase were purified from a total biomass extraction of a baker &# 39 ; s yeast cake . the distinction between phytase ( which is a phosphatase , for which one of the substrates is phytate ) and phosphatase activity was that a phosphatase was able to hydrolyze alpha - glycerophosphate but unable to hydrolyze ip6 . the purified phytase was assessed for substrate specific activity using 11 different phosphorous sources . phenyl - phosphate was one of these and the specific activity with this substrate was 40 times higher than for ip6 . the data set forth above , shows virtually no degradation of pnpp until ip6 is depleted . even at six times higher pnpp concentration the data indicate an inhibition of pnpp hydrolysis by ip6 . although the yeast phytase is not one single enzyme the activity was shown to be very precise in regard to the position on the inositol ring to be hydrolyzed , consistent with previous data on one commercial baker &# 39 ; s strain , türk et al . ( 2000 ) inositol hexaphosphate hydrolysis by baker &# 39 ; s yeast . capacity , kinetics , and degradation products . j . agric . food chem . 48 , 100 - 104 . this specificity , the so - called 3 - phytase activity , was true for all yeasts tested , including such different wild isolates of s . cerevisiae including those from fish intestine and clinical isolates of human pathogens , as well as for all deletion strains . accordingly , the modified strains can be used to efficiently produce highly specific isomers of lower inositol phosphates . in addition to the saccharomyces phytase work we are screening non - saccharomyces yeasts for the possibility of finding novel enzymes with desirable properties . tested species are primarily from tropical - and cactus origin . desired properties are high temperature optimum and / or a specificity yielding different isomers as compared with s . cerevisiae . so far , all tested species and strains have shown phytase activity . however , biochemical properties of the different enzymes have not yet been examined . in addition to s . cerevisiae , other yeast species that are capable of expressing phytase can be transformed to exhibit increased phytase activity . although the present invention has been shown and described with respect to several preferred embodiments thereof , various changes , omissions and additions to the form and detail thereof , may be made therein , without departing from the spirit and scope of the invention .	0
fig1 shows an enlarged side view of a guidewire made according to a very desirable variation of the inventive guidewire ( 100 ). the guidewire ( 100 ) is made up of the wire core formed of a flexible torqueable wire filament material , of the alloys described below , and has a total length typically between about 50 and 300 centimeters . the proximal section ( 102 ) preferably has a uniform diameter ( along its length ) of about 0 . 010 to 0 . 025 inches , preferably 0 . 010 to 0 . 018 inches . the relatively more flexible distal section ( 104 ) extends for 3 to 30 centimeters or more of the distal end of the guidewire ( 100 ). there may be a middle section ( 106 ) having a diameter intermediate between the diameter of the two portions of the wire adjoining the middle section . the middle section ( 106 ) may be continuously tapered , may have a number of tapered sections or sections of differing diameters , or may be of a uniform diameter along its length . if middle section ( 106 ) is of a generally uniform diameter , the guidewire core will neck down as is seen at ( 108 ). the distal section ( 104 ) of the guidewire ( 100 ) typically has an end cap ( 110 ), a fine wire coil ( 112 ), and a solder joint ( 114 ). the fine wire coil ( 112 ) may be radiopaque and made from materials including but not limited to platinum and its alloys . specific inventive variations of the distal section ( 104 ) are described below . the end cap ( 110 ) may be radiopaque to allow knowledge of the position of the coil ( 112 ) during the process of inserting the catheter and traversal of the guidewire through the vasculature . all or part of the guidewire proximal section ( 102 ) and middle section ( 106 ) and distal section ( 104 ) may be coated with a thin layer ( 116 ) of polymeric material to improve its lubricity without adversely affecting the flexibility or shapeability of the guidewire . fig2 shows a variation of the inventive guidewire which is a composite , e . g ., a distal portion of the guidewire core is produced of the specified alloy and the composite is of another material or configuration . in particular , the composite guidewire ( 140 ) is made up of a proximal section ( 142 ) that is a section of small diameter tubing of , e . g ., an appropriate stainless steel or high elasticity alloy such as those discussed elsewhere herein . the tubular proximal section ( 142 ) is attached by soldering or by gluing or by other joining method suitable for the materials involved at the joint ( 144 ) to a distal section ( 146 ) that extends to the distal end of the composite guidewire assembly ( 140 ). the distal tip ( 148 ) of the catheter assembly ( 140 ) may be of the same configuration as those otherwise described herein . the catheter assembly may be coated ( 150 ) with polymeric material , as desired . fig3 shows a partial cutaway of one embodiment of the distal section ( 104 ) and the distal end of the intermediate section ( 106 ). the metallic guidewire core is shown partially coated with polymer ( 116 ) and a malleable metal coating ( 118 ) on the tapered portion of the distal tip . the malleable metal may be selected from suitable radiopaque materials such as gold or other easily solderable materials such as silver , platinum , palladium , rhodium , and alloys of the above . the tip also includes a radiopaque coil ( 112 ) which is bounded on its proximal end by a solder joint ( 114 ) and is joined with the end of the guidewire at ( 110 ). the radiopaque coil ( 112 ) may be made of known suitable materials such as platinum , palladium , rhodium , silver , gold , and their alloys . preferred is an alloy containing platinum and a small amount of tungsten . the proximal and distal ends of coil ( 112 ) may be secured to the core wire by soldering . fig4 shows a partial cutaway of another embodiment of the distal section ( 104 ) of the inventive guidewire . in this embodiment , the metal guidewire core has a proximal tapered portion ( 120 ), a distal tapered section ( 122 ) with a solder joint ( 114 ) separating the two sections , and a constant diameter tip ( 124 ). the distal tip ( 124 ) may have constant diameter typically between about 0 . 002 and 0 . 005 inches , preferably about 0 . 003 inches . the distal tip ( 124 ) is preferably between about 1 and 5 cm in length , preferably about 2 cm but the portion of constant diameter extends for at least about 25 % of the distance between the solder joint ( 128 ) and the solder joint ( 114 ). this constant diameter section marginally stiffens the distal tip assembly for enhanced control . the entire distal section ( 104 ) desirably is between about 20 and 50 cm , preferably about 25 cm in length . the maximum diameter of the proximal tapered portion ( 120 ) of the guidewire core typically is between about 0 . 005 and 0 . 020 inches , preferably about 0 . 010 inches . the distal tapered portion ( 122 ) and distal tip ( 124 ) are again shown with a malleable metal coating ( 118 ) such that the distal tapered portion ( 122 ) and distal tip ( 124 ) stay bent upon forming by the physician . in this embodiment , the fine wire coil ( 112 ) is bounded on its proximal end by a solder joint ( 114 ) and on its distal end by an end cap ( 110 ). the end cap ( 110 ) is connected to the guidewire by means of a metallic ribbon ( 126 ). the ribbon ( 126 ) may be made of stainless steel , platinum , palladium , rhodium , silver , gold , tungsten , and their alloys or other materials which are plastic and that are easily soldered . the ribbon ( 126 ) is soldered to the fine wire coil ( 112 ) and to the distal tip ( 124 ) of the distal section ( 104 ) of the guidewire at a solder joint ( 128 ) such that the end cap ( 110 ) is secured against the fine wire coil ( 112 ). fig5 a and 5b show yet another inventive embodiment of the distal section ( 104 ) of the guidewire ( 100 ). fig5 a shows a side view , partial cutaway of the inventive guidewire . the fine wire coil ( 112 ) may be bounded by a polymer adhesive ( 136 ) that joins the coil ( 112 ) to the core wire and an end cap ( 110 ) and further secured to the guidewire core by a solder joint ( 128 ). in this embodiment , the distal section ( 104 ) of the guidewire again comprises a tapered portion ( 120 ) that is proximal to the polymer adhesive ( 136 ) and a tapered portion ( 122 ) that is distal to the polymer adhesive ( 136 ). the distal section ( 104 ) also comprises a smaller diameter portion ( 130 ) or &# 34 ; neck &# 34 ; that may be surrounded by optional inner coil ( 132 ). as may be seen from fig5 a , just distal of the neck ( 130 ) is a section which is larger in side view than is the neck . as may be seen from fig5 a , just distal of the neck ( 130 ) is a section which is larger in side view than is the neck . the inner coil ( 132 ) may be made of a suitable metallic material preferably that is easy to solder and preferably radiopaque . it is preferably platinum or stainless steel . one way to produce neck ( 130 ) is to flatten the distal portion of the guidewire ( 134 ) distal to the neck so that the resulting spade ( 134 ) is no longer of circular cross - section but rather is of rectangular shape . this may be more easily visualized in fig5 b since that figure shows a cutaway top view of the guidewire shown in fig5 a . as in above - described embodiments , the end cap ( 110 ) is secured to the guidewire by a metallic ribbon ( 126 ). the solder joint ( 128 ) secures the guidewire core to the inner helical coil ( 132 ) which secures the end cap ( 110 ) via the ribbon ( 126 ) and further secures the outer fine wire coil ( 112 ). this configuration is especially valuable for use with guidewire materials which are not easily solderable . the solder joint need not adhere to the guidewire and yet the inner coil ( 132 ), ribbon ( 126 ), and outer fine wire coil ( 112 ) all are maintained as a single integral unit and have no chance of slipping proximally or distally on the guidewire assembly . although the embodiment described with reference to fig5 a and 5b speaks generally of a guidewire made of a high elasticity alloy , materials for the guidewire and the ribbon such as stainless steel , platinum , palladium , rhodium and the like are suitable with that embodiment . fig6 is a partial side view of a midsection joint in the inventive guidewire . on many variations of the inventive guidewire , various sections of the core are joined by tapered sections such as seen at ( 160 ). this means that the guidewire core is significantly stiffer at the proximal end of the tapered joint ( 160 ). we have found that it is sometimes desirable to place grooves ( 162 ) in that proximal end to lower the overall stiffness of the guidewire at that junction and yet retain the columnar strength . this guidewire is typically used in a catheter which is made up of an elongate tubular member having proximal and distal ends . the catheter is ( again ) about 50 to 300 centimeters in length , typically between about 100 and 200 centimeters in length . often , the catheter tubular member has a relatively stiff proximal section which extends along a major portion of the catheter length and one or more relatively flexible distal sections which provide greater ability of the catheter to track the guidewire through sharp bends and turns encountered as the catheter is advanced through the torturous paths found in the vasculature . the construction of a suitable catheter assembly having differential flexibility along its length is described in u . s . pat . no . 4 , 739 , 768 . we have found that certain alloys , particularly ni - ti alloys , retain their super - elastic properties during traversal through the vasculature and yet are sufficiently pliable that they provide the physician using the guidewire with enhanced &# 34 ; feel &# 34 ; or feedback and yet do not &# 34 ; whip &# 34 ; during use . that is to say , as a guidewire is turned it stores energy during as a twist and releases it precipitously as it &# 34 ; whips &# 34 ; to quickly recover the stored stress . the preferred alloys do not incur significant unrecovered strain during use . we have also found that if the eccentricity of the wire , i . e ., the deviation of the cross - section of the guidewire from &# 34 ; roundness &# 34 ; ( particularly in the middle section ) is maintained at a very low value , the guidewire is much easier to steer or direct through the vasculature . the material used in the guidewires of this invention are of shape memory alloys which exhibit super - elastic / pseudo - elastic shape recovery characteristics . these alloys are known . see , for instance , u . s . pat . nos . 3 , 174 , 851 and 3 , 351 , 463 as well as 3 , 753 , 700 ; however , the &# 39 ; 700 patent describes a less desirable material because of the higher modulus of the material due to an increased iron content . these metals are characterized by their ability to be transformed from an austenitic crystal structure to a stress - induced martensitic ( sim ) structure at certain temperatures , and return elastically to the austenitic structure when the stress is removed . these alternating crystalline structures provide the alloy with its super - elastic properties . one such well - known alloy , nitinol , is a nickel - titanium alloy . it is readily commercially available and undergoes the austenite - sim - austenite transformation at a variety of temperature ranges between - 20 ° c . and 30 ° c . these alloys are especially suitable because of their capacity to elastically recover almost completely to the initial configuration once the stress is removed . typically there is little plastic deformation , even at relatively high strains . this allows the guidewire to undertake substantial bends as it passes through the body &# 39 ; s vasculature , and yet return to its original shape once the bend has been traversed without retaining any hint of a kink or a bend . however , the tips shown are often sufficiently plastic that the initial tip formation is retained . nevertheless , compared to similar stainless steel guidewires , less force need be exerted against the interior walls of the vessels to deform the guidewire of the invention along the desired path through the blood vessel thereby decreasing trauma to the interior of the blood vessel and reducing friction against the coaxial catheter . a guidewire , during its passage through the vasculature to its target site , may undertake numerous bends and loops . the desirably of enhancing the ease with which a guidewire may be twisted to allow the bent distal tip to enter a desired branch of the vasculature cannot be overstated . we have found that a major factor in enhancing such ease of use , that is , in enhancing the controllability of the guidewires is by controlling the eccentricity of the cross - section of the middle portion of the guidewire . we have found that by maintaining the middle portion of the guidewire ( 106 in fig1 ) to an eccentricity ratio of 1 ± 10 - 4 , the guidewire is significantly more controllable than those which fall outside this ratio . by &# 34 ; eccentricity &# 34 ;, we mean that at any point along the guidewire the ratio of the largest diameter at that cross - section to the smallest diameter of the wire at that cross - section . to achieve these results of high strength and enhanced control even while allowing feedback to the attending physician during use , we have found that the following physical parameters of the alloy are important . in a stress - strain test as shown on a stress - strain diagram such as that found in fig7 the stress found at the midpoint of the upper plateau ( up ) ( measured , e . g . at about 3 % strain when the test end point is about 6 % strain ) should be in the range of 75 ksi ( thousand pounds per square inch ) + 10 ksi and , preferably , in the range of 75 ksi ± 5 ksi . additionally , this material should exhibit a lower plateau ( lp ) of 25 ± 7 . 5 ksi , preferably 20 ± 2 . 5 ksi , measured at the midpoint of the lower plateau . the material preferably has no more than about 0 . 25 % residual strain ( rs ) ( when stressed to 6 % strain and allowed to return ) and preferably no more than about 0 . 15 % residual strain . the preferred material is nominally 50 . 6 %± 0 . 2 % ki and the remainder ti . the alloy should contain no more than about 500 parts per million of any of o , c , or n . typically such commercially available materials will be sequentially mixed , cast , formed , and separately co - worked to 30 - 40 %, annealed and stretched . by way of further explanation , fig7 shows a stylized stress - strain diagram showing the various parameters noted above and their measurement on that diagram . as stress is initially applied to a sample of the material , the strain is at first proportional ( a ) until the phase change from austentite to martensite begins at ( b ). at the upper plateau ( up ), the energy introduced with the applied stress is stored during the formation of the quasi - stable martensite phase or stress - induced - martensite ( sim ). upon substantial completion of the phase change , the stress - strained relationship again approaches a proportional relationship at ( c ). the stress is no longer applied when the strain reaches 6 %. the measured value ( up ) is found at the midpoint between zero and 6 % strain , i . e ., at 3 % strain . if another terminal condition of strain is chosen , e . g ., 7 %, the measured valued of ( up ) and ( lp ) would be found at 3 . 5 %. materials having high up values produce guidewires which are quite strong and allow exceptional torque transmission but cause a compromise in the resulting &# 34 ; straightness &# 34 ; of the guidewire . we have found that guidewires having high up values in conjunction with high lp values are not straight . these guidewires are difficult to use because of their tendency to &# 34 ; whip &# 34 ; as they are turned . again , that is to say , as a guidewire is turned it stores energy during as a twist and releases it quickly . the difficulty of using such a whipping guidewire should be apparent . materials having up values as noted above are suitable as guidewires . furthermore , materials having values of lp which are high , again , are not straight . lowering the value of lp compromises the ability of the guidewire to transmit torque but improves the ease with which a straight guidewire may be produced . lowering the lp value too far , however , results in a guidewire which , although round , has poor tactile response . it feels somewhat &# 34 ; vague &# 34 ; and &# 34 ; soupy &# 34 ; during its use . the lp values provided for above allow excellent torque transmission , straightness , and the valuable tactile response . the values of residual strain discussed above define a materials which do not kink or otherwise retain a &# 34 ; set &# 34 ; or configuration after stress during use as a guidewire . in each instance , the following procedure was used in producing the data displayed in the table which follows : commercial ni - ti alloy wires having a nominal composition of 50 . 6 % ni and the remainder ti , and diameters of 0 . 13 &# 34 ;, 0 . 16 &# 34 ;, or 0 . 18 &# 34 ; were stressed at room temperature . in each instance , values for transition temperature , ps , up , and lp were measured . additionally , several of the noted wires were introduced into a u - shaped tygon tube and spun to allow qualitative evaluation of the roundness and tactile response of the wires . comments on that response are also found in the following table . table______________________________________ comparative / invention up lp ps a * qualitative # ( c / i ) ( ksi ) ( ksi ) (%) t ° c . spin test______________________________________1 . sup . 1 i 74 . 48 31 . 45 0 . 06 - 11 smooth rotation , good feel2 . sup . 2 i 76 . 94 18 . 90 0 . 121 - 8 smooth rotation , good feel3 . sup . 3 i 71 . 92 24 . 06 0 . 10 13 . 5 smooth4 . sup . 4 c 78 . 24 58 . 82 0 . 20 - 9 very rough turning , whipped5 . sup . 5 c 63 . 80 13 . 25 0 . 2 12 . 5 smooth turning , mushy feel6 . sup . 6 c 58 . 30 13 . 31 0 . 0 - 12 turned roughly , mushy feel7 . sup . 7 c -- -- -- -- difficult to______________________________________ turn . sup . 1 commercially available from u . s . nitinol , inc . . sup . 2 commercially available from special metals , inc . . sup . 3 commercially available from shape metal alloys , inc . . sup . 4 commercially available as a plastic coated 0 . 13 &# 34 ; guidewire from fuji terumo , inc . . sup . 5 commercially available from iti . . sup . 6 commercially available from metal tek . sup . 7 stainless steel * measured at room temperature with no applied stress . these data describe both guidewires made according to the invention and comparative guidewires . additionally , they show that guidewire made from a typical stainless steel alloy is very difficult to turn using the qualitative test described above . as mentioned above , all or part of the guidewire core may be covered or coated with one or more layers of a polymeric material . the coating is applied typically to enhance the lubricity of the guidewire core during its traversal of the catheter lumen or the vascular walls . as noted above , at least a portion of the guidewire core may simply be coated by dipping or spraying or by similar process with such materials as polysulfones , polyfluorocarbons ( such as teflon ), polyolefins such as polyethylene , polypropylene , polyesters ( including polyamides such as the nylon &# 39 ; s ), and polyurethanes ; their blends and copolymers such as polyether block amides ( e . g ., pebax ). it is often desirable to utilize a coating such as discussed just above on the proximal portion of the guidewire and a coating such as discussed below on the more distal sections . any mixture of coatings placed variously on the guidewire is acceptable as chosen for the task at hand . the guidewire core may also be at least partially covered with other hydrophilic polymers including those made from monomers such as ethylene oxide and its higher homologs ; 2 - vinyl pyridine ; n - vinylpyrrolidone ; polyethylene glycol acrylates such as mono - alkoxy polyethylene glycol mono ( meth ) acrylates , including mono - methoxy triethylene glycol mono ( meth ) acrylate , mono - methoxy tetraethylene glycol mono ( meth ) acrylate , polyethylene glycol mono ( meth ) acrylate ; other hydrophilic acrylates such as 2 - hydroxyethylmethacrylate , glycerylmethacrylate ; acrylic acid and its salts ; acrylamide and acrylonitrile ; acrylamidomethylpropane sulfonic acid and its salts cellulose , cellulose derivatives such as methyl cellulose ethyl cellulose , carboxymethyl cellulose , cyanoethyl cellulose , cellulose acetate , polysaccharides such as amylose , pectin , amylopectin , alginic acid , and cross - linked heparin ; maleic anhydride ; aldehydes . these monomers may be formed into homopolymers or block or random copolymers . the use of oligomers of these monomers in coating the guidewire for further polymerization is also an alternative . preferred precursors include ethylene oxide ; 2 - vinyl pyridine ; n - vinylpyrrolidone and acrylic acid and its salts ; acrylamide and acrylonitrile polymerized ( with or without substantial crosslinking ) into homopolymers , or into random or block copolymers . additionally , hydrophobic monomers may be included in the coating polymeric material in an amount up to about 30 % by weight of the resulting copolymer so long as the hydrophilic nature of the resulting copolymer is not substantially compromised . suitable monomers include ethylene , propylene , styrene , styrene derivatives , alkylmethacrylates , vinylchloride , vinylidenechloride , methacrylonitrile , and vinyl acetate . preferred are ethylene , propylene , styrene , and styrene derivatives . the polymeric coating may be cross - linked using various techniques , e . g ., by light such as ultraviolet light , heat , or ionizing radiation , or by peroxides or azo compounds - such as acetyl peroxide , cumyl peroxide , propionyl peroxide , benzoyl peroxide , or the like . a polyfunctional monomer such as divinylbenzene , ethylene glycol dimethacrylate , trimethylolpropane , pentaerythritol di - ( or tri - or tetra -) methacrylate , diethylene glycol , or polyethylene glycol dimethacrylate , and similar multifunctional monomers capable of linking the monomers and polymers discussed above . polymers or oligomers applied using the procedure described below are activated or functionalized with photoactive or radiation - active groups to permit reaction of the polymers or oligomers with the underlying polymeric surface . suitable activation groups include benzophenone , thioxanthone , and the like ; acetophenone and its derivatives specified as : r 1 is h , r 2 is an alkoxy group including -- och 3 , -- oc 2 h 3 , r 3 is ph ; or r 1 = r 2 = an alkoxy group , r 3 is ph ; or r 1 = r 2 = an alkoxy group , r 3 is h ; or r 1 = r 2 = cl , r 3 is h or cl . the polymeric coating may then be linked 25 with the substrate using known and appropriate techniques selected on the basis of the chosen activators , e . g ., by ultraviolet light , heat , or ionizing radiation . crosslinking with the listed polymers or oligomers may be accomplished by use of peroxides or azo compounds such as acetyl peroxide , cumyl peroxide , propionyl peroxide , benzoyl peroxide , or the like . a polyfunctional monomer such as divinylbenzene , ethylene glycol dimethacrylate , trimethylolpropane , pentaerythritol di - ( or tri - or tetra -) methacrylate , diethylene glycol , or polyethylene glycol dimethacrylate , and similar multifunctional monomers capable of linking the polymers and oligomers discussed above is also appropriate for this invention . the polymeric coating may be applied to the guidewire by any of a variety of methods , e . g ., by spraying a solution or suspension of the polymers or of oligomers of the monomers onto the guidewire core or by dipping it into the solution or suspension . initiators may be included in the solution or applied in a separate step . the guidewire may be sequentially or simultaneously dried to remove solvent after application of the polymer or oligomer to the guidewire and crosslinked . the solution or suspension should be very dilute since only a very thin layer of polymer is to be applied . we have found that an amount of oligomer or polymer in a solvent of between 0 . 25 % and 5 . 0 % ( wt ), preferred is 0 . 5 to 2 . 0 % ( wt ), is excellent for thin and complete coverage of the resulting polymer . preferred solvents for this procedure when using the preferred polymers and procedure are water , low molecular weight alcohols , and ethers , especially methanol , propanol , isopropanol , ethanol , and their mixtures . other water miscible solvents , e . g ., tetrahydrofuran , methylene dichloride , methylethylketone , dimethylacetate , ethyl acetate , etc ., are suitable for the listed polymers and must be chosen according to the characteristics of the polymer ; they should be polar because of the hydrophilic nature of the polymers and oligomers but , because of the reactivity of the terminal groups of those materials , known quenching effects caused by oxygen , hydroxyl groups and the like must be recognized by the user of this process when choosing polymers and solvent systems . particularly preferred as a coating for the guidewire cores discussed herein are physical mixtures of homo - oligomers of at least one of polyethylene oxide ; poly - 2 - vinyl pyridine ; polyvinylpyrrolidone , polyacrylic acid , polyacrylamide , and polyacrylonitrile . the catheter bodies or substrates are preferably sprayed or dipped , dried , and irradiated to produce a polymerized and crosslinked polymeric skin of the noted oligomers . the lubricious hydrophilic coating is preferably produced using generally simultaneous solvent removal and crosslinking operations . the coating is applied at a rate allowing &# 34 ; sheeting &# 34 ; of the solution , e . g ., formation of a visibly smooth layer without &# 34 ; runs &# 34 ;. in a dipping operation for use with most polymeric substrates including those noted below , the optimum coating rates are found at a linear removal rate between 0 . 25 and 2 . 0 inches / sec , preferably 0 . 5 and 1 . 0 inches / sec . the solvent evaporation operations may be conducted using a heating chamber suitable for maintaining the surface at a temperature between 25 ° c . and the glass transition temperature ( t g ) of the underlying substrate . preferred temperatures are 50 ° c . to 125 ° c . most preferred for the noted and preferred solvent systems is the range of 75 ° to 110 ° c . ultraviolet light sources may be used to crosslink the polymer precursors onto the substrate . movement through an irradiation chamber having an ultraviolet light source at 90 - 375 nm ( preferably 300 - 350 nm ) having an irradiation density of 50 - 300 mw / cm 2 ( preferably 150 - 250 mw / cm 2 ) for a period of three to seven seconds is desired . passage of a guidewire core through the chamber at a rate of 0 . 25 to 2 . 0 inches / second ( 0 . 5 to 1 . 0 inches / second ) in a chamber having three to nine inches length is suitable . when using ionizing radiation , a radiation density of 1 to 100 krads / cm 2 ( preferably 20 to 50 krads / cm 2 ) may be applied to the solution or suspension on the polymeric substrate . exceptional durability of the resulting coating is produced by repetition of the dipping / solvent removal / irradiation steps up to five times . preferred are two to four repetitions . we have found that it is often desirable to incorporate a &# 34 ; tie &# 34 ; layer as a coating between the outer polymeric surface and the guidewire core to enhance the overall adhesion of the outer polymeric surface to the core . of course , these materials must be able to tolerate the various other solvents , cleaners , sterilization procedures , etc . to which the guidewire and its components are placed during other production steps . choice of materials for such tie layers is determined through their functionality . specifically , the materials are chosen for their affinity or tenacity to the outer polymeric lubricious or hydrophilic coating . clearly , the tie layer material must be flexible and strong . the material must be extrudable and preferably easily made into shrinkable tubing for mounting onto the guidewire through heating . we have found that various nylon &# 39 ; s , polyethylene , polystyrene , polyurethane , and preferably polyethylene terephthalate ( pet ) make excellent tie layers . these tubing materials may be also formulated to include radio opaque materials such as barium sulfate , bismuth trioxide , bismuth carbonate , tungsten , tantalum or the like . as noted above , one readily achievable manner of applying a tie layer is by heat - shrinking the tubing onto the guidewire . the guidewire core is simply inserted into a tubing of suitable size -- often with a small amount of a &# 34 ; caulking &# 34 ; it either end to seal the tubing from incursion of fluids or unsterile materials from beneath the tubing . the tubing is cut to length and heated until it is sufficiently small in size . the resulting tubing tie layer desirably is between about 0 . 0025 and 0 . 015 inches in thickness . the thinner layers are typically produced from polyurethane or pet . the layer of lubricious polymer is then placed on the outer surface of the shrunk tubing . another procedure for preparing or pretreating guidewires prior to receiving a subsequent coating of a polymer , preferably a polymer which is lubricious , biocompatible , and hydrophilic , is via the use of a plasma stream to deposit a hydrocarbon or fluorocarbon residue . the procedure is described as follows : the guidewire core is placed in a plasma chamber and cleaned with an oxygen plasma etch . the guidewire core is then exposed to a hydrocarbon plasma to deposit a plasma - polymerized tie layer on the guidewire core to complete the pretreatment . the hydrocarbon plasma may comprise a lower molecular weight ( or gaseous ) alkanes such as methane , ethane , propane , isobutane , butane or the like ; lower molecular weight alkenes such as ethene , propene , isobutene , butene or the like or ; gaseous fluorocarbons such as tetrafluoromethane , trichlorofluoromethane , dichlorodifluoromethane , trifluorochloromethane , tetrafluoroethylene , trichlorofluoroethylene , dichlorodifluoroethylene , trifluorochloroethylene and other such materials . mixtures of these materials are also acceptable . the tie layer apparently provides c -- c bonds for subsequent covalent bonding to the outer hydrophilic polymer coating . preferred flow rates for the hydrocarbon into the plasma chamber are in the range of 500 c . c ./ min . to 2000 c . c ./ min . and the residence - time of the guidewire in the chamber is in the range of 1 - 20 minutes , depending on the chosen hydrocarbon and the plasma chamber operating parameters . power settings for the plasma chamber are preferably in the range of 200 w to 1500 w . a tie layer of plasma - produced hydrocarbon residue having a thickness on the order of 10 å thick is disposed between core and coating . this process typically produces layers of hydrocarbon residue less than about 100 å in thickness , and more typically less than about 100å . tie layer effectively bonds the outer layer to the guidewire core while adding very little additional bulk to the guidewire . guidewires made according to this invention therefore avoid the size and maneuverability problems of prior art guidewires . the pretreated guidewire may be coated by a polymer using a procedure such as described above . for example , the pretreated guidewire may be dipped in a solution of a photoactive hydrophilic polymer system , i . e ., a latently photoreactive binder group covalently bonded to a hydrophilic polymer . after drying , the coated guidewire is cured by exposing it to uv light . the uv light activates the latently reactive group in the photoactive polymer system to form covalent bonds with crosslinked c -- c bonds in the hydrocarbon residue tie layer . the dipping and curing steps are preferably repeated often enough , typically twice , to achieve the appropriate thickness of the hydrophilic coating layer . one highly preferred variation of the invention involves a guidewire with metal core , preferably 0 . 010 to 0 . 025 &# 34 ; thick stainless steel or nitinol . the exterior surface of guidewire is a biocompatible coating of a polyacrylamide / polyvinylpyrrolidone mixture bonded to a photoactive binding agent . the preferred coating is made from a mixture of bio - metric systems pa03 and pv05 ( or pv01 ) binding systems according to the examples below . the photoactive hydrophilic polymer system of this preferred embodiment is a mixture of bio - metric systems pa03 polyacrylamide / binder system and bio - metric systems pv05 polyvinylpyrrolidone system . the polyacrylamide system provides lubricity , and the polyvinylpyrrolidone system provides both lubricity and binding for durability . the exact proportions of the two systems may be varied to suit the application . as an alternative , however , the hydrophilic biocompatible coating may be polyacrylamide alone , polyvinylpyrrolidone alone , polyethylene oxide , or any suitable coating known in the art . in addition , a coating of heparin , albumin or other proteins may deposited over the hydrophilic coating in a manner known in the art to provide additional biocompatibility features . the guidewire or other device may be cleaned by using an argon plasma etch in place of the oxygen plasma etch . the thickness of the plasma - polymerized tie layer may also vary without departing from the scope of this invention . the following examples are further illustrative of the articles and methods of this invention . the invention is not limited to these examples . a 0 . 016 &# 34 ; diameter nitinol guidewire was placed in a plasma etch mk ii plasma chamber and cleaned with an oxygen plasma for 10 minutes . methane flowing at a rate of 2000 c . c ./ min . was admitted into the chamber , and the chamber operated at a power setting of 400 w for 2 minutes to deposit a hydrocarbonaceous residue onto the surface of the wire . all but approximately six inches of the wire was dipped in a polyvinylpyrrolidone / polyacrylamide ( pvp / pa ) photocrosslinkable solution of a mixture of 67 % bsi pv01 and 33 % bsi pa03 . the coated guidewire was then dried and exposed to an ultraviolet light ( 325 nm .) for 8 seconds . the dipping , drying , and exposing steps were repeated twice . when wetted , the resulting wire felt lubricious and required less force to pull through an 0 . 018 &# 34 ; id catheter than an uncoated wire . a 0 . 016 &# 34 ; diameter nitinol guidewire was placed in a plasma etch mk ii plasma chamber and cleaned with an oxygen plasma for 10 minutes . methane flowing at a rate of 1500 c . c ./ min . was admitted into the chamber , and the chamber was operated at a power setting of 600 w for 5 minutes to plasma - treat the methane into a hydrocarbonaceous residue on the surface of the wire . all but approximately six inches of the wire was dipped in a polyvinylpyrrolidone / polyacrylamide ( pvp / pa ) photocrosslinkable solution consisting essentially a mixture of 50 % bsi pv01 and 50 % bsi pa03 . the coated guidewire was then dried and exposed to an ultraviolet light ( 325 nm .) for 8 seconds . the dipping , drying , and exposing steps were repeated . when wetted , the resulting wire felt lubricious and required less force to pull through an 0 . 018 &# 34 ; id catheter than an uncoated wire . a 0 . 016 &# 34 ; diameter nitinol guidewire was placed in a plasma etch mk ii plasma chamber and cleaned with an oxygen plasma for 10 minutes . ethane flowing at a rate of 900 c . c ./ min . was admitted into the chamber , and the chamber was operated at a power setting of 600 w for 10 minutes to deposit a hydrocarbon residue onto the surface of the wire . all but approximately six inches of the wire was dipped in a polyvinylpyrrolidone / polyacrylamide ( pvp / pa ) photocrosslinkable solution of a mixture of 33 % bsi pv01 and 67 % bsi pa03 . the coated guidewire was then dried and exposed to an ultraviolet light ( 325 nm .) for 8 seconds . the dipping , drying , and exposing steps were repeated twice . when wetted , the resulting wire felt lubricious and required less force to pull through an 0 . 01811 id catheter than an uncoated wire . although preferred embodiments of the present invention have been described , it should be understood that various changes , adaptations , and modifications may be made therein without departing from the spirit of the invention and the scope of the claims which follow .	0
reference will now be made to the drawing figures to describe the present invention in detail . referring to fig1 - 5 , a cable connector assembly 100 in accordance with the present invention comprises a cover 1 , a pair of metal screws 2 , a pair of insulators 3 , an electrical connector 4 , a cable 5 connected to the electrical connector 4 , and an insulative block 6 . the cover 1 is made of metallic material , and comprises a top cover 11 and a bottom cover 12 assembled to the top cover 11 along an upper - to - lower direction thereof . the electrical connector 4 is compatible with digital visual interface ( dvi ) transmitting protocol , and includes an insulative housing 40 , a plurality of terminals 41 retained in the insulative housing 40 , and a metal shell 42 covering the insulative housing 40 . the insulative housing 40 is sandwiched between the pair of insulators 3 in a laterally direction perpendicular to the upper - to - lower direction . the pair of insulators 3 press forwardly against the insulative housing 40 for preventing the electrical connector 4 from moving rearwardly . the shell 42 includes a base 421 , a mating portion 422 protruding forwardly from the base 421 , and two opposite flanges 423 protruding laterally from the base 421 respectively . the mating portion 422 forms a font mating port 424 for receiving a mating connector ( not shown ). the flanges 423 each defines a through securing hole 425 locking with the screw 2 . the terminals 41 each defines a soldering tail 411 soldered to the cable 5 . a retaining space 10 is surrounded by the cover 1 and the pair of insulators 3 to retain the electrical connector 4 and the cable 6 therein . the top cover 11 includes a rectangle shape top wall 111 , a rear wall 112 bending downwardly from the top wall 111 , a pair of side walls 113 bending downwardly from the top wall 111 and connected to the rear wall 112 , a pair of first positioning posts 118 , a pair of enlarging portions 114 which extending downwardly from the top wall 111 , and a pair of second positioning posts 115 extending downwardly from the enlarging portions 114 respectively . the top cover 11 has a first opening 1131 disposed among the top wall 111 and the side walls 113 , a second opening 1121 opposited to the first opening 1131 . the first opening 1131 extends into the top wall 111 and the side walls 113 , but not passes through the top wall 111 and the side walls 113 . the second opening 1121 passes through the rear wall 112 . the openings 1121 , 1121 are in communication with the retaining space 10 . the pair of side walls 113 each defines a cutout 1132 passing therethrough into the retaining space 10 and adapted to retain the insulator 3 . the first positioning posts 118 each defines a positioning hole 116 , and has a same dimension with the enlarging portion 114 . the first positioning posts 118 and the second positioning posts 115 are disposed on four apexes of a rectangle at end of the top wall 111 respectively . the second positioning posts 115 each defines a plurality of vertical ribs 1151 on an outer surface thereof . the top cover 11 defines a first vertical reinforce wall 1111 connected to the first positioning post 118 , the top wall 111 and the side wall 113 , and a second vertical reinforce wall 1112 connected to the enlarging portion 114 , the top wall 111 and the side wall 113 . the bottom cover 12 is similar to the top cover 11 , and includes a pair of first positioning posts 124 corresponding to the pair of second positioning posts 115 of the top cover 111 , and a pair of second positioning posts 125 corresponding to the pair of first positioning posts 118 respectively . the first positioning posts 124 each defines a positioning hole 126 adapted to retain the second positioning post 115 therein . the second positioning posts 125 each is retained into the positioning hole 116 of the first positioning 118 of the top cover 11 . the bottom cover 12 includes a bottom wall 121 opposited to the top wall 111 of the top cover 11 , a pair of side walls 123 and a rear wall 122 all of which bend upwardly from the bottom wall 121 , and an enlarging portion 128 extending upwardly from the bottom wall 121 to the second positioning post 125 . the pair of side walls 123 each defines a cutout 1232 formed together with the cutout 1132 of the top cover 11 to form a chamber for retaining the insulator 3 to prevent the insulator 3 from moving along the front - to - rear direction and the upper - to - lower direction . the pair of side walls 123 each combines with the side wall 113 of the top cover 11 to form a pair of circular holes 1230 passing through the side walls 113 , 123 along the front - to - rear direction . the cutout 1132 is disposed between the pair of circular holes 1130 . the insulators 3 are sandwiched between the top cover 11 and the bottom cover 12 along the upper - to - lower direction , and each defines a locating hole 31 passing therethrough along the front - to - rear direction , a first retaining slot 32 disposed at a front end thereof , a second retaining slot 33 disposed at a rear end thereof . the first retaining slot 32 and the second retaining slot 33 extend through the insulator 3 along the upper - to - lower direction respectively . the first retaining slot 32 defines a first gap 320 extending to exterior of the insulator 3 . the second retaining slot 33 defines a second gap 330 extending to exterior of the insulator 3 . the locating hole 31 is disposed in an outer side of the first retaining slot 32 and the second retaining slot 33 . the locating hole 31 is divided into a front locating hole 311 and a rear locating hole 312 whose dimension is wider than the front locating hole 311 . the screws 2 each includes a middle portion 21 received into the locating hole 31 , a thread portion 22 locking in the securing hole 425 of the shell 42 of the electrical connector 4 and protruding forwardly beyond the flange 423 for latching with the mating connector , and a rotating portion 23 disposed on a rear end thereof for rotating the screw 2 . the middle portion 21 defines a circular ring 210 surrounding an outer side wall thereof and received in the rear locating hole 312 of the insulator 3 for preventing the screw 2 from over - moving along the front - to - rear direction . the cable 5 includes a strain relief portion 51 on a front end thereof and a plurality of wires ( not shown ) connected to the soldering tails 411 of the terminals 41 of the electrical connector 4 . the block 6 is insert molded with the soldering tails 411 . the strain relief portion 51 defines a cavity 510 extending forwardly therethrough to retain the block 6 therein , and a rear plate 511 enclosing the cavity 510 . the block 6 is sandwich between the pair of insulators 3 in the laterally direction . the rear plate 511 is located in the retaining space 10 and is pressed against by an inner wall of the rear walls 112 , 122 of the cover 1 for preventing the cable 5 from breaking away from the electrical connector 4 . after the cable connector assembly 100 is assembled , the second positioning posts 115 , 125 of one of the top cover 11 and the bottom cover 12 that are retained into the positioning holes 126 , 116 of the first positing posts 118 , 124 of the other one of the top cover 11 and the bottom cover 12 respectively . the first positioning posts 118 , 128 presses against the corresponding enlarging portions 114 , 124 which are connected to the second positioning post 115 , 125 along the upper - to - lower direction . the enlarging portions 114 , 124 and the first positioning post 118 , 128 of one of the top cover 11 and the bottom cover 12 are retained in the first locating slot 32 and the second locating slot 33 of the insulators 3 respectively to ensure the top cover 11 combined with the bottom cover 12 reliably . it is to be understood , however , that even though numerous characteristics and advantages of the present invention have been set forth in the foregoing description , together with details of the structure and function of the invention , the disclosure is illustrative only , and changes may be made in detail , especially in matters of shape , size , and arrangement of parts within the principles of the invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed .	7
the compounds of the invention comprise tungsten oxide layers which have a lewis base inserted between the metal oxide layers and directly coordinated to tungsten . unlike the metal chalcogenides employed in intercalation compounds , commercially obtainable h 2 wo 4 may be used as a starting material without any pretreatment such as heat annealing or a preliminary interaction with ammonia . lewis bases which form the present layered compounds are those which have heterocyclic nitrogen donors and oxygen donors , preferably 5 - and 6 - membered heterocyclic amine donors and especially 6 - membered heterocyclic amine donors . preferred nitrogen donors are pyridines having the formula ## str1 ## where r is hydrogen ; halogen ; c 1 - c 20 , preferably c 1 - c 10 aliphatic ; c 6 - c 10 aryl , preferably phenyl which may be substituted in the 4 - position by halogen or c 1 - c 6 alkyl ; c 7 - c 20 aralkyl ; or &# 39 ; or sr &# 39 ; where r &# 39 ; is c 1 - c 6 alkyl . examples are ## str2 ## other 5 - and 6 - membered heterocyclic amines which may form layered compounds include pyridazine , pyrimidine , pyrazine , triazine , n - substituted oxazine , n - substituted imidazole , oxazole and thiazole . a lewis base which is a bidentate heterocyclic nitrogen ligand forms compounds of the formula l 1 / 2 wo 3 , preferably compounds of the formulae ## str3 ## where n is 0 or 1 and r 2 is methylene ; alkylene , alkene or alkylene of 2 - 6 carbon atoms ; c 6 - c 10 arylene , preferably paraphenylene ; c 7 - c 14 aralkylene , preferably ## str4 ## where p is from 1 to 6 ; oxygen ; or sulfur . the bidentate ligands form connecting linkages between separate tungsten oxide layers . oxygen donors may be amine oxides , triorganophosphates , phosphine oxides or sulfoxides . m . camelot in revue de chemie minerale , 6 , 853 - 883 ( 1969 ), p . 854 reports that it is remarkable that tungsten oxide is unlike cro 3 , moo 3 and uo 3 in that wo 3 will not react with pyridine even at very high temperatures ( 300 ° c . or more ). it has been discovered that amines such as pyridine can be reacted with h 2 wo 4 in the presence of molecular sieves . in general , wo 3 layered compounds may be prepared by a process which comprises placing h 2 wo 4 , lewis base and molecular sieve in a tube , evacuating and sealing the tube , and heating at temperatures of from about 100 ° to 400 ° c . for up to 40 days . the desired product may then be isolated by cooling and opening the tube and removing the molecular sieves . the amount of amine is not critical and a stoichiometric amount or an excess may be present . molecular sieves should be activated prior to use . preferred reaction temperatures and times are from about 100 ° to 250 ° c . for from about 1 to 20 days . a general reaction is described as follows . ## str5 ## the water produced is taken up by molecular sieves . the layered compounds of the present invention do possess the covalent bonding characteristic of molecular coordination compounds . they are not , however , molecular coordination compounds since they possess 2 - dimensional extended lattices . nor are they intercalation compounds such as are reported in u . s . pat . no . 3 , 766 , 064 . the latter compounds are generally the result of electrostatic interactions wherein the nitrogen atom of the intercalated guest is equidistant between the layers of the intercalation host and the arrangement of host atoms within the lattice is essentially unchanged . rather , the present layered compounds possess a unique physical structure as shown in fig1 which is a schematic diagram of the bonding arrangement in ## str6 ## as illustrated in this figure , pyridine occupies space between the tungsten oxide layers and bonds directly to a w atom . the overall layered structure is shown in fig2 and 3 which depict the 001 projection of the structure of ## str7 ## showing van der waals packing of the ## str8 ## molecules as designated by the cross - hatching and the 110 projection of ## str9 ## respectively . the nature of l determines the separation of wo 3 layers , e . g ., ( pyridine ) wo 3 has an interlayer separation of 11 . 5 a , and ( 4 - phenylpyridine ) wo 3 a separation of about 20 . 7 a . as can be seen from the figures , the layers are composed of wo 5 l octahedra sharing corner oxygen atoms . the lewis base is trans to the single unshared oxygen . based on x - ray studies , it can be determined that in order for the lewis base to bond to w atoms , it must meet the steric requirement such that the cross - sectional area of the lewis base perpendicular to an axis running through the lewis base - w covalent bond is less than about 30 ( a ) 2 . thus bulky lewis bases such as triethylamine or triphenylphosphine will not form layered compounds according to the invention , because of the above - mentioned structural considerations . when a bidentate lewis base is incorporated into the lwo 3 structure , separate tungsten oxide layers can be bound together . for example , when 4 , 4 &# 39 ;- bipyridine is employed , each separate pyridine ring can bind to tungsten atoms in adjacent tungsten oxide layers , thus forming a composition wherein individual layers within the overall lwo 3 crystal structures are bound together by bridging 4 , 4 &# 39 ;- bipyridine molecules . this is shown schematically in fig4 . these bridged layered compounds are unique in that they exhibit a higher degree of thermal stability than the corresponding unbridged compounds . the pure lwo 3 product shows no lines characteristic of the starting materials in an x - ray powder pattern analysis . the x - ray analysis further demonstrates that the interlayer distance correlates with the size of specific lewis bases between the layers . thermogravimetric analysis indicates the loss of lewis base corresponding to a 1 : 1 or 2 : 1 moo 3 : l composition . the 2 : 1 ratio reflects a bridging ligand such as 4 , 4 &# 39 ;- bipyridine . layered compounds according to the invention possess unique properties . first , they have a 2 - dimensionally bonded layered structure with tungsten in its highest oxidation state . their color is pale in contrast to the dark opaque colors of intercalation compounds of wo 3 , which compounds have 3 - dimensional structures . the present layered compounds are useful in electrochromic devices and as lithium battery cathodes . the preparation of wo 3 ( pyridine ) is described as follows . h 2 wo 4 was heated in a sealed tube with an excess of dry pyridine in the presence of activated 4 a molecular sieves at 150 ° c . for 7 - 14 days . the resulting pale green solid was shown by thermogravimetric ( tga ) and chemical analysis to contain approximately one equivalent of pyridine per wo 3 . the x - ray powder diffraction pattern could be fully indexed in the tetragonal system with lattice parameters a = 5 . 29 a and c = 11 . 47 a . the infrared spectrum contained bands at 1647 , 1605 , 1572 , 1488 , 1446 , 1239 , 1220 , 1154 , 1141 , 1063 , and 1042 cm - 1 which are typical of coordinated pyridine . the pyridine is quantitatively lost upon heating to 275 ° c . the high temperature required to release the pyridine ( boiling point 115 ° c .) indicates that it is strongly bound into the lattice , rather than physically adsorbed . a layered compound containing dabco ( 1 , 4 - diazabicyclo [ 2 . 2 . 2 ] octane = ## str10 ## is prepared by heating h 2 wo 4 in a sealed tube with an excess of sublimed dabco in dry toluene in the presence of activated 4 a molecular sieves at 150 ° c . for 18 hr . the resulting blue - green solid product was shown by tga to contain 0 . 50 equivalent of dabco per mole of wo 3 . the dabco is lost in a sharp exothermic reaction upon heating to 235 ° c . in oxygen . since dabco itself sublimes below 100 ° c ., the weight loss at 235 ° c . indicates its incorporation into the lattice . x - ray powder diffraction showed broad low angle lines at d spacings of 11 . 0 and 9 . 4 a . the incorporation of 4 , 4 &# 39 ;- bipyridine into the layered structure of wo 3 is accomplished by heating h 2 wo 4 in a sealed tube with excess sublimed 4 , 4 &# 39 ;- bipyridine in dry toluene in the presence of activated 4 a molecular sieves at 150 ° c . for 15 days . the green solid product had incorporated 0 . 20 equivalent of 4 , 4 &# 39 ;- bipyridine that was lost in the temperature range 200 °- 500 ° c . in the tga analysis . a powder x - ray diffraction diagram showed strong lines at 11 . 6 , 3 . 73 , and 2 . 64 a d spacings and less intense lines at 5 . 69 , 3 . 36 , and 3 . 12 a . this example is directed to a layered compound containing a 4 - substituted pyridine , i . e . 4 - phenylpyridine . h 2 wo 4 was heated in a sealed tube with excess dry 4 - phenylpyridine , toluene and activated 4 a molecular sieves at 180 ° c . for about 4 days . thermogravimetric analysis of the blue - colored product showed a weight loss in the temperature range 250 °- 450 ° c . corresponding to 0 . 5 mole 4 - phenylpyridine per mole wo 3 . powder x - ray diffraction indicated a layer separation of 20 . 7 a . an example of the incorporation of a 5 - membered heterocyclic amine into the wo 3 layered structure is wo 3 ( n - methylimidazole ). the preparation of this layered compound was achieved by heating h 2 wo 4 in a sealed tube with excess n - methylimidazole and activated molecular sieves for 4 days at 160 ° c . the resulting green solid product showed a weight loss in the temperature range 100 °- 450 ° c . corresponding to 0 . 87 mole n - methylimidazole per mole wo 3 . powder x - ray diffraction showed a broad low angle peak at 10 . 5 - 11 . 0 a . the same reaction run at 125 ° c . for 22 days gave a similar product that contained 0 . 76 equivalent n - methylimidazole per wo 3 .	2
