text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
according to various embodiments of the invention , a pre - compression trigger sprayer may include any configuration as shown in fig1 thru 11 . a pre - compression trigger sprayer according to various embodiments may include an open and closed opposing valve system where the pre - compression valve 1 is located in a vertical cylinder 2 , or fluid flow path , behind the horizontal pumping cylinder 3 , or piston chamber . located below the pre - compression valve 1 is a check valve 4 . the check valve 4 can be part of the pre - compression valve system shown in fig2 as a disc type valve 4 or as in fig3 as a frusta - conical shaped valve 5 or as in fig4 as a separate valve 14 or many other configurations that would serve as a one way check valve system preventing liquid under pressure or at rest returning back into the container from which it was once drawn when a vacuum was created inside of the pumping cylinder 3 . a pre - compression valve 1 , as shown in fig1 , can have a flat , concave or convex shape . fig1 shows a valve 1 in a trigger sprayer however this valve system could be used in any opposing valve dispenser . the pre - compression valve system shown in fig1 requires a predetermined pressure to allow liquid to pass between valve 1 and the valve seat 7 . this occurs when a vacuum is created in the pumping cylinder 3 by the movement of the piston to the front portion of the pumping cylinder which has been forced back by a spring biasing component 8 . the vacuum draws the liquid up the dip tube 9 from the container and passes the check valve 4 into the pumping cylinder 3 . then , once the piston is moved to the back portion of the pumping cylinder 3 the liquid that was drawn into the pumping cylinder 3 is compressed and forces the liquid in area 10 to compress the top portion of pre - compression valve 1 allowing liquid to travel past the pre - compression valve 1 and valve seat 7 of component 11 into the flow channel 12 then exit the nozzle swirl orifice as a spray , foam or accelerated stream . in some embodiments , a one piece pre - compression valve system as shown in fig1 may include a priming valve portion 1 and the check valve portion 4 molded from flexible plastic materials which may allow the valve portions of the system to move freely under pressure or vacuum . this is not however desirable for the non - valve area 15 of the structure . movement of the non - valve area 15 can reduced the overall effectiveness of the pre - compression valve system . embodiments of the present invention may overcome this problem by inserting post 13 of valve case 16 which is made of a harder material inside of the pre - compression valve system . inserting the harder material valve case post 13 into non - valve area 15 may also eliminate the requirement to mold the pre - compression valve system component in two different materials , thus reducing the manufacturing cost . channel 17 inside post 13 of the valve case 16 may also serve as conduit to allow normal atmosphere outside air pressure to enter behind the pre - compression valve 1 allowing the pre - compression valve 1 to move freely without concern of a vacuum or compressed trapped air on the opposite side of the pre - compression valve 1 . the pre - compression valve system shown in fig5 is an optional design for the valve seat 18 . in this embodiment , the priming valve 19 which is part of the lower check valve 20 , or which could be made of a separate component , does not move . instead the valve seat 18 moves upward against a bias spring element 21 . this movement does not occur until a predetermined pressure of the liquid is reached in the pumping cylinder 3 as described before . the moving valve seat 18 embodiment may require a sealing means 35 between the moving valve seat 18 and the inside diameter of flow channel 12 . this design may also be reversed where the valve portion replaces the valve seat 18 and is part of the upper bias spring element 21 and moves upwards and the valve seat portion replaces the priming valve 19 and is part of the lower check valve 20 and does not move . fig6 illustrates another embodiment which may include a cost reduction option which eliminates the separate valve seat component 11 shown in the pre - compression valve system of fig1 . in this embodiment the valve seat 36 may be part of the housing 25 . the pre - compression valve system shown in fig6 functions the same as the pre - compression valve system shown in fig1 , 2 , 3 and 4 . the positive lock pre - compression valve pre - load design shown in fig7 provides a constant load between surface 23 of valve case 16 and surface 24 of housing 25 preventing movement of pre - compression valve system which is assembled into valve case 16 and housing 25 . undercuts 29 on housing 25 are snapped through slots 30 in valve case 16 under a preload interference . movement of the pre - compression valve system may result in inconsistency of stokes to prime , of liquid volume output , and of the spray / foam / stream patterns produced from the dispensing system . a positive lock gasket retention system for a closure is shown in fig7 and 7a . gasket 26 may be retained in place through slots 31 in gasket 26 with ribs 21 and undercuts 28 of valve case 16 . a bias loaded assist tab 33 on the plastic spring component 8 according to various embodiments of the invention , is shown in fig8 and provides pressure against the housing surface 34 to assist the spring arms 22 of the plastic spring component 8 on the return vacuum stroke of the piston / actuator creating a vacuum in the pumping cylinder 3 which allows product to be drawn into the pumping cylinder 3 . this process may be repeated over and over which puts stress on the plastic spring arms 22 of the plastic spring component 8 which can break or lose the ability to fully return the piston on the return vacuum stroke . inclusion of a tab 33 according to embodiments of the invention , increases the strength of the overall plastic spring component 8 thus reducing the stress on the arms 22 . having thus described certain particular embodiments of the invention , it is understood that the invention defined by the appended claims is not to be limited by particular details set forth in the above description , as many apparent variations thereof are contemplated . rather , the invention is limited only be the appended claims , which include within their scope all equivalent devices or methods which operate according to the principles of the invention as described . | 1 |
in this section , a silicon electrospray ionization chip for the mass spectrometric analysis is described , along with its fabrication method and characteristics . with reference to fig1 , the chip has three parts : a sample introduction spot 12 , a flow channel 14 , and a sharp electrospray ionization tip 14 . a regular micropillar array , shown in fig2 a and 2a , is micromachined inside the whole channel . as can be seen , the chip has no lid , which makes the sample application easy . with reference to fig2 a , according to one embodiment , the chip comprises a flow channel 20 , where capillary forces are facilitated by micropillars 22 arranged in rows shifted in one dimension in turns . no external pumping is required and the only high voltage source needed is the one necessitated by ms . the whole chip can be made out of silicon , which allows the fabrication of high aspect ratio micropillars 22 inside the channel 20 and the accurate definition of a truly three - dimensional , in - plane tip , as shown below . the tip and the flow channel can be in - plane and the tip can be manufactured sharp so as to provide un - aided spraying . the chip combines self - filling of the channel , based on capillary forces of the micropillar array , and electrospray ionization at the tip of the chip . with reference to fig2 a , the pillar diameter d can , for example , vary within the range of 1 - 200 μm , in particular 1 - 80 μm and the pillar centre - to - centre distances z 1 and z 2 are typically of the order of 1 - 250 μm , in particular 1 - 80 μm , and 11 - 500 μm , in particular 1 - 160 , respectively . z 1 is the distance between neighboring micropillars and z 2 is the distance between second - nearest micropillars . several working examples have been manufactured and tested , from which a first conforming to the design parameters d = 10 μm , z 1 = 12 μm and z 2 = 22 μm ( as shown in fig2 b ), and a second conforming to the design parameters having d = 60 μm , z 1 = 75 μm and z 2 = 160 μm are mentioned . it has been proven than both these sets of geometrical parameters provide reliable capillary filling , even at relatively high contact angles ( see below under the subtitle “ capillary filling ”). the hexagonal pillar geometry described in detail above and illustrated in the drawings represents only one possible option . it has to be understood that a similar liquid - transporting effect may be achieved by other regular and non - regular arrays provided that the density of the array allows for capillary transportation of liquid . according to one embodiment , the fabrication process utilizes nested masks of silicon dioxide and aluminum oxide . in addition , a combination of anisotropic and isotropic plasma etching steps allows formation of a truly three - dimensional electrospray ionization tip without double - sided lithography . the present microchips can be fabricated using deep reactive ion etching ( drie ) which results in accurate dimensional control . the chip provides a reliable open - channel filling structure based on capillary forces , which eliminates the use of pumps or high - voltage supplies for liquid transfer and offers very easy operation . fig3 a - 3f show a μpesi chip comprising a sample introduction spot , a liquid transfer channel , and a sharp tip for direct esi in different stages of an exemplary fabrication process . the bottom layer 30 is a silicon substrate ( 300 μm ); the middle layer 32 is a sio 2 ( 1020 nm ) layer and the top layer 34 a al 2 o 3 ( 96 nm ) layer . photoresist layers are not shown in the figure . the μpesi chips were fabricated on 300 - μm thick & lt ; 100 & gt ; silicon wafers that had resistivity of 1 - 50 ohm - cm . both p and n - type wafers were used . the chip has a 2 . 5 - mm wide circular sample introduction spot and a 5 . 5 - mm long and 1 - mm wide straight flow channel , which ends to a sharp , in - plane esi tip . the chip has no lid . both the sample introduction spot and the flow channel contain a perfectly ordered array of micropillars . two different sets of geometrical parameters for pillars and pillar packing were used . similar chips without the pillar array were also fabricated for reference . the depth of the channels was varied between 20 and 40 μm . the fabrication process had two mask levels and utilized nested masks of silicon dioxide ( sio 2 ) and aluminum oxide ( al 2 o 3 ), which were both patterned on the wafer prior to any silicon etching . first , sio 2 was thermally grown on the wafers . the sio 2 mask for pillar channels was etched by chf 3 / ar reactive ion etching ( rie ) using a photoresist mask ( fig3 a ). after photoresist removal , amorphous al 2 o 3 layer was deposited on top of the patterned sio 2 mask using atomic layer deposition ( ald ). the deposition took place at 220 ° c ., trimethylaluminum and water vapor being the source gases . the second lithography defined the sharp esi tip at the end of the flow channel . both al 2 o 3 and sio 2 were etched away from tip area , by phosphoric acid and chf 3 / ar rie , respectively ( fig3 b , 3 c ). aluminum oxide served as an etch mask during the through - wafer deep reactive ion etching ( drie ) ( fig3 d ). if a three - dimensionally sharp esi tip is desired , the through - wafer etching can be done in two parts . first , fairly shallow anisotropic silicon drie step is performed . then , a 250 - nm thick sio 2 passivation layer is deposited using plasma enhanced chemical vapor deposition ( pecvd ). deposited pecvd sio 2 is removed from horizontal surfaces using chf 3 / ar rie again , but vertical sidewalls remain passivated because of the anisotropic nature of the rie step . the rest of the through - wafer etching is also done with drie , but using a more isotropic etching process . isotropic etching causes undercutting and because of the passivation layer a three - dimensionally sharp tip is formed . the two - step anisotropic - isotropic sharpening process is not shown in fig3 . after the through - wafer etching , the al 2 o 3 mask was removed in phosphoric acid ( fig3 e ) and the pillar channels were created in another anisotropic silicon drie step , using the revealed sio 2 pattern as a mask . all silicon etchings were done in inductively coupled sf 6 / o 2 plasma at cryogenic temperature ( plasmalab system 100 , oxford instruments , uk ). after the last silicon drie step the remaining sio 2 was removed using buffered hydrofluoric acid ( fig3 f ). the channels can be transformed to more hydrophilic using short oxygen plasma treatment or piranha treatment . μpesi chips comprising a sample introduction spot , a liquid transfer channel , and a sharp tip for direct esi were fabricated on 380 - μm - thick n - type & lt ; 100 & gt ; silicon wafers with resistivity of 1 - 14 ω - cm and diameter of 100 mm . deep reactive ion etching ( drie ) of silicon was done using plasmalab system 100 reactor ( oxford instruments , uk ). the fabrication process is described in fig4 . briefly , the two lithography - step fabrication process utilized nested masks of silicon dioxide ( sio 2 ) and aluminum ( al ), which were both patterned on the wafer prior to any si etching . sio 2 and al have shown to work well in deep reactive ion etching process at cryogenic temperatures . sio 2 was thermally grown on the wafers ( step 2 ). the patterns for the pillar channels were etched into the 520 - nm - thick sio 2 layer using rie ( step 3 ). the aluminum layer ( 200 nm ) was sputtered on top of the sio 2 structures ( steps 4 & amp ; 5 ). the aluminum and sio 2 were wet etched from the tip using a phosphoric acid based etchant and buffered hydrofluoric acid ( bhf ), respectively . aluminum served as a mask during the through - wafer etching ( step 7 ) which defined the sharp esi tips at the ends of the channels . the angle at the tip was approximately 60 degrees . the al mask was removed ( step 8 ) and the 40 - μm - deep pillars were etched in another si etching step , using the previously made sio 2 pattern as a mask ( step 9 ). the both silicon drie steps were done in inductively coupled sf 6 / o 2 plasma at cryogenic temperature . after silicon etching the remaining sio 2 was removed in buffered hydrofluoric acid . finally , the chips were diced using a wafer saw . two different chip sizes were fabricated : the small chip had 8 - mm - long and 1 - mm - wide channels and the large chip 18 - mm - long and 2 . 25 - mm - wide channels . pillar diameters ranged from 15 to 200 μm in different chips and the distances between the pillars varied from a micrometer to 80 μm . this fabrication procedure produced well - shaped , uniform micropillars with well - defined and accurate distances between them . also the height of micropillars can be precisely defined , thus increasing the chip - to - chip reproducibility . the fabrication costs per one μpesi chip are low as over one hundred chips can be produced on one 100 mm diameter silicon wafer . in esi - ms a strong electric field at the tip of the esi chip forms a taylor cone and the liquid breaks into droplets that are ionized . the ionized molecules are analyzed using a ms . the voltage needed to create an electric field that is sufficiently strong for formation of electrospray is known to be dependent on the sharpness of the esi tip . the sharper the tip , the lower the onset voltage of electrospraying is . therefore , it is desirable to have a three - dimensionally sharp esi tip . the esi tip fabricated without the sharpening process is shown in fig5 a and 5b . the width of the 100 μm wide esi tip is defined by the second lithography step and therefore easily adjusted . the thickness control of the tip is not as easy , because it cannot be determined by lithography . the tip presented in fig5 a and 5b has the thickness of 300 μm , which is determined by the wafer thickness . the thickness control of esi tip without double - sided lithography requires adequate combination of anisotropic and isotropic plasma etching steps . combining the sharpening process discussed above with a narrow tip results in a three - dimensionally sharp esi tip . the shorter the first anisotropic etching step during the sharpening process is , the sharper the tip becomes . however , the depth of the first anisotropic etching during the sharpening process must always be greater than that of the pillar channel . the tradeoff of an extremely sharp tip is poorer mechanical strength . the esi tip of the μpesi chip where sharpening process was utilized is presented in fig6 a and 6b . passivation layer protects the top part of the chip during isotropic etching . we used ald al 2 o 3 layer as a mask during the through wafer - etching process , because of its exceptionally high selectivity in cryogenic drie . also the selective removal of al 2 o 3 after the through - wafer etching process is important . al 2 o 3 can be removed using phosphoric acid without affecting the underlying sio 2 layer and silicon surface . aluminum etch mask was also tested for the through wafer etching , but in fluorine based plasmas sputtering and redeposition of aluminum result in rough etched surfaces . capillary filling of microchannels is based on the surface energetics of the system . a liquid will fill a microchannel spontaneously if doing so leads to a decrease of the total surface free energy . the surface energies of the system and the contact angle are linked by the young - dupré equation : where θ is the contact angle , γ lv , γ sl , and γ sv are the surface energies of the liquid - vapor , solid - liquid and the solid - vapor phases respectively . the capillary pressure in a microchannel with a rectangular cross section has been given as : p = γ lv ( cos θ t + cos θ b d + cos θ l + cos θ r w ) , ( 2 ) where θ t , θ b , θ l , and θ r are the contact angles at the top , bottom , left , and right channel walls respectively , d is the depth of the channel and w is the width of the channel . in the absence of other driving forces , a microchannel will fill spontaneously if the capillary pressure is positive . other forces that are present in our experimental setup include forces generated by hydrostatic pressure and laplace pressure of the droplet , but their contribution is usually small . we investigated the filling properties of similar channels with and without a micropillar array . a 2 . 5 - μl de - ionized water droplet was applied onto the sample introduction spot and capillary filling was observed under an optical microscope . typical filling experiments are presented in fig7 and 8 . both channels were 22 . 5 μm deep and 1 mm wide . contact angle of the etched silicon with de - ionized water was measured immediately after the experiment by sessile drop method ( cam 101 from ksv instruments , finland ) and it was 47 °± 2 °. the contact angle of the top wall was taken to be 180 ° since the material of the top wall was air . inserting these values into equation ( 2 ) gives approximately − 930 pa as the capillary pressure in the channels without pillars , which means that the channels should not fill spontaneously by capillarity . this is also what was observed in the experiments ( fig7 a and 7b ). instead , the channels filled only at the corners and even there the flow was very slow . capillary flow in corners is well known and for a 90 ° corner , it should happen spontaneously when the contact angle is less than 45 °. since the measured contact angle was slightly higher than this , it is possible that in this experiment the vertical sidewalls were slightly more hydrophilic than horizontal areas . the channels with a micropillar array filled spontaneously as shown in fig8 a and 8b . that is , the micropillars facilitate the capillary forces and the whole channel is filled without other driving forces . the sidewalls of the pillar channel were most conductive to capillary flow and the flow often proceeded to a new pillar row first at the edgemost pillar and then filled rest of the row . qualitatively , the difference in capillary properties of a channel with and without a micropillar array is that the channel with the pillar array has a lot more hydrophilic surface area per unit length , which makes the pillar channels much more conductive to capillary flow . contact angles in the 45 °- 50 ° range started to be near the limit of capillary filling even for the both pillar channel geometries tested ( see description of fig2 a above ). at these contact angles the filling was very slow ( approximately 1 mm / min ) and the sample spot droplet evaporated before the entire channel had filled . at more hydrophilic contact angles , in the 20 °- 35 ° range , the both pillar channels filled quickly ( approximately 1 mm / s ) and the channels without pillars still filled only at the edges . at extremely low contact angles (& lt ; 10 °), capillary pressure ( 2 ) becomes positive even for the channels without micropillars and the droplet quickly wetted even the channels without pillars . both pillar channel geometries used produced similar flow rates , but in general the geometrical parameters of the pillar channel also affect filling rate . wide pillar channels are preferred in comparison to narrow channels without pillars because of the increased sample capacity and low clogging probability . the wide pillar channels provide sufficient volume for sample , and therefore sample supply to the esi tip is continuous , which is essential for stable electrospraying . the clogging of the pillar channel is highly improbable because the sample flow is not stopped if one or even a few gaps between pillars are blocked . in a first stage , the operation of the present μpesi chip was explored by mass spectrometric measurements by coupling the chip to a mass spectrometer ( applied biosystems / mds sciex api - 3000 , concord , ontario , canada ) and tested for the detection of drug molecules . the sample volume applied onto the sample introduction spot was varied between 0 . 5 and 4 . 0 μl . the application of the sample onto the chip is extremely easy because the chip is lidless . the sample was driven through the flow channel by capillary forces . when the sample reached the esi tip of the chip it was sprayed out forming a taylor cone in the electrospray ionization process . no auxiliary gas or liquid flow was required to produce stable spraying . the voltage needed for ionization depended on the distance between the chip and the first lens of ms . when the distance was 1 . 5 - 2 . 0 cm , the voltage needed was 4 . 0 - 4 . 5 kv , while the first lens of ms was kept at the potential of 1 kv . the μpesi chip offers high sensitivity and good stability . the limit of detection for verapamil measured with ms / ms using selected reaction monitoring ( srm ) mode ( m / z 455 → m / z 165 and 303 ) was 30 μmol / l ( 75 amol ) as seen in fig9 . the system shows also quantitative linearity ( r 2 = 0 . 997 ) with linear dynamic range of at least 6 orders of magnitude ( fig1 ) and good stability ( standard deviation & lt ; 4 %) at a measurement of 10 μm verapamil lasting for sixty minutes ( fig1 ). the tests were extended to a variety of bioanalyses . the mss used in these tests were a api300 triple - quadrupole , api3000 triple - quadrupole instruments ( applied biosystems / amds sciex , concord , canada ), and a quadrupole - time - of - flight instrument micromass q - tof micro ( micromass / waters , manchester , uk ). nitrogen produced by a whatman 75 - 720 nitrogen generator ( whatman inc ., haverhill , mass ., usa ) was used as curtain gas . a microfluidic toolkit voltage supplier from micralyne ( micralyne inc ., edmonton , ab , canada ) was used . with reference to fig1 , the sample droplet 120 injected ( 0 . 5 - 4 μl ) to the sample introduction spot 121 filled the chip 122 spontaneously by strong capillary forces to the es tip 123 . the high voltage ( 2 - 5 kv ) required for the es was applied to the sample introduction spot 121 by a platinum electrode 124 . since the entire chip 122 was conductive and the voltage drop across the micropillar array 125 was negligible , the 2 - 5 kv voltage provided sufficient electric field for stable es . the electric current was measured between the high voltage supply and the platinum electrode by an amperometer ( meterman 38xr , taiwan ). in experiments , the distance between the tip and the first lens 126 of the mass spectrometer was about 1 . 5 cm . for bioanalysis experiments verapamil , angiotensin i , angiotensin ii , substance p , and horse heart myoglobin were used as test compounds and 2 . 5 μl of each sample was pipetted to the sample introduction spot . for the measurements of linearity and sensitivity verapamil was dissolved into acetonitrile : water ( 95 : 5 ) with 0 . 1 % formic acid at concentrations of 10 pm to 10 μm . the metabolism sample was prepared by incubating r - enantiomer of sibutramine hydrochloride ( purity & gt ; 99 %) with rat hepatocytes for 8 h . after sample preparation the sample was evaporated dryness and the residue was diluted to 50 μl of methanol . 10 μl of sample was dissolved into 500 μl acetonitrile : water ( 95 : 5 ) with 0 . 1 % formic acid . in the linearity and sensitivity measurements the selected reaction monitoring ( srm ) mode in the positive mode was used to measure the verapamil signal and the selected reactions were m / z 455 → m / z 165 and m / z 455 → m / z 303 . quantitative linearity was measured by applying separately 10 times 2 . 5 μl of each concentration of verapamil sample . the average and relative standard deviation ( rsd ) for signal heights was calculated for each different concentration . the peptides ( angiotensin i , angiotensin ii , and substance p ) and the protein ( horse heart myoglobin ) were diluted into 80 % aqueous methanol containing 1 % acetic acid ( two separate samples ). the concentrations were 5 μm for the peptides and 300 nm for horse heart myoglobin . full - scan mass spectra ranging from m / z 400 to 750 were measured from the peptide mixture and m / z 700 to 950 from the protein in the positive mode . sibutramine metabolism sample was measured with q - tof micro . a mass spectrum of solvent blank sample was subtracted from that of metabolism sample . a solution of tetrabutylammoniumiodide ( 5 μm ) in acetonitrile : water ( 95 : 5 v / v ) with 0 . 1 % formic acid was used to test the formation of es plume at the tip of the chip . 2 . 5 μl of the solution deposited to an introduction spot and the formation of esi was verified by videoing the tip of the chip with a ccd camera ( watec camera wat - 502a , japan ). in the measurement of long - term stability of the chip the verapamil solution was applied to the sample introduction spot via a fused silica capillary ( i . d . 150 μm , o . d , 250 μm ) using a syringe pump ( harvard apparatus pdh2000 , harvard apparatus , holliston , mass ., usa ) at a flow rate of 8 μl / min . the performance of the μpesi chip was evaluated , concerning the self - filling and the formation of the es ionization . the pillar array provides a liquid transfer by capillary action . it was noticed that the self - filling of the chip does not work when the pillar array is removed . incomplete filling also hampers electrospray operation . the pillar channel structure is not prone to clogging , since the liquid can flow via several routes between the pillars . the flow rate at the tip of the esi sprayer is dependent on the width of the channel and the flow rate in the channel is dependent on the diameter of the pillars and distance between the pillars . best performance and stability was achieved by using 2 . 25 - mm - wide channel , 15 - 50 μm - diameter pillars with the distances of 2 - 25 μm . the ion current appears as soon as the liquid reaches the tip of the chip and fades away when the liquid runs out . the signal lasted for about 20 s ( with a 2 - μl sample ) but by changing the dimensions of the chip and pillars the duration of signal can be decreased for faster analysis or increased for successive analysis with different ms scanning modes or for accumulation of the signal . the exact flow rate of solvents during the self - filling and electrospray could not be measured since the flow channel is open but the electric current , measured between the high voltage supply and the platinum electrode , varied between 20 and 150 na , depending on the high voltage and solvents used , and the distance between the chip and ms . these values indicate that the spray from the tip is somewhere between normal es and nanoes . fig1 a shows the linearity of the signal of verapamil standards obtained with μpesi / ms / ms in srm mode ( reactions of m / z 455 → m / z 165 and 303 were monitored ). 2 . 5 μl of standard solutions at six different concentration levels were applied ten times each , and the average and standard deviation were calculated . fig1 b shows the intensities of ms / ms signal of 10 - nm and 100 - nm verapamil solutions in 1 - h continuous flow analysis . the sample was infused continuously onto the sample introduction spot of the chip with a syringe pump at the flow rate of 8 μl / min . fig1 shows the detection capability of μpesi / ms / ms in srm mode at a low concentration level , 30 pm , which was considered as a limit of detection . similarly , the quantitative linearity of the system was tested with verapamil standard solutions in a concentration range of 100 pm to 10 μm with a 2 . 5 - μl injection ( ten times each concentration ) and a correlation coefficient ( r 2 ) of 0 . 997 was obtained , indicating good quantitative linearity of the system over a range of six orders of magnitude ( fig1 a ). the relative standard deviation ( rsd ), calculated from those ten injections , was less than 8 % at each concentration level , except at 100 pm level in which the rsd was 30 %. the stability of the signal with the microchip was tested by infusing 10 and 100 nm verapamil with a syringe pump at a flow rate of 8 μl / min for one hour ( fig1 b ). the signal measured with tandem mass spectrometry ( ms / ms ) was stable throughout the entire experiment , with a relative standard deviation of less than 5 %, indicating suitability of μpesi / ms for long - term analysis . the μpesi / ms produced high - quality spectra for the biomolecules tested , showing multiply charged ions for three peptides ( angiotensin i , angiotensin ii , and substance p ) and a protein ( horse heart myoglobin ) ( fig1 a - 15c ). the usability of μpesi chip was also tested with real metabolic sample of sibutramine . a 2 . 5 - μl injection of the metabolism sample showed demethylated ( at m / z 252 , 266 , 268 , and 282 ), hydroxylated ( at m / z 268 and 310 ) and dehydrogenated ( at m / z 310 ) sibutramine metabolites . also small amounts of sibutramine glucuronides were found ( at m / z 444 and 458 , not shown in fig1 c ). the same metabolites were found also with liquid chromatography - esi - ms / ms . 24 μpesi - ms was shown to be a sensitive technique as the limit of detection measured for verapamil ( fig1 ) using the selected reaction monitoring ( srm , m / z 455 → m / z 165 and 303 ) mode was 60 amol ( 28 fg ) with a 2 . 5 - μl injection volume ( corresponding to 30 pmol / l or 13 . 5 pg / ml ). comparison of the detection limits determined with μpesi / ms and nanospray / ms showed that the sensitivity was typically better or at least similar to that obtained with nanospray / ms or microfluidic hplc - chip / ms . the chemicals and samples used in the experiments presented above were obtained mainly from commercial sources . acetonitrile was obtained from rathburn ( walkerburn , scotland ). acetone was obtained from vwr international ab ( stockholm , sweden ). methanol was obtained from j . t . baker , deventer , holland and ethanol was from altia , rajamaki , finland . formic acid and acetic acid was obtained from sigma - aldrich , st . louis , mo ., usa . all solvents were of hplc grade . water was purified with milli - q water purification system ( millipore , molsheim , france ). verapamil was purchased from icn biomedicals inc . ( aurora , ohio , usa ) and tetrabutylammoniumiodide from lancaster synthesis , ( eastgate , white lund , morecambe , england ). the peptides ( angiotensin i , angiotensin ii , and substance p ) and horse heart myoglobin were purchased from sigma - aldrich . r - enantiomer of sibutramine hydrochloride ( purity & gt ; 99 %) was obtained from research institute for pharmacy and biochemistry ( prague , czech republic ). | 7 |
referring now to fig1 - 12 , a double check valve 2 is provided that includes an inlet check valve 6 and an outlet check valve 10 positioned in a valve body 14 . the valve body 14 receives a valve cap 18 that is adapted for interconnection to a sill cock of a faucet , for example . the valve body 14 also includes a plurality of vents 22 that allow for drainage of fluids from the sill cock , the inlet check valve 6 and / or outlet check valve 10 depending on the pressure gradient within the double check valve 2 . embodiments of the present invention thus allow fluid within the sill cock to drain from the double check valve to prevent freezing . back flow is prevented such that when pressure at an outlet 26 of the double check valve is greater than the pressure at the inlet 30 , which is in communication with a fluid supply , a main seal 34 ( or diaphragm ) will cooperate with an inlet check seal 38 to prevent back flow from entering the fluid supply . excess water then will be trapped within the inlet check valve 6 or outlet check valve 10 ( when a hose is interconnected to the check valve ), or be drained from the vents 22 . if no hose is interconnected , trapped fluid is able to drain from the inlet and outlet valves as well . referring now to fig1 and 1a , a double check valve 2 of one embodiment of the present invention is shown . preferably , the components of double check valve 2 , which will be described in further detail below , are constructed of a rigid material commonly used in the plumbing arts , such as brass . however , one skilled in the art will appreciate other suitable materials may be utilized without deviating from the scope of the invention . the double check valve 2 includes a valve body 14 that is interconnected to a valve cap 18 . the valve cap 18 is the inlet 30 of the double check valve 2 and employs a plurality of threads 42 ( or a bayonet fitting ), positioned on its outer and / or inner surface thereof , for interconnection to a sill cock of a faucet . the valve body 14 is preferably a cylindrical member that may include a knurled 46 outer surface that aids in the interconnection of the double check valve 2 to a fluid source . the double check valve 2 also includes a plurality of vents 22 that allow fluid and / or air to escape from the internal volume thereof . the valve body 14 also includes a plurality of threads 42 positioned about an outlet 26 of the double check valve 2 . a hose plunger 50 is selectively interconnected to the valve body 14 and is designed to coincide with the outlet 26 of the double check valve 2 when a hose 4 is interconnected thereto . fig1 a illustrates an embodiment of the double check valve 2 in association with a faucet 51 , also referred to as a sill cock . the faucet 51 employs a valve 52 to control the flow of water . referring now to fig2 and 3 , exploded views of one embodiment of the present invention are provided . an o - ring 54 is positioned within the valve cap 18 . one of skill in the art will appreciate the sealing function provided by the o - ring 54 may be performed by a flat seal or any other sealing member , or combination thereof , without departing from the scope of the invention . the valve cap 18 may also include a plurality of wrench flats 58 for securely interconnecting the double check valve 2 to a sill cock , for example . the valve cap 18 also includes an annular jut 62 that interfaces with the main seal 34 of the double check valve 2 . between the main seal 34 and the valve body 14 resides an inlet check body 66 that includes a lower end with a protruding , or hooked surface 70 . the inlet check body 66 receives the inlet check seal 38 on one end and an inlet check spring 74 on the other end . the inlet check spring 74 rests on an internal wall , or seat 78 , provided within the valve body 14 . alternatively , the inlet check spring 74 may contact and outlet check body 86 . the seat 78 defines a passage 80 that allows fluid to flow from the inlet check valve 6 to the outlet check valve 10 . the valve body 14 also includes threads 42 that receive a hose . the seat 78 is also associated with a drain spring 82 that is positioned about the outlet check body 86 . the outlet check body 86 includes a hollow portion 90 having a slot 94 bounded by a stop 98 . the stop 98 cooperates with the hooked surface 70 of the inlet check body 66 , thereby operably interconnecting the inlet check body 66 and the outlet check body 86 . the outlet check body 86 includes an outlet check seal 102 and an outlet check spring 104 positioned about a cylindrical portion 108 thereof . finally , the outlet check body 86 includes a lower protrusion 112 that is snap fit within a hub 116 of the hose plunger 50 . an upper surface 118 of the hose plunger 50 is engaged to the drain spring 82 wherein its lower portion is adapted to contact a hose . the hose plunger 50 also includes a lip that engages an inner surface of the valve body 14 when a hose is interconnected thereto that prevents further insertion of the hose plunger 50 into the double check valve when the hose is interconnected . the hose plunger 50 of one embodiment of the present invention is a snap fit within the valve body 14 such that the lip 120 of the hose plunger 50 engages a stop 124 provided adjacent to the outlet of the valve body 14 when a hose is not interconnected to the valve body 14 . referring now to fig4 , the double check valve 2 of one embodiment is shown during an open flow condition . here , the valve cap 18 is shown interconnected to the valve body 14 . the valve cap 18 may include a thumbscrew aperture 128 to receive a thumbscrew that allows a user to tightly ( an often permanently ) affix the double check valve 2 onto a sill cock . a main seal 34 is positioned between the annular jut 62 of the valve cap 18 and the valve body 14 . embodiments of the present invention interference fit the valve cap 18 onto the valve body 14 . one skilled in the art , however , will appreciate that the valve cap 18 may be screwed , welded or otherwise interconnected to the valve body 14 . an o - ring 54 resides within the valve cap 18 and is adapted to provide a seal between the sill cock and the valve cap 18 . fig4 shows an open flow condition wherein the supply pressure exists but no hose is interconnected to the double check valve 2 . the hose plunger 50 is biased by the drain spring 82 such that the lip 120 of the hose plunger 50 contacts the stop 124 of the valve body 14 . supply pressure forces the main seal 34 to deflect downwardly , which blocks fluid flow through the vents 22 . this configuration is substantially different from the v - 444 configuration described above . during an open flow condition with no interconnected hose , the v - 444 valve will allow fluid to escape out of the vents that wastes water . supply pressure also forces the inlet check body 66 downwardly , which compresses the inlet check spring 74 . the supply pressure in this configuration is sufficient enough to transition the outlet check seal 102 downwardly and to compress the outlet check spring 104 to separate the outlet check seal 102 and seat 78 . referring now to fig5 , the double check valve 2 is shown with the hose 4 interconnected during a non - flow condition . in this configuration , connection of the hose 4 , which includes a hose washer 132 , forces the hose plunger 50 , and thus the hub 116 thereof , axially upward . the upward motion of the hose plunger 50 compresses the outlet check spring 104 , which forces the outlet check body 86 upwardly such that the outlet check seal 102 engages the seat 78 . thus , interconnection of the hose 4 completely isolates the outlet check valve 10 from the inlet check valve 6 . if any