reference will now be made in detail to various embodiments of the apparatus utilized with present invention , one or more examples of which are illustrated in the drawings . each example is provided by way of explanation of the invention , and not meant as a limitation of the invention . for example , features illustrated or described as part of one embodiment can be used in another embodiment to yield still a further embodiment . it is intended that the present invention cover such modifications and variations coming within the scope and spirit of the invention . although a wide variety of webs may be used in the present invention , such as , for example , spundbonded webs , meltblown webs , films , staple fiber webs , or multilayer nonwoven laminates of such webs , side - by - side bicomponent spunbonded webs were utilized in the examples presented herein . other webs which are suitable for use in the present invention include meltblown fiber webs having a basis weight between about 0 . 3 ounces per square yard ( osy ) and about 4 osy , and even more desirably between about 0 . 3 osy and about 1 osy . with respect to meltblown fiber webs , and as a specific example , both the polypropylene and the polyethylene desirably have a number average molecular weight ( or mn ) of between about 20 , 000 and 40 , 000 and a melt - flow rate of at least 400 grams of polymer at 230 degrees c . in ten minutes , measured per astm d1238 , and even more desirably between about 800 and 1000 grams of polymer at 230 degrees c . in ten minutes , measured per astm d1238 . spunbonded fiber webs suitable for use with the present invention desirably have a basis weight between about 1 ounces per square yard ( osy ) ( or about 34 grams per square meter or gsm ) and about 10 osy ( about 340 gsm ). with respect to bicomponent spunbonded fiber webs , and as a specific example , both the polypropylene and the polyethylene desirably have a mn of between about 100 , 000 and 200 , 000 and a melt - flow rate between about 20 and 36 grams of polymer at 230 degrees c . in ten minutes measured per astm d1238 . according to the present invention , a nonwoven web 10 is electret treated with an electret treatment unit 12 shown in fig1 the electret treatment unit 12 having a first electret treatment station 14 and a second electret treatment station 16 . the first and second electret treatment stations are positioned in series . the nonwoven web 10 moves through the treatment stations 14 and 16 in the direction indicated by the arrows . the first and second treatment stations 14 and 16 each include a bias roll 18 and 24 , respectively . the bias roll serves both as an electrode and a mechanism for transfer of the web 10 into and out of the electret treatment unit 12 . each treatment station , an embodiment of which is schematically depicted in fig1 also includes an anode . in the embodiment depicted in fig1 the anode is a charge bar which is electrically configured as a parallel device , an embodiment of the parallel device charge bar being depicted in fig2 at 22 . although a variety of charge bars 22 which are electrically configured as a parallel device may be utilized in the present invention , the charge bar 22 may include a plurality of sets 20 of four pins 36 , extending from a resistor 34 . the pins 36 in each set 20 are generally spatially aligned in a parallel fashion with respect to each other . a wide variety of pin spacings may be utilized in the present invention , and , in some devices , the pins may be spaced apart from each other by at least 0 . 125 inches ( 0 . 3175 cm ). in other devices , may be spaced apart from each other by 0 . 25 inches ( 0 . 635 cm ). the pins within each particular set 20 are electrically connected in series to the resistor 34 . each resistor 34 extends from a power bus 32 . each set of pins 20 and the associated resistor 34 is electrically connected in parallel to the power bus 32 . such charge bars are frequently utilized to adhere , or “ pin ” films together by applying an electrostatic charge to a first film which will cause the first film to be attracted to and adhere to a second film . a parallel device charge bar suitable for use in the present invention is a chargemaster ® pinner ™ arc resistant charge bar which is available from simco of hatfield , pa . in the embodiment depicted in fig1 four charge bars are utilized in each treatment station although any number of charge bars may also be utilized . as shown in fig1 the pins 36 of the parallel device charge bar 22 are positioned proximate to and spaced equidistant from the nonwoven web 10 , and are separated from the web 10 by a gap . in selected embodiments , the gap between the nonwoven web 10 and the pins 36 of each parallel device charge bar 22 is roughly uniform for each parallel device charge bar 22 . this may be accomplished in several ways , including positioning the charge bars radially outwardly from the bias roll , as depicted in fig1 . alternately , as depicted in fig3 at least one parallel device charge bar 22 is disposed on one side of the nonwoven web 10 while a bias plate 30 is disposed on the other side of the nonwoven web 10 . alternate embodiments of the present invention include a wide variety of configurations of the charge bars 22 and a biasing device such as the bias plate and bias roll described above . an additional alternate configuration of treatment station is depicted in fig4 wherein two charge bars 22 and 28 are positioned on opposite sides of the nonwoven web 10 . high loft and low loft bicomponent spunbonded nonwoven webs described above were subjected to electret treatment on - line by the above - described apparatus . in selected embodiments , the electret treatment may be performed as part of other on - line operations such as , for example , converting of the web into particular products , or may be performed off - line . in some of the examples which follow , a wire ionizer or ( series device ionizer ) was utilized in place of the parallel device charge bar for the purposes of comparison . the series device wire ionizer is configured differently than the parallel device charge bar and is essentially a thin wire positioned within a channel frame and maintained under tension . like the parallel device charge bar , the series device wire ionizer is positioned within the electret treatment station so as to span the width of the web or film passing through the electret treatment station . such a wire ionizer is described in u . s . pat . no . 5 , 627 , 376 to jaisinghani et al ., which is hereby incorporated by reference . for each ionizing device , specifically the parallel device charge bars and the series device wire ionizers , the polarity of the ionizing device was maintained positive and the polarity of the bias rolls was maintained negative relative to earth ground , although alternate configurations of polarity may be utilized . fig5 depicts the ionizing current as a function of applied voltage during the electret treatment of a 2 . 0 osy high loft side - by - side bicomponent spunbonded web using the wire ionizer as described above . notably , the ionizing current rises very rapidly just above 10 kv . the rise in current continues until the arcing point , indicated by the word “ arcing ” on the graph , is reached at about 15 kv . the maximum current which could be achieved before arcing was approximately 1 ma . in contrast to the current - voltage characteristic ( i - v ) for series device wire ionizers depicted in fig5 the ionizing current measured for the parallel device charge bar , depicted in fig6 increases monotonically over the entire range of the applied voltage . in addition , the applied voltage can be increased significantly over the voltage used with series device wire ionizers without arcing . for example , the maximum voltage shown in fig6 is about 25 kv . however , in contrast to the wire ionizers , no arcing was detected at this higher field in processes utilizing charge bars . the maximum ionizing current achieved in processes utilizing charge bars was 3 ma , roughly three - times higher than the maximum ionizing current achieved with wire ionizers . the maximum ionizing current of 3 ma was limited by the power supply utilized . higher ionizing currents may be achieved with different power supplies . additionally , it is important to control the relative humidity and air temperature as variables in the electret treatment process . as used herein , the term relative humidity is defined as the ratio of the partial pressure of water in air to its saturation vapor pressure at a given temperature . thus , a relative humidity of 20 % at 65 degrees f . is different than a relative humidity of 20 % at 80 degrees f . in many processes , a relative humidity of about 60 % at 60 degrees f . to about 50 % at 90 degrees f . is suitable for electret treating a variety of materials by the apparatus described herein . in some processes , a range of about 40 % at 60 degrees f . to about 30 % at 90 degrees f . is desirable . in selected processes , a range of about 30 % at 60 degrees f . to about 20 % at 90 degrees f . is desirable . samples of a high loft bicomponent spunbonded webs were electret treated with either series device wire ionizers or parallel device charge bars . the side - by - side bicomponent spunbonded webs utilized in the examples presented herein were prepared in a manner similar to that described in u . s . pat . no . 5 , 382 , 400 to pike et al ., the entirety of which is hereby incorporated by reference . the a - side polymer was exxon 3155 ( exxon chemical company , houston , tex .) polypropylene and the b - side polymer was dow xus 61800 . 41 ( dow , midland , mich .) polyethylene . the bicomponent spunbonded webs utilized were prepared using a 14 inch ( about 36 cm ) wide pilot scale spunbonded machine . the line speed of the forming wire was used to control the basis weight of the nonwoven web . basis weights of 2 . 0 ounces per square yard ( osy ) ( about 68 grams per square meter or gsm ), 2 . 5 osy , and 3 . 0 osy were spun using polypropylene / polyethylene side - by - side bicomponent fibers . the air filtration efficiencies of these webs were measured using the aft tester , as described above . for each sample , ten measurements were taken of frazier porosity , pressure drop and percent penetration . the average of these measurement are reported in table 1 and table 2 . notably , the high loft bicomponent spunbonded webs which were electret treated using parallel device charge bars exhibited significantly lower percent penetrations ( i . e . higher filtration efficiencies ) than similar webs treated using series device wire ionizers . it is believed that this improvement results from the operation of the parallel device charge bars at higher voltage and higher ionization current as compared to the series device wire ionizers . the basis weight , frazier porosity , and ames bulk of the polypropylene / polyethylene bicomponent spunbonded webs utilized in this example are listed below in table 3 . the high and low loft webs listed therein were either electret treated on - line using wire ionizers , or were electret treated off - line using charge bars . whether treated on - line or off - line , each web was passed through two treatment stations and was subjected to the electric field established between the ionizer and the bias roll . for both types of ionizers , the polarity of the ionizing device was maintained positive and the polarity of the bias rolls was maintained negative relative to earth ground . in alternate embodiments , a variety of configurations of polarity may be used in the present invention . for electret treating the high loft web samples with the wire ionizers , the first treatment station was operated at a potential of 13 kv between the ionizer and bias roll , and the ionizer current was 0 . 1 ma , while the second treatment station was operated at a potential of 22 . 3 kv between the ionizer and the bias roll , and the ionizer current of the second treatment station was 5 . 5 ma . the webs were electret treated in an environment of 40 % relative humidity at 70 degrees f . for electret treating the low loft web samples with the wire ionizers , the first treatment station was operated at 6 . 6 kv and an ionizing current of 2 . 0 ma . the second treatment station was operated 8 kv and an ionizing current of 14 . 0 ma . the on - line treatment stations were sixty ( 60 ) inches ( about 152 . 4 cm ) wide in order to cover the deckle width of the spunbonded machine . samples of high loft and low loft bicomponent spunbonded webs were also produced without on - line electret treatment and were electret treated off - line with charge bars according to the schematic diagram shown in fig1 and described above . these materials were electret treated off - line using charge bars at a line speed of 50 ft / min . both high loft and low loft webs were processed at the following conditions : the first treatment station was operated at 20 kv and an ionizing current of 3 . 0 ma ; the second treatment station was operated at 21 . 5 kv and an ionizing current of 3 . 0 ma . the off - line treating was performed using four 20 inch ( about 55 cm ) wide pinner ® bar ionizers in each station . additionally , the filtration efficiencies of the high and low loft bicomponent spunbonded webs similar to the webs used in example 2 were measured without subjecting the webs to electret treatment . these filtration efficiencies , determined utilizing the automated filter tester in the manner described above , are reported in table 4 . the air filtration efficiencies of high and low loft webs manufactured as described above which were electret treated with series device wire ionizers and charge bars are tabulated in table 5 . the data shows that the filter penetration of high loft webs electret treated with charge bars is significantly lower than the filter penetration of high loft webs electret treated with wire ionizers , the low loft web exhibits a more modest improvement . both the high and low loft webs which were electret treated with the charge bar ; were subjected to higher electric field strengths than the webs which were electret treated with the wire ionizers , without electrical arcing occurring between the charge bars and the bias rolls . the thermal stability of the electret treated high loft polypropylene / polyethylene bicomponent spunbonded webs was evaluated using the webs described in example 2 . samples of material were thermally annealed for 185 hours at 130 degrees fahrenheit in a conventional forced air laboratory convection oven , which is available from fisher scientific . the oven temperature was controlled to within + 2 degrees fahrenheit . thermal stability was examined by comparing the filtration efficiency , as measured by the aft test , before and after the thermal annealing described above . the filtration data is summarized in table 6 , wherein the initial efficiency , as reported in percent , is the filtration efficiency before thermal annealing . the final efficiency , reported in percent , is the filtration efficiency after thermal annealing . the percent change in filtration efficiency was calculated as follows : percent change =( initial filtration efficiency − final filtration efficiency )/ initial filtration efficiency . the change in efficiency on thermal annealing is less for the higher basis weight bicomponent spunbonded materials . it is believed that this reduction in percent change of filtration efficiency is an improvement which is due to the more effective electret treatment at higher field strengths . while the invention has been described in detail with respect to specific embodiments thereof , it will be appreciated that those skilled in the art , upon attaining an understanding of the foregoing , may readily conceive of alterations to and variations of the embodiments disclosed herein . such alterations and variations are believed to fall within the scope and spirit of the present invention and the appended claims .	3
experiments have surprisingly shown that very good etching results are achieved for phosphosilicate glass ( psg or phosphorus glass ) through the use of a novel koh - containing etching paste . it has been found to be particularly advantageous here that the underlying silicon layer can be etched simultaneously in one step . experiments with the novel etching - paste formulations have also shown that the use of the composition according to the invention both enables very good polishing results to be achieved and also the etching depth which can be achieved in a short time in the structured etching is sufficient for the opening of p / n junctions , with an etching depth of & gt ; 5 μm being achieved here . it has furthermore been found that the integration of the novel etching - paste compositions into the production process of solar cells having a local back surface field ( lbsf ) enables the process to be successfully simplified and to be made less expensive . the simultaneous etch - polishing and edge insulation ( p / n opening ) of the underlying silicon layer enables the production of solar cells having an lbsf having higher efficiency by the improved process in accordance with the present invention . after the acidic texturing using hf and hno 3 or after alkaline texturing using koh and isopropanol in the process according to the invention , the wafer is strongly doped over the entire wafer surface . for this purpose , the wafer is doped with phosphorus using pocl 3 at temperatures of about 800 - 850 ° c . during a residence time of about 30 to 90 minutes . due to the doping , the conductivity of the cell front surface is adjusted to about 60 - 70 ohm / sq . the novel etching paste is subsequently printed onto the back surface of the si wafer , preferably over the entire surface , by screen printing using a special screen layout or by means of a steel stencil and heated . the wafer surface is for this purpose heated to a temperature of 100 ° c . to 150 ° c . the heating duration is 2 to 5 minutes . the heating is preferably carried out in a belt furnace . during the heating step , both the psg layer and also the silicon layer are etched . the etching is complete when an etching depth of & gt ; 5 μm has been reached . this is evident from the back surface beginning to shine strongly . after simple cleaning with di water , the psg glass ( phosphorus glass ) on the front surface of the wafer is removed in the next process step with the aid of hydrofluoric acid . the wafer is rinsed again with di water and dried . a passivation layer is then applied to the back surface . for this purpose , sio 2 can be applied with a layer thickness of 30 nm ( by thermal surface oxidation ) or al 2 o 3 can be applied with a layer thickness of 20 nm ( using atomic layer deposition ). silicon nitride is subsequently deposited on the back surface and on the front surface with a layer thickness of 90 nm by pe - cvd . the solaretch aqs etching paste is printed onto the back surface as dot pattern ( about 25 , 000 dots with a diameter of 90 μm ) ( by screen printing ). the wafer surface is subsequently heated to a temperature of 350 ° c . to 450 ° c . the heating duration here is between one and 5 minutes . the heating is preferably carried out in a belt furnace . during the heating step , both the sin x layer and also the sio 2 or al 2 o 3 layer are etched . after this process step , the wafer surface is cleaned with 0 . 1 - 0 . 4 % koh solution in an ultrasound bath , rinsed with di water and dried . the corresponding silver paste is printed onto the front surface for front surface contacting , while an aluminium paste is printed onto the back surface in the intended areas for back surface contacting . for this purpose , use is preferably made of special lbsf aluminium pastes , which have a reduced glass frit concentration ( for example solamet ® lbsf aluminium pastes from dupont ). the printed wafers are finally heated in the belt furnace and dried . the process according to the invention for the production of solar cells having a local back surface field using the etching - paste compositions according to the invention accordingly comprises the following process steps , which are reproduced in fig4 : 1 . texturing of the surface with pyramidal structures 2 . phosphorus doping (˜ 65 ω / sq diffusion of pocl 3 ) 3 . etching of the back surface using the etching paste according to the invention , by means of which the surface is polished and at the same time the p / n junction is opened ( printing of the etching paste onto the back surface by stencil printing , activation in a belt furnace at about 150 ° c . for 2 min , rinsing of the wafer with di water 4 . psg etching using hf ( psg : phosphosilicate glass ) 5 . coating of the back surface with sio 2 or al 2 o 3 passivation layer and coating of the back surface and front surface with silicon nitride [ pecvd - sin x ( pecvd : plasma enhanced chemical vapour deposition )] 6 . selective opening of the passivation layer and the sin x layer by means of etching paste ( solaretch aqs printing , heating , rinsing ) 7 . screen printing for metallisation of the surface ( silver paste ) and back surface ( aluminium paste )/ sintering in the belt furnace . compared with the known processes for the production of solar cells having a local back surface field ( lbsf ), the process according to the invention comprises fewer process steps . it is thus possible , by means of the modified process using the etching - paste compositions according to the invention , to save both time and also chemicals which would have been necessary for the two omitted steps . at the same time , the entire production process thus also becomes less expensive . for the production of solar cells having a local back surface field ( lbsf ), the process according to the invention and the solar cells produced thereby exhibit the following advantages over the known processes a , b and c described above : 1 . fewer process steps for the production of solar cells comprisng selective emitters 2 . lower costs for carrying out the entire process 3 . more environmentally friendly process , since an etching step ( polishing step ) using an acid mixture consisting of an hf / hno 3 mixture is superfluous and the formation of nitrous gases is thus avoided 4 . higher efficiency , or higher cell efficiencies than standard solar cells besides these process advantages and the higher efficiency of the solar cells produced , it has been observed that the back surface of the wafer has very low roughness after etching using the novel , alkaline etching paste according to the invention . this low roughness significantly reduces the electron recombination rate . the latter in turn has a positive influence on the efficiency of the solar cell produced . in particular , these advantages are effected by the use of an alkaline etching paste in process step 3 . naoh , koh or mixtures thereof may be present therein as alkaline etching component . preference is given to etching pastes which comprise koh as alkaline etching component . the corresponding alkaline pastes comprise the alkaline etching component in a concentration in the range from 5 to 40 % by weight on , based on the entire composition . the concentration of the etching component is preferably in the range from 10 to 37 % by weight . the concentration is particularly preferably in the range from 12 to 35 % by weight of koh or koh and naoh in a mixture . experiments have given particularly good results with compositions which comprise koh in a concentration of 20 to 35 % by weight . apart from water as solvent , solvents selected from the group glycerol , ethylene glycol , polyethylene glycol , octanol , 1 , 3 - propanediol , 1 , 4 - butanediol , diethylene glycol monomethyl ether , diethylene glycol monoethyl ether , dimethyl sulfoxide and gamma - butyrolactone , in pure form or in a mixture , may be present in the alkaline etching pastes used in accordance with the invention . these solvents can be added to the composition in an amount of 20 to 70 % by weight , preferably in an amount of 20 to 60 % by weight , particularly preferably in an amount of 20 to 40 % by weight . for thickening , the paste comprises non - particulate thickeners selected from the group polyvinylpyrrolidone , polyacrylates , carboxymethylcellulose and hydroxypropylcellulose , in pure form or in a mixture . furthermore , particulate thickeners selected from the group carbon black , pyrogenic silicic acid , magnesium aluminium silicate and low - melting wax particles can be added to the paste . these particulate thickeners can be added in pure form or in a mixture . depending on the choice of thickener , thickeners may be present in an etching paste of this type in an amount of in total 0 . 1 to 35 % by weight . preferably , the thickener concentration in a corresponding etching paste having good etching properties is preferably between 0 . 5 and 35 % by weight . fig6 shows a photo of the surface of an untreated wafer compared with a wafer after treatment with the etching paste according to the invention . after the etching step using the alkaline etching paste , the smooth reflective surface is clearly evident . fig7 shows the surface profile of a partially etched wafer . for demonstration , half of the surface of the wafer has not been printed and etched using the etching paste according to the invention . it is thus possible to measure the untreated and etched sides in one measurement operation . as already stated above , the selective opening of the passivation layer and the sin x layer can be carried out using etching pastes as commercially available , for example , under the name solaretch aqs . these etching pastes , which are described in greater detail , inter alia , in wo 03 / 034504 a1 , are hf / fluoride - free etching media which are suitable for the etching of inorganic layers and also for the . they usually comprise , as etching component , phosphoric acid and / or salts thereof , which are decomposed to the corresponding phosphoric acid on heating . owing to their pasty form , the etching pastes can be applied selectively to the surface regions to be opened , so that local openings of the wafer surface can be produced on subsequent heating at temperatures in the range from 250 to 350 ° c . for 30 to 120 seconds . for the application according to the invention , suitable compositions are those which comprise , as etching component , ortho - phosphoric acid , meta - phosphoric acid , pyrophosphoric acid , or salts thereof and here in particular the ammonium salts (( nh 4 ) 2 hpo 4 , nh 4 h 2 po 4 , ( nh 4 ) 3 po 4 ) and other compounds which form one of these compounds on thermal decomposition thereof , in adequate concentration , so that they are capable , at temperatures above 250 ° c ., of completely etching away silicon nitride layers of layer thickness 70 nm within a few seconds to minutes . besides the etching component , these etching pastes comprise solvents , thickeners and optionally additives , such as antifoams , thixotropic agents , flow - control agents , deaerators , adhesion promoters . the etching component is present in the composition in the concentration range 1 - 80 % by weight , based on the total weight of the etching paste , preferably in the moderate to upper concentration range . the proportion of the solvent in the composition can be in the range 20 - 80 % by weight , preferably in the lower to moderate range , based on the total weight of the etching paste . suitable solvents can be pure inorganic or organic solvents or mixtures thereof , such as water , simple and / or polyhydric alcohols , ethers , in particular ethylene glycol monobutyl ether , triethylene glycol monomethyl ether , or [ 2 , 2 - butoxy ( ethoxy )] ethyl acetate . furthermore , the proportion of the thickener present in the paste , which is necessary for specific setting of the viscosity range and in principle for achieving printability of the composition , i . e . for the formation of a printable paste , is in the range 1 - 20 % by weight , based on the total weight of the etching paste . thickeners which may be present are organic or inorganic products or mixtures thereof , such as , for example , cellulose / cellulose derivatives , such as ethyl -, hydroxypropyl -, hydroxyethyl -, sodium carboxymethylcellulose , or starch / starch derivatives , such as sodium carboxymethylstarch ( vivastar ®), or anionic heteropolysaccharides ), acrylates ( such as borchigel ®), polymers , such as polyvinyl alcohols ( mowiol ®), polyvinylpyrrolidone ( pvp ), or highly disperse silicic acids , such as aerosil ®. both types of thickeners , organic and inorganic , can also be combined as desired . additives optionally present can be antifoams , thixotropic agents , flow - control agents / antiflow agents , deaerators and adhesion promoters . for selective metallisation of the surface using a silver paste , corresponding screen - printable compositions can be used , as marketed , for example , by dupont under the trade name pv 145 conductor ® or by metalor ® under the trade name metpaste helisii5718 ®. pastes of this type can contain silver in an amount of 50 to 80 % by weight , based on the total weight , and solvents or solvent mixtures , further organic additives and water , as well as inorganic oxides , such as zinc oxide , silicon dioxide , thallium oxide , lead in glass frit . inter alia , substances such as 2 , 2 , 4 - trimethyl - 1 , 3 - pentanediol monoisobutyrate , dibutyl phthalate , terpineol , 2 -( 2 - butoxyethoxyl ) ethyl acetate or ethylcellulose may be present , in each case in matched amounts , giving screen - printable pastes . the compositions should be selected here in such a way that the heating after the metallisation pastes have been printed on results in the formation of conductive metal layers which no longer contain any interfering organic substances by means of which the conductivity would be impaired . as already stated above , the metallisation of the back surfaces is carried out using aluminium pastes which are likewise screen - printable and can be sintered by heating at elevated temperatures to give corresponding conductive coatings . suitable pastes are marketed by pemco euroinks s . r . l under the name ag / al 8205 pc silver aluminium pastes . corresponding aluminium pastes comprise at least 1 to 10 % by weight of aluminium besides silver in an amount of 50 to 85 % by weight and may comprise corresponding solvents and additives , like the silver pastes described above , where the specifically mentioned aluminium paste comprises enamel frit based on borosilicate glass in an amount of 1 -% by weight , lead compounds in an amount of 1 - 5 % by weight and alpha - terpineol in an amount of less than 20 % by weight . like the silver pastes described above , screen - printable aluminium pastes are also employed here in the process according to the invention . correspondingly , the aluminium pastes must on the one hand be capable of being printed well and on the other hand must adhere well to the surfaces , so that they can be printed selectively and bond well to the layers of the wafer at high temperatures and form a uniform conductive metallisation layer . for the production of monocrystalline or multicrystalline solar cells , corresponding wafers are basically typically cut out of solid drawn silicon rods or cast silicon blocks using a wire saw ( dietl j ., helmreich d ., sirtl e ., crystals : growth , properties and applications , vol . 5 springer verlag 1981 , pp . 57 and 73 ). an exception is formed by the silicon drawn by the efg method ( edge - defined film - fed growth ) ( wald , f . v . ; crystals : growth , properties and applications , vol . 5 springer verlag 1981 , p 157 ). for the production of solar cells having a local back surface field ( lbsf ) by the process according to the invention , it is possible to employ monocrystalline or polycrystalline silicon wafers produced correspondingly , which may in turn be doped with boron [ p - type silicon , 5 ″ size ( 125 × 125 mm , d 150 mm ), thickness 200 - 260 μm , resistivity 1 . 0 - 1 . 5 ω · cm ]. the wafers are usually sawn out of mono - or polycrystalline silicon rods . the sawn monocrystalline or multicrystalline silicon wafers obtained in this way have a rough surface . this roughness is also referred to as saw damage , where the peak - to - valley height is about 20 - 30 μm . these differences in the surface plane are disadvantageous for the further production of high - performance solar cells . a so - called saw damage etch is therefore carried out before further processing of the wafers into solar cells , but in particular for achieving the highest possible efficiency . besides the actually intended removal of the saw damage ( very badly damaged surface regions of the wafer having a depth of several μm ), contamination located in the troughs of the surface is removed during this saw damage etch . this contamination is , in particular , metal abrasion from the saw wire , but also traces of abrasive . the saw damage etch is typically carried out in an approximately 30 % potassium or sodium hydroxide solution at temperatures of about 70 ° c ., preferably higher , in particular at 90 ° c . due to the etching rates of about 2 μm / min , which are also relatively low under these conditions , etching times of 10 min and possibly longer may be necessary in order to achieve the desired effect . an si layer with a thickness of about 7 μm is usually removed on both sides of the wafer in this way . although this etching produces a rough surface on the substrate , the opening angles achieved at the surface here are , however , very flat and totally unsuitable for reducing reflections or even multiple reflections at the surface . such reflection effects are , however , desired in order to achieve high efficiencies of the cells . a multiplicity of publications and patents therefore relate to the reduction of reflections at solar cells of all types , for example also for amorphous solar cells ( u . s . pat . no . 4 , 252 , 865 a ). fig1 : process variant a of a standard process for the production of solar cells having an lbsf fig2 : process variant b of a standard process for the production of solar cells having an lbsf fig3 : process variant c of a newer process for the production of solar cells having an lbsf fig4 : representation of process d according to the invention , comprising 6 process steps ( opening of the passivation layer using etching paste ) fig5 : representation of process e according to the invention , comprising 6 process steps ( opening of the passivation layer using laser ) fig6 : comparison pictures of untreated surface and treated surface , effect of the etching pastes according to the invention on silicon surfaces fig7 : surface profile of the etched back surface of the wafer , profile measurement of the surface roughness from right to left ( from untreated side to etched side ) fig8 : sem photomicrographs of the surface of the untreated wafer before the process according to the invention fig9 : sem photomicrographs of the surface of the wafer after the process according to the invention using the etching paste according to the invention fig1 : detail sketch for the stencil printing of the etching paste onto the back surface of the wafer ( with dimensions ) fig1 : detail sketch ( side view of edge region ) of the printed - on paste before the heating step . paste separation from the edge after printing about 100 μm . fig1 : detail sketch ( side view of edge region ) of the printed - on paste after the heating step . paste has flowed to the edge . in the further description , examples of the process according to the invention for the production of solar cells having an lbsf and the etching pastes used therein which are within the scope of protection of the present invention are given for better understanding and in order to illustrate the invention . these examples also serve to illustrate possible process variants or possible variations of suitable paste compositions for the etching step . owing to the general validity of the inventive principle described , however , the examples are not suitable for reducing the scope of protection of the present application to these alone . the temperatures given in the examples and description and in the claims are always in ° c . unless stated otherwise , content data are given as % by weight or weight ratios . furthermore , it goes without saying to the person skilled in the art that , both in the examples given and also in the remainder of the description , the component amounts present in the compositions always add up only to 100 % by weight , mol -% or % by volume , based on the total composition , and cannot exceed this , even if higher values could arise from the percent ranges indicated . unless indicated otherwise , % data are regarded as % by weight , with the exception of ratios , which are shown in volume data . a reduction in the reflection of solar cells is usually achieved by texturing using an alkaline solution , preferably comprising a koh solution and isopropanol , or using an acidic solution consisting of an acid mixture of hf and hno 3 . after texturing , a surface cleaning is carried out with acid - containing , aqueous solutions , with hot demineralised water or also treatment in an oven in the following sequence : after the surface of the wafer has been cleaned , the single - step emitter is formed in a diffusion step . this is a batch process , in which the surface of the wafer is doped with phosphorus within about one hour , preferably within about 40 minutes , at a temperature of higher than 800 ° c ., a maximum of 895 ° c . the doping is carried out using liquid pocl 3 . after about 40 minutes , the desired conductivity of about 65 ohm / sq has been reached . using an alkaline etching paste , the back surface polishing and the back surface edge insulation is carried out in one process step . the etching paste is applied by stencil printing here . for the etching step , a koh - containing etching paste is used . the paste can be applied using a screen - printing machine , ( for example suitable machine from baccini , print monitoring using four cameras ). the etching pastes can be printed using , for example , a stencil from koenen with a stencil thickness of 500 μm . the paste can be printed very well using a steel doctor blade . the following parameters were set for the paste printing : no separation ; printing speed : 150 mm / s . the etching paste is applied over the entire surface with a separation of 200 μm from the edge of the wafer ( see sketch from fig1 ). for the etching , the printed wafer is heated at a temperature up to 150 ° c . for a period of about 5 minutes , causing the etching paste to be activated . a belt furnace is used for this purpose . the furnace is divided into four heating zones . zone 1 is set to 250 ° c ., zone 2 to 200 ° c ., zone 3 to 150 ° c . and zone 4 to 150 ° c . the belt speed is 51 cm / min . the etched wafer is then cleaned using a rena inline cleaning unit . the cleaning is carried out in two steps . in the first step , the wafer is treated in a continuous ultrasound bath ( 2 × 500 w , 40 khz ). in the second step , the wafer is cleaned on both sides using a water jet and subsequently dried ( compressed air ). psg glass etching and wet - chemical surface cleaning is carried out using hf , hot demineralised water and again using hf . a thin layer with a thickness of 20 nm of thermal sio 2 is deposited on the back surface . 90 nm of lpcvd sin x is then deposited on the front surface and on the back surface . the lpcvd sin x deposition on both surfaces is carried out at up to 790 ° c . the process duration for the deposition of a layer thickness of 90 nm is about 2 hours . the reaction gases used for the deposition of si 3 n 4 are dichlorosilane and nh 3 . a dot layout with about 90 , 000 dots ( diameter of about 100 μm and separation of 500 μm ) is subsequently printed onto the back surface of the wafer . the paste can be applied using a screen - printing machine . the etching pastes can be printed , for example , using a screen from koenen with the specification 280 mesh / inch and a wire diameter of 25 μm . the clamping angle of the screen is preferably 22 . 4 °. the screen emulsion used is the azokol z130 type from kissel & amp ; wolf . the paste can be printed very well using a diamond doctor blade and a doctor blade hardness of 80 shore . the following parameters are set here for the printing of the paste : for the etching , the printed wafer is heated at a temperature of up to 400 ° c . for a period of about 5 minutes , causing the etching paste to be activated . a belt furnace is used for this purpose . the furnace is divided into four heating zones . zone 1 is set to 550 ° c ., zone 2 to 400 ° c ., zone 3 to 400 ° c . and zone 4 to 300 ° c . the belt speed is 51 cm / min . the etched wafer is then cleaned using an inline cleaning unit ( for example from rena ). the cleaning is carried out in two steps . in the first step , the wafer is treated in a continuous ultrasound bath ( 2 × 500 w , 40 khz ), and in the second step is cleaned on both sides using a water jet and subsequently dried , for example using compressed air . the requisite back surface contacts can be produced under the following conditions : the paste can be applied using a screen - printing machine it is advantageous here to monitor the print result continuously . in the unit employed for the experiments , the monitoring is carried out using four cameras . ag / al paste is used as standard . for the process described , a corresponding paste from dupont , pv 502 , was used in the experiments . the paste can be printed using , for example , a screen from koenen with the specification 230 mesh / inch and a wire diameter of 36 μm . the clamping angle of the screen is preferably 45 °. the screen emulsion used can be the isar type from koenen . it has been found here that the paste used can be printed very well using a diamond doctor blade and a doctor blade hardness of 60 shore . the following parameter settings have proven advantageous for the printing of the pastes : using the ag / al paste , two busbars measuring 5 mm × 124 mm are printed onto the back surface . the printed paste thickness is about 15 μm . for drying , the printed wafer is warmed at up to 200 ° c . for a period of about 3 minutes . a belt furnace can be used for this purpose . the paste is applied using a screen - printing machine which is sold under the name “ baccini printer ” ( with four cameras ). the process described is carried out using the solamet ® pv36x aluminium paste ( conductive pastes for local back surface field solar cells from dupont ). the paste is printed using a screen from koenen with the specification 330 mesh / inch and a wire diameter of 34 μm . the clamping angle of the screen for this purpose is preferably 45 °. the screen emulsion used is an emulsion of the isar type from koenen . the paste employed can be printed very well using a diamond doctor blade and a doctor blade hardness of 60 shore . in this case , the following parameter setting have proven advantageous : separation : 1 . 2 mm ; pressure : 70 n ; speed : 150 mm / s . the entire back surface is printed using the standard al paste . the printed thickness of the pastes is preferably about 22 μm , where the amount of paste applied is about 2 . 64 mg / cm 2 . for drying , the printed wafer is warmed at up to 290 ° c . for a period of about 3 minutes . this is carried out in a belt furnace . the paste is applied using a screen - printing machine which is sold under the name “ baccini printer ” ( with four cameras ). for the process described , the pv 145 silver paste from the dupont company is used by way of example . the paste is printed using a screen from koenen with the specification 280 mesh / inch and a wire diameter of 25 μm . the clamping angle of the screen is 22 . 5 °. the screen emulsion used in this case is the isar type from koenen . the paste can be printed very well using a diamond doctor blade and a doctor blade hardness of 60 shore . the following parameter settings have proven suitable for the printing of the pastes under the conditions tested : using the silver paste , the front surface layout with 2 busbars and fingers is printed . the line width is 80 μm and the separation between the fingers is 1 . 7 mm . the width of the main busbar is 2 mm . the paste thickness printed is about 20 μm . for drying , the printed wafer is warmed at a temperature of up to 290 ° c . for a period of about 3 minutes . a belt furnace can be used for this purpose . the silicon wafers printed using metal paste are transported through an ir belt furnace , where they are heated to a maximum temperature of 880 ° c . and fired . this temperature step serves both for burning out the organic paste components and also for sintering and melting the metal particles and the glass frit components . this produces a surface contact which is stable in the long term ( state of the art : “ co - firing ” and “ arc firing through ”). the firing in the process described can be carried out using a belt furnace with 7 zones , where the following temperature profile has proven advantageous : 250 - 350 - 400 - 480 - 560 - 560 - 880 ° c . at a belt speed of 1 . 5 m / min . the solar cells produced are characterised by means of a sunlight simulator ( xe lamp ) under standard conditions ( stc . 1000 w / sqm , am 1 . 5 , temperature : 25 ° c .). the following measurement values have been found for the cell produced as a model : the measurements show that the process according to the invention can be used to produce solar cells comprising single - step selective emitters with an efficiency increased by & gt ; 0 . 4 % compared with the efficiencies of standard solar cells . with vigorous stirring . 22 g of carbon black are then added to the clear homogeneous mixture , which is then stirred for a further 2 hours . with vigorous stirring . 5 g of ceridust ( polyethylene wax ) are then added to the clear homogeneous mixture , which is then stirred for a further 2 hours . with vigorous stirring . 5 g of ceridust 9202 f are then added to the clear homogeneous mixture , which is then stirred for a further 2 hours . 70 g of ceridust 9202 f are then added to the clear homogeneous mixture , which is then stirred for a further 2 hours with vigorous stirring . 22 g of carbon black are then added to the clear homogeneous mixture , which is then stirred for a further 2 hours . the paste , which is now ready to use , can be printed using a steel stencil ( see fig1 ) or a printing screen with stainless - steel fabric ( 70 mesh / inch and emulsion thickness of 50 um ). in principle , other screen fabric materials can also be used . in storage experiments , the etching paste prepared has proven to have a long shelf life with retention of the advantageous etching properties .	8