back flow causing pressure rise in the hose 4 occurs , the seal between the outlet check seal 102 and its seat 78 will prevent fluid from entering the fluid source , unless those components have failed ( for example , debris lodged between the outlet check seal 102 and the seat 7 that allows for fluid infiltration ). since there is no flow from the fluid supply , the inlet check spring 74 and the inlet check body 66 will be positioned upwardly so that the inlet check seal 38 is engaged to the main seal 34 . thus , the inlet check valve 6 is isolated from the valve cap 18 that is interconnected to the fluid source . the inlet check valve 6 is , however , in fluidic communication with the vents 22 wherein any fluid pressurized by the transitioning outlet check body 86 will exit therethrough . referring now to fig6 , a closed flow condition is shown wherein the hose ( not shown ) is interconnected to the valve body 14 and the fluid supply has been opened . here , supply pressure deflects the inner diameter of the main seal 34 downwardly such that the main seal 34 blocks the vents 22 . supply pressure also acts on the inlet check seal 38 to force it downwardly which compresses the inlet check spring 74 . as described above , since the hose is interconnected to the valve body 14 , the hose plunger and the outlet check body 86 will be shifted upwardly . the inlet check body , however , will contact the outlet check body 86 and force it downwardly , thereby counteracting the outlet check seal and opening the passage 80 between the inlet check valve 6 and the outlet check valve 10 . referring now to fig7 , a non - flow configuration wherein a siphon has occurred is shown subsequent to the removal of supply pressure with the hose ( not shown ) interconnected to the valve body 14 . a siphon condition may be caused when gravity - induced flow of the water in the hose pulls a vacuum after the supply pressure has been shut off . the vacuum within the inlet check valve 6 and the outlet check valve causes the main seal 34 and the outlet check body 86 to deflect towards the outlet of the double check valve 2 . the outlet check body 86 translates downwardly until it contacts the hub 116 of the hose plunger 50 . the inlet check spring 74 pushes the inlet check body 66 upwardly . however , the hooked surface 70 of the inlet check body 66 will engage with the stop 98 of the outlet check body 86 , thereby limiting the range of motion of the inlet check body 66 and preventing the inlet check seal 38 from closing the main seal 34 . that is , during a siphoning condition , the inlet check seal 38 will not be able to fully flatten the main seal 34 . as a result , the deflected main seal 34 will be prevented from completely blocking the vents 22 . a path between the inlet check seal 38 and the internal surface of the inlet check valve 6 will allow air from the outside of the double check valve 2 to enter through the vents 22 to break the vacuum which allows the outlet check spring 104 to relax and engage the outlet check valve 10 on the seat 78 . this in turn will allow the inlet check body 66 to transition upwardly to engage the inlet check seal 38 onto the main seal 34 to isolate the inlet check valve 6 and the outlet check valve 10 from the valve cap 18 as shown in fig5 . referring now to fig8 , a back siphonage situation is shown . here , the hose ( not shown ) is interconnected to the valve body 14 and a vacuum has occurred at fluid supply that could cause contaminated fluid from the hose or double check valve 2 to enter the fluid supply . in operation , the hose forces the hose plunger 50 upwardly that compresses the drain spring 82 . the hub 116 of the hose plunger 50 also moves upwardly and forces , via the outlet check spring 104 , the outlet valve check body 86 to move upwardly so that outlet check seal 102 engages the seat 78 . the vacuum in the valve cap 18 pulls the inlet check seal upwardly to engage the main seal 34 . thus the outlet check valve 10 is isolated from the inlet check valve 6 and the inlet check valve 6 is isolated from the cap valve 18 which is interconnected to the fluid supply , and no fluid from the hose and / or the double check valve can enter the fluid supply . referring now to fig9 , draining of the double check valve 2 is illustrated . after the hose is removed , the drain spring 82 expands and forces the hose plunger 50 downwardly such that the lip 120 of the hose plunger 50 contacts the stop 124 of the valve body 14 . the hub 116 of the hose plunger 50 will also contact the protrusion 112 of the outlet check body 86 and pull the outlet valve body 86 downwardly , which removes the outlet check seal 102 from the outlet check seat 78 . the stop 98 of the outlet check body 86 will contact the hooked surface 70 of the inlet check body 66 and pull the inlet check seal 38 from the main seal 34 . thus , a free flow path from the inlet check valve 6 into the outlet check valve 10 and out of the hose plunger 50 is provided . water in the sill cock will also be able to flow through the valve cap 18 and through the inlet check valve 6 , the outlet check valve 10 and out of the hose plunger 50 . fluid may also drain through the plurality of vents provided . referring now to fig1 , the double check valve 2 is shown during a test . more specifically , it is one aspect of the present invention that the double check valve 2 of embodiments of the present invention can be easily tested in the field to ensure that it is in proper working condition . here , the hose ( not shown ) is interconnected to the threads 42 of the valve body 14 that forces the hose plunger 50 upwardly and compresses the drain spring 82 . the hub 116 is also forced upwardly which compresses the outlet check spring 104 and forces the outlet check seal 102 against seat 78 . if the double check valve 2 is working properly the outlet check valve 10 should be isolated from the vents 22 . fluid 134 is then added via the hose and into the outlet 26 of the double check valve 2 . if the integrity of the outlet check valve 102 and the seat 78 are adequate , no fluid will enter the inlet check valve 6 . conversely , if the integrity between the outlet check seal 102 and the seat 78 is broken , fluid 134 will fill the inlet check valve 6 , and will exit from the plurality of vents 22 . the inlet check spring 74 will force the inlet check body 66 upwardly to place the inlet check seal 38 in contact with the main seal 34 to prevent any fluid from entering the water source during this test . referring now to fig1 and 12 , valve caps 18 of alternate embodiments of the present invention are provided . here , the annular jut 62 , which interfaces with the main seal 34 and ring 136 , which interfaces with a groove 140 provided on the valve body 14 are substantially the same as those described above . however , the inlet portion 30 of the valve cap 18 includes a plurality of exterior threads 42 for threading onto sill cocks and have inwardly threads 42 . inspection of fig1 and 12 will show that the inlets 30 of these valve caps 18 are of different diameters , thereby succinctly illustrating the scalability of the present invention . one of skill in the art will appreciate that the valve described and shown herein may be interconnected to the sill cock via a bendable or telescoping member to provide the ability to selectively locate the valve . alternatively , or in addition , valves as described may possess telescoping functionality as shown in u . s . design pat . no . d491 , 253 to hansle . the valve may also employ a timer , flow regulation capabilities , etc . to control the flow of fluid therefrom . the valve may employ more than one outlet , which each may include valving as described , and may employ a combination of materials as described in tripp . further , the valve may be directly integrated into the sill cock instead of interconnected thereto . the system described herein may include a visual or audible alarm to notify the instance of a valve failure . while various embodiments of the present invention have been described in detail , it will be apparent that modifications and alterations of those embodiments are also intended to be encompassed by this description . however , it is to be expressly understood that such modifications and alterations are within the scope and spirit of the present invention , as set forth in the following claims . for example , aspects of inventions disclosed in u . s . pat . nos . 5 , 632 , 303 , 5 , 590 , 679 , 7 , 100 , 637 , 5 , 813 , 428 , and 20060196561 , all of which are incorporated herein by this reference , which generally concern back flow prevention , may be incorporated into embodiments of the present invention . aspects of inventions disclosed in u . s . pat . nos . 5 , 701 , 925 and 5 , 246 , 028 , all of which are incorporated herein by this reference , which generally concern sanitary hydrants , may be incorporated into embodiments of the present invention . aspects of inventions disclosed in u . s . pat . nos . 6 , 532 , 986 , 6 , 805 , 154 , 6 , 135 , 359 , 6 , 769 , 446 , 6 , 830 , 063 , re39235 , 6 , 206 , 039 , 6 , 883 , 534 , 6 , 857 , 442 and 6 , 142 , 172 , all of which are incorporated herein by this reference , which generally concern freeze - proof hydrants , may be incorporated into embodiments of the present invention . aspects of inventions disclosed in u . s . pat . nos . d521113 , d470915 , u . s . pat . nos . 7 , 234 , 732 , 7 , 059 , 937 , 6 , 679 , 473 , 6 , 431 , 204 , 7 , 111 , 875 , d482431 , u . s . pat . nos . 6 , 631 , 623 , 6 , 948 , 518 , 6 , 948 , 509 , 20070044840 , 20070044838 , 20070039649 , 20060254647 and 20060108804 , all of which are incorporated herein by this reference , which generally concern general hydrant technology , may be incorporated into embodiments of the present invention . | 4 |
referring now to fig1 of the drawing a bore hole 1 drilled in the soil by conventional means is irradiated by a laser beam 2 emitted horizontally by a source 3 . it is deflected from its course and directed towards the bore wall by means of a flat mirror 4 and a concave mirror 5 which is slowly rotated and at the same time angularly displaced about a spherical pivot 5 -- thereby gradually changing the direction of the beam so as to irradiate the entire wall of the bore along a helical path . in fig1 the helical path having started at the top of the bore , is seen to have reached a point a lower down . the soil surrounding the bore has been converted into a solid mass 10 down to point a , by the extreme heat produced by the laser beam which served to evaporate the water between the soil particles and to fuse the latter . obviously the irradiation may be started at any point of the bore and irradiation may be accomplished in repeated passes . fig1 also indicates that the outer contours of the converted soil portion are not smooth but irregular as a consequence of the varying resistance of the soil against penetration of the radiation . the mechanism for providing the motion of the concave mirror is of the kind utilized in moving telescopes and is , therefore , not specially shown . fig2 shows a more exact method of directing the beam towards the bore hole wall , at a right angle of incidence . herein a laser beam 2 emanates from a laser source 3 in a direction coaxial with the bore 1 and travels downwardly until it meets the surface of a mirror 7 which is positioned in the center of the bore while forming an angle of 45 ° with its axis . the mirror is attached by actuating and suspending means 9 , to a mechanism 8 ( both diagrammatically indicated ) which rests on the rim of the bore hole and is adapted to rotate the mirror and to propel it in a constant axial motion along the bore . the laser beam is deflected by the mirror 7 from a vertical to a horizontal direction 2 &# 39 ; and is made to strike the bore wall at a right angle . the movement of the mirror serves to rotate the horizontal beam 2 &# 39 ; and at the same time to change its distance from ground level , whereby it describes a helical path on the bore hole wall . it can be seen that in the case illustrated , the mirror started from the bottom upwards to a point a , the soil around the bore hole having been converted to a hard column 10 from its lower end to this point . the apparatus shown in fig3 is , in its underground portion , identical with that shown in fig2 . however , herein the laser beam emerges from a source 3 in a horizontal direction and is deflected into a vertical path coaxial with the bore by a flat , inclined mirror 4 and a concave mirror 5 placed above the bore concentric therewith . this mirror 5 also serves to concentrate the beam to a very small diameter so as to increase its local intensity . this arrangement is preferable to that illustrated in fig2 in that it permits the adjustment of the laser path by means of easily movable mirrors , while the previously described apparatus of fig2 requires the direct adjustment of the heavy laser source . the apparatus shown in fig4 uses a hollow laser beam 12 , which can be produced by an unstable optical resonator of known construction running coaxialy with the axis of the bore 1 . the hollow laser beam is deflected and directed towards the bore circumference at a variable height a by an optical system comprising a conical mirror 13 and an annular mirror 14 in the shape of an inverted , straight or curved , frustum , the resulting radiation 12 &# 39 ; is in the shape of a horizontal disc of small thickness . mechanical means 8 and 9 are provided for the purpose of moving the optical system in an upward or downward direction at a desired rate of progress ; the support 9 in this case may be , as illustrated , a cylindrical tubing . it is evident that this apparatus calls for a laser source of much higher power than in the previously described embodiments , but this is compensated for by the shorter time required for completing a column . after the formation of a group of underground columns or piles by one of the aforedescribed methods , a structure can be erected thereon in a conventional way . the bores in the columns may be filled , if desired , such as with concrete , or they may preferably be left open and unfilled , since the strength of the converted soil is sufficient to carry the load . the void actually lessens the weight of the column or pile compared with a steel or concrete pile of the same capacity , and this saved weight may be usefully employed by allowing a corresponding additional weight of the structure to be loaded on each individual pile or column . the optical and mechanical systems serving to direct a laser beam along and around the bore hole wall may be suitably modified , and any type of mirrors and lenses may be used in any combination in accordance with the state of the art . the wave length of the laser beam is preferably in the infra - red region in which mostly thermic energy is produced . suitable soil temperatures lie between 2000 ° and 3000 ° centigrade , but higher surface temperatures may be employed to obtain deeper penetration for the purpose of creating columns of greater thickness . the type of laser used , the energy of the beam , its velocity of travel along the bore wall and spacing between adjoining helix paths will be chosen in accordance with the properties of the soil , its water contents and the size and load - bearing capacity of the column to be formed ; these will be largely determined by simple , routine on - the - spot testing . however , in general a laser generator of 3 - 10 kw output is satisfactory for most situations , although higher outputs may be used for increased speed . the size of the bore is dependent on the mechanism to be inserted , and in this respect the method illustrated in fig1 permits a smaller bore than the other methods . it is further proposed to utilize a stationary laser source for the irradiation of a plurality of bore holes , by successively or simultaneously deflecting the path of the laser beam into the desired direction and location by means of movable and adjustable mirrors . in order to save energy , it may be advantageous to pump out or evaporate excessive moisture in the soil . evaporation may be accomplished by means of a gas or plasma flame , an electron beam , or other suitable means . such evaporation may not , however , itself result in fusing of the soil . it shall be understood that fusing of the soil using direct heating means cannot be used in place of the laser beam . any such attempt to use direct heat other than a laser , e . g . a flame , from inside the bore would at least result in the formation of a &# 34 ; skin &# 34 ; which would prevent or at least greatly impede the fusing of the soil behind the skin . only the laser beam is capable of simultaneously heating the entire depth of soil so that it fuses and consolidates to form the desired load - bearing foundation . on the other hand , suitable means to provide inductive or dielectric heating could be used . it will be obvious to those skilled in the art that various changes may be made without departing from the scope of the invention and the invention is not to be considered limited to what is shown in the drawings and described in the specification . | 4 |
in the production of a multilayered film according to the invention , first an ethylene vinyl alcohol film is applied onto a surface of a first polyethylene film and a second polyethylene film is applied onto another surface of the ethylene vinyl alcohol film . ethylene vinyl alcohol compounds are well known in the art and readily commercially available . copolymers of ethylene and vinyl alcohol suitable for use in the present invention can be prepared , for example , by the methods disclosed in u . s . pat . nos . 3 , 510 , 464 ; 3 , 560 , 461 ; 3 , 847 , 845 ; 3 , 595 , 740 and 3 , 585 , 177 . the ethylene vinyl alcohol copolymer can be a hydrolyzed ethylene vinyl acetate copolymer . the degree of hydrolysis can range from about 85 % to about 99 . 5 %. the ethylene vinyl alcohol copolymer preferably contains from about 15 to about 65 mol percent ethylene and more preferably about 25 to about 50 mol percent ethylene . copolymers of lower than 15 mol percent ethylene tend to be difficult to extrude while those above 65 mol percent ethylene have reduced oxygen barrier performance . the term “ ethylene / vinyl alcohol copolymer ” or “ evoh ” is intended to comprise also the hydrolyzed or saponified ethylene / vinyl acetate copolymers and refers to a vinyl alcohol copolymer having an ethylene comonomer , which may be obtained , for example , by the hydrolysis of an ethylene / vinyl acetate copolymer or by chemical reaction of ethylene monomers with vinyl alcohol . the first and second polyethylene films are preferably attached to the ethylene vinyl alcohol film by coextrusion , lamination , coating , sputtering or evaporation . of these coextrusion is the most preferred . non - limiting examples of suitable materials for the polyethylene films are low density polyethylene ( ldpe ), linear low density polyethylene ( lldpe ), linear medium density polyethylene ( lmdpe ), linear very - low density polyethylene ( vldpe ), linear ultra - low density polyethylene ( uldpe ), high density polyethylene ( hdpe ). of these , the most preferred is low density polyethylene . an antifog composition is applied onto another surface of the second polyethylene film , preferably by coextrusion or by coating . in an alternate embodiment of the invention , an antifog composition is incorporated into the second polyethylene film rather than attaching a separate antifog layer . non - limiting examples of antifog compositions are glycerol monoesters of a saturated or unsaturated fatty acid having from about 8 to about 20 carbon atoms , glycerol diesters of a saturated or unsaturated fatty acid having from about 8 to about 20 carbon atoms and ionic surfactants having phosphate , sulfate or quaternary amine functional end groups . also suitable as antifog compositions are surfactants including anionic , cationic , nonionic and amphoteric surfactants . suitable ionic surfactants have phosphate , sulfate or quaternary amine functional end groups . other antifog compositions include sorbitan esters of aliphatic carboxylic acids , glycerol esters of aliphatic carboxylic acids , esters of other polyhydric alcohols with aliphatic carboxylic acids , polyoxyethylene compounds , such as the polyoxyethylene sorbitan esters of aliphatic carboxylic acids and polyoxyethylene ethers of higher aliphatic alcohols . preferred antifog compositions are glycerol monooleate , glycerol monostearate and blends thereof . when the antifog composition is incorporated into the second polyethylene film , it is blended into the polyethylene film composition in an amount of from about 0 . 1 weight percent to about 5 weight percent . when the antifog composition is coated on the second polyethylene film it is preferably applied at a coating weight of from about 0 . 2 to about 0 . 6 g / m 2 . suitable antifog compositions are described , for example , in u . s . pat . no . 5 , 766 , 772 . a layer of a nylon film is attached to the second polyethylene film via an intermediate adhesive layer or tie layer . the adhesive layer may be applied either directly onto the nylon film or onto the first polyethylene layer by any appropriate means in the art , such as by coating . any suitable adhesive may be employed . such adhesives include polyurethanes , epoxies , polyesters , acrylics , anhydride modified polyolefin and blends thereof . modified polyolefin compositions have at least one functional moiety selected from the group consisting of unsaturated polycarboxylic acids and anhydrides thereof . such unsaturated carboxylic acid and anhydrides include maleic acid and anhydride , fumaric acid and anhydride , crotonic acid and anhydride , citraconic acid and anhydride , itaconic acid an anhydride and the like . the adhesive layer may also optionally comprise a colorant , an ultraviolet light absorber or both . the nylon film is preferably attached to the first polyethylene film by lamination . suitable nylons within the scope of the invention non - exclusively include homopolymers or copolymers selected from aliphatic polyamides and aliphatic / aromatic polyamides having a molecular weight of from about 25 10 , 000 to about 100 , 000 . general procedures useful for the preparation of polyamides are well known to the art . such include the reaction products of diacids with diamines . useful diacids for making polyamides include dicarboxylic acids which are represented by the general formula wherein z is representative of a divalent aliphatic radical containing at least 2 carbon atoms , such as adipic acid , sebacic acid , octadecanedioic acid , pimelic acid , suberic acid , azelaic acid , dodecanedioic acid , and glutaric acid . the dicarboxylic acids may be aliphatic acids , or aromatic acids such as isophthalic acid and terephthalic acid . suitable diamines for making polyamides include those having the formula wherein n has an integer value of 1 - 16 , and includes such compounds as trimethylenediamine , tetramethylenediamine , pentamethylenediamine , hexamethylenediamine , octamethylenediamine , decamethylenediamine , dodecamethylenediamine , hexadecamethylenediamine , aromatic diamines such as p - phenylenediamine , 4 , 4 ′- diaminodiphenyl ether , 4 , 4 ′- diaminodiphenyl sulphone , 4 , 4 ′- diaminodiphenylmethane , alkylated diamines such as 2 , 2 - dimethylpentamethylenediamine , 2 , 2 , 4 - trimethylhexamethylenediamine , and 2 , 4 , 4 - trimethylpentamethylenediamine , as well as cycloaliphatic diamines , such as diaminodicyclohexylmethane , and other compounds . other useful diamines include heptamethylenediamine , nonamethylenediamine , and the like . useful polyamide homopolymers include poly ( 4 - aminobutyric acid ) ( nylon 4 ), poly ( 6 - aminohexanoic acid ) ( nylon 6 , also known as poly ( caprolactam )), poly ( 7 - aminoheptanoic acid ) ( nylon 7 ), poly ( 8 - aminooctanoic acid )( nylon 8 ), poly ( 9 - aminononanoic acid ) ( nylon 9 ), poly ( 10 - aminodecanoic acid ) ( nylon 10 ), poly ( 11 - aminoundecanoic acid ) ( nylon 11 ), poly ( 12 - aminododecanoic acid ) ( nylon 12 ), nylon 4 , 6 , poly ( hexamethylene adipamide ) ( nylon 6 , 6 ), poly ( hexamethylene sebacamide ) ( nylon 6 , 10 ), poly ( heptamethylene pimelamide ) ( nylon 7 , 7 ), poly ( octamethylene suberamide ) ( nylon 8 , 8 ), poly ( hexamethylene azelamide ) ( nylon 6 , 9 ), poly ( nonamethylene azelamide ) ( nylon 9 , 9 ), poly ( decamethylene azelamide ) ( nylon 10 , 9 ), poly ( tetramethylenediamine - co - oxalic acid ) ( nylon 4 , 2 ), the polyamide of n - dodecanlanedioic acid and hexamethylenediamine ( nylon 6 , 12 ), the polyamide of dodecamethylenediamine and n - dodecanedioic acid ( nylon 12 , 12 ) and the like . useful aliphatic polyamide copolymers include caprolactam / hexamethylene adipamide copolymer ( nylon 6 , 6 / 6 ), hexamethylene adipamide / caprolactam copolymer ( nylon 6 / 6 , 6 ), trimethylene adipamide / hexamethylene azelaiamide copolymer ( nylon trimethyl 6 , 2 / 6 , 2 ), hexamethylene adipamide - hexamethylene - azelaiamide caprolactam copolymer ( nylon 6 , 6 / 6 , 9 / 6 ) and the like . also included are other nylons which are not particularly delineated here . of these polyamides , preferred polyamides include nylon 6 , nylon 6 , 6 , nylon 6 / 6 , 6as well as mixtures of the same . of these , nylon 6 / 6 , 6is most preferred . aliphatic polyamides used in the practice of this invention may be obtained from commercial sources or prepared in accordance with known preparatory techniques . for example , poly ( caprolactam ) can be obtained from honeywell international inc ., morristown , n . j . under the trademark capron ®. exemplary of aliphatic / aromatic polyamides include poly ( tetramethylenediamine - co - isophthalic acid ) ( nylon 4 , i ), polyhexamethylene isophthalamide ( nylon 6 , i ), hexamethylene adipamide / hexamethylene - isophthalamide ( nylon 6 , 6 / 6i ), hexamethylene adipamide / hexamethyleneterephthalamide ( nylon 6 , 6 / 6t ), poly ( 2 , 2 , 2 - trimethyl hexamethylene terephthalamide ), poly ( m - xylylene adipamide ) ( mxd6 ), poly ( p - xylylene adipamide ), poly ( hexamethylene terephthalamide ), poly ( dodecamethylene terephthalamide ), polyamide 6t / 6i , polyamide 6 / mxdt / i , polyamide mxdi , and the like . blends of two or more aliphatic / aromatic polyamides can also be used . aliphatic / aromatic polyamides can be prepared by known preparative techniques or can be obtained from commercial sources . other suitable polyamides are described in u . s . pat . nos . 4 , 826 , 955 and 5 , 541 , 267 , which are incorporated herein by reference . each of the first and second polyethylene films , nylon film , ethylene vinyl alcohol film , and adhesive layers may optionally also include one or more conventional additives whose uses are well known to those skilled in the art . the use of such additives may be desirable in enhancing the processing of the compositions as well as improving the products or articles formed therefrom . examples of such include : oxidative and thermal stabilizers , lubricants , release agents , flame - retarding agents , oxidation inhibitors , oxidation scavengers , dyes , pigments and other coloring agents , ultraviolet light absorbers and stabilizers , organic or inorganic fillers including particulate and fibrous fillers , reinforcing agents , nucleators , plasticizers , as well as other conventional additives known to the art . such may be used in amounts , for example , of up to about 10 % by weight of the overall composition . representative ultraviolet light stabilizers include various substituted resorcinols , salicylates , benzotriazole , benzophenones , and the like . suitable lubricants and release agents include stearic acid , stearyl alcohol , and stearamides . exemplary flame - retardants include organic halogenated compounds , including decabromodiphenyl ether and the like as well as inorganic compounds . suitable coloring agents including dyes and pigments include cadmium sulfide , cadmium selenide , titanium dioxide , phthalocyanines , ultramarine blue , nigrosine , carbon black and the like . representative oxidative and thermal stabilizers include the period table of element &# 39 ; s group i metal halides , such as sodium halides , potassium halides , lithium halides ; as well as cuprous halides ; and further , chlorides , bromides , iodides . also , hindered phenols , hydroquinones , aromatic amines as well as substituted members of those above mentioned groups and combinations thereof . exemplary plasticizers include lactams such as caprolactam and lauryl lactam , sulfonamides such as o , p - toluenesulfonamide and n - ethyl , n - butyl benylnesulfonamide , and combinations of any of the above , as well as other plasticizers known to the art . as mentioned above , the first and second polyethylene films are preferably attached to the ethylene vinyl alcohol film by coextrusion . for example , the polymeric material for the individual layers , are fed into infeed hoppers of a like number of extruders , each extruder handling the material for one or more of the layers . the melted and plasticated streams from the individual extruders are fed into a single manifold co - extrusion die . while in the die , the layers are juxtaposed and combined , then emerge from the die as a single multiple layer film of polymeric material . after exiting the die , the film is cast onto a first controlled temperature casting roll , passes around the first roll , and then onto a second controlled temperature roll , which is normally cooler than the first roll . the controlled temperature rolls largely control the rate of cooling of the film after it exits the die . additional rolls may be employed . in another method , the film forming apparatus may be one which is referred to in the art as a blown film apparatus and includes a multi - manifold circular die head for bubble blown film through which the plasticized film composition is forced and formed into a film bubble which may ultimately be collapsed and formed into a film . processes of coextrusion to form film and sheet laminates are generally known . typical coextrusion techniques are described in u . s . pat . nos . 5 , 139 , 878 and 4 , 677 , 017 . alternatively the individual layers may first be formed as separate layers and then laminated together under heat and pressure with or without intermediate adhesive layers . lamination techniques are well known in the art . typically , laminating is done by positioning the individual layers on one another under conditions of sufficient heat and pressure to cause the layers to combine into a unitary film . typically the polyethylene films , the ethylene vinyl alcohol film , the adhesive and nylon layers are positioned on one another , and the combination is passed through the nip of a pair of heated laminating rollers by techniques well known in the art . lamination heating may be done at temperatures ranging from about 120 ° c . to about 175 ° c ., preferably from about 150 ° c . to about 175 ° c ., at pressures ranging from about 5 psig ( 0 . 034 mpa ) to about 100 psig ( 0 . 69 mpa ), for from about 5 seconds to about 5 minutes , preferably from about 30 seconds to about 1 minute . preferably the nylon film is oriented prior to being attached to the first polyethylene film . for the purposes of the present invention the term draw ratio is an indication of the increase in the dimension in the direction of draw . preferably , in the present invention the film nylon film is drawn to a draw ratio of from 1 . 5 : 1 to 5 : 1 uniaxially in at least one direction , i . e . its longitudinal direction , its transverse direction or biaxially in each of its longitudinal and transverse directions . preferably , the film is simultaneously biaxially oriented , for example orienting a plasticized film in both the machine and transverse directions at the same . this results in dramatic improvements in clarity strength and toughness properties . preferably , the nylon film is biaxially oriented and is not heat set so that it is shrinkable both in its transverse and longitudinal directions . although each layer of the multilayer film structure may have a different thickness , the thickness of the nylon layer is from about 1 μm to about 25 μm , preferably from about 3 μm to about 8 μm , and more preferably from about 4 μm to about 6 μm . the thickness of the ethylene vinyl alcohol layer is from about 1 μm to about 25 μm , preferably from about 2 μm to about 8 μm and more preferably from about 3 μm to about 5 μm . the thickness of each of the first and second polyethylene films is from about 1 μm to about 50 μm , preferably from about 10 μm to about 30 μm , and more preferably from about 12 μm to about 25 μm . further , if a separate antifog layer is included , the thickness of that antifog layer is from about 1 μm to about 25 μm , preferably from about 2 μm to about 8 μm and more preferably from about 3 μm to about 5 μm . while such thicknesses are preferred , it is to be understood that other film thicknesses may be produced to satisfy a particular need and yet fall within the scope of the present invention . the oxygen transmission rate ( otr ) of the multilayered film of the invention may be determined via the procedure of astm d - 3985 . in the preferred embodiment , the multilayered film according to this invention has an otr of about 0 . 1 cc / 100 in 2 / day or less , preferably from about 0 . 085 cc / 100 in 2 / day or less and more preferably from about 0 . 07 cc / 100 in 2 / day or less at 65 % relative humidity at 20 ° c . the multilayered film of the invention is preferably heat shrinkable , generally by an amount of from about 2 % to about 30 %, more preferably from about 10 % to about 20 % in its length , or its width or each of its length and width . to provide a tightly adhering lid for a tray , for example , the film only need to exhibit shrinkage on the order of about 2 to about 3 %. however , in order to have the film also form ( unrestrained ) about the side of the tray , higher shrinkage in the film is desirable . the multilayered film may further have printed indicia between the first polyethylene film and its attached nylon film . since such printing is on an internal surface of the structure , it will not rub off when the surface is contacted . optionally , the multilayered film may be uniaxially or biaxially oriented in a manner and in an amount indicated above for the nylon film and is not heat set so that it is shrinkable both in its transverse and longitudinal directions . in this case the nylon film may or may not have been oriented already . the film preferably has a puncture resistance of at least about 1600 grams as measured by astm f 1306 . preferably the film has a haze of about 5 % or less as measured by astm d1003 . the multilayered film is useful for forming a food package including a container , such as a tray , having an open portion and the multilayered film sealing the open portion . such a structure is generally referred to a lidding film . the multilayered film is positioned such that the antifog composition is adjacent to the open portion , that is , facing the inside of the container . such containers are suitable for packaging a variety of raw meats such as beef , pork , poultry , and veal , among others . a packaged food may comprises the food package and a food product such as a meat in the food package . the container may have enclosed side walls , a floor and an top opening defining a central cavity wherein the open top optionally has a substantially flat peripheral rim . the multilayered film surrounds the container and is heat shrunk and heat sealed to it via the second polyethylene film such that the antifog composition is on the open portion ( facing inward ). the container may comprise a material such as cardboard , paperboard , boardstock , a plastic and combinations thereof . preferred plastics include any one of several thermosetting or thermoplastic resins any of which are capable of sealing to the lidding material . examples of materials include acrylonitrile , an acrylic polymer , polyethylene terephthalate ( pet ) or copolymers thereof , polyvinyl chloride , polycarbonate , polystyrene and polypropylene . in use the lidding film is positioned around the open portion and is caused to shrink , e . g . by the application of heat , a sufficient amount to seal the open portion of the container . the invention further contemplates additional layers being attached to the multilayered film either before or after attaching the nylon layer , for example , first polyethylene / adhesive / evoh / adhesive / second polyethylene ; or first polyethylene / adhesive / oxygen barrier / adhesive / second polyethylene . further , the nylon layer may be attached to the first polyethylene film by coextrusion , lamination , or coating by extrusion coating of the nylon with or without an intermediate adhesive . it is also within the scope of the invention that any shrinkable film may be substituted for the nylon layer . suitable shrinkable films other than nylons include polyesters , oriented polyolefins , and combinations thereof . additionally , other suitable oxygen barrier films or coatings other than ethylene vinyl alcohol include polyvinyl alcohol , polyvinylidene chloride and combinations thereof . it is also within the contemplation of the invention that the multilayered film comprises a nylon film attached to a surface of an oxygen barrier film , a polyethylene film attached to another surface of the oxygen barrier film via an adhesive layer , and an antifog composition on another surface of the polyethylene film or incorporated into the polyethylene film . as mentioned above , the oxygen barrier film may comprise a coating of ethylene vinyl alcohol , polyvinylidene chloride or combinations thereof . a film having the structure substrate a / adhesive / substrate b is produced wherein substrate a is a 60 gauge ( 0 . 60 mil ) shrinkable nylon 6 / 6 , 6 copolymer film having 20 to 25 % shrinkage in both directions . the adhesive is a polyurethane based adhesive for indirect food contact coated at a weight of 1 . 0 to 1 . 5 lb / ream . substrate b is a 5 layer coextrusion of antifog pe / tie / evoh / tie / pe , with evoh at 25 % of the total 1 mil film . the antifog additive is a glycerol monooleate ( gmo ). the antifog pe side of the coextrusion is the sealing side when the structure is heat sealed to a barrier tray . the total thickness of the film structure was 1 . 6 - 1 . 7 mils , and oxygen transmission rate was 0 . 008 cc o 2 / 100 in 2 / day at 10 ° c ., 80 % rh . a film having the structure substrate a / adhesive / substrate b is produced wherein substrate a and adhesive are as example 1 . substrate b is a coextrusion of 5 layers : antifog pe / tie / evoh / tie / antifog pe with evoh at 25 % of the total 1 mil film . the antifog additive is a glycerol monooleate ( gmo ). the total thickness of the film structure was 1 . 6 - 1 . 7 mils , and oxygen transmission rate was 0 . 008 cc o 2 / 100 in 2 / day at 10 ° c . , 80 % rh . a film having the structure substrate a / adhesive / substrate b / antifog coating c is produced wherein substrate a and adhesive are as example 1 . substrate b has 5 layers : pe / tie / evoh / tie / pe without any compound loading of the antifog . the antifog coating is a glycerol monostearate ( gms ) coated at a weight of 0 . 20 - 0 . 25 lb / ream . the total thickness of the film structure was 1 . 6 - 1 . 7 mils , and oxygen transmission rate was 0 . 008 cc o 2 / 100 in 2 / day at 10 ° c ., 80 % rh . the light transmission was 93 . 2 %, the haze level was 3 . 27 and the clarity was 95 . a film having the structure substrate a / evoh coating / adhesive / substrate b is produced wherein substrate a is as example 1 . an evoh coating is applied on the substrate a with a coating weight of 1 to 2 lb / ream to provide an oxygen barrier . the adhesive is polyurethane or epoxy to bond the evoh coating to the second substrate . substrate b is a 1 mil coextrusion of pe / tie / evoh / tie / antifog pe with the evoh layer below 18 % of the total thickness . the total thickness of the film structure was 1 . 6 - 1 . 7 mils . films from example 2 were used as lidding film to seal polyethylene trays with a meat patty inside . the heat seal conditions were 250 ° f . ( 121 ° c .) seal temperature and 350 ° f . ( 177 ° c .) knife temperature . the seal was good and there was no significant water condensation on the antifog coating . example 5 was repeated using films from example 4 with polystyrene trays having a polyethylene sealant web , as well as polypropylene trays . the heat seal conditions were 330 ° f . ( 166 ° c .) seal temperature and 350 ° f . ( 177 ° c .) knife temperature . the seal was good and there was no significant water condensation on the antifog coating . example 5 was repeated using films made from example 3 with polystyrene trays having a polyethylene sealing web . the heat seal conditions were 275 - 300 ° f . ( 135 - 149 ° c .) seal and 300 ° f . ( 149 ° c .) knife . there was no significant water condensation on the antifog coating after 72 hours . while the present invention has been particularly shown and described with reference to preferred embodiments , it will be readily appreciated by those of ordinary skill in the art that various changes and modifications may be made without departing from the spirit and scope of the invention . it is intended that the claims be interpreted to cover the disclosed embodiment , those alternatives which have been discussed above and all equivalents thereto . | 1 |
referring first to fig1 there is shown a standard swimming pool with standard skimmer apparatus for removal of debris and the like from the water surface . while the preferred embodiment herein will be described with respect to a swimming pool , it should be understood that the invention can be used in conjunction with any recreational or other device wherein a suction is involved , such as in spas , hot tubs and the like . there is shown the swimming pool 1 having water 3 therein having a water surface 5 . a prior art fitting 7 , shown in greater detail in fig2 is secured to a wall 9 of the pool 1 , the fitting being connected by a pipe 11 to filter apparatus 13 external of the pool wherein the water is filtered and / or otherwise treated . the filtered and / or otherwise treated water is then returned to the pool via pipe 15 . the fitting includes an open end 17 which is mounted in an aperture in the side wall 9 of the swimming pool . the fitting end walls defining the aperture 17 have disposed therearound first and second gaskets 19 and 21 and a face plate 23 . the face plate bears against the gaskets and is held secured against the fitting 7 by screws 25 and 27 which are secured in the fitting , pass through the face plate 23 and gaskets 19 and 21 and bear against the face plate . as can be seen , the face plate of the prior art as depicted in fig1 and 2 is of flat and annular construction . since a suction action will be present at the aperture 17 of the fitting 7 , and since the aperture 17 is usually positioned at or close to the surface of the water 5 as shown in fig1 debris at the water surface as well as surface water will be sucked into the aperture for operation thereon in the skimmer apparatus 13 as noted hereinabove . however , as is readily apparent , anything else that is in the vicinity of the aperture 17 will also have a suction action applied thereto and be carried toward the aperture . this action can cause a clogging of the opening to the aperture in the case of large objects which cannot fit therethrough , thereby causing potential damage to the skimmer apparatus and can cause harm to small children and the like who are unable to extricate themselves from the suction action and become entrapped against the aperture . this problem of the prior art is substantially minimized by use of the novel face plate 31 in accordance with the present invention as shown in fig3 . the face plate of fig3 is a direct replacement for the face plate of fig1 and 2 . the face plate includes a rectangular member 33 , preferably formed of a rigid , non - rusting material , such as plastic , and having a large central aperture 35 which is the same as the aperture in the face plate 23 . a plurality of holes 37 are disposed about the rectangular section to receive screws therethrough such as the screws 25 and 27 of fig2 . a plurality of ribs 39 are formed on each side of the rectangular member 33 . the ribs 39 are preferably integral with the rectangular member 33 , the rectangular member and ribs preferably being formed is a single unit . the ribs are preferably disposed on the rectangle in a direction toward the aperture 35 and are preferably normal to the major axis of the side of the rectangle on which they are disposed . it can be seen that , with the use of the face plate 31 of fig3 in place of the face plate 23 of fig1 and 2 , the movement of large objects against the face plate will not be capable of completely blocking the aperture 17 in the swimming pool side . this will permit water to continue to flow to the skimmer apparatus 13 and prevent potential damage thereto . in addition , due to the flow of water around the ribs at all times , small children and the like will be subjected to a decreased suction against the ribs 39 as opposed to the face plate 23 , thereby having an improved opportunity to extricate themselves from the suction action of the skimmer apparatus . it can be seen that there has been provided an improved face plate for use in conjunction with a skimmer apparatus which is simple and can operate as a direct replacement for the prior art face plate without necessity for alteration of the prior art system . though the invention has been described with respect to a specific preferred embodiment thereof , many variations and modifications will immediately become apparent to those skilled in the art . it is therefore the intention that the appended claims be interpreted as broadly as possible in view of the prior art to include all such variations and modifications . | 4 |
fig1 is a partial perspective top view of the separator of this invention . projecting from the upper planar surface 12 of separator 10 are a plurality of ribs 14a through 14j . the ribs 14 are disposed in narrow lanes in the longitudinal direction of the separator 10 , substantially parallel to longitudinal edges 16 and 18 thereof . fig2 is a partial edge view in cross - section of separator 10 taken along line 2 -- 2 of fig1 . rib 14 projects above upper planar surface 12 of backweb 20 of separator 10 . projecting below lower planar surface 13 of backweb 20 is a rib 15 . ribs 14 and 15 are identical in width and lie in the same vertical plane . a partial edge view in cross - section of ribs 14 and 15 is illustrated in fig3 . as can be seen , rib 14 is a corrugated structure comprised of alternating ridges and furrows 22a and 23a , 22b and 23b , 22c and 23c , 22d and 23d , etc ., respectively . likewise , rib 15 is a corrugated structure comprised of alternating ridges and furrows 24a and 25a , 24b and 25b , 24c and 25c , 24d and 25d , etc ., respectively . a ridge on one planar surface forms the furrow on the other planar surface , and vice versa . for example , the underside of ridge 22a of rib 14 forms the furrow 25a of rib 15 . fig4 is an enlarged , partial top view of a rib 14 . as can be seen , ridges 22 and furrows 23 of rib 14 are perpendicular to the longitudinal side walls 26 and 28 of rib 14 and thus also perpendicular to the longitudinally disposed side edges 16 and 18 of separator 10 . the length dimension of the ridges 22 and 24 , i . e ., the length of the ridges 22 and 24 from one side wall 26 to the other side wall 28 of rib 14 , is selected in accordance with the desired width of the narrow lanes constituting the ribs . this dimension will generally be between about 0 . 020 and about 0 . 060 inch . the frequency of the ridges , i . e ., the number of ridges per unit of rib length , will preferably be between about 5 and about 25 ridges per inch . the height of the ridges 22 and 24 above the respective planar surfaces 12 and 13 of the backweb 20 is selected in accordance with the desired height of the ribs . this dimension will generally be between about 0 . 01 to about 0 . 10 inch . the distance between adjacent ribs will generally be between about 0 . 25 to about 1 . 0 inch . the width of the separator of this invention can be any width used by battery manufacturers ; generally this width will range between about 2 to about 12 inches . the thickness of backweb 20 of the separator 10 will typically range between about 0 . 002 to about 0 . 025 inch . the cross - section of the corrugated structure forming the rib of this invention is illustrated in fig1 - 4 as being triangular , with each individual embossed projection thus being wedge shaped . each wedge shaped embossment is comprised of a sloping leading wall 17 , a sloping trailing wall 19 and vertical side walls 26 and 28 . however , other similar wedge shapes may be use , including but not limited to a rounded wedge shape where the ridge is slightly rounded instead of angular , or a flattened wedge shape where the ridge is either formed flat during embossing or the ridge flattened by subsequent pressing . one of the advantages obtained in using the separator of the present invention is that , since the ribs are a corrugated structure formed of adjacent ridges and furrows , the separator provides a substantially barrier free environment for flow of electrolyte and any gases released during charging and discharging since the ribs contact the plates only in the ridge area . prior art ribs ( see , for example , fig7 ), being sold , are in contact with the positive plate in the entire upper surface area of the rib which imposes a barrier to electrolyte and / or gas flow . a further advantage obtained in using the separator of the present invention is in reducing or eliminating rib bending and / or flattening . in assembling a battery the number of alternating enveloped ( with separator material ) and unenveloped plates required to form a cell are stacked together , compressed and inserted into a cell compartment of a battery case . the compressive forces to which the separators are subjected can cause undesirable rib bending and / or flattening with conventional rib construction , especially at higher &# 34 ; overall &# 34 ; dimensions , i . e ., rib heights . the rib configuration of the present invention reduces or eliminates such rib bending and / or flattening . although the separator of the invention is illustrated as having ribs 14 and 15 extending from both planar surfaces 12 and 13 of the backweb 20 , the invention is intended to include a separator where the ribs are formed on only one side . similarly , although the ribs 14 and 15 are illustrated as having the same height above planar surfaces 12 and 13 , respectively , of backweb 20 , the height of the ribs on one side may be greater or lesser than the height of the ribs on the other side . in addition , adjacent ridges of a rib may vary in height . fig5 and 6 illustrate an apparatus suitable for making the separators of this invention . fig5 is a front view of two embossing rolls 30 and 32 having a plurality of embossing wheels 31a - 31g and 33a - 33g , respectively , located thereon . each of embossing wheels 31a - 31g on embossing roll 30 are aligned with embossing wheels 33a - 33g , respectively , on embossing roll 32 . each of the embossing wheels 31 and 33 are , essentially , gear wheels with a plurality of gear teeth 32 and 33 , respectively , projecting therefrom , as best seen in fig6 . the phrase &# 34 ; embossing wheels &# 34 ; is intended to include both separate gear wheels located on an embossing roll or axle ( such as by press fitting ) or an embossing roll having multiple rows of teeth machined therein . embossing rolls 30 and / or 32 are rotated by suitable drive means , not shown . it is preferred to have only one of embossing rolls 30 or 32 driven by external drive means with the other roll being rotated by the driven embossing roll . the gear teeth 32 and 34 of aligned embossing wheels 31 and 33 intermesh and emboss ribs 14 and 15 into flat separator material 20 when it is passed through the nip between rotating embossing rolls 30 and 32 in the direction indicated by the arrow in fig6 . where the height of the ribs extending from both planar faces are the same , the teeth 32 and 34 are equal in height . where the height of the ribs one side is different than the height of the ribs on the other side , the height of gear teeth 32 and 34 are , correspondingly , different in height . where it is desired to have ribs extending from only one surface of the separator , one of embossing wheels 31 or 33 may be a &# 34 ; male &# 34 ; roll having gear teeth as illustrated with the other embossing wheel being a &# 34 ; female &# 34 ; roll having grooves therein with dimensions corresponding to the dimensions of the gear teeth extending from the male roll . where it is desired to have a rib where adjacent ridges have different heights above the adjacent planar surface of the separator backweb this may be achieved by using as the first embossing roll a male with gear teeth of varying height and as the second embossing roll a smooth roll formed of rubber or other deformable material . the formation of the ribs of the present invention involves plastic deformation of the backweb material in the plurality of narrow lanes where the embossing takes place . permanent deformation indicates that the material was loaded beyond its yield point which , by definition , means that it has experienced plastic flow . it has been shown that oxidation resistance is improved in the area of plastic deformation due to oil being driven to the surface upon collapse of micropores . fig7 is a perspective view of a prior art separator 40 having a plurality of ribs 42 extending from the upper planar face 44 of backweb 46 . ribs 42 are integral with backweb 46 and are formed during the calendering of extrudate , as described above in the discussion of the background material . in the preferred mode of practicing the present invention the web upon which ribs are formed is flat on both sides and constitutes the backweb 20 of the finished separator 10 . however , it is intended to include within the definition of &# 34 ; flat &# 34 ; or &# 34 ; substantially flat &# 34 ; ( as used herein ) a web having some minor ribs formed therein during the calendering phase of its manufacture . although the invention has been described relative to forming ribs in a microporous polyethylene separator , as this is the principal type of separator material currently used by flooded cell type lead acid battery manufacturers , any separator material which is porous , acid resistant and capable of being permanently embossed may be used . these materials may be generally characterized as filled or unfilled films and nonwoven webs of thermoplastic or thermoset polymers . suitable thermoplastic polymers include polymers and copolymers of ethylene , propylene , butylene , vinyl chloride and styrene . suitable thermoset compositions include phenolics , ethylene / propylene / diene , isoprene , butadiene , styrene and similar thermosetting polymers . the ribs have been illustrated in the preferred embodiment disclosed herein as having ridges and furrows that are perpendicularly aligned with the longitudinal dimension of the separator . however , the alignment of the ridges and furrows may be such as to form an angle to the longitudinal dimension of the separator , such angle being less than 180 degrees , and preferably less than about 160 degrees , to the longitudinal dimension , but greater than 0 degrees and preferably greater than about 20 degrees . in addition , the alignment of the ridges and furrows of some ribs to the longitudinal dimension of the separator may vary from the alignment of the ridges and furrows of other ribs . fig8 illustrates a separator 100 in which the ribs 114 have embossments in adjacent ribs 114a , 114b and 114c whose ridges 122 and 124 , and corresponding furrows , are alternatingly angled with respect to each other . fig9 illustrates a separator 200 in which the ridges of rib 214 form a chevron pattern made up of ridge elements 222 and 224 . fig1 illustrates a separator 300 in which the ridges of rib 314 form a tractor tread pattern made up of ridge elements 322 and 324 . fig1 illustrates a separator 400 in which the ridges of rib 414 form a continuous sinusoidal ( zig - zag ) pattern made up of ridge elements 422 and 424 . the continuous sinusoidal pattern of the ridges could be rounded (&# 34 ; s &# 34 ; shaped ) instead of sharp as illustrated in fig1 . a primary advantage of the present invention is that it allows battery separator manufacturers to continuously produce a substantially flat sheet of microporous material without interrupting the manufacturing process to change engraved calender rolls . such flat sheet would then be supplied to the battery manufacturer in rolls of appropriate width and the battery manufacturer would apply the ribs in accordance with this invention . it is contemplated that such ribs would be applied just prior to the plate enveloping operation . | 7 |
a caster unit assembly is generally indicated at 10 . four caster units 110 are illustrated in fig1 while a single caster unit is shown in fig2 and 3 . all of the caster units are identical . the caster units each consist of a housing 12 having a support plate 14 attached thereto . the support plate 14 includes bolt holes for receiving fasteners wherein the caster unit may be mounted as desired . in the drawings , the caster units 10 are illustrated in a manner wherein the caster wheels are located above the housing 12 whereby a plurality of caster units can be used to support a large workpiece , table , or the like , which is to be moved upon the casters . of course , the caster units 10 can be mounted in a more conventional manner , 180 ° from the orientation shown in the drawings , wherein the caster wheel is located below the housing 12 . regardless of the mounting of the caster units to accommodate the particular caster application , the constant pressure imposed upon the caster wheel occurs . each housing 12 has a column 16 welded thereto as will be appreciated from fig2 and the upper end of the column 16 includes a pivot shaft 18 for a purpose later described . interiorly , the housing 12 includes a cylindrical chamber 20 communicating with a threaded port 22 . a cylindrical piston 24 is reciprocally received within the chamber 20 and is sealed at 26 . it will be appreciated that the chamber 20 and the piston 24 constitute a typical simple expansible chamber motor . a pivot shaft 28 is located at the outer end of the piston 24 as will be appreciated from fig2 and 3 . a pair of levers 30 are mounted in a spaced parallel relationship and support the rotatable caster wheel 32 at the levers &# 39 ; outer end upon the caster axle 34 . the other end of the levers 30 are pivotally connected to the column 16 by pivot shaft 18 , fig2 and elongated slots 36 , fig2 are defined in the central region of the levers 30 for receiving the piston pivot shaft 28 . accordingly , it will be appreciated that as the piston 24 reciprocates within the chamber 20 , the piston shaft 28 acting upon the levers 30 through elongated slots 36 will raise and lower the caster wheel 32 relative to the support plate 14 . the elongated configuration of the slots 36 will prevent binding as the levers 30 are operated by the piston . the caster units 10 are pressurized by a fluid medium , usually hydraulic oil , by a pressure unit 37 , fig1 and 4 . the pressure unit 37 is mounted upon support columns 38 , and will normally be located in relatively close proximity to the caster units 10 pressurized thereby . the columns 38 support plates 40 by a plurality of bolts 42 threaded into the upper ends of the columns 38 . a cylindrical tube 44 is mounted upon the plates 40 having an open upper end , and a cylindrical chamber 46 . a port 48 is located in the lower region of the tube 44 in communication therewith . a cylindrical piston 49 is reciprocally received within the chamber 46 , fig4 and the piston includes an enlarged piston head 50 located above plates 40 . a tubular spring jacket 52 is mounted upon the upper plate 40 and includes a cover 54 . centrally , the cover 54 is provided with a threaded hole through which the threaded screw 56 extends . screw 56 includes hexagonal upper end 50 for application of a wrench thereto in order to rotate the screw 56 , and a lock nut 60 threaded upon screw 56 will lock the screw in its desired axial position . the lower of the end screw 56 includes a spring pad 62 , fig4 whereby the compression spring 64 housed within the spring jacket 52 will be located between the piston head 50 and the spring pad 62 . the extent of compression of spring 64 is determined by the axial position of screw 56 within jacket cover 54 . the further the screw extends through the jacket cover , the greater the force imposed by the spring 64 on the piston 49 . with reference to fig1 each of the caster units 10 includes a supply conduit 66 which is attached to the port 22 of each caster unit chamber 20 . each of the supply conduits 66 communicates with the manifold conduit 68 , and the pressure unit 73 communicates with the manifold conduit 68 through conduit 70 which is in communication with port 48 . accordingly , it will be appreciated that the pressure imposed upon the fluid within pressure unit chamber 46 will simultaneously be imposed upon all of the caster unit pistons 24 , and hence , the caster wheel levers 30 . from the above description , it will be appreciated that the fluid pressure within the chambers 20 of the caster units 10 will the same in each caster unit as determined by the pressure of the fluid within the pressure unit chamber 46 . in this manner , a constant force is imposed on all of the caster unit pistons 24 , and hence , the caster wheels 32 . the interconnection of all of the caster units 10 by the conduit system assures constant supporting forces on each of the caster assemblies of the caster array , and regardless of whether the caster units 10 are oriented in the position shown in the drawings , reversed , or used in any other orientation , equal forces are created in each of the casters . of course , it will be appreciated that a pumping movement of the piston 49 will simultaneously increase or decrease the pressure within the caster units 10 , and by utilizing various known means for positioning the piston 49 , such as by a hydraulic pump , manually operated lever arm , or the like , the caster wheels 32 may be used to simultaneously “ jack up ” a load , or lower the same . it will be appreciated that various modifications to the inventive concepts may be apparent to those skilled in the art without departing from the spirit and scope of the invention . | 8 |
referring now to fig1 , a closed - system commercial oven 10 suitable for providing steam and convection air cooking provides a housing 12 defining a cooking volume 14 open toward a front of the housing 12 . the cooking volume 14 is accessible through a door 16 connected by a hinge at one vertical side of the cooking volume 14 to sealingly close that cooking volume 14 during cooking operations . a latch assembly ( not shown ) may hold the door 16 in the sealed position or may be released to allow the door 16 to open . positioned within the housing 12 and communicating with the cooking volume 14 is a forced convection fan 18 providing a stream of air into the cooking volume 14 and across a heater element 20 ( shown schematically ) providing heat for cooking items , in the cooking volume 14 and for vaporizing steam . the heater element may be an electric heating element or a heat exchanger receiving heat from a gas flame or the like . the steam may be produced by a valve - controlled water jet 19 typically impinging on the fan 18 and a portion of the heater element 20 proximate to the fan 18 . ovens of this type are commercially available from the alto - shaam inc . of menomonee falls , wis . and are described generally in u . s . pat . no . 6 , 188 , 045 “ combination oven with three stage water atomizer ” hereby incorporated by reference . a controller board 21 within the housing 12 may provide an electronic computer or microcontroller receiving instructions from a control panel 23 accessible on the front of the oven 10 , and having , for example , membrane switches that may be activated by user . as will be discussed in greater detail below , the controller board 21 generally provides an electronic computer executing a stored program to control the heater element 20 , fan 18 , and the waterjet 19 , turning them on and off as necessary to implement a particular cooking schedule . the cooking volume 14 may further provide for a removable drip pan 22 being a metal tray fitting adjacent to the bottom of the cooking volume 14 and having a drainage aperture 24 through which collected grease and oil from cooked product within the cooking volume 14 may pass . referring now to fig2 , the drip pan 22 is positioned with respect to a bottom wall 26 of the cooking volume 14 so that the drainage aperture 24 is located directly above a drainpipe 28 , the latter being a short tube extending vertically downwardly from the bottom wall 26 to a condenser chamber 30 positioned beneath the bottom wall 26 . the drainpipe 28 allows grease and oil 33 passing through the drainage aperture 24 to enter the condenser chamber 30 under the influence of gravity . in an alternative embodiment ( not shown ) the drainpipe 28 may extend horizontally for a short distance before or after it is received within the condenser chamber 30 . referring now also to fig3 , the condenser chamber 30 provides a generally enclosed box having a bottom wall 32 sloping downwardly from an end closest to the drainpipe 28 to an opposite end adjacent to an , exit port 34 . upstanding sidewalls 36 around the periphery of the bottom wall 32 retain , a pool of water having a water level 46 and accumulated grease within the condenser chamber 30 as will be described . these upstanding sidewalls 36 are joined at their upper edges to a generally horizontal upper wall 38 adjacent to a bottom of the cooking volume 14 and having an opening for receiving the drainpipe 28 therethrough . the lower end of the drainpipe 28 passing into the condenser chamber 30 stops above the bottom wall 32 and above a water level 46 . the volume of the condenser chamber 30 is divided into a reservoir area 40 directly beneath the drainpipe 28 and a non - reservoir area 42 being the remaining area outside of the reservoir area within the condenser chamber 30 . the reservoir area 40 may be defined by upstanding reservoir walls 44 joining with the sidewalls 36 to define an upwardly open container closed on all sides and positioned beneath the drainpipe 28 . the reservoir walls extend upward from the bottom wall 26 to a position above a water level 46 but below the upper wall 38 so as to provide a path of steam 48 from the drainpipe 28 past the reservoir walls 44 to the exit port 34 . the exit port 34 generally connects to the sanitary sewer line but with some venting arrangement which allows the escape of gases . for example , the exit port 34 may discharge onto a floor drain or the like . as noted , it is desirable that excess grease not be introduced into the sanitary sewer such as may create clogging problems . generally grease 33 will drop through the drainpipe 28 to be retained by the reservoir area 40 whereas steam 48 will not be so constrained but will pass into the non - reservoir area 42 . the non - reservoir area 42 will be filled with cool water 52 and controlled in height to the water level 46 . a baffle plate 54 may extend downward from the upper wall 38 through the water level 46 to beneath the level of the water 52 but above the bottom wall 32 . the baffle plate 54 thereby forces heated air and steam 48 passing from the drainpipe 28 to the exit port 34 to pass through the cool water 52 thus condensing the steam and cooling the associated air 56 exiting the exit port 34 as indicated by an arrow . the water 52 is maintained at a cool temperature by a freshwater inlet valve 57 adding makeup water 55 through an opening in the upper wall 38 . the freshwater inlet valve 57 is under the control of the controller board 21 which may also communicate with a temperature gauge 62 so that additional water is added through valve 57 only when the temperature of the existing water 52 rises above a certain amount . as water is admitted through valve 57 excess water 52 drains out through the exit port 34 as indicated by arrow , the lower edge of which provides an overflow lip 47 defining the water level 46 . the reservoir area 40 communicates through a grease discharge opening 64 passing through a sidewall 36 to discharge accumulated grease 33 and pass it to a suction pump 68 . for this purpose the grease discharge opening 64 in this embodiment may be positioned near the bottom wall 32 . the suction pump 68 may pump the grease through a conduit 70 of arbitrary length to a collection vessel 72 , for example , removed from the oven 10 for convenient access . the removal path may be substantially horizontal allowing grease to be readily collected from an oven 10 placed closely adjacent to a floor that would otherwise preclude the placement of a grease collection bucket at a point lower than the drainpipe 28 . the suction pump 68 may also communicate with the controller board 21 to be controlled thereby . steam passing through the drainpipe 28 may also pass into a steam collection port 74 that may recirculate back to the oven cavity . the steam collection port 74 may hold a temperature sensor 76 communicating with the controller board 21 which may be used to provide steam temperature information useful for control of the oven 10 . referring now to fig3 and 4 , the controller board 21 may execute a stored program 58 held in a memory 61 using a processor 60 communicating with memory 61 . the program 58 may selectively operate the pump 68 both on a periodic basis during the cooking of foods that express grease and only in cooking modes associated with foods that express grease in order to conserve energy . the program 58 implements this functionality by communicating with a cooking program also executed by the controller board 21 and the control panel 23 . the cooking program generally includes and implements pre - stored schedules of cooking times and temperatures for different foods . the cooking program may also allow manual setting of temperatures and times . as indicated by process block 78 , a pump cycle in which pump 68 is turned on for a brief period of time may be initiated by indication of a particular cooking mode captured by the cooking program through cooking mode buttons 80 on control panel 23 , such as may indicate , for example , a desired cooking schedule for cooking of chicken . in this regard , a particular button 80 may be labeled with indicia indicating roasted chicken , for example . alternatively , a pump cycle may be initiated by pressing of a special grease purge button 82 indicating a desire to manually operate the suction pump 68 . upon either such indication , the program 58 determines whether the temperature of the oven is sufficiently high for the generation of grease ( and its mobility ) as indicated by decision block 84 . if not the program loops at this point . if the temperature is sufficient , the program 58 checks to see whether the pump 68 has been operated recently according to a stored time value indicating its last operation per decision block 86 . the amount of time elapsed since the last operation of the pump 68 is compared to empirically developed data indicating approximate rate of filling of the reservoir area 40 as informed by the cooking mode of process block 78 . if the suction pump 68 has been operated within this interval , the program 58 may loop at decision block 86 until this time has elapsed . if the time elapsed since the last running of the suction pump 68 exceeds the stored filling rate interval of the reservoir area 40 , the program 58 proceeds to process block 88 and the pump is run for a fixed period of time sufficient to fully empty the reservoir area 40 . in this way , the pump 68 does not need to operate continuously and power is conserved . for example , the pump 68 may be activated first when the temperature of the oven is within five degrees of a set temperature on intervals of 20 minutes for a pumping duration of 60 seconds . referring to fig4 and 2 , the time delay between pump cycles implemented by decision block 86 provides a temperature acclamation of the discharge grease to more moderate temperatures . this temperature moderation of the grease 33 reservoir area 40 may occur through conduction , for example , through reservoir walls 44 and bottom wall 32 and allows the grease 33 to cool sufficiently to be readily handled and yet not so cool much as to prevent easy pumping by the suction pump 68 . referring now to fig5 and 6 , in an alternative embodiment , the reservoir walls 44 separating the reservoir area 40 from the non - reservoir area 42 may also implement the function of the baffle plate 54 . this is done by positioning the reservoir walls 44 to extend downward from the upper wall 38 below the water level 46 but above the bottom wall 32 . this embodiment segregates the grease 33 by exploiting the fact that the grease 33 will have lower density than the water 52 and thus will float on its surface and can be blocked by a reservoir wall 44 that does not extend fully to the bottom wall 32 of the condensation chamber 30 . in this embodiment , the grease discharge opening 64 may be positioned approximately at the water level 46 . this embodiment provides more intimate contact between the grease 33 and the water to provide improved cooling and eliminates an element of the chamber 30 . certain terminology is used herein for purposes of reference only , and thus is not intended to be limiting . for example , terms such as “ upper ”, “ lower ”, “ above ”, “ below ”, “ clockwise ”, and “ counterclockwise ” refer to directions in the drawings to which reference is made . terms such as “ front ”, “ back ”, “ rear ”, “ bottom ” and “ side ”, describe the orientation of portions of the component within a consistent but arbitrary frame of reference which is made clear by reference to the text and the associated drawings describing the component under discussion . such terminology may include the words specifically mentioned above , derivatives thereof , and words of similar import . similarly , the terms “ first ”, “ second ” and other such numerical terms referring to structures do not imply a sequence or order unless clearly indicated by the context . when introducing elements or features of the present disclosure and the exemplary embodiments , the articles “ a ”, “ an ”, “ the ” and “ said ” are intended to mean that there are one or more of such elements or features . the terms “ comprising ”, “ including ” and “ having ” are intended to be inclusive and mean that there may be additional elements or features other than those specifically noted . it is further to be understood that the method steps , processes , and operations described herein are not to be construed as necessarily requiring their performance in the particular order discussed or illustrated , unless specifically identified as an order of performance . it is also to be understood that additional or alternative steps may be employed . references to a controller , computer or processor or its equivalent can be understood to include one or more computational devices including microprocessors , field programmable gate arrays , and application specific integrated circuits that can implement state aware logic and that can communicate in a stand - alone and / or a distributed environment ( s ), and can thus be configured to communicate via wired or wireless communications with other processors , where such one or more processor can be configured to operate on one or more processor - controlled devices that can be similar or different devices . furthermore , references to memory , unless otherwise specified , can include one or more processor - readable and accessible memory elements and / or components that can be internal to the processor - controlled device , external to the processor - controlled device , and can be accessed via a wired or wireless network . | 1 |
referring to fig3 , an overview of the tensioner 350 of the present invention is shown installed on and in operative engagement with a conventional closed loop power transmission system of an internal combustion engine . the engine configuration represented consists of a drive sprocket 305 engaged with the drive shaft of the engine ( not shown ) and two cam sprockets 310 and 310 ′, each engaged with their respective cam shafts ( also not shown ). the cam sprockets 310 and 310 ′ are driven by power provided by through the cam sprocket 305 supplied from a drive transmission device 307 , which can be either a belt or chain . teeth in the drive transmission device 307 securely engage teeth on the outer circumferences of each of the sprockets 305 , 310 and 310 ′. for purposes of this description , the drive transmission device will be referred to as a chain 307 . engaged with each strand of chain 307 is a left tensioning arm 320 and a right tensioning arm 330 . left tensioning arm 320 has an upper region 322 and a lower region 321 . right tensioning arm 330 has an upper region 332 and a lower region 331 . in this embodiment , the lower regions 321 and 331 of it respective tensioning arm , 320 and 330 , is connected to the engine housing by a single pivotal mount 303 . however , other embodiments may include separate pivotal mounts for each of the tensioning arms . the pivoting action permitted by the pivotal mount 303 allows each tensioning arm to move in response to changes in tension in each strand of chain 307 . the tensioner 350 provides a substantially uniform and consistent balanced force between the two strands of chain 307 . tensioner 350 consists of a substantially planar upper tensioner yoke 355 pivotally connected to a mounting pin 352 . the mounting pin 352 is securely affixed to the engine housing by conventional means , such as with threads or through force fitting ( not shown ). the tensioner 350 is connected to each tensioning arm by linkages . linkage 356 is connected to the upper region 323 of the first tensioning arm 320 between a first yoke pin 357 and a first upper tensioning arm pin 323 . both the first yoke pin 357 and the first upper tensioning arm pin 323 permit the unimpeded movement of linkage 356 . linkage 358 is connected to the upper region 332 of the second tensioning arm 330 between a second yoke pin 359 and a second upper tensioning arm pin 333 . as with the first linkage 356 , the second yoke pin 359 and the second upper tensioner arm pin 333 permit the unimpeded movement of linkage 358 . fig4 is an isometric view of the tensioner not connected to the tensioning arms 320 and 330 . linkages 356 and 358 are shown as consisting of reinforcing arms 356 a and 356 b , and 358 a and 358 b , respectively . reinforcing arms 356 a and 356 b pivot about first yoke pin 357 . correspondingly , reinforcing arms 358 a and 358 b pivot about second yoke pin 359 . the configuration shown for linkages 356 and 358 may be varied depending on differing design parameters , such as strength requirements and weight restrictions . in this view , a corresponding substantially planar lower tensioner yoke 365 is shown along with the upper tensioner yoke 355 . a torsion spring 370 is shown in the center of the tensioner 350 and positioned between the upper tensioner yoke 355 and the lower tensioner yoke 365 . fig5 provides a cross sectional view of the tensioner 350 . surrounding the mounting pin 352 is a center bushing 380 , having an upper annular flange 382 and a lower annular flange 384 . a belleville spring 390 surrounds the center bushing 380 . the belleville spring 390 is separated from the upper tensioner yoke 355 by upper spring bushing 392 and from the lower tensioner yoke 365 by lower spring bushing 394 . the tensioner 350 functions as a torque biased two way damper once it is bolted to the engine . the tensioner mounting pin 352 clamps the center bushing stack , that is , the center bushing 380 , the belleville spring 390 , the upper spring bushing 392 and the lower spring bushing 394 . tightening the mounting pin 352 into the engine block ( not shown ) not only compresses the torsion spring 370 to a specified operating gap but the compression between both the upper tensioner yoke 355 and the upper annular flange 382 and the lower tensioner yoke 165 and the lower annular flange 384 generate a drag coefficient that provides a resistance to the pivotal motion of the tensioner 350 . the magnitude of the drag coefficient is determined by the belleville spring working length from the gap set by the center bushing 380 and the upper and lower spring bushings 392 and 394 , respectively . the biased torque to tighten the tensioner is supplied by the size of the torsion spring 370 relative to the space provided between the upper tensioner yoke 355 , the lower tensioner yoke 365 and the first and second yoke pins 357 and 359 , respectively . one leg of the torsion spring 370 abuts one of the yoke pins while the other leg is grounded to the engine block ( not shown ). the most important advantage of the present tensioner design is to reduce the severity of the oscillations in the relative timing between the cam ( s ) shaft ( s ) and the crank shaft . the present tensioner 350 achieves this desirable objective , as evidenced by the graphs shown in fig6 - 8 . fig6 shows the relative phase angle , in degrees , as a function of engine speed on a 2 . 3 l production mazda engine . the production tensioner was used . the engine test was performed at an ambient temperature of 183 ° f . and the engine speed was ramped up from @ 850 rpm to @ 7000 in @ 60 seconds with the engine in the wide open throttle position ( wot ). what is evident are the severe oscillations in the phase angle over the range of − 0 . 05 to over + 5 . 5 degrees . fig7 shows the results of the same test , under the same conditions , except that a 1 - way bearing clutch was used . the temperature was 180 ° f . the clutch was set to slip at between 1 nm and 2 nm of torque . approximately a 350 n spring was used . it is apparent that this tensioner reduced the oscillations seen in the production tensioner and reduced the overall range of variation in the phase angle only between − 0 . 5 and + 2 . 0 degrees . fig8 represents the tensioner claimed herein . the slip torque was set at between 1 nm and 2 nm , as with the 1 - way bearing clutch exemplified in fig7 . the temperature was also 180 ° f . all other conditions and components remained the same . the graph shows not only that the oscillations have been minimized ( as with the one way clutch ), but the phase angle range varied very little up to about 4000 rpm ( from @ 0 to @ 1 . 75 degrees ) and that the phase angle variation was limited to between @ 0 . 2 and @ 1 . 5 degrees at 7000 rpm . it is apparent that the two way tensioner 350 of the instant tensioner design not only minimizes variations in the relative phase timing between the cam ( s ) and the crank , but it also positively influences the degree of the oscillations in timing error . these advantages not only improve engine performance but functions to reduce wear on various engine components , thus increasing engine life . accordingly , it is to be understood that the embodiments of the invention herein described are merely illustrative of the application of the principles of the invention . reference herein to details of the illustrated embodiments is not intended to limit the scope of the claims , which themselves recite those features regarded as essential to the invention . | 5 |