referring to fig1 it can be seen that typical game and windowing systems have similar display subsystems . an operating system ( os ) or host platform 101 contains a graphics subsystem 102 . the graphics subsystem 102 fills a frame buffer 103 with display information . the display information is taken out of the frame buffer 103 by a display controller 104 and displayed on the display or monitor 105 by the display controller 104 . regions are arbitrarily defined in the display area by a game or windowing system . on microsoft windows and x - windows , regions are not sophisticated and are essentially stored as a list of rectangles . with regard to fig2 in a front - to - back drawing with rectangular opaque sprites , an area is selected to be redrawn . that area is represented as a region 201 . this is a very simple region consisting of a single rectangle . a sprite 202 is drawn into the region . the sprite area is subtracted from the original drawing region . there are many ways that the region may be divided into rectangles . thus , those areas of the region 201 that remain after the sprite 202 is drawn are divided into rectangles . the region is represented as a list of rectangles 203 , 204 , 205 , and 206 . another way of representing the region is to use a single bitmapbit map , where each pixel is a separate bit . this type of representation can beis expensive memory - wise when compared to the use of rectangles where the region can be represented simply , with rectangles , as in this caseas four rectangles . as previously mentioned , on microsoft windows and x - windows , regions are represented as lists of rectangles and not as bitmapspixels . it is therefore more efficient to use rectangle listss to manipulatewhenever regions when they can be represented with short listspossible . if rectangles are used for front - to - back drawing , then a bit map is only necessary with the back - to - front drawing . in the case of microsoft windows and x - windows , one constraint is the representation provided by the native operating system . this is one reason why the hybrid system disclosed herein is beneficialnecessary . thus , the invention is designed to adapt a sophisticated sprite technique to the constraints of the operating system , particularly microsoft windows and x - windows . the decision of when to use a front - to - back algorithm or a back - to - front algorithm for a given sprite in a given drawing pass is made on - the - fly by the sprite engine . a particular sprite is drawn at mostonly drawn once , in one of these two passes . if , for example , it is known that part of a sprite is drawn such that it is obscured by another sprite that has transparency and thus part of it would be drawn back - to - front , the sprite engine avoids having to draw only part of it back - to - front . it draws the entire sprite back - to - front , which is more efficient . with regard to fig3 three sprites 301 , 302 , and 303 are shown . sprite 303 is at the topmost z level , with sprite 302 at the next level , and sprite 301 at the lowest level . a painter &# 39 ; s algorithm draws the lowest layer first , then each subsequent layer , one on top of the other . fig4 shows the resultant image 401 after sprite 301 is drawn first , then sprite 302 , and finally sprite 303 . the painter &# 39 ; s algorithm requires more drawing because exposed portions of sprites are always drawn , even though they are overlapped by another sprite . in the front - to - back algorithm , the topmost layer is drawn first . after the topmost layer is drawn , then its opaque area is subtracted from the total area that needs to be redrawn . the next layer is drawn and its opaque area subtracted from the remaining area to be redrawn . each subsequent layer is drawn in the same manner . fig5 shows each of the sprites with the higher level sprite opaque areas subtracted from its image . sprite 503 is intact because it is at the highest z level . sprite 502 has sprite 503 &# 39 ; s overlapping opaque area subtracted from it . finally , sprite 501 has both sprite 502 and 503 &# 39 ; s opaque areas subtracted from it because it is at the lowest z level and is overlapped by both of the other sprites . the resultant image is identical to the image 401 depicted in fig4 . the front - to - back algorithm requires less drawingis more efficient than the back - to - front algorithm because it does not unnecessarily draw obscuredunnecessary portions of sprites . referring to fig6 sprites 601 are registered with the sprite engine or compositor 602 and are essentially put in a list 603 maintained by the sprite engine or compositor 602 . the list 603 is effectively in z order in front - to - back or back - to - front sortingorder . additionally , for each sprite there is an indication of whether or not it has transparent areasis transparent , the bounding rectanglebox of the sprite , and a reference to the function responsible for drawing the spritethe drawing function . when an application creates a sprite , it provides a bounding rectangle which encompasses any portions of the sprite that are non - transparent , i . e . the bounding rectangle must enclose the visible portions of the sprite . the application is responsible for notifying the sprite engine of any changes in a sprite &# 39 ; s bounding rectangle as the sprite &# 39 ; s shape or size change . the sprite engine uses the bounding rectangle information to optimize its operation . when the sprite engine is instructed to draw a particular area of the display and a sprite &# 39 ; s bounding rectangle does not fall in that area of the display , the sprite engine will not invoke the sprite &# 39 ; s drawing function for that particular case . it is therefore advantageous for the application to specify the minimum possible bounding rectangle for a sprite . the sprite engine is not necessarily concerned with what is inside a sprite . it only knows that something needs to be drawn , and that it is either entirely opaque or it is potentially partially transparent . it also knows that the sprite cannot be larger than a certain size . when an application creates a sprite it must tell the sprite engine that the sprite is never bigger than a certain size . the sprite engine uses that information to optimize its operation . when the sprite engine is instructed to draw a particular area of the display and a sprite does not fall in that area of the display , the sprite engine never tells that sprite to draw for that particular case . many windowing systems support subwindows , that is , within one window there may be multiple subwindows . some windowing systems also provide a root window , where the entire display is taken up by the root window in which subwindows provide applications windows . the application windows , in turn , may have their own subwindows , which may be different documents within the application . as previously mentioned , windows also have the notion of z order , in addition to the subwindow concept . most windowing systems place subwindows in z order in front of the parent window , such that the parent window and all of its subwindows are a single unit that can be at some position with respect to the siblings of the parent window . the registration between the parent and the children remains constant , even though the parent may be moved . therefore , one skilled in the art can readily appreciate that these techniques can be applied to windowing systems as well as to sprite engines . windows and subwindows are drawn in the order of their z position using a front - to - back or back - to - front algorithm , in the same manner as sprites . referring to fig7 if a game system uses a typical sprite engine , it first loads bit maps 701 that correspond to the sprites . it then takes the bit maps and registers them as sprites with the sprite engine 702 . for many game sprite engines a sprite is drawn using a single static bitmap that does not change its bounding rectangle or opacity over time . the concept of a display is a single bit map that is static , and , as it is drawn , it does not change along with its transparent areas . the invention is intended for application to any system element that can draw . when a sprite registers , it does not register a bit map to be drawn . rather , it registers a function to be called when a draw needs to occur . that function can draw whatever it wants . for example , a function might draw a different bit of text every time it is told to draw , which means that the transparency is not something that stays true across every draw . in other words , a sprite is an object , and it has a draw method . the invention is intended for application to any system element that can be drawn . the sprite engine possesses no specific information regarding the appearance of the sprite other than its bounding rectangle and whether or not the sprite is wholly opaque within the bounding rectangle . there is no bitmap registered for each sprite . rather , when a sprite must be drawn , the sprite engine invokes the sprite &# 39 ; s registered drawing function . that function can draw anything within the sprite &# 39 ; s bounding rectangle . for example , a game system might provide a function which draws a static bitmap . alternatively , a drawing function might display a different text string every time it is invoked , which means that the opaque areas of the sprite need not remain the same across every draw . ( however , the application is responsible for keeping the sprite engine informed of changes in an objects opacity .) in object - oriented terms , a sprite is an object , and it has a draw method . in the context of a windowing system , a window is something that an application creates and that application has control of the drawing withinits own concept of what to draw into that window . therefore , it is similar to a sprite because a window has its own drawing function in the same manner as sprites have their own draw method . with regard to fig8 in a preferred embodiment of the invention , sprites 801 are registered with the sprite engine or compositor 802 . the sprite engine 802 determines where and when the sprites 801 draw and the sprites 801 draw using the graphics subsystem 803 . the graphics subsystem 803 is a component of the os or host platform 804 . the graphic subsystem 803 draws into the frame buffer 805 . the frame buffer 805 is the area of video memory that corresponds to what is displayed on the monitor 807 . the sprite engine 802 also uses the graphics subsystem 803 for its drawing . the sprite engine 802 may be combined with the graphic subsystem 803 to form a single subsystem . the sprite engine &# 39 ; s determination of the order in which spriteswhen the sprites should draw is based on either the back - to - front or the front - to - back approach . in a simple back - to - frontfront - to - back system with rectangular opaque sprites , the sprite engine instructs a sprite , e . g . sprite 12 , to draw and sprite 12 then uses the graphics subsystem to draw . the sprite engine then instructs sprite 21 to draw , and sprite 21 does the same . once again , the main function of the sprite engine is to maintain a list of the ordering of the sprites and to tell the sprites when and in what order to draw . when an application creates uses a mechanism to create a sprite , it registers the sprite with the sprite engine . as long as the sprite remains active , the application is responsible for keeping the sprite engine informed of its current characteristics : it informs the sprite engine what sprite number it is , its bounding rectanglebox , drawing function , and the presence or absence of transparent areas within the bounding rectangleif it is transparent or opaque . the sprite engine internally maintains its list of sprites as a linear list or a doubly - linked list . the list is maintained in z order , so the sprite engine can identify , for example , the topmost sprite in z order and the bottom most sprite in z order . when the sprite engine is told to redraw areas of the display , it decides which sprites need to draw , or which sprites overlap the area that needs to be redrawn . it then decides on a per - sprite basis whether it should draw the sprites in the front - to - back pass or wait until the back - to - front pass to actually draw them . fig9 is a flow diagram showing operation of a preferred embodiment of the invention . when the drawing process begins 900 a front - to - back drawing phase 910 is first commenced . upon completion of this first phase , a back - to - front drawing phase 920 is entered . at the conclusion of the back - to - front drawing phase , the process ends 930 . fig1 is a flow diagram showing a front - to - back drawing phase of a preferred embodiment of the invention . with regard to fig1 , the sprite engine starts 1001 with the region to be drawndraw area parameters which are passed to it by a calling routine . the sprite engine is initialized 1002 , such that the remaining region to be drawn is not obscured by any other spritesunobscured ( r unobscured = r draw ,) and , all sprites have their drawing area , r i , initialized to their entire bounding rectangle , and all sprites are unmarked . the sprite engine contains a list of all the sprites that have been registered with the sprite engine . each sprite is registered with the sprite engine by the application that created the sprite . the creating application passes the sprite engine the sprite &# 39 ; s z order , bounding rectanglebox parameters , whether or not the sprite containsis transparent areas , and the drawing routine for the sprite . the sprite engine records all of the information in the list . the list is organized in an increasing or decreasing order of each sprite &# 39 ; s z position . the sprite engine keeps track of the z position of each sprite . whenever a region needs to be refreshed , the sprite engine examines each sprite to determine if the sprite overlaps that region . the drawing occurs in two passes : the first pass occurs in a top - down manner , by z position . only opaque sprites that are not overlapped by any transparent sprites may be drawn in this pass . in this pass , the algorithm keeps track of three regions -- the total area to be drawn ( r1 ), the area not yet drawn to by sprites in this pass ( r2 ) and the area covered by transparent sprites ( r3 ). at the beginning of the top - down pass , r2 is the same as r1 and r3 is empty . if a sprite encountered in the top - down pass is transparent and its bounding rectangle overlaps the area r2 , its bounding rectangle is added to r3 . note that , since it is transparent , it is not drawn in this pass . if a sprite is opaque and its bounding box overlaps the area r2 , it may be drawn in this pass only if it is not overlapped by a transparent sprite , i . e . if its bounding box does not intersect the region r3 . during the first pass , the sprite engine initially examines each sprite in the list in front - to - back z order ( i = 1 . . . n ) 1003 and determines the overlap of the sprite drawing area with the remainingif the sprite overlaps the area to be drawn 1004 ( r i =- r i ( r unobscured ). the sprite engine then determines if the sprite is not entirely obscured by opaque sprites above it ( ri ( 0 ) 1005 . if a sprite does overlap the area to be drawn and is not entirely obscured , the sprite engine checks if the sprite is registered as having transparent or whollyentirely opaque properties 1006 . if the sprite is entirely opaque , then the sprite engine instructs the sprite to draw that portion of the sprite that overlaps the remaining area to be drawn 1009 . the sprite uses its registeredwhatever drawing routine that it requires to draw the portion of the sprite covered by its drawing area , r i , intoonto the draw area in the frame buffer . the remaining area to be drawn is updated by subtracting the area of the sprite from its current value ( r unobscured = r unobscured - r i ) 1007 . an optimization is provided that tests to determine if the entire area to be drawn is covered ( r unobscured ( 0 ) 1011 . if the entire area to be drawn is already covered , then there is no need to continue examining the sprites and this phase of the process is complete 1013 . otherwise , the front - to - back search continues until the last sprite is reached 1012 and the task is completed 1013 , or when the front - to - back search finds a sprite that overlaps the draw area but has transparent properties 1011 . if the sprite is not entirely opaque 1006 , then the sprite is marked for drawing in the second , back - to - front drawing pass 1015 . the sprite &# 39 ; s unobscured area , r i , calculated in the front - to - back pass , is preserved for use in that back - to - front drawing operation . thus , if the sprite intersects with region r3 , the sprite engine records that the sprite has to be drawn in the back - to - front search rather than in the front - to - back search . because that sprite has to be drawn back - to - front , other sprites behind that sprite need to be drawn back - to - front . once the last sprite has been processed during the first pass 1013 , the second pass is begun 1100 ( see fig1 ). the second pass occurs in a back - to - frontbottom - up manner . transparent sprites are drawn in this pass , as are opaque sprites that were not drawn in the front - to - backtop - down pass because they were overlapped by transparent sprites . in this pass , no region maintenance need happen because the system is using the painter &# 39 ; s algorithm . thus , this algorithm combines both front - to - backtop - down and back - to - frontbottom - up drawing to minimize drawing for opaque areas of a display , while still maintaining the simplicity of the painter &# 39 ; s algorithm for areas of the display that include transparent sprites . fig1 is a flow diagram showing a back - to - front drawing phase of a preferred embodiment of the invention . in the second pass , the sprite engine then searches the list in back - to - front order 1101 . when a sprite is found that overlaps the draw area and the sprite was marked for drawing back - to - front during the first pass 1102 , the sprite engine draws the sprite onto the draw area in the frame buffer by calling the draw routine that was registered with the sprite , using the sprite &# 39 ; s draw region , r i computed in the first pass 1103 . each remaining sprite is treated in the same manner until each transparent sprite that was previously marked is drawn 1104 . if the last sprite has been processed , then the draw area has been completed and the sprite engine &# 39 ; s task is completed 1105 . at a higher level , the sprite engine walks down the list , going from the top to the very bottom sprite , and for each sprite it keeps track of a particular arbitrary region as well as an overall region . then it walks backwards , going from the bottom most sprite up to the topmost sprite , taking into account those particular regions that tells it which parts of the sprite need to be drawn and which do not . it takes the sprites that it did not handle on the top - down phase and draws them in the bottom - up phase . at a higher level , the sprite engine walks down the list in z order , going from the top to the very bottom sprite , and for each sprite it computes a region containing that portion of the sprite not obscured by opaque sprites above . the visible parts of any wholly sprites that are wholly opaque are drawn in this pass . then the sprite engine walks backwards , going from the bottom most sprite up to the topmost sprite , taking into account those regions constructed in the first pass that tell it which parts of each sprite need to be drawn and which do not . it takes the sprites that it did not draw in the front - to - back phase and draws them in the back - to - front phase . although the invention is described herein with reference to the preferred embodiment , one skilled in the art will readily appreciate that other applications may be substituted for those set forth herein without departing from the spirit and scope of the present invention . accordingly , the invention should only be limited by the claims included below .	6
fig2 a is a perspective view of a semi - submersible modu 100 in a drilling mode , according to one embodiment of the present invention . fig2 b is a plan view of the semi - submersible modu 100 in drilling mode . fig2 c is a profile view of the semi - submersible modu 100 in drilling mode . the modu 100 may be semi - submersible and include a helipad 101 , an upper hull 105 , one or more stability columns 110 , a submersible lower hull 115 , one or more cranes 120 a - c , one or more life - rafts 125 , a cabin 130 , a remotely operated vehicle ( rov ) 135 , a mooring system 140 , a drilling rig , a . k . a . derrick equipment set ( des ), 150 , and a moonpool 155 . the helipad 101 may be used for shuttling roughnecks to and from the modu 100 . the upper hull 105 may have an trapezoidal shape , such as isosceles trapezoidal , and may include one or more decks , such as a main deck 105 p , a mezzanine deck 105 z , a machinery deck 105 m , and a tank deck 105 t . as discussed above , the upper hull 105 and stability columns 110 may float on the lower hull 115 and three stability columns may support the upper hull from the lower hull . the lower hull 115 may include one or more pontoons and a ballast system . the pontoon may be a ring pontoon having a trapezoidal shape corresponding to the upper hull . the pontoons may float near or on the surface when empty for towing the modu 100 between locations and may submerge when ballasted for drilling or tender assist drilling mode ( discussed below ). the rov 135 may be deployed to perform subsea work . the mooring system 140 may be employed to maintain position of the modu 100 during drilling or tender assisted drilling . alternatively or additionally , the modu 100 may include a dynamic positioning system to maintain position of the modu 100 . fig3 a - g illustrate the des 150 in drilling mode . fig3 a is a profile view of the des 150 . the des 150 may include a derrick 205 , a top drive 210 , a drill floor 215 , a process level 220 , a lower level 225 , a base 230 , drawworks 235 , a crown block 240 , a blow out preventer ( bop ) 245 ( see fig3 b ), a drill pipe handling system 250 , a mud treatment system 255 , a driller &# 39 ; s cabin 265 ( see fig3 d ), and a skidding system 275 . the derrick 205 , drill floor 215 , process level 220 , and lower level 225 may be mounted on the base 230 , such as by fasteners . in the drilling mode , the derrick 205 may be located over the moonpool 155 to conduct drilling operations and the base 230 may rest on the main deck 105 p and / or be fastened to the upper hull 105 . fig3 b is another profile view of the des 150 . the derrick 205 may include an upper mast portion 205 m and lower housing portion 205 h . in drilling mode , the mast 205 m may extend from the housing 205 h . the portions 205 h , m may be connected , such as fastened , at an overlap 205 c . to transport the derrick 205 for tender assist drilling mode or when towing the modu 100 between locations , one of the cranes 120 a - c may be fastened to the mast 205 m , the connection 205 c disassembled , and the mast 205 m may then be lowered into the housing . the connection 205 c may be reassembled , the derrick 205 may be disconnected from the base 230 , and the derrick 205 may be laid down on the main deck 105 p ( see fig5 a ). fig3 c is a profile view of the drill pipe handling system 250 . fig3 d is a plan view of the drill floor 215 . the drill pipe handling system 250 may include a bridge crane , a racking arm , a racking board , an elevator , one or more power tongs ( ir ), an offline stand building ( osb ), and one or more pipe bins . single joints of drill pipe 260 may be stored in the pipe bins . during and before drilling , the joints 260 may be assembled into stands of two or more joints , such as quad stands . the joints 260 may be assembled by retrieving a joint from the bins using a catwalk machine , raising the joint to a vertical position using the elevator , setting the joint into a mouse hole , and engaging slips of the mouse hole spider . a second joint may then be hoisted over the first joint in a similar fashion . the power tongs may engage the joints and make - up a threaded connection between the two joints . this process may be repeated until a quad stand is assembled . the racking arm may then retrieve the assembled stand and the bridge crane may lift the racking arm to store the stand in the racking board . once the drill string has drilled to an end of a capable depth , the top drive may raise the drill string and set the drill string in a spider of a rotary table in the drill floor . the top drive may then be disconnected from the drill string and raised to a height proximate to the racking arm . the racking arm may retrieve the stand from the racking board and the bridge crane may lift the racking arm and the stand and hold the stand proximate to the top drive . the top drive may then engage the stand with a backup tong , and connect the stand to the quill . the top drive may then lower the stand to an end of the drill string . a second set of power tongs may engage the stand and make - up a threaded joint between the stand and the drill string . while the top drive is drilling with the extended drill string , the handling system 250 may be assembling and storing more stands as needed . the drill floor 215 may further include other accessories , such as a hydraulic power unit , an air compressor , a mud logger building , a measurement while drilling ( mwd ) building , a choke manifold , and a standpipe manifold . fig3 e is a plan view of the process level 220 . fig3 f is a plan view of the lower level 225 . the mud treatment system 255 may include a process tank , one or more shale shakers , a degasser , a desander , a desilter , a centrifuge , one or more feed pumps , an agitator , one or more trip tanks , and a gas separator . the process tank may include a sand compartment , a degas compartment , a desand compartment , a desilt compartment , and a clean mud compartment . fig3 g is a plan view of the base 230 . the base 230 may include a frame operably coupled to the skidding system 275 . the skidding system may include one or more linear actuators and one or more skid beams . each linear actuator may be connected to the base and a respective skid beam . each linear actuator may be hydraulic , such as a piston and cylinder assembly , or electric , such as a motor and ball - screw assembly . the skid beams may rest on the main deck 105 p in drilling mode . the base 230 may be slidable on the skid beams by operation of the linear actuators . additionally , the modu 100 may include riser pipe for assembly and deployment of a riser string ( see fig2 c ). further , the modu may include production tubing ( not shown ) for assembly and deployment of a production tubing string . further , the modu may include a subsea wellhead and a subsea production tree ( a . k . a . christmas tree ), such as a vertical or horizontal tree for deployment to the wellhead . the modu 100 may prepare , drill , and complete a subsea wellbore . alternatively , the modu 100 may be deployed for workover of an existing subsea wellbore . fig4 a is a plan view of the mezzanine deck 105 z . the mezzanine deck 105 z may include crew quarters and crew facilities , such as a washroom , toilets , locker room , and utility room . fig4 b is a plan view of the machinery deck 105 m . the machinery deck 105 m may include a diesel / electric power system including diesel drivers and electric generators and a plurality of electrical control panels . the machinery deck may further include one or more mud pumps and one or more mud tanks , one or more reserve mud tanks , pre - load / ballast tanks , dry mud containers , dry cement containers , one or more cement blenders , and one or more cement pumps . the machinery deck may further include additional crew quarters and facilities , such as a galley , mess hall , cinema , and gym . fig4 c is a plan view of the tank deck 105 t . the tank deck 105 t may include mud pit cellar tanks , drilling water tanks and fuel oil tanks . the tank deck may further include additional pre - load / ballast tanks . further , electrical cables and piping ( not shown ) may extend between the decks 105 p , z , m , t and the des 150 for transferring fluids and electricity . fig4 d is a plan view of a lower level 130 l of the cabin 130 . fig4 e is a plan view of an upper level 130 u of the cabin 130 . fig4 f is a plan view of the helipad . the cabin 130 may include crew quarters , a hospital , offices , a lounge , an emergency generator , a utility room , a control house , a conference room , a waiting area for the helipad , and an hvac system . fig5 a - d illustrate the des 150 being deployed in tender assist drilling mode . fig5 a is a plan view of the main deck 105 p . in tender assist drilling mode , the des 150 may be located on an adjacent production platform 500 . the modu 100 may be connected to the platform 500 as if the des were in drilling mode , supplying drilling fluid and electricity to the des 150 . the modu 100 may be connected using one or more hawsers and one or more umbilicals . tender assisted drilling may be useful for workover of existing wells having the existing production platform 500 in place and connected to a subsea production tree ( not shown ). otherwise , the existing production platform 500 would have to be disconnected from the subsea production tree and moved so that the modu 100 could be moved over the production tree and connected to the tree . to move the des 150 from the modu 100 to the platform 500 , the des 150 may be disassembled as discussed above . the des 150 may be disassembled prior to towing the modu 100 to the platform 500 . the modu 100 may further include a telescopic personnel bridge 505 rotatable about the main deck 105 p for deployment to the platform 500 . fig5 b is a plan view of the modu 100 connected to a platform 500 . fig5 c is a profile view of the des 150 having been hoisted from the modu 100 and set on the platform 500 . fig5 d is a profile view of the des 150 in place over the platform &# 39 ; s moonpool . fig5 e is a perspective view of the modu 100 in tender assist drilling mode . the modu 100 may be moored and / or dynamically positioned in place adjacent the platform 500 . the telescopic bridge 505 , hawsers , and umbilicals may be deployed to the platform 500 . the base 230 , drilling floor 215 , process level 220 , and lower level 225 may then be hoisted by the crane 120 a onto the platform 500 . the crane 120 a may include an elevator and a tower so that the crane boom may be raised on the tower to accommodate height difference between the modu 100 and the platform 500 . the derrick 205 may then be hoisted by the crane 120 a onto the platform 500 . the des 150 may then be assembled . the des 150 may be assembled on an edge of the platform 500 and skidded to the platform &# 39 ; s moonpool using the skidding system 275 . the drill pipe 260 may be hoisted from the modu to the platform and loaded into the rig &# 39 ; s bins . alternatively , instead of the drilling rig , the modu 100 may include a j - lay tower ( not shown ) pivotably mounted to the main deck over the moonpool . the j - lay tower may be transported in a horizontal position and then raised to a vertical or near - vertical position for deployment of a subsea pipeline . alternatively , the modu 100 with the j - lay tower may be used to lay tendons for a tension leg platform . while the foregoing is directed to embodiments of the present invention , other and further embodiments of the invention may be devised without departing from the basic scope thereof , and the scope thereof is determined by the claims that follow .	1
preferred embodiments of the present invention will be described herein below with reference to the accompanying drawings . in the following description , well - known functions or constructions are not described in detail since they would obscure the invention in unnecessary detail . the present invention provides a method of supporting a seamless handover in a transport layer . fig2 illustrates a network configuration for data transmission under a seamless handover environment according to the present invention . referring to fig2 , a cn 270 is an end node in communication with an mn 260 by sctp / ip over internet 200 . according to the present invention , it is assumed that the mn 260 uses a data link layer protocol ( e . g . ieee 802 . 11a / b / g ) supporting wireless communications and routers 215 , 225 and 245 each have a wireless communication device ( e . g . an ap supporting an ieee 802 . 11a / b / g protocol ) in addition to a conventional router structure and is thus capable of wireless communication . the wireless communication devices are preferably incorporated into the routers 215 , 225 and 245 , or may be separately implemented . the routers 215 , 225 and 245 have their unique ip address ranges so that nodes connected to the routers 215 , 225 and 245 have unique ip addresses according to their connected routers . in ipv4 , a unique ip address is a public address , not a private address . in ipv6 , it is not a local address but a global unicast address . while not shown , the cn 270 can be connected to the router 245 by cable , instead of being connected wirelessly as shown . the routers 215 , 225 and 245 periodically send advertisement messages announcing their existence to nodes which want to access the routers . the advertisement messages contain the network addresses of the routers 215 , 225 and 245 . the advertisement messages , which are sent wirelessly with the network addresses of the routers 215 , 225 and 245 , cover areas 210 , 220 and 240 , respectively , because of their radio power levels . nodes within the coverage areas 210 , 220 and 240 of the routers 215 , 225 and 245 can acquire ip addresses by the periodic advertisement messages . the ip address acquisition is carried out by dynamic host configuration protocol ( dhcp ) in ipv4 . in ipv6 , a node generates an ip address on its own or acquires an ip address by dhcp as with ipv4 . dhcp is a protocol for allocating an ip address to a node by a router or a particular server . fig3 is a flowchart illustrating the mn &# 39 ; s operation for data transmission under a seamless handover environment according to the present invention . referring to fig3 , after a handover from the first area 210 ( area 1 ) to the second area 220 ( area 2 ), the mn 260 receives an add - ip - asconf - ack message in response to an add - ip - asconf message sent to the cn 270 in step 310 . upon receipt of a handover - conf message from the cn 270 in step 315 , it replies with a handover - conf - ack message in step 320 . the handover - conf message is a message confirming the handover of the mn 260 and the handover - conf - ack message is a response message for the handover - conf message , indicating whether the reception of the handover - conf message has failed or was successful . in step 325 , the mn 260 receives data from the cn 270 . then the mn 260 monitors reception of the data at a new ip address acquired after the handover in step 330 . if the data is not received at the new ip address , the mn 260 maintains its primary ip address in step 335 and sends a data ack message for the received data to the cn 270 in step 345 . if the data is received at the new ip address , the mn 260 updates the primary ip address to the new ip address in step 340 and sends the data ack message for the received data to the cn 270 in step 345 . fig4 is a flowchart illustrating the cn &# 39 ; s operation for data transmission under the seamless handover environment according to the present invention . referring to fig4 , the cn 270 receives the add - ip - asconf message from the mn 260 when the mn 260 moves from area 1 to area 2 and replies with the add - ip - asconf - ack message in step 405 . the cn 270 then sends the handover - conf message to the mn 260 in step 410 and monitors reception of the handover - conf - ack message for the handover - conf message from the mn 260 in step 415 . if the handover - conf - ack message is not received in step 415 , the process ends . upon receipt of the handover - conf - ack message in step 415 , the cn 270 sends data to the new ip address of the mn 260 set in the handover - conf message in step 420 . in step 425 , the cn 270 monitors reception of the data ack message for the data from the new ip address in step 425 . upon receipt of the data ack message from the new ip address , the cn 270 updates the primary ip address of the mn 260 to the new ip address in step 430 , and then the process ends . if the data ack message is not received from the new ip address , the cn 270 sends data to the primary ip address of the mn 260 in step 435 . the primary ip address is included in the handover - conf message . in step 440 , the cn 270 monitors reception of the data ack message from the primary ip address . if the data ack message is not received , the process ends . upon receipt of the data ack message form the primary ip address , the cn 270 maintains the primary ip address in step 445 and then ends the process of the present invention . fig5 illustrates the structure of the handover - conf message according to the present invention . each of specific numerals filled in the brackets denotes the size of a corresponding field , expressed as the number of bits . the terms “ chunk ” and “ message ” have the same meaning . referring to fig5 , a type 505 indicates the type of the message , i . e . indicates that this message is a handover - conf message . the type of the handover - conf message is valued as “ 0xc2 ”. a chunk flags 510 is reserved for setting a particular flag . in the present invention , one of the chunk flags 510 is used as a handover ( h ) bit 511 indicating whether the handover is confirmed . a chunk length 515 indicates the length of the message . a serial number 520 is the serial number of the message , ranging from 0 to 4294967295 ( the number equals 2 32 ) an address parameter # 1 525 provides the primary ip address of the mn 260 , and an address parameter # 2 530 provides the new ip address of the mn 260 acquired after the handover . fig6 illustrates the structure of the handover - conf - ack message according to the present invention . the handover - conf - ack message is a response for the handover - conf message . each of specific numerals filled in the brackets denotes the size of a corresponding field in the number of bits . referring to fig6 , a type 605 indicates the type of the message , i . e . indicates that this message is a handover - conf - ack message . the type 605 is set to “ 0x81 ” to indicate handover - conf - ack message . a chunk flags 610 is reserved for setting a particular flag . in the present invention , one bit of the chunk flags 610 is used as an h bit 611 to indicate whether the handover is confirmed . a chunk length 615 indicates the length of the message . a serial number 620 is the serial number of the message , ranging from 0 to 4294967295 . an address parameter # 1 625 indicates the primary ip address of the mn 260 and an address parameter # 2 630 indicates the new ip address of the mn 260 acquired after the handover . a handover - conf parameter response 635 indicates whether the reception of the handover - conf message has failed or was successful . fig7 illustrates a handover operation under the seamless handover environment according to the present invention . referring to fig7 , an mn 701 moves from area 1 to area 2 by handover in step 710 . the mn 701 in area 2 ( newly denoted by a reference numeral 702 ), i . e . the mn 702 , acquires a new ip address and notifies a cn 705 of the handover by an add - ip - asconf message in step 715 . the cn 705 replies to the mn 702 with an add - ip - asconf - ack message in step 720 and then sends a handover - conf message confirming the handover to the mn 702 in step 725 . upon receipt of the handover - conf message , the mn 702 replies to the cn 705 with a handover - conf - ack message in step 730 . in step 735 , the cn 705 sends data to the new ip address of the mn 702 set in the handover - conf message . the mn 702 sends a data ack message for the data to the cn 705 in step 740 . upon receipt of the data ack message , the cn 705 updates the primary ip address of the mn 702 to the new ip address of the mn 702 in step 750 . if the cn 705 fails to receive the data ack message and the mn 702 performs a handover back to area 1 in step 755 , the cn 705 sends data to the primary ip address in step 760 . the mn 701 in area 1 sends a data ack message for the data sent to the primary ip address to the cn 705 in step 765 . the cn 705 maintains the primary ip address of the mn 701 in step 770 and ends the process of the present invention . in accordance with the present invention as described above , when an mn moves to a new network area by handover and thus acquires a new ip address , it notifies a cn of the new ip address and the handover is confirmed by the cn . then the cn keeps or changes the primary ip address of the mn for data transmission , considering the handover . therefore , the mn seamlessly communicates with the cn with minimized data loss even under a handover environment . while the invention has been shown and described with reference to certain preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims .	7
the present application discloses a novel dual - homing technology for small industrial ethernet switches . this dual - homing technology is being implemented in the new magnum ™ esd42 switches by garrettcom , inc . of fremont , calif . the magnum ™ esd42 switches provide dual - homing for redundancy at the edge of the network for any attached nodes . the magnum ™ esd42 switches are unmanaged plug - and - play for simplicity , hardened and rugged for use in any industrial environment , physically small ( about the size of your fist ) to fit into any package , have mtbfs ( mean time before failures ) over 25 years for reliability , and are low in cost . redundancy at the edge of industrial networks is now easily accomplished using such switching technology . in ethernet lans ( local area networks ), dual - homing is a network topology in which a device is connected to the network by way of two independent access points ( points of attachment ). such a network topology is illustrated in fig1 . as depicted in fig1 , one access point ( the currently active port ) is the operating connection to the “ upstream ” network , and the other ( the currently passive port ) is a standby or back - up connection to the upstream network that is activated in the event of a failure of the operating connection . other ports of the switch may be connected “ downstream ” to various network nodes . advantageously , dual - homing adds reliability by providing a backup connection if the operating link fails . because a dual - homing switch has two attachments into the network , you have two independent media paths and two upstream switch connections available . using dual - homing , only one of the two attachment paths is active at a time . loss of the link signal on the operating port indicates a fault , and traffic is quickly moved to the standby connection to accomplish a fault recovery . fig2 depicts a magnum ™ esd42 dual - homing switch configured in a network topology in accordance with a specific embodiment of the invention . in the magnum ™ esd42 dual - homing switch , the two dual - homing ports ( port numbers 1 and 2 ) are peers . when the esd42 is powered up , port 1 is initially used for operation providing that it can establish a link signal . thereafter , all ethernet traffic upstream to and from the attached nodes is over port 1 , with port 2 in standby mode . normally , port 2 will be attached upstream and will have link enabled , ready to go into operation at any time . when there is a loss of link ( i . e . a loss of the link signal ) on port 1 , the esd42 dual - homing switch operates to move all of the traffic quickly to port 2 . thereafter , all ethernet traffic upstream to and from the attached nodes is over port 2 , with port 1 becoming available for back - up or standby after the fault is repaired and the link signal on port 1 is enabled again . once port 2 is in operation , it will stay in operation indefinitely . . . until it experiences a loss of link , whereupon the esd42 will move all of the traffic to port 1 to recover from the port 2 fault . the signal for the esd42 to switch traffic to the other dual - homing port is the loss of link on the operating port . there are no configuration variables or set - up choices associated with the esd42 dual - homing switch . it is plug - and - play . the dual - homing switch - over time is a few milliseconds , during which time the esd42 changes the state of its internal address buffers and notifies upstream devices of the change to the new operating port . advantageously , the operation of the esd42 is the same , no matter what brand or model of ethernet switch or switches is upstream . the dual - homing redundancy features of the esd42 are consistent with industry - standard ethernet and do not require garrettcom &# 39 ; s magnum ™ switches upstream . while garrettcom has more thoroughly tested the esd42 dual - homing switch with magnum ™ switches and s - ring ™ redundancy manager software and link - loss - learn ™ ( lll ) and ieee 803 . 1x rapid spanning tree protocol ( rstp ) self - healing lan software , some other ethernet switch products have been tested and have been found to work as well . a full recovery from the fault in the overall network is dependent upon the time used by the upstream switches to adjust to the movement of the nodes attached to the esd42 from one connection port to another . in testing the esd42 using some different brands of ethernet switches running industry standard rstp software , it has been found that this is usually less than a second . this rapid fault recovery is a substantially advantageous feature . fig3 shows example pseudo code for implementing dual - homing in a layer 2 switch in accordance with an embodiment of the invention . as shown at the beginning of the pseudo code , a first link ( link_ 1 ) is set 302 to be the active link ( operational path ), and a second link ( link_ 2 ) is set 304 to be the passive link ( standby path ). within the main loop of instructions , the link signal on the currently active link is read 306 , and if the link is up , then operation of the switch continues 308 without a switchover to the standby path . in alternate embodiments , the determination of whether a link is available to the upstream network on the currently active link may be performed by means other than by detecting the presence or absence of the ethernet link signal . in one alternate embodiment , this determination is made by detecting the presence or absence of a periodic “ heartbeat ” packet . in another alternate embodiment , this determination is made by detecting the presence or absence of traffic through the link . other suitable techniques may also be employed . however , if the link is down ( i . e . the “ else ” case ) 310 , then the status of the links are interchanged 312 in that the currently active link is set to passive status , and the currently passive link is set to active status . the currently active link may be set to the passive state by setting the port to drop all data traffic , or by dropping the ethernet link signal , or by other suitable techniques . the currently passive link may be set to the active state by setting the port so that it no longer drops all data traffic , or by turning on the ethernet link signal , or by other suitable techniques . in addition , the entire address table of the switch may be cleared 314 so that the switch re - learns which mac addresses correspond to which ports . alternatively , the switch may clear the address table and force a re - learn on the previously active port . in yet another alternate embodiment , the switch may move the learned addresses from the previously active port to the newly active port . furthermore , the switch sends 316 a “ spoof ” of each mac address out of the newly active link so that devices upstream in the topology are informed that packets destined to these mac addresses are to be sent to the newly active link ( instead of the previously active link ). advantageously , such address “ spoofing ” makes sure that the traffic originating in the upstream network takes the correct path and so enables the rapid fault recovery . the address spoofing may be performed by copying the mac addresses of the nodes and sending out broadcast or multicast packets to force the upstream network to learn the correct path for the addresses . alternatively , a suitably coded protocol packet may be sent out of the newly active port to force the upstream network to learn the correct path for the addresses . in industrial applications , popular redundant ethernet lans usually use a ring structure . fig4 depicts an example of such a ring structure of ethernet switches . a ring structure will recover from faults such as a ring media break or the failure of one switch in the ring . but , as depicted in fig5 , the failure of a switch in the ring takes down the nodes connected into that switch . additional up - time for any given node can be increased by connecting it to two switches in the ring , so that the node &# 39 ; s lan connection is maintained even when there is a failure of either switch in the ring . dual - homing can do this , as shown by the configuration of fig6 , so as to achieve improved lan connection time for critical nodes . in evaluating the improvement in connection time in ring structures , it should be noted that use of a dual - homing switch improves reliability in two ways . first , it uses two media connections into the lan so that media faults cause less down - time . second , the reliability of the little dual - homing switch itself ( which is a single point - of - failure for the attached nodes ) is much greater that the reliability of a large managed ethernet switch in the ring . it should also be noted that a dual - homing layer 2 switch provides connection flexibility that provides maintenance and service options . in order to upgrade a switch in a ring or to load new software , it may need to be temporarily taken out of service on a planned basis . during a planned outage , dual - homing can maintain the connection of critical nodes in a redundant lan , adding valuable up - time to overall operations and permitting service work to be done during normal work time . single ethernet rings can recover from only one fault at a time . where up - time needs to be increased to levels above what can be achieved with a single ring , some lan designs use two rings for greater redundancy . fig7 depicts a conventional dual ring topology . with two rings , there are two paths for lan traffic , providing the potential for recovery from more than one fault at a given time . dual ring configurations can sometimes be achieved at little cost increase by breaking up a large ring into two smaller rings . in a dual ring topology , dual - homing of selected high - availability nodes is highly desirable and is easily implemented by using a dual - homing layer 2 switch in accordance with an embodiment of the invention . such a configuration is depicted in fig8 . the up - time requirements in these applications make cost considerations secondary . there have been a few special - purpose dual - homing plcs and dual - nic computers available , and these have often been called into service where complex dual ring lans were being designed and used . now , dual - homing switches enable any ethernet - enabled edge device with a single nic to have the advantage of dual - homing up - time . as shown in fig8 , to use a dual - homing es42d switch in a dual ring lan , connect port 1 into any switch in one ring and port 2 into any switch in the other ring . the same fault - recovery logic as for single rings is used in handling fault conditions for dual - homing switches used in dual ring lans . loss of link on the operating port causes the dual - homing switch to move all traffic on the upstream connection to the standby port , making it the operating port . for redundant lan structures more robust than rings , a mesh can provide advantages . fig9 depicts an illustrative mesh topology . meshes can be made very complex almost without limit , with many switches and multiple interconnects adding to the fault recovery capability to achieve operations even with multiple faults . of course , the cost of the ethernet lan equipment and cabling used in constructing the mesh goes up as the complexity increases . if cost is no problem , meshes can be good solutions for high - availability networks . in a mesh structure , dual - homing provides the capability to insert selected critical nodes that are connected to two switches so as to maintain connectivity into the lan even when one switch or one media link fails . fig1 depicts a dual - homing switch utilized within a mesh topology in accordance with an embodiment of the invention . a simple mesh is sufficient to illustrate the principles of meshes for redundancy . the same fault - recovery logic in the dual - homing switch as for single ring and dual ring structures applies for meshes . of course , the connectivity and correspondingly increased up - time gain in a mesh is the same for a dual - homing switch as it is for any other switch in the mesh . note that every switch in a mesh has at least two connections into the lan , and can therefore support continued operation of its attached nodes if a connection switch or media fails . the reliability advantage of the dual - homing switch in a mesh comes from the fact that it is a small , simple , inherently much more reliable device than the typical managed mesh switch . another useful application for a dual - homing switch is to provide for media redundancy . where there is significant risk of media faults ( for example , where the media is attached to a movable device and is flexed during normal operation , or where undependable wireless interconnects are utilized , or where part of the media path is exposed in a high - security situation ), media redundancy adds essential connectivity uptime . fig1 depicts an example configuration of a dual - homing switch utilized for media redundancy in accordance with an embodiment of the invention . for media redundancy , both ports 1 and 2 ( the operating port and the standby port ) are connected to the same switch upstream . media types for ports 1 and 2 may be copper or fiber , may be the same or may be different , and different media types ( such as wireless ) may be inserted so long as the link signal is passed through to provide a reliable signal for switchovers between the operating and standby ports of the esd42 . the present application discloses a dual - homing ethernet switch . using such a switch , the dual - homing function may be advantageously moved from the node into the layer 2 switch . this enables the designer of redundant lans to pick any industrial control device ( i . e . node ) that has an ethernet port ( not just those few designed with dual nics configurable for dual - homing ) and make it dual - homing for increased reliability and up - time . such a new dual - homing switch provides a new plug - and - play redundancy tool , making new design options and choices available . many more industrial scada ( supervisory control and data acquisition ) devices can now be used creatively in redundant lans , and more robust lans are made cost effective and less complex with this new tool . in the above description , numerous specific details are given to provide a thorough understanding of embodiments of the invention . however , the above description of illustrated embodiments of the invention is not intended to be exhaustive or to limit the invention to the precise forms disclosed . one skilled in the relevant art will recognize that the invention can be practiced without one or more of the specific details , or with other methods , components , etc . in other instances , well - known structures or operations are not shown or described in detail to avoid obscuring aspects of the invention . while specific embodiments of , and examples for , the invention are described herein for illustrative purposes , various equivalent modifications are possible within the scope of the invention , as those skilled in the relevant art will recognize . these modifications can be made to the invention in light of the above detailed description . the terms used in the following claims should not be construed to limit the invention to the specific embodiments disclosed in the specification and the claims . rather , the scope of the invention is to be determined by the following claims , which are to be construed in accordance with established doctrines of claim interpretation .	7
useful materials for the heat - recoverable sheet of this invention are typically comprised of a semicrystalline crosslinkable polymer , such as polyolefins ( e . g ., polyethylene ), polyesters ( e . g ., polyethylene terephthalate ), or polyamides ( e . g ., nylon ), which has been stabilized against ultraviolet and oxidative degradation . blends of a non - crystalline polymer ( e . g . neoprene ) with a semicrystalline polymer ( e . g . polyethylene ) are also useful as heat recoverable sheet materials . in the case of polyethylene and other polymers which are crosslinkable with radiation without significant degradation , electron beam crosslinking is highly desirable for web or tube processing and precision control of crosslinking chemistry . radiation crosslinked materials generally contain a pro - rad ( a multifunctional acrylate or allylic monomer ) to enhance the dose / modulus response and a loading of carbon black for increased reinforcement and thermal conductivity . chemically crosslinked polymers , e . g ., silane , peroxide , etc . are also useful . orientation of such materials typically follows the extrusion and crosslinking steps and must be performed at temperatures above the crystalline melt temperature of the composition . the orientation locks into place when the material is cooled in its stretched state . generally stretch ratios of up to about 8 are possible to accommodate transitions in diameter with recovery forces ranging up to about 15 pounds per linear inch , which can be controlled by the extension ratio and the crosslink density . the crosslinked pressure - sensitive adhesive useful as the closure adhesive in the heat recoverable sheet materials of this invention will be described in more detail below . several adhesives useful in this invention are described in u . s . application ser . no . 752 , 950 , filed concurrently herewith and incorporated herein by reference thereto . the acrylate terpolymers useful in the crosslinked adhesives of the present invention are of the general type disclosed in u . s . pat . no . 4 , 404 , 246 . the preferred long chain alkyl acrylate ester of type ( i ) is isooctyl acrylate . the preferred short chain alkyl acrylate esters of type ( ii ) are ethyl and / or n - butyl acrylates . the preferred acidic monomer of type ( iii ) is acrylic acid . the inclusion of the alkyl acrylate ester having from 1 to 4 carbon atoms in the alkyl group has been found to permit increased levels of the acid monomer , typically the hardening monomer because of the acid functionality , to be present without embrittlement of the composition upon crosslinking or total loss of tackiness thereof prior to crosslinking . the relative amounts of monomers selected from each of the three types are selected to achieve the optimum adhesive properties for a given adhesive application . in general , the terpolymers are comprised of a major amount of the long chain alkyl acrylate of type ( i ), a minor amount of a short chain alkyl acrylate of type ( ii ), and an even more minor amount of the acidic monomer of type ( iii ). the preferred terpolymers are comprised of about 50 to about 60 % by weight of the long chain alkyl acrylate , from about 32 to about 42 of the short chain alkyl acrylate , and from about 8 to about 13 % by weight of the acidic monomer . the terpolymer can be prepared by the addition polymerization of the desired monomers . the addition polymerization is preferably accomplished by the use of a photoinitiator and electromagnetic radiation ( e . g ., uv , ir , microwave , etc .) in amounts sufficient to obtain a terpolymer of the desired molecular weight . particular techniques of polymerization are disclosed in u . s . pat . no . 4 , 181 , 752 , the disclosure of which is incorporated herein by reference . the adhesive composition also includes a crosslinking agent in an amount from about 0 . 7 % to about 10 % by weight of the terpolymer , preferably about 1 % to about 8 %. amine formaldehyde condensates , e . g . lower - alkoxylated ( c 1 - 4 alkyl groups ) amine formaldehyde condensates are suitable crosslinking agents . an example of such a crosslinking agent is hexamethoxymethylmelamine , commercially available as cymel 303 from american cyanamid ( hereinafter cymel 303 ). further examples include tetramethoxy methyl urea , commercially available as beetle 65 , or tetrabutoxy methyl urea , commercially available as beetle 85 , both from american cyanamid . the alkoxylated crosslinking agent is particularly effective in amounts within the range of about 1 to about 6 % by weight of the terpolymer . the amount of crosslinking agent is preferably selected to range from about 5 % to about 15 %, on an effective equivalent basis based on the number of equivalents of acid monomer available for crosslinking . for example , cymel 303 is known to have a theoretical molecular weight of 390 grams per mole and an effective equivalency of 2 . 2 which leads to an effective equivalent weight of 177 . 3 grams per equivalent . this figure is then used to compute the amount of cymel 303 needed to react with the available acidic monomer in the terpolymer . when the preferred terpolymers useful in this invention are employed the most preferred levels of cymel 303 range from about 2 % to about 5 % by weight of the terpolymer . lower levels of crosslinking agent may provide insufficient internal strength for some applications and higher levels of crosslinking agent reduce the initial tack of the adhesive and are insufficient in increasing the crosslink density of the crosslinked adhesive due to low diffusion rates in the crosslinking composition . other suitable crosslinking agents include chromophore - substituted halomethyltriazines , e . g . 4 ( 3 , 4 - dimethoxyphenyl ) bistrichloromethyl - s - triazine . because such triazines absorb uv light , the amount of the crosslinker used should be adjusted along with the amount of uv light and photoinitiator to obtain the desired degrees of polymerization and crosslinking of the terpolymer . mixtures of crosslinking agents , particularly cymel 303 and the above - described triazine , are also within the contemplation of this invention . indeed , a mixture of an amine formaldehyde condensate and a bistrihalomethyltriazine is the preferred crosslinking agent . while the triazine crosslinker component tends to crosslink during the uv polymerization of the acrylate terpolymer , it has been found that such crosslinking , unlike amine formaldehyde condensate crosslinking , does not detrimentally reduce the tack of the acrylate terpolymer . this is believed to be due to the more uniform distribution of triazine crosslinks ( crosslinking by uv presumably occurs through the alpha hydrogen atoms of the acrylate molecule ) which allows longer segments of uncrosslinked terpolymer to move freely and thereby provide tack . still other suitable crosslinking agents include the polyfunctional acrylate monomers , e . g , pentaerythritol tetra - acrylate , that can be copolymerized with the components of the terpolymer or graft polymerized onto a prepolymerized terpolymer . when the crosslinking agent used is a polyfunctional acrylate , the amount thereof should be kept to amounts less than about 3 % by weight of the terpolymer , preferably less than 2 % by weight . a polyfunctional acrylate monomer is any compound having two or more acrylate or metacrylate functionalities per molecule . suitable polyfunctional acrylates are the acrylate esters of polyols . specific polyfunctional acrylates include ethylene glycol diacrylate or dimethacrylate , glycerol triacrylate or trimethacrylate , trimethylol propane triacrylate or trimethacrylate , as well as the preferred pentaerythritol tetra - acrylate . the adhesive of the present invention can be applied to a heat - recoverable closure in any manner that will ensure that the closure will remain closed during the recovery process . the preferred means of applying the adhesive to the closure involves the application of an adhesive tape of this invention to the closure . the adhesive can be deposited on a carrier backing and / or a release liner as a tape for application to the heat - recoverable substrate . the adhesive tape of this invention can be manufactured via a procedure as taught in u . s . pat . no . 4 , 181 , 752 . in such a procedure , a mixture of the aforementioned monomers and an effective amount of a photoinitiator is partially polymerized by ultraviolet radiation to provide a syrupy composition having a coatable viscosity , e . g ., from about 300 to 20 , 000 cps . the aforementioned crosslinking agent is added and the resulting mixture is coated on a release liner . the adhesive is also preferably impregnated into a reinforcing web . the reinforcing web is impregnated with the adhesive by any means sufficient to substantially saturate the web with adhesive . the reinforcing web is preferably impregnated with the adhesive by the procedures disclosed in u . s . pat . no . 4 , 181 , 752 . the impregnated reinforcing web is preferably contacted by at least one release liner having a low adhesion surface and from which the reinforcing web can be applied to the heat - recoverable substrate . in a particularly preferred embodiment , the reinforcing web is impregnated with the partially polymerized monomer mixture and fed between two polyethylene terephthalate ( pet ) release liners ( such as mylar film , available from dupont , pretreated with a silicone release agent ) which sandwich the impregnated web . the release liners are pressed against the web to ensure that little if any occluded air is present to inhibit the final polymerization . the entire sandwich structure is then exposed to ultraviolet radiation to complete the polymerization . the adhesive is exposed to ultraviolet radiation in an inert environment to complete the copolymerization thereby providing a pressure - sensitive heat - activatable adhesive tape which can be immediately wound upon itself into a roll form for storage or shipment . crosslinking of the amine formaldehyde condensate is easily avoided since very little heat is generated by the polymerization exotherm associated with this process . in addition to this preferred process , the monomer mixtures can be also polymerized with conventional peroxide - initiated solution polymerization techniques . the reinforcing web is a porous flexible sheet material which is saturated with the adhesive and which maintains its structural integrity in at least one direction when subjected to the temperatures used to cause a heat - recoverable closure to recover , i . e . the direction of recovery . examples of suitable reinforcing webs include fibrous webs of fiberglass and / or polyester . these webs may be non - woven or loosely woven , e . g . woven loosely enough to allow easy penetration of the non - polymerized adhesive solution . preferred webs are the woven fiberglass scrims and woven fabrics of fiberglass and polyester wherein all parallel threads are of the same fiber materials , i . e ., the warp is fiberglass and the fill is polyester or vice versa . the adhesive web can be applied to the closure sheet in a variety of ways to secure the sheet during the recovery thereof . for example , a portion of the adhesive - coated carrier backing can be placed , adhesive face down , upon a sheet transverse to the direction of recovery which has been wrapped a partial turn around the structure to be enclosed . the carrier backing is removed and the wrapping of the sheet is then continued such that the remainder of the sheet is allowed to completely overlap the adhesive . in this particular embodiment , the adhesive layer is interposed between layers of heat - recoverable material to maintain the closure , i . e ., there is an interposed adhesive layer . a second layer of adhesive can be applied to the surface of the sheet which will contact and overlie the first adhesive after the wrapping is completed , but the use of such a second layer is not necessary . fig1 shows a substrate 1 about which a portion 2 of the sheet has been wrapped . an adhesive layer 3 has been placed upon the portion 2 of the sheet transverse to the direction of recovery such that completion of the wrapping will place the remaining portion 4 of the sheet over the adhesive layer 3 . fig2 shows a cross - section of the completed closure with portion 2 of the sheet underlying the adhesive layer 3 which in turn underlies portion 4 of the sheet , i . e ., the adhesive layer 3 contacts the opposing faces of the two overlapped layers 2 and 4 of the sheet . the adhesive is then activated by the application of heat which also serves to cause the sheet to recover . of course , that portion of the sheet overlying the adhesive should be heated first to activate the adhesive before the rest of the sheet is heated to produce substantial shear force at the closure of the sheet . when the adhesive does not contain a thermal crosslinking agent , e . g . cymel 303 , the heating of that portion of the sheet overlying the adhesive before the rest of the sheet is heated is still preferred . the heat will soften the pressure - sensitive adhesive to allow better melting of the sheet material and so enhance the adhesion thereof . alternatively , the heat - recoverable sheet can be completely wrapped around the structure to be enclosed with the carrier tape applied to the longitudinal seam at the end of the circumferential wrap . in this embodiment , the adhesive layer is on the exterior of the closure , i . e . there is an exterior adhesive layer . fig3 shows substrate 5 about which portion 6 of the sheet has been wrapped . an adhesive layer 7 extends from the edge of the remaining portion 8 of the sheet . fig4 shows the adhesive layer 7 overlapping both portions 6 and 8 of the heat - recoverable sheet to maintain the closure thereof . when applied in this manner , the reverse face 9 of the adhesive layer 7 , i . e . that face not in contact with the sheet , is preferably covered with a flame retardant backing , which will prevent exposure of the adhesive to the flame used to cause the sheet to recover . a flame retardant backing is any backing which will not propagate a flame when exposed to the heat necessary to cause the sheet to recover . suitable flame retardant backings include synthetic fabrics such as kevlar from dupont and coatings such as highly loaded carbon black in acetone acryloid . a particularly preferred flame retardant backing is woven cotton fabric pretreated with a flame retardant such as diammonium phosphate . in accordance with the foregoing , the use of a terpolymer having higher than conventional acid functionality and the use of elevated levels of the alkoxylated condensate crosslinking agent and / or the use of a triazine crosslinking agent allow the formulation of a composition which is moderately tacky , thus allowing easy repositionability , but which is capable upon heating of crosslinking rapidly to a stiff composition which is nonflowable and provides substantial shear and peel resistance . it has been found desirable to incorporate in the adhesive composition a reinforcing filler . such fillers include chemically inert solids , generally particulate or fibrous solids . general examples include glass fibers , microfibers , mineral fibers , glass beads or bubbles , clay , metal oxides and the like . these may also be treated with a surface active agent , e . g . a vinylsilane , to enhance surface wetting of the filler by the adhesive thereby providing better reinforcement . a particulary preferred example of a reinforcing filler is cab - o - sil which is a fumed silica , commercially available from cabot corp . levels of reinforcing filler range from about 2 % to about 7 % by weight preferably 3 % to 6 %. amounts less than about 2 % are often insufficient to reinforce the adhesive and amounts in excess of 7 % may cause problems in processing due to the high content of non - liquid materials of the composition . the filler is incorporated into the adhesive composition prior to polymerization to reinforce the adhesive when crosslinked , much like carbon black in rubber or elastomer compositions . when such a filler is incorporated , the thixotropic mixture obtained does not require the aforementioned prereaction to afford an increase in coating viscosity , and as a result is capable of wetting a reinforcing web more quickly and thoroughly . it has been found that to achieve consistently superior bonding of the pressure - sensitive heat - activatable adhesive to low surface energy heat - recoverable sheet materials , e . g ., polyolefins , during the recovery process , a primer must be utilized . a primer is not necessary for heat - recoverble sheet materials from polyesters or polyamides which have high surface energies . the surface of the heat - recoverable closure to which the adhesive is to be applied is therefore preferably primed prior to the application of the adhesive of this invention . the priming of the sheet material can be accomplished by the procedures described in u . s . ser . no . 583 , 896 , filed feb . 27 , 1984 , now u . s . pat . no . 4 , 563 , 388 , incorporated herein by reference . this priming of the closure is achieved by graft polymerizing to at least a portion of the closure at least one monomer selected from the group consisting of acrylic acid , methacrylic acid , and esters thereof ; acrylamide , methacrylamide ; sterically non - hindered tertiary alkyl acrylamides and methacrylamides ; secondary alkyl acrylamides and methacrylamides having three or less carbon atoms in the alkyl group ; and n - vinylpyrrolidone . the graft polymerization is preferably conducted by coating the desired portion of the substrate with a composition comprises of at least one of the above monomers and irradiating that coated portion with ionizing radiation , e . g ., electron beam radiation . the preferred primer composition is comprised of a major amount of n , n - dimethylacrylamide , and minor amounts of an alkoxy methylolamino compound , e . g ., cymel 303 available from american cyanamid , a polyacrylate , e . g ., trimethylolpropane triacrylate , an alkanol , e . g , n - butanol and trace amounts of a surfactant and an acid or mineral chain transfer agent , e . g ., nitric acid or salts of silver , copper , etc . primer can be applied to the heat - recoverable sheet by utilizing , for example , a fine knurl gravure coater and irradiated as a thin , nearly invisible film by electron beam . the thinnest coating possible is most desirable to optimize product appearance and effectiveness of the primer , i . e ., the amount of primer on the heat recoverable sheet is preferably minimized . heat - recoverable sheets used as wrap - around closure members are typically coated on their inner surface with a thermally activatable adhesive or mastic which is caused to flow into voids and irregularities on the attaching substrates surface by the shrinking tension of the sleeve during heat recovery . the heat activated mastic or sealant in effect acts to hermetically seal the cable once the sleeve is shrunk in place . the adhesive or mastic should melt and be flowable at a temperature below the shrink temperature of the sleeve to facilitate rapid shrinkage of the backing , be fluid in the 300 °- 350 ° f . range and yet possess high cohesive strength at 60 ° c . while under pressure . the adhesive or mastic should also adhere tenaciously to both lead and polyethylene and / or polyvinylchloride . while our closure can function with a wide range of sealants or mastics for various applications , a preferred heat activatable adhesive is based on a blend of an amine - terminated polyamide and an ethylene / acrylic acid copolymer . the procedures used to prepare and test the following examples are described below . in the following examples , all amounts are expressed in terms of parts by weight . a mixture of isooctyl acrylate ( ioa ), butyl acrylate ( ba ) and acrylic acid ( aa ), in the amounts shown in the tables , was placed in a glass jar and swirled gently to mix . to this was added 0 . 1 part by weight of 2 - phenyl - 2 , 2 - dimethoxyacetophenone ( irgacure 651 ) photoinitiator and the indicated amounts of hexamethoxymethyl melamine ( cymel 303 ) and / or 4 ( 3 , 4 - dimethoxyphenyl )- bistrichloromethyl - s - triazine or pentaerylthritol tetra - acrylate ( peta ) as crosslinker . after each of these additions the jar was swirled until the material was observed to be in solution . the indicated amount of fumed silica (&# 34 ; cab - o - sil &# 34 ; m5 ) was added incrementally with swirling to &# 34 ; wet out &# 34 ; each portion and the mixture was subsequently sheared until a solution of coatable viscosity was obtained . the solution was next coated into a loosely woven fiberglass scrim to a thickness of 10 mils between 0 . 05 millimeter thick transparent biaxially - oriented films of polyethylene terephthalate , the facing surfaces of which had been previously treated with a release agent . exposure to ultraviolet radiation which continued for 13 minutes beyond the observed exotherm substantially completely polymerized the fiberglass scrim - reinforced coating to a pressure - sensitive adhesive state . alternatively , the solution was coated as described above , but without the inclusion of a fiberglass scrim . a strip of fiberglass scrim - reinforced tape was adhered by its adhesive layer to a primed polyethylene substrate by firm hand pressure applied through the end of a tongue depressor with a free end of tape extending beyond the substrate and the adhesive contact bond area being 1 inch by 1 / 2 inch . when the testing is to be done at an elevated temperature , this substrate was first adhered to stiff aluminum to impart rigidity while testing . an alternate method was to use the adhesive layer of a fiberglass scrim - reinforced tape to bond two freshly cleaned aluminum strips together with a bond area of 1 inch by 1 / 2 inch . the bond was tested in shear in an instron tensile tester at a jaw separation rate of about 1 millimeter per second . pairs of adhesive discs , each disc 1 1 / 4 inch in diameter and 1 / 8 inch in thickness , were prepared by repeatedly layering sheets of polymerized adhesive which contains no fiberglass using firm hand pressure applied through the end of a tongue depressor until the required thickness was obtained or by using ultraviolet radiation to cure unpolymerized adhesive solution which had been poured into appropriately sized wells and covered with a release agent treated transparent biaxially - oriented film of polyethylene terephthalate for 13 minutes beyond the observed exotherm . one of each pair of adhesive discs had a 3 / 8 inch diameter hole punched in its center which accomodates the shaft of the metal disc in a monsanto oscillating disc rheometer ( odr ). the other adhesive disc was placed on top of the odr disc . the chamber , which had been previously heated to a temperature sufficient to crosslink the adhesive , was closed and the metal disc was started oscillating through an arc of 3 degrees . the test was continued until the generated graph indicated that a peak had occurred or until it became obvious that no peak was likely to occur . a strip of fiberglass scrim - reinforced tape was adhered to either a primed polyethylene substrate or a freshly cleaned aluminum substrate using firm hand pressure applied through the end of a tongue depressor and leaving a long end free . when testing was to be done at an elevated temperature from primed polyethylene , this substrate was first adhered to stiff aluminum to impart rigidity while testing . the free end of the tape was grasped by the jaws of an instron tensile tester while the substrate was restrained in an apparatus which ensures a peelback of 90 degrees . the tape was pulled from the substrate at a rate of about 1 millimeter per second . a 1 inch diameter disc weighing about 0 . 3 g was cut from a sheet of polymerized adhesive which contains no fiberglass or other reinforcing scrim . the adhesive was optionally aged in an oven at 150 ° f . for the number of days shown in each table and / or optionally cured at 350 ° f . for 4 min . prior to testing , as shown in the tables . the disc was accurately weighed and then placed in a 4 oz . jar containing 30 g of methyl ethyl ketone ( mek ) and allowed to swell at room temperature for 24 hours . the disc was then removed from the mek and accurately weighed . the amount of mek absorbed by the adhesive disc sample was calculated using the following equation : ## equ1 ## closure strips were prepared for application testing by laminating a suitably flame retardant cotton cloth ( boot duck 2818 / 40 available from burcott mills , chicago , ill ., saturated with a solution of diammonium phosphate and dried ) to one side of each of the fiberglass scrim - reinforced tapes ( examples 1 - 15 ) and then trimming them into strips 1 . 5 inches wide and 12 inches long . sleeves were prepared from graft - primed ( primed in accordance with example 27 of u . s . application ser . no . 583 , 896 , filed feb . 27 , 1984 , now u . s . pat . no . 4 , 563 , 388 ) polyethylene heat - recoverable sheet material having the characteristics shown below : the sheet material had a 20 mil layer of extruded hot melt on the reverse side . the sheet was trimmed to 12 inches in the &# 34 ; cable length &# 34 ; direction and 9 inches in the &# 34 ; circumferential &# 34 ; or &# 34 ; recovery &# 34 ; direction to form a sleeve . the tape was then 1 / 2 lapped to one edge of the sleeve , the sleeve was wrapped circumferentially around a 1 . 9 inch diameter cable and overlayed an inch before mating the remaining 1 / 2 lap of exposed tape to the backing surface thus creating a closed and overlapped sleeve of 2 . 6 inches in diameter . the closure strip was rubbed firmly with a tongue depressor to ensure uniform contact to the backing surface . a mapp ( stabilized methylacetylenepropadiene available from airco , inc ., murray hill , n . j .) gas torch with a bushy flame was used to shrink the sleeve down on to the cable . the heat was applied to the area of the closure strip first to activate the adhesive and then to the sleeve backing . the geometry chosen allowed the sleeves to recover about 25 %, leaving a residual recovery force of about 5 . 4 pli which the closure strips must hold . the sleeves were heated for about 3 - 5 minutes to ensure activation of the hot melt and it is at this point that the viscosity thins sufficiently to transfer substantially all of the recovery force substantially to the closure strip . if the tape closure held this force it passed the test ( h = hold ), if it opened up it failed ( r = release ). it should be noted that an r rating , e . g ., a release , may be due to primer and / or sheet failure as well as adhesive failure such that an r rating does not necessarily denote failure of the adhesive of this invention . the results of examples 1 - 15 are shown in table i , below . table i__________________________________________________________________________ example 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15__________________________________________________________________________ioa 52 55 52 53 55 52 52 55 55 55 55 55 55 55 55ba 32 35 32 34 35 32 32 35 35 35 35 35 35 35 35aa 16 10 16 13 10 16 16 10 10 10 10 10 10 10 10cymel 303 3 . 5 2 . 2 2 . 36 2 . 4 1 . 48 2 . 36 3 . 5 2 . 2 1 . 48 2 . 2 -- -- -- -- 0 . 5cab - o - sil m5 6 6 6 5 6 4 4 4 4 4 6 4 4 4 4xl - 353 -- -- -- -- -- -- -- -- -- -- -- 0 . 1 0 . 15 0 . 20 0 . 1aged time ( days ) swelling index ( q ): 0 19 . 1 17 . 8 17 . 9 22 . 5 14 . 3 20 . 9 17 . 9 -- -- -- -- 13 . 06 15 . 52 15 . 30 8 . 04 1 3 . 73 4 . 79 4 . 2 4 . 43 5 . 54 4 . 03 4 . 07 7 . 12 8 . 21 -- -- -- -- -- -- 3 2 . 54 3 . 54 3 . 12 3 . 47 4 . 33 3 . 39 2 . 97 4 . 27 4 . 97 -- -- -- -- -- -- 5 2 . 36 2 . 92 2 . 89 3 . 11 3 . 86 3 . 03 2 . 64 3 . 68 4 . 36 -- -- -- -- -- -- 10 1 . 90 2 . 5 2 . 48 2 . 54 3 . 03 2 . 74 2 . 21 3 . 16 3 . 67 -- -- -- -- -- -- cured at 350 ° f ., 2 . 23 3 . 33 2 . 91 3 . 56 5 . 93 4 . 97 3 . 39 8 . 89 9 . 21 4 . 18 -- -- -- -- 6 . 164 minutessleeve test r r h r h h r h r h r h -- -- h__________________________________________________________________________ the dynamic shear , rheological properties and peel adhesion values were measured for a terpolymer of ioa / ba / aa : 52 %/ 32 %/ 16 %, respectively , with varying amounts of cymel 303 crosslinker and cab - o - sil reinforcing filler to show the effect of these components . examples a and b without a crosslinker are shown for comparsion . table ii__________________________________________________________________________cymel 303 cab - o - sil odr shear peelexample ( wt %) ( wt %) ( in .- lb .) 23 ° c . 180 ° c . 23 ° c . 180 ° c . __________________________________________________________________________16 2 . 5 -- 16 . 8 -- -- -- -- 17 3 . 5 -- 20 . 4 120 22 4 1 . 518 3 . 5 6 30 . 0 -- -- -- -- 19 5 . 0 -- 24 . 2 -- -- -- -- a -- -- 4 . 0 -- -- -- -- b -- 6 6 . 6 -- -- -- -- __________________________________________________________________________ the rheological properties at 180 ° c . of a fully cured terpolymer of ioa / ba / aa : 53 %/ 36 %/ 11 % cured with varying levels of cymel 303 are shown in table iii . the results show that the effect of additional crosslinking agent is linear up to about 1 / 8 equivalent but falls off asymptotically at levels above 1 / 8 equivalent . table iii______________________________________ cymel 303 odrexample ( wt %) ( equiv . fraction ) ( in - lb ) ______________________________________20 13 . 5 1 / 2 32 . 921 6 . 8 1 / 4 27 . 522 3 . 4 1 / 8 21 . 223 1 . 7 1 / 16 12 . 124 0 . 8 1 / 32 8 . 125 0 . 4 1 / 64 6 . 0______________________________________ the swelling measurement ( q ) and sleeve test evaluation of a fully cured terpolymer ( prepared with and without a reinforcing fiberglass scrim ) of ioa / ba / aa : 55 / 35 / 10 parts by weight 4 parts by weight cab - o - sil , 0 . 1 parts by weight irgacure 650 , prepared as described above and using as a crosslinker varying parts of peta per 100 parts psa as indicated are shown in table iv . the sleeve test was conducted with a sheet material which has a shrinkage force of 4 . 8 pounds per inch when it shrinks from 2 . 59 inch in diameter to a cable of 1 . 35 inch in diameter . table iv______________________________________ peta ( parts per swelling test onexample no . 100 parts psa ) index sleeve______________________________________26 0 . 1 8 . 07 h27 0 . 2 6 . 00 h28 0 . 4 5 . 08 h29 1 3 . 17 h30 3 1 . 71 r31 5 1 . 26 r______________________________________ tapes with three or more parts of peta crosslinker per φ parts psa show a release ( r ) rating on the sleeve test . swelling measurements were carried out on tape samples corresponding to the sample of example 27 and the results are reported in the table v . table v______________________________________example aged ( days ) swelling index , q______________________________________32 2 5 . 6633 5 6 . 1734 13 4 . 9035 20 5 . 6036 35 5 . 69______________________________________ the tapes crosslinked by peta showed very little change in swelling index , while tapes which contained cymel as a crosslinker , e . g , examples 1 - 10 , showed a significant decrease in swelling index .	2
in fig1 a portion of an outboard motor steering system 10 is shown attached to an outboard motor 12 . the motor 12 is attached to the boat transom 11 with a conventional mounting bracket 9 . the mounting bracket 9 includes a tilt tube 8 which is a horizontal pivot by which the motor is attached to the mounting bracket and about which the motor may be tilted out of the water . a steering arm 13 extends forwardly from the motor 12 and over the transom for operative connection to the steering system 10 . the tilt tube 8 also functions as a guide tube 15 for the steering system 10 . the steering system per se is not a part of the subject invention and a full and complete description of its operation is unnecessary for a proper understanding of the invention . however , a brief description of one aspect of the steering system operation , which directly involves the linkage on which the connector of the subject invention is used , will be described briefly . in a so - called &# 34 ; push - pull &# 34 ; cable steering system of the type illustrated , operator movement of the steering wheel ( not shown ) imparts an axial push or pull movement to a steering cable 14 which is slidable axially in the guide tube 15 . an output ram 16 extends axially from the opposite end of the guide tube 15 and the output ram may be an integral extension of the cable 14 or operate as a result of internal hydraulic forces . relative axial movement of the output ram 16 with respect to the guide tube 15 will impart corresponding movement to the connected link rod 17 and , in turn , to the steering arm 13 attached to the other end of the link rod . a similar steering mechanism may be utilized in a stern drive motor which , as is well - known , is attached to the outboard face of the transom and includes a steering arm which extends through the transom for connection to the steering system . the guide tube 15 in a stern drive embodiment , is attached to the inboard face of the transom . in other respects , particularly those relevant to the subject invention , the operation is essentially the same . the link rod 17 typically has a long main body portion 19 which terminates in an apertured end 20 by which it is attached to the steering arm 13 with a bolted or other type of connection . the opposite end portion 21 of the link rod comprises a short cylindrical section bent at a right angle to the main body 19 . referring also to fig2 and 4 , part of the end portion 21 of the link rod 17 is provided with a reduced diameter portion 22 defining an annular shoulder 23 . the output ram 16 includes a flattened end 25 provided with an aperture 24 just slightly larger in diameter than the reduced diameter portion 22 of the link rod end 21 . the connection between the link rod 17 and the output ram 16 simply requires the axial insertion of the reduced diameter portion of the rod end 21 into and through the aperture 24 . in the prior art , as indicated above , this connection was secured with a lock nut or similar device suitably threaded onto the reduced diameter portion 22 . in the present invention , as may best be seen in fig2 and 4 , the reduced diameter portion 22 of the link rod end 21 is provided with a pair of diametrically opposite flats 26 which extend from the end of the rod to approximately the near face of the flattened end 25 of the attached output ram 16 . a leaf spring 27 is attached by one of its ends to the end of a flat 26 , as with a rivet 28 or other suitable fastener . the leaf spring which extends axially along the rod end 21 is bent in an arc to diverge radially from the rod axis and terminates in a free opposite end 30 immediately adjacent the near face of the flattened end 25 of the output ram 16 . with the output ram 16 and link rod 17 interconnected , the flattened end 25 of the output ram is loosely retained between the annular shoulder 23 and the free ends 30 of the leaf springs 27 . the flats 26 and attached spring 27 are preferably positioned to insure that the free ends 30 will have a substantial surface against which to bear . orienting the flats such that they are aligned with the axis of the main body 19 of the link rod 17 , as shown , will help assure an adequate bearing surface . the leaf springs do not carry a significant load and the loose joint allows the necessary relative rotational movement between the interconnected parts . the length and thickness of the leaf spring material are selected to allow the springs to be manually flexed ( as with moderate thumb and finger pressure ) toward one another and into the recessed flats 26 . in this position , the linked rod end 21 may be withdrawn axially through the aperture 24 for convenient disassembly . reassembly requires only the imposition of a moderate force in the opposite axial direction sufficient to cause the leaf springs to deflect radially toward the axis of the rod end 21 ( and toward one another ) as a result of the bearing force imposed on the leaf springs by the wall defining the aperture 24 . the leaf springs will be forced into the recessed flats 26 until the free ends 30 thereof have cleared the face of the flattened end 25 of the output ram , whereupon they will snap outwardly and assume the retaining position shown . a single leaf spring 27 would be sufficient to provide the desired connection . however , the use of two springs provides a back - up should one become inoperative . other types of spring biased retainers might also be used , such as oppositely extending spring - loaded buttons . the retainer of the preferred embodiment , however , is simple in construction and reliable in operation . in an alternate embodiment shown in fig5 the overall connector assembly is identical except for the configuration of the leaf springs . in this construction , each of the leaf springs 32 comprises a leg of a unitary u - shaped spring piece 33 , which includes an integral cross piece 34 joining the leaf springs 32 at their fixed ends . the leaf springs may be substantially flat , but bent to a suitable angle at their juncture with the crosspiece 34 to provide the necessary divergence between their flexible free ends to create a retention similar to the leaf springs of the preferred embodiment . the unitary cross piece 34 is suitably attached to the flt end of the link rod with a drive screw 35 or the like . assembly and disassembly of the fig5 connector is identical to that of the preferred embodiment shown in fig2 and 3 . the invention has been shown and described with particular reference to the steering system for a outboard motor drive . however , as previously mentioned , essentially the same assembly may be used on stern drive steering assembly . clearly , the readily demountable connector assembly of the present invention has more utility when used on an outboard motor steering system simply because an outboard motor is more often removed and reinstalled , requiring disassembly and reassembly of the linkage for which the connector of the present invention is particularly adapted . various modes of carrying out the present invention are contemplated as being within the scope of the following claims particularly pointing out and distinctly claiming the subject matter which is regarded as the invention .	1
fig1 shows a currency processing machine 10 embodying the present invention and loaded with a batch feed of currency 12 prior to starting the currency processing cycle . this batch feed of currency 12 is fed into the currency processing machine one single note at a time . single notes then travel on a conveyer past several different detectors before being deposited in one of the sort bins 14 . typically , a single sort bin is used to accumulate a single denomination of note at the end of the sort process . currently , most currency processors do not comply with noise emission standards established in several jurisdictions . with reference now to fig2 , a block diagram illustrating a data processing system is depicted in which the present invention may be implemented . data processing system 200 employs a peripheral component interconnect ( pci ) local bus architecture . although the depicted example employs a pci bus , other bus architectures such as accelerated graphics port ( agp ) and industry standard architecture ( isa ) may be used . processor 202 and main memory 204 are connected to pci local bus 206 through pci bridge 208 . pci bridge 208 also may include an integrated memory controller and cache memory for processor 202 . additional connections to pci local bus 206 may be made through direct component interconnection or through add - in boards . in the depicted example , local area network ( lan ) adapter 210 , scsi host bus adapter 212 , and expansion bus interface 214 are connected to pci local bus 206 by direct component connection . in contrast , audio adapter 216 , graphics adapter 218 , and audio / video adapter 219 are connected to pci local bus 206 by add - in boards inserted into expansion slots . expansion bus interface 214 provides a connection for a keyboard and mouse adapter 220 , modem 222 , and additional memory 224 . small computer system interface ( scsi ) host bus adapter 212 provides a connection for hard disk drive 226 , tape drive 228 , and cd / dvd - rom drive 230 . typical pci local bus implementations will support three or four pci expansion slots or add - in connectors . an operating system runs on processor 202 and is used to coordinate and provide control of various components within data processing system 200 in fig2 . the operating system may be a commercially available operating system , such as windows xp , which is available from microsoft corporation . instructions for the operating system , the object - oriented operating system , and applications or programs are located on storage devices , such as hard disk drive 226 , and may be loaded into main memory 204 for execution by processor 202 . those of ordinary skill in the art will appreciate that the hardware in fig2 may vary depending on the implementation . other internal hardware or peripheral devices , such as flash rom ( or equivalent nonvolatile memory ) or optical disk drives and the like , may be used in addition to or in place of the hardware depicted in fig2 . also , the processes of the present invention may be applied to a multiprocessor data processing system . the depicted example in fig2 and the above - described examples are not meant to imply architectural limitations . fig3 shows a typical ocr camera configuration in accordance with the prior art . this configuration places the camera 320 along one of the straight sections in the note travel path . as a note approaches the camera position it enters a special note feeder 330 comprised of two angled panels that help straighten and guide the note before its jump across the imaging gap . at the gap itself 310 , the conveyor belt 350 turns away in both directions and the note is literally launched across the gap at high speed and caught on the opposite side by flared note guide 340 which feeds the note to the next conveyor belt 360 . the note must jump the gap 310 without the mechanical guidance of the conveyor belt so that the camera 320 has an unobstructed view of the note . since the camera 320 is a line scan camera it does not need to view the entire note at once . however , because the note is essentially flying through the air unguided over a brief distance it has a tendency to slightly wave or “ flag ” in midair . this flagging is very subtle , but the effect is significant enough to alter light reflectivity and focus , thereby degrading image resolution . when one considers that modern currency processing machines may process up to 2 , 000 notes per minute , misreads by the camera may require subsequent reprocessing of notes , which can significantly increase the processing time for large batches of currency . fig4 shows a camera configuration that uses inertia to maintain note flatness in accordance with a preferred embodiment of the present invention . the present invention provides a simple yet elegant solution to keeping notes flat while making the high speed jump across the gap between conveyor belts in front of the camera . whereas the prior art requires the note to jump the gap and continue in a straight line , the present invention requires the note to change direction by approximately 90 degree in order to reach the next conveyor belt . as shown in fig4 , when the note jumps the gap 440 between the first conveyor belt 460 and the next conveyor belt 450 , the change in path direction is facilitated by a curved note guide 400 . when a note comes into contact with the curved note guide 400 at high speed , the inertia of the note causes it to flatten against the note guide in response to the centripetal force applied by the note guide . fig5 a - 5c sequentially depict the process of a note moving against the curved note guide in accordance with a preferred embodiment of the present invention . for ease of illustration , the note 500 is shown slightly spaced apart from the note guide 510 , particularly in fig5 c . however , it should be kept in mind that during actual operation of the present invention , the note 500 will in fact lie flush against the note guide 510 as it moves along the surface . by providing a physical contact surface against which the note presses due to inertia , the note guide 510 prevents the note 500 from waving or flagging since the note is not flying freely through the air unguided , as in the prior art . referring back to fig4 , a line scan camera 410 is positioned to record notes at approximately the apex of the curvature of the note guide 400 . although not visible in this view , there is a small slit in the note guide 400 opposite the camera 410 ( see fig6 ). this slit facilitates the proper illumination of the note surface by lights 420 , 430 , which is necessary for proper imaging by the camera 410 . fig6 shows a perspective view of the note guide . in this view , one can see the slit 610 referenced above that allows light to pass through a passing note while it is being scanned by the line scan camera . illumination of passing bank notes can be accomplished in two ways . the first is to reflect the light off the note by facing the light toward the concave surface of the note guide ( as pictured in fig4 ). the other method is to shine the light through the slit 610 ( and through the notes ) from the opposite ( convex ) side of the note guide 600 . the slit 610 in the note guide 600 is actually needed in both cases , with reflected light and with the light beaming through from the opposite side . while it is obvious why the slit 610 is needed when a beam of light is pointed toward the camera from the opposite side of the note guide 600 in order to create a transparency image , it is far less intuitive in the cases when the camera is reading in reflective mode . in the case of reflected light , part of the light bounces back from the note to the camera and part transmits though the banknote . if the slit 610 is not present , the light which transmits through the banknote reflects back from the surface of the note guide 600 , creating undesirable light conditions for consistent imaging by the camera . also pictured is a flared panel 620 at the receiving end of the note guide 600 . the flared panel 620 is not pictured in the embodiment shown in fig4 but may be used to catch and direct notes when the conveyors are placed at a further distance from the ends of the note guide 600 , requiring the notes to be launched into the note guide from a small distance . in such a configuration , guide wheels 630 , 640 are used to help move the note along the surface of the note guide 600 . while the above description has specifically covered application to currency processing machines , it should be emphasized that the method of the present invention can easily be adapted for use in any situation requiring accurate , high speed image processing of paper documents . although preferred embodiments of the present invention have been described in the foregoing detailed description and illustrated in the accompanying drawings , it will be understood that the invention is not limited to the embodiments disclosed , but is capable of numerous rearrangements , modifications , and substitutions of parts and elements without departing from the spirit of the invention . accordingly , the present invention is intended to encompass such rearrangements , modifications , and substitutions of parts and elements as fall within the scope of the appended claims .	6
embodiments of the present invention address the need for dynamic and interactive multimedia scenes ( dims ) applications to adapt to changes in screen orientation . embodiments of the present invention provide mechanisms that are both syntactic and functional to address the screen orientation problem for rich media content . such mechanisms enable implicit ( e . g ., when the phone screen is rotated between landscape and portrait ) and explicit ( e . g ., when the content itself includes a screen orientation event listener to a button that is triggered when clicked ) adaptation of content to the required orientation modes . in particular , embodiments of the invention provide ( 1 ) application based orientation modes for rich media content , ( 2 ) an event interface for these orientation modes , and ( 3 ) event management and processing of screen orientation events . there are several use cases where such screen orientation mechanisms described herein would be useful in rich media services . for example , interactive mobile tv services are understood as the ability to provide a deterministic rendering and behavior of rich - media content , including audio - video content , text , images , xml - based content such as svg , and tv and radio channels , together in the end - user interface . the service must provide convenient navigation through the content in a single application or service and must allow synchronized interaction , such as voting and personalization ( e . g ., related menu or sub - menu , advertising and content in function of the end - user profile or service subscription ). typically , default applications run in portrait mode on hand - held devices . however , it may be optimal to view mobile tv in landscape mode for various reasons ( e . g ., displaying closed captioning , video content itself is in landscape mode , etc .). further , a live enterprise data feed may include stock tickers that provide streaming of real - time quotes , live intra - day charts with technical indicators , news monitoring , weather alerts , charts , business updates , etc . given how such data could dynamically vary in terms of what is shown and how much content is shown , the content may often toggle between several orientations . further , certain rich media games allow for multimedia content to be presented with some game logic for entertainment purposes . either based in user interaction or change in game logic , the orientation of the content may change . in accordance with embodiments of the present invention , the following may be used for generating screen - orientation events : ( 1 ) via device hardware events ( e . g ., rotation of the phone screen ) and ( 2 ) explicit instructions , for example , sent from a remote terminal / server that would be triggered when certain events occur on the client . in the first case , the application could completely rely on the underlying application shell to take care of rotating the content based on the orientation of the screen . however , automatic adaptation of the content by simple rotation is not always optimal . certain adjustments to the content presentation are often preferred for better viewing experience . for example , in fig1 , the application grid on the n93 screen is readjusted from portrait to landscape to make efficient use of the screen . these adjustments of how the content is to be adapted have to be specified in the data itself . in addition , the second case of adjusting orientation based on events ( e . g ., a button click , after a duration of a certain period ) would need explicit definition in the data as well . thus , in accordance with an embodiment of the invention , an attribute called “ screenorientation ” in the rich media content is provided . in one embodiment , this attribute takes one of three possible forms : specification of the portrait format , specification of the landscape format , or an angle in degrees . while the first two values correspond to existing modes on most devices , the third option can be user defined . in another embodiment , a “ view ” element for defining the scope of the screen orientation in rich media content is provided . while the “ screenorientation ” attribute specifies the mode in which the rich media content has to be rendered , there still needs to be a way of specifying how much of the content has to be rendered in that mode . here , if the first circle and the first ellipse are to be rendered in landscape mode while the second circle and second ellipse are to be rendered normally in the default presentation mode , one would have to use the “ screenorientation ” mode for every element that needs to be rendered in that mode . so in the above example , screenorientation =“ landscape ” would have to be added to the first circle and first ellipse . while this may still be considered fine with just two elements , it is not optimal to add the same mode for large sets of elements . thus , to address this issue , we introduce the concept of “ views ” in this invention . a “ view ” is a subset of the rich media content that can be rendered and interacted within the application . by default , an application has at least one logical view . if the entire application is to rendered in a particular orientation , then views are not required . however , if a subset of the application is to be rendered in one mode then views are useful in differentiating the scope of the “ screenorientation ” attribute applied . again , considering the above example , the svg content with views would be : further , a particular view can be associated with a screenorientation event that would be triggered upon a certain condition being satisfied . in one embodiment of the invention , one or more event types are provided . for example , event types may include “ screenorientationportrait ,” “ screenorientationlandscape ” and “ screenorientationmanual ” corresponding to the screenorientation attribute values “ portrait ”, “ landscape ” and “ orientation in degrees ,” respectively . the first two events ( i . e ., portrait and landscape ) are the most commonly used orientations in current devices . in another embodiment , a screen orientation event interface for the rich media system is provided . the following is the definition of the screenorientation interface that provides the contextual information related to screen orientation changes . this interface is designed and based on dom level 3 events specification , and therefore can be used in any dom based implementations . note that this interface extends the base “ event ” interface , which contains the basic event information such as the event target , and event type information . “ softkeys_bottom ” indicates that the device soft keys at the bottom of the screen in the current screen orientation , as illustrated in fig4 a . “ softkeys_top ” indicates that the device soft keys are at the top of the screen in the current screen orientation , as illustrated in fig4 b . “ softkeys_left ” indicates that the device soft keys are to the left of the screen in the current screen orientation , as illustrated in fig4 c . “ softkeys_right ” indicates that the device soft keys are to the right of the screen in the current screen orientation , as illustrated in fig4 d . “ screenwidth ” contains the new screen display or viewport width reflecting the new orientation . “ screenheight ” contains the new screen display or viewport height reflecting the new orientation . “ softkeyslayout ” indicates the location of the device soft keys in response to the orientation change . the possible values are softkeys_left , softkeys_right , softkeys_top , and softkeys_bottom , as described above with reference to fig4 ( a )-( d ) . for reference , provided below is the event interface as defined in dom level 3 events specification : with the information provided by the screen orientation interface , the user agent or underlying rich media engine can adapt to the layout or visual representation of the content to current screen orientation . in another embodiment , the event management and processing of screen orientation events is provided . according to an embodiment of the invention , the event management and processing of screen orientation events is based on the dom level 3 events processing model . this includes event creation , event dispatching , event registration and event handling . event creation deals with the creation of a screenorientationevent object which is an implementation of screenorientationevent interface . this event is directly mapped to the hardware event notification ( e . g ., using the symbian ui framework ) or through an event “ message ” from the server . during the event creation it is important that the relevant event attributes such as event target , event type , screenwidth , screenheight attributes are set . event dispatching deals with dispatching the screenorientation event to the appropriate target based on the event target . with regard to the event registration , the content author or application typically registers for the events if he / she chooses to listen to a particular event . for example , to listen to a screenorientationevent , a listener must be registered with the event target within the rich media engine . this can be done either declaratively using the & lt ; ev : listener & gt ; element or can be done by the implementation by attaching the “ eventlistener ” object to the “ eventtarget ” object . this completes the registration process and is usually done prior to the event creation and dispatching phase . event handling relates to event processing or realization . event handlers contain the logic or code that must be executed based on a specific event listener and an event target . for example , when the screenorientationevent is dispatched to a particular event target as described in the previous stages , the event manager of the rich media engine checks the list of event listeners and invokes the appropriate event handler , thereby executing the logic that is present within the handler . and the handler can access all the information relevant to screen orientation as defined by the screenorientationevent object . the following example illustrates the concept of screen orientation and the content adoption based on the orientation change . the content is authored in svg format . when this content is loaded by the rich media client , the content is seen in the portrait mode ( default ), as illustrated in fig2 . now , when the screen orientation change event is fired , either by the hardware or streamed from the server , this event gets dispatched to the rich media engine , where the & lt ; listener & gt ; elements get the notification . upon this notification , the listener elements invoke the appropriate & lt ; handler & gt ; elements that , in this example , execute the associated scripts to change the layout of the content from ‘ portrait ’ mode to ‘ landscape ’ mode , as illustrated in fig3 . in one embodiment , hardware - based orientation event triggers are mapped to software - based rich media screen events . while screenorientation events can be triggered purely from the application software side ( e . g ., via a button click , menu selection , after a certain time duration , etc . ), these events could also be triggered from a change in orientation of the phone screen . in order to address the latter scenario , the mapping from the underlying phone hardware event triggers to the rich media application based screenorientation events needs to be specified . in order to explain the mapping , we take the example of symbian , particularly the s60 application framework . though the s60 application framework is not the only framework used on mobile phones , it is representative of a larger market of such adaptable screen devices . in symbian , applications would normally be expected to run in any screen orientation , portrait or landscape . the applications can , however , specify a fixed orientation that they require to work in . by default , applications are set to work in any orientation , so only applications that have a definitive orientation requirement should take any action . looking at the api documentation for aknscreenmode . h , one method in this library is : here , the application will be displayed in the selected screen mode . the application will no longer respond to hardware or software events which would normally affect screen mode . it will be permanently fixed to the selected screen mode . the list of available screen modes are specific to that particular device . if an application wants a fixed orientation , it should use the scalable apis in ceikappui . particularly , a new enumeration and two apis have been added to ceikappui : enum caknappuibase :: tappuiorientation with possible values ; eappuiorientationunspecified this is the default rotation setting for an application , and it should be used by nearly all applications . eappuiorientationportrait use a portrait screen rotation for this application . this should only be used when an application specifically wants portrait rotation . the device will select an appropriate portrait rotation , if one is available . this should only be used when an application specifically wants landscape rotation . the device will select an appropriate landscape rotation , if one is available . eappuiorientationautomatic use the normal device screen rotation set for this application . both portrait and landscape screen rotations are possible . the application rotation follows device screen rotation . an example is provided below . here , we are trying to detect a flip - state by checking the current screen mode . each mode has a different size , and one or more possible rotations / orientations . for the actual mode change detection , you need to implement the method handlescreendevicechangedl ( ) on the ui class . a sample header file definition based on the standard helloworld example is illustrated below . handlescreendevicechangedl ( ) will be called by the system when the screen mode changes . to check which mode it is in ( flip open or flip closed ), the following code is inserted in the implementation of handlescreendevicechangedl ( ): finally , it is ensured that the window server notifies your application when the screen mode changes . to do that , the following is added to the constructl ( ) method : this would , in turn , notify the rich media engine , and the corresponding screenorientation event would be set in the rich media environment for either a specific view in the content or to entire document . the process flow is illustrated in fig5 . the embedded os framework regularly or continuously polls for hardware orientation changes ( block 510 ). at block 520 , the os framework determines whether the phone orientation has changed . as noted above , this may be achieved through use of sensors in the hardware . if no changes are detected , the os framework continues to poll for hardware changes . on the other hand , if a change is detected , the process proceeds to block 530 and notifies the application framework . at block 540 , if the application framework is responsible for changing orientation , the process proceeds to block 550 , and the orientation change is applied to the rich media application . if the application framework is not responsible for changing orientation , the process proceeds to block 560 , and the rich media engine is notified of the orientation change . at block 570 , the screenorientation event is triggered and the necessary changes are applied to the content orientation . in other embodiments , the attribute values for screenorientation can be extended for future orientation modes . further , the screenorientation event types can also be extended for future orientation modes . the mapping of device hardware event triggers to rich media screenorientation events are agnostic of the underlying embedded operating system . various embodiments described herein are described in the general context of method steps or processes , which may be implemented in one embodiment by a computer program product , embodied in a computer - readable medium , including computer - executable instructions , such as program code , executed by computers in networked environments . a computer - readable medium may include removable and non - removable storage devices including , but not limited to , read only memory ( rom ), random access memory ( ram ), compact discs ( cds ), digital versatile discs ( dvd ), etc . generally , program modules may include routines , programs , objects , components , data structures , etc . that perform particular tasks or implement particular abstract data types . computer - executable instructions , associated data structures , and program modules represent examples of program code for executing steps of the methods disclosed herein . the particular sequence of such executable instructions or associated data structures represents examples of corresponding acts for implementing the functions described in such steps or processes . software and web implementations of various embodiments can be accomplished with standard programming techniques with rule - based logic and other logic to accomplish various database searching steps or processes , correlation steps or processes , comparison steps or processes and decision steps or processes . it should be noted that the words “ component ” and “ module ,” as used herein and in the following claims , is intended to encompass implementations using one or more lines of software code , and / or hardware implementations , and / or equipment for receiving manual inputs . the foregoing description of embodiments has been presented for purposes of illustration and description . the foregoing description is not intended to be exhaustive or to limit embodiments of the present invention to the precise form disclosed , and modifications and variations are possible in light of the above teachings or may be acquired from practice of various embodiments . the embodiments discussed herein were chosen and described in order to explain the principles and the nature of various embodiments and its practical application to enable one skilled in the art to utilize the present invention in various embodiments and with various modifications as are suited to the particular use contemplated . the features of the embodiments described herein may be combined in all possible combinations of methods , apparatus , modules , systems , and computer program products .	7