the following chart summarizes the physical characteristics of seven coarse kaolin crudes , including crudes that meet the criteria and will make products of the invention as well as those that fail to meet the criteria or make products of the invention . crudes 1 , 4 , 5 , 6 and 7 are kaolins sampled from various kaolin deposits in central georgia , usa , and crudes 2 and 3 are kaolin crudes from the amazon region of brazil . crudes 1 , 2 and 3 satisfy all of the criteria of required physical characteristics for use in the methods according to the invention ; products of the invention have been made from crudes 2 and 3 . in this chart , the viscosity characteristics are proxied by fluidity which denotes maximum solids achieved at optimum dispersion with a brookfield value of 300 cps . all values reported are for de - gritted , minus 325 mesh crudes with the exception of the structural order characteristics , which are measured on whole crude . ______________________________________crude 1 2 3 4 5 6 7______________________________________fluidity 77 . 9 76 . 6 73 . 6 68 . 7 67 . 4 62 . 5 64 . 1 ( solids @ 300 cps ) surface area ( bet , n . sub . 2 ) sa ( m . sup . 2 / g ) 9 . 3 8 . 5 10 . 8 11 . 9 16 . 4 14 . 6 13 . 2particle sizedistribution5 μm (% finer ) 73 . 3 76 . 0 72 . 0 75 . 5 76 . 9 78 . 9 60 . 92 μm (% finer ) 54 . 2 55 . 0 51 . 0 54 . 2 56 . 9 61 . 2 43 . 21 μm (% finer ) 39 . 5 40 . 4 32 . 0 42 . 4 43 . 6 48 . 5 31 . 80 . 5 μm (% finer ) 16 . 6 23 . 3 10 . 5 25 . 3 28 . 1 31 . 7 20 . 70 . 2 μm (% finer ) 1 . 4 10 . 3 0 . 0 6 . 3 8 . 4 11 . 1 7 . 0 ## str1 ## 3 . 26 2 . 36 4 . 86 2 . 14 2 . 0 1 . 9 2 . 1structural orderhinckley index 1 . 07 1 . 06 1 . 05 . 62 . 68 . 55fwhm &# 34 ; 001 &# 34 ; . 25 . 25 . 22 . 29 . 25 . 30cation exchangecapacity ( micro - equivalents / m . sup . 2 ) ph 4 . 03 . 06 . 80 1 . 00 . 09______________________________________ a typical prior commercial delaminated pigment from a georgia producer will have the following characteristics : some commercially available kaolin pigments marketed as delaminated pigments will exhibit better viscosity than is indicated above . these pigments may have dyne - endpoint high shear viscosity at 68 % solids . however , these particular pigments will be finer than the products of the invention and the above typical delaminated pigment , as measured by a higher surface area and the higher weight percentage of kaolin particles finer than the 0 . 5 micrometers and 0 . 2 micrometers control points while the presence of fine kaolin particles improves the high shear viscosity of delaminated kaolin pigments , the presence of fines concomitantly reduces the scattering efficiency and opacification of the pigments , as quantified by a reduction in the black glass scatter coefficients of the &# 34 ; good &# 34 ; viscosity pigment below those values for products of the invention . for example , the &# 34 ; best &# 34 ; viscosity , commercially available delaminated pigment tested had the following characteristics : median particle size 0 . 50 micrometers ## equ4 ## surface area 16 . 9 m 2 / g viscosity hercules viscosity , measured at 1100 rpm ( a bob ) and 68 % solids : 15 . 9 dyne brookfield viscosity , measured at 20 rpm (# 2 spindle ) and 68 % solids : 290 cp while the good high shear viscosity characteristics of this commercially available pigment , marketed as a delaminated pigment , will be perceived as advantageous , the comparatively low black glass scatter coefficients will be perceived by the papermakers as a reduction in paper and print quality , particularly in lightweight papers . products of the invention possessing the characteristics set forth in the accompanying claims have been made by various techniques , all involving the step of mechanically delaminating kaolin crudes or fractions of crudes , e . g . from the rio capim river basin , para state , brazil . the rio capim kaolins are contained within an extensive sedimentary formation containing coarse and fine sands , clays and silts . the near - surface clay bearing members have been preserved from erosion in plateau tops . the clay members appear to be stratigraphically flat - lying , with high brightness kaolin horizons occurring underneath variously superficial laterites , sands , and discolored kaolins not suitable for processing . underneath this waste material , typically there is an horizon of high brightness , low sand content kaolin which is an acceptable source material for products of the invention . in the northern portions of the rio capim kaolin district , in the vicinity of igarape cipoteua , the crudes can be described as coarse , with the - 325 mesh [ u . s . sieve ] fraction typically having a cumulative particle size distribution of : ______________________________________weight percent finer than range average______________________________________2 . 0 micrometers 72 - 39 % 58 % 1 . 0 micrometers 55 - 25 % 40 % 0 . 5 micrometers 34 - 8 % 20 % 0 . 2 micrometers 13 - 1 % 6 % ______________________________________ further to the south , in the vicinity of igarape cupijo , the - 325 mesh fraction of the crude kaolin is typically finer , averaging 75 % finer than two micrometers and 60 % finer than one micrometer . those skilled in the art know that the use of sedimentation to determine particle size of the thin platelets of mechanically delaminated kaolins results in values that do not truly reflect the size of thin flat plates . inspection of micrographs ( sem ) of the degritted - 325 mesh crudes used in the practice of this invention indicate that , numerically , most of the discrete kaolin particles consist of crystals having 1 to 2 micrometers face diameter and less than 0 . 5 micrometers edge thickness . those skilled in the art refer to particles of this size and crystal form as platelets . typically the platelets in a suitable crude will have at least one well - formed straight edge , and occasional crystals will have six well - formed edges in a pseudohexagonal crystal habit . the coarseness of kaolin particle population is imparted by the kaolin crystals referred by those skilled to in the art as books and large plates . books are stacks of kaolinite layers . in well - formed crystals the perfect , regular basal cleavage of kaolinite with straight edges at 60 degree angles are readily apparent . typically the books in crudes used in practice of the invention can be described as roughly equant , on the order of 15 micrometers by 15 micrometers in size . occasionally , books will develop the vermiform habit wherein the dimension perpendicular to the basal cleavage will be upwards of 40 micrometers in length , often curving at one end of the crystal . another crystal habit is known as the plate wherein the face diameter is 10 to 15 micrometers and the thickness ( the direction perpendicular to the basal cleavage ) is on the order of 0 . 5 micrometers . plates typically will have less well - formed edges than books . in the rio capim , the degritted kaolin crudes from the &# 34 ; coarser &# 34 ; northern portion of the area appear to have a greater proportion of books and plates relative to platelets than in the &# 34 ; finer &# 34 ; southern area . typically the crude is initially crushed and then blunged in water , preferably containing a clay dispersant , such as , for example , a mixture of soda ash and sodium silicate , or a condensed phosphate salt , e . g ., tetrasodium pyrophosphate or sodium polyacrylate . generally , solids of the blunged clay are in the range of 30 % to 65 %, usually about 40 % by weight . the blunged clay is then degritted by known means such as the use of screens or gravity settling to remove oversize ( grit ). suitable for this purpose are 200 or 325 mesh , u . s . standard ( 0 . 074 and 0 . 044 mm ) screens . in an embodiment of the invention , the degritted slip of kaolin is then separated into one or more coarse and fine size fractions , the finer fraction being , for example , 70 to 90 % by weight finer than 2 micrometers . continuous centrifuges such as those equipped with nozzle bowls or scrolls can be used or gravity settling can be employed for fractionation . excellent results were obtained with the crude used in an illustrative example by operating the centrifuge to remove and then isolate a fine size fraction of which about 90 % by weight of the particles were finer than 2 micrometers and a coarse fraction which was about 25 % by weight finer than 2 micrometers . the coarse size fraction remaining after centrifugation to separate the fines is employed as delaminator feed optionally along with a portion of the fines separated during centrifugation and / or a portion of degritted feed . when a fine fraction is separated in the first classification step , the population of particles of the delaminator feed contains of a higher proportion of large kaolin books and plates than occurs in the population of kaolin particles in the kaolin slip prior to classification . fines and / or feed are included in delaminated feed primarily to control the particle size distribution of the mechanically delaminated product . see example 2 . in another embodiment of the invention , the degritted slip is subjected to delamination without an intervening particle size classification . this operation is referred to as &# 34 ; whole fraction delamination &# 34 ;. see example 1 and example 3 . it is preferred in this invention to terminate the delamination when delamination is essentially complete and attrition of finer than 5 micron platelets begins to occur . the onset of undesired attrition may be controlled by determining the increase in the particle size fraction finer than a particular e . s . d . ( e . g ., 5 . 0 and 2 . 0 micrometers ). duration and intensity of delamination varies , depending on the source of crude , the blend of coarse and fine particle fractions in the delaminator feed , and the desired particle size distribution of the product . the process of delaminating the clay can be practiced using fine milling media in a batch operation but is advantageously carried out in a continuous manner . nonlimiting examples of milling media are small ceramic balls , coarse sand , plastic cylinders , beads , or pellets of nylon , styrene - divinyl benzene copolymer , polyethylene or other plastic . the medium acts upon a suspension of the clay in water . most preferably , the milling medium is minus 20 plus 50 mesh ( us sieve ) styrene divinyl benzene copolymer beads . generally the volume of beads to clay slurry varies between 20 - 70 %, most preferably between 35 % and 50 %. the clay feed to the process should typically be controlled between 20 % to 50 % solids ; however , optimum processing conditions are often achieved between 35 and 45 % solids . a suitable vessel used for the process contains vertical baffles and typically has a height to diameter ratio greater than 1 . 0 and optimally 1 . 5 to 2 . 0 . such a vessel is equipped with an agitation system containing multiple agitator elements attached to a vertical shaft . the number and spacing of the agitators must be optimized for the specific process conditions in order to impart the necessary combined shear and percussive and frictional energy input necessary to overcome the van der waals forces holding individual platelets in a stacked array . energy input required for delamination will vary due to differences between crudes , process conditions , and equipment ; typically requiring 10 to 50 horsepower - hour per ton of clay charged to the delaminators . in continuous delamination , the clay is fed continuously into a delaminating apparatus and the discharge from the apparatus is advantageously combined with a fractionation of the clay , returning the coarser clay to the apparatus while removing only the finer clay of the desired particle size . the selective takeoff of finer clay , while returning the coarser clay to the vessel in which the delamination is taking place , has the advantage that the overall process yield can be improved and plates greater than 5 micrometers face diameter can be fractured to meet the desired particle size attributes . in this manner , the clay remaining in the apparatus during the continued operation is made up mainly of the coarser clay particles which are undergoing delamination and which are continuously freed from finer clay particles by the selective draw - off and fractionation and return of coarser clay particles . in this continuous withdrawal of clay suspension , separation of finer clay and return of coarser clay to the apparatus is also advantageously continuous , and can be accomplished by subjecting the withdrawn clay to a centrifugal separation with return of the coarser clay to the apparatus , or by the use of one or more cyclone separators which will separate the finer clay fraction and return the coarser clay to the apparatus . the slip of delaminated clay is then optionally centrifuged to remove oversize , e . g . particles larger than 2 micrometers , as an underflow and the overflow product is then passed through a high intensity magnetic separator , followed by bleaching , filtration and drying to produce product of the invention . the centrifuged underflow containing oversize may be blended with appropriate levels of delaminated and / or undelaminated clay to achieve blends of desired particle size distribution and further processed in a conventional manner , e . g . magnetic purification and / or bleaching , to produce other advantageous kaolin products . the fine particle size fraction separated from the coarser kaolin in the first classification step ( prior to delamination ) may be processed in a conventional manner , e . g ., magnetic purification and / or bleaching , to produce no . 1 or no . 2 grade coating clays . as mentioned , it is within the scope of the invention to delaminate the degritted slip without first fractionating the slip . it is also within the scope of the invention to delaminate with grinding media other than plastic beads , e . g ., by sand , zircon or glass beads or by the delamination process known as &# 34 ; superstrusion &# 34 ;. delaminated kaolin pigments of the invention can be advantageously used as the single pigment in coating color formulations used to coat paper and paper board . however , it is also within the scope of the invention to employ pigments of the invention in blends with other kaolin and non - kaolin pigments , and to use the blends to coat paper and paperboard . such blends may be produced prior to the preparation of coating color formulations or produced concomitant with the preparation of coating color formulations . delaminated pigments are particularly advantageous when used as the single pigment to coat ground wood - containing lightweight paper . a typical ground wood containing lightweight paper basestock , suitable for coating , may have the following characteristics : in preparing coating color formulations , coating pigments are admixed in a conventional manner with other constituents and binders , materials that bind the coating pigments to the paper basestock surface . coating color formulations will vary from mill to mill for the same end - use application , and will differ on the basis of the surface characteristics required by different printing methods commonly used . for example : ______________________________________typical light weight coated paper - coating formulationsoffset paper rotogravure paper______________________________________europe100 pts pigment 100 pts pigment10 pts dow 685 4 . 8 pts acronal . sup . r 5485 pts pg280 0 . 5 pts nopcote . sup . r c - 1040 . 5 pts nopcote . sup . r c - 1040 . 5 pts sunrez . sup . r 700cunited states100 pts pigment 100 pts pigment8 pts pg280 7 pts pg2808 pts cp640 a 4 pts cp620 a0 . 5 pts nopcote . sup . r c - 104 5 pts nopcote . sup . r c - 1040 . 5 pts sunrez . sup . r 700c______________________________________ pts = parts all particle sizes used in the specification and claims are determined with the sedigraph 5100 particle size analyzer and are reported as equivalent spherical diameters ( e . s . d .) on a weight percentage basis . light scattering and gloss were determined by coating the kaolin clay suspensions at 60 % solids onto black glass plates at a coat weight of 7 . 0 - 14 . 0 g / m 2 ( expressed as dry clay ). the reflectance of the coatings , after drying in air , is measured at wavelengths 457 nm and 577 nm by means of an elrepho reflectometer . the 457 nm wavelength corresponds to the wavelength used in the tappi brightness measurement and the 577 nm wavelength to that used to measure opacity . the reflectance values are converted by the use of kubelka - munk equations to light scattering values ( m 2 / kg ). the light scattering values are a measure of the opacity potential of the clay . the higher values indicate that light , rather than passing through , is reflected and scattered back . the higher the light scattering value , the higher the opacity potential of the clay . the black glass gloss value is a measure of specular gloss at 75 degrees ( 15 degrees from the plane of the paper ), and is widely used as a particle measure of surface quality and shiny appearance ( which is conventionally equated with high quality ). in many applications , high gloss values are desirable . in preparing slurries for measurement of high shear ( hercules ) and low shear ( brookfield ) viscosity , engelhard corporation procedure pl - 1 was used . brookfield viscosity was measured using tappi procedure t648 om - 88 at 20 rpm using the # 1 or # 2 spindle ; in some cases brookfield viscosity was measured at 100 rpm using the # 3 spindle . all slurries were formulated with optimum amount of dispersant , following the pl - 3 procedure of engelhard corporation . descriptions of pl - 1 , pl - 3 and hercules viscosity measurement procedures appear in u . s . pat . no . 4 , 738 , 726 . in the examples which follow , references are made to pigment brightness , which was determined in the conventional manner ( tappi standard t452 m - 58 ) using a g . e . brightness meter . in examples 1 & amp ; 2 which follow , the kaolin clay crudes were obtained from deposits of the northern portion of the rio capim river basin of para , brazil . in example 3 , the kaolin crudes were a bulk sample obtained from deposits approximately 75 kilometers due north of manaus , amazonas , brazil . this example demonstrates the embodiment of the invention in which a degritted slip of kaolin is subjected to mechanical delamination without first fractionating the slip ( whole fraction delamination ). the kaolin slip used as feed in the process was a sample of capim kaolin , described above . the slip was prepared by blunging kaolin crude ( ph 4 . 4 ) in water containing sodium polyacrylate ( c211 brand ) and soda ash as a dispersant , resulting in a slurry having a ph of 8 . 2 the slip was degritted in two stages , the first involving allowing the slip to remain quiescent ( settle ) for 5 minutes and then passing the nonsettled portion through a 200 mesh screen . the degritted slip at about 39 % solids contained about 86 % of the starting crude . particle size of the recovered kaolin was 54 % finer than 2 micrometers . brightness was 81 . 3 %; tio 2 and fe 2 o 3 were 1 . 08 % and 0 . 71 %, respectively . delamination was carried out in a pilot plant delamination simulator which consists of a stainless steel vessel nominally 10 &# 34 ; id by 15 &# 34 ; high . within the vessel are three vertical baffles approximately 1 / 2 &# 34 ; wide extending the length of the vessel . the agitation system utilizes three ceramic cones mounted in a turban array where two or more cones can be mounted on the vertical shaft . the power for the vessel is provided by a 3 / 4 hp drill press with variable speed control . in this vessel , approximately 2 . 5 gallons of clay slip are delaminated per batch utilizing the necessary bead volume ratio of styrene divinyl benzene copolymer to achieve optimum results . in this example , bead volume was 50 % and residence time of the slip in the delaminator was 55 minutes . bead size was minus 20 plus 50 mesh ( us sieve ), and shape was spherical . particle size of the delaminated product was about 70 % finer than 2 micrometers . brightness was 81 . 9 %. tio 2 and fe 2 o 3 analyses were 1 . 08 and 0 . 72 %, respectively , indicating that kaolin was not brightened during delamination . solids of the delaminator discharge was 19 . 2 %. in one case the delaminator discharge was then charged to brightness enhancing equipment , described below , resulting in a finished product a with 70 % of the kaolin particles finer than 2 micrometers . in another case , the delaminator discharge was charged to a sharples centrifuge which divided the slip into product b , a fine fraction of 80 % finer than two micrometers ( 77 . 3 % yield and 19 . 2 % solids ), and a coarse reject fraction . for both products a and b , the delaminated kaolin was then charged to a conventional high intensity magnetic separator using various throughput rates in order to remove colored paramagnetic impurities and thereby improve brightness . prior to magnetic treatment the brightness of the feed kaolin was 82 . 3 %; tio 2 and fe 2 o 3 were 1 . 13 and 0 . 70 %, respectively . the pilot plant high insensity magnetic separator is fitted with a 1 &# 34 ; id × 20 &# 34 ; high canister containing approximately 100 pads of 430 stainless steel . space velocity calculations are utilized to simulate equivalent processing conditions for commercial scale hims units . typically , commercial scale units have canisters of 84 or 120 inch diameter × 20 inch high matrix . an important consideration in plant scale - up is the performance of a process under varying capacities . thus , in order to simulate future scale - up requirements space velocities are varied typically to simulate production capacities of 20 to 40 tons per hour utilizing an 84 &# 34 ; hims unit . at throughput rates between 20 and 40 tons per hour , products having brightness in the range of 87 . 7 to 88 . 4 % were produced . those skilled in the art will recognize that the 5 - 6 points increase in brightness as a result of magnetic separation treatment was unusually high ; typical georgia kaolins experience an increase in brightness of only 1 to 3 points by treatment in conventional high intensity separators . brightness of all magnetically purified products was further significantly increased by floccing the slip of magnetically purified kaolin with 6 #/ t aluminum sulfate ( 4 . 7 ph ), treatment with a conventional sodium dithionite bleach reagent , followed by filtration and viscosity measurement . brightness results for runs at various magnet throughput rates and bleach levels are reported below in table form for the 80 % finer than two micrometer product . ( the 70 % finer than two micrometers product responded similarly ) ______________________________________brightness of delaminated beneficiated kaolin productsbleach magnetic through - put tons / hour )#/ t 0 t / hr 20 t / hr 30 t / hr 40 t / hr______________________________________ 0 82 . 3 88 . 4 87 . 8 87 . 8 7 84 . 2 89 . 6 89 . 4 88 . 810 85 . 0 89 . 6 89 . 4 89 . 113 84 . 7 89 . 6 89 . 5 89 . 2______________________________________ the characteristics of the two products a and b of this example : ______________________________________ a b______________________________________particle size % finer than 10 micrometers 98 100 % finer than 5 micrometers 92 98 % finer than 2 micrometers 72 80 % finer than 1 micrometers 52 60 % finer than 0 . 5 micrometers 28 32 % finer than 0 . 2 micrometers 7 6median particle size . 94 . 77 ## str2 ## 2 . 57 2 . 50surface area m . sup . 2 / g 10 . 6 11 . 5viscositysolids % 67 . 0 67 . 0brookfield # 2 @ 20 rpm 97 cp 76 cp @ 100 rpm 77 cp 71 cphercules @ 1100 rpm 5 dynes 5 . 2 dynes______________________________________ products of the invention , a and b , and two commercially available high aspect ratio delaminated kaolin products c and d , made from georgia , usa and cornwall , united kingdom kaolin crudes , respectively , were admixed in a conventional manner with binders , commonly used in europe for rotogravure paper in the following formulation : the admixtures , commonly referred to as coating colors , were tested for viscosity in a conventional manner : ______________________________________ product a b c d______________________________________solids (%) 59 . 4 59 . 2 59 . 2 55 . 6ph 9 . 5 9 . 6 9 . 5 9 . 8brookfield ( cps ) 20 rpm 2070 2140 3510 7220100 rpm 672 678 1064 2176spindle # 4 # 4 # 4 # 54400 h . e . p . &# 34 ; e &# 34 ; 20 . 4 22 . 4 25 . 0 19 . 6______________________________________ note that commercially available product d has substantially worse rheology as it is measurable in this formulation at 3 . 5 % lower solids than products of the invention a and b and commercially available product c . at the same solids level , products of the invention a and b have superior viscosity to commercially available product c . the coating color was then applied to a european base sheet suitable for rotogravure printing applications . the following coated sheet and print properties were measured : ______________________________________european lwc rotogravurecoated sheet properties product a b c d______________________________________brightness (%) 74 . 0 74 . 2 73 . 6 73 . 6opacity (%) 86 . 3 86 . 5 85 . 8 85 . 5gloss (%) 49 54 48 43heliotest ( mm )@ 25 kg / f 22 25 19 18 @ 30 kg / f 48 67 52 42pps 1 . 19 1 . 10 1 . 28 1 . 27______________________________________ properties shown at 5 . 5 lb / 3300 ft . sup . 2 calendar conditions : 1 nip at 2000 psig and 140 ° f . in each of these measures of desirable coated sheet optical properties and printability , the products of the invention a and b are equivalent to or superior to the commercially available products c and d . samples of product a , b , c , d as described above were admixed with binders typically used in european lwc formulations ; ______________________________________coating formulation______________________________________pigment 100dow 685 10pg 280 5nopcote c - 104 0 . 5sunrez 700c 0 . 5______________________________________ viscosity measurements of the four coating colors were then taken in a conventional manner with the following result : ______________________________________european lwc offsetcoating color properties product a b c d______________________________________solids (%) 58 . 1 58 . 1 58 . 0 58 . 3ph 8 . 5 8 . 5 8 . 5 8 . 5brookfield ( cp ) 20 rpm 840 940 1490 2100100 rpm 320 330 534 760spindle # 4 # 4 # 4 # 44400 h . e . p . &# 34 ; e &# 34 ; 15 . 0 15 . 2 24 . 8 26 . 0______________________________________ the coating color formulations a , b , c , d were applied to a european base sheet suitable for light weight coated offset applications . coated sheet and print properties were measured in conventional manner with the following results : ______________________________________european lwc offsetcoated sheet properties product a b c d______________________________________brightness (%) 71 . 4 71 . 7 70 . 9 70 . 9opacity (%) 81 . 6 81 . 6 80 . 7 80 . 6gloss (%) 55 59 56 49print gloss (%) 79 81 79 79o . d . = 1 . 6print through 79 79 79 79resistance (%) o . d . = 1 . 6igt pick ( vvp ) 35 33 32 33k & amp ; n (%) 21 22 20 18pps 1 . 13 1 . 06 1 . 08 1 . 16______________________________________ properties shown are at 5 . 5 lb / 3300 ft . sup . 2 calendar conditions : 4 nips , 2000 psig . 140 ° f . thus , in a european lwc offset application , products of the invention a and b demonstrated better coating color high and low shear viscosities than commercially available products c and d , and have equivalent to slightly superior optical and printability characteristics . this example illustrates the production of a mechanically delaminated clay product of the invention from a coarse particle size fraction of crude and a by - product no . 1 grade product . the crude was blunged in water at 40 % solids , resulting in a ph of 4 . 4 . to facilitate subsequent processing the slurry was dispersed by adding soda ash ( 2 pounds per ton ) and n r brand sodium silicate solution ( 4 pounds per ton ), resulting in a ph of 8 . 4 . the dispersed slurry was degritted by allowing it to settle for 5 minutes and then passing the nonsedimented portion through a 200 mesh screen ( u . s . standard ) to remove grit . the size of the kaolin in the minus 200 mesh ( degritted ) slip was 54 % by weight finer than 2 micrometers . brightness was 82 . 6 %. chemical analysis was 0 . 90 weight % tio 2 and 0 . 58 % fe 2 o 3 . the degritted slip at 32 . 7 % solids was then divided in a sharples centrifuge into a fine fraction ( 93 % finer than 2 micrometers at 20 ., 6 % solids ) and a coarse fraction ( 22 % finer than 2 micrometers ). to the coarse centrifuge underflow fraction ( 22 % finer than 2 micrometers ) there was added a portion of the fines ( 93 % finer then 2 micrometers ) and a portion of degritted feed ( 54 % finer than 2 micrometers ) to produce a delaminator charge have a desired particle size of about 51 % minus 2 micrometers . the blend of clays charged to the delaminator had a brightness of 82 . 8 % and analyzed 0 . 90 % tio 2 and 0 . 63 % fe 2 o 3 . the resulting blend of dispersed clays at 42 . 6 % solids was then subjected to mechanical delamination in a pilot plant delamination simulator , described in the previous example , in a batch operation for 11 / 2 hours using minus 20 plus 50 mesh spherical styrene - divinyl benzene co - polymer beads ; bead volume was 35 % during delamination . particle size distribution of the delaminated product was 62 % by weight finer than 2 micrometers ; tio 2 and fe 2 o 3 contents were 0 . 86 % and 0 . 64 %. brightness was 83 . 5 %. the slurry discharged from the delaminator , which had a distinctly pink appearance , was then separated in a sharples centrifuge , recovering a delaminated fractionated product having no . 2 coating clay particle size specification ( 81 % finer than 2 micrometers ) and 84 . 1 % brightness . tio 2 was 1 . 24 %; fe 2 o 3 was 0 . 61 %. the delaminated product was then purified in a high intensity magnetic separator with a 430 stainless steel wool matrix . as a consequence of magnetic separation , the distinctly pink color disappeared . portions of the mechanically delaminated , magnetically purified clay were then bleached with various amounts of sodium dithionite . optimum bleach dosage was 12 pounds per ton , resulting in a bleached , delaminated product having a brightness of 90 . 2 %. tio 2 content was 0 . 78 %; fe 2 o 3 was 0 . 56 %. the 93 % finer than 2 micrometer fraction of undelaminated clay from the initial sharples classification ( prior to delamination ) was also magnetically purified , bleached and spray dried to recover a no . 1coating clay . the delaminated product made in the above described procedure had the following characteristics : median particle size : 0 . 88 micrometers ## equ5 ## surface area : 9 . 4 m 2 / g slurry viscosity it is within the scope of the invention to utilize feed to the delaminator which consists of coarse centrifuge underflow fraction ( about 20 % finer than 2 micrometers ) and a portion of degritted feed ( about 55 % finer than two micrometers ) to produce a delaminator charge of a desired particle size of about 35 % minus 2 micrometers . the resulting blend of dispersed clays is then subjected to mechanical delamination under the conditions and in the manner described above . the delaminator discharge has a particle size distribution of about 60 % finer than two micrometers . the slurry discharge is then charged to a sharples centrifuge , recovering a delaminated fractionated product stream with a particle size of about 80 % finer than 2 micrometers , which is then purified as described above . the characteristics of the delaminated , fractionated product conform to the specifications of the products of the invention . this embodiment of the invention is not limited to the specific particle size variations set forth above . delaminated product from the above described procedure was admixed with binders and other constituents in the formulation described below to make paper coating colors which were tested for coating color viscosity and then applied in a conventional manner to appropriate commercially available european and american lightweight paper base stock . ______________________________________coating color formulationsamerican american europeanlwc offset lwc roto lwc roto______________________________________pigment 100 pigment 100 pigment 100pg 280 8 pg 280 7 resyn 5 6833cp 640a 8 cp 620a 4 finnfix 1 . 5 5sunrez 0 . 5 nopcote 0 . 5 nopcote 0 . 5700c c - 104 c - 104nopcote 0 . 5c - 104______________________________________ pigment c -- commercially available mechanically delaminated pigment made from georgia , usa kaolins . pigment d -- commercially available naturally delaminated pigment made from kaolins mined in cornwall , united kingdom . coating color viscosity and coated sheet properties were measured as follows : ______________________________________ product a product c______________________________________solids (%) 57 . 1 57 . 0ph 8 8brookfield ( cp ) 20 rpm 2640 2800100 rpm 900 9784400 h . e . p . ` e ` 18 . 2 23 . 6______________________________________ ______________________________________coated sheet properties ( american lwc roto ) product a product c______________________________________gloss (%) 55 49brightness (%) 74 . 2 73 . 4opacity (%) 85 . 2 84 . 6heliotest ( mm ) 84 69______________________________________ properties shown are at 5 . 5 lb / 3300 ft . sup . 2 calendar conditions : 3 nips , 2000 psig , 140 ° f . similarly , coating color viscosity and coated sheet properties for product a , product c , product d were tested in the european lwc rotogravure formulation with the following results : ______________________________________color properties ( european lwc roto ) a c d______________________________________solids (%) 57 . 1 57 . 0 57 . 2ph ( naoh ) 8 8 8brookfield ( cps ) 20 rpm 1 , 050 1 , 680 13 , 150100 rpm 352 536 4 , 280400 h . e . p . ` e ` 16 . 0 22 . 8 35 . 6______________________________________ ______________________________________coated sheet properties ( european lwc roto ) a c d______________________________________gloss (%) 53 46 43brightness (%) 74 . 8 73 . 8 74 . 2opacity (%) 85 . 6 84 . 5 84 . 5heliotest ( mm ) 51 40 52______________________________________ properties shown are at 5 . 5 lb / 3300 ft . sup . 2 calendar conditions : 2 nips , 1600 psig , 140 ° f . in each of the cases above , the product a of the invention provided equivalent to superior to significantly superior optical and printability characteristics compared to commercial delaminated pigments c and d ; and the product of the invention had significantly lower high and low viscosity than the commercially available pigments at the same solids level in the same coating color formulation . an alternative means of quantifying the novel , unexpected viscosity characteristics of the delaminated product of the invention is to determine the coating color solids level at which the product of the invention will report viscosity measurement values equal to the commercially available pigments . this determination was made by measuring the brookfield and hercules viscosity of the commercially available product c at typical color coating solids level 57 %. a product of the invention , product a , was admixed in a pigment binder system at a significantly higher solids level than 57 % solids and viscosity measurements were taken ; then the solids level was reduced by one percent increments with the addition of deionized water , with viscosity measurements again taken at each new lower solids level . this process is repeated to establish a range of data relating coating color solids to viscosity and until the viscosity measurements of product a , initially higher than that of product c , are , via dilution of solids content , lower than the viscosity measurement of product c . in this manner and with the pigments of this example , it was determined that product of the invention a can be dispersed in an american lwc offset formulation and achieve an equivalent brookfield viscosity value to commercially available product c at 2 % higher color solids level and an equivalent hercules viscosity value at 3 % higher coating color solids . these differences are significant and can provide substantial commercial advantages to the paper maker . in this example , processing steps described above in example 1 for product a were employed for crudes from deposits of kaolinitic sands located about 75 kilometers north of the city of manaus , amazonas state , brazil . the slip was prepared by blunging the kaolin crude in water containing calgon ® dispersant , resulting in a slurry with a ph of 7 . 1 . the slip was degritted in two stages , the first involving allowing the slip to remain quiescent for about 5 minutes and then passing the nonsettled portion through a 200 mesh screen ( u . s . standard ). the degritted slip at about 41 % solids contains about 43 % of the starting crude . particle size of the recovered kaolin was 57 % finer than 2 micrometers . brightness was 82 . 6 %; fe 2 o 3 and tio 2 were 0 . 69 % and 0 . 81 % respectively . delamination was carried out in a pilot plant delamination simulator as described above . bead volume was 50 % and residence time was 45 minutes . the discharge of the delaminator was charged to a magnetic separator and then flocced and bleached with 6 #/ ton k - brite ® sodium dithionite solution , then filtered , rinsed and dried using conventional procedures . the delaminated pigment product of this example had the following characteristics : median particle size : 1 . 02 micrometers ## equ6 ## surface area : 9 . 2 m 2 / g viscosity , measured at 70 . 3 % solids example 4 processing replicates of novel whole fraction delaminated and delaminated produces from coarse fractions of crude in this example , the crudes used in example 1 and example 2 were again processed , in part , in a manner more fully described in example 1 and example 2 to make products of the invention . in this case a degritted slip of kaolin , with physical characteristics as reported below , is subjected to mechanical delamination without first fractioning the slip . the delaminator discharge , with physical characteristics as described below , was charged to a sharples centrifuge which divided the slip into product a , a fine fraction of 75 % finer than two micrometers , as more fully described below , and a coarse reject fraction . the product slip can then be subjected to brightness enhancement as described in example 1 . ______________________________________whole fraction delaminated degritted crude & amp ; delaminator delaminator final charge discharge product______________________________________particle sizedistribution % less than 5 microns 76 . 4 91 . 1 95 . 8 2 microns 55 . 0 67 . 6 74 . 5 1 micron 40 . 4 47 . 4 53 . 2 . 5 micron 23 . 3 25 . 1 28 . 8 . 3 micron 10 . 3 9 . 2 11 . 4 . 2 micron 4 . 8 3 . 6 4 . 4surface area 7 . 8 7 . 9 8 . 9m . sup . 2 / gbet - n . sub . 2viscosity72 % solidsbrookfield 90 cps 138 cps 205 cps @ 20 rpmbrookfield 122 cps 168 cps 174 cps @ 100 rpm68 % solidsbrookfield 40 cps 59 cps 64 cps @ 20 rpmbrookfield 71 cps 78 cps 76 cps @ 100 rpmhercules 2 . 0 dynes @ 1100 rpm 1 . 9 dynes 2 . 3 dynes 2 . 0 dyneshercules 12 dynes 28 . 8 dynes 26 . 8 dynes @ 4400 rpm______________________________________ in this example , the degritted kaolin crude slip , with physical characteristics as described below , is separated by a centrifuge , as described in example 2 , into a fine fraction and coarse fraction with particle size distributions as described below . a portion of the fine fraction recovered in the first step is then admixed with the course fraction in order to make a kaolin slip for charge to the delaminator ; the portion of fine fraction remaining can be further processed in a conventional manner into a fine fraction no . 1 grade product , if desired . the delaminator charge , with physical characteristics as described below , is charged to the delaminator , as described in example 2 . the delaminator discharge with physical characteristics as described below is then charged to a centrifuge to separate the slip into a delaminated product as described below , and a course reject fraction . the fractionated , delaminated product slip can then be subjected to brightness enhancement , as described in example 2 . __________________________________________________________________________ degritted crude & amp ; fine centrifuge fractionated coarse delam . delam . centrifuge charge slip fraction charge discharge product__________________________________________________________________________particle size distribution % less than 5 microns 76 . 4 99 . 4 59 . 9 73 . 3 89 . 5 97 . 5 2 microns 55 . 0 88 . 1 28 . 3 49 . 9 63 . 0 75 . 3 1 micron 40 . 4 68 . 9 19 . 1 35 . 3 42 . 8 52 . 7 . 5 micron 23 . 3 39 . 9 11 . 1 21 . 4 23 . 2 28 . 5 . 3 micron 10 . 3 16 . 9 6 . 0 8 . 8 9 . 8 11 . 1 . 2 micron 4 . 8 7 . 1 2 . 6 3 . 1 4 . 7 3 . 6surface area m . sup . 2 / g 7 . 8 8 . 3 8 . 7bet - n . sub . 2viscosity72 % solidsbrookfield @ 20 rpm 90 cps 90 cps 112 cps 158 cpsbrookfield @ 100 rpm 122 cps 129 cps 143 cps 170 cps68 % solidsbrookfield @ 20 rpm 40 cps 41 cps 42 cps 61 cpsbrookfield @ 100 rpm 71 cps 76 cps 66 cps 73 cpsbrookfield @ 1100 rpm 1 . 9 dynes 2 . 6 dynes 2 . 6 dynes 2 . 5 dyneshercules @ 4400 rpm 12 dynes 15 . 2 dynes 28 . 4 dynes 32 . 0 dynes__________________________________________________________________________ | 8 |