the following examples are intended to convey certain principles of the invention . these examples are not intended to limit the scope of the claims to any particular example . it is understood that the claims are to be given their broadest reasonable interpretation in view of the description herein , any prior art , and the knowledge of those of ordinary skill in the field . those skilled in the art will readily appreciate that many variations may be derived using the following description . fig1 shows a diagram of the molecular structure of an alkyl ketene dimer . alkylketene dimers can be heated and formed into a surface . further , alkylketene dimer surfaces spontaneously form fractal structures when cooled . these fractal surfaces have a high degree of surface roughness resulting in super - water - repellent properties . contact angle is one indicator of water repellency or wettability . the increased surface roughness results in a higher contact angle between an aqueous drop and the fractal surface on which the drop rests . the greater the surface contact angle , the more spherical the drop is on the surface and the less contact there is between the drop and the surface . this effect is illustrated in fig2 . fig2 shows 5 μl drops of water that have been placed on various surfaces . on untreated glass , the surface contact angle is less than 90 degrees , as illustrated by fig2 a and 2d . on glass that has been coated with silicon ( siliconized ), the surface contact angle of the water is greater than 140 degrees , as illustrated by fig2 b and 2e . this is comparable to glass that has been coated with the alkylketene dimer , distearoyl ketene . fig2 c and 2f illustrate the high contact angle on the distearoyl ketene dimer - coated surface . both siliconized and alkylketene dimer - coated surfaces have high contact angles with drops of pure water . as described above , contact angle is an indicator of a surfaces ability to promote crystallization of macromolecules such as proteins . the greater the contact angle , the more spherical the droplet , thereby minimizing interfering effects from the surface / liquid interface . thus , higher quality crystals can be grown . this relationship between contact angle and surface is particularly critical in the emerging field of high - throughput crystallization . thus , high - throughput crystallization is a good example of an application for this invention . typically , high - throughput techniques use sitting drop vapor diffusion formats in which the drop ( or drops ) of fluid containing the macromolecules to be crystallized sit on top of a surface . most often a plastic , rather than siliconized glass , is preferable as a crystallization surface . attempts to use high - throughput crystallization technology for integral membrane proteins has led to disappointing results due to the required presence of detergent in the aqueous medium . detergents and lipids are necessary for crystallization of integral membrane proteins because detergent micelles are required to maintain the macromolecule in a soluble state and lipids are required to prevent dilapidation of the macromolecule by mass action . the presence of lipid and detergent also reduces the surface tension of the crystallization drop , dramatically decreasing the contact angle between the drop and the surface . this is illustrated in fig3 . fig3 shows 5 μl drops of water containing 0 . 05 % dodecylmaltoside ( ddm ) detergent placed on various surfaces . on untreated glass , the surface contact angle is less than 90 degrees , as illustrated by fig3 a and 3d . on glass that has been coated with silicon ( siliconized ), the surface contact angle of the water is also less than 90 degrees , as illustrated by fig3 b and 3e . however , on glass coated with an alkylketene dimer that has been doped with a dialkyl ketone ( stearoylketene dimer doped with distearoyl ketene ), the surface angle is greater than 150 degrees . fig3 c and 3f illustrate the high contact angle on the distearoyl ketene dimer - coated surface . thus , alkylketene dimers can reduce the wettability and thereby increase the contact angle of the crystallization drop even when using detergent . in particular , stearoylketene dimer is an alkylketene dimer that promotes a reduced surface wettability in the presence of detergent at or above the critical micelle concentration . however , pure alkylketene dimer coatings alone are insufficient . a highly pure alkylketene dimer coating exhibits too much variability in the fractal surface . this variation least to inconsistent wettability in the presence of detergent . when using detergents , consistent super - water - repellent properties of alkylketene dimers are achieved only when modifications in the composition of the stearoylketene dimer mixture are made . thus , the alkylketene dimer coating should be “ doped ” with some modifying compound to achieve consistent results with detergent - containing drops . in experiments with stearoylketene dimer coatings , the variability of surface wettability ( contact angle ) of drops containing detergent was traced to the variable presence of small amounts of distearoyl ketone impurity in the stearoylketene dimer sample . distearoyl ketone forms as a hydrolysis product of stearoylketene dimer ; repeated exposure of liquid stearoylketene dimer to the atmosphere increases the relative proportion of distearoyl ketone . fig4 shows a molecular model of a dialkyl ketone . distearoyl ketone is a form of dialkyl ketone . the proportion of distearoyl ketone and stearoylketene dimer alters the surface wettability and resulting contact angle . the exact cause of the doping effect is unknown . we hypothesize that a more regular fractal surface pattern results from the higher melting temperature of distearoyl ketone contaminant relative to stearoylketene dimer . thus , the distearoyl ketone acts as a nucleation point for the formation of the stearoylketene dimer fractal structure . by increasing the relative percentage of distearoyl ketone , the relative number of nucleation points are increased , which in turn increases the overall complexity of the resulting surface due to the eventual mixing of many different fractal - forming growth patterns evolving from the multiple nucleation points . regardless of the cause , this suggests that an optimum distearoyl ketone / stearoylketene dimer ratio may exist for different applications , and possibly for each type of integral membrane protein crystallized , since the complexity of the surface may promote protein crystal nucleation and ordered growth . the alkylketene dimer mixture may be doped with any additional compounds that alter the complexity of the resulting surface . for instance , a compound with an altered alkyl chain length such as oleoylketene dimer could be introduced into the mixture to selectively alter fractal growth patterns , thereby attenuating the complexity of the surface . this invention contemplates using a mixture of alkylketene dimers that has been doped with a nucleating compound to create a surface on which crystals of integral membrane proteins can be grown . as described , the ratio of dimer and nucleating compound ( or potentially compounds ) can be determined for any particular application . this invention also contemplates creating surfaces which vary the ratio of alkylketene dimer and nucleating compound across the surface . such a surface would be helpful in optimizing the ratio when crystallizing different macromolecules . any form of alkylketene dimer could be used with this invention , in conjunction with any nucleating compound capable of altering the fractal pattern of the alkylketene dimer surface . stearoylketene dimer doped with distearoyl ketone is a specific example of an alkylketene dimer and nucleating compound contemplated by this invention . a coating of alkylketene dimer doped with a nucleating compound can be applied to virtually any surface to create a crystallization surface . for example , plastic or glass slides could be coated . it may be desirably to apply the coating in as thin a layer as possibly . because typical doped alkylketene dimer coatings are opaque , thinner coatings may simplify directly visualizing crystal growth . alternatively , coated slides with potential crystal - yielding drops could be screened by x - ray diffraction . after a suitable growth period , the crystal growth array can be flash frozen in liquid nitrogen and screened en mass for crystal growth by assessing the ability of each crystal growth drop to diffract x - rays . in this way , many conditions for crystal growth could be screened in parallel . screening crystals while they are still on the alkylketene dimer surface does complicate the analysis , however . this technique requires that the x - ray diffraction pattern of the alkylketene dimer factal surface be deconvolved from the x - ray diffraction pattern produced by the protein crystal . fig5 shows the diffraction pattern of the stearoylketene dimer . although differently - oriented protein crystals would complicate such an analysis , a highly focused x - ray beam would eliminate this potential complication . alkylketene dimers doped with a nucleating compound can be coated to surfaces by many different methods . preliminary tests were made using stearoylketene dimer doped with distearoyl ketene . the stearoylketene dimer / distearoyl ketene mixture was first heated past its melting point , and then the liquid was transferred to a solid surface and allowed to cool . different thicknesses of doped alkylketene dimers are possible . this invention contemplates using a vapor chamber to uniformly apply a layer or doped alkylketene dimer to a surface . this invention is not limited to the sitting drop vapor diffusion method of crystal growth . although doped alkylketene dimer surfaces are useful for high - throughput crystallization screening using the sitting drop crystallization format , these surfaces may also be useful in alternate conformations . other conformations include sandwich drop and hanging drop vapor diffusion . all publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference . although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding , it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims .	2
according to an exemplary embodiment , as shown in fig1 , an exemplary system may receive non - deterministic or flaky tests , and run the tests with call trace collection enabled . a test is identified as non - deterministic if some of its runs execute successfully while the others end up with failure without any change to the code . an exemplary test , as shown in fig2 and written in pseudo code , verifies a condition to assign a task to a scheduler , schedule the task , and then check whether the task has been executed . call trace collection may be performed several different ways . in an exemplary embodiment , while a test is running , all function / method call histories may be sequentially recorded as ( call depth , methodid ). for instance , when at a call depth ( or stack depth ) of 10 , method a calls method b first , method c , and then method d , pairs ( 10 , a ), ( 11 , b ), ( 11 , c ), and ( 11 , d ) may be recorded accordingly . all the call records together may construct a call trace and may be saved to a log file per thread . this call trace collection may be implemented through interpreter / compiler instrumentation or byte code rewriting . alternatively , call relations may be sequentially recorded as method pairs ( callerid , calleeid ). for example , when method a calls b first , c next , and then d , pairs ( a , b ), ( a , c ), ( a , d ) are recorded accordingly . all the method pairs together construct a call trace and are saved to a log file . for each execution of the test , the corresponding trace log file is labeled with either a “ pass ” or “ fail ” to reflect the execution status . the test may be run at least enough times to receive one pass execution and one fail execution . more traces may produce better results . for each trace log file , an exemplary system constructs a dynamic call tree . a dynamic call tree is an ordered tree where each node is a method and child nodes are actual call sequence from the method in the order of activation . for example , an edge going from node a to node b indicates that the procedure represented by node a calls the procedure represented by node b . fig3 a and 3 b represent examples of call trees for the execution of a non - deterministic test . fig3 a illustrates a successful run of the test while fig3 b illustrates a failing run of the same test . these two trees have slightly different call traces , which indicate root cause of the non - determinism . an exemplary system splits each tree into a set of smaller trees by truncating the whole tree into subtrees . in an exemplary embodiment , subtrees may be truncated by capturing subtrees to a depth of d . if there is a loop in the subtree at depth d , the subtree may be split at the back edge of the loop . the back edge may be obtained from the source code using static analysis . this method for truncating subtrees is only an example and any algorithm to capture subpatterns may work within an exemplary system . each subtree partially represents some call relations demonstrated in the overall trace . by comparing the subtree sets derived from pass traces and those from fail traces , an exemplary system determines the subtree patterns unique to each set ( 113 ). fig4 a and 4 b illustrate subtrees of the successful execution shown in fig3 a . fig5 a - 5 c illustrate subtrees of the failing execution shown in fig3 b . by comparing the two sets , we find differences in the methods called by method b . the exemplary system may then report patterns that only happen in pass traces and subpatterns that only happen in fail traces . in some embodiments , the exemplary system may rank the diverging subtree patterns between the two sets based on the frequency of each pattern . the higher a pattern is ranked , the more likely it is to be a root cause of the non - deterministic test . in some scenarios , source code contains some dynamically generated functions or classes at runtime . each of such dynamically generated entity may contain the same code across different runs , but gets assigned different identity names . in order to get the actual difference between different traces ignoring such innocuous distinction , we take advantage of the naming convention for generated entities and map entities accordingly . for instance , an exemplary system maps class name class_runa and class_runb together based on their same prefix and aligns two traces on top of that . in other scenarios , an exemplary system separates call traces relevant to class initialization from others in order to isolate effects caused by non - deterministic class loading . then the call traces relevant to class initialization are analyzed separately to decide whether a different class loading order is the root cause for non - determinism . using the class - initialization for the root causing analysis is optional . this is because many root causes are not related to the class - initialization , and this can be turned on only when the user may think it is relevant . an exemplary system may also map subtree patterns to the collected call traces and merge the overlapping subtrees . if trees differ at a high level , the differences in the lower levels may be merged ( or hidden ) so an end user is not confused . since an exemplary system may base its comparison on subtree patterns , several subtree patterns may actually overlap on the real tree . for example , the tree represented in fig3 a may be written as ( a ( b ( e f ) c d ) in parentheses notation . the tree in fig3 b may be written as ( a b ( e ) c ( f ) d ). for every opening parenthesis , the tree descends one level and for every closing parenthesis , the tree ascends one level . if the tree in fig3 b was ( a b ( e ) x ( f ) d ) instead of ( a b ( e ) c ( f ) d ), with method x replacing method c , then the patterns at the very top of the trees of fig3 a and 3 b already differ . at the top level fig3 a is ( a ( b c d ) and revised fig3 b is ( a ( b x d ). although there are also differences at the lower levels of the two trees , the lower - level differences are continuations of the differences at the top level . therefore , an exemplary system combines these differences into a single pattern to display to the end user . without combining the differences , the end user may assume that there are multiple differences when , in fact , there is one difference . fig7 is a high - level block diagram to show an application on a computing device ( 700 ). the application determines the root cause of flaky tests . in a basic configuration ( 701 ), the computing device ( 700 ) typically includes one or more processors ( 710 ), system memory ( 720 ), and a memory bus ( 730 ). the memory bus is used to do communication between processors and system memory . depending on different configurations , the processor ( 710 ) can be a microprocessor ( μp ), a microcontroller ( μc ), a digital signal processor ( dsp ), or any combination thereof . the processor ( 710 ) can include one or more levels of caching , such as a l1 cache ( 711 ) and a l2 cache ( 712 ), a processor core ( 713 ), and registers ( 714 ). the processor core ( 713 ) can include an arithmetic logic unit ( alu ), a floating point unit ( fpu ), a digital signal processing core ( dsp core ), or any combination thereof . a memory controller ( 716 ) can either be an independent part or an internal part of the processor ( 710 ). depending on the desired configuration , the system memory ( 720 ) can be of any type including but not limited to volatile memory ( such as ram ), non - volatile memory ( such as rom , flash memory , etc .) or any combination thereof . system memory ( 720 ) typically includes an operating system ( 721 ), one or more applications ( 722 ), and program data ( 724 ). the application ( 722 ) may include a system and method for determining the root cause of non - deterministic tests . program data ( 724 ) includes storing instructions that , when executed by the one or more processing devices , implement a system and method for determining the root cause of non - deterministic tests . ( 723 ). in some embodiments , the application ( 722 ) can be arranged to operate with program data ( 724 ) on an operating system ( 721 ). the computing device ( 700 ) can have additional features or functionality , and additional interfaces to facilitate communications between the basic configuration ( 701 ) and any required devices and interfaces . system memory ( 720 ) is an example of computer storage media . computer storage media includes , but is not limited to , ram , rom , eeprom , flash memory or other memory technology , cd - rom , digital versatile disks ( dvd ) or other optical storage , magnetic cassettes , magnetic tape , magnetic disk storage or other magnetic storage devices , or any other medium which can be used to store the desired information and which can be accessed by computing device 700 . any such computer storage media can be part of the device ( 700 ). the computing device ( 700 ) can be implemented as a portion of a small - form factor portable ( or mobile ) electronic device such as a cell phone , a smart phone , a personal data assistant ( pda ), a personal media player device , a tablet computer ( tablet ), a wireless web - watch device , a personal headset device , an application - specific device , or a hybrid device that includes any of the above functions . the computing device ( 700 ) can also be implemented as a personal computer including both laptop computer and non - laptop computer configurations . the foregoing detailed description has set forth various embodiments of the devices and / or processes via the use of block diagrams , flowcharts , and / or examples . insofar as such block diagrams , flowcharts , and / or examples contain one or more functions and / or operations , it will be understood by those within the art that each function and / or operation within such block diagrams , flowcharts , or examples can be implemented , individually and / or collectively , by a wide range of hardware , software , firmware , or virtually any combination thereof . in one embodiment , several portions of the subject matter described herein may be implemented via application specific integrated circuits ( asics ), field programmable gate arrays ( fpgas ), digital signal processors ( dsps ), or other integrated formats . however , those skilled in the art will recognize that some aspects of the embodiments disclosed herein , in whole or in part , can be equivalently implemented in integrated circuits , as one or more computer programs running on one or more computers , as one or more programs running on one or more processors , as firmware , or as virtually any combination thereof , and that designing the circuitry and / or writing the code for the software and / or firmware would be well within the skill of one skilled in the art in light of this disclosure . in addition , those skilled in the art will appreciate that the mechanisms of the subject matter described herein are capable of being distributed as a program product in a variety of forms , and that an illustrative embodiment of the subject matter described herein applies regardless of the particular type of non - transitory signal bearing medium used to actually carry out the distribution . examples of a non - transitory signal bearing medium include , but are not limited to , the following : a recordable type medium such as a floppy disk , a hard disk drive , a compact disc ( cd ), a digital video disk ( dvd ), a digital tape , a computer memory , etc . ; and a transmission type medium such as a digital and / or an analog communication medium . ( e . g ., a fiber optic cable , a waveguide , a wired communications link , a wireless communication link , etc .) with respect to the use of any plural and / or singular terms herein , those having skill in the art can translate from the plural to the singular and / or from the singular to the plural as is appropriate to the context and / or application . the various singular / plural permutations may be expressly set forth herein for sake of clarity . thus , particular embodiments of the subject matter have been described . other embodiments are within the scope of the following claims . in some cases , the actions recited in the claims can be performed in a different order and still achieve desirable results . in addition , the processes depicted in the accompanying figures do not necessarily require the particular order shown , or sequential order , to achieve desirable results . in certain implementations , multitasking and parallel processing may be advantageous .	6
in one aspect disclosed herein are substituted trifluoromethanes of formula i : a is independently selected from one or more functionalities selected from the group consisting of ( a ) amino acids , ( b ) carbohydrates , ( c ) lipids and lipid derivatives , ( d ) metabolic intermediates , ( e ) cofactors and ( f ) sub - molecular compositions shown to be biologically active . the term “ amino acids ” includes , but is not limited to , peptides , hormones and proteins , while the term “ carbohydrates ” includes , but is not limited to , sugars , oligosaccharides , and polysaccharides . furthermore , combinations of the above functionalities , such as a glycosylated peptide or a glycosylated hormone or a glycosylated protein , elaborated with the disclosed mimic are understood as members of the contemplated set a as illustrated by ( i ). other classes of compounds commonly known as inositols , prenylation intermediates , eicosanoid precursors and monomeric and polymeric nucleotides are further understood and contemplated within the context of the present disclosure . x is selected from the group consisting of ( a ) oxygen , ( b ) sulfur ( c ) carbon , ( d ) silicon , ( e ) selenium and ( f ) any non - hydrogen atom or atomic null capable of serving as a covalent link between functionality a and the carbon of the parent trifluoromethane such that chemical stability of the compound is achieved and all valance requirements of linker x are satisfied . furthermore , the linker , x , may consist of a series of atoms ( 2 - 12 ) allowing the optimal positioning of the trifluoromethyl functionality relative to the atomic sets defined as a within a given macromolecular binding site . in some embodiments , x is a sulfur atom , s ( o ), or so 2 . in some embodiments , x is cr 1 r 2 or sir 1 r 2 , where r 1 and r 2 are each independently selected from the group consisting of hydrogen , alkyl , aryl , heteroaryl , halogen , hydroxyl , thiol , amino , ether , thioether , alkyl amine , dialkyl amine , aryl amine , diaryl amine , and alkyl aryl amine . in some embodiments where x is cr 1 r 2 , r 1 and r 2 taken together form a cabonyl (═ o ), thiocarbonyl (═ s ) or substituted alkenyl (═ c ). in some embodiments , x is nr 3 , where r 3 is selected from the group consisting of hydrogen , alkyl , aryl , heteroaryl , heteroalicyclyl , hydroxyl , thiol , amino , ether , thioether , alkyl amine , dialkyl amine , aryl amine , diaryl amine , and alkyl aryl amine . in some embodiments , x is a substituted or unsubstituted linker , 2 - 12 atoms in length , including substituted or unsubstituted alkyl , substituted or unsubstituted alkenyl , substituted or unsubstituted alkynyl , substituted or unsubstituted cycloalkyl , substituted or unsubstituted cycloalkenyl , substituted or unsubstituted aryl , substituted or unsubstituted heteroaryl , substituted or unsubstituted heteroalicyclyl or substituted or unsubstituted ether , substituted or unsubstituted thioether , and substituted or unsubstituted amine . where a is as defined above and s is a sulfur atom . in some embodiments , a in the compounds of formula i is an amino acid selected from the group consisting of tyrosine , serine , and threonine , or other amino acid residues without limitation . certain embodiments of these compounds are compounds of formula ic , id , or ie : d 1 and d 2 is each independently selected from the group consisting of hydrogen , substituted or unsubstituted alkyl , substituted or unsubstituted alkenyl , substituted or unsubstituted alkynyl , substituted or unsubstituted cycloalkyl , substituted or unsubstituted cycloalkenyl , substituted or unsubstituted aryl , substituted or unsubstituted heteroaryl , substituted or unsubstituted heteroalicyclyl , substituted or unsubstituted ether , substituted or unsubstituted thioether , and substituted or unsubstituted amine , or other independent amino acids or a sequence of one to one thousand ( 1 - 1000 ) of such amino acids . in the context of the independent amino acid sequences defined above , the common definitions of peptide and protein are understood as well as non - natural and β - amino acids and higher homologues without limitation . in some embodiments , disclosed herein are analogues of compounds ic - ie , where the phenyl ring is replaced with other aromatics , such as naphthalene , biphenyl , or heteroaromatics , such as pyridine , thiophene , furan and imidazole and substituted analogues of these heteroaromatics such as ortho - pyridones ( 2 - hydroxy pyridines ), 2 - phenyl thiophenes , 3 - pyrazole furans , 2 - hydroxy - 4 - methyl imidazoles or other substituted heteroaromatics . furthermore , analogues of compounds ( ic - ie ) corresponding to positional or stereochemical isomers such as meta - hydroxy phenylalanine or d - tyrosine or modified amino acids understood as rigidified or conformationally restrained or metabolically stabilized analogues such as hydroxylproline or homo - serine or n - methyl l - tyrosine are further contemplated without limitation in this disclosure . it is further understood that a glycosylated peptide or hormone or protein functionalized at an amino acid residue with the parent trifluoromethane group is contemplated in the context of the present aspect of this disclosure . in some embodiments , a in the compounds of formula i is glucose or fructose . in some of these embodiments , disclosed herein are compounds of formula if or ig : e 1 - e 4 is each independently selected from the group consisting of hydrogen , substituted or unsubstituted alkyl , substituted or unsubstituted alkenyl , substituted or unsubstituted alkynyl , substituted or unsubstituted cycloalkyl , substituted or unsubstituted cycloalkenyl , substituted or unsubstituted aryl , substituted or unsubstituted heteroaryl , substituted or unsubstituted heteroalicyclyl , substituted or unsubstituted ether , substituted or unsubstituted thioether , and substituted or unsubstituted amine or single carbohydrates or an ensemble of carbohydrates containing one to one thousand ( 1 - 1000 ) members . in the context of the independent carbohydrate sequences defined above , the common definitions of carbohydrate and polysaccharide are understood . furthermore , in some embodiments , disclosed herein are analogues of compounds ( if - ig ) corresponding to positional or stereochemical isomers such as l - glucose or d - mannose or α - lactose or sucrose or modified carbohydrates , as rigidified or conformationally restrained , or metabolically stabilized analogues such as sialic acid or shikimic acid or myo - inositol or steviol . in other embodiments , a is a peptide or protein or lipid covalently modified with a carbohydrate or polysaccharide wherein that carbohydrate or polysaccharide is further functionalized by the parent trifluoromethane group . in another embodiment , a in the compounds of formula i , is a substituted analogue of sphingosine . in some of these embodiments , disclosed herein are compounds of formula ( ih ): g1 - g4 is each independently selected from the group consisting of hydrogen , substituted or unsubstituted alkyl , substituted or unsubstituted alkenyl , substituted or unsubstituted alkynyl , substituted or unsubstituted cycloalkyl , substituted or unsubstituted cycloalkenyl , substituted or unsubstituted aryl , substituted or unsubstituted heteroaryl , substituted or unsubstituted heteroalicyclyl , substituted or unsubstituted ether , substituted or unsubstituted thioether , and substituted or unsubstituted amine or single carbohydrates or a ensemble of carbohydrates containing one to one thousand ( 1 - 1000 ) members . in some embodiments , the sphingosines is selected from the group consisting of ceramide , sphingomyelins , and glycososphingolipids . in further embodiments , the sphingosines is selected from the group consisting of cereborsides and gangliosides . analogues of compounds ( ih ) corresponding to positional or stereochemical isomers are understood as are rigidified or conformationally restrained or metabolically stabilized analogues without limitation in this disclosure . in some embodiments , a in the compounds of formula i is enol pyruvate or creatine . in some of the embodiments , disclosed herein are compounds of formula ii or ij : in some embodiments , a in the compounds of formula i is adenosine diphosphate or pyridoxal or other cofactors . in some of the embodiments , disclosed herein are compounds of formula ik or il : in some embodiments , a in the compounds of formula i is des - phosphonate glyphosate or des - phosphonate homo - glyphosate or other glyphosate analogues . in some of the embodiments , disclosed herein are compounds of formula ( im ): in another aspect disclosed herein there are substituted difluoromethanes of formula ii : a and b are each independently selected from ( a ) des - phosphate nucleic acids or ( b ) biologically active substituents . iterative covalent bonding and linear polymerization of these difluoromethanes are contemplated herein . x and y is each independently selected from the group consisting of ( a ) oxygen , ( b ) sulfur ( c ) carbon , ( d ) silicon , ( e ) selenium and ( f ) any non - hydrogen atom or atomic null capable of serving as a covalent link between functionality a or b and the carbon of the parent difluoromethane such that chemical stability of the compound is achieved and all valance requirements of linkers x and y are satisfied . furthermore , the linker , x , may consist of a series of atoms ( 2 - 12 ) allowing the optimal positioning of the difluoromethyl functionality relative to substituent a within a given macromolecular binding site . in some embodiments , x and y is each independently sulfur , s ( o ), or so 2 . in some embodiments , x and y is each independently cr 1 r 2 or sir 1 r 2 , where r 1 and r 2 is each independently selected from the group consisting of hydrogen , alkyl , aryl , heteroaryl , halogen , hydroxyl , thiol , amino , ether , thioether , alkyl amine , dialkyl amine , aryl amine , diaryl amine , alkyl aryl , and amine . in some embodiments where x is cr 1 r 2 , r 1 and r 2 taken together form a cabonyl (═ o ), thiocarbonyl (═ s ) or substituted alkenyl (═ c ). in some embodiments , x and y is each independently selenium or se ( o ). in some embodiments , x and y is each independently nr 3 , where r 3 is selected from the group consisting of hydrogen , alkyl , aryl , heteroaryl , hydroxyl , thiol , amino , ether , thioether , alkyl amine , dialkyl amine , aryl amine , diaryl amine , and alkyl aryl amine . in some embodiments , x and y is each independently a substituted or unsubstituted linker , 2 - 12 atoms in length , selected from the group consisting of substituted or unsubstituted alkyl , substituted or unsubstituted alkenyl , substituted or unsubstituted alkynyl , substituted or unsubstituted cycloalkyl , substituted or unsubstituted cycloalkenyl , substituted or unsubstituted aryl , substituted or unsubstituted heteroaryl , substituted or unsubstituted heteroalicyclyl , substituted or unsubstituted ether , substituted or unsubstituted thioether , and substituted or unsubstituted amine . in some embodiments , x and y is each independently a methylene group . in another embodiment of the disclosure are compounds of formula iib or iic : iterative covalent bonding and linear polymerization ( n = 1 to n = 5000 ) of these substituted difluoromethanes is presently contemplated herein . for example , the compound of formula iib or iic is the compound where n = 4 . the monomeric nucleotide units may carry the purine and pyrimidine bases corresponding to adenine , guanine , cytosine and thymine as well as other functionally stable bases . the terminal 3 ′- end of the compound may be substituted with the trifluoromethyl group as disclosed for the compound of formula i . in another aspect , disclosed herein is a pharmaceutical composition comprising a therapeutically effective amount of a compound of any one of formula i or ii and a pharmaceutically acceptable carrier , excipient , or diluent . as used herein , a “ therapeutically effective amount ” refers to an amount of a compound that elicits the desired biological or medicinal response in a subject . as used herein , a “ pharmaceutical composition ” refers to a mixture of a compound of this invention with other chemical components such as diluents , carriers or other excipients . a pharmaceutical composition may facilitate administration of the compound to a subject . many techniques of administering a compound exist are known in the art , such as , without limitation , orally , intramuscularly , intraocularly , intranasally , parenterally , intravenously and topically . pharmaceutical compositions will generally be tailored to the specific intended route of administration . as used herein , a “ carrier ” refers to a compound that facilitates the incorporation of a compound into cells or tissues . for example , without limitation , dimethyl sulfoxide ( dmso ) is a commonly utilized carrier that facilitates the uptake of many organic compounds into cells or tissues of a subject . as used herein , a “ diluent ” refers to an ingredient in a pharmaceutical composition that lacks pharmacological activity but may be pharmaceutically necessary or desirable . for example , a diluent may be used to increase the bulk of a potent drug whose mass is too small for manufacture or administration . it may also be a liquid for the dissolution of a drug to be administered by injection , ingestion or inhalation . a common form of diluent in the art is a buffered aqueous solution such as , without limitation , phosphate buffered saline that mimics the composition of human blood . the compounds of this invention can be administered to a subject per se , or in a pharmaceutical composition where they are mixed with other active ingredients as , for example , in a combination therapy , or suitable carriers or excipient ( s ). techniques for formulation and administration of the compounds of the instant application may be found in “ remington &# 39 ; s pharmaceutical sciences ,” mack publishing co ., easton , pa ., 18th edition , 1990 . suitable routes of administration may , without limitation , include oral , rectal , transmucosal , or intestinal administration ; parenteral delivery , including intramuscular , subcutaneous , intravenous , intramedullary injections , as well as intrathecal , direct intraventricular , intraperitoneal , intranasal , intraocular injections or as an aerosol inhalant . alternatively , one may administer the compound in a local rather than systemic manner , for example , via injection of the compound directly into the area of pain or inflammation , often in a depot or sustained release formulation . furthermore , one may administer the drug in a targeted drug delivery system , for example , in a liposome coated with a tissue - specific antibody . the liposomes will be targeted to and taken up selectively by the organ . the pharmaceutical compositions disclosed herein may be manufactured procedures well - known in the art , e . g ., by means of conventional mixing , dissolving , granulating , dragee - making , levigating , emulsifying , encapsulating , entrapping or tabletting processes . pharmaceutical compositions for use in accordance with the present disclosure thus may be formulated in conventional manner using one or more pharmaceutically acceptable carriers comprising excipients and auxiliaries , which facilitate processing of the active compounds into preparations , which can be used pharmaceutically . proper formulation is dependent upon the route of administration chosen . any of the well - known techniques , carriers , and excipients may be used as suitable and as understood in the art ; e . g ., in remington &# 39 ; s pharmaceutical sciences , above . for injection , the agents disclosed herein may be formulated in aqueous solutions , preferably in physiologically compatible buffers such as hank &# 39 ; s solution , ringer &# 39 ; s solution , or physiological saline buffer . for transmucosal administration , penetrants appropriate to the barrier to be permeated are used in the formulation . such penetrants are generally known in the art . for oral administration , the compounds can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art . such carriers enable the compounds disclosed herein to be formulated as tablets , pills , dragees , capsules , liquids , gels , syrups , slurries , suspensions and the like , for oral ingestion by a patient to be treated . pharmaceutical preparations for oral use can be obtained by mixing one or more solid excipient with pharmaceutical combination disclosed herein , optionally grinding the resulting mixture , and processing the mixture of granules , after adding suitable auxiliaries , if desired , to obtain tablets or dragee cores . suitable excipients are , in particular , fillers such as sugars , including lactose , sucrose , mannitol , or sorbitol ; cellulose preparations such as , for example , maize starch , wheat starch , rice starch , potato starch , gelatin , gum tragacanth , methyl cellulose , hydroxypropylmethyl - cellulose , sodium carboxymethylcellulose , and / or polyvinylpyrrolidone ( pvp ). if desired , disintegrating agents may be added , such as the cross - linked polyvinyl pyrrolidone , agar , or alginic acid or a salt thereof such as sodium alginate . dragee cores are provided with suitable coatings . for this purpose , concentrated sugar solutions may be used , which may optionally contain gum arabic , talc , polyvinyl pyrrolidone , carbopol gel , polyethylene glycol , and / or titanium dioxide , lacquer solutions , and suitable organic solvents or solvent mixtures . dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses . pharmaceutical preparations , which can be used orally , include push - fit capsules made of gelatin , as well as soft , sealed capsules made of gelatin and a plasticizer , such as glycerol or sorbitol . the push - fit capsules can contain the active ingredients in admixture with filler such as lactose , binders such as starches , and / or lubricants such as talc or magnesium stearate and , optionally , stabilizers . in soft capsules , the active compounds may be dissolved or suspended in suitable liquids , such as fatty oils , liquid paraffin , or liquid polyethylene glycols . in addition , stabilizers may be added . all formulations for oral administration should be in dosages suitable for such administration . for buccal administration , the compositions may take the form of tablets or lozenges formulated in conventional manner . for administration by inhalation , the compounds for use according to the present disclosure are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer , with the use of a suitable propellant , e . g ., dichlorodifluoromethane , trichlorofluoromethane , dichlorotetrafluoroethane , carbon dioxide or other suitable gas . in the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount . capsules and cartridges of , e . g ., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch . the compounds may be formulated for parenteral administration by injection , e . g ., by bolus injection or continuous infusion . formulations for injection may be presented in unit dosage form , e . g ., in ampoules or in multi - dose containers , with an added preservative . the compositions may take such forms as suspensions , solutions or emulsions in oily or aqueous vehicles , and may contain formulatory agents such as suspending , stabilizing and / or dispersing agents . pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water - soluble form . additionally , suspensions of the active compounds may be prepared as appropriate oily injection suspensions . suitable lipophilic solvents or vehicles include fatty oils such as sesame oil , or synthetic fatty acid esters , such as ethyl oleate or triglycerides , or liposomes . aqueous injection suspensions may contain substances , which increase the viscosity of the suspension , such as sodium carboxymethyl cellulose , sorbitol , or dextran . optionally , the suspension may also contain suitable stabilizers or agents , which increase the solubility of the compounds to allow for the preparation of highly , concentrated solutions . alternatively , the active ingredient may be in powder form for constitution with a suitable vehicle , e . g ., sterile pyrogen - free water , before use . the compounds may also be formulated in rectal compositions such as suppositories or retention enemas , e . g ., containing conventional suppository bases such as cocoa butter or other glycerides . in addition to the formulations described previously , the compounds may also be formulated as a depot preparation . such long acting formulations may be administered by implantation ( for example subcutaneously or intramuscularly ) or by intramuscular injection . thus , for example , the compounds may be formulated with suitable polymeric or hydrophobic materials ( for example as an emulsion in an acceptable oil ) or ion exchange resins , or as sparingly soluble derivatives , for example , as a sparingly soluble salt . a pharmaceutical carrier for the hydrophobic compounds disclosed herein is a co - solvent system comprising benzyl alcohol , a nonpolar surfactant , a water - miscible organic polymer , and an aqueous phase . a common co - solvent system used is the vpd co - solvent system , which is a solution of 3 % w / v benzyl alcohol , 8 % w / v of the nonpolar surfactant polysorbate 80 ™, and 65 % w / v polyethylene glycol 300 , made up to volume in absolute ethanol . naturally , the proportions of a co - solvent system may be varied considerably without destroying its solubility and toxicity characteristics . furthermore , the identity of the co - solvent components may be varied : for example , other low - toxicity nonpolar surfactants may be used instead of polysorbate 80 ™; the fraction size of polyethylene glycol may be varied ; other biocompatible polymers may replace polyethylene glycol , e . g ., polyvinyl pyrrolidone ; and other sugars or polysaccharides may be used . alternatively , other delivery systems for hydrophobic pharmaceutical compounds may be employed . liposomes and emulsions are well known examples of delivery vehicles or carriers for hydrophobic drugs . certain organic solvents such as dimethylsulfoxide also may be employed , although usually at the cost of greater toxicity . additionally , the compounds may be delivered using a sustained - release system , such as semi - permeable matrices of solid hydrophobic polymers containing the therapeutic agent . various sustained - release materials have been established and are well known by those skilled in the art . sustained - release capsules may , depending on their chemical nature , release the compounds for a few weeks up to over 100 days . depending on the chemical nature and the biological stability of the therapeutic reagent , additional strategies for protein stabilization may be employed . many of the compounds used in the pharmaceutical combinations disclosed herein may be provided as salts with pharmaceutically compatible counterions . pharmaceutically compatible salts may be formed with many acids , including but not limited to hydrochloric , sulfuric , acetic , lactic , tartaric , malic , succinic , etc . salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free acids or base forms . pharmaceutical compositions suitable for use in the methods disclosed herein include compositions where the active ingredients are contained in an amount effective to achieve its intended purpose . more specifically , a therapeutically effective amount means an amount of compound effective to prevent , alleviate or ameliorate symptoms of disease or prolong the survival of the subject being treated . determination of a therapeutically effective amount is well within the capability of those skilled in the art , especially in light of the detailed disclosure provided herein . the exact formulation , route of administration and dosage for the pharmaceutical compositions disclosed herein can be chosen by the individual physician in view of the patient &# 39 ; s condition . ( see e . g ., fingl et al . 