in fig1 there is illustrated one form of a conventional cash register means designated 10 that includes a stand 12 with a recess 14 to receive a conventional cash drawer 16 . mounted on the stand 12 is the cash register 18 with a conventional numerical keyboard 20 , screen 22 to view the transaction and an upper area 24 wherein a receipt would appear to give to the customer . the drawer 16 is usually spring loaded to open upon completion of the sales transaction so the sales clerk may deposit the cash or checks and make change . preferably in most cash register means or consoles 10 each cash drawer 16 is fitted with a removable cash drawer insert designated 30 . the insert 30 includes side walls 32 and 34 , and rear wall 36 ( see fig3 ). the bottom 38 extends from the rear wall and is generally flat to a front portion 40 that is curved upwardly and terminates on the same horizontal plane as the top edge 42 of side walls 32 and 34 . in addition the insert 30 includes a forwardly extending mounting flange 44 . the interior of the insert 30 is fitted with coin compartments 46 in the front so that coins may be slid up to curved front portion 40 for easy removal . behind the coin compartments 46 are a series of paper currency compartments 48 to receive paper currency of various denominations and possibly checks . the paper currency compartments 46 are each elongated with rear wall 36 and front wall 50 defining the elongated dimension . the side dimensions may be defined by walls 52 and or side walls 32 and 34 and walls 52 . usually each paper currency compartment is fitted with a conventional wire or metal spring loaded bail 54 that is secured to the mounting flange 44 ( see fig3 ). the bail 54 can be formed of wire 56 as shown in fig2 and is hinged and generally spring loaded with a torsion spring 58 . a bail 54 is lifted manually by the clerk for access to the currency 60 in one or more of the compartments 48 and they usually assume open position off center from the vertical so they remain in the lifted or up position until they are pulled back down to rest on the bills or paper currency 60 . such bails 54 are conventional in cash drawers 16 except the design and shapes vary depending upon the manufacturer . while most cash register complexes 10 include cash drawer inserts 30 , others may only use the cash drawers 16 . in either case the invention will operate with whichever arrangement is utilized , and the terms &# 34 ; cash drawer insert &# 34 ; and &# 34 ; cash drawer &# 34 ; may be used interchangeably . now turning to the present invention , a money shield or insert generally designated 68 is provided that includes a cover member or overlay portion 70 that over lies the paper currency 60 . the cover member or overlay portion 70 preferably includes a width from edge 72 to edge 74 just slightly less than the width of the compartment 48 . the length of the cover 70 is such that when added to the mounting flange 44 of the drawer or drawer insert 30 corresponds to the length of the compartment 48 . generally the front edge 76 is curved downward so that it will engage paper currency 60 thereunder and provide access for fingers so the cover member may be lifted . in the preferred embodiment of the shield or insert 68 , currency holder insert is designated 78 and is formed and physically placed in a paper currency compartment 48 of the drawer or drawer insert 30 . the cover or overlay portion 70 is hingedly secured by cooperative means such as hinge pin 80 to an upper extension piece 82 , which extends rearwardly to a vertical end wall 84 . there is a bottom wall 86 that extends from the end wall 84 forward terminating in a preferred turned up end 88 . the upturned end allows an easy grasp of the insert 78 for removal from the tray 30 and for removal of paper currency 60 within the insert 68 . as can be seen in fig3 and 4 the bottom 86 may include an elevated end portion 90 in the rear portion of the shield 68 to create a void . also there could be formed a tunnel portion 92 extending across the width of the shield to accommodate special ridge constructions 94 formed in some existing cash drawer inserts 30 . if the shield or insert 68 does not fit where the cover 70 can stay up by itself as seen in fig3 because of the void and tipping of the insert the inventors provide a wedge 96 to tip the shield member forward and fix the same against rocking . also in order to achieve securement of the shield 68 in the drawer insert 30 , an adhesive pad or two sided adhesive pad 98 may be affixed to the underportion of the bottom 86 of the money shield 68 . in operation when the drawer 16 is to be opened , the clerk may insert a finger under the top or cover 70 hingedly raising the same against a biased spring loaded bail 54 that is resting thereagainst to a slightly vertical off set position while paper currency is being added or taken from the stack of paper currency . once the transaction is completed the clerk may manually push outward against the bail 54 or the cover 70 causing the spring loaded bail 54 to in turn close the cover 70 . alternatively , the drawer 16 may be closed which will push against the bail and in turn the cover 70 to close the same . with the shield or insert 68 in place no one looking into the open cash drawer 16 would be able to see the denomination or quantity of paper currency therein . this may be a deterrent to robbery or just the curious from seeing the contents of the drawer 16 . it has been found that the money shield 68 may be made of a light weight plastic with good results to achieve strength , stability and a low cost factor per unit . in fig5 and 6 there is illustrated modified money inserts 68 &# 39 ; and 68 &# 34 ;. here there is only the cover member 70 &# 39 ; and 70 &# 34 ;. each cover member 70 &# 39 ; and 70 &# 34 ; illustrated is generally that of a rectangle that interfits within compartments 48 &# 39 ; and 48 &# 34 ;. the difference resides in cooperative means for affixing the cover members 70 &# 39 ; and 70 &# 34 ; to a conventional bale 54 &# 39 ; and 54 &# 34 ;. in the case of fig5 the bail 54 &# 39 ; includes two parallel wire sides 100 and 102 and a curved end wire piece 104 united by the side pieces . the cover member 70 &# 39 ; is fitted with pairs of detentes 106 spaced from one another and the wire sides may be snapped therein for frictional retention therebetween . in fig6 the bail design differs and cleats or clips 108 may be used to lock the bail 54 &# 34 ; to the cover 70 &# 34 ; for simultaneous movement . the invention and its attendant advantages will be understood from the foregoing description and it will be apparent that various changes may be made in the form , construction and arrangements of the parts without departing from the spirit and scope thereof or sacrificing its material advantages , the arrangements herein before described being merely by way of example . we do not wish to be restricted to the specific forms shown or uses mentioned , except as defined in the accompanying claims , wherein various portions have been separated for clarity of reading and not for emphasis . | 6 |
the invention is a vibratory rotation sensor for which the control and readout is accomplished with multiplexed signals . the vibratory rotation sensor of the present invention consists of a resonator , a housing to which the resonator is attached , and multiplex electronics . the resonator can be any rotationally - symmetric thin - walled object having standing - wave vibration modes . the prior art typically suggests that the resonator be hemispherical in shape . a simplified method for determining the parameters of the standing waves and controlling the dynamics of the resonator is illustrated in fig2 . the standing waves are describable with respect to x and y axes fixed with respect to the resonator . the orientation of the inphase standing wave with respect to the resonator can be specified by the orientation angleθ of an inphase antinodal axis measured clockwise from the x axis . the deviation of the resonator rim from a circle along the inphase antinodal axis is assumed to vary as cos ( ωt + θ ) where ω is the vibration frequency , t is time , and φ is an arbitrary phase angle . the orientation of the quadrature standing wave with respect to the resonator is specified by the orientation angledθ + π / 4 of a quadrature antinodal axis measured clockwise from the x axis . the deviation of the resonator rim from a circle along the quadrature antinodal axis is assumed to vary as sin ( ωt + φ ). the circumferentially - continuous resonator electrode 42 , deposited on the interior surface of the resonator , is biased to a dc voltage v b and is connected through a dc - blocking capacitor 43 to the amplifier - demultiplexer 44 . eight electrodes 46 attached to the vrs housing are equally spaced about the circumference in close proximity to the resonator electrode 42 , the uppermost xp electrode being centered on the x - axis . the eight electrodes 46 are supplied with the driving voltages v xp ( t ), v xn ( t ), v yp ( t ), and v yn ( t ) from the multiplexer 48 where v . sub . xp ( t )= v . sub . mxr ( t ) cos 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )- v . sub . myr ( t ) sin 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cx ( t ) u . sub . xp ( t ) v . sub . xn ( t )=- v . sub . mxr ( t ) cos 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )+ v . sub . myr ( t ) sin 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cx ( t ) u . sub . xn ( t ) v . sub . yp ( t )= v . sub . mxr ( t ) sin 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )+ v . sub . myr ( t ) cos 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cy ( t ) u . sub . yp ( t ) ( 1 ) v . sub . yn ( t )=- v . sub . mxr ( t ) sin 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )- v . sub . myr ( t ) cos 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cy ( t ) u . sub . yn ( t ) the excitation voltages v mxr ( t ) cos ( ω xr t + ψ xr ) and v myr ( ω yr t + ψ yr ) are components in the x r - y r tracking - angle coordinate system of fig2 ( denoted by the r in the subscripts ). the preferred embodiments of the excitation voltages include the sinusoids cos ( ω xr t + ψ xr ) and cos ( ω yr t + ψ yr ). there are a variety of periodic functions f ( ω xr t + ψ xr ) which may be utilized instead of the sinusoids including ordinary square waves . the x r - axis is rotated clockwise from the x - axis by the tracking angle θ r . the excitation voltages are designed not to affect the parameters of a standing wave on the resonator . the angular frequencies ω xr and ω yr and phases ψ xr and ψ yr depend on the type of multiplexing being used . the forcing voltages v cx ( t ) u xp ( t ), v cx ( t ) u xn ( t ), v cy ( t ) u yp ( t ), and v cy ( t ) u yn ( t ) ( expressed as components in the x - y coordinate system ) cause forces to be applied to the resonator for the purpose of controlling the parameters of the one or more standing waves on the resonator . the functions u xp ( t ), u xn ( t ), u yp ( t ) and u yn ( t ) are generated by control unit 50 and supplied to multiplexer 48 . the voltages v cx ( t ) and v cy ( t ) are predetermined functions used to isolate the forcing voltages from the excitation voltages . the current i ( t ) flowing from the resonator electrode 42 into the amplifier - demultiplexer 44 is given by i . sub . xp ( t )= k . sub . i v . sub . mxr ( t ) ω . sub . xr cos 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )- v . sub . myr ( t ) ω . sub . yr sin 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cx ( t ) ωuxpu . sub . xp ( t )! c . sub . xp i . sub . xn ( t )= k . sub . i - v . sub . mxr ( t ) ω . sub . xr cos 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )+ v . sub . myr ( t ) ω . sub . yr sin 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cx ( t ) ωuxnu . sub . xn ( t )! c . sub . xn i . sub . yp ( t )= k . sub . i v . sub . mxr ( t ) ω . sub . xr sin 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )+ v . sub . myr ( t ) ω . sub . yr cos 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cy ( t ) ωuypu . sub . yp ( t )! c . sub . yp ( 3 ) i . sub . yn ( t )= k . sub . i - v . sub . mxr ( t ) ω . sub . xr sin 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )- v . sub . myr ( t ) ω . sub . yr cos 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cy ( t ) ω . sub . uyn u . sub . yn ( t )! c . sub . yn the capacitances c xp , c xn , c yp , and c yn are the capacitances of the xp , xn , yp , and yn electrodes 46 with respect to the resonator electrode 42 . the angular frequencies ω uxp , ω uxn , ω uyp , and ω uyn are those associated with the corresponding u &# 39 ; s and are typically equal to or less than 2ω where ω is the resonator vibration frequency . the symbol k 1 denotes a constant . the phase differences between the driving voltages and the resulting currents are of no relevance and have been ignored in the equations above . the capacitances are given by where terms involving higher orders of d i and d q have been omitted . the effects of the higher - order terms are taken into account in subsequent processing operations . the quantity c o is the capacitance of the electrode pairs when the resonator is not excited , d i and d q are the maximum flexing amplitudes respectively of the inphase and quadrature modes divided by the gap between the resonator electrode 42 and the electrodes 46 when the resonator is not excited , θ is the angle between the antinode of the inphase standing wave and the x - axis , ω is the angular frequency of vibration of the resonator , and φ is an arbitrary phase angle . substituting the expressions for the capacitances in the current equations and summing to obtain i , we obtain ## equ1 ## the current i ( t ) is transformed into the voltage v ( t ) by the amplifier - demultiplexer 44 : v ( t )= k . sub . v v . sub . x ( t ) r . sub . x ( t )+ v . sub . y ( t ) r . sub . y ( t )!+ k . sub . f f . sub . x ( t )+ f . sub . y ( t )! ( 6 ) f . sub . y ( t )= v . sub . cy ( t ) ω . sub . uyp u . sub . yp ( t ) c . sub . yp ω . sub . uyn u . sub . yn ( t ) c . sub . yn ! ( 8 ) the signals r x ( t ) and r y ( t ) are the desired outputs from a demultiplexing process consisting of separate operations applied to v ( t ) since they contain the standing wave parameters d i , d q , θ - θ r , ω , and φ . signals s x ( t ) and s y ( t ) containing the signals r x ( t ) and r y ( t ) are extracted by amplifier - demultiplexer 44 by performing the operations o x on s x ( t ) and the operations o y and s y ( t ). the operating principle of the demultiplexer portion of the amplifier - demultiplexer 44 depends on the form of the voltages v mxr ( t ), v myr ( t ), v cx ( t ), and v cy ( t ) and the values of ω xr , ω yr , ψ xr , and ψ yr . for frequency - division multiplexing , v mxr ( t ), v myr ( t ), v cx ( t ), and v cy ( t ) are all equal to a constant , ω xr , ω yr , and | ω xr - ω yr | are greater than about 6ω , and ψ xr , and ψ yr are arbitrary constants . the signals r x ( t ) and r y ( t ) which contain the standing - wave parameters are obtained by performing two product demodulations of v ( t ), one with respect to cos ( ω xr t + ψ xr ) and the other with respect to cos ( ω yr t + ψ yr ). if a periodic function other than a sinusoid is being used , then the demodulations proceed using replicas of the periodic functions . a product demodulation consists of multiplying the input voltage by the reference sinusoid ( or replica ) and lowpass filtering the product , the cutoff frequency of the lowpass filter being about 3ω . the results of the above process are the signals s fdmx ( t ) and s fdmy ( t ): where k fdm is a constant . because the upper limit to the frequency spectrums of f x ( t ) and f y ( t ) are about 3ω , these quantities are eliminated by the demultiplexing process . for phase - division multiplexing , ω xr and ω yr have the same value ω o , ω o being greater than about 6ω , and ψ xr - ψ yr is equal to π / 2 radians . the signals s pdmx ( t ) and s pdmy ( t ) are obtained by performing product demodulations of v ( t ) with respect to cos ( ω o t + ψ x ) and with respect to cos ( ω o t + ψ y ) ( or with respect to replicas of the periodic functions being used ). for one form of time - division multiplexing , ω xr and ω yr have the same value ω o with ω o being greater than about 6ω and ψ xr , and ψ yr are equal to an arbitrary number ω o . the voltages v mxr ( t ) and v myr ( t ) are proportional to square waves which take on values of 0 and 1 , only one of which being equal to 1 at any given time and the duration of a &# 34 ; 1 &# 34 ; value being equal to an integer times 2π / ω . the voltages v cx ( t ), and v cy ( t ) are both equal to a constant . the signals s tdmx ( t ) and s tdmy ( t ) are obtained by performing a product demodulation of v ( t ) with respect to cos ( ω o t + ψ o ) ( or replica ) followed by parallel multiplications with v mxr ( t ) and v myr ( t ): where k tdm is a constant . it should be noted that r x ( t ) and r y ( t ) are available only when v mxr ( t ) and v myr ( t ) are non - zero . the same results are obtained ( except possibly for the value of the constant k tdm ) if v mxr ( t ), v myr ( t ), v cx ( t ), and v cy ( t ) are proportional to square waves which take on values of 0 and 1 , only one of the square waves being equal to 1 at any given time , and the duration of a &# 34 ; 1 &# 34 ; value being equal to an integer times 2π / ω . this mode of operation may be desirable in that it completely isolates the forcing voltages v cx ( t ) u xp ( t ), v cx ( t ) u xn ( t ), v cy ( t ) u yp ( t ), and v cy ( t ) u yn ( t ) from each other and from the excitation voltages v mxr ( t ) cos ( ω o t + ψ o ) and v myr ( t ) cos ( ω o t + ψ o ). for another form of time - division multiplexing , ω o equals 0 and v mxr ( t ), v myr ( t ), v cx ( t ), and v cy ( t ) are proportional to square waves which take on values of 0 and 1 , only one of the square waves being equal to 1 at any given time , and the duration of a &# 34 ; 1 &# 34 ; value being equal to an integer times 2π / ω . multiplying v ( t ) in parallel operations by v mxr ( t ) and by v myr ( t ) gives the same results as in the first form of time - division multiplexing . for code - division multiplexing , ω xr , ω yr , ψ xr , and ψ yr are all equal to 0 , v cx ( t ), and v cy ( t ) are constants , and v mxr ( t ) and v myr ( t ) are proportional to square waves which take on pseudo - random sequences of values of - 1 / t and 1 / t and satisfy the following conditions : ## equ2 ## where the subscripts i and j stand for any of the subscripts mxr , myr , cx , and cy . the integration time interval t should be less than 2π / 3ω . the signals s cdmx ( t ) and s cdmy ( t ) are obtained by separately multiplying v ( t ) by v mxr ( t ) and v myr ( t ) and then integrating over t : where k tdm is a constant and n is an integer . it should be noted that the signals s cdmx ( t ) and s cdmy ( t ) provide information concerning the standing - wave parameters at intervals of t . the voltages u x ( t ) and u y ( t ) typically may include three components : where the subscripts a , q , and r identify the amplitude , quadrature and rate control voltages . it is not necessary to isolate these components from one another in all applications . however , if isolation is desired , the following substitutions can be made in the foregoing equations . v . sub . cay ( t ) u . sub . ayp ( t )+ v . sub . cqy ( t ) u . sub . qyp ( t )+ v . sub . cry ( t ) u . sub . ryp ( t ) for v . sub . cy ( t ) u . sub . yp ( t ) ( 15 ) with these substitutions , any constraints imposed on v cx ( t ) and v cy ( t ) also apply to v cax ( t ), v cqx ( t ), v crx ( t ), v cay ( t ), v cqy ( t ), and v cry ( t ). for example , equations ( 1 ) become v . sub . xp ( t )= v . sub . mxr ( t ) cos 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )- v . sub . myr ( t ) sin 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cax ( t ) u . sub . axp ( t )+ v . sub . cqx ( t ) u . sub . qxp ( t )+ v . sub . crx ( t ) u . sub . rxp ( t ) v . sub . xn ( t )=- v . sub . mxr ( t ) cos 2θ . sub . r cos ( ω . sub . x rt + ψ . sub . xr )+ v . sub . myr ( t ) sin 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cax ( t ) u . sub . axn ( t )+ v . sub . cqx ( t ) u . sub . qxn ( t )+ v . sub . crx ( t ) u . sub . rxn ( t ) v . sub . yp ( t )= v . sub . mxr ( t ) sin 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )+ v . sub . myr ( t ) cos 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cay ( t ) u . sub . ayp ( t )+ v . sub . cqy ( t ) u . sub . qyp ( t )+ v . sub . cry ( t ) u . sub . ryp ( t ) ( 16 ) v . sub . yn ( t )=- v . sub . mxr ( t ) sin 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )- v . sub . myr ( t ) cos 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cay ( t ) u . sub . ayn ( t )+ v . sub . cqy ( t ) u . sub . qyn ( t )+ v . sub . cry ( t ) u . sub . ryn ( t ) one possible time - division - multiplex configuration is a sixteen - slot frame of duration 32π / ω synchronized to the flexure rate of the resonator . the multiplex control voltages are as shown in fig3 . when θ r equals θ , the x r axes coincide with the antinodal axes and the y r axes coincide with the nodal axes . eight slots are assigned to reading out the y r signal component , 4 slots to reading out the x r signal component , and 1 slot each to applying amplitude , quadrature , and rate forces to the resonator . for a vibration frequency of 4 khz , readouts of the x r and y r signal components would be available at a rate of 2 khz and 1 khz respectively . the control voltages would be applied at a rate of 0 . 25 khz . in general , the signals s x ( t ) and s y ( t ) exiting from the amplifier - demultiplexer 44 have the form where k vx and k vy each equals k v except in the case of time - division multiplexing when k vx equals k v v mx ( t ) and k vy equals k v v my ( t ). in order to extract the standing - wave parameters from the signals s x ( t ) and s y ( t ), a stable and precise replica of the resonator vibration signal cos ( ωt + φ ) is required . the replica is obtained from a voltage - controlled oscillator in replica generator 52 wherein the voltage - controlled oscillator is phase - locked to the in - phase standing - wave antinodal signal . the first step of the process is to multiply s x ( t ) and s y ( t ) first by the replica signal cos ( ω r t + φ r ) and lowpass filter the results and then by the phase - shifted replica sin ( ω r t + φ r ) and lowpass filter the results . the results of this process are : ## equ3 ## where k is a constant . the next step is to form the following combinations of products of the s ix ( t ), s iy ( t ), s qx ( t ), and s qy ( t ): l . sub . i = 2 ( s . sub . ix s . sub . qx + s . sub . iy s . sub . qy )= k . sup . 2 ( d . sub . i . sup . 2 - d . sub . q . sup . 2 ) sin 2 ( ω . sub . r - ω ) t + 2 ( φ . sub . r - φ )! with l i ( t ) as the error signal , the phase - locked loop will lock up with the replica phase φ r equal to φ and ω r equal to ω . the difference between the standing - wave orientation angle and the tracking angle θ - θ r , can be determined from the equation ## equ4 ## and the signs of s ix ( t ) and s iy ( t ) the quantity s ( t ) can be used as the error signal in a control loop which generates θ r and causes on average θ to equal θ r and d / dt ( θ - θ r ) to equal 0 . the digitally - synthesized tracking angle θ r is used in generating sinθ r and cosθ r which are supplied to the multiplexer 48 . the actual value of θ at any given time is given by ## equ5 ## the difference between e ( t ) and a specified number is used as the error signal in the amplitude control loop which causes the total energy in the combined inphase and quadrature standing waves , which is proportional to d i 2 + d q 2 , to equal the specified number . the quantity q ( t ) is used as the error signal in the quadrature control loop which results in the quadrature standing - wave amplitude d q to be zero . when this loop is closed , the amplitude control loop maintains the inphase amplitude d i at a specified value . the use of the above control variables can be shown to be optimum . it will be apparent to those skilled in the art that there are many choices of control variables that are suboptimum but still practical . the outputs of the control unit 50 are the functions u xp ( t ), u xn ( t ), u yp ( t ), and u yn ( t ) together with the sine and cosine of θ r , which are all supplied to multiplexer 48 . additional details concerning vibratory rotation sensors are contained in u . s . pat . no . 4 , 951 , 508 by loper , jr . et al . dated aug . 28 , 1990 which is incorporated by reference . | 6 |
the following description of the preferred embodiment is provided to understand the features and the structures of the present invention . please refer to fig1 and fig2 , which are a cross sectional view of a structure and a flow chart of the method showing a preferred embodiment according to the present invention . as shown in the figures , the present invention is a structure of a polymeric material with hydrophobic and oleophobic modification by using atmospheric plasmas and a fabrication method thereof . the structure 1 comprises a substrate 11 , a grafted fluorocarbon monomer layer 12 ; and a grafted fluorocarbon functional group layer 13 , where there is a first rough surface 111 on the substrate 11 ; the grafted fluorocarbon monomer layer 12 is formed on the first rough surface 111 of the substrate 11 , in which a second rough surface 121 is induced with same roughness as that of the first rough surface 111 ; and the grafted fluorocarbon functional group layer 13 is formed on the second rough surface 121 of the grafted fluorocarbon monomer layer 12 . the fabrication method of the structure 1 comprises the following steps : ( a ) irradiation of atmospheric filamentary discharge plasma 21 on substrate : the substrate 11 is moved into an atmospheric plasma area in a roll - to - roll way . a first plasma working gas is used for generating atmospheric filamentary discharge plasma to irradiate on the surface of the substrate 11 . the surface of the substrate 11 is thus activated and roughened to obtain a first rough surface 111 of the substrate 11 . the roughness of the first rough surface 111 of the substrate 11 is adjusted to a required value by adjusting the power density of the atmospheric filamentary discharge plasma and adjusting the period of time for irradiation of substrate with the atmospheric filamentary discharge plasma . therein , the first plasma working gas is a mixture of oxygen ( o 2 ) and helium ( he ) or a mixture of o 2 and argon ( ar ); and , the first rough surface 111 of the substrate 11 is hydrophilic and has a roughness not smaller than 20 nanometer ( nm ). ( b ) exposure of substrate to air 22 : the substrate is exposed to air after being irradiated by the atmospheric filamentary discharge plasma and peroxide is thus formed on the first rough surface 111 of the substrate 11 . ( c ) graft of fluorocarbon monomers 23 : the substrate 11 with peroxides is immersed in a solution of fluorocarbon compound for grafting fluorocarbon monomers or oligomers to form a grafted fluorocarbon monomer layer 12 on the first rough surface 111 of the substrate 11 . the grafted fluorocarbon monomer layer 12 has a second rough surface having the same roughness as that of the first rough surface of the substrate for obtaining preliminary hydrophobicity and oleophobicity . therein , the fluorocarbon compound is perfluoroalkylsilane ; further , is 1h , 1h , 2h , 2h - perfluorooctyldimethyl chlorosilane ( pfdmcs ) or fluoroalkyl silane ; and , the grafted fluorocarbon monomer layer 12 has a thickness between 5 and 200 nm . ( d ) irradiation of carbon tetrafluoride plasma 24 : the grafted fluorocarbon monomer layer 12 is processed further through a second stage of grafting and polymerizing a fluorocarbon functional group . a second plasma working gas is used to form a carbon tetrafluoride plasma to be irradiated on the second rough surface 121 of the grafted fluorocarbon monomer layer for an enhanced hydrophobic and oleophobic modification , where a grafted fluorocarbon functional group layer 13 is thus formed on the second rough surface 121 of the grafted fluorocarbon monomer layer 12 . therein , the second plasma working gas is a mixture of he and carbon tetrafluoride ( cf 4 ); the grafted fluorocarbon functional group layer 13 is a modified layer having a fluorocarbon functional group ; and the grafted fluorocarbon functional group layer 13 has a thickness between 5 and 20 nm . ( e ) curing and drying of the substrate 25 : the substrate 11 with a grafted fluorocarbon monomer layer and a grafted fluorocarbon functional group layer is cured and dried to generate cross - links on both the grafted fluorocarbon monomer layer 12 and the grafted fluorocarbon functional group layer 13 and between the grafted fluorocarbon monomer layer 12 and the grafted fluorocarbon functional group layer 13 . thus , a novel structure 1 having hydrophobic and oleophobic modification is fabricated through the method according to the present invention . therein , the atmospheric filamentary discharge plasma and the carbon tetrafluoride plasma used in the present invention are all low - temperature plasma , so the present invention can be applied to polymeric materials , which is not fit for high temperature treatments , such as polypropylene ( pp ), polyethylene ( pe ), polyethylene terephthalate ( pet ), polyamide ( pa ) and cotton . please refer to fig3 , which is a list showing contact angles of water droplet and those of oil droplet . as shown in the list , before the surface modification using present invention , the roughness of the substrate of a polymer fabric is about 2 nm , its contact angle of water droplet and oil droplet ( n - hexadecane ) is about 100 ° and 15 °, respectively . after curing and drying of the grafted substrate , its contact angle of water droplet and oil droplet increases to 150 ° and 120 °, respectively please refer to fig4 , which shows the relative concentration of fluorine atoms of the substrate before and after each stage of modification . the substrate is processed through two stages of a hydrophobic and oleophobic modification with atmospheric plasmas . according to fig2 , the 5 steps of the fabrication method are described in detail in the following . the substrate is moved into an atmospheric plasma area in a roll - to - roll way . he or ar is mixed with o 2 for obtaining a plasma working gas to be filled in at a rate of o 2 / he or o 2 / ar not smaller than 10 % and a flow ratio of 4 slm . a power density is increased to not smaller than 0 . 9 w / cm 2 for generating an atmospheric filamentary discharge plasma to be irradiated on the polymer fabric for activating and roughening the substrate . therein , through a local heat effect of the atmospheric filamentary discharge plasma , a surface of the polymer fabric is etched to form a rough surface with a high roughness , where the power density is adjusted for 3 to 5 minutes ( min ) to obtain the required roughness of about 26 nm . the activated and roughened surface of the substrate thus obtained is highly hydrophilic , with its contact angle of water droplet and oil droplet to be decreased to 40 ° and 5 °, respectively . then , the polymer fabric being irradiated by the atmospheric filamentary discharge plasma is exposed to air for 6 min to form highly active peroxide on the rough surface of the polymer fabric . the polymer fabric with peroxide is immersed in the solution of fluorocarbon compound for 3 to 5 min for a first stage of graft of fluorocarbon monomers . the peroxide of the substrate grafts monomers of pfdmcs to form a grafted fluorocarbon monomer layer on the rough surface of the polymer fabric . therein , after the grafted fluorocarbon monomer layer is formed on the polymer fabric , the contact angle of water droplet and oil droplet is increased to 80 ° and 10 °, respectively . the characteristic of the modified surface is not only hydrophobic and oleophobic , but also with fluorocarbon monomers on its surface , which will facilitate for the following graft of fluorocarbon functional group . the polymer fabric with the grafted fluorocarbon monomer layer is processed through a second stage of grafting and polymerizing a fluorocarbon functional group . a mixture of he and cf 4 is used as a plasma working gas under one atmospheric pressure at a flow rate of 9 : 1 ( cf 4 / he = 11 %). a power density is set not smaller than 0 . 6 w / cm 2 for obtaining a carbon tetrafluoride plasma to be irradiated on the grafted fluorocarbon monomer layer of the polymer fabric for an enhanced hydrophobic and oleophobic modification . since the carbon tetrafluoride plasma has a lot of free radicals such as — cf 3 , — cf 2 − , — cf 2 − cf 3 , fluorine atom and fluorine ion , these highly reactive groups such as fluorine atom and fluorine ion will react strongly with the fluorocarbon monomers on the rough surface of the polymer fabric . that is , hydrogen atoms of pfdmcs and those of its derivative are etched by the discharged hydrogen fluoride . then , the free radicals in the carbon tetrafluoride plasma rapidly take the original positions of the hydrogen atoms ; and graft on the grafted fluorocarbon monomer layer . after graft and polymerization for about 3 min , a grafted fluorocarbon functional group layer with a lowest surface free energy is formed for enhanced hydrophobicity and oleophobicity of the polymer fabric . at last , the polymer fabric is cured and dried for 3 min at 150 ° c ., to generate cross - links on both the grafted fluorocarbon monomer layer and the grafted fluorocarbon functional group layer and between the grafted fluorocarbon monomer grafted layer and the grafted fluorocarbon functional group layer to enhance a wash fastness of the polymer fabric while a structure with a hydrophobic and oleophobic modification is obtained . after the curing and drying of the modified substrate , its contact angle of water droplet and oil droplet is increased to to 150 ° and 120 °, respectively . the contact angles of water droplet and oil droplet before and after each step of modification are listed in fig3 . for showing differences of chemical components of the substrate before and after the modification , x - ray photoelectron spectroscopy ( xps ) of the substrate is used to analyze the concentration of fluorine atoms on the surface of the polymer fabric before and after the modifications . as shown in fig4 , almost no fluorine atoms are detected before the modification and only few fluorine atoms are detected after the graft of fluorocarbon monomers . and a relatively tremendous amount of fluorine atoms are found after the graft of fluorocarbon functional group on the polymer fabric . the structure of the hydrophobic and oleophobic modification fabricated according to the present invention has a surface with a high roughness and a fluorocarbon functional group having a lowest surface free energy for greatly improved hydrophobicity and oleophobicity . the grafted fluorocarbon monomer layer not only facilitates the graft of a fluorocarbon functional group ; but also strengthens the cross - links between the substrate and the fluorocarbon functional group for enhancing the wash fastness of the structure . even after washing for 40 times , its contact angle of water droplet and oil droplet still meets the requirements of textile industry . moreover , since the manufacturing process using atmospheric plasmas can readily be configured into mass - production with low cost and is environmentally friendly , the present invention can be economically used in plastics and textile industries . to sum up , the present invention is a structure of a polymeric material with a hydrophobic and oleophobic modification by using atmospheric plasmas and a fabrication method thereof , where an atmospheric filamentary discharge plasma is used to generate an active and rough surface of a substrate ; then a grafted fluorocarbon monomer layer is obtained and with a carbon tetrafluoride plasma a fluorocarbon functional group layer is further grafted , which has a lowest surface free energy ; thus , an enhanced hydrophobicity and oleophobicity of the substrate are obtained ; and , the present invention can be put in mass production with low cost and is environmentally friendly . the preferred embodiment herein disclosed is not intended to unnecessarily limit the scope of the invention . therefore , simple modifications or variations belonging to the equivalent of the scope of the claims and the instructions disclosed herein for a patent are all within the scope of the present invention . | 1 |
a preferred example wearable chemical dispenser 18 is shown in fig1 - 11 . the wearable chemical dispenser 18 includes a top housing section 20 having a generally oblong side wall 22 that extends from a top wall 23 . in use , the wall 23 is typically frontally disposed and acts as a lid . a plurality of spaced apart apertures 24 are radially arranged in the top wall 23 of the top housing section 20 . the apertures 24 provide an inlet for permitting air to enter into an interior space of the wearable chemical dispenser 18 . a tab 26 provides a means to grasp the top housing section 20 when opening the top housing section 20 . the wearable chemical dispenser 18 also includes a slide cover 28 having an on - off button 29 , openings 31 , and a cam projection 32 . a fastener 34 ( see fig6 ) mounts the slide cover 28 to the top housing section 20 such that the slide cover 28 may rotate with respect to the top housing section 20 when a user moves the on - off button 29 along the side wall 22 of the top housing section 20 . in the ‘ off ’ position , the slide cover 28 closes the apertures 24 that are radially arranged in the top wall 23 of the top housing section 20 . in the ‘ on ’ position , the openings 31 of the slide cover 28 align with the apertures 24 that are radially arranged in the top wall 23 of the top housing section 20 . the wearable chemical dispenser 18 also includes a hinge bracket 36 that is mounted to an inner surface of the top housing section 20 as shown in fig5 . the hinge bracket 36 has a flat base plate 37 that mounts to the top housing section 20 , a generally l - shaped arm 38 having an inwardly directed pivot pin 39 at its end , and generally l - shaped arm 40 having an inwardly directed pivot pin 41 at its end . the arm 38 and the arm 40 are spaced apart on the plate 37 as shown in fig5 and 6 . the hinge bracket 36 forms part of a hinge mechanism as described below . a replaceable refill unit 44 is provided with the wearable chemical dispenser 18 . the refill unit 44 has a generally slab - like support structure 45 . in top plan view , the refill unit 44 has an essentially tear - drop shaped overall appearance , with a generally circular portion at one end and a generally triangular portion at another end . there is a spoke support 47 across a circular opening through the refill unit 44 ( see fig5 ). across the spoke support 47 is positioned a fabric substrate 48 . when air is drawn in , the air passes through the fabric substrate 48 . the choice of the fabric , and its porosity , the speed of the air flow , and the vapor pressure of the active , are the main factors in coordinating the speed of use up of the active with the speed of use up of a visual use - up cue 49 ( see fig5 ) that can be viewed through the slot 25 of the top housing section 20 . an example refill unit has a twelve hour life , and the visual use - up cue 49 is designed to evaporate or change in appearance after twelve hours . a suitable visual use - up cue is described in u . s . patent application publication no . 2008 / 0141928 . by impregnating the fabric substrate 48 with an appropriate air treatment chemical , air entering the device will pick up some of the volatile chemical , and dispense it out of the device . active release rates of 0 . 2 milligrams per hour ( mg ./ hr .) or higher are preferred . particularly preferred actives are transfluthrin , prallethrin , vaporthrin , tefluthrin , and esbiothrin or other synthetic pyrethroids . for use in controlling mosquitoes , it is preferred to use metofluthrin from the sumitomo chemical company ( trade name sumione ). the impregnation material can be pure active , or for ease of handling the material can be dissolved in a hydrocarbon or other solvent . alternatively , or in addition , the fabric may also bear a fragrance , a deodorizer , or other air treatment chemical . it is preferred to have the fabric substrate 48 configured so that the pressure drop across the substrate is no more than 40 pascals ( pa ). suitable fabrics can be made of woven or non - woven materials providing only minimal resistance to the airflow . the fabric substrate 48 should also be capable of holding active ingredient dosed onto the material and also allow ready migration of the active to the surface so as to allow its evaporation in response to the airflow . for an active ingredient that is hydrophobic and migrateable at common environmental temperatures between about 10 ° c . and 40 ° c . ( e . g ., metofluthrin ), suitable materials include , only by way of example , polyester , polypropylene , cotton , cellulose , poly - rayon , and other similar fabrics . these can be non - wovens with basis weights ranging from 10 grams per square meter ( gsm ) to 40 grams per square meter ( gsm ), fabricated from synthetic , natural , or combined synthetic and natural polymeric materials . the ideal fabric substrate 48 should also allow for wicking of the active ingredient following dosing so as to ensure efficient distribution throughout the substrate , and thereafter allow migration of active ingredient to the substrate surface to replenish the active ingredient that is being evaporated by the passing airflow . dosing may be by dropping , spraying , printing , or other conventional delivery of a liquid active ingredient to the substrate . a particularly desirable fabric is a non - woven felted material with a basis weight of 20 - 30 gsm fabricated from polyethylene terephthalate . a frame 50 is located below the refill unit 44 in the wearable chemical dispenser 18 . the frame 50 has a generally oblong perimeter , and supports the refill unit 44 ( see fig5 and 6 ). note that one side of the essentially triangular portion of the refill unit 44 is straight and the other is indented . this slight lack of symmetry is designed to accommodate a corresponding slight lack of symmetry along the top side of frame 50 , and to thereby prevent a consumer from installing the refill unit 44 inside - out on the frame 50 . one end of the frame 50 has a pair of slots 51 that form part of a hinge mechanism as described below . a circular opening 52 is provided at the other end of the frame 50 . holes 54 in the frame 50 support a rotating activation button 56 that is biased by a rotary spring 57 into an off position . looking at fig6 and 11 , there is shown a fan 60 of the wearable chemical dispenser 18 . the fan 60 has a rotor 61 having a central vertical wall 63 that joins a top central horizontal wall 64 . the central vertical wall 63 and the top horizontal wall 64 define a recess 65 in the bottom of the rotor 61 ( see fig7 ). the top horizontal wall 64 of the rotor 61 includes a tubular mounting element 66 on the axis of the rotor 61 . the preferred fan 60 includes fourteen fan blades 68 a to 68 n ( see fig1 ). it has been discovered that a fan configuration , which results in an ideal balance of airflow and minimal power consumption for the wearable chemical dispenser 18 , includes twelve to eighteen fan blades . preferably , the fan produces an average volumetric flow rate of air of 1 . 5 to 3 cubic feet per minute ( with the refill unit 44 installed ) over the life ( e . g ., at least eight , and most preferably at least twelve hours ) of a refill unit 44 . typically , the fan will operate at 3000 - 5000 rpm . in one example wearable chemical dispenser 18 , over the life ( e . g ., twelve hours ) of a refill unit 44 , the consumed power from the power supply is 0 . 35 watts or less , preferably 0 . 30 watts or less , more preferably 0 . 25 watts or less , and even more preferably 0 . 20 watts or less . in one example embodiment , over a twelve hour life of a refill unit 44 , the consumed power from the power supply is about 0 . 17 watts while maintaining an average volumetric flow rate of air of at least 1 . 5 cubic feet per minute over the twelve hour period . when using one or more batteries for the power supply , the voltage will vary during discharge . however , the power consumed can be determined from the total energy consumed divided by the total time . each blade 68 a to 68 n has a generally rectangular body 69 defined by an inner edge 70 , an outer edge 71 , a top edge 72 extending from the inner edge 70 to the outer edge 71 , and top surface 73 of the rotor 61 . looking at fig1 , a radial reference line r 1 can be extended from a centerpoint c of the rotor 61 to the inner edge 70 of each blade 68 a to 68 n . likewise , a radial reference line r 2 can be extended from a centerpoint c of the rotor 61 to the outer edge 71 of each blade 68 a to 68 n . the body 69 of each blade 68 a to 68 n forms an included angle a with its associated radial reference line r 1 . it has been discovered that a fan configuration , which results in an ideal balance of airflow and minimal power consumption for the wearable chemical dispenser 18 , includes a range of fan sizes and fan blade angles . preferably , each blade 68 a to 68 n has a length extending from the inner edge 70 to the outer edge 71 in which the length measures 80 % to 130 % of the distance of radial reference line r 1 . preferably , each blade 68 a to 68 n has a length extending from the inner edge 70 to the outer edge 71 in which the length measures 45 % to 75 % of the distance of radial reference line r 2 . preferably , the included angle a in fig1 , which is formed between the body 69 of each blade 68 a to 68 n and its associated radial reference line r 1 , is in the range of 100 to 150 degrees . these example fan sizes and fan blade angles contribute to an ideal balance of airflow and minimal power consumption for the wearable chemical dispenser 18 . thus , among other things , the average volumetric flow rate of air from the fan depends on the outer radius of the rotor , the inner radius of the rotor , the number of blades , the blade angles , and the fan revolutions per minutes . one non - limiting example of the fan 60 has a length extending from the inner edge 70 to the outer edge 71 of about 15 millimeters , a radial reference line r 1 of about 14 millimeters , a radial reference line r 2 of about 25 millimeters , and an included angle a of about 120 degrees . in this non - limiting example , blade thicknesses can range from 0 . 3 - 1 . 0 millimeters , with 0 . 6 millimeters being preferred , and blade height ( from the top surface 73 of the rotor 61 to the top edge 72 of the body 69 ) can range from 5 - 11 millimeters , with about 8 millimeters being preferred . the wearable chemical dispenser 18 includes an electrical power supply . in the example embodiment shown , a microswitch 75 of the power supply is electrically connected to battery contacts 76 . another battery contact 77 completes an electrical circuit with batteries 78 and the battery contacts 76 to provide electricity to the microswitch 75 . when a user rotates the slide cover 28 by rotating the on - off button 29 into the ‘ on ’ position , the cam projection 32 of the slide cover 28 is driven into the rotating activation button 56 which then contacts the microswitch 75 to turn on the power supply . looking at fig6 - 8 , the wearable chemical dispenser 18 includes a chassis 80 for mounting various components of the wearable chemical dispenser 18 . when the top housing section 20 and the chassis 80 are in a closed position ( see , e . g ., fig1 ), a housing having an interior space is formed . the chassis 80 engages the frame 50 in a snap fit . the chassis 80 has a bottom wall 81 with a raised portion 82 that defines a upwardly directed space 83 in the chassis 80 ( see fig6 and 7 ). a battery compartment 84 is also provided in the bottom wall 81 of the chassis 80 ( see fig7 ). the battery contacts 76 , 77 are mounted at opposite ends of the battery compartment 84 . extending upward from the bottom wall 81 of the chassis 80 there is a hinge support 85 having a notch 86 and a hinge support 87 having a notch 88 ( see fig6 and 8 ). the hinge support 85 and the hinge support 87 form part of a hinge mechanism as described below . the chassis 80 also includes a side wall 90 having regularly spaced openings 91 that define an outlet for permitting air mixed with air treatment chemical to exit the interior space of the wearable chemical dispenser 18 . in the non - limiting example embodiment shown in fig5 , the openings 91 extend from point e to point f around the side wall 90 of the chassis 80 . in fig5 , the included angle between point e and point f and point d ( which is on axis x shown in fig6 ) is about 270 degrees . therefore , the openings 91 are regularly spaced around 270 degrees of the side wall 90 of the chassis 80 . preferably , the openings 91 are regularly spaced around at least 180 degrees of the side wall 90 of the chassis 80 . more preferably , the openings 91 are spaced around at least 235 degrees of the side wall 90 of the chassis 80 . one non - limiting example of the total outlet area of the openings 91 is 8 . 5 × 10 − 4 m 2 . advantageously , the battery compartment 84 is isolated from the openings 91 . these example opening configurations contribute to an ideal balance of airflow and minimal power consumption for the wearable chemical dispenser 18 . preferably , a flow path from the fan to the openings 91 is unobstructed . some other devices included a slide cover designed to shut off air flow by blocking the inlet vents and the exhaust vents . the intent was to minimize loss of actives while the unit is not in use by blocking off airflow across the dosed pad . the walls blocking the exhaust vents and the geometries supporting them occupied large space and caused the device to increase in size . these blocking walls are eliminated in the present invention without increased loss in actives ingredient . a motor 93 is positioned in the space 83 in the chassis 80 , and a wire 94 connects the motor 93 to the microswitch 75 for powering the motor when the rotating activation button 56 contacts the microswitch 75 to turn on the power supply . the motor 93 includes a drive shaft 95 that is connected to the tubular mounting element 66 on the rotor 61 . as a result , the motor 93 can rotate the fan 60 . a battery door 96 covers the battery compartment 84 in the bottom wall 81 of the chassis 80 . the battery door 96 includes mounting tabs 97 . a bottom cover 102 is fastened to the chassis 80 by way of fasteners . looking now at fig6 , 9 and 10 , means for clipping the wearable chemical dispenser 18 to a user &# 39 ; s clothing ( e . g ., a belt ) are shown . the bottom cover 102 includes a throughhole 103 partially surrounded by an arcuate well 104 in a bottom surface 105 of the bottom cover 102 . the bottom surface 105 of the bottom cover 102 further includes five spaced apart oblong depressions 106 a , 106 b , 106 c , 106 d , 106 e arranged in a semicircle around the throughhole 103 . the wearable chemical dispenser 18 also includes a clip 110 having a front section 112 that is spaced at its upper end from a rear section 113 by a top section 114 that connects the front section 112 and the rear section 113 . at the lower end of the clip 110 , the front section 112 and the rear section 113 are in contact until flexed apart by a user . the rear section 113 of the clip 110 has an arcuate projection 116 , a tubular mounting element 117 , and a movable tab 119 having a protrusion 120 on its end . the movable tab 119 is formed by a cutout 121 in the rear section 113 of the clip 110 . a fastener 122 ( see fig6 ) is inserted through the throughhole 103 of the bottom cover 102 and into the tubular mounting element 117 of the clip 110 to connect the bottom cover 102 and the clip 110 . still looking at fig6 , 9 and 10 , a rotation feature of the clip 110 can be explained . when the clip 110 is connected to the bottom cover 102 , the clip 110 is positioned as in fig9 . the fastener 122 secures the tubular mounting element 117 of the clip 110 in the throughhole 103 of the bottom cover 102 such that the clip 110 can rotate with respect to the bottom cover 102 . when the clip 110 is rotated clockwise from its position shown in fig9 , the arcuate projection 116 moves in the arcuate well 104 in a clockwise direction thereby guiding rotation of the clip 110 . the protrusion 120 of the movable tab 119 moves out of the depression 106 c by way of flexing of the movable tab 119 . the clip 110 rotates clockwise until the protrusion 120 of the movable tab 119 moves into the depression 106 b of the bottom cover 102 . when the clip 110 is further rotated clockwise from the position in which the protrusion 120 is in the depression 106 b , the arcuate projection 116 moves further clockwise in the arcuate well 104 , and the protrusion 120 moves out of the depression 106 b by way of flexing of the movable tab 119 . the clip 110 rotates clockwise until the protrusion 120 of the movable tab 119 moves into the depression 106 a of the bottom cover 102 . when in this position , the arcuate projection 116 is prevented from moving further clockwise by wall 129 of the arcuate well 104 , and the housing of the wearable chemical dispenser 18 is at 90 degrees in relation to the clip 110 . when the clip 110 is rotated counterclockwise from its position shown in fig9 , the arcuate projection 116 moves in the arcuate well 104 in a counterclockwise direction thereby guiding rotation of the clip 110 . the protrusion 120 of the movable tab 119 moves out of the depression 106 c by way of flexing of the movable tab 119 . the clip 110 rotates counterclockwise until the protrusion 120 of the movable tab 119 moves into the depression 106 d of the bottom cover 102 . when the clip 110 is further rotated counterclockwise from the position in which the protrusion 120 is in the depression 106 d , the arcuate projection 116 moves further counterclockwise in the arcuate well 104 , and the protrusion 120 moves out of the depression 106 d by way of flexing of the movable tab 119 . the clip 110 rotates counterclockwise until the protrusion 120 of the movable tab 119 moves into the depression 106 e of the bottom cover 102 . when in this position , the arcuate projection 116 is prevented from moving further counterclockwise by wall 127 of the arcuate well 104 , and the housing of the wearable chemical dispenser 18 is at 90 degrees in relation to the clip 110 . thus , the arcuate projection 116 and the arcuate well 104 provide a means for controlled rotation of the clip 110 with respect to the bottom cover 102 . specifically , the projection 116 moves in the well 104 when rotating the clip 100 . in the example embodiment of fig9 , the well 104 and the projection 116 are dimensioned such that the clip 110 can rotate 180 degrees ( i . e ., 90 degrees clockwise and 90 degrees counterclockwise ). preferably , the clip 110 can rotate at least 90 degrees . in addition , the movable tab 119 with the protrusion 120 and the spaced apart oblong depressions 106 a , 106 b , 106 c , 106 d , 106 e arranged in a semicircle around the throughhole 103 provide a means for indexed rotational positioning of the clip 100 and the housing relative to each other . the depressions 106 a , 106 b , 106 c , 106 d , 106 e provide a guide and the protrusion 120 of the movable tab 119 travels stepwise in the guide as explained above . often a user will clip the wearable chemical dispenser 18 to a belt with the clip 110 of the wearable chemical dispenser 18 in the position shown in fig9 wherein the outlet openings 91 face down from , to one side , and to the opposite side of the user . this directs a mixture of air and air treatment chemical down from , to one side , and to the opposite side of the user . if a user wishes to direct the mixture of air and air treatment chemical up , down , and to one side , the user can rotate the housing using the rotating clip 110 as described above . a user may also wish to rotate the housing in order to avoid any pinching against the body when sitting . also , by locating a pivot point of the clip 110 in a section of the housing adjacent the outlet openings 91 , more precise control of the direction of the mixture of air and air treatment chemical is afforded when rotating the clip 110 . thus , the housing of the wearable chemical dispenser 18 can be vertical or horizontal when in use . turning now to fig5 , 6 , 8 , 8 a , 8 b , and 8 c , the hinge mechanism of the wearable chemical dispenser 18 can be described further . the hinge mechanism allows a user to open the top housing section 20 to the open position of fig5 , 7 and 8 a so that a new refill unit 44 can be installed on the frame 50 as shown in fig5 . looking at fig8 a , 8 b and 8 c , movement of the pivot pin 39 of the hinge arm 38 in the notch 86 of the hinge support 85 can be explained . the pivot pin 39 has an outer wall 131 having an arcuate section 132 that extends between a first flat section 133 and a second flat section 134 . an intermediate section 135 connects the first flat section 133 and the second flat section 134 . although fig8 a , 8 b and 8 c do not show the pivot pin 41 , the pivot pin 41 has an outer wall with the same shape as outer wall 131 of pivot pin 39 . in fig8 a , the top housing section 20 is in a fully open position . the second flat section 134 of the outer wall 131 of the pivot pin 39 rests on a bottom flat surface 137 ( see fig8 ) of the notch 86 of the hinge support 85 . the mating of the bottom flat surface 137 of the notch 86 and the second flat section 134 of the outer wall 131 of the pivot pin 39 keeps the top housing section 20 in the fully open position . in fig8 c , the top housing section 20 is in a closed position . the first flat section 133 of the outer wall 131 of the pivot pin 39 rests on the bottom flat surface 137 of the notch 86 of the hinge support 85 . the mating of the bottom flat surface 137 of the notch 86 and the first flat section 133 of the outer wall 131 of the pivot pin 39 keeps the top housing section 20 in the closed position . also , a catch 155 ( see fig5 ) of the top housing section 20 engages a slot 157 ( see fig5 ) to keep the housing closed . in fig8 b , the top housing section 20 is in a partially open position . the intermediate section 135 of the outer wall 131 of the pivot pin 39 rests on the bottom flat surface 137 of the notch 86 of the hinge support 85 . the mating of the bottom flat surface 137 of the notch 86 and the intermediate section 135 of the outer wall 131 of the pivot pin 39 tends to keep the top housing section 20 in the partially open position . however , movement of the top housing section 20 in direction z will cause the top housing section 20 to quickly return to the fully open position shown in fig8 a as pivot pin 39 will rotate due to gravity until the second flat section 134 of the outer wall 131 of the pivot pin 39 rests on a bottom flat surface 137 of the notch 86 . in contrast , movement of the top housing section 20 in direction y will cause the top housing section 20 to move to the closed position shown in fig8 c as pivot pin 39 will rotate due to gravity until the first flat section 133 of the outer wall 131 of the pivot pin 39 rests on a bottom flat surface 137 of the notch 86 . the pivot pin 41 moves in the notch 88 in a similar manner with flat sections of the outer wall of the pivot pin 40 resting on the bottom flat surface 138 ( see fig8 ) of the notch 88 of the hinge support 87 during opening of the top housing section 20 . during movement of the hinge , the arm 38 and the arm 40 of the hinge bracket 36 move in the slots 51 of the frame 50 ( see fig5 ). the configuration of the outer wall of the pivot pins 39 , 41 of the arms 38 , 40 of the hinge bracket 36 provides an advantageous hinging action when opening the top housing section 20 . when a user first begins to open the top housing section 20 , the user must overcome the tendency of the pivot pins 39 , 41 to return to the closed position where the first flat section of the outer wall of the pivot pin rests on a bottom flat surface of the associated notch ( see fig8 c ). however , once the top housing section 20 has reached the partially open position of fig8 b , a small amount of further movement in direction z will cause the top housing section 20 to quickly move to the fully open position shown in fig8 a as pivot pin 39 will rotate due to gravity until the second flat section 134 of the outer wall 131 of the pivot pin 39 rests on a bottom flat surface 137 of the notch 86 . likewise , the configuration of the outer wall of the pivot pins 39 , 41 of the arms 38 , 40 of the hinge bracket 36 provides an advantageous hinging action when closing the top housing section 20 . when a user first begins to close the top housing section 20 , the user must overcome the tendency of the pivot pins 39 , 41 to return to the fully open position where the second flat section of the outer wall of the pivot pin rests on a bottom flat surface of the associated notch ( see fig8 a ). however , once the top housing section 20 has reached the partially open position of fig8 b , a small amount of further movement in direction y will cause the top housing section 20 to quickly move to the closed position shown in fig8 c as pivot pin 39 will rotate due to gravity until the first flat section 133 of the outer wall 131 of the pivot pin 39 rests on a bottom flat surface 137 of the notch 86 . regarding component construction , the top housing section 20 , slide cover 28 , hinge bracket 36 , support structure 45 of the refill unit 44 , frame 50 , fan 60 , chassis 80 , battery door 96 , bottom cover 102 , and clip 110 may be formed from a suitable polymeric material such as polyethylene , polypropylene , or polyester . in operation , the wearable chemical dispenser 18 will be clipped on a belt , purse or the like using clip 110 for that purpose . when a user moves the on - off button 29 along the side wall 22 of the top housing section 20 into the ‘ on ’ position , the openings 31 of the slide cover 28 align with the apertures 24 that are radially arranged in the top wall 23 of the top housing section 20 . the cam projection 32 of the slide cover 28 is driven into the rotating activation button 56 which then contacts the microswitch 75 to turn on the power supply to power the fan 60 by way of motor 93 . air is sucked by the fan 60 of the wearable chemical dispenser 18 in through apertures 24 and the openings 31 . as the air passes through fabric substrate 48 , the air treatment chemical mixes into the air and a mixture of air and air treatment chemical is then blown radially out openings 91 ( preferably down along pants or dresses ). a user can rotate the clip 110 as described above . while the present device is primarily intended to be used as a wearable item carried with a human when outdoors , it can also be laid flat , with the clip 110 downward and the top housing section 20 upward , on a picnic table or the like . when used in this manner it can provide protection to an area during a picnic or similar outdoor activity . hence , the device is much more compact and lightweight , yet still effective . further , the cost of operation from a battery standpoint is reduced . the device can more comfortably be used when seated , and provides greater control over dispensing direction . also , installing a replacement active refill is easier . these advantages are achieved at lowered cost , and provide a reliable construction . in the wearable dispenser , the intake grill size is designed to work in concert with an improved fan which falls within a specific range of fan blades , size and blade angle . a low current draw motor is recessed into the axial hub of the fan design . the airflow exits through 270 of output vents . this combination of design features results in an ideal balance of airflow and minimal power consumption that results in a highly efficient system , which produces good insect repellency and usage duration in a relatively small , lightweight unit . while an example embodiment has been described above , it should be appreciated that there are numerous other embodiments of the invention within the spirit and scope of this disclosure . for example , the device can be powered by a different source of energy ( e . g . a solar power panel ), other forms of actives can be dispensed along with or in substitution for the insect control ingredients ( e . g . a fragrance or deodorizing chemical ), and even when an insect control ingredient is dispensed it need not be one focused on controlling mosquitoes ( e . g . chemicals for repelling other flying or crawling insects or pests can be used ). hence , the invention is not to be limited to just the specific embodiments shown or described . provided herein are wearable dispensing devices capable of dispensing insect control chemicals and / or other air treatment chemicals adjacent a human body . | 0 |
the invention will be understood more fully from the detailed description given below and from the accompanying drawings of embodiments of the invention which , however , should not be taken to limit the invention to the specific embodiments described , but are for explanation and understanding only . fig2 illustrates one embodiment of an audio amplifier system 20 according to this invention . the system includes an amplifier , which may optionally be a multi - stage amplifier chain . the amplifier stage ( s ) may optionally be equipped with feedback loop ( s ). the feedback loop of at least one stage of the amplifier , preferably the final power amplifier stage , is coupled to receive a signal 22 or other indicator from the volume control mechanism . this signal dynamically adjusts the feedback loop , to set the gain of the amplifier . this signal also dynamically adjusts the bias setting of the bias generator , to set the bias provided to the amplifier stage ( s ). the bias generator ( or , alternatively , the volume control mechanism ) monitors and derives a control value from the volume control setting . the bias generator modifies the quiescent bias currents provided to the amplifier , to satisfy only the maximum signal level possible at the current volume control setting . in this manner , the bias current and hence the power consumption of the system can be reduced as the volume setting is reduced . audio systems are rarely used at their maximum volume setting , and using this technique will reduce power consumption during most operating conditions . the amplifier system is coupled to be powered by a power source which , in many embodiments , may be a battery . the output of the amplifier system is coupled to drive a transducer such as a headphone or loudspeaker . fig3 illustrates one embodiment of an audio amplifier system 30 similar to that of fig2 . the amplifier system includes an output amplifier 32 with a combined feedback loop and volume control mechanism 34 , implemented as a tap selector and a resistor chain 36 between the output node and the input node . the volume is set by selecting a suitable point ( tap ) along the resistor chain for the feedback point of the amplifier . selecting a tap closest to the output will provide the minimum gain and thus the lowest volume setting . selecting a tap closest to the input will provide the maximum gain and thus the highest volume setting . the tap selector is typically implemented as an array of switches ( not shown ) controlled by a digital word ( volume setting ). the same digital volume setting word can be used to control the bias of the amplifier , as previously described , via a connection 38 to the bias generator . fig4 illustrates an audio amplifier system 40 according to another embodiment of this invention . in this embodiment , the user - settable volume control mechanism is coupled to adjust the bias produced by the bias generator , and to directly adjust the amplifier rather than a feedback loop of the amplifier . the volume control mechanism controls the gain of the amplifier by altering the effective multiplier number or “ size ” of the amplifier . fig5 illustrates one embodiment of an audio amplifier circuit 70 similar to that of fig4 . the circuit includes an input stage ( is ) which receives a signal from an input terminal , and provides gain and complementary output signals to a bias and driver top side circuit ( bdts ) and to a bias and driver bottom side circuit ( bdbs ). the bdts receives the output from the input stage and provides an output signal that is capable of driving and suitably biasing the relatively large output devices connected to the vdd rail . the bdbs accepts another output from the input stage and provides an output signal that is capable of driving and suitably biasing the relatively large output devices connected to the vss rail . one suitable way to implement the output stage of the amplifier is to configure the output stage as multiple parallel devices which can be independently or sequentially powered down as the volume setting is reduced . in this manner , the output bias current , which flows between output devices 76 and 90 , and between output devices 80 and 94 , and between output devices 84 and 98 , etc ., can be reduced as the output swing requirements are reduced . since the output bias current is generally a dominant component of the overall power consumption , large power savings can be made . the circuit includes a plurality of parallel output stages 76 , 90 , 80 , 94 , 84 , 98 , 88 , and 102 , coupled in parallel to drive the output node vout . the number , size , and / or power handling capacities of the various output stages can be selected according to the needs of the application at hand , and particularly in view of an anticipated volume setting usage model . in the example shown , the first output stage comprising devices 76 and 90 has a multiplier ( m ) value of n and is always active and directly coupled to the output . n can be any value suitable to create a minimum bias current that performs correctly for the minimum signal level with all other amplifier devices switched off . in some applications , n will be greater than 1 . the values n , 1 , 2 , 4 , etc . are for illustration only ; in practice , the values do not need to be integer multiples . a second output stage comprising devices 80 and 94 has a multiplier value of 1 and is coupled to be enabled and disabled by switches 78 and 92 . a third output stage comprising devices 84 and 98 has a multiplier value of 2 and is coupled to be enabled and disabled by switches 82 and 96 . a fourth output stage comprising devices 88 and 102 has a multiplier value of 4 and is coupled to be enabled and disabled by switches 86 and 100 . the switches are controlled by a binary weighted control word which may , in some embodiments , also be used to set a digitally controlled volume control ( not shown ). the binary weighted control word may be derived from the same digital signal that is used as an input to the digital volume control ( not shown ). amplifier output stages having a larger multiplier number ( m ) are able to drive larger output voltage swings into the loudspeaker load , but the output bias currents also increase by a factor of the multiplier m . by allowing the effective aggregate size of the amplifier output stage , and hence the overall output stage biasing current , to be adjusted by the volume control , the amplifier can be better optimized to match the output signal swing conditions while saving power . when one component is said to be “ adjacent ” another component , it should not be interpreted to mean that there is absolutely nothing between the two components , only that they are in the order indicated . the various features illustrated in the figures may be combined in many ways , and should not be interpreted as though limited to the specific embodiments in which they were explained and shown . those skilled in the art , having the benefit of this disclosure , will appreciate that many other variations from the foregoing description and drawings may be made within the scope of the present invention . indeed , the invention is not limited to the details described above . rather , it is the following claims including any amendments thereto that define the scope of the invention . | 7 |