1975 , in “ the pharmacological basis of therapeutics ”, ch . 1 p . 1 ). typically , the dose range of the composition administered to the patient can be from about 0 . 5 to 1000 mg / kg of the patient &# 39 ; s body weight , or 1 to 500 mg / kg , or 10 to 500 mg / kg , or 50 to 100 mg / kg of the patient &# 39 ; s body weight . the dosage may be a single one or a series of two or more given in the course of one or more days , as is needed by the patient . note that for almost all of the specific compounds mentioned in the present disclosure , human dosages for treatment of at least some condition have been established . thus , in most instances , the methods disclosed herein will use those same dosages , or dosages that are between about 0 . 1 % and 500 %, or between about 25 % and 250 %, or between 50 % and 100 % of the established human dosage . where no human dosage is established , as will be the case for newly - discovered pharmaceutical compounds , a suitable human dosage can be inferred from ed 50 or id 50 values , or other appropriate values derived from in vitro or in vivo studies , as qualified by toxicity studies and efficacy studies in animals . although the exact dosage will be determined on a drug - by - drug basis , in most cases , some generalizations regarding the dosage can be made . the daily dosage regimen for an adult human patient may be , for example , an oral dose of between 0 . 1 mg and 500 mg of each ingredient , preferably between 1 mg and 250 mg , e . g . 5 to 200 mg or an intravenous , subcutaneous , or intramuscular dose of each ingredient between 0 . 01 mg and 100 mg , preferably between 0 . 1 mg and 60 mg , e . g . 1 to 40 mg of each ingredient of the pharmaceutical compositions disclosed herein or a pharmaceutically acceptable salt thereof calculated as the free base , the composition being administered 1 to 4 times per day . alternatively the compositions disclosed herein may be administered by continuous intravenous infusion , preferably at a dose of each ingredient up to 400 mg per day . thus , the total daily dosage by oral administration of each ingredient will typically be in the range 1 to 2000 mg and the total daily dosage by parenteral administration will typically be in the range 0 . 1 to 400 mg . suitably the compounds will be administered for a period of continuous therapy , for example for a week or more , or for months or years . dosage amount and interval may be adjusted individually to provide plasma levels of the active moiety , which are sufficient to maintain the modulating effects , or minimal effective concentration ( mec ). the mec will vary for each compound but can be estimated from in vitro data . dosages necessary to achieve the mec will depend on individual characteristics and route of administration . however , hplc assays or bioassays can be used to determine plasma concentrations . dosage intervals can also be determined using mec value . compositions should be administered using a regimen , which maintains plasma levels above the mec for 10 - 90 % of the time , preferably between 30 - 90 % and most preferably between 50 - 90 %. in cases of local administration or selective uptake , the effective local concentration of the drug may not be related to plasma concentration . the amount of composition administered will , of course , be dependent on the subject being treated , on the subject &# 39 ; s weight , the severity of the affliction , the manner of administration and the judgment of the prescribing physician . the compositions may , if desired , be presented in a pack or dispenser device , which may contain one or more unit dosage forms containing the active ingredient . the pack may for example comprise metal or plastic foil , such as a blister pack . the pack or dispenser device may be accompanied by instructions for administration . the pack or dispenser may also be accompanied with a notice associated with the container in form prescribed by a governmental agency regulating the manufacture , use , or sale of pharmaceuticals , which notice is reflective of approval by the agency of the form of the drug for human or veterinary administration . such notice , for example , may be the labeling approved by the u . s . food and drug administration for prescription drugs , or the approved product insert . compositions comprising a compound disclosed herein formulated in a compatible pharmaceutical carrier may also be prepared , placed in an appropriate container , and labeled for treatment of an indicated condition . in another aspect , disclosed herein is a method of modulating the activity of a phosphoenolpyruvyl transferase ( pept ) enzyme , comprising : contacting the pept enzyme with a compound of any one of formulae i or ii as described herein . in some embodiments , the method further comprises the step of detecting a change in the activity of the enzyme , and / or comparing the activity of the enzyme after the contacting to the activity of the enzyme before the contacting . in some embodiments , the compound of any one of formulae i or ii is a competitive inhibitor of the pept enzymes . in other embodiments , the compound of any one of formulae i or ii is an un - competitive inhibitor of the pept enzymes . in yet other embodiments , the compound of any one of formula i or ii is a non - competitive inhibitor of the pept enzymes . in still other embodiments , the compound of any one of formulae i or ii is a mixed inhibitor of the pept enzymes . as used herein , to “ modulate ” the activity of an pept enzyme means either to activate it , i . e ., to increase its cellular function over the base level measured in the particular environment in which it is found , or deactivate it , i . e ., decrease its cellular function to less than the measured base level in the environment in which it is found and / or render it unable to perform its cellular function at all even in the presence of a natural binding partner . a natural substrate partner is an endogenous molecule that is a substrate for the enzyme . as used herein , to “ detect ” changes in the activity of a pept enzyme refers to the process of analyzing the result of an experiment using whatever analytical techniques are best suited to the particular situation . in some cases simple visual observation may suffice , in other cases the use of a microscope , visual or uv light analyzer or specific bioassays may be required . the proper selection of analytical tools and techniques to detect changes in the activity of pept enzymes are well - known and will be apparent to those skilled in the art based on the disclosures herein . as used herein , a “ competitive inhibitor ” refers to a compound that binds to an enzyme in preference over a substrate to form an enzyme - inhibitor complex that modulates the pharmacological response associated with that particular enzyme . as used herein , “ uncompetetive inhibitor ” refers to a compound that has an affinity for an enzyme - substrate complex to form an enzyme - substrate - inhibitor complex that modulates the pharmacological response associated with that particular enzyme . as used herein , “ non - competetive inhibitor ” refers to a compound that reduces the maximum rate of an ezymatic reaction without changing the apparent binding affinity of the substrate thus modulating the pharmacological response associated with that particular enzyme . as used herein , “ mixed inhibitor ” refers to a compound that binds to an enzyme or enzyme - substrate complex that changes both the affinity of the enzyme for the substrate and reduces the maximal rate of an enzymatic reaction thus modulating the pharmacological response associated with that particular enzyme . in some embodiments , the above enzyme is contacted with the compound of any one of formula i or ii in vivo , e . g ., when the enzyme is in a tissue or in an animal . in other embodiments , the above enzyme is contacted with the compound of any one of formula i or ii in vitro , e . g ., in an assay , or when the enzyme is in an intact cell or in a plurality of cells . in some embodiments , the compound of any one of formulae i or ii selectively modulates the pept enzyme activity relative to other enzymes that utilize phosphoenolpyruvate as a substrate . in some embodiments , the other enzymes that utilize phosphoenolpyruvate comprise the krebs cycle enzymes . throughout the present disclosure , the pept enzyme can be selected from the group consisting of a bacterial pept enzyme , a fungal pept enzyme , a plant pept enzyme , a trypanosomal pept enzyme , a protozoan pept enzyme or any other non - mammalian organism expressing the pept enzyme . in another aspect , disclosed herein is a method of alleviating bacterial , fungal or trypanosomal infection or parasitism in a subject , comprising : identifying a subject in need thereof ; and administering to the subject a therapeutically effective amount of a compound of any one of formulae i or ii . in some embodiments , the subject is a patient . as used herein , a “ subject ” refers to an animal that is the object of treatment , observation or experiment . “ animal ” includes cold - and warm - blooded vertebrates and invertebrates such as fish , shellfish , reptiles and , in particular , mammals . “ mammal ” includes , without limitation , mice ; rats ; rabbits ; guinea pigs ; dogs ; cats ; sheep ; goats ; cows ; horses ; primates , such as monkeys , chimpanzees , and apes ; and , in particular , humans . as used herein , a “ patient ” refers to a subject that is being treated by a medical professional such as an m . d . or a d . v . m . to attempt to cure , or at least ameliorate the effects of , a particular disease or disorder or to prevent the disease or disorder from occurring in the first place . in some embodiments , the infection or parasitism is caused by vectored diseases such as malaria , chagas disease , sleeping sickness , leishmaniasis or lyme disease or is as an unintended consequence of medical therapies including , but not limited to , invasive surgeries , antibiotic treatments or antiviral treatments . in another aspect , disclosed herein is a method of identifying a compound that modulates the activity of a pept enzyme , comprising : contacting the pept enzyme with a plurality of compounds of any one of formulae i or ii one at a time ; comparing the activity of the enzyme after the contacting with each compound of any one of formulae i or ii to the activity of the enzyme before the contacting ; and selecting a compound of any one of formulae i or ii that changes the activity of the enzyme after the contacting . in some embodiments , the enzyme is located within a cell , while in other embodiments , the enzyme is located within a plurality of cells . in further embodiments , the enzyme is located within a cell extract that expresses the enzyme , e . g ., a cell extract that contains the genetic code for any of the pept enzymes . contacting a cell or plurality of cells may comprise incubating the cell ( s ) with the test compound . the cell ( s ) may be engineered to over - express the enzyme . the assay may further comprise the addition of a known inhibitor to the test milieu to assist in differentiating a competetive inhibitor from a non - competetive inhibitor . in general , if the basal activity of the enzyme , as measured before any compound is added , is decreased , the compound is likely an inhibitor . in another aspect , disclosed herein is a method of identifying a compound effective for the treatment of infection and non - mammalian parasitism , comprising : contacting a compound of any one of formulae i or ii with a enzyme selected from the group consisting of a bacterial pept enzyme , a fungal pept enzyme , a plant pept enzyme , a trypanosomal pept enzyme , a protozoan pept enzyme or any other non - mammalian organism expressing the pept enzyme ; comparing the activity of the enzyme after the contacting with each compound of any one of formula i or ii to the activity of the enzyme before the contacting ; and selecting a compound of any one of formula i or ii that changes the activity of the enzyme after the contacting . in another aspect , disclosed herein is a method of modulating the activity of an enzyme that utilizes a phosphorylated molecule as a substrate . in another aspect , disclosed herein is a method of modulating the activity of an enzyme that generates a phosphorylated molecule as a product . in another aspect , disclosed herein is a method of modulating the activity of a kinase enzyme . in another aspect , disclosed herein is a method of modulating the activity of a phosphatase enzyme . in another aspect , disclosed herein is a method of modulating the activity of a receptor utilizing a phosphorylated molecule as a ligand . in another aspect , disclosed herein is a method of modulating the activity of an enzyme utilizing a phosphorylated molecule as a cofactor . in another aspect , disclosed herein is a method of modulating the activity of a macromolecule that has affinity for a phosphorylated molecule . in another aspect , disclosed herein is a method of modulating the activity of a molecule that has affinity for a phosphorylated molecule . the following examples are provided by way of illustration only and are not intended , nor should they be construed , as limiting the scope of this disclosure in any manner whatsoever . the isostere disclosure was analyzed using ab initio calculations with density functional theory employing the b3lyp functional and the 6 - 31g * basis set ( yoo , h . y . and houk , k . n . jacs 119 : 2877 ( 1997 )). this method is known to provide excellent geometries and electrostatic potentials . phosphorylated tyrosine ( phosphorylated 4 - hydroxy phenylalanine ) is known to play a key role in maintaining cellular homeostasis . a series of phospho - tyrosine analogues was computationally analyzed in order to obtain a deeper physiochemical understanding of the trifluoromethyl isostere and its coupling by various linkages to the parent phenyl ring . these calculations pointed to the remarkably and extremely similar shapes of the constant electron density surfaces in the case of the phenyl - linker - trifluoromethyl compounds as compared to the native phosphate . overall electrostatic potentials are not identical due to the inherent charge of the phosphate group at physiological ph . these calculations clearly establish the trifluoromethyl functionality as a viable isostere for phosphate . the desired neutrality of the isostere is clear in these calculations while the overall lack of charge does not impact the constant electron density surface in comparison to the naturally occurring phosphate . the energetics of solvation was examined across a wider set of trifluoromethyl analogues . the calculated dipole moments in aqueous solution for these compounds are presented along with the values for the neutral , monoanionic , and dianionic phenyl phosphates . in no case examined is the isostere found to be ionic . these results are presented in table 1 . the generality of the isostere as a mimic of phosphate found beyond naturally occurring molecules was next examined . dipole calculations analogous to those performed in the context of phospho - tyrosine were performed on the phosphorylated portion of the herbicide glyphosate ® [ n -( phosphonomethyl ) glycine , cas1017 - 83 - 6 ] along with a set of trifluoromethyl - containing analogues . the ionics of the glyphosate molecule are well - known and these dipole calculations verify the similarity of the isostere to the phosphate . as in the case of the phospho - tyrosine analogues , the trifluoromethyl isostere was not ionized under any conditions explored by this calculation . these results are presented in table 2 . trifluoroethylamine hydrochloride ( 8 . 19 g ) was dissolved in water ( 5 ml ), and the solution was adjusted to ph 9 with 1m aqueous koh . bromoacetic acid ( 2 . 78 g ) was dissolved in water ( 10 ml ), and the ph was adjusted to 9 with 1m aqueous koh . this solution of bromoacetic acid was added in portions with stirring to the solution of the amine over 1 hour . the ph of the mixture was kept at 8 - 9 by addition of 1m koh . the solution was left overnight at room temperature . in the morning the ph was 6 . 7 ; the solution was adjusted again to ph 9 . 5 with 1m koh and the solution kept at ph 8 . 5 - 9 as above . after 1 . 5 hours , the reaction mixture was concentrated under vacuum (˜ 30 ml ), and the ph was adjusted again to 9 . after 3 hours the solution was heated to 65 ° c . for 4 hours , cooled and left in the refrigerator overnight . the next day , the ph was 7 . 2 , and there was some precipitate . the ph was adjusted to 6 by addition of 2 m aqueous hbr , and the precipitate dissolved . a 0 . 1 ml aliquot was dried to a solid under vacuum , re - evaporated from d 2 o , and dissolved in 0 . 7 ml d 2 o . 1 h nmr and 13 c nmr showed the product as a mixture of im and in in a ratio of 3 : 1 . the reaction mixture was analyzed by lc - ms . approximately 1 / 50 of the solution was mixed with 1 / 10 of its volume 2m teaa , and was injected on gemini c18 20 × 250 mm column , and eluted with a gradient from 0 to 5 % acetonitrile for 45 min at 10 ml / min . the target compound eluted late , and , after evaporation , 5 mg pure im was obtained . the reaction mixture was evaporated to dryness to leave 8 . 07 g of solid . a 0 . 44 g sample of this solid was loaded in a sublimation apparatus , dried overnight under high vacuum at room temperature and sublimed by gradual increase from room temperature to 170 ° c . sublimation began at approximately 85 ° c ., and was fast above 100 ° c . the sublimate was dissolved in water / meoh , and the solution evaporated to give 89 . 1 mg of pure im . the residue was acidified with trifluoroacetic acid to approximately ph 2 , evaporated to dryness , and resublimed . the sublimate consisted of 67 mg of im , and the residue contained pure in . the remaining solid ( 6 . 52 g ) was sublimed as above . the flask was heated gradually to 150 ° c ., and held at 150 ° c . for 30 minutes . the sublimate was dissolved in water / meoh (˜ 5 . 8 ml ). an aliquot ( 0 . 3 ml ) was evaporated to a semi - solid that solidified on standing to give 81 . 3 mg of im . the balance of the sample was concentrated in the same manner to yield 4 . 80 g of im as a white powder . 1 h nmr : ( d 2 o ) δ 3 . 79 ( s , 2h ), 3 . 87 ( q , 2h ). 13 c nmr : ( d 2 o ) δ 46 . 52 ( four line pattern ), 48 . 85 , 121 . 99 ( four line pattern ), 169 . 81 . electrospray ms ( negative ion ): calculated for c 4 h 6 f 3 no 2 [ m - h ] − 156 . found 156 . 1 h nmr : ( d 2 o ) δ 3 . 91 ( s , 4h ), 3 . 93 ( q , 2h ). trifluoropropylamine ( 0 . 46 g ) was added with cooling to 98 % formic acid ( 10 ml ). glyoxylic acid ( 0 . 78 g ) was added , and the mixture was heated in a 50 ° c . water bath . after 16 hours , an aliquot ( 50 μl ) was evaporated under vacuum , and the residue evaporated twice from 1 ml of d 2 o . 1 h nmr showed ˜ 10 % unreacted amine and 90 % of the formylated adduct . additional glyoxylic acid hydrate ( 0 . 078 g ) was added , and the reaction mixture was heated at 75 ° c . in a water bath . after 2 hours an aliquot ( 50 μl ) was evaporated and the residue evaporated from d 2 o . 1 h nmr showed less amine present . after an additional 2 . 5 hours , the reaction mixture was evaporated , and the residue evaporated from water ( 5 ml ), to give 1 . 15 g of clear oil . the oil was dissolved in 1m aqueous hcl ( 8 . 1 ml ), and the solution was heated at 95 ° c . for 2 . 5 hours . the 1 h nmr showed ca . 85 % conversion to the deformylated product , io . after refluxing for another 1 . 5 hours , the reaction mixture was left at room temperature overnight . the reaction mixture was evaporated to a semisolid . this material was dissolved in meoh (˜ 5 ml ) and left in a freezer overnight . this suspension of crystals was reduced to ˜ 2 - 3 ml , and diethyl ether (˜ 10 ml ) was added . this suspension was left at room temperature for 30 minutes and the crystalline precipitate was centrifuged and washed with 10 ml diethyl ether . the crystals were dried at high vacuum to give io ( 0 . 88 g ) as a white solid . a larger scale preparation was performed to give io ( 3 . 10 g ) as a white powder . this process was developed from a similar approach ( kihlberg , j . et al acta chem scan b 37 : 911 - 916 ( 1983 )). 1 h nmr : ( d 2 o ) δ 2 . 63 ( m , 2h ), 3 . 30 ( t , 2h ), 3 . 78 ( s , 2h ). 13 c nmr : ( d 2 o ) δ 30 . 05 ( four line pattern ), 40 . 73 , 47 . 93 , 125 . 38 ( four line pattern ), 168 . 93 . electrospray ms ( negative ion ): calculated for c 5 h 8 f 3 no 2 [ m - h ] − 170 . found 170 . a 250 - ml round - bottomed flask containing a large magnetic stirbar is charged with ( benzhydrylidene - amino )- acetic acid tert - butyl ester ( 2 . 95 g ) and dry thf ( 40 ml ) under an atmosphere of nitrogen and cooled with stiffing in a dry ice / acetone bath . a solution of lihmds ( 1 . 0 m in thf , 10 ml ) is added via syringe and the content of the flask are stirred for 1 hour . a solution of 1 - bromomethyl - 4 - trifluoromethylsulfanyl - benzene ( 2 . 71 g ) in thf ( 10 ml ) is added dropwise over 30 minutes . the cooling bath is removed and the contents of the flask are allowed to warm to ambient temperature . the reaction mixture is partitioned into et 2 o against an aqueous solution of 10 % saturated citric acid ( 3 ×), an aqueous solution of 50 % saturated sodium bicarbonate ( 3 ×) and brine . the organic solution is dried over sodium sulfate , the solids filtered and the resulting organic solution is concentrated to give the crude alkylation product . a 500 - ml flask containing a magnetic stirbar is charged with this material , 1 , 4 - dioxane ( 100 ml ) and concentrated sulfuric acid ( 5 . 0 ml ). the flask is fitted with a reflux condenser and the contents of the flask were heated to reflux for 12 h . the volatiles are removed in vacuo and the residue is recrystallized from ethyl acetate / hexanes . a 250 - ml round - bottomed flask containing a large magnetic stirbar is charged with 2 -( benzhydrylidene - amino )- 3 - hydroxy - propionic acid tert - butyl ester ( 3 . 25 g ), pyridine ( 1 . 6 ml ) and dry methylene chloride ( 50 ml ) under an atmosphere of nitrogen and cooled with stiffing in an ice bath . a portion of mesyl chloride ( 1 . 15 g ) is added and the contents of the flask are stirred for 1 hour . the volatile components of the reaction mixture are evaporated and the residue dissolved in 2 - butanone ( 25 ml ). thiourea ( 1 . 52 gm ) is added in a single portion , the flask is fitted with a reflux condenser and heated for 8 hours . volatile components are again removed under vacuum and the residue is dissolved in thf ( 40 ml ) and water ( 10 ml ). potassium hydroxide ( 1 . 40 g ) and 18 - crown - 6 ( 0 . 26 g ) are added to the solution and the contents are held at reflux overnight . the reaction mixture is cooled , partitioned into et 2 o against an aqueous solution of 10 % saturated citric acid ( 3 ×), an aqueous solution of 50 % saturated sodium bicarbonate ( 3 ×) and brine . the organic solution is dried over sodium sulfate , the solids filtered and the resulting organic solution is concentrated to give the crude thiol in suitable purity for the subsequent alkylation . a 250 - ml flask containing a magnetic stirbar is charged with 2 -( benzhydrylidene - amino )- 3 - mercapto - propionic acid tert - butyl ester , and dry thf ( 40 ml ) under an atmosphere of nitrogen and cooled with stirring in a dry ice / acetone bath . a solution of khmds ( 1 . 0 m in thf , 10 ml ) is added via syringe and the content of the flask were held for 1 hour . a solution of 1 - trifluoromethyl - 1 , 2 - benziodoxol - 3 -( 1h )- one ( 3 . 16 g ) in thf ( 10 ml ) along with zinc triflimide ( 1 . 20 g ) is added dropwise over 30 minutes . the cooling bath is removed and the contents of the flask are allowed to warm to ambient temperature . the reaction mixture is partitioned into et 2 o against an aqueous solution of 10 % saturated citric acid ( 3 ×), an aqueous solution of 50 % saturated sodium bicarbonate ( 3 ×) and brine . the organic solution is dried over sodium sulfate , the solids filtered and the resulting organic solution is concentrated to give the crude alkylation product . a 500 - ml flask containing a magnetic stirbar is charged with this material , 1 , 4 - dioxane ( 100 ml ) and concentrated sulfuric acid ( 5 . 0 ml ). the flask is fitted with a reflux condenser and the contents of the flask are held at reflux for 12 h . the volatiles are removed in vacuo and the residue is recrystallized from ethyl acetate / hexanes . a 250 - ml round - bottomed flask containing a large magnetic stirbar is charged with 2 -( benzhydrylidene - amino )- 3 - hydroxy - butyric acid tert - butyl ester ( 3 . 39 g ) pyridine ( 1 . 6 ml ) and dry methylene chloride ( 50 ml ) under an atmosphere of nitrogen and cooled with stiffing in an ice bath . a portion of mesyl chloride ( 1 . 15 g ) is added and the contents of the flask stirred for 1 hour . the volatile components of the reaction mixture are evaporated and the residue dissolved in 2 - butanone ( 25 ml ). thiourea ( 1 . 52 gm ) is added in a single portion , the flask fitted with a reflux condenser and heated for 8 hours . volatile components are again removed under vacuum and the residue is dissolved in thf ( 40 ml ) and water ( 10 ml ). potassium hydroxide ( 1 . 40 g ) and 18 - crown - 6 ( 0 . 26 g ) are added to the solution and the contents are held at reflux overnight . the reaction mixture is cooled , partitioned into et 2 o against an aqueous solution of 10 % saturated citric acid ( 3 ×), an aqueous solution of 50 % saturated sodium bicarbonate ( 3 ×) and brine . the organic solution is dried over sodium sulfate , the solids filtered and the resulting organic solution is concentrated to give the crude thiol in suitable purity for the subsequent alkylation . a 250 - ml flask containing a magnetic stirbar is charged with 2 -( benzhydrylidene - amino )- 3 - mercapto - butyric acid tert - butyl ester , and dry thf ( 40 ml ) under an atmosphere of nitrogen and cooled with stiffing in a dry ice / acetone bath . a solution of khmds ( 1 . 0 m in thf , 10 ml ) is added via syringe and the content of the flask were held for 1 hour . a solution of 1 - trifluoromethyl - 1 , 2 - benziodoxol - 3 -( 1h )- one ( 3 . 16 g ) in thf ( 10 ml ) along with zinc triflimide ( 1 . 20 g ) is added dropwise over 30 minutes . the cooling bath was removed and the contents of the flask are allowed to warm to ambient temperature . the reaction mixture is partitioned into et 2 o against an aqueous solution of 10 % saturated citric acid ( 3 ×), an aqueous solution of 50 % saturated sodium bicarbonate ( 3 ×) and brine . the organic solution is dried over sodium sulfate , the solids filtered and the resulting organic solution was concentrated to give the crude alkylation product . a 500 - ml flask containing a magnetic stirbar is charged with this material , 1 , 4 - dioxane ( 100 ml ) and concentrated sulfuric acid ( 5 . 0 ml ). the flask is fitted with a reflux condenser and the contents of the flask are held at reflux for 12 h . the volatiles are removed in vacuo and the residue is recrystallized from ethyl acetate / hexanes . a 250 - ml round - bottomed flask containing a large magnetic stirbar is charged with ( 3 , 4 , 5 , 6 - tetrakis - benzyloxy - tetrahydro - pyran - 2 - yl )- methanol ( 5 . 40 g ) pyridine ( 1 . 6 ml ) and dry methylene chloride ( 50 ml ) under an atmosphere of nitrogen and cooled with stirring in an ice bath . a portion of mesyl chloride ( 1 . 15 g ) is added and the contents of the flask stirred for 1 hour . the volatile components of the reaction mixture are evaporated and the residue dissolved in 2 - butanone ( 25 ml ). thiourea ( 1 . 52 gm ) is added in a single portion , the flask is fitted with a reflux condenser and heated for 8 hours . volatile components are again removed under vacuum and the residue dissolved in thf ( 40 ml ) and water ( 10 ml ). potassium hydroxide ( 1 . 40 g ) and 18 - crown - 6 ( 0 . 26 g ) are added to the solution and the contents are held at reflux overnight . the reaction mixture is cooled , partitioned into et 2 o against an aqueous solution of 10 % saturated citric acid ( 3 ×), an aqueous solution of 50 % saturated sodium bicarbonate ( 3 ×) and brine . the organic solution is dried over sodium sulfate , the solids filtered and the resulting organic solution is concentrated to give the crude thiol in suitable purity for the subsequent alkylation . a 250 - ml flask containing a magnetic stirbar is charged with ( 3 , 4 , 5 , 6 - tetrakis - benzyloxy - tetrahydro - pyran - 2 - yl )- methanethiol and dry thf ( 40 ml ) under an atmosphere of nitrogen and cooled with stiffing in a dry ice / acetone bath . a solution of khmds ( 1 . 0 m in thf , 10 ml ) is added via syringe and the content of the flask are held for 1 hour . a solution of 1 - trifluoromethyl - 1 , 2 - benziodoxol - 3 -( 1h )- one ( 3 . 16 g ) in thf ( 10 ml ) along with zinc triflimide ( 1 . 20 g ) is added dropwise over 30 minutes . the cooling bath is removed and the contents of the flask are allowed to warm to ambient temperature . the reaction mixture is partitioned into et 2 o against an aqueous solution of 10 % saturated citric acid ( 3 ×), an aqueous solution of 50 % saturated sodium bicarbonate ( 3 ×) and brine . the organic solution is dried over sodium sulfate , the solids filtered and the resulting organic solution is concentrated to give the crude alkylation product . a 500 - ml flask containing a magnetic stirbar is charged with this material , methanol ( 50 ml ), and 10 % pd / c ( 0 . 5 g ) under a nitrogen atmosphere . the flask is sealed and acetic acid ( 10 ml ), sulfuric acid ( 2 ml ) and formic acid ( 10 ml ) are sequentially added via syringe . the contents of the flask are stirred at ambient temperature for 24 hours . the suspension is filtered and the resultant solution is concentrated to dryness . the product is recrystallized from ethyl acetate / hexanes . a 250 - ml round - bottomed flask containing a large magnetic stirbar is charged with 1 , 3 , 4 - tris - benzyloxy - 5 - hydroxymethyl - 6 - phenoxy - hexan - 2 - one ( 5 . 40 g ) pyridine ( 1 . 6 ml ) and dry methylene chloride ( 50 ml ) under an atmosphere of nitrogen and cooled with stirring in an ice bath . a portion of mesyl chloride ( 1 . 15 g ) is added and the contents of the flask stirred for 1 hour . the volatile components of the reaction mixture are evaporated and the residue dissolved in 2 - butanone ( 25 ml ). thiourea ( 1 . 52 gm ) is added in a single portion and the flask is fitted with a reflux condenser and heated for 8 hours . volatile components are again removed under vacuum and the residue dissolved in thf ( 40 ml ) and water ( 10 ml ). potassium hydroxide ( 1 . 40 g ) and 18 - crown - 6 ( 0 . 26 g ) are added to the solution and the contents are held at reflux overnight . the reaction mixture is cooled , partitioned into et 2 o against an aqueous solution of 10 % saturated citric acid ( 3 ×), an aqueous solution of 50 % saturated sodium bicarbonate ( 3 ×) and brine . the organic solution is dried over sodium sulfate , the solids filtered and the resulting organic solution is concentrated to give the crude thiol in suitable purity for the subsequent alkylation . a 250 - ml flask containing a magnetic stirbar is charged with 1 , 3 , 4 - tris - benzyloxy - 5 - mercaptomethyl - 6 - phenoxy - hexan - 2 - one and dry thf ( 40 ml ) under an atmosphere of nitrogen and cooled with stiffing in a dry ice / acetone bath . a solution of khmds ( 1 . 0 m in thf , 10 ml ) is added via syringe and the content of the flask are held for 1 hour . a solution of 1 - trifluoromethyl - 1 , 2 - benziodoxol - 3 -( 1h )- one ( 3 . 16 g ) in thf ( 10 ml ) along with zinc triflimide ( 1 . 20 g ) is added dropwise over 30 minutes . the cooling bath is removed and the contents of the flask are allowed to warm to ambient temperature . the reaction mixture is partitioned into et 2 o against an aqueous solution of 10 % saturated citric acid ( 3 ×), an aqueous solution of 50 % saturated sodium bicarbonate ( 3 ×) and brine . the organic solution is dried over sodium sulfate , the solids filtered and the resulting organic solution is concentrated to give the crude alkylation product . a 500 - ml flask containing a magnetic stirbar is charged with this material , methanol ( 50 ml ), and 10 % pd / c ( 0 . 5 g ) under a nitrogen atmosphere . the flask is sealed and acetic acid ( 10 ml ), sulfuric acid ( 2 ml ) and formic acid ( 10 ml ) are sequentially added via syringe . the contents of the flask are stirred at ambient temperature for 24 hours . the suspension is filtered and the resultant solution concentrated to dryness . the product is recrystallized from ethyl acetate / hexanes . a 250 - ml round - bottomed flask containing a large magnetic stirbar is charged with 2 -( benzhydrylidene - amino )- 3 -( tert - butyl - dimethyl - silanyloxy )- octadec - 4 - en - 1 - ol ( 5 . 78 g ), pyridine ( 1 . 6 ml ) and dry methylene chloride ( 50 ml ) under an atmosphere of nitrogen and cooled with stirring in an ice bath . a portion of mesyl chloride ( 1 . 15 g ) is added and the contents of the flask stirred for 1 hour . the volatile components of the reaction mixture are evaporated and the residue dissolved in 2 - butanone ( 25 ml ). thiourea ( 1 . 52 gm ) is added in a single portion , the flask fitted with a reflux condenser and heated for 8 hours . volatile components are again removed under vacuum and the residue dissolved in thf ( 40 ml ) and water ( 10 ml ). potassium hydroxide ( 1 . 40 g ) and 18 - crown - 6 ( 0 . 26 g ) are added to the solution and the contents are held at reflux overnight . the reaction mixture is cooled , partitioned into et 2 o against an aqueous solution of 10 % saturated citric acid ( 3 ×), an aqueous solution of 50 % saturated sodium bicarbonate ( 3 ×) and brine . the organic solution is dried over sodium sulfate , the solids filtered and the resulting organic solution is concentrated to give the crude thiol in suitable purity for the subsequent alkylation . a 250 - ml flask containing a magnetic stirbar is charged with 2 -( benzhydrylidene - amino )- 3 -( tert - butyl - dimethyl - silanyloxy )- octadec - 4 - ene - 1 - thiol and dry thf ( 40 ml ) under an atmosphere of nitrogen and cooled with stiffing in a dry ice / acetone bath . a solution of khmds ( 1 . 0 m in thf , 10 ml ) is added via syringe and the content of the flask were held for 1 hour . a solution of 1 - trifluoromethyl - 1 , 2 - benziodoxol - 3 -( 1h )- one ( 3 . 16 g ) in thf ( 10 ml ) along with zinc triflimide ( 1 . 20 g ) is added dropwise over 30 minutes . the cooling bath is removed and the contents of the flask are allowed to warm to ambient temperature . the reaction mixture is partitioned into et 2 o against an aqueous solution of 10 % saturated citric acid ( 3 ×), an aqueous solution of 50 % saturated sodium bicarbonate ( 3 ×) and brine . the organic solution is dried over sodium sulfate , the solids filtered and the resulting organic solution was concentrated to give the crude alkylation product . a 500 - ml flask containing a magnetic stirbar is charged with this material , methanol ( 50 ml ), and 10 % pd / c ( 0 . 5 g ) under a nitrogen atmosphere . the flask is sealed and acetic acid ( 10 ml ), sulfuric acid ( 2 ml ) and formic acid ( 10 ml ) are sequentially added via syringe . the contents of the flask are stirred at ambient temperature for 24 hours . the suspension is filtered and the resultant solution concentrated to dryness . the product is recrystallized from ethyl acetate / hexanes . a 250 - ml flask containing a magnetic stirbar is charged with 2 - thioxo - propionic acid tert - butyl ester ( 1 . 60 g ), and dry thf ( 40 ml ) under an atmosphere of nitrogen and cooled with stiffing in a dry ice / acetone bath . a solution of khmds ( 1 . 0 m in thf , 10 ml ) is added via syringe and the content of the flask are held for 1 hour . a solution of 1 - trifluoromethyl - 1 , 2 - benziodoxol - 3 -( 1h )- one ( 3 . 16 g ) in thf ( 10 ml ) along with zinc triflimide ( 1 . 20 g ) is added dropwise over 30 minutes . the cooling bath was removed and the contents of the flask were allowed to warm to ambient temperature . the reaction mixture is partitioned into et 2 o against an aqueous solution of 10 % saturated citric acid ( 3 ×), an aqueous solution of 50 % saturated sodium bicarbonate ( 3 ×) and brine . the organic solution is dried over sodium sulfate , the solids filtered and the resulting organic solution is concentrated to give the crude alkylation product . a 500 - ml flask containing a magnetic stirbar is charged with this material , 1 , 4 - dioxane ( 100 ml ) and concentrated sulfuric acid ( 5 . 0 ml ). the flask is fitted with a reflux condenser and the contents of the flask are held at reflux for 12 h . the volatiles are removed in vacuo and the residue is recrystallized from ethyl acetate / hexanes . a 250 - ml flask containing a magnetic stirbar is charged with ( n - methyl - guanidino )- acetic acid tert - butyl ester ( 1 . 87 g ), and dry thf ( 40 ml ) under an atmosphere of nitrogen and cooled with stiffing in a dry ice / acetone bath . a solution of khmds ( 1 . 0 m in thf , 10 ml ) is added via syringe and the content of the flask are held for 1 hour . a solution of 1 - trifluoromethyl - 1 , 2 - benziodoxol - 3 -( 1h )- one ( 3 . 16 g ) in thf ( 10 ml ) along with zinc triflimide ( 1 . 20 g ) is added dropwise over 30 minutes . the cooling bath was removed and the contents of the flask are allowed to warm to ambient temperature . the reaction mixture is partitioned into et 2 o against an aqueous solution of 10 % saturated citric acid ( 3 ×), an aqueous solution of 50 % saturated sodium bicarbonate ( 3 ×) and brine . the organic solution is dried over sodium sulfate , the solids filtered and the resulting organic solution is concentrated to give the crude alkylation product . a 500 - ml flask containing a magnetic stirbar is charged with this material , 1 , 4 - dioxane ( 100 ml ) and concentrated sulfuric acid ( 5 . 0 ml ). the flask is fitted with a reflux condenser and the contents of the flask are held at reflux for 12 h . the volatiles are removed in vacuo and the residue is recrystallized from ethyl acetate / hexanes . a 250 - ml round - bottomed flask is charged with a large stirbar , 1 , 1 , 2 - tri - benzylpyrophosphoryl chloride ( 4 . 67 g ), pyridine ( 1 . 6 ml ), dry methylene chloride ( 50 ml ) and is sealed under an atmosphere of nitrogen and cooled with stirring in an ice / salt bath . a portion of trifluoromethylsulfide ( 1 . 12 g ) is added dropwise ( caution : stench ) over 1 hour and the contents of the flask are allowed to warm for 1 hour . all volatile materials are removed under vacuum . the residue is taken up with methanol ( 50 ml ), and 10 % pd / c ( 0 . 5 g ) is added under a nitrogen atmosphere . the flask is sealed and acetic acid ( 10 ml ), sulfuric acid ( 2 ml ) and formic acid ( 10 ml ) are sequentially added via syringe . the contents of the flask are stirred at ambient temperature for 24 hours . the suspension is filtered and the resultant solution concentrated to dryness . this material is dissolved in methylene chloride ( 40 ml ) and pyridine ( 10 ml ) and the flask is sealed under an atmosphere of nitrogen . the contents are cooled in an ice bath with stirring and thionyl chloride ( 1 . 20 g ) is added dropwise over 30 minutes followed by a solution of 2 -( 6 - amino - purin - 9 - yl )- 5 - hydroxymethyl - tetrahydro - furan - 3 , 4 - diol ( 2 . 67 g ) in thf ( 20 ml ). the reaction mixture is allowed to warm to ambient temperature , poured onto ice water and partitioned into et 2 o . the combined et 2 o extracts are washed with water ( 3 ×), dried over sodium sulfate , the solids filtered and the resulting organic solution is concentrated to give the product . a 250 - ml round - bottomed flask containing a large magnetic stirbar is charged with [ 5 -( tert - butyl - dimethyl - silanyloxy )- 4 -[ 1 , 3 ] dioxan - 2 - yl - 6 - methyl - pyridin - 3 - yl ]- methanol ( 3 . 40 g ), pyridine ( 1 . 6 ml ) and dry methylene chloride ( 50 ml ) under an atmosphere of nitrogen and cooled with stirring in an ice bath . a portion of mesyl chloride ( 1 . 15 g ) is added and the contents of the flask are stirred for 1 hour . the volatile components of the reaction mixture are evaporated and the residue dissolved in 2 - butanone ( 25 ml ). thiourea ( 1 . 52 gm ) is added in a single portion and the flask is fitted with a reflux condenser and heated for 8 hours . volatile components are again removed under vacuum and the residue is dissolved in thf ( 40 ml ) and water ( 10 ml ). potassium hydroxide ( 1 . 40 g ) and 18 - crown - 6 ( 0 . 26 g ) are added to the solution and the contents are held at reflux overnight . the reaction mixture is cooled , partitioned into et 2 o against an aqueous solution of 10 % saturated citric acid ( 3 ×), an aqueous solution of 50 % saturated sodium bicarbonate ( 3 ×) and brine . the organic solution is dried over sodium sulfate , the solids filtered and the resulting organic solution is concentrated to give the crude thiol in suitable purity for the subsequent alkylation . a 250 - ml flask containing a magnetic stirbar is charged with [ 5 -( tert - butyl - dimethyl - silanyloxy )- 4 -[ 1 , 3 ] dioxan - 2 - yl - 6 - methyl - pyridin - 3 - yl ] methane - thiol and dry thf ( 40 ml ) under an atmosphere of nitrogen and cooled with stirring in a dry ice / acetone bath . a solution of khmds ( 1 . 0 m in thf , 10 ml ) is added via syringe and the content of the flask were held for 1 hour . a solution of 1 - trifluoromethyl - 1 , 2 - benziodoxol - 3 -( 1h )- one ( 3 . 16 g ) in thf ( 10 ml ) along with zinc triflimide ( 1 . 20 g ) is added dropwise over 30 minutes . the cooling bath was removed and the contents of the flask are allowed to warm to ambient temperature . the reaction mixture is partitioned into et 2 o against an aqueous solution of 10 % saturated citric acid ( 3 ×), an aqueous solution of 50 % saturated sodium bicarbonate ( 3 ×) and brine . the organic solution is dried over sodium sulfate , the solids filtered and the resulting organic solution is concentrated to give the crude alkylation product . a 500 - ml flask containing a magnetic stirbar is charged with this material , methanol ( 50 ml ), and 10 % pd / c ( 0 . 5 g ) under a nitrogen atmosphere . the flask is sealed and acetic acid ( 10 ml ), sulfuric acid ( 2 ml ) and formic acid ( 10 ml ) are sequentially added via syringe . the contents of the flask are stirred at ambient temperature for 24 hours . the suspension is filtered and the resultant solution concentrated to dryness . the product is recrystallized from ethyl acetate / hexanes . compounds were evaluated in enzymatic assays against two phospho - enolpyruvyl transferases ( pepts ): compounds were dissolved in water at 100 mg / ml . enzyme reactions were conducted in 100 ml 50 mm hepes ( ph 7 . 5 ) at room temperature . the reaction was started by the addition of epsps or mura into buffer containing 100 μm pep , 100 μm s3p or 100 μm unag and 0 , 1 , 10 , 100 , 1000 μg / ml of the respective compound . glyphosate and / or fosfomycin were used as control . the reactions were stopped after 3 minutes by the addition of 800 μl of malachite green reagent . color development was allowed to proceed for 5 min and stopped by the addition of 100 μl 34 % sodium citrate . the optical density was measured at 650 nm and the activity was calculated using phosphate standard . enzyme activity is expressed in percentage of the respective control ( minus inhibitor ) in fig1 , where meh - 001 is 2 , 2 , 2 - trifluoro - ethylamino - acetic acid ), meh - 001b is [ carboxymethyl -( 2 , 2 , 2 - trifluoro - ethyl )- amino ]- acetic acid , and meh - 002 is ( 3 , 3 , 3 - trifluoro - propylamino )- acetic acid . cytotoxicity evaluations were also performed using rat skeletal myoblast cells . experimental assay protocols and the cytotoxicity protocol appear below . assay and cytotoxicity results appear in table 3 . 2 - mercaptoethanol : 1 ml of a diluted stock ( 14 μl 2 - mercaptoethanol + 10 ml dh 2 o ) compounds are dissolved in dmso at 10 mg / ml ( sop nr . if insoluble other solvents are used according to the recommendations of the supplier . the dmso stocks are kept at − 20 ° c . for the assays fresh dilutions in medium are prepared each time . ( since dmso is toxic , care has to be taken not to exceed a final concentration of 1 % dmso in the assay ). 1 . into the wells h1 and h12 add 75 μl medium and into well h2 - h11 add 75 μl of medium that contains two times the highest drug concentration desired . per plate 10 drugs can be tested ( drug 1 - 10 column 2 - 11 ). for each assay melarsoprol is tested as the standard with 0 . 072 μg / ml as highest concentration . 2 . add 50 μl of medium at room temperature to rows a to g of a 96 - well plate ( row h has the drug ). 3 . serial drug dilutions are prepared by using a 12 - well multi - pipette . first , remove 25 μl from wells of row h and put it into row g and mix well . next , 25 μl are taken out of row g and put into row f and so on until row b . the last 25 μl of row b are discarded . a serial dilution factor of 1 : 3 is thus obtained . row a wells serve as controls without drugs . 4 . 50 μl of medium without trypanosomes are added to columns 1 and 12 ; these columns serve as background controls . 5 . dilute the trypanosomes to 3 × 104 tryps / ml . the trypanosome density is adjusted with a cell analysis system ( casy , scharfe system ) or by a count on the haemocytometer . ( the trypanosome density used should be adjusted depending on the current growth characteristics of the corresponding cultures ) per plate , allow for the use of 3 . 5 ml of the trypanosome stock . 6 . into the remaining wells ( column 2 - 11 ), add 50 μl of trypanosome suspension . 7 . the plates are then incubated for 69 h (= 72 h — time incubated with resazurin )* at 37 ° c ./ 5 % co 2 . 1 . the plates are inspected under an inverted microscope to ensure that growth is normal . additional information may be recorded , such as drug insolubility or contamination , etc . 2 . add 10 μl of the fluorescent dye resazurin to each well and incubate for an additional 3 hours ( until a subtle color change is observed , but maximum 5 hours )*. 3 . to determine an ic 50 value , the plate is read at excitation wavelength 530 nm and emission wavelength 590 nm ( pre - set lilit template file ). make sure that the values in each well are approximately 10 times the background values . 4 . data are transferred into a graphic program ( excel ) and are evaluated to determine the ic 50 or analyzed using the fluorescent plate reader software ( softmax ). standard assay parasite strains : t . cruzi tulahuen c2c4 , containing the lac z gene . standard drug : benznidazole ( radanil ™, hoffman la roche ): start conc . 30 μg / ml ( ic 50 = 0 . 35 μg / ml ) medium : rpmi 1640 + 10 % fcs + 1 . 7 μm l - glutamine ( 850 μl 200 mm for 100 ml ) plates : costar ™ 96 - well microtiter plates incubation : 37 ° c ., 5 % co 2 substrate : 2 . 5 × cprg / nonidet solution : 5 × stock = 500 μl nonidet p40 + 30 . 38 mg cprg in 100 ml 1 × pbs dilute the 5 × stock 1 : 1 with 1 × pbs . light sensitive ! compounds are dissolved in dmso at 10 mg / ml ( sop nr . if insoluble other solvents are used according to the recommendations of the supplier . the dmso stocks are kept at − 20 ° c . for the assays fresh dilutions in medium are prepared each time . ( since dmso is toxic , care has to be taken not to exceed a final concentration of 1 % dmso in the assay ). caution : t . cruzi is a human pathogen and must be treated as such , i . e . biohazard waste , soap disinfection , gloves . seed all 96 wells with 100 μl medium containing 2 × 103 l6 cells per well , using a multiwall repeater pipette . add 5 × 103 tryps into all columns 2 - 11 using the multi - well repeater pipette . in columns 1 and 12 , add 50 μl of medium . remove medium from wells in row a to g with the aspirator and replace with 100 μl medium using the multi - well repeater pipette . ( take care to not cross infect columns 1 and 12 - remove medium only before medium + tryps !) remove medium from row h ( do not cross - infect !) and add 150 μl medium to wells h1 and h12 and add into wells h2 - h11 150 μl medium with the highest drug concentration . per plate 10 drugs can be tested ( drug 1 10 columns 2 - 11 ). note : do the first half of the plates ( remove medium and add drug ) and then the second half , so the cells / tryps don &# 39 ; t dry out . serial drug dilutions are prepared by using a 12 - channel multi - pipette . first , remove 50 μl from wells of row h and put into row g and mix well . next , 50 μl are taken out of row g and put into row f and so on until row b . the last 50 μl of row b are discarded . a serial dilution factor of 1 : 3 is thus obtained . wells in row a serve as control wells without drugs . evaluate the plates visually to determine the mic ( minimal inhibitory concentration ): lowest drug concentration at which no trypanosomes with a normal morphology and motility as compared to the control wells can be seen . 50 μl of 2 . 5 × cprg / nonidet are added to all wells . a color reaction will become visible in 2 - 6 hours and can be read in an absorbance reader at 540 nm data are transferred into a graphic program ( excel ) and are evaluated to determine the ic 50 or analyzed using the plate reader software ( softmax ). compounds are dissolved in dmso ( sop nr . d1 ), unless otherwise specified by the supplier . the stock solution is 10 mg / ml and stored at − 20 ° c . stocks are kept for 3 years . ( since dmso is toxic , care has to be taken not to exceed a final concentration of 1 % dmso in the assay ). 1 . into the wells h1 and h12 add 75 μl of medium and into well h2 - h11 add 75 μl of medium that contains two times the highest drug concentration desired . per plate 10 drugs can be tested ( drug 1 - 10 column 2 - 11 ). for each assay miltefosin is tested as the standard with 3 μg / ml as highest concentration . 2 . add 50 μl of medium at room temperature to rows a to g of a 96 - well plate ( row h has the drug ). 3 . serial drug dilutions are prepared by using a 12 - channel multi - pipette . first , remove 25 μl from wells of row h and put it into row g and mix well . next , 25 μl are taken out of row g and put into row f and so on until row b . the last 25 μl of row b are discarded . a serial dilution factor of 1 : 3 is thus obtained . row a wells serve as controls without drugs . 4 . 50 μl of medium without parasites are added to columns 1 and 12 which serve as controls to provide the background signal in the fluorescence scanner . 5 . 50 μl of a suspension containing 2 × 106 axenically grown amastigotes from a healthy culture in log phase are added to all the remaining wells leading to an initial parasite density of 1 × 106 / ml . 6 . the plates are incubated for 70 hours (= 72 h — time incubated with resazurin ) at 37 ° c ./ 5 % co 2 . 1 . the plates are inspected under an inverted microscope to ensure that growth is normal . additional information may be recorded , such as drug insolubility or contamination , etc . 2 . add 10 μl of the fluorescent dye resazurin to each well and incubate for an additional 2 hours ( until a subtle color change is observed ). 3 . to determine an ic 50 value , the plate is read in a fluorescence scanner ( spectramax gemini xs from molecular devices ) at excitation wavelength 530 nm and emission wavelength 590 nm ( pre - set lilit template file ). make sure that the values in each well are approximately 10 times the background values . 4 . data are transferred into a graphic program ( excel ) and are evaluated to determine the ic 50 or analyzed using the fluorescent plate reader software ( softmax ). plasmodium falciparum nf54 ( sensitive to all known drugs ) plasmodium falciparum k 1 ( chloroquine / pyrimethamine resistant ) chloroquine ( 10 mg / ml stock ; start concentration 1000 ng / ml ) ( average ic 50 : 0 . 065 μg / ml ) artemisinine ( qinghaosu ) ( 5 mg / ml stock ; start concentration 10 ng / ml ) medium : rpmi 1640 without hypoxanthine 10 . 44 g / l hepes 5 . 94 g / l albumax ® 5 g / l neomycin 10 ml / l ( 100 u / ml ) nahco3 50 g / l stock 42 ml / l ( 2 . 1 g / l ) radioactive hypoxanthine : 500 μl 3h - hypoxanthine stock + 500 μl etoh + 49 ml medium ( these 1 ml aliquots are stored at − 20 ° c ., medium added fresh ) washed human red blood cells a +( rbc ): may be stored up to 10 days fresh dilutions made for each assay plates : costar ™ 96 - well microtitre plates incubation : 37 ° c ., 4 % co 2 , 3 % o 2 , 93 % n 2 inactive ( no repeat ): ic 50 & gt ; 5 μg / ml moderate activity ( repeat ): 0 . 5 μg / ml & lt ; ic 50 & lt ; 5 μg / ml high activity ( repeat ): ic 50 & lt ; 0 . 5 μg / ml ( for active series & lt ; 0 . 2 ) compounds are dissolved in dmso at 10 mg / ml ( sop nr . d1 ). if insoluble other solvents are used according to the recommendations of the supplier . the dmso stocks are kept at − 20 ° c . for the assays fresh dilutions in medium are prepared each time . ( since dmso is toxic , care has to be taken not to exceed a final concentration of 0 . 5 % dmso in the assay ). caution : p . falciparum is a human pathogen and must be treated as such , i . e . biohazard waste , disinfection , gloves , etc . 1 . into the wells of row h add 100 μl of medium that contains four times the highest drug concentration desired . per plate 12 drugs can be tested . 2 . add 100 μl of medium at room temperature to all wells of the plate . 3 . serial drug dilutions are prepared by using a 12 - well multi - pipette . first , remove 100 μl from wells of row h and put it into row g and mix well . next , 100 μl are taken out of row g and put into row f and so on until row b . the last 100 μl of row b are discarded . a serial dilution factor of 1 : 2 is thus obtained . row a wells serve as controls without drugs . 4 . 100 μl of medium + rbc are added to the last 4 wells of row a ; these columns serve as background controls ( that may be caused by 3h - hypoxanthine incorporation into rbc without the parasite ) 5 . into the remaining wells , add 100 μl of medium + rbc + p . falciparum mix . 6 . the plates are put into a chamber and gassed with a 4 % co 2 , 3 % o 2 , 93 % n2 mix . the chamber is placed in the incubator for 48 hours at 37 ° c . 1 . add 50 μl of medium + 3h - hypoxanthine ( 0 . 5 μci ) to each well . 2 . the plates are put back into the chamber and gassed with a 4 % co 2 , 3 % o 2 , 93 % n2 mix . the chamber is placed back in the incubator for 24 hours at 37 ° c . data are transferred into a graphic program ( excel ) and are evaluated to determine the ic 50 . l - 6 ( rat skeletal myoblast cells ) or ht - 29 ( human bladder carcinoma ) standard drug : podophylotoxin ( ppt ); starting concentration : 0 . 1 μg / ml average ic 50 = 0 . 006 μg / ml medium : rpmi 1640 + 10 % fcs + 1 . 7 μm l - glutamine ( 850 μl 200 mm for 100 ml ) culture vessel : costar ™ 96 - well microtiter plates incubation : 37 ° c ., 5 % co 2 compounds are dissolved in dmso ( sop nr . d1 ), unless otherwise specified by the supplier . the stock solution is 10 mg / ml and stored at − 20 ° c . stocks are kept for 3 years . ( since dmso is toxic , care has to be taken not to exceed a final concentration of 1 % dmso in the assay ). 1 . add 100 μl of medium to wells of columns 1 and 12 of a microtiter plate . these wells serve as controls . 2 . 100 μl of a cell suspension of 4 × 104 cells / m 1 is added into the remaining columns ( 2 - 11 ). cells are allowed to attach over night . per plate , allow for 6 . 5 ml of cell suspension to be used . 3 . the next day , the medium is removed from row h ( do this for half of the plates and go to step 4 and return to step 3 for the second half , so the cells don &# 39 ; t dry out ). 4 . 150 μl of medium containing the highest drug concentration is added to the wells h2 - h11 and 150 μl medium is added in wells h1 and h12 . 10 drugs can be tested on one plate ( drug 1 - 10 in column 2 - 11 ). columns 1 and 12 serve as background . 5 . serial drug dilutions are prepared by using a 12 - channel multi - pipette . first , remove 50 μl from wells of row h and put into row g and mix well . next , 50 μl are taken out of row g and put into row f and so on until row b . the last 50 μl of row b are discarded . a serial dilution factor of 1 : 3 is thus obtained . wells in row a serve as control wells without drugs . 6 . the plates are then incubated for 70 hrs at 37 ° c ./ 5 % co 2 . 1 . the plates are inspected under an inverted microscope to ensure that growth is normal . additional information may be recorded , such as drug insolubility or contamination , etc . 2 . add 10 μl of the fluorescent dye resazurin to each well and incubate the plates for another 2 hours ( until a color change is observed , but maximum 3 hours ). 3 . to determine an ic 50 value , the plate is read at excitation wavelength 530 nm and emission wavelength 590 nm ( pre - set lilit template file ). make sure that the values in each well are approximately 10 times the background values . 4 . data are transferred into a graphic program ( excel ) and are evaluated to determine the ic 50 or analyzed using the fluorescent plate reader software ( softmax ).	2