in the following description , a preferred embodiment of the invention is described with regard to preferred process steps and data structures . however , those skilled in the art would recognize , after perusal of this application , that embodiments of the invention may be implemented using one or more general purpose processors ( or special purpose processors adapted to the particular process steps and data structures ) operating under program control , or other special purpose circuits , and that implementation of the preferred process steps and data structures described herein using such equipment would not require undue experimentation or further invention . fig1 shows a block diagram of a system for security information acquisition . a system 100 for security information acquisition includes at least one client device 110 , at least one certification server 120 such as a ca ( certification authority ), at least one security information server 130 such as a tsip ( trusted security information provider ), and a communication network 140 for communication . the client device 110 includes a processor 111 , a program and data memory 112 , and a nonvolatile memory 113 , and possibly other elements such as input and output peripherals . in a preferred embodiment , the client device 110 has relatively few processing resources or memory resources , and is designed to use relatively minimal amounts of the nonvolatile memory 113 . for example , the client device 110 can comprise a “ set - top box ” used with a television set for receiving and decoding broadcast information in conjunction with interactive or personalized information . the certification server 120 includes a physical embodiment of a public or private ca , and includes a set of binding between keys and identified parties . the certification server 120 provides certificates 121 , each of which can identify to the client device 110 the binding between a particular public key and a particular identified party . the certification server 120 digitally signs each certificate 121 , to assure those client devices 110 trusting that particular certification server 120 that the certificate 121 is accurate and trustworthy . in a preferred embodiment , the certification server 120 verifies that a particular identified party has the right to use a particular public key , such as using techniques stated in a cps ( certification practices statement ) for the ca . one example such cps is publicly available from verisign , inc ., or on the internet at the url “ http :// www . verisign . com /”. in a preferred embodiment , several terms used herein , including “ key ” or “ key pair ,” “ ca ” or “ certification authority ,” “ encryption ” and “ decryption ,” and “ digitally signed ,” refer to those concepts as they are known in the art of public key cryptography , however , alternative embodiments may use other and further forms of authentication and certification , using other forms of cryptography either in addition to or instead of public key cryptography , and are within the scope and spirit of the invention . public key cryptography is known in the art of communication . each key ( or key pair ) is a pair comprising one public key and one private key . documents are encrypted by applying an encryption technique using the recipient &# 39 ; s public key , and decrypted by applying a decryption technique using the recipient &# 39 ; s private key . documents are digitally signed by applying the same encryption technique using the sender &# 39 ; s private key , and digital signatures are verified by applying the same decryption technique using the sender &# 39 ; s public key . in a preferred embodiment , the actual digital signature technique is performed with regard to a document digest or secure hash ( such as the known functions md 5 or sha - 1 ), selected responsive to the document and usable to detect any alteration in the document . other and further information about public key cryptography can be found in the following reference : “ the public - key cryptography standards ( pkcs )” ( version 1 . 5 ), publicly available from rsa data security , inc ., and on the internet at the url “ http :// www . rsa . com / rsalabs / pubs / pkcs /”. the certification server 120 also provides at least one particular type of certificate 121 , called a “ self - authenticating certificate ,” which is self - signed by the certification server 120 . the certification server 120 can provide a self - authenticating certificate 121 for itself , called a “ root certificate ,” which is self - signed by the certification server 120 using the private key counterpart to the public key included in the certificate . the certification server 120 can also provide a certificate 121 for a deputy certification server 120 . in a preferred embodiment , the communication network 140 can include an internet or intranet , or a switching network such as a telephone network . there is no particular need for the communication network 140 to comprise a trusted communication path . the security information server 130 preferably includes a physical embodiment of a tsip . in alternative embodiments , the security information server 130 may be coupled to a tsip and provide an online presence for that tsip . the security information server 130 provides an sio ( security information object ) 131 , which includes information about certification servers 120 to be trusted by the client 110 . each sio 131 can include information indicating a new trusted certification server 120 , modifying information about a known certification server 120 , or revoking the trustworthiness of a certification server 120 . the security information server 130 also provides a sequence of root certificates 132 to authenticate the tsip ( itself ) to the client device 110 . each root certificate 132 is self - authenticating ( it is digitally signed by the security information server 130 itself ). root certificates 132 are described in further detail with regard to fig2 . the security information server 130 can also provide certificates 121 for any deputy security information servers 130 . the client device 110 includes in its nonvolatile memory 113 sufficient information to reach the security information server 130 and to obtain trusted information from the security information server 130 ( such as a current root certificate 132 or sufficient information to obtain a current root certificate 132 ). when the security information server 130 provides an sio 131 to the client device 110 , the latter has information about at least one trusted certification server 120 . when the trusted certification server 120 provides a certificate 121 to the client device 110 , the latter has sufficient information to conduct secure communications using the communication network 140 , even when the communication network 140 is not a trusted medium . fig2 shows a data block diagram of a chain of root certificates . the security information server 130 generates two key pairs 201 , key pair 201 r 1 and key pair 201 r 2 . of these , key pair 201 r 1 is an active key pair , while key pair 201 r 2 is a dormant key pair intended for future use . each root certificate 132 is self - authenticated ( it is digitally signed by the security information server 130 using its own private key ). the root certificate 132 c 12 for key pair 201 r 1 and key pair 201 r 2 includes the following elements : the public key 211 for key pair 201 r 1 ; a validity period indicator 212 ( including at least an ending date for validity , and preferably including a beginning date for validity ); and a digest 213 ( or secure hash ) of the public key for key pair 201 r 2 . the root certificate 132 is digitally signed by the security information server 130 using the private key for key pair 201 r 1 . when the root certificate 132 c 12 expires ( or in a preferred embodiment , some time before the root certificate 132 expires ), the security information server 130 generates a new key pair 201 r 3 and issues a root certificate 132 c 23 for key pair 201 r 2 and key pair 201 r 3 . the root certificate 132 c 23 for key pair 201 r 2 and key pair 201 r 3 is digitally signed using the private key from key pair 201 r 2 . similarly , if the root certificate 132 c 12 is compromised , the security information server 130 generates a new key pair 201 r 3 and issues a root certificate 132 c 23 for key pair 201 r 2 and key pair 201 r 3 , thus revoking root certificate 132 c 12 . each root certificate 132 c ij for the key pair 201 r i and the key pair r j is digitally signed using the private key for key pair 201 r j . each root certificate 132 c ij for the key pair 201 r i and the key pair r j includes a digest 213 for the public key for key pair 201 rj , creating a chain from the root certificate 132 c ij to a next root certificate 132 c jk . in a preferred embodiment , k = j + 1 and j = i + 1 when root certificate 132 c jk is next in the chain after root certificate 132 c ij . the client device 110 having the certificate 132 c ij is able to determine that the root certificate 132 c jk is trustworthy upon receipt from the security information server 130 . the active root certificate 132 c ij is the last distributed certificate in the chain , is digitally signed using the active key pair r i , and includes a digest 213 for the for the public key for the dormant key pair 201 r j . the client device 110 records in its nonvolatile storage ( preferably a read - only persistent storage such as rom ), a base root certificate 221 , comprising the current root certificate 132 at the time the client device 110 is built or configured for shipping . the client device 110 also maintains access to a current time and date ( such as using a clock or provided by a user ), to determine if any particular root certificate 132 has expired . the client device 110 validates any new root certificate 132 using the procedure it uses for validating an sio 131 , described with reference to fig4 . fig3 shows a data block diagram of a security information object . a sequential chain 133 of root certificates 132 , including at least a starting root certificate 132 cx and continuing in sequence to the most recently issued root certificate 132 , i . e ., the active root certificate ; a trust data object 134 including information about at least one certification server 120 , digitally signed by the security information server 130 using the active root key pair 201 . the security information server 130 transmits an sio 131 to each client device 110 whenever any one of the following events occurs : the security information server 130 issues new information about one or more certification servers 120 ; or the security information server 130 issues a new root certificate 132 . fig4 shows a process flow diagram of a method for security information acquisition . a method 400 is performed by the client device 110 to validate each sio 131 . at a flow point 410 , the client device 110 is ready to receive an sio 131 . at a step 411 , the client device 110 receives an sio 131 and prepares to validate it . at a step 412 , the client device 110 determines if its base root certificate 221 is part of the sequential chain 133 . if not , the method 400 proceeds with the step 413 . if so , the method 400 proceeds with the step 414 . at a step 413 , the client device 110 presumes that its base root certificate 221 immediately precedes the first root certificate 132 in the sequential chain 133 . the client device 110 attempts to validate that first root certificate 132 using its own base root certificate 221 . if so , the method 400 proceeds with the step 414 . if not , the attempt to verify the sio 131 fails and the method 400 reverts to the flow point 410 . at a step 414 , the client device 110 traces down the sequential chain 133 to determine a most recent root certificate 132 for the security information server 130 . to perform this step , the client device 110 performs the following sub - steps : at a sub - step 414 ( a ), the client device 110 verifies each of the digital signatures for each of the root certificates 132 in the sequential chain 133 . at a sub - step 414 ( b ), the client device 110 verifies that each of the root certificates 132 in the sequential chain 133 is properly linked to its successor . for each root certificate 132 in the sequential chain 133 , the client device 110 determines the digest 213 ( or secure hash ) of the public key for its successor , and verifies that the digest 213 for the successor is included in that root certificate 132 . at a step 415 , the client device 110 verifies that the most recent root certificate 132 is currently valid , that is , that it has not expired . at a step 416 , the client device 110 makes the most recent ( active , currently valid ) root certificate 132 its new base root certificate 221 . this allows the client device 110 to more quickly verify any sio 131 it receives in the future , and protects the client device 110 against any compromised root certificates 132 . however , if the client device 110 is reset or the new base root certificate 221 is corrupted , the client device 110 can revert to the base root certificate 221 stored in its permanent read - only memory . at a step 417 , the client device 110 verifies the digital signature on the trust data object 134 , using the new base root certificate 221 . at a flow point 420 , the client device 110 has verified the sio 131 and implements the information in the trust data object 134 . although preferred embodiments are disclosed herein , many variations are possible which remain within the concept , scope , and spirit of the invention , and these variations would become clear to those skilled in the art after perusal of this application . | 7 |
embodiments of the present invention will be illustrated in detail referring to drawings . in this specification , a pixel electrode and facing electrode correspond to either an anode or cathode so as to constitute a pair of electrodes . all layers provided in between them are generically called el layers , and the hole injection layer , hole transportation layer , light emitting layer , electron injection layer and electron transportation layer are included in this . [ 0046 ] fig8 shows the sectional structure of an organic el element . organic el emits light when electric field is applied to electrodes and electric current is passed through an el layer . conventionally , only fluorescent emission due to returning from singlet excited state to ground state was used , however , as results of recent studies , phosphorescence emission due to returning from triplet excited state to ground state can be utilized effectively and efficiency is improved . usually , a translucent electrode 3 is formed on a translucent substrate 2 such as a glass substrate and plastic substrate , then , an el layer 5 and a facing electrode 6 are formed in this order . in general , an anode is constituted of a translucent electrode such as ito and the like , and a cathode is a non - translucent electrode constituted of a metal , in many cases . though not shown in fig8 since an organic el element shows remarkable deterioration in properties by moisture and oxygen , in general , reliability thereof is insured by filling an inert gas so that an element does not contact to moisture and oxygen , then , using another substrate , or conducting so - called sealing by vapor deposition of a thin film . when an organic el element is used as a display , the mode can be roughly classified into a passive matrix mode and active matrix mode depending on the electrode constitution and driving method , as for lcd . in the passive matrix mode , a pair of electrodes is constituted of a horizontal electrode and vertical electrode mutually crossing while sandwiching an el layer so that its structure is simple . however , for displaying an image , moment brightness has to be enhanced by the multiple of the number of scanning lines by time divisional scanning , and in displays of usual vga or more , moment brightness of organic el of over 10000 cd / m 2 is necessary , causing a lot of practical problems as a display . in the active matrix mode , a pixel electrode is formed on a substrate on which tft or the like is formed , and an el layer and facing electrodes are formed , namely , its structure is complicated as compared with the passive matrix method , however , it is advantageous as an organic el display in many points such as light emitting brightness , consumption power and crosstalk . further , a display of active matrix mode , using a polycrystalline silicon ( polysilicon ) film or a continuous grain boundary silicone ( cg silicon ) film , manifests higher electric charge mobility than an amorphous silicon film , therefore , it can treat tft with large electric current and is suitable for driving of organic el which is a current driven element . since polysilicon tft and cg silicon tft can move at high speed , various control circuits , conventionally treated by exterior ic , are formed on the same substrate as for a display pixel , and there are a lot of merits such as reduction of the size , lowering the cost , multi - functioning and the like of a display . [ 0052 ] fig1 shows a typical pixel circuit constitution of an active matrix organic el display . in addition to bus lines such as a scanning line g 11 , data signal line d 12 and power supply line v 13 , the apparatus comprises switching tft 14 , gate retention capacity 15 , driving tft 16 and el element 17 . when a gate of switching tft , selected by the scanning line g , is opened and signal voltage corresponding to emitting strength is applied from the date signal line d to a tft source , a gate of driving tft is opened in analogue - wise responding to magnitude of signal voltage , and this condition is retained in gate retention capacity . when voltage is applied from the power supply line v to a source of driving tft , electric current corresponding to the degree of opening of a gate flows into an el element , to cause light emission in gradation depending on the magnitude of signal voltage . fig1 shows the structure of an actual display in which pixels 18 are placed in a form of matrix . even under passive matrix mode , a simple display having a small number of scanning lines can realize a practical apparatus utilizing the simplicity of the structure . further , development of a phosphorescent emitting material is being progressed in addition to conventional fluorescent emitting materials , and emitting efficiency is improved significantly . by utilizing these light emitting materials having high light emitting efficiency , there is a possibility of solving the conventional problem in the passive matrix mode . also a top emission structure , in which light emission 10 is taken out toward the opposite direction of a substrate as shown in fig9 is under investigation . in contrast to the top emission structure , a structure shown in fig8 is called a bottom emission structure in some cases . in the top emission structure , particularly in a display of active matrix mode , the light emitting area rate is not limited by circuit constitutions such as tft and bus lines , so that higher multi - functional and complicated circuits can be formed . therefore , they are being developed as a promising technology . in the present invention , any of the above mentioned technologies may be used in organic el . the method of attaining colorization includes a cf mode in which a white light emitting layer and color filters ( cf ) of three colors r , g and b are combined , and a ccm ( color changing medium ) mode in which a blue light emitting layer and an r and g fluorescent converting dye filter are combined , in addition to a three color juxtaposition mode in which organic el materials of the most basic three colors r , g and b are precisely placed per each pixel of a display . when colorization modes are compared , in the cf method , a white light emitting material is necessary , and an apparent white organic el material for illumination use is realized . however , a real white organic el material having spectra of three colors r , g and b is not realized yet , and there is a shortcoming that the utilizing efficiency of light emission will become one - third , due to the use of color filters . in the ccm mode , only a blue emitting material is used , therefore , its light emitting efficiency and r - g converting efficiency of a ccm filter are important . however , sufficient efficiency cannot be obtained easily , and is not practical yet . the cf mode is insufficient in the point of color reproduction , in the same way that lcd of the cf mode has drawbacks in reproducing tv images . the ccm mode is also one kind of filter mode , and is common in the above respect , and the three color juxtaposition mode is excellent in color reproduction in that composition of each color light emitting material is slightly adjusted . since the cf mode and ccm mode have shortcomings such as increase in the thickness of an element due to the use of filters , increase in the number of parts , and the like , thus the three color juxtaposition mode is favorable overall . as the mode of forming three color juxtaposition fine pixels , a mask vacuum vapor deposition method is used in the case of a low molecular weight material , and in the case of a high molecular weigh material , it is made into a solution and an ink jet method , printing method , transferring method and the like are used . recently , a low molecular weight material which can be coated is also being developed . in the case of a three color juxtaposition color display , the mask vacuum vapor deposition method of a low molecular weight material has a problem that it is difficult to respond to a large scale display and to produce a large number of displays using a large sized substrate , due to restriction of a vacuum apparatus and a vapor deposition mask . this means that there is no problem in manufacturing of trial manufacturing level in the development , however , requests of the market cannot be responded in terms of tact and cost in the full manufacturing stage . on the other hand , high molecular weight materials and low molecular weight materials which can be coated can be formed into a film by wet processes such as an ink jet method , printing method , casting method , layer - by - layer self - assembling method , spin coating method , dipping method and the like . therefore , the above mentioned problems for responding to a large scale substrate are scarce , and particularly in the case of an ink jet method , manufacturing of a highly precise display is also possible so that this method can be the most promising method in the future . in the mask vacuum vapor deposition method , when a light emitting material is selectively placed on a pixel portion , most of the material adheres to a mask , leading to remarkable decrease in material utilizing efficiency . in contrast , the ink jet method is a method of the highest material utilizing efficiency since a light emitting material can be selectively placed only on necessary pixel portions . in the present invention , treatment which may cause deterioration of the el layer such as heating treatment is not carried out . and an organic el element shown in fig4 with film thickness distribution within a pixel , is used . in such an organic el element , the inventors have found that , as shown in fig1 the light emitting region is increased and decreased by voltage variation . fig1 ( a ) shows a state in which the voltage is below light emitting threshold . as the voltage increases , the region of the light emitting portion 22 gradually increases , and the light emitting region is saturated as shown in fig1 ( d ). conventionally , for example , by an ink jet method , details are explained in “ color polymer el display ”, vol . 22 , no . 11 , o plus e , p1433 - 1440 by inoue and “ characterization of light - emitting polymer devices prepared by ink - jet printing ”, we - 07 , proceedings of the 10 th international workshop on inorganic and organic electroluminescence ” by morii et al . however , the phenomena which the inventors have found are not described in them . in paragraph no . 0010 of jp - a no . 2002 - 164181 , there is a description that if a part of the el layer is thin within the facing electrode region , electric field will concentrate to the thin el layer part , and light emission will occur only at the thin el layer part . however , the thickness of the thin el layer stated here is extremely thin such that the facing electrode will short - circuit . if the film thickness is such that short - circuit of the electrode will not occur , the above phenomenon will not usually occur . in the present invention , the phenomenon as in the above mentioned jp - a no . 2002 - 164181 will not occur by forming the thinnest part of the light emitting layer by a thickness of not less than 10 nm , preferably not less than 20 nm within the element region where an electric field is applied to a pair of facing electrodes . further , in the element region where an electric field is applied to a pair of facing electrodes , by forming the thickness of the thickest part of the light emitting layer is within 300 %, preferably within 200 % of the thickness of the thinnest part , an element in which the light emitting region is increased and decreased by the voltage variation , as shown in fig1 can be manufactured stably . if the thickness of the thinnest part is too thin , short - circuit of the electrodes will be a problem as mentioned above . on the other hand , if it is too thick , voltage to apply an efficient electric field to the light emitting layer will be high , so that 500 nm is a practical upper limit . the statement “ preferably ” for the thinnest film thickness and the thickness ratio of the thickest film thickness to the thinnest film thickness shows that better reproduction stability can be obtained , manufacturing yield can be improved and cost superiority can be improved by substituting each first constitutional region with the second constitutional region . in the present invention , the light emitting layer is preferably a meniscus shape , that is , concave shape in which the center part is the thinnest part or convex shape in which the periphery part is the thinnest part . particularly , since it is easy to be formed , concave shape in which the center part is the thinnest part is preferable . in view of preventing electrode formed on the light emitting layer from disconnecting , these meniscus shapes are preferably formed with gently - sloping surfaces . [ 0070 ] fig2 is a pattern diagram of the element light emitting brightness property shown in fig1 of the present invention . fig1 ( a ) shows a state in which the voltage is below light emitting threshold . as the voltage increases , the region of the light emitting portion 22 gradually increases . as the voltage increases as in fig1 ( b ), fig1 ( c ) and fig1 ( d ), the brightness per unit area locally increases as the light emitting region increases . however , since the light emitting region will be saturated at a certain voltage , it appears to have a gentle non - liner property . this gentle non - liner property derives from the saturation of the light emitting region . therefore , it is the same for an electric current . to drive the organic el element of the present invention as a display , a digital gradation driving method is preferable . as the circuit constitution and driving method of an organic el display , other than the basic circuit constitution of fig1 and fig1 , a method in which the number of tft is further increased such as “ pixel - driving methods for large - sized poly - si am - oled displays ” asia display / idw ′ 01 p . 1395 - 1398 by yumoto et al . is reported . however , these are basically conventional analogue gradation driving methods in which the brightness is controlled according to an optional voltage or current of the voltage - brightness property or current - brightness property of the organic el element . in the organic el element of the present invention , the brightness of these elements , which are pixel unit of the display , changes according to two different factors , increase and decrease of the light emitting region , and increase and decrease of the local brightness . therefore , from practical aspect such as evenness and reproduction property within a display surface of certain area or more , it is difficult to control the brightness accurately according to an optional voltage or current . in contrast , with the digital driving method as shown in fig2 in which off state is controlled by the state of fig1 ( a ), and on state is controlled by the state of fig1 ( d ), control of the brightness is easy and effective . to carry out gradation display required for a display by a digital driving method , it is effective to use a time divisional gradation driving method , an area divisional gradation driving method or a combination of the time divisional gradation driving method and area divisional gradation driving method . techniques for digital gradation driving of an organic el element include time divisional gradation by mizukami et al . “ 6 - bit digital vga oled ” sid ′ 00 p . 912 - 915 , area division gradation by miyashita et al . “ full color displays fabricated by ink - jet printing ” asia display / idw ′ 01 p . 1399 - 1402 and a combination of the time divisional gradation and area divisional gradation “ color polymer el display ”, vol . 22 , no . 11 , o plus e , p1433 - 1440 by inoue . the above are to compensate the influence of the variation of driving tft ( 16 of fig1 ) within the display , in case of an active matrix display . in formation of a polysilicon thin film on a substrate , the above are employed because a technique to form an even film , which determines mobility of polysilicon film such as size of a crystal grain and control of grain boundary , is not sufficiently developed . in other words , if the technique for forming an even polysilicon film is improved , necessity will decrease because the above mentioned analogue gradation is advantageous in basic property such as multitude of gradation numbers and low power consumption . in contrast , in the present invention , the digital gradation driving method is essentially necessary . it is till important even though the technique for forming an even polysilicon film is improved . also , it is important in the passive matrix displays . as mentioned above , the present invention is naturally not known , but also is clearly different from any of the known technique , and the effect is remarkable . as device 20 shown in fig1 equipped with a display 1 , provided by using the above mentioned present invention , a portable telephone provided with an operating portion 19 and a terminal of pda ( personal digital assistant ) type , pc ( personal computer ), tv receiver set , video camera , digital camera , and the like can be listed . the present application has been illustrated above , and the present application will be illustrated further in detail based on examples . the following solution was prepared as an example of the present invention . polyvinylcarbazole 70 parts by weight oxadiazole compound 30 parts by weight coumarin 6 (* fluorescent dye ) 1 part by weight 1 , 1 , 2 - trichloroethane ( solution ) 633 parts by weight a substrate on which electrodes and partitions are formed as shown in the sectional form in fig4 was prepared . partitions are placed so as to cover the electrode ends so that the partitions act also as electrode insulating layer . as the electrode , a transparent electrode such as ito , nesa film , izo and the like was formed into a film in thickness of 2000 å , and patterned by etching . the partition was formed to have a height of 5 μm using photosensitive acrylic resin . a transparent electrode is used in an element structure of bottom emission , and a transparent substrate is used . it is also possible that a metal is used as an electrode to give a top emission element structure . electrode opening part was formed into a rectangle shape of 100 μm × 300 μm . after cleaning of a substrate , pedot / pss ( polythiophene : bayer ch8000 ) with hole injecting property was coated by a thickness of 80 nm by spin coating , and baked at 160 ° c . to form a so - called buffer layer . by an ink jet method , the above mentioned organic el layer forming coating solution was discharged to pixel opening parts on pedot and dried at 80 ° c ., thereby formed a light emitting layer . subsequently , a mgag alloy ( mg : ag = 10 : 1 ) was vapor - deposited to give a thickness of 150 nm , and on this , ag was vapor - deposited to form a protective layer having a thickness of 200 nm , to form a cathode . when an active matrix display is manufactured by using so - called tft substrate , a cathode is formed on the entire surface , and in the case of manufacturing of passive matrix display , a cathode is formed in the form of stripes so as to cross at right angles with an electrode pattern on a substrate . the shape of the light emitting layer was observed with an atomic force microscope ( afm ), and meniscus shape as shown in fig4 was confirmed . an attempt of forming a flat light emitting layer without meniscus shape by adjusting solvent , concentration , viscosity and the like of the light emitting layer ink . however , the attempt could not be attained . by the same procedure , a film was formed so as the thickness of the thinnest part of the light emitting layer within the element region where an electric field is applied to a pair of facing electrodes is 10 nm , and further , the thickness of the thickest part of the light emitting layer in the element region where an electric field is applied to a pair of facing electrodes is within 300 % of the thickness of the thinnest part . the light emission of the pixel opening part was observed by applying direct electric field to the electrodes , and increase and decrease of the light emitting region by the voltage variation as shown in fig1 was confirmed . as for this display , non - voltage applied state is an off state , and the light emitting region saturating voltage applied state is an on state . an image signal was input to the display by connecting a time divisional gradation display control circuit by 6 bit divisional signal , and color display with excellent displaying property could be obtained . the same procedure as in example 1 was conducted except that a film was formed so as the thickness of the thinnest part of the light emitting layer within the element region where an electric field is applied to a pair of facing electrodes is 20 nm , and further , the thickness of the thickest part of the light emitting layer in the element region where an electric field is applied to a pair of facing electrodes is within 220 % of the thickness of the thinnest part . the light emission of the pixel opening part was observed by applying direct electric field to the electrodes , and increase and decrease of the light emitting region by the voltage variation as shown in fig1 was confirmed . as for this display , non - voltage applied state is an off state , and the light emitting region saturating voltage applied state is an on state . an image signal was input to the display by connecting a time divisional gradation display control circuit by 6 bit divisional signal , and color display with excellent displaying property could be obtained . the same brightness could be obtained with lower voltage driving as compared with example 1 . further , gradation inversion error has decreased and color display with improved image quality could be obtained . the same procedure as in example 1 and 2 was conducted except that the element structure was formed into a 2 bit pixel divisional . as in example 1 and 2 , an image signal was input to the display by connecting display control circuit of a combination of a time divisional gradation by 4 bit divisional signal and a pixel divisional gradation by 2 bit divisional signal , and color display with excellent displaying property could be obtained . even though a number of time divisional gradation is fewer than example 1 and 2 , that is , circuit load is reduced by reducing driving frequency , total of 256 gradation was possible and so - called full color display could be attained . a time divisional gradation of 6 bit or more will not be a problem in a case of connecting an external driving ic . however , in a case of integrating a driving driver onto a substrate with polysilicon , the gradation driving method of the present example is advantageous since an operation frequency will be a problem because its mobility is not high as crystalline silicon . examples of the present invention have been explained in the above . however , the present invention is not limited to the above . | 7 |
as to the fiber constituting the hose of the present invention and the air bag which is connected to the hose , there may be used polyamide fiber , polyester fiber , etc . although the present invention is not limited thereto . strength of the yarn is not less than 6 g / dtex , preferably not less than 7 g / dtex or , more preferably , not less than 7 . 5 g / dtex . the hose of the present invention can be prepared using a cylindrical weaving machine used for weaving a fire hose and the like . when a cylindrical weaving machine is used , there is no necessity of conducting a process for making a cylinder whereby the processing cost such as sewing can be reduced . in addition , it is not necessary to take the breakage from the sewed part into consideration and the reliability is increased . it is necessary that at least one side of the hose of the present invention is coated with rubber or with synthetic resin . examples of the rubber to be coated are neoprene rubber , ethylene propylene diene rubber and silicone rubber . examples of the silicone rubber are thermosetting addition polymerization silicone rubber and rtv silicone rubber of a two - liquid type although they are non - limitative . the silicone rubber may use silane coupling agent of an amino type , epoxy - modified silane coupling agent , silane coupling agent of a vinyl type , silicone coupling agent of a chlorine type , etc . for improving the adhesive property . as a result of improving the adhesive property , it is possible to increase the slip - off resistance . with regard to the synthetic resin , there may be used polyester , polyamide , elastomer of a polyester type , elastomer of a polyamide type , elastomer of a polyurethane type , etc . although they are non - limitative . the hose of the present invention may have a distribution hole in any shape or any size and it is preferred that the distribution hole is substantially square or rectangular where each side is located substantially parallel to or in a right angle to warp or woof constituting the hose . distribution hole in a circular shape is inferior to that in a square or rectangular shape in terms of the preference . that is because , when the shape of the distribution hole is circular , easily unraveled parts are formed at the area where ends of the warp and woof are crossed , resistance to gas flow at the area upon development of the air bag become big and the possibility of unusual breakage becomes high . fig2 shows hoses with square distribution holes , rectangular distribution holes , and with circular distribution holes . side lengths or diameter of the distribution hole is preferably 5 ˜ 40 mm or , more preferably , 10 ˜ 30 mm . when it is more than 40 mm , flow rate of the inflator gas becomes high and local heating is generated whereby breakage is resulted from such a part and that is not preferred . when it is less than 5 mm , many distribution holes are to be formed whereby the processing cost is needed and that is not preferred . although it is not necessary to particularly process the surrounding of the distribution hole , such a part may be fused by heat or may be sewed . it is preferred that the slip - off resistance of the warp and the woof of the hose of the present invention is not less than 10 n , more preferably not less than 15 n and , particularly preferably , not less than 20 n . when the slip - off resistance is less than 10 n , unusual deformation of the hose occurs near the distribution hole due to the inflator gas or the distribution hole becomes large by such a deformation whereby the distributing ratio is unable to be controlled and that is not preferred . when the distribution hole becomes large , the air bag for side collision may burst during the initial stage of its development and that is not preferred . slip - off resistance is able to be adjusted by the control of amount of the coat , amount of the additive or fineness of warp and / or woof constituting the hose . diameter of the hose is preferably 20 ˜ 60 mm or , preferably , 30 ˜ 50 mm . when the hose diameter is less than 20 mm , breakage is apt to occur while , when it is more than 60 mm , the hose is hardly received in the air bag for side collision and that is not preferred . crimp of the woof constituting the hose is preferably smaller than that of the warp . the woof is apt to be affected by tension and , in order to make the influence of heat as little as possible , the part which comes out of the surface is to be made small . accordingly , it is better that there is no crimp in the woof and the state of being covered by the warp is better . fineness of the yarn constituting the main body of the air bag for side collision is preferably 200 ˜ 600 dtex or , more preferably , 300 ˜ 500 dtex . when the fineness is more than 600 dtex , its receiving property becomes a problem . when it is less than 200 dtex , strength of the substrate cloth is insufficient resulting in a high possibility of burst even if distribution of the inflator gas is controlled and that is not preferred . fineness of single yarn of the multifilament constituting the main body of the air bag for side collision is preferably 2 ˜ 10 dtex or , more preferably , 3 ˜ 6 dtex . when the single yarn fineness is more than 10 dtex , rigidity of the substrate cloth becomes high and receiving property lowers . when it is less than 2 dtex , snapping of the single yarn or the like happens upon weaving whereby many disadvantages of the substrate cloth are resulted and that is not preferred . fineness of one multifilament of warp constituting the hose is - preferably not less than two - fold or , more preferably , not less than three - fold , of fineness of one multifilament constituting the main body of the air bag for side collision . when the fineness of warp of the hose is less than two - fold , the hose is apt to cause poor distribution by cutting - off of the warp in the distribution of the inflator gas and that is not preferred . fineness of one multifilament of woof constituting the hose is to be not less than three - fold or , more preferably , not less than five - fold , of fineness of one multifilament constituting the main body of the air bag for side collision . when the fineness of one multifilament of woof constituting the hose is less than three - fold , the hose is apt to cause poor distribution by cutting - off of the woof and that is not preferred . the present invention will now be illustrated in more detail by the followings examples . measurements in the examples are carried out in accordance with the following measuring methods . slip - off resistance : conducted according to “ method a ; method for pulling out the yarn ; resistance to sliding - off ” of jis l1096 . distribution test : into a test connecting tube where one side was closed by sewing was introduced nitrogen gas compressed to an initial pressure of 800 kpa to an extent of volume of 5 liters from another inlet which was not sewed and then the state of the distribution hole was observed . the test connecting tube was made in 2 m and five distribution holes having predetermined shape and size were set up every 30 cm from the inlet . with regard to the result of the evaluation , there was observed the state of the distribution hole by deformation of warp and woof at the nearest distribution hole from the nitrogen gas inlet in the hose after the test . shape of the observed distribution hole was evaluated according to the five stages of a to d . a tube was woven on cylindrical weaving machine using a polyamide 66 fiber having strength of 8 . 0 g / dtex , then a coating agent was uniformly applied thereon and setting was carried out at 140 ° c . for 5 minutes to prepare a hose for introduction and distribution of inflator gas . results of the examples and the comparative example of the hose for distribution of inflator gas manufactured as such are shown in table 1 . from the results of evaluation for examples 1 and 2 versus 4 and examples 5 versus 6 in table 1 , it is noted that , with regard to the shape of the distribution hole , deformation of the distribution hole is rarer in the case of square or rectangle ( examples 1 , 4 and 5 ) than in the case of circle ( examples 2 and 6 ). from example 1 and example 3 , it is noted that , when fineness of warp and woof is made large ( example 1 ), slip - off resistance becomes high and distribution hole is hardly deformed . from the result of example 7 and example 8 , it is noted that coating amount is proportional to slip - off resistance and that , when coating amount is high ( example 7 ), slip - off resistance is high and distribution hole is hardly deformed . from the result of example 7 and example 9 , it is noted that , when an epoxy - modified silane coupling agent is added as an auxiliary adhesive , slip - off resistance is improved ( example 7 ) and distribution hole is hardly deformed . it is also noted from table 1 that the distribution hoses of the inflator gas of the present invention ( examples 1 ˜ 9 ) are hardly deformed in terms of the shape of the distribution hole as compared with the inflator gas distribution hoses of comparative example 1 which is not coated with a coating agent and accordingly that they are suitable as distribution hoses . as fully illustrated hereinabove , in the distribution hose for inflator gas according to the present invention , breakage near the inlet of the inflator is prevented and gas is homogeneously distributed whereby it is now possible to provide a method for distribution of air bag for side collision having good developing property , having good receiving property and being advantageous in terms of cost . | 1 |