fig1 to 4 show an oscillating piston engine provided with general reference numeral 10 . further details of the oscillating piston engine 10 are shown in fig5 to 10 . the oscillating piston engine 10 is generally designed as an internal combustion engine but , modified accordingly , can also be used as a pump or as a compressor . the oscillating piston engine 10 has a housing 12 which in fig1 is shown closed . the housing 12 has a central housing portion 14 which is spherical in its formation . the central housing portion 14 is composed of two housing halves 16 and 18 which are joined together via a flange 20 . the housing 12 also has a first end face 22 and a second end face 24 opposing the first end face 22 . the first end face 22 is formed by an end - face housing lid 26 and the second end face 24 by an end - face housing lid 28 . the housing lids 26 and 28 are connected to the central housing portion 14 or the housing halves 16 and 18 thereof . the housing lids 26 and 28 can be detached from the central housing portion 14 , just as the housing half 16 can be detached from the housing half 18 . according to fig2 to 4 , four pistons 30 , 32 , 34 , and 36 are arranged in - side the housing 12 . the pistons 30 , 32 , 34 , and 36 can revolve in the housing 12 jointly about an axis of rotation 38 in the direction indicated by an arrow 40 . the axis of rotation 38 passes through the center of the spherical interior of the housing 12 and is fixed in relation to the housing , i . e . does not change its position relative to the housing 12 as the pistons 32 , 34 , and 36 revolve . the pistons 30 , 32 , 34 , and 36 perform as they revolve about the axis of rotation 38 a pivoting movement which is superimposed on the revolving movement . the pistons 30 and 32 perform in this case reciprocating pivoting movements about a first pivot axis 42 which perpendicularly intersects the axis of rotation 38 at the center of the interior of the housing 12 , while the pistons 34 and 36 perform as they revolve about the axis of rotation 38 reciprocating pivoting movements about a second pivot axis 44 which perpendicularly intersects the axis of rotation 38 likewise at the center of the interior of the housing 12 , but is also located perpendicularly to the pivot axis 42 . the pivot axes 42 and 44 revolve with the pistons 30 , 32 , 34 , and 36 likewise about the axis of rotation 38 . the instantaneous pivot plane of the pistons 30 and 32 is in this case located at all times perpendicularly to the instantaneous pivot plane of the pistons 34 and 36 . it is however also possible for all four pistons 30 , 32 , 34 , and 36 to be arranged in a common plane and for the pivot axes 42 and 44 to be parallel or coincide . both the axis of rotation 38 and the pivot axes 42 and 44 are in this case to be understood as geometric axes . the pivoting movements of the pistons 30 and 32 or 34 and 36 are carried out between two end positions , one end position being shown in fig2 ( what is known as the bdc position ) and the other end position in fig3 ( what is known as the tdc position ). the pivoting movements of the pistons 30 and 32 , on the one hand , and the pistons 34 and 36 , on the other hand , are in all cases in the same direction , i . e . when the pistons 30 and 32 pivot apart from each other , the pistons 34 and 36 also pivot apart from each other , and vice versa . each of the pistons has an end surface , i . e . the piston 30 has an end surface 46 , the piston 32 has an end surface 48 , the piston 34 has an end surface 50 and the piston 36 has an end surface 52 , the view onto said end surface 52 being obscured in fig2 by another component . the pistons 30 and 32 form a first pair of pistons , the end surfaces 46 and 48 of which face each other . the end surfaces 46 and 48 define a first working chamber 54 . the pistons 34 and 36 form a second pair of pistons , the end surfaces 50 and 52 of which face each other and define a second working chamber 56 . the volumes of the working chambers 54 and 56 increase and decrease in size in accordance with the reciprocating pivoting movements of the pistons 30 and 32 or 34 and 36 , the working chambers 54 and 56 increasing or decreasing in size in all cases in the same direction . the pistons 30 , 32 , 34 , and 36 are arranged in the housing 12 in such a way that the axis of rotation 38 passes through both working chambers 54 and 56 , preferably centrally in each revolving and pivoting position of the pistons 30 , 32 , 34 , and 36 . in order to generate the pivoting movements of the pistons 30 , 32 , 34 , and 36 during the revolving movement thereof about the axis of rotation 38 , each piston has a running element : the piston 30 a running element 58 ( fig3 and 4 ), the piston 32 a running element 60 ( cf . fig2 to 4 ), the piston 34 a running element 62 ( cf . fig2 ) and the piston 36 a running element 64 ( cf . fig3 and 4 ). the running elements 58 , 60 , 62 and 64 are in this case formed as rollers , each running element 58 , 60 , 62 and 64 being rotatably fastened to the associated piston 30 , 32 , 34 , and 36 . a first control cam 66 , which is formed on a control cam member 68 , is associated with the running elements 58 and 60 of the pistons 30 and 32 . a second control cam 70 on the control cam member 68 is associated with the running elements 62 and 64 of the pistons 34 and 36 . the running elements 58 and 60 accordingly run along the same control cam 66 , and the running elements 62 and 64 along the same control cam 70 . the control cams 66 and 70 are formed around the axis of rotation 38 over their entire circumference and have a contour or cam guide allowing the pivoting movement of the pistons 30 and 32 or 34 and 36 to be derived from the revolving movement thereof about the axis of rotation 38 . the pistons 30 , 32 , 34 , and 36 are mounted to slide in the housing 12 in a piston cage 72 which revolves about the axis of rotation 38 in conjunction with the pistons 30 , 32 , 34 , and 36 and is shown in fig5 together with the pistons 30 , 32 , 34 , and 36 , but without the housing 12 . in the piston cage 72 , the pistons are prevented from turning or tilting , for example by means of tongue - and - groove connections ( not shown ). the piston cage 72 has according to fig4 a bore 74 associated with the pistons 34 and 36 and according to fig2 a bore 76 associated with the pistons 30 and 32 . the pistons 34 and 36 are mounted to slide in the bore 74 , and the pistons 30 and 32 are mounted to slide in the bore 76 . together with the end surfaces 46 and 48 of the pistons 30 and 32 , the bore 76 delimits the working chamber 54 , and the bore 74 delimits the working chamber 56 together with the end surfaces 50 and 52 of the pistons 34 and 36 . owing to the arrangement , staggered through 90 °, of the pistons 30 and 32 relative to the pistons 34 and 36 , bores 74 and 76 are also formed perpendicularly to each other in the piston cage 72 . the bores 74 and 76 are provided in a respective main bearing portion 78 ( bore 74 ) and main bearing portion 80 ( bore 76 ). via the main bearing portions 78 and 80 , the piston cage 72 is mounted in the housing 12 so as to be able to rotate about the axis of rotation 38 via bearings 82 and 84 respectively . the piston cage 72 serves not only to mount the pistons 30 , 32 , 34 , and 36 , but rather also to transmit the rotational movement from or to a drive / output shaft 86 . for this purpose , the piston cage 72 is provided at its ends with in each case a set of outer teeth 88 and 90 respectively , of which at least one set , in the exemplary embodiment shown the set of outer teeth 88 , meshes with a gear - wheel 92 connected to the output shaft 86 . the output shaft 86 is , in the case of the oscillating piston engine 10 , accordingly arranged on the axis of rotation 38 not coaxially , but rather extra - axially , thus facilitating the gas exchange control of the oscillating piston engine 10 to be described hereinafter . for operating the oscillating piston engine 10 as an internal combustion engine , it is necessary that the working chambers 54 and 56 , in which a fuel / air mixture is compressed and ignited and after ignition expanded , allow an exchange of gas , i . e . air and fuel must periodically be admitted into the working chambers 54 and 56 and combusted fuel / air mixture expelled again from the working chambers 54 and 56 . this requires gas exchange openings in the housing 12 , which will be described hereinafter . in the case of the oscillating piston engine 10 , the gas exchange openings are provided in the end faces 22 and 24 of the housing 12 , i . e . in proximity to the axis of rotation 38 , but eccentrically thereto . as the oscillating piston engine 10 has two working chambers 54 and 56 which are however formed symmetrically to each other , the gas exchange openings in the end faces 22 and 24 are formed identically to one another apart from an offset through 180 ° about the axis of rotation 38 , so only the gas exchange openings on the end face 22 of the housing 12 will be described hereinafter . fig7 is an internal view of the housing lid 26 forming the end face 22 of the housing 12 , and fig6 is an external view of the housing lid 26 . according to fig7 , a first gas exchange opening 94 and a second gas exchange opening 96 are formed in the end - face housing lid 26 . the gas exchange opening 94 serves to admit gas , in the present case to admit combustion air into the working chamber 56 , and the gas exchange opening 96 serves to discharge or expel a gas from the working chamber 56 , in this case to expel combusted fuel / air mixture . the gas exchange opening 94 has associated with it a connecting piece 98 which in the exemplary embodiment shown is combined with an injection nozzle 100 for injecting a fuel together with the combustion air into the working chamber 56 . however , direct injection may also be provided for the oscillating piston engine 10 , i . e . the injection nozzle 100 is then arranged separately from the connecting piece 98 . the gas exchange opening 96 has associated with it a connecting piece 102 which serves to connect the oscillating piston engine 10 to an exhaust system . the gas exchange openings 94 and 96 are arranged on the end - face housing lid 28 eccentrically with respect to the axis of rotation 38 . as is apparent from fig7 , the gas exchange openings 94 and 96 are not formed as bores passing through the end - face housing lid 28 with the same opening cross section , but rather widen from the outside to the inside of the end - face housing lid 28 . the gas exchange opening 94 has for this purpose a cavernous or funnel - shaped recess 104 , while the gas exchange opening 96 has a corresponding cavernous recess 106 . the outline of the cavernous recesses 104 and 106 is approximately in the shape of a sector of a circle in its formation . the cavernous depressions or recesses 104 and 106 respectively act as funnels for the respective admission of gas or discharge of gas . a maximum clear width w of the gas exchange openings 94 and 96 , more precisely the cavernous recesses 104 and 106 , extends , viewed in the direction of revolution about the axis of rotation 38 , over an angle of revolution of more than 30 ° and less than 90 °. for the cavernous recesses 104 and 106 , the angle of revolution in fig7 is in each case approximately 70 °. the gas exchange openings 94 and 96 are separated from each other by a web 108 . the web 108 has , viewed in the direction of revolution about the axis of rotation 38 , a smaller angular extension than the two cavernous depressions or recesses 104 and 106 , in the present case of approximately 40 °. viewed in the direction of revolution of the pistons 30 , 32 , 34 , and 36 or of the piston cage 72 ( arrow 40 in fig7 ), the gas exchange opening 96 for discharging combusted fuel / air mixture is located before the gas exchange opening 94 for admitting the fresh fuel / air mixture . this makes allowance for the mode of operation of the oscillating piston engine 10 when performing the working strokes of expel - ling , drawing - in , compressing and expanding ( working ), as will be described hereinafter . the gas exchange openings 94 and 96 in the end - face housing lid 26 of the end face 22 are one part of the gas exchange control of the oscillating piston engine 10 . the other part of the gas exchange control of the oscillating piston engine 10 is performed by the piston cage 72 . the piston cage 72 has an end face 110 which directly opposes the end - face housing lid 26 of the end face 22 of the housing 12 and is externally convexly arched in accordance with the internally concave configuration of the end - face housing lid 26 , with the same radius of curvature . present in the end face 110 of the piston cage 72 is an opening 112 which passes through the end face 110 . in the exemplary embodiment shown , the opening 112 has an opening cross section having substantially the shape of a sector of a circle . the breadth or maximum width of the opening 112 , viewed in the direction of revolution about the axis of rotation 38 , is in this case smaller than the minimum breadth or width of the web 108 in the end - face housing lid 26 . the opening 112 is , like the gas exchange openings 94 and 96 , arranged eccentrically to the axis of rotation 38 . as the piston cage 72 revolves about the axis of rotation 38 , the opening 112 sweeps the surface directly opposing it of the inside of the end - face housing lid 26 and , depending on the revolving position , the opening 112 sweeps successively the gas exchange opening 96 and the gas exchange opening 94 and obviously also the remaining closed region 114 of the surface of the end - face housing lid 26 that opposes the end face 110 , including the web 108 . with the exception of the opening 112 and with the exception of a central opening 116 , which is flush with a likewise central opening 118 in the end - face housing lid 26 and in which a spark plug or glow plug 120 is positioned , the end face 110 of the piston cage 72 is a full - area end face , i . e . is closed . in order adequately to seal the gas exchange openings 94 and 96 from the end face 110 when specifically no gas is to be exchanged , i . e . when the opening 112 communicates neither with the gas exchange opening 94 nor with the gas exchange opening 96 , a sealing arrangement 122 is provided , on the end face 110 of the piston cage 72 in the exemplary embodiment shown . the sealing arrangement 122 has a radially outer ring seal 124 , a radially inner ring seal 126 and a plurality of radially extending or radiantly arranged seals 128 which are arranged between and join together the radially inner ring seal 126 and the radially outer ring seal 124 . the radially inner ring seal 126 produces a seal from the central opening 116 , as does the radially outer ring seal 124 from the radially outer region of the end face 110 of the piston cage 72 . two of the radially extending seals 128 , namely radially extending seals 130 and 132 , surround in this case , together with the corresponding portion of the radially inner ring seal 126 and the radially outer ring seal 124 , the opening 112 in the end face 110 of the piston cage 72 . all the above - mentioned seals 124 , 126 , 128 , 130 and 132 of the sealing arrangement 122 are formed in one piece with one another and received in corresponding grooves in the outside of the end face 110 of the piston cage 72 . the seals 124 , 126 , 128 , 130 and 132 are in particular mounted in the aforementioned grooves resiliently , example via compression spring elements , so that the seals 124 , 126 , 128 , 130 and 132 can be pressed against the inside of the end - face housing lid 26 by means of spring force . fig8 to 10 show various relative positions between the opening 112 in the end face 110 of the piston cage 72 and the gas exchange openings 94 and 96 in the end - face housing lid 26 . starting with fig8 , the piston cage 72 is located in a revolving position about the axis of rotation 38 in which the opening 112 communicates with the gas exchange opening 96 . while the opening 112 sweeps the gas exchange opening 96 , combusted fuel / air mixture is expelled from the working chamber 54 . during this process , the pistons 30 and 32 pivot from the bdc position shown in fig2 into the tdc position shown in fig3 via the intermediate position shown in fig4 . for this pivoting stroke , the pistons 30 and 32 require a path of revolution of 90 ° about the axis of rotation 38 . during the expulsion process , the gas exchange opening 94 is completely sealed from the working chamber 54 via the sealing arrangement 122 . once the expulsion process has been terminated , or in the tdc position in fig3 , the opening 112 in the end face 110 of the piston cage 72 is flush with the web 108 of the end - face housing lid 26 . in this state , both gas exchange openings 94 and 96 are sealed from the working chamber 54 . after the tdc position according to fig3 , the pistons 30 and 32 again pivot apart from each other , into the bdc position according to fig2 via the intermediate position according to fig4 , although the pistons in the renewed bdc position have continued to revolve through 180 ° about the axis of rotation 38 in relation to fig2 . during the above - described pivoting - apart of the pistons 30 and 32 , the opening 112 in the end face 110 of the piston cage 72 slides , as shown in fig1 , via the gas exchange opening 94 , as a result of which fuel / air mixture is drawn into the working chamber 54 via the gas exchange opening 94 . the process of admitting or drawing in the fuel / air mixture is carried out , again , over less than 90 ° of the revolving movement of the pistons 30 and 32 about the axis of rotation 38 . once the pistons 30 and 32 have reached their bdc position , the opening 112 is no longer flush with the gas exchange opening 94 , and the working chamber 54 is now again completely sealed from the gas exchange openings 94 and 96 . from this renewed bdc position , the pistons 30 and 32 again pivot , imparted by the control cam 66 , toward each other , as a result of which the previously admitted or drawn - in fuel / air mixture is compressed until the pistons 30 and 32 have returned to the tdc position . the opening 112 is located in this case approximately at the level of a point 136 in fig1 . the fuel / air mixture , which is now maximally compressed , is then ignited via the spark plug 120 , and the ensuing expansion of the fuel / air mixture is then carried out during the renewed passing of the pistons 30 and 32 from their tdc position to their bdc position via a further 90 ° path of revolution about the axis of rotation 38 . during the working strokes of compressing and expanding ( working ), which overall take place over a path of revolution of 180 ° about the axis of rotation 38 , the gas exchange openings 94 and 96 are tightly closed by the end face 110 of the piston cage 72 and the sealing arrangement 122 . the gas exchange openings 96 and 94 open automatically as the opening 112 of the piston cage 72 passes the gas exchange openings 96 and 94 . in fig1 , the corresponding piston positions are denoted by “ ot ” ( tdc ) and “ ut ” ( bdc ). while the control of the exchange of gas has been described hereinbefore with regard to the working chamber 54 , it should be noted that the exchange of gas for the working chamber 56 is controlled in exactly the same way , without this requiring more detailed description in the present document . there is merely a time lag between the working strokes . just while the working stroke of drawing in fresh fuel / air mixture is taking place in the working chamber 54 , the expanding working stroke ( working ) takes place in the working chamber 56 . when the expelling working stroke is taking place in the working chamber 54 , the compressing working stroke takes place in the working chamber 56 , etc . the end surfaces of the pistons 30 , 32 , 34 , and 36 have in their respective region facing the end face of the piston cage 72 a trough - like depression such as is denoted by reference numerals 140 and 142 for the pistons 30 and 32 . the trough - like depressions 140 and 142 , which are accordingly also provided on the pistons 34 and 36 , cause a finite volume of the working chamber 54 still to remain in the tdc position of the pistons 30 and 32 , as a result of which the pistons 30 and 32 are pressed apart from each other with optimum leverage on ignition of the fuel / air mixture which has just been compressed in the working chamber 54 . according to fig3 , the pistons 30 and 32 each have associated with them , remote from the working chamber 54 , backward chambers 150 and 152 , the volume of which decreases in size when the working chamber 54 increases in size , and vice versa . the chambers 150 and 152 can be used as admission pressure chambers for precompressing combustion air as the pistons 30 and 32 swivel apart from each other , wherein in the bdc position of the pistons 30 and 32 the precompressed combustion air can then be injected into the pistons 30 and 32 via a valve arrangement ( not shown ) and , through said pistons , into the working chamber 54 . comparable backward chambers or preliminary pressure chambers can be provided accordingly for the pistons 34 and 36 . according to fig1 , an air inlet 154 and a corresponding air outlet 156 are also present on the housing 12 , cooling air for the interior of the housing 12 being supplied via the air inlet 154 and discharged again via the air outlet 156 . also provided is a water inlet 158 via which cooling water for cooling the housing 12 itself can be admitted , the water then being discharged again via a water outlet 160 . an oil inlet 162 for lubricating and cooling the rotating parts of the oscillating piston engine 2 , in particular the piston cage 72 and the pistons 30 32 34 and 36 , and an oil outlet 164 are likewise provided on the housing 12 .	5
please refer to fig1 to fig4 for a first embodiment of the present invention . the single - arm pedal assembly , which can be horizontally placed on the floor , for a percussion instrument of the present embodiment includes two frames 1 , 1 ′, a first main axle 2 , a second main axle 2 ′, a first linking element 3 , a second linking element 3 ′, two pedals 4 , 4 ′, two transmission elements 5 , 5 ′, a first resilient means 6 , a second resilient means 6 ′, a secondary axle , a clamping element 8 , a linkage member 9 and two hammers 10 , 10 ′. the frame 1 has a base plate 13 , a supporting arm 14 and a pedal axle 12 . the supporting arm 14 extends upward from the base plate 13 . the supporting arm 14 has a distal end which splits into two rack poles 141 , 142 . each rack pole 141 , 142 is formed with an axial hole 11 , 11 ′. each axial hole 11 , 11 ′ extends horizontally . the two axial holes 11 , 11 ′ of the supporting arm 14 are coaxial . the pedal axle 12 is disposed on the base plate 13 . the pedal axle 12 extends horizontally . the two axial holes 11 , 11 ′ and the pedal axle are non - coaxial . the frame 1 ′ has a similar structure to the frame 1 . the first main axle 2 is rotatably received in two axial holes 11 , 11 ′ of the supporting arm 14 . the second main axle 2 ′ is rotatably disposed on the other flame 1 ′. each main axle 2 , 2 ′ is rotatable about its longitudinal direction . the first main axle has an inner surface . a penetrating hole is defined in the inner surface so that the first main axle is a tube - shaped axle . please refer to fig3 a . the penetrating hole has a first end 21 , a second end 22 , a first section 23 , a second section 24 and a third section 25 . each section 23 , 24 , and 25 of the penetrating hole has an inner diameter . the inner diameter of the second section 24 is smaller than those of the other sections . the first main axle 2 forms a first abutting surface 26 between the first section 23 and the second section 24 . the first main axle 2 forms a second abutting surface 27 between the second section 24 and the third section 25 . the second main axle 2 ′ can be a solid axle or a hollow axle , which is similar to the first main axle 2 . the first linking element 3 is disposed on the first main axle 2 in a rotational operative relationship . the second linking element 3 ′ is disposed on the second main axle 2 ′ in a rotational operative relationship . each linking element is adapted for a hammer to install thereon . more particularly , each linking element 3 , 3 ′ may include a chunk , which is adapted for a hammer . or , the first linking element 3 may include a sprocket 31 and a chunk 32 , as shown in fig5 . the first main axle 2 and both the sprocket 31 and the chunk 32 are in a rotational operative relationship . each pedal 4 , 4 ′ is pivotably disposed about one of the pedal axle 12 , 12 ′. thus , the pedals 4 , 4 ′ can pivot with respect to the frames 1 , 1 ′. each transmission element 5 , 5 ′ may be a linking bar . each transmission element 5 , 5 ′ rotatably connects one of the pedals 4 , 4 ′ to one of the linking elements 3 , 3 ′. the linking elements 3 , 3 ′ rotate during the movement of the transmission elements . the transmission elements 5 , 5 ′ move during the sway of the pedals 4 , 4 ′. please refer to fig5 . the transmission element 5 may also be a belt or a chain when the first linking element 3 includes the sprocket 31 . the sprocket 31 is adapted for the belt or the chain to coil thereon . the first resilient means 6 is adapted for driving a pedal 4 to return to an initial position . the second resilient means 6 ′, similar to the first resilient means 6 , is adapted for driving the other pedal 4 ′ to return to another initial position . more specifically , the first resilient means includes a fixing piece 61 , a swaying piece 62 and a spring element 63 . the fixing piece 61 may be fixed on the base plate 13 or the supporting arm 14 , so that the fixing piece 61 is firmly disposed on the frame 1 . the swaying piece 62 is removably disposed on the first main axle 2 in a rotational operative relationship . the spring element 63 connects the swaying piece 62 to the fixing piece 61 . the spring element 63 provides a resilient force to rotate the swaying piece 62 , so that the first main axle 2 and the first linking part 3 rotate together . thus , the pedal 4 moves to an initial position . the second resilient means 6 ′ is provided with a similar structure to the first resilient means 6 . for example , the second resilient means 6 ′ may include a fixing piece 61 ′, a swaying piece 62 ′ and a spring element 63 ′. the fixing piece 61 ′ is firmly disposed on the frame 1 ′. the swaying piece 62 ′ is removably disposed on the second main axle 2 ′ in a rotational operative relationship . the spring element 63 ′ connects the swaying piece 62 ′ to the fixing piece 61 ′. the spring element 63 ′ provides another resilient force to rotate the swaying piece 62 ′, so that the second main axle 2 ′ and the second linking part 3 ′ rotate together . thus , the pedal 4 ′ moves to another initial position . the fixing piece 61 of the first resilient means 6 may further include a main fixing lump 611 and a secondary fixing lump 612 , as shown in fig6 . both the main fixing lump 611 and the secondary fixing lump 612 are adapted for a spring element to connect thereon . the secondary axle is removably disposed on the first main axle 2 . the secondary axle includes a shaft 71 . the shaft 71 is rotatable with respect to the first main axle 2 . more specifically , the secondary axle may include the shaft 71 , a first bearing 72 , a second bearing 72 ′ and a threaded element 73 . the shaft 71 has a working portion 711 and a constructing portion 712 . one end of the working portion 711 forms a stepped surface 7111 . the constructing portion 712 extends axially from the stepped surface 7111 . the constructing portion 712 may includes a bigger diameter section 7121 and a smaller diameter section 7122 . the bigger diameter section 7121 connects the smaller diameter section 7122 to the working portion 711 . a distal end of the constructing portion 712 is formed with a threaded hole . the shaft 71 has a third abutting surface 713 located between the bigger diameter section 7121 and the smaller diameter section 7122 . the first bearing 72 includes an outer ring 721 and an inner ring 722 , which is received in the outer ring 721 . several balls may be disposed between the outer ring 721 and the inner ring 722 . or , the outer ring 721 may slidably contact to the inner ring 722 . thus , the outer ring 721 is rotatable with respect to the inner ring 722 . the second bearing 72 ′ has a similar structure to the first bearing 72 . the second bearing 72 ′ includes an outer ring 721 ′ and an inner ring 722 ′, which is received in the outer ring 721 ′. the outer ring 721 ′ of the second bearing 72 ′ is rotatable with respect to the inner ring 722 ′ of the second bearing 72 ′. the constructing portion 712 is received in the penetrating hole from the first end 21 . the first bearing 72 is radially disposed between the constructing portion 712 and the first main axle 2 . the first bearing 72 is axially disposed between the third abutting surface 713 and the first abutting surface 26 . the threaded element 73 mates with the threaded hole of the constructing portion 712 from the second end 22 . the second bearing 72 ′ is axially disposed between the second abutting surface 27 and the threaded element 73 . thus , the two bearing 72 , 72 ′ is disposed between the shaft 71 and the first main axle 2 . in other embodiment of the present invention , the shaft 71 may slidably contact to the first main axle 2 directly . the clamping element 8 is disposed on the shaft 71 in a rotational operative relationship . the clamping element 8 is adapted for a hammer to install thereon . wherein , the clamping element 8 may be disposed on the working portion 711 . the linkage member 9 removably connects the second main axle 2 ′ to the shaft 71 in a rotational operative relationship . thus , the second main axle 2 ′ and the shaft 71 can rotate simultaneously . one of the two hammers 10 is removably disposed on the first linking element 3 , so the hammer 10 and the linking element 3 can rotate together . the other hammer 10 ′ is removably disposed on the clamping element 8 . in other possible embodiments of the present invention , the hammer 10 may be firmly disposed on the first linking element 3 . accordingly , the single - arm pedal assembly can be used to percuss a drum , in which the two pedals 4 , 4 ′ can drive the two hammers respectively . when users need only one pedal and one hammer , the secondary axle and the linkage member can be removed . also , the hammer 10 ′ may be repositioned on the second linking element 3 ′. in the event , the single - arm pedal assembly is reconstituted into two single - hammer pedal assemblies . each single - hammer pedal assembly has only one pedal and one hammer , as shown in fig7 . please refer to fig8 and fig9 . in another embodiment of the present invention , the shaft may include a rod 714 and a sleeve 715 . the rod 714 has two ends . one end of the rod 714 is received in the sleeve 715 . the rod 714 is rotatable with respect to the sleeve 715 . the other end of the rod 714 extends axially forming the constructing portion 712 . the working portion , which is disposed the clamping element 8 thereon , is formed with the sleeve 715 . the rod 714 may connect slidably to the sleeve 715 . or , several bearings 716 , 716 ′ may be disposed between the rod 714 and the sleeve 715 so that the rod 714 is rotatable with respect to the sleeve 715 . please refer to fig1 to fig1 . in another embodiment of the present invention , the constructing portion 712 may include a bigger diameter section 7121 , a smaller diameter section 7122 , a screw section 7123 and a stretching section 7124 . the bigger diameter section 7121 connects the smaller diameter section 7122 to the working portion 711 . the screw section 7123 connects the stretching section 7124 to the smaller diameter section 7122 . the smaller diameter section 7122 is received in the second bearing 72 . the threaded element 73 mates with the screw section 7123 . the stretching section 7124 passes through the second end 22 of the penetrating hole . as a result , the swaying piece 62 ′ of the second resilient means may be repositioned on the stretching section 7124 . the spring element 63 ′ of the second resilient means can connect the swaying piece of the second resilient means to the secondary lump of the fixing piece 61 of the first resilient means . the spring element 63 ′ of the second resilient means can make the swaying piece 62 ′ of the second resilient means and the shaft 71 rotate .	6
the gearless drive proposed for belt conveyors can have a very robust design and can be manufactured inexpensively in different power classes . for example , depending on the power of the drive drum required , a different number of in each case identically designed motors can be used in one and the same drum casing . fig1 illustrates a first exemplary embodiment of a drive drum of a belt conveyor in longitudinal section . the drive drum 1 has a hollow - cylindrical drum casing 2 , which is coated with a drum covering 3 ( for example a vulcanized - on rubber layer ). a conveyor belt 18 is driven by the drive drum 1 . the two end - side bases 4 and 6 of the drive drum 1 are provided with centrically arranged bearings 5 and 7 , respectively , which are used for fitting a fixed drum spindle 8 . the two ends of the drum spindle 8 which protrude beyond the bases 4 , 6 are fitted in spindle fastenings 9 , 10 . for example , six motors a are arranged within the hollow - cylindrical drum casing 2 . the motors a can be synchronous motors with excitation using permanent magnets and with a cooling apparatus . no component parts which require feedlines for the supply of power or for cooling purposes are arranged on rotating parts . each motor a is fastened on the drum spindle 8 via a spindle - side motor frame 11 , is fastened on the drum casing 2 via a casing - side motor frame 12 , has a winding 13 , which is fastened on the spindle - side motor frame 11 , has permanent magnets 14 , which are fastened on the casing - side motor frame 12 , as motor components for field generation , has an air gap 15 between the permanent magnets 14 and the winding 13 , has a winding connection 27 for supplying power , has a winding coolant feedline 28 and a winding coolant discharge line 29 . the winding connections 27 are connected to at least one connecting line 16 for the supply of power ( cable ). this at least one connecting line 16 can run , for example , within the drum spindle 8 . in order to be able to operate the motors at a variable rotation speed , a converter 19 , e . g ., a frequency converter , is provided which is connected on the input side to a power supply ( mains ) 20 and on the output side supplies the at least one connecting line 16 . the winding coolant feedlines 28 are connected to a coolant feedline 25 , which is routed , for example , within the drum spindle 8 . in the same way , the winding coolant discharge lines 29 are connected to a coolant discharge line 26 , which is routed , for example , within the drum spindle 8 . depending on the type of coolant , the coolant feedline 25 and the coolant discharge line 26 may be connected to further components . when using a liquid ( for example water or oil ) as the coolant , a recooler and a coolant pump for coolant transport act as further components . when using a gas ( for example air ) as the coolant , a fan for coolant transport is used as the further component . the abovementioned fastening of the motors between the spindle - side motor frame 11 and the drum spindle 8 and between the casing - side motor frame 12 and the drum 2 can take place via technologically customary form - fitting connections , for example feather keys or toothed formations , lateral stops being used to prevent lateral sliding of the motors . it is important here that the casing of the drum 2 is sufficiently stable in terms of the high tensile force of the belt occurring and the high belt weight ( tangential forces ), i . e . for the resulting bending to be in the desired tolerance range . fig2 illustrates a cross section through a drive drum 1 of the first exemplary embodiment , the drive spindle 8 being in the form of a hollow spindle . the at least one connecting line 16 for supplying power , the coolant feedline 25 and the coolant discharge line 26 run within the hollow drum spindle 8 . the motor is formed by the spindle - side motor frame 11 , the winding 13 , the permanent magnets 14 and the casing - side motor frame 12 , it being possible to identify the air gap 15 between the winding 13 and the permanent magnets 14 . the electrical winding connection 27 , the winding coolant feedline 28 , which is connected to the coolant feedline 25 , and the winding coolant discharge line 29 , which is connected to the coolant discharge line 26 , are shown in sketched form ; the same for the drum casing 2 with the drum covering 3 and the driven conveyor belt 18 which is slung around the drive drum . for the guidance of the coolant , for example , a pipeline 40 , which is connected to the coolant feedline 25 and the coolant discharge line 26 , is laid within the winding 13 of a motor a . fig3 illustrates a second exemplary embodiment of a drive drum of a belt conveyor in longitudinal section . in this second exemplary embodiment there is a reduced power requirement in comparison with the first exemplary embodiment . this exemplary embodiment differs from the first exemplary embodiment shown in fig1 and 2 in that six motors b without a cooling apparatus have been inserted in a drive drum 21 . accordingly , there is no need for the coolant feedline 25 , the coolant discharge line 26 , the winding coolant feedlines 28 , the winding coolant discharge lines 29 and the pipelines 40 . fig4 illustrates a third exemplary embodiment of a drive drum of a belt conveyor in longitudinal section . in this third exemplary embodiment there is a reduced power requirement in comparison with the second exemplary embodiment . this exemplary embodiment differs from the second exemplary embodiment shown in fig3 in that only three motors b without a cooling apparatus have been inserted in a drive drum 22 . the arrangement of the motors b within the drum 2 can take place in symmetrical fashion at the edges and in the center of the drum . fig5 illustrates a fourth exemplary embodiment of a drive drum of the belt conveyor in longitudinal section . in this fourth exemplary embodiment , there is a reduced power requirement in comparison with the third exemplary embodiment . this exemplary embodiment differs from the third exemplary embodiment shown in fig3 in that only one motor b without a cooling apparatus has been inserted in a drive drum 22 . the arrangement of the motor b within the drum casing 2 can take place in symmetrical fashion in the center of the drum . fig6 illustrates a fifth exemplary embodiment of a drive drum of a belt conveyor in longitudinal section . in this fifth exemplary embodiment , a shorter drive drum 24 with a shorter drum casing 17 and a shorter drum spindle 23 is used in comparison with the first four exemplary embodiments . four motors a with a cooling apparatus are used in the drive drum 24 . fig7 illustrates a sixth exemplary embodiment of a drive drum of a belt conveyor in longitudinal section . in this sixth exemplary embodiment , a drive drum 30 with a drum casing 31 with an enlarged diameter is used in comparison with the first five exemplary embodiments , into which four motors c with a correspondingly enlarged diameter are inserted , which motors each have a spindle - side motor frame 35 , a casing - side motor frame 36 , a winding 37 and permanent magnet 38 . the air gap 39 is shown . the figures show motors with a cooling apparatus , but it is of course also possible for these to be motors without a cooling apparatus . the drum casing 31 is sealed at both ends by end - side bases 33 , 34 and is provided with a drum covering 32 . the length of the drum casing 31 is equal to the length of the drum casing 17 in accordance with the fifth exemplary embodiment , with the result that the drum spindle 23 which is also used in the fifth exemplary embodiment can be used . fig8 illustrates an exemplary possibility for the electrical connection and the coolant connection of a winding as a schematic detailed sketch . the figure merely shows , by way of example , a motor arranged within the drive drum 1 ( with the drum casing 2 , the drum covering 3 , the drum spindle 8 ) with the spindle - side motor frame 11 , the casing - side motor frame 12 , the winding 13 , the permanent magnets 14 , the air gap 15 . the lines to / from the motors can be laid into the interspaces between the motors : winding connection 27 between winding 13 and connecting line 16 , winding coolant feedline 28 between winding 13 and coolant feedline 25 , winding coolant discharge line 28 between winding 13 and coolant discharge line 26 . this displacement of the lines into the interspaces between the motors can result in a simplified construction and simplified assembly . as is apparent from the explanations above , a “ drive drum construction kit system ” comprising different modules , such as standard drums of different lengths and different diameters , standard drum spindles of different lengths and / or diameters and standard motors of different diameters and with different cooling systems is formed which can be assembled in a corresponding manner for the specific application case . since no special components need to be manufactured for a specific application case but standard components ( modules ) which can be produced in relatively high numbers can be used , the total production costs per drive drum and belt conveyor are reduced . the selection of the components is made in an application - specific manner taking into consideration the required power , the required torque , the required rotation speed , the predetermined width of the conveyor belt and the desired type of cooling ( gas as coolant , liquid as coolant , without gas / liquid cooling ). even if only a single drum casing and a single drum spindle are used as the basis , a “ drive drum construction kit system ” results since a broad power spectrum can be covered depending on the number of motors used in this drum casing . the use of a plurality of motors instead of a single motor results in the following : the same motor can be used for different lengths of the drums ( only the number of motors used is changed ), which results in cost advantages , the air gap can be kept constant more easily over the entire length of the drum than the air gap of a single motor with a long length , the installation of a plurality of small motors into the drum is simpler than the installation of a single motor having a long length , standardization of the components is possible in a simple manner . in addition to the above comments it should be mentioned that it is never necessary for the fixed components , such as the drum spindle 8 , 23 and the spindle - side motor frame 11 , for example , to have a cylindrical shape . the “ first ” component which absolutely must have a round cross section is the surface of the rotor of the motor on the air - gap side and the bearings 5 , 7 . furthermore , it is never necessary for the at least one connecting line 16 and / or the coolant feedline 25 / coolant discharge line 26 to run within the drum spindle 8 , 23 . as an alternative to this , these lines can also be routed in another way in or on the drum spindle 8 , 23 , for example in grooves , which can simplify assembly and disassembly of the motors . in this regard , fig9 to 13 illustrate a seventh exemplary embodiment of a drive drum of a belt conveyor in longitudinal section and cross section . in contrast to the first exemplary embodiment shown in fig1 , the drum spindle 8 is designed to be solid and has a plurality of longitudinal grooves 42 which are accessible from the casing surface and in which the ( electrical ) winding connections 27 or 27 a - 27 f and / or electrical connecting lines 47 , the winding coolant feedlines 28 or 28 a - 28 f and the winding coolant discharge lines 29 or 29 a - 29 f for the windings 13 a - 13 f and / or coolant connecting lines 47 are routed . as has already been mentioned in connection with fig8 , the lines directly to / from the motors are laid in each case into the interspaces between the motors a or between the motor a and the end - side base / bearing . fig1 shows a first possible schematic of the electrical connection technology and the coolant connection technology for the seventh exemplary embodiment . in order to avoid any branch - off points in connection with the coolant feed and discharge within the drive drum 41 , a coolant distributer 43 and a coolant accumulator 44 are provided outside the drive drum 41 and connected to a recooler 45 . the following coolant cycle for the exemplary embodiment shown in fig9 results : recooler 45 — coolant feedline 25 ( outside the drive drum )— coolant distributor 43 — six separate ( parallel ) winding coolant feedlines 28 a to 28 f to the six windings 13 a to 13 f ( within the drive drum )— coolant lines within these windings — six separate ( parallel ) winding coolant discharge lines 29 a to 29 f ( within the drive drum )— coolant accumulator 44 — coolant discharge line 26 ( outside the drive drum )— recooler 45 . furthermore , any branch - off points in connection with the electrical connections within the drive drum 41 are avoided . the converter 19 , which is connected on the input side to the power supply 20 , is connected to the individual windings 13 a to 13 f via separate winding connections 27 a to 27 f . the winding connections 27 a to 27 f in this case run within the grooves 42 , as do the winding coolant feedlines 28 a to 28 f and the winding coolant discharge lines 29 a - 29 f . the further exemplary embodiment corresponds to the first exemplary embodiment . in the exemplary embodiment shown in fig1 , four symmetrically arranged grooves 42 which are each accessible from the casing surface are shown . of course it is also possible for more than or fewer than four grooves to be provided . it is alternatively possible to guide only the winding connections 27 and / or the electrical connecting lines 47 ( see fig1 and 13 ) or only the coolant feedlines 28 or only the coolant discharge lines 29 or coolant feedlines 28 and coolant discharge lines 29 or only coolant connecting lines 46 ( see fig1 and 13 ) or coolant feedlines 28 and coolant discharge line 29 or coolant connecting lines 46 and winding connections 27 or electrical connecting lines 47 fig1 and 13 show a second possible schematic of the electrical connection technology and the coolant connection technology for the seventh exemplary embodiment . while a strictly parallel circuit of coolant lines and also electrical lines to the individual windings is realized in fig1 , in fig1 a series circuit of the coolant lines is used . a coolant connecting line 46 and an electrical connecting line 47 are provided in each case between two windings , these lines running in grooves 42 . fig1 shows two possible cooling cycle variants . in the first variant shown in the upper region of the drawing there is the following coolant cycle : recooler 45 — coolant feedline 25 ( can likewise run in a groove 42 )— winding 13 f — coolant connecting line 46 — winding 13 e — coolant connecting line 46 — winding 13 d — coolant connecting line 46 — winding 13 c — coolant connecting line 46 — winding 13 b — coolant connecting line 46 — winding 13 a — coolant discharge line 26 — recooler 45 in the second variant shown in the lower region of the drawing the following coolant cycle results : recooler 45 — coolant feedline 25 — winding 13 a — coolant connecting line 46 — winding 13 b — coolant connecting line 46 — winding 13 c — coolant connecting line 46 — winding 13 d — coolant connecting line 46 — winding 13 e — coolant connecting line 46 — winding 13 f — coolant connecting line 46 — winding 13 e — coolant connecting line 46 — winding 13 d — coolant connecting line 46 — winding 13 c — coolant connecting line 46 — winding 13 b — coolant connecting line 46 — winding 13 a — coolant discharge line 26 — recooler 45 . it will be appreciated by those skilled in the art that the present invention can be embodied in other specific forms without departing from the spirit or essential characteristics thereof . the presently disclosed embodiments are therefore considered in all respects to be illustrative and not restricted . the scope of the invention is indicated by the appended claims rather than the foregoing description and all changes that come within the meaning and range and equivalence thereof are intended to be embraced therein . b motor ( synchronous motor with excitation using permanent magnets ) without cooling apparatus	1
the term &# 34 ; asphalt &# 34 ; ( sometimes referred to as &# 34 ; bitumen &# 34 ;) refers to all types of asphalts ( bitumen ), including those that occur in nature and those obtained in petroleum processing . the choice will depend essentially on the particular application intended for the resulting bitumen composition . preferred materials have an initial viscosity at 140 ° f . ( 60 ° c .) of 200 to 6000 poise . the initial penetration range of the base asphalt at 77 ° f . ( 25 ° c .) is 30 to 350 dmm , preferably 50 to 200 dmm , when the intended use of the composition is road paving . asphalt , which does not contain any polymer , sulfur , etc ., may sometimes be referred to herein as a &# 34 ; base asphalt &# 34 ;. suitable asphalt components include a variety of organic materials , solid or semi - solid , at room temperature , which gradually liquify when heated , and in which the predominate constituents are naturally occurring bitumens , e . g ., trinidad lake , or residues commonly obtained in petroleum , synthetic petroleum , or shale oil refining , or from coal tar or the like . for example , vacuum tower bottoms produced during the refining of conventional or synthetic petroleum oils are a common residue material useful as asphalt composition . solvent deasphalting or distillation may produce the asphalt . solvent deasphalting ( sda ) bottoms may be used as part or all of the asphalt of the product blend . sda bottoms are obtained from suitable feeds such as vacuum tower bottoms , reduced crude ( atmospheric ), topped crude , and preferably hydrocarbons comprising an initial boiling point of about 450 ° c . ( 850 ° f .) or above . preferably the solvent deasphalting bottoms are obtained from vacuum tower bottoms , preferably boiling above 538 ° c . ( 1000 ° f .). solvent deasphalting can be carried out at temperatures of 93 - 148 ° c . ( 200 - 300 ° f .). after solvent deasphalting , the resulting sda bottoms have a boiling point above 510 ° c . ( 950 ° f . ), preferably above 540 ° c . ( 1000 ° f . ), and a penetration of 0 to 70 dmm @ 25 ° c . ( 77 ° f . ), preferably 0 to 50 dmm @ 25 ° c . ( 77 ° f .). the asphalt composition may be solely or partly material produced by distillation , without any solvent extraction step . such materials , sometimes referred to as &# 34 ; asphalt cement &# 34 ;, have a reduced viscosity relative to sda bottoms . such asphalt cement component can have a viscosity of 100 to 5000 poises at 60 ° c . ( 140 ° f . ), preferably 250 to 4000 poises , e . g ., 500 poises for ac5 ( pg52 - 28 ) asphalt cement . the asphalt cement component is added in amounts sufficient to provide the resulting asphalt composition with the desired viscosity for the intended application , e . g ., 2000 poises at 60 ° c . ( 140 ° f .) for paving applications . for performance graded ( pg ) applications , the asphalt compositions will have a g */ sin delta value in excess of 1 . 0 kpa at temperatures ranging from 46 to 82 ° c ., preferably 52 to 76 ° c . generally , the asphalt compositions of the present invention may contain from 0 to 100 wt %, preferably from 0 to 90 wt %, e . g ., 5 to 95 wt %, of such asphalt cement component . the asphalt cement component of reduced viscosity can be obtained from any suitable source , e . g ., atmospheric distillation bottoms . fluxing components may be added to improve the flow properties of the asphalt composition and improve the penetration for a desired softening point . such fluxing components can include paraffinic as well as aromatic materials , e . g ., gas oils ( which can contain both isoparaffins and monoaromaties ). gas oils include neutral oils , including hydrotreated , hydrocracked , or isodewaxed neutral oils . suitable paraffinic fluxing components include paraffinic oils having at least 50 wt % paraffins content ( isoparaffins and normal paraffins ) such as footes oil ( which is highly paraffinic and obtained from deoiling slack wax ), as well as slack wax itself . poly ( alphaolefins ) ( paos ) are also suited for use as fluxing components . aromatic oils such as lube plant extract may also be used , but are not preferred due to the high aromatic content . the primary constraints on the fluxing components are safety and compatibility . the material should be relatively non - volatile , i . e ., have initial boiling points above 600 ° f . the oil should also be chosen so as to minimize health effects . there is no upper limit , per se , on boiling point , and many suitable oils will have end points in the 1000 +° f . range . the material preferably has a viscosity similar to that of neutral oils , or higher . higher viscosity helps keep the sulfur particles in suspension and much , or all , of the flux oil is preferably added to the asphalt with the sulfur slurry , reviewed after the table of suitable flux oils . the following table gives the properties of suitable liquid hydrocarbon oils for use in forming the sulfur slurry . table__________________________________________________________________________fluxing agents texaco texaco 325 hf 100 hf 325 aromatic enprotect hvgo 93010 ae % off neutral neutral extract 180n 61205 btms__________________________________________________________________________ibp 653 607 647 450 494 474 1 % 682 629 670 554 564 577 5 % 749 668 737 690 667 71810 % 782 687 771 724 698 75715 % 802 700 792 744 716 78320 % 817 710 807 760 730 80325 % 829 721 819 774 743 82030 % 840 730 830 786 755 83635 % 850 739 840 797 766 85140 % 859 748 850 808 776 86445 % 868 757 859 818 787 87850 % 877 766 868 829 797 89155 % 885 776 877 840 807 90460 % 894 785 886 851 818 91765 % 902 796 895 862 829 93070 % 911 807 905 875 842 94375 % 921 819 915 888 855 95880 % 931 833 925 901 871 97485 % 942 850 937 916 889 99090 % 955 873 952 934 912 101595 % 974 907 973 959 946 1063fbp 1028 986 1033 1015 1030 1151__________________________________________________________________________ many blenders will add sufficient sulfur to incorporate into the final blend asphalt product from 0 . 01 to 1 . 0 wt % sulfur , preferably 0 . 025 to 0 . 5 wt % sulfur , e . g ., and more preferably 0 . 05 to 0 . 2 wt %. blenders wanting or needing higher sulfur contents may add sufficient sulfur slurry to produce finished asphalt blends with 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 or 10 wt % sulfur , or even more . there is no &# 34 ; lower limit &# 34 ; on sulfur concentration in the sulfur slurry , other than one set by economics of using such a dilute sulfur &# 34 ; solution .&# 34 ; the upper limit on sulfur concentration is set by pumpability and to some extent by the nature of the flux oil used to form the sulfur slurry . in practice , a 50 / 50 ( by weight ) blend works well and makes it easy for operators to calculate how much sulfur slurry is needed , e . g ., specify 0 . 2 wt % slurry addition to add 0 . 1 wt % sulfur to the final blended asphalt product . if desired , additives such as surfactants , thickeners , stabilizers , emulsifiers , etc . may be added . a source of sulfur slurries is the harwick chemical manufacturing company , a subsidiary of the m . a . hanna company . the reactive sulfur compound used in the present invention is preferably elemental sulfur , preferably in a finely ground or divided form . sulfur is a well - known additive for asphalt and may be added in conventional amounts . what is different is the way the sulfur is added , not the amount . those wishing to add very small amounts of sulfur to the asphalt may do so by adding small amounts of sulfur / oil slurry . those wishing to add large amounts of sulfur may do so by adding a larger amounts of sulfur / oil slurry , or increasing the sulfur concentration in the sulfur / oil slurry . preferably , all , or at least a portion of the total amount of , flux oil destined for addition to the asphalt product is added with the sulfur slurry . this means that some , or all , of the flux oil which would be added to the asphalt product is slurried with sulfur and the resulting slurry of sulfur in liquid hydrocarbon is added to the ( asphalt + polymer ) blend . the use of neutral oil and high shear mixing of sulfur is preferred for forming a relatively stable slurry of sulfur and oil . use of 325hf neutral oil is more preferred , both as a good carrier for the sulfur and to improve the low temperature performance properties of the finished product . the sulfur may comprise from 0 . 1 to 80 wt % of the slurry , with the balance being the liquid oil . preferably the sulfur slurry has a sulfur content of 10 to 60 wt %, with the balance being liquid oil . a suitable high shear mixing device is a should , reichel - drews , or cowels type disperser for kettle type dispersion mixtures . ross , siefer or dalworth high shear inline mills may also be used for larger production batches . slurries may also be produced using conventional ball type mills commonly used for pigment dispersion manufacture in the paint and coatings industry . the sulfur slurry may be formed by mixing dry powdered sulfur , having a small average particle size , with the hydrocarbon oil and mixing for 10 - 240 minutes at 70 - 250 ° temperature . there is nothing novel about adding finely ground sulfur to asphalt ; this has been practiced for decades and detailed discussion is not necessary for those skilled in the asphalt arts . ground sulfur is a staple article of commerce , with extensive use in rubber making and as a pesticide . while finely ground elemental sulfur slurry is the preferred source of sulfur cross - linking agent , it is also possible to use other hydrocarbon based sulfur sources , though not necessarily with equivalent results . sulfurized oils , disulfide oils , and other hydrocarbon streams containing naturally occurring sulfur compounds may also be used though generally somewhat larger amounts of sulfur will be required . while use of chemically bound , hydrocarbon phase , sulfur cross - linking agent is not as efficient in terms of total sulfur usage required , the hydrocarbon liquid phase sulfur does avoid localized high concentrations of sulfur which will occur when powdered sulfur is added . it is the intent of the process of the present invention to provide a way to achieve the benefits of sulfur addition to asphalt mixtures which are essentially free of polymer , rubber additives and the like . conventional conditions may be used to blend the base bitumen ( or base asphalt ) with the sulfur slurry . high shear mixing is a preferred blending method , using a device such as a reichel - drews polymer unit equipped with a super high shear mill , operating for 10 to 240 minutes at a temperature of 200 to 400 ° f . other conventional mixing techniques may be used -- use of blades or impellers to stir a tank of the material , use of low efficiency pumps to transfer the material from vessel to another , use of static mixers , and the like . the conditions for treatment with elemental sulfur comprise temperatures of 100 to 300 ° c . ( 220 to 572 ° f . ), preferably 110 to 250 ° c . ( 230 to 482 ° f .) a time from 1 or 2 minutes to 5 to 10 hours , preferably 0 . 1 to 4 hours , e . g ., 0 . 5 to 2 hours . in practice , the blending of asphalt + sulfur slurry will usually occur at a temperature above the melting point of sulfur , so the sulfur treating reaction proceeds quickly . in practice , much of the sulfur treating will take place in trucks delivering hot product . ______________________________________ broad preferred most preferred______________________________________asphalt cement 80 . 0 to 99 . 98 % 80 . 0 to 99 . 9 % 90 . 0 to 98 . 0 % 325hf neutral oil 0 . 01 to 10 . 0 % 0 . 05 to 15 . 0 % 1 . 0 % to 10 . 0 % sulfur 0 . 01 to 10 . 0 % 0 . 05 to 5 . 0 % 0 . 05 to 0 . 5 % ______________________________________ the sulfur and 325hf neutral oil slurry blend is pre - dispersed at high shear with or without the use of dispersants or surfactants . the mixture is injected into the asphalt preferably with mixing . the asphalt - sulfur slurry mixture is preferably reacted at temperatures of 200 - 500 ° f . other oils may be used , such as aromatic extracts , bright stocks , or other mineral lubricating base oils , but the neutral oils are preferred . for clarity , i emphasize that much of the blending process is conventional and forms no part of the present invention . the starting asphalt ( or bitumen ) materials are well known , as is the addition of sulfur and of flux oil to improve low temperature properties . my invention is not , per se , the amount of sulfur or flux oil added to the asphalt -- all amounts added can be conventional . what is different in my approach is forming a slurry of ( sulfur + flux oil ) and mixing the sulfur slurry into the asphalt with both the asphalt and the slurry being essentially free of polymer . the present invention is useful for , e . g ., the production of valuable high - specification asphalts having increased resistance to rutting at high temperatures ( 46 to 82 ° c . ), as outlined in the performance based pg specifications contained in aashto mp - 1 . details of shrp specifications may be taken from fig6 of u . s . pat . no . 5 , 728 , 291 . a simplified process flow diagram for vacuum tower processing of crude oil to produce an asphalt fraction is shown in fig2 of u . s . pat . no . 5 , 728 , 291 . the following examples represent actual experimental work . in some cases the directions may seem &# 34 ; hypothetical &# 34 ; as when mild agitation is performed for &# 34 ; a period of 2 to 24 hours &# 34 ;. these were , however , the actual instructions . the operator was given considerable flexibility to perform non - critical steps , and products would be mixed for 2 hours , and shipped within 24 hours . into a high shear mixing device is charged 95 . 25 parts of asphalt cement and agitation started . slowly added is 4 . 75 parts of an sbs copolymer and allowed to pre - wet at a temperature of 325 - 340 ° f . for a period of 10 to 30 minutes . circulation is initiated through a high shear mixer until sbs polymer is completely dispersed into the asphalt phase . finished blend is then pumped to a separate storage tank and held under mild agitation at 325 - 340 ° f . for a period of 2 to 24 hours . material is sampled and tested for conformance to performance graded asphalt specifications and found to have an actual pg grade of pg80 . 6 - 20 . 5 , meeting requirements of pg76 - 16 . separation tests for compatibility and stability performed on this material typically have separation differences of 35 - 50 degrees . into a high shear mixing device is charged 95 . 25 parts of asphalt cement under agitation . slowly added is 4 . 75 parts of an sbs copolymer and allowed to prewet at a temperature of 325 - 340 ° f . for a period of 10 - 30 minutes . circulation is initiated through a high shear mixer until sbs polymer is completely dispersed into the asphalt phase . finished blend is then pumped to a separate storage tank and held under mild agitation at 325 - 340 ° f . for a period of 2 to 24 hours . in a separate mixing device , elemental sulfur is added to a mineral lubricating base stock in equal parts of 50 percent sulfur and 50 percent oil . this mixture is subjected to a high shear mixing device with prepares a fine dispersion of sulfur in the oil phase . once this dispersion is prepared , 0 . 2 parts of said dispersion is added slowly by injection into the tank under agitation and allowed to react with the asphalt polymer mix for 2 to 24 hours at temperatures of 325 - 340 ° f . material is then sampled and evaluated for performance graded asphalt specification compliance and found to have an actual grade of pg80 . 1 - 26 . 2 , meeting requirements of pg76 - 22 , a completed low temperature grade improvement . storage stability separation testing is completed and separation differences are found to be less than 4 ° c . to a conventional mixing kettle is added 91 parts of an asphalt cement having a pg grade of pg64 - 22 . under mild agitation at temperatures of 325 - 340 ° f . is added 9 parts of an sbs copolymer which is then allowed to mix into the liquid asphalt . circulation is initiated through a high shear mixing device to completely disperse the polymer into a fine dispersion in the asphalt cement . this concentrate is then shipped to a satellite facility where it is then diluted 50 parts with an asphalt cement having a pg grade of pg64 - 22 and is further diluted 50 parts with an asphalt binder having a pg grade of pg52 - 28 . this blend is then allowed to mix under agitation at temperatures of 325 - 340 ° f . for a period of 2 to 24 hours . in a separate mixing device , elemental sulfur is added to a mineral lubricating base stock in equal parts of 50 percent sulfur and 50 percent oil . this mixture is subjected to a high shear mixing device with prepares a fine dispersion of sulfur in the oil phase . once this dispersion is prepared , 0 . 2 parts of said dispersion is added slowly by injection into the polymer / asphalt mixture under agitation and allowed to react with the asphalt polymer mix for 2 to 24 hours at temperatures of 325 - 340 ° f . material is then sampled and evaluated for performance graded asphalt specification and found to have an actual grade of pg66 . 2 - 29 . 8 , meeting the requirements of pg64 - 28 . storage stability separation testing is conducted on the finished blend and found to have a separation difference of less than 4 ° c . into a conventional mixing kettle is charged 96 . 8 parts of an asphalt cement binder meeting pg64 - 22 requirements . into this liquid is added slowly under mild agitation 3 . 0 parts of an sbs copolymer and allowed to mix at temperatures of 325 - 340 ° f . this mixture is then circulated through a high shear mill until the polymer is uniformly dispersed into the liquid asphalt cement . the mixture is then pumped to a storage tank and held under mild agitation for a period of 2 to 24 hours . approximately 0 . 1 parts of elemental sulfur is bagged into 5 lb . packages using low density polyethylene plastic bags which are then dropped into the top of the tank in sequence slowly over a period of 5 to 30 minutes and allowed to react under mild mixing at 325 - 340 ° f . for a period of 2 to 24 hours . material is then sampled and evaluated for performance graded asphalt specification conformance and found to meet an actual grade of pg75 . 6 - 26 . 5 , meeting requirements for pg70 - 22 . however , when the tank was empty and opened for inspection , large globules of over - cross - linked polymerized asphalt were found which were non - soluble in the liquid asphalt and remained dispersed as contamination throughout the batch and upon filtering . into a conventional mixing kettle is charged 96 . 8 parts of an asphalt cement binder meeting pg64 - 22 requirements . into this liquid is added slowly under mild agitation 3 . 0 parts of an sbs copolymer and allowed to mix at temperatures of 325 - 340 ° f . this mixture is then circulated through a high shear mill until the polymer is uniformly dispersed into the liquid asphalt cement the mixture is then pumped to a storage tank and held under mild agitation for a period of 2 to 24 hours . the material is sampled for conformance to performance graded asphalt binder specifications and found to meet an actual grade of pg73 . 2 - 22 . 7 , meeting requirements for a pg70 - 22 . borderline low temperature results were obtained as well as a 3 degree inferior high temperature grading without the use of sulfur . to a conventional mixing kettle is charged 97 . 0 parts of an asphalt binder meeting the requirements of pg58 - 28 . under mild agitation at temperatures of 325 - 340 ° f . is slowly added 3 . 0 parts of an sbs copolymer . after mixing for 10 to 60 minutes , this mixture is circulated through a high shear mixer until the polymer is completely dispersed uniformly into the liquid asphalt . this material is then pumped to a storage tank and held under mild agitation for a period of 2 to 24 hours . the material is then sampled and evaluated for conformance to performance graded asphalt binder specifications conformance and found to meet an actual grading of pg65 . 5 - 28 . 3 , meeting the requirements for a pg64 - 28 . the material , without the use of sulfur and oil dispersion of example 3 , just barely met the pg64 - 28 low temperature requirements . the separation testing on this material was found to have a difference of greater than 10 degrees . the examples above show that a safe sulfur slurry can be used to safely and efficiently add finely divided elemental sulfur to asphalt . the examples are identical to those in my closely related case , 6318aus , filed simultaneously with this case . 6318aus claimed blending polymer with asphalt and then adding sulfur in oil . this work gave me the idea of a new , and safer , way of adding sulfur to asphalt , even when there was no polymer present . while i do not wish to be bound by any theory as to why the invention works , my belief is as follows . the sulfur treating reaction occurs relatively rapidly , as soon as sulfur slurry is added . indeed the extreme rapidity of cross - linkng , caused by high localized concentrations of sulfur when dumping large amounts of sulfur powder into the asphalt , is the reason i add sulfur as a readily dispersible slurry . my sulfur slurry approach to sulfur addition greatly reduces , or eliminates , formation of incompatible , over - treated asphalt phases which can settle in the bottom of the hot mix tank or cause filtration problems . i am not sure exactly why the sulfur slurry process works so well as a method of sulfur addition . the mechanism for its success may be as simple as that experienced by cooks forming flour gravies . a flour - in - water slurry mix provides an easy and reliable way of incorporating a thickening agent into a pot . sprinling dry flour into the same pot frequently results in formation of lumps . it is a simple process which improves safety , and has never been used to form a polymer free asphalt , so far as is known . specific compositions , methods , or embodiments discussed are intended to be only illustrative of the invention disclosed by this specification . variations on these compositions , methods , or embodiments are readily apparent to a person of skill in the art based upon the teachings of this specification and are , therefore , intended to be included as part of the invention disclosed herein . reference to documents made in the specification is intended to result in such patents or literature being expressly incorporated herein by reference , including any patents or other literature references cited within such documents .	2
the preferred embodiment of the present invention , the interior / exterior trash removal system 10 , is shown in fig1 , and 3 . in the preferred embodiment , the interior / exterior trash removal system 10 has a door 20 located on an exterior wall within any room of a house . the door 20 is preferably attached to the exterior wall via hinges 22 , although other means can be used , and has a secure locking system 24 much like any other exterior door of a house such that it prevents unwanted pests and intruders from entering the house via the door 20 . in the preferred embodiment , the door 20 opens to the chute 30 that is located within the exterior wall of the house . the chute 30 is preferably made of plastic although a number of other materials including , but not limited to , wood and / or metal can be used to make the chute . it is preferred that the chute 30 is angled down from the door 20 to the outside of the house . one of ordinary skill in the art would recognize that the angle of the chute 30 should be of such a degree that garbage will easily slide without sticking or stopping . further , it is preferred that the interior of the chute 30 be smooth such that garbage will slide easily without getting caught . at the outside of the house , the chute 30 extends over the top of a garbage can or receptacle 40 . it is preferred that a forty - five gallon garbage receptacle 40 be used . using such a large receptacle 40 will lesson the frequency of changing or emptying the garbage receptacle 40 . one of ordinary skill in the art would readily recognize that any number of different sized garbage receptacles can be used . the size of the garbage receptacle 40 can vary based on the size of the household that is going to use the interior / exterior trash removal system 10 , the amount of garbage that said household throws out and how often the garbage is picked up by a trash collector . a single user whose garbage is picked up once a week may only need a fifteen gallon trash receptacle , whereas a family of five would need a much larger trash receptacle 40 . as seen in fig1 and 2 in the preferred embodiment , the trash receptacle 40 is enclosed within a shed - like housing 50 . the housing 50 is preferably sized to be just large enough to enclose the trash receptacle 40 and accommodate a portion of the chute 30 , although one of ordinary skill in the art would recognize that the housing 50 can be any size that the user would like . the housing 50 can be built larger to house tools , etc . together with the trash receptacle 40 . one of ordinary skill in the art would also recognize that the interior / exterior trash removal system 10 can exist without the housing 50 . the housing 50 serves to keep unwanted pests away from the garbage within the trash receptacle 40 and further serves to prevent precipitation from entering and filling the trash receptacle 40 . in the preferred embodiment , the floor of the housing 50 is constructed from concrete whereas the side walls and ceiling of the housing 50 are constructed from wood and are covered , sided , painted , etc . to match the home to which the interior / exterior trash removal system 10 is being installed . one of ordinary skill in the art would readily recognize that the housing 50 can be constructed from a number of different materials , including , but not limited to , plastic or concrete and need not match the home to which it is installed . in the preferred embodiment , the housing 50 has openings 52 along the top and bottome of the side walls . said openings 52 are preferably located in the side wall approximately six inches down from the ceiling of the housing 50 and approximately eighteen inches up from the floor of the housing 50 . the openings 52 are preferably small in size , to prevent unwanted pest infiltration . screening preferably covers the openings 52 , although it is not necessary . the openings 52 ventilate the housing 50 letting out odors and heat . it is preferred that said openings 52 be located both at the top and bottom of the side walls in order for the air within the housing 50 to circulate properly . one of ordinary skill in the art would readily recognize that the openings 52 can be located anywhere on the side walls or ceiling of the housing 50 and that there can be as many openings 52 as desired . in the preferred embodiment , the housing 50 has a door 54 that allows the user access to the trash receptacle 40 for removal and replacement . in the preferred embodiment , the door 54 is attached to the housing 50 via a set of hinges 56 . it is also preferred that the door 54 have a secure latch 58 that prevents unwanted pests and people from entering the housing 50 through the door 54 . one of ordinary skill in the art would recognize that the door 54 need not be attached to the housing 50 via hinges 56 , a variety of other methods including but not limited to , having a sliding door , exist . further , a secure latch 58 or lock is not necessary to the interior / exterior trash removal system 10 , but is preferred . although this invention has certain preferred embodiments , it will be obvious to those skilled in the art that various changes and modifications may be made therein without departing from the invention , and all such changes and modifications are intended to fall within the true spirit and scope of the invention .	1
with reference to the figures , the biochemically - powered self - exciting electric power source , according to the invention , comprises a container 1 , inside which there is an electrolyte 2 , which is advantageously constituted by a semiliquid solution composed of pure nickel acetate in 70 % double - distilled water . an anode , generally designated by the reference numeral 3 , is arranged inside the container 1 and is advantageously provided by a pure nickel plate 4 , on the faces whereof a gummy biochemical compound , designated by the reference numeral 10 a and provided by way of example by means of a spurge latex , is applied . according to a convenient embodiment , the biochemical compound is obtained by means of 20 grams of spurge latex , preferably collected when the plant is in bloom , which is diluted in one deciliter of water and put to slowly boil until it becomes a pasty mass . this operation , which must be performed carefully in order to prevent the mix from burning , must be performed advantageously in the vicinity of an aspirator . the resulting mix is arranged in a vessel that is covered by 10 grams of nitrobenzene mixed with 10 grams of ferric nitrate and with 10 grams of 90 ° ethyl alcohol . the system is left to rest in an environment at 25 - 30 ° c . for approximately 24 hours so as to obtain a yellowish colloid . the colloid is then mixed in aqueous ammonia with 50 grams of potassium bichromate and 10 grams of nickel acetate . the compound is poured into a vessel that contains a resin of the “ sintolit ” type with the corresponding hardener , and is mixed for a few minutes until a mix is obtained which can be spread with a spatula on an insulating support 5 provided with through holes 10 . the compound passes through the holes 10 of the plates 5 , as shown in fig3 , and remains incorporated in such holes , which are then placed in contact with the nickel plate , obtaining a monolithic piece which is substantially provided with the nickel plate at the center and , on each of its two faces , with an insulating supporting element 5 , the through holes whereof are filled with the biochemical compound 10 a , so that the compound is in contact with the nickel plate and with the electrolyte . a first electrode , designated by the reference numeral 20 , and a second electrode 21 are provided inside the container 1 , which faces the anode 3 ; the electrodes face the anode 3 on opposite sides without having a direct electrical connection . the anode 3 and the electrodes 20 and 21 preferably have the same substantially rectangular contour , with a protruding central projection 22 on the anode and lateral projections 23 and 24 on the electrodes , arranged on opposite sides with respect to the projection 22 . in a preferred but not exclusive embodiment , suitable for the quantity of the biochemical compound obtained by proceeding as described above , the dimensions of the anode 3 and of the electrodes 20 and 21 are equal to approximately 10 cm by approximately 5 cm . an important feature of the invention resides in that the electrode 21 is made of cadmium - plated iron and that the cadmium plating is performed with an electroplating process , by depositing approximately 5 microns of material . the electrode 20 is advantageously obtained by means of electrolytic iron , which is subjected to washing with aqueous ammonia . the electrode is kept in an ammonia bath for approximately 10 minutes and , after drying , is treated with a material obtained by mixing together three spoonfuls of rustproofing paint , lead oxide , mixed with 15 grams of alumina powder , which is brushed onto the plate with three coats after the drying of each layer . an electrical stimulator , designated by the reference numeral 30 , is connected to the electrode 20 and is constituted by an oscillator , which is adapted to generate a square - wave frequency , or by a source of pulses induced by means of a rotating magnet . the action of the electrical stimulation on the biochemical compound is meant to create an increase in voltage and current , which is many times higher than the intensity required by the electrical stimulator . a load , generally designated by the reference numeral 15 and represented schematically by means of a variable resistor , can be applied between the second electrode 21 and the anode 3 ; the type of load that can be applied can of course be varied in any case . in order to regenerate the source , a container 31 of active material to be introduced in the electrolyte is provided ; such material is advantageously constituted by a mixture of sodium chloride and potassium chloride or sodium chloride and calcium carbonate , optionally with the addition of potassium bicarbonate . the pack , constituted by way of example by the pure nickel electrode and the insulating sheets in which the biochemical compound is placed , is replaced periodically . during product engineering , the compound 10 a , which in the example is formed on a basis of spurge latex , can be provided or supplied by way of other methods . instead of spurge , it is in fact also possible to use a natural or synthetic component that has the same characteristics , in particular a compound based on hydrocarbons , including petroleum and its derivatives , which have a composition that is very similar to spurge liquid , which is characterized by a composition that is similar to a hydrocarbon and by electrical semiconduction . from what has been described above , it is thus evident that the invention achieves the intended aim and objects , and in particular the fact is stressed that the particular solutions used to provide the electrodes and to obtain the biochemical compound allow to considerably increase the electric power that can be generated by the source according to the invention . it is obviously possible to modify a whole series of elements with equivalent elements without thereby altering anything in operation ; in particular , and as mentioned , the natural spurge liquid can be replaced with synthetic or natural compounds that have the same characteristics and in particular the ones based on the hydrocarbons that constitute most of natural spurge . the invention thus conceived is susceptible of numerous modifications and variations , all of which are within the scope of the appended claims . all the details may further be replaced with other technically equivalent elements . in practice , the materials used , so long as they are compatible with the specific use , as well as the contingent shapes and dimensions , may be any according to requirements . the disclosures in italian patent application no . mi2003a001603 , from which this application claims priority , are incorporated herein by reference .	7
the active aerial shown in fig1 comprises an aerial element 1 whose length is shorter than the wavelength at the operating frequency and an amplifier circuit 2 connected thereto having an input 3 and an output 4 to which a load 5 can be connected . when the length 1 of this aerial is much less than the wavelength at the operating frequency , such an aerial is particularly suitable for use in mobile receivers and in so - called aerial &# 34 ; arrays &# 34 ;. since these aerials comprise an amplifier , noise and distortion products coming from the amplifier are unavoidable , these products being added to the received signal . the configuration must therefore be of such a design that these unwanted signals are suppressed to the best possible extent . such an active aerial is provided with diodes 6 and 7 to protect the amplifier input from high voltages as resulting from , for example , static discharges . these diodes 6 , 7 , which limit the input voltage variation between ground potential and the supply voltage potential have stray capacitances , which reduce the strength of the signal coming from the aerial . furthermore , the non - linear behavior of the diodes 6 , 7 increases the distortion of the active aerial . also contamination of the aerial by dust and moisture produce unwanted impedances which negatively affect the quality of the transfer characteristic of the aerial . in order to considerably reduce the influence of these effects , the amplifier circuit 2 comprises , in this embodiment , a high - gain amplifier 8 with the signal input 9 of the amplifier 8 connected to a point of common potential , this point being connected to ground in this embodiment . in addition , the amplifier has a feedback circuit which , in this example , is formed by an impedance 12 , which is arranged between the output 11 and the signal - inverting input 10 of the amplifier 8 . it should be noted that the input stage of the amplifier 8 may be implemented as a symmetrical differential amplifier . in view of the fact that the gain factor of the amplifier 8 is very high and the output voltage is negatively fedback to the signal - inverting input by way of the feedback impedance 12 , the voltage at the signal - inverting input 10 will be substantially equal to the voltage at the signal input 9 and consequently substantially equal to the voltage at the point of common potential . this means that the signal - inverting input is virtually connected to ground . it should be noted that the signal - inverting input 10 constitutes the control input of the first active element of the amplifier circuit 2 . because of the very small voltage difference between the signal input 9 and the signal inverting input 10 , the amplifier circuit 2 has a very low input impedance . as a result of the fact that the signal - inverting input is virtually connected to ground , there is normally no signal voltage across the protection diodes 6 and 7 and the influence of these diodes on the aerial transfer characteristic is eliminated . the same applies as regards the influence of aerial contamination due to moisture and dust . also the non - linear distortion of the amplifier is considerably reduced by the fact that the variations in the input voltage is very small . an aerial having a length which is much less than the wavelength may be represented by a voltage source u a with which a capacitance v a is arranged in series . this is proof of the fact that the open voltage produced by the aerial 11 is independent of the frequency . in order to obtain a frequency - independent active aerial transfer characteristic a capacitance ( 16 ) must be chosen as the feedback impedance 12 . it can be demonstrated in a simple manner that in that case the transfer function is equal to u b representing the voltage across the load 5 . when a variable capacitor c 16 is used as the feedback impedance 12 , then it follows from formula 1 that the gain changes linearly versus the change of the value of this feedback capacitance c 16 , which renders it possible to set in a simple way the desired output voltage for driving the receiver , which is coupled to the active aerial , to full power . the embodiment shown in fig2 shows an operational amplifier 8 , whose signal input 9 is also connected to ground , as the active portion of the amplifier circuit 2 . however , the feedback circuit is formed by a first transformer 13 , a first winding 14 of which is connected between the output 4 of the amplifier and ground and a second winding 15 of which is connected between the aerial element and the signal - inverting input 10 of the amplifier 8 . for a n : 1 ratio for the number of turns of the first winding 14 to the number of turns of the second winding 15 it holds for the transfer function of the aerial at a very high gain factor of the amplifier 8 that the transfer function is equal to so also this aerial configuration has a well - defined transfer function which is independent of the frequency . as the signal inverting input is virtually grounded , the influences of stray capacitances 22 , produced for example by the protection diodes connected to the signal inverting input 10 , the miller - capacitance of the first active element of the amplifier 8 and the capacitance of the wiring in the region of the said input 10 , are eliminated . only the parasitic wiring capacitance 23 remains . in order to obtain an optimal matching of the active aerial to the load 5 , which may be formed by , for example , the characteristic impedance of the cable and the input impedance of a receiver , the feedback circuit of the amplifier 12 may be modified . thus , fig3 shows an embodiment in which , in addition to the negative feedback by means of a capacitance 16 , this negative feedback being operative in parallel from the output as described with reference to fig1 a negative feedback is operative in series from the output by means of a second transformer 18 and a second capacitor 17 . a first winding 19 of the second transformer 18 is connected between the output 11 of the amplifier 8 and the load 5 , this winding being shunted by a resistor 20 having a value which is small with respect to the load impedance 5 . a second winding 21 of this transformer 18 is connected in series with the second capacitor 17 between the point of common potential ( ground ) and the signal - inverting input 10 of the amplifier 8 . starting from a m : 1 ratio of the number of turns of the first winding 19 to the number of turns of the second winding 21 , it can be demonstrated , at a very high gain factor of the amplifier 8 , that the voltage u b across the load 5 is equal to ## equ1 ## and that the output impedance z o of the amplifier 2 is equal to let the load impedance z 5 be equal to z o and ## equ2 ## then formula ( 3 ) is simplified to as formula ( 5 ) shows , the active aerial of in fig3 has a defined , frequency - independent transfer characteristic . in addition , formula ( 4 ) shows that by the choice of the value of resistance 20 an optimum power transfer can be obtained in a simple manner , a considerable loss in signal power not occurring . the embodiment shown in fig4 shows a feedback circuit in which not only the negative feedback as shown in fig2 is operative from the output but in which there is also an additional negative feedback which is operative in series with the output , in a similar manner as shown in fig3 . the difference between this additional negative feedback and the negative feedback shown in fig3 is that the second winding 21 of the second transformer 18 is connected in series with the second winding 15 of the first transformer 13 between the aerial element 1 and the signal - inverting input 10 of the amplifier 8 . and that the output impedance z o of the amplifier 2 is equal to for the case where z 5 = z o formula ( 6 ) is simplified to this formula ( 8 ) shows that the active aerial shown in fig4 has a defined and frequency - independent transfer characteristic and that the output impedance of the amplifier 2 can be set in a simple manner by the choice of the value of the resistor 20 and / or the winding ratio of the second transformer 18 , in order to obtain an optimum power transfer . the embodiment shown in fig1 can be wholly implemented in integrated form and is therefore particularly suitable for use in car radios and aerial &# 34 ; arrays &# 34 ;. it appeared that , when the aerial element has a length of 0 . 5 meter , the described active aerial had , over a frequency band from 5 khz to 30 mhz , a transfer characteristic which is flat within 0 . 5 db and an extremely low distortion , which will be explained with reference to fig5 . in the graph shown in this fig5 the power applied by the active aerial to a 50 ω load is plotted in dbm versus the root means square value of the received field strength e rms , expressed in v / m . the right - hand line 22 represents the relationship of the desired signal , the straight lines 23a and 23b represent the second order distortion then occurring ( indicated in the figure by 2 nd ) and the straight lines 24a and 24b represent the third order distortion then occurring ( indicated in the figure by 3 rd ). the indices a and b , respectively , indicate that these lines are associated with the active aerial as shown in fig1 and fig2 respectively . the excitation limit of the active aerial is shown in fig5 by means of line 25 . a criterion by which the quality can be judged , this graph shows that the second order interception point is located above + 70 db m and that the third order interception point is located above + 50 dbm .	7
referring now to fig1 and 2 , basic flowcharts of the system and method is shown according to an embodiment of the invention . in general , the system and method of the invention determines a proper environment for a tpms sensor for a vehicle of interest , i . e ., determining whether a particular sensor is compatible with the actual sensor taken from the vehicle . if not , then the invention allows a user to program a generic sensor with a programming tool . the invention also enables the user to re - program the vehicle in a relearn process so that the vehicle is safe to drive with the replacement tpms sensor . in addition , the invention provides a sensor track feature that tracks the reason ( s ) why the sensor taken from the vehicle of interest has failed , thereby providing valuable fault diagnostics tool for the tire industry ( fig1 ). the system and method identifies tpms parts , parts aliases , parts suppressions , parts interchanges , parts service components , vehicle tpms relearn processes and tpms scan tool compatibility . this is achieved through a tpms software program “ wizard ” walk - through that incorporates images , text , videos and multiple filters that allow the user to complete the process with accuracy by accessing a tpms manager database , which is the driver behind the value and usefulness of the information presented to a user through a graphical user interface ( gui ). the content population of the tpms manager database comprises data tables that include the following general categories : 1 ) vendors ; 2 ) vehicles ; 3 ) service tools ; 4 ) original equipment ( oe ) sensors ; 5 ) interchanges and aftermarket sensors ; 6 ) service kits ; and 7 ) service kit components . the database population details are given in the appendix attached hereto . there are basically two types of searches for an original equipment manufacturer ( oem ) part that can be performed by the user : 1 ) a quick search , and 2 ) an advanced search . as shown in fig2 and 3 , a user can perform a quick search of the tpms manager database by entering a group of subsets into the gui of the tpms software program . for quick search , these subsets includes the year , make and model ( y / m / m ) for the vehicle of interest . in addition , a group of subsets may need to be input by the user to further determine the exact original equipment manufacturer ( oem ) part . these subsets may include , for example , sub model , couple , sedan , trim level ( i . e ., lx model ), alloy or steel wheels , wheel size , mhz , vehicle system type ( high line / low line , valve angle ( i . e ., 20 degrees or 40 degrees ), or other determinants assigned to that vehicle and tpms sensor . if the user does not have the vehicle y / m / m , the same results may be provided based on the input of the vehicle identification number ( vin ). this result may , however , require further input to subsets not determined in the vin , like wheel material or system type . the tpms manager software will execute algorithms for the type of input ( y / m / m or vin ) by the user to determine the following : referring now to fig4 , the tpms manager stores results from the executed algorithms in a lookup table within the tpms manager software program , which is available for users to retrieve at any point in time . the left side of fig4 shows options that can be selected by the user , such as vehicle relearn , service requirements and scan tool compatibility check . the right side of fig4 shows a display of results , such as oem component ( s ), supersession component , interchange component , and alias component ( alternative part ). by clicking on any of the “ relearn ”, “ replace ” or “ service kits ” buttons , the “ 1k0 - 907 - 253d ,” for example , would be selected as the current sensor of the vehicle of interest . clicking on each button yields a different screen of stored results for the vehicle of interest . for example , clicking on the “ relearn ” button displays a screen of the stored results shown in fig5 . clicking on the “ replace ” button displays a screen of stored results shown in fig6 . clicking on the “ service kits ” button displays a screen of stored results shown in fig7 . the second type of search that can be performed by the user is an advanced search . the user selects the advanced search option by entering input in the advanced search section of fig2 and 3 . here , a user enters any number of subsets into the advanced search of the tpms manager software program . a full list of each subset is shown in fig8 , but at the high level , a user may use one or many combinations of subsets to identify an oem component . the tpms manager software program performs a dominance filtering technique based on “ and ” matching . thus , “ blue ” and “ metal ” selections would show only “ blue ” and “ metal ” sensors . there is no way for a user to use “ or ” logic within the query . the advanced search option will resolve at the results screen shown in fig9 . from this point , the user can navigate the results to select the desired sensor or service kit of interest . the user can also view attributes , images , and any other available data . the final step of advanced search is two paths : 1 ) the user can either save the results , or 2 ) navigate through selection to begin a new quick search . the tpms manager software program maintains any selections made in advanced search , and the data is carried forward into quick search . a user may need to determine the application , service requirements or communication of a tpms sensor without having vehicle information . this may result when a sensor is not functioning and the user has no knowledge of its application , and whether it is a correct part or not . to determine a part in a reverse lookup system , the user enters information through a series of dominance filters . a search by color of the sensor , the federal communications commission ( fcc ) id number , the industry canada ( ic ) number , the oem part number on the part ( if available ), the valve design , whether it is one piece , two piece , rubber or aluminum or a combination of the above - mentioned filters will provide a result that can be traced back to the application , as shown in fig1 . this will allow a user located at tpms service facility , for example , to accurately determine that the tpms sensor is for a hyundai vehicle , for example , as opposed to a honda vehicle . additionally , many tpms sensors do not have an oem part number on them , yet all are required to be labeled with the fcc and ic numbers . as the number of tpms manufacturers increases in the aftermarket , it is easy to understand the need for parts identification . it is recommended that a service facility replace some mechanical part of a tpms sensor when a tire is dismounted for either tire replacement or repair . these tpms components consist of critical air sealing parts that are unique to each sensor . matching the correct service part is important for safety reasons because this is the barrier between a highly pressurized tire and sudden air loss . these components consists of an external cap , a valve core , a retaining nut , and a rubberized washer , o - ring or grommet . in some cases , the service kit may or many not include an aluminum valve stem . once the sensor has been identified , the user can correctly match the service components . again , the user is allowed to filter and drill down the information to a vendor specific part for that application using the dominance filtering technique of the tpms manager software program . these service parts are fragile and contribute to air loss through decomposition of the rubber and / or galvanic corrosion of the parts due to incompatibility of the metals . the user will find clearly and identifiable images and description of the corresponding service parts , as shown in fig1 . by entering the y / m / m , vin , fcc , ic or filtered description , a user is given a resultant oem part number . it is very common in the life cycle of an oem art that future generations of like parts have part number that supersede to a new number . for example , nissan / infiniti p / n 40700 - jk00a was the factory or “ birth ” number of a tpms sensor for a 2008 g35 . this part number has superseded to 40700 - jk00b , then 40700 - jk00c . a typical service facility would not easily understand a vehicle that was equipped with sensors that hat three unique part numbers , yet were identical , except for the p / n . the inventions shows all superseded number in a “ chain ” related to the birth number . the user will find clearly identifiable images to support and understand the sequence of superseding parts , as shown in fig1 . by entering the y / m / m , vin , fcc , ic or filtered description , a user is given a resultant oem part number . it is very common that manufacturers other than the oem have produced replacement parts for a given application . the invention will provide a directory of alias or interchange parts that can be used in place of the oem part . all alias and interchange parts will be supported by images and detailed descriptions , as shown in fig1 and 14 . an alias part may have a distinctly different design or shape which in turn will require a different service component . the invention ties together all components based on results and selections made by the user . in other words , the invention confirms for the user the answer to the question ; “ will this part work on this vehicle ?.” by entering the y / m / m , vin or using a reverse lookup to determine the vehicle result , the user will then be shown a relearn procedure for the vehicle of interest , as shown in fig5 . every vehicle equipped with a direct measuring tpms system has a proprietary sequence of events or instructions that must be followed or undertaken to enable the sensor to communicate with the vehicle . vehicle manufacturers devised their own unique sequence resulting in multiple relearn procedures and multiple exceptions and derivatives of relearn . a relearn is a set of instructions that must be followed . in many cases a scanning and diagnostic tool specified for tpms must be used . these tools can trigger low frequency ( lf ) signals , collect transmission data and protocols , and embed collected data into the vehicle via and obd port . in some relearns , a part of the vehicle acts as the initiator . examples such as the headlamp switch , the key fob , the ignition cycle , the brake pedal , the drivers information center ( dic ) and countless other combinations . in some cases , a powerful magnet is required to activate a sensor for relearning . other systems require some or all of the above and driving the vehicle a prescribed distance and speed . lastly , some systems learn automatically without instructions or sequences . these are called “ auto - learn ” systems . understanding these instructions and sequences is critical to safely and successfully relearning the tpms system . the user will find an abbreviated version , as well as a full text version , of each vehicles specific relearn procedure based on vehicle results . by entering the y / m / m , the user is shown results related to a scan tools compatibility to perform the relearn where a scan tool is required . a scan tool is required for relearn on a significant percentage of tpms equipped vehicles . scan tools vary in complexity size and functionality . a gm dealership will have a proprietary scan tool for just gm vehicles . the same applies to every other car maker out of necessity to service their own brands . in the aftermarket , there are many scan tool manufacturers who have tools that can cover many of the oem platforms . however as new vehicles and tpms systems are introduced the aftermarket manufacturers are lagging in adding these applications to their respective scan tool products . it is common that tool manufacturers update their tools , usually via a web browser , every week or month as applications are added . knowing whether a scan tool currently be used by the user has the capability to perform the scan tool required relearn is a final critical aspect the tpms service cycle . a service shop that proceeds to repair , install or service a tpms sensor or system , only to ultimately find out that their scan tool is incapable of performing this final step , will most likely bear the responsibility of paying someone else , perhaps a competitor to perform this relearn . the invention allows a user to check the tool functionality before performing the work to ensure that a complete cycle of service can be performed , as shown in fig1 and 16 . the results shows the user this result in a yes or no answer . an accompanying video of the relearn using the tool will support the yes result . the tpms manager software program allows the user to setup administrative information in the tpms manager software program as follows : results from the y / m / m driver will populate with only those vendors selected . when a product or selected company has or shows no inventory or no application the user may opt to “ show all ” within a group . the architecture of the invention supports an integrated version to tie in with a companies existing inventory and management system . a web - based version supports other or non in house infrastructure methods of use . the patents and publications referred to herein are hereby incorporated by reference . having described presently preferred embodiments the invention may be otherwise embodied within the scope of the appended claims .	1

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.