an embodiment of the present invention will be described in detail with reference to the accompanying drawings . as shown in fig1 , a flat panel display 1 according to this embodiment has a cathode substrate 20 having a substrate 21 made of glass or the like , an anode substrate 30 having an at least partially transparent front glass 31 , and a gate substrate ( gate electrode structure ) 10 which is disposed to be substantially parallel to the substrate 21 and front glass 31 . the substrate 21 of the cathode substrate 20 and the front glass 31 of the anode substrate 30 are arranged to oppose each other through a frame - like spacer glass and are adhered to the spacer glass with low - melting frit glass to form an envelope . the interior of the envelope is maintained at a vacuum degree on the order of 10 − 5 pa . the cathode substrate 20 has the substrate 21 described above , a plurality of substrate ribs 22 , and cathodes 23 . the substrate ribs 22 vertically extend on that surface of the substrate 21 which opposes the gate substrate 10 at a predetermined interval to be parallel to each other . the cathodes 23 are disposed on those regions of the substrate 21 which are sandwiched by the substrate ribs 22 to substantially form matrices when seen from the top . as the cathodes 23 , those obtained by fixing electron - emitting sources made of nanotube fibers such as carbon nanotubes or carbon nanofibers to the surfaces of metal members such as 42 - 6 alloy members can be used . the upper surfaces of the cathodes 23 have the same heights as those of the upper surfaces of the substrate ribs 22 . the anode substrate 30 has the front glass 31 described above , a plurality of black matrices 32 having rectangular sections , red -, green -, and blue - emitting phosphor films 33 r , 33 g , and 33 b , metal - backed films 34 serving as anodes , and a plurality of front ribs 35 having rectangular sections . the black matrices 32 are formed on that surface of the front glass 31 which opposes the gate substrate 10 to form stripes at a predetermined interval in a direction parallel to the substrate ribs 22 of the cathode substrate 20 . the phosphor films 33 r , 33 g , and 33 b are formed on those regions of the front glass 31 which are sandwiched by the black matrices 32 . the metal - backed films 34 are formed on those regions of the front glass 31 which are sandwiched by the phosphor films 33 r , 33 g , and 33 b . the front ribs 35 vertically extend on the black matrices 32 at a predetermined interval toward the gate substrate 10 . the front ribs 35 form rods or plates which are very thin as compared to their lengths . the front ribs 35 are made of a material having a small secondary electron emission ratio in consideration of secondary electron emission from the front ribs 35 , or a slightly conductive material so the front ribs 35 will not accumulate electrons . for example , a glass paste containing chromium oxide or the like , more specifically , one of np - 7800 series ( manufactured by noritake kizai k . k .) such as np - 7833 , can be used . the gate substrate 10 is sandwiched in the envelope by the substrate ribs 22 of the cathode substrate 20 and the front ribs 35 of the anode substrate 30 . the gate substrate 10 has a second insulating layer 11 which is arranged to oppose the cathode substrate 20 , a plurality of parallel ribs 12 which are formed on the anode substrate 30 - side surface of the second insulating layer 11 to be spaced apart from each other at a predetermined interval , gate electrodes 13 which are disposed between the ribs 12 , a first insulating layer 14 which is formed on the ribs 12 and gate electrodes 13 , a flat electrode 15 which is disposed on the first insulating layer 14 to serve as a field control electrode , and a plurality of gate ribs 16 which extend vertically on the flat electrode 15 at a predetermined interval toward the front glass 31 , run in a direction perpendicular to the front ribs 35 , and each have a rectangular section . the gate substrate 10 has electron - passing holes 17 which are formed at regions where the gate electrodes 13 and cathodes 23 intersect , and extend through the second insulating layer 11 , gate electrodes 13 , first insulating layer 14 , and flat electrode 15 . the gate substrate 10 excluding the gate ribs 16 will be referred to as a “ plate - like body ”. the second insulating layer 11 is made of , e . g ., frit glass or ppsq ( polyphenyl silsesquioxane ), and has a plurality of openings 11 a ( see fig7 a and 7b to be described later ) which are spaced apart from each other at predetermined intervals in the widthwise and longitudinal directions of the front ribs 35 . the openings 11 a , together with the openings of the gate electrodes 13 , first insulating layer 14 , and flat electrode 15 to be described later , form part of the electron - passing holes 17 . the ribs 12 are made of a vitreous insulating paste into rods or plates each having a rectangular section . the ribs 12 are formed on the second insulating layer 11 at the intermediate portions of the openings 11 a that are adjacent in either the widthwise or longitudinal direction . hence , the ribs 12 line up to be spaced apart from the adjacent ones at predetermined intervals . such ribs 12 serve as a guide to dispose the gate electrodes 13 to be spaced apart from each other at predetermined intervals . the gate electrodes 13 are formed of strip - like flat plates , e . g ., flat plates made of a conductor such as a 42 - 6 alloy . the gate electrodes 13 have openings 13 a ( see fig6 a and 6b to be described later ) at a predetermined interval in the longitudinal direction to form part of the electron - passing holes 17 . the first insulating layer 14 is made of , e . g ., frit glass . the first insulating layer 14 has openings 14 a ( see fig4 a and 4b to be described hereinafter ), which are substantially rectangular when seen from the top , at the equal interval to that of the openings 11 a of the second insulating layer 11 . the openings 14 a form part of the electron - passing holes 17 . the flat electrode 15 is formed of flat plates made of a conductor such as a 42 - 6 alloy . the flat electrode 15 has openings 15 a , which are substantially rectangular when seen from the top , at the equal interval to that of the openings 11 a of the second insulating layer 11 and that of the openings 14 a of the first insulating layer 14 . the openings 15 a form part of the electron - passing holes 17 . the flat electrode 15 not only accelerates electrons extracted from the electron - emitting sources of the cathodes 23 but also shields the electric field of the metal - backed films 34 serving as the anodes to prevent leaking light . the gate ribs 16 form rods or plates each having a rectangular section . the gate ribs 16 are formed on the flat electrode 15 at the intermediate portions of the electron - passing holes 17 that are adjacent in either the widthwise or longitudinal direction . for example , the gate ribs 16 are formed immediately on the ribs 12 . hence , the gate ribs 16 line up to be spaced apart from the adjacent ones at predetermined intervals . in the case of fig1 , the gate ribs 16 are formed in a direction perpendicular to the front ribs 35 . such gate ribs 16 are made of a material having a small secondary emission ratio in consideration of secondary emission from the gate ribs 16 , or a slightly conductive material so the gate ribs 16 will not accumulate electrons . for example , a glass paste containing chromium oxide or the like , more specifically , one of np - 7800 series ( manufactured by noritake kizai k . k .) such as np - 7833 , can be used . a method of forming the gate substrate 10 will be described with reference to fig3 a and 3b to fig8 a and 8b . first , the flat electrode 15 is prepared as shown in fig3 a and 3b . the plurality of openings 15 a which are substantially rectangular when seen from the top are formed in the flat electrode 15 in advance with a known etching method such as wet etching , dry etching , or electric field etching , such that they are spaced apart from each other by predetermined intervals . using a predetermined mask pattern , frit glass is printed and calcined on the flat electrode 15 with a known printing method such as screen printing . as shown in fig4 a and 4b , this forms the first insulating layer 14 having the openings 14 a , which form the electron - passing holes 17 , at positions corresponding to the openings 15 a of the flat electrode 15 . subsequently , using a predetermined mask pattern , a vitreous insulating paste is printed on the first insulating layer 14 with a known printing method such as screen printing . this forms the ribs 12 on the first insulating layer 14 , as shown in fig5 a and 5b . with the ribs 12 , the gate electrodes 13 can be positioned accurately . as shown in fig6 a and 6b , the gate electrodes 13 , in which the openings 13 a are formed in advance with a known etching method such as wet etching , dry etching , or electric field etching , are disposed at those regions on the first insulating layer 14 which are sandwiched by the ribs 12 . the surfaces of the gate electrodes 13 on the first insulating layer 14 side are entirely fixed to the first insulating layer 14 by adhesion with frit glass or the like such that the openings 13 a overlap the openings 14 a of the first insulating layer 14 . using a predetermined mask pattern , frit glass is printed and calcined on the ribs 12 and gate electrodes 13 with a known printing method such as screen printing . as shown in fig7 a and 7b , this forms the second insulating layer 11 having the openings 11 a , which form the electron - passing holes 17 , at positions corresponding to the openings 15 a of the gate electrodes 13 . subsequently , using a predetermined mask pattern , frit glass is repeatedly printed and calcined on that surface of the flat electrode 15 which is opposite to the surface where the first insulating layer 14 has been formed , with a known printing method such as screen printing . as shown in fig8 a and 8b , this forms the gate ribs 16 on the flat electrode 15 . alternatively , the gate ribs 16 can be formed in the following manner . first , a vitreous paste mixed with a resin that is cured by ultraviolet radiation is prepared . this paste is discharged from a tapered nozzle onto that surface of the flat electrode 15 which is opposite to the surface where the first insulating layer 14 has been formed . the paste is irradiated with ultraviolet rays so its surface is cured . in this state , the paste is calcined so it is cured to its interior . hence , for example , the gate ribs 16 having widths of 50 μm to 200 μm and heights of 1 mm to 2 mm can be formed . the gate ribs 16 having the above heights can be formed by conducting only once the series of steps of discharging the paste , ultraviolet radiation , and calcination . alternatively , the series of steps may be performed a plurality of number of times to form the gate ribs 16 to desired heights . in the above description , after the ribs 12 are formed , the gate electrodes 13 are disposed on the first insulating layer 14 . alternatively , the gate electrodes 13 may be disposed on the first insulating layer 14 after the gate ribs 16 are formed . this case will be described hereinafter . first , as shown in fig5 a and 5b , the ribs 12 are formed on the first insulating layer 14 , and thereafter the gate ribs 16 are formed on the flat electrode 15 . the second insulating layer 11 is formed on one surface of the gate electrodes 13 . the ribs 12 are formed to have substantially the same thicknesses as those of the gate electrodes 13 . then , the gate electrodes 13 on which the second insulating layer 11 is formed are fitted on those regions of the first insulating layer 14 which are sandwiched by the ribs 12 , from the surface where the second insulating layer 11 is not formed . at this time , the gate electrodes 13 may be positioned by adhering one end in the longitudinal direction of each gate electrode 13 on the first insulating layer 14 with frit glass or the like . the gate substrate 10 can be formed in this manner as well . in this case , the second insulating layer 11 is not formed on the ribs 12 . the second insulating layer 11 need not be formed on the ribs 12 as far as the gate electrodes 13 are not in direct contact with the cathodes 23 . the method of forming the gate substrate 10 has been described so far . the cathode substrate 20 and anode substrate 30 can be formed in the same manner as in the conventional case . the substrate ribs 22 of the cathode substrate 20 and the front ribs 35 of the anode substrate 30 can be formed by employing the method including ultraviolet radiation and calcination of the paste which has been described regarding the gate ribs 16 . the positional relationship between the gate substrate 10 and anode substrate 30 ( both are described above ) in the flat panel display according to this embodiment will be described with reference to fig9 . according to this embodiment , the front ribs 35 are formed on the front glass 31 of the anode substrate 30 , and the gate ribs 16 are formed on the flat electrode 15 of the gate substrate 10 . the gate ribs 16 are in contact with the front ribs 35 to support the anode substrate 30 . namely , the gate ribs 16 serve as a support member . in this manner , in the flat panel display of this embodiment , not only the front ribs 35 but also the gate ribs 16 are provided between the anode substrate 30 and gate substrate 10 . thus , the distance between the gate substrate 10 and anode substrate 30 can be increased to be larger than in a case wherein only the front ribs 135 are provided as in the conventional flat panel display . conventionally , the gate ribs cannot be formed on the gate substrate 110 . this is because of the following reason . the glass plate 111 having a thickness of about 0 . 1 mm is used as the insulating layer that separates the gate electrodes 113 from the flat electrode 112 . if the gate electrodes 113 and flat electrode 112 are respectively printed on the two surfaces of the glass plate 111 and the gate ribs are formed on the flat electrode 112 by repeating printing , the glass plate 111 may be broken . in view of this , according to this embodiment , the flat electrode 15 is formed of a conductive plate . then , even if the gate ribs 16 are printed on the flat electrode 15 by repeating printing , the first insulating layer 14 will not be broken , so the gate ribs 16 can be formed on the gate substrate 10 . in this manner , according to this embodiment , the gate ribs 16 can be formed on the gate substrate 10 . thus , the distance between the gate substrate 10 and anode substrate 30 can be increased to such a degree that even when a high voltage is applied to the metal - backed films 34 , abnormal discharge will not occur between the cathodes 23 and metal - backed films 34 . therefore , as shown in , e . g ., fig9 , if the gate ribs 16 and front ribs 35 are formed to have heights of 1 . 5 mm , the distance between the gate substrate 10 and anode substrate 30 becomes 3 . 0 mm . a high voltage of about 10 kv can be applied to the metal - backed films 34 , so that a high luminance can be realized . at this time , while the gate ribs 16 and front ribs 35 are formed to have widths of , e . g ., 0 . 2 mm in fig9 , they can be formed to have widths of about 0 . 05 mm to 0 . 2 mm . as a result , micropatterning can also be realized simultaneously . modifications of the gate substrate 10 will be described . the direction in which the gate ribs 16 are to be formed is not limited to the direction perpendicular to the front ribs 35 , as shown in fig1 , but may be a direction merely intersecting the front ribs 35 . the gate ribs 16 may be formed in a direction parallel to the front ribs 35 , like gate ribs 16 a of a gate substrate 10 a shown in fig1 . in this case , regarding the gate ribs 16 a and front ribs 35 , the gate ribs 16 a and front ribs 35 at opposing positions are in contact with each other . the gate ribs are not limited to the rods as shown in fig1 and 10 , but may substantially form matrices when seen from the top , which extend vertically on the flat electrode 15 , like gate ribs 16 b of a gate substrate 10 b shown in fig1 . in this case , the gate ribs 16 b are formed by repeatedly printing and calcining frit glass on the flat electrode 15 to a predetermined height using a predetermined mask pattern , with a known printing method such as screen printing . with the matrix shape , the gate ribs 16 b can improve the resistance against the pressures from the cathode substrate 20 and anode substrate 30 which result from the atmospheric pressure or the like . as in a gate substrate 10 c shown in fig1 a , focus electrodes 18 may be formed on the distal end faces of the gate ribs 16 which oppose the front ribs 35 . a positive potential equal to that applied to the flat electrode 15 is applied to the focus electrodes 18 . it was confirmed that with the focus electrodes 18 , electrons extracted from the cathodes 23 and emitted from the electron - passing holes 17 converge toward the centers of the phosphor films 33 r , 33 g , and 33 b from the side surfaces of the front ribs 35 . this may be because the strength of the electric field generated by the metal - backed films 34 which serve as the anodes is changed by the electric field generated by the focus electrodes 18 . the focus electrodes 18 can shield the cathodes 23 and gate electrodes 13 from the influence of the electric field generated by the metal - backed films 34 , so an electric field will not be generated by the potential difference between the gate electrodes 13 and the metal - backed films 34 which serve as the anodes . thus , abnormal discharge between the cathodes 23 and metal - backed films 34 , and leaking light can be prevented . the focus electrodes 18 can be formed by printing , e . g ., silver paste on the gate ribs 16 with a known printing method such as screen printing . the positions to form the focus electrodes 18 are not limited to on the gate ribs 16 shown in fig1 a which are perpendicular to the front ribs 35 . as in a gate substrate 10 d shown in fig1 b , focus electrodes 18 a can be formed on gate ribs 16 a which are parallel to the front ribs 35 . alternatively , the focus electrodes may be formed on gate ribs 16 b shown in fig1 which substantially form matrices when seen from the top . the focus electrodes may also be formed on those surfaces of the front ribs 35 which oppose the gate ribs 16 , 16 a , or 16 b . in place of the focus electrodes 18 described above , as shown in fig1 , a focus substrate ( focus electrode ) 40 may be arranged between the gate ribs 16 and front ribs 35 to be sandwiched by them . the focus substrate 40 is formed of a conductive plate made of , e . g ., a 42 - 6 alloy , and openings 40 a are formed in it , at positions corresponding to the electron - passing holes 17 of the gate substrate 10 , with a known etching method such as wet etching , dry etching , or field etching . with the focus substrate 40 , in the same manner as in the case provided with the focus electrodes 18 , the gate electrodes 13 can be electrically shielded so as to prevent an electric field from being generated by the potential difference between the gate electrodes 13 and the metal - backed films 34 which serve as anodes . consequently , abnormal discharge between the cathodes 23 and metal - backed films 34 , and leaking light can be prevented . the focus substrate 40 can be formed not only when the gate ribs 16 of the gate substrate 10 are perpendicular to the front ribs 35 , as shown in fig1 , but also when the gate ribs 16 of the gate substrate 10 are parallel to the front ribs 35 , as shown in fig1 . according to this embodiment , the electron - passing holes 17 form substantially matrices when seen from the top . the shapes of the electron - passing holes 17 are not limited to this , but can be set arbitrarily and freely , e . g ., substantially circular when seen from the top . according to this embodiment , one end in the longitudinal direction of each gate electrode 13 is adhered on the first insulating layer 14 with frit glass . alternatively , an adhesion layer made of frit glass or the like may be formed on the first insulating layer 14 , and the gate electrodes 13 may be disposed on the adhesion layer . in this case , the ribs 12 are formed on the adhesion layer as well . as has been described above , according to the present invention , the gate ribs 16 , 16 a , or 16 b are formed on one surface of the gate substrate 10 , 10 a , 10 b , 10 c , or 10 d . thus , the distance between the gate substrate 10 , 10 a , 10 b , 10 c , or 10 d and the metal - backed films 34 serving as the anodes can be increased . even when a high voltage is applied to the anodes , the cathodes 23 and gate electrodes 13 can be protected from the influence of the electric field generated by the anodes . thus , discharge between the cathodes 23 and the anodes can be prevented . as a result , a high luminance can be realized . | 7 |
with reference to fig1 and 2 , which show a plan view of the single - piece flat punched members made of cardboard or the like , for obtaining the covering part and the containing part , respectively , of a first embodiment of the present invention , it can be noted that the two above mentioned punched members are exactly alike . as a consequence only one of the punched members will be described in detail , in particular the one shown in fig1 whereas the components of the punched member of fig2 corresponding to those of fig1 with the same reference numerals will be distinguished with an apostrophy , fig1 includes six housings for eggs arranged in two parallel rows of three housings each . in 1 is shown a rectangular panel forming the top wall ( the corresponding panel 1 &# 39 ; in the punched member of fig2 constituting the bottom wall of the containing part ), a long edge of which is connected by means of a crease to a long edge of the rectangular panel 3 forming a first lower wall ( the corresponding panel 3 &# 39 ; in the punched member of fig2 constituting the upper wall of the containing part ), the opposite long edge of which is connected by means of a crease to a long side of a panel 4 of a second lateral wall , the long edge of which is connected by means of a crease to the longest bottom edge of a trapezoidal fastening wing 5 . in the formation of the two parallel rows , each of three half - housings for eggs , sets of cuts are provided in said punched member , the set of cuts for each of said half - housings including two cuts placed symmetrically and not merging , each comprising a first arch shaped portion 6 in the bottom wall panel 3 , with the removal of an arched strip of said panel , one end of which is joined to a second curved portion 7 extending transversally into the first lateral wall panel 2 or into the second lateral wall panel 4 according to the position of the half - housing , the corresponding ends of said two symmetrically opposed cuts being connected by first and second creases 8 and 9 , respectively , while a third crease 10 , parallel to the first and second ones , is formed in an intermediate position in registry with the above mentioned end of said first arch - shaped cut 6 . for the assembly into a three - dimensional form of the covering part and the containing part of the packaging for eggs of the present invention , starting from the respective punched members of fig1 and fig2 the wing 5 ( 5 &# 39 ;) is bent at a right angle with respect to the panel 4 ( 4 &# 39 ;) along the connection crease , the panel 3 ( 3 &# 39 ;) is folded over the panel 4 ( 4 &# 39 ;) along the respective connection crease lines , the panel 2 ( 2 &# 39 ;) is folded with respect to the panel ( 3 &# 39 ;), and the panel 1 ( 1 &# 39 ;) is folded with respect to the panel 2 ( 2 &# 39 ;), bringing the panel 1 ( 1 &# 39 ;) parallel to the panel 3 ( 3 &# 39 ;) and making the external face of the wing 5 ( 5 &# 39 ;) correspond with the corresponding portion of the internal face of panel 1 ( 1 &# 39 ;), providing at the same time for their fixing , for example with glue . with said parts in their three - dimensional shape , the portions of the respective punched members included between the pairs of symmetrically opposed cuts 6 and 7 ( 6 &# 39 ; and 7 &# 39 ;) are made to toggle with a spring action towards the interior , by folding along the creases 8 , 9 and 10 ( 8 &# 39 ;, 9 &# 39 ; and 10 &# 39 ;), so as to create in each of said parts half - housings for the eggs each of which is formed by a circular aperture in the panel 3 ( 3 &# 39 ;) and by an element retaining the egg in a damped way , said element being formed by the respective portions of the punched member toggled towards the interior of said covering and containing parts of the packaging . the covering part and the containing part of the packaging for eggs according to the present invention for assembly in a three - dimensional form are shown separated in fig3 and 4 , respectively , wherein one can see said half - housings each of which is apt to hold an egg cut transversally in half . in fig5 the packaging according to the invention is shown in the operative condition with eggs 11 contained in the respective completed housings , obtained from the coupling of corresponding half - housings , formed following the superimposition of the covering part on the containing part and following the fastening , using spots of glue dots , on the lower wall panel 3 of the former and on the top wall panel 3 &# 39 ; of the latter . as can be seen from fig5 the eggs contained in the packaging according to the invention are supported in a spaced relationship both with respect to the panels 2 , 4 and 2 &# 39 ;, 4 &# 39 ; of 9 lateral wall , by means of rounded protrusions formed on the external side of said circular apertures in the panels 3 and 3 &# 39 ; following the assembly , and also with respect to the panels 1 and 1 &# 39 ; of the top wall of the covering part and of the bottom wall of the containing part , respectively , by means of said retaining members which moreover provide for the absorption of the shock forces , without the respective eggs therein contained being affected . finally , it should be made clear that the diameter of each of said circular apertures made in the panels 3 and 3 &# 39 ; is slightly greater than the diameter of the maximum transverse section of a normal egg so as to allow the use of the packaging with eggs of different sizes . in fig6 and 7 , flat single - piece punched members are shown , wherein the covering part and the containing part , respectively , are obtained according to a second embodiment of the packaging of the invention . as can be seen upon inspection of said figures the above mentioned punched members are substantially similar to the corresponding punched members of fig1 and 2 of the former embodiment and they differ from these latter only in the fact that members are provided therein for the fastening of the covering part without recurring to the reciprocal glueing as before described . given that , in the punched members being considered ; components similar to those of the punched members of fig1 and 2 will be indicated with the same reference numerals used in the disclosure of the first embodiment of the invention . attention is drawn to the punched member in fig6 forming the covering part , wherein , in addition to all the components previously disclosed , four tags 12 are obtained , by means of cuts in the lower wall panel 3 , said tags being substantially shaped like the point of an arrow , of which two are placed with the respective bases integral with the edge of the panel 2 along the crease connecting it to the panel 3 , and the other two , opposed to the first ones , with the respective bases integral with the edge of the panel 4 along the crease connecting it to the panel 3 , each of said tags 12 being located in equidistant position between respective arch shaped cuts 6 adjacent to the panel 3 . to each of the tags 12 a respective rectangular wing 13 corresponds , in a similar position on the punched member of fig7 of the containing part , said wings being obtained by means of cuts in the panels 2 &# 39 ; and 4 &# 39 ; of the lateral wall , and integral with said panels along parallel and opposed base lines with respect to the connection creases of said panels with the panel 3 &# 39 ;. following the assembly in a three - dimensional form , in the same way as above described , of the cover and containing parts of the packaging , as respectively shown in fig8 and 9 , the tags 12 are again positioned in an upright position while the wings 13 are slightly bent towards the interior , then , on the overlapping of said two parts , ( see fig1 ) the tags 12 are introduced into corresponding holes , shown in 14 , formed in the panels 2 &# 39 ; and 4 &# 39 ; of the lateral wall , following folding of the wings 13 , to lock the covering part onto the containing part , said wings 13 pressing elastically over the respective tags 12 to prevent the exit of the latter , thus rendering still more stable the locking of these two parts of the packaging . finally , with reference to fig1 and 12 , the single - piece flat punched members of the cover and containing part , respectively , of a third embodiment of the packaging are shown . while the punched member of fig1 relating to the containing part is exactly the same as the punched member of fig2 of the first embodiment , that of fig1 is different from the corresponding punched members above described , in that it comprises a different locking system for the superimposed cover and containing parts . also in this case it should be remarked beforehand that in said punched members components similar to those already disclosed will be indicated with the same reference numerals previously adopted . therefore , considering only the punched member of fig1 , it can be noted that the difference with respect to the previous corresponding ones resides in the formation of four rectangular wings 15 obtained by means of cuts in the bottom wall panel 3 , of which two with the respective bases integral with the edge of the panel 4 along the crease connecting it to panel 3 , each of said wings 15 being located in a position equally spaced from the respective adjacent arch shaped cuts 6 in the panel 3 . with the cover and containing parts of the packaging assembled in a three - dimensional form , as shown in fig1 and 14 , respectively , the wings 15 are placed in an upright position in such a manner that in the superimposition of the covering on the containing part , as shown in fig1 , said wings on the former plabe themselves in contact with the corresponding portions of the external faces of the respective lateral wall panels 2 &# 39 ; and 4 &# 39 ; of the latter , to which they are then fastened , for instance by glueing , to obtain in this way the connection of said two parts of the packaging . it should be kept in mind that the fastening of only one pair wings 15 on the panel 2 &# 39 ; or 4 &# 39 ; causes the creation of a hinge between said cover and containing parts , the locking of which in the superimposed position could take place at a later time by means of the fastening of the other pair of wings 15 . if it is considered advisable , on the opposite side of the panel 1 and / or 1 &# 39 ; to that connected to panel 2 , a grasping wing can be integrally formed , protruding towards the exterior , having the purpose of rendering more easy the separation of said cover and containing parts superimposed and fastened to one another . according to a modification of the present invention , the removal of the arch shaped strips included between the respective pairs of said arch shaped external and internal portions of the symmetrically opposed cuts is omitted , and the portions of the panel 3 , substantially corresponding to said arch shaped strips , are adapted for forming two opposed wings which can each be bent over elastically , along a respective crease connecting them to the punched member in question , towards the interior of the relative box shaped body obtained following the assembly in a three - dimensional form , of said punched member . said wings , besides stiffening the strip portions between adjacent apertures of respective half - housings of the same longitudinal row , allow adaption to eggs of different sizes in each of said half - housings , avoiding an undesirable play between the opening and the egg lying therein , and also preventing the eggs in adjacent half - housings from coming into contact with each other . it is finally remarked that , even if in all the formerly described embodiments of the packaging for eggs of the present invention two distinct and separated punched members are provided for the covering part and the containing part , respectively , it is possible to have a single punched member for obtaining both the abovementioned parts , comprising said two punched members integrally united to one onother by means of a longitudinal or transversal hinge edge , stating , moreover , that the elements that constitute the above described punched members may assume shapes different from the ones described . the present invention is not limited to the disclosed embodiments , but includes any change or modification thereof . | 1 |
the function of the output current of the circuit of this invention with respect to the digital input code ( i . e ., the transfer characteristic ) is plotted in the diagram of fig2 . the current output is supplied at 4 , 096 discrete levels , which levels are partitioned into eight groups of 512 steps each . the key to the inherent monotonicity may be seen by examining the major carry function amplified in the inset of fig2 . rather than switching in an entirely different current at the major carry as the r - 2r converter does , the current from the segment prior to the major carry current i 3 is retained and the current to create additional steps is added to this current in the form of increments of current i 4 . thus , the converter is monotonic regardless of the relative slopes of the eight segments . the only critical resistor matching occurs at the major carries or midpoints of each of the eight segments , and the tolerances are equivalent to that of a 9 - bit dac , or eight times lower than the r - 2r structure . accordingly , the problem has been divided into eight separate problems each with tolerances eight times lower than that of a 12 - bit dac . table i below compares the resistor requirements of a 12 - bit dac built according to the prior art shown in fig1 with the master - slave type of network described in a paper by d . t . comer entitled &# 34 ; a monolithic d / a converter ,&# 34 ; which paper was published in the isscc digest of technical papers of february 1977 at pages 104 - 105 . also , table i compares the two prior art dac &# 39 ; s with a 12 - bit segmented dac built according to the teachings of this invention . the two prior art dac &# 39 ; s require 50 % more resistors than does the segmented dac , and the prior art resistors must match to within ± 0 . 05 % to guarantee monotonicity ( defined as ± 1lsb differential nonlinearity : dnl , a measurement of step uniformity ). the remaining numbers in the table indicate resistor temperature tracking requirements . if the converter is perfect at room temperature , resistor tracking within ± 5 parts per million per degree celcius ( or ± 5 ppm /° c .) would maintain monotonicity from 25 ° c . to 125 ° c . some allowance must be made for error , however , so if the initial dnl were 1 / 2 lsb , a ± 2 . 5 ppm /° c . tracking figure would be necessary , which is difficult to maintain with almost any technology . table i______________________________________ tracking tracking req &# 39 ; d required for + initial for ± 1 1 / 2 lsb matching lsb dnl dnl required ( ppm /° c .) ( ppm /° c .) for o 1 / 2 lsb 1 / 4 lsbladder no . of ± 1 lsb initial initial initialtype resistors dnl (%) dnl dnl dnl______________________________________straightr - 2r 37 ±. 05 5 2 . 5 1 . 25master - slave 26 / 38 ±. 05 5 2 . 5 1 . 256 + 6 bitssegmented3 + 9 bits 24 ±. 4 40 20 10______________________________________ the segmented approach of the present invention requires only 24 resistors and the initial resistor matching is ± 0 . 4 percent . note that the numbers are relaxed by a factor of eight with respect to the r - 2r ladder network . typical diffused resistor tracking is on the order of ± 2 ppm /° c ., thus providing ample latitude for maintaining 13 bit differential linearity over the temperature range of 25 ° c . to 125 ° c . the tracking requirements over the temperature range of - 55 ° c . to 25 ° c . are even less stringent since total temperature change is smaller . referring now to fig3 a schematic diagram of the 12 - bit dac of the present invention is illustrated in greater detail . this diagram is referred to herein as a &# 34 ; segmented &# 34 ; 12 - bit dac , since the transfer characteristic is divided into segments . the binary number to be converted to an analog signal is provided on terminals b1 through b12 , wherein the msb is provided on the terminal b1 and the lsb is provided on the terminal b12 . the bit terminals b1 , b2 and b3 are coupled to inputs of a segment decoder 50 , the bit terminals b4 through b8 are coupled to inputs of a master ladder network 51 , and the bit terminals b9 through b12 ( the lsb ) are coupled to inputs of a slave ladder network 52 . the combination of the networks 51 and 52 is referred to herein as a step generator . in this embodiment , the analog output signal and its complement are supplied on lines 54 and 56 , and the output signal is referred to herein as i out , and its complement as i out . the segment generator includes , in addition to the segement decoder 50 , transistor q10 through q18 having base terminals thereof coupled to the output of an amplifier a20 . the transistors q11 through q18 form current sources i 0 through i 7 coupled to the segment decoder 50 . the relative scaling of the emitters of the transistors illustrated and described herein are noted by a number followed by an x . for example , the emitter of the transistor q10 is twice the size of that of the emitter of the transistor q11 , hence a 2x adjacent q10 notes this fact . the master ladder network 51 includes transistors q19 through q24 , and is coupled to the segment decoder 50 at the emitter terminal of the transistor q19 by means of a line 58 . the segment current i s is supplied to the step generator by means of the line 58 . the slave ladder network 52 includes transistors q25 through q29 . the ladder networks 51 and 52 ( or step generator ) form a conventional r - 2r ladder network with a remainder divider network similar to that described in u . s . pat . no . 4 , 055 , 773 . switches s10 through s18 are schematic represtations of current switches ( to be explained further hereinbelow ), which is operative in response to the presence of a binary signal ( one or a zero ) supplied on the terminals b4 through b12 , respectively . a binary one will operate the switch to a second position . the master ladder network 51 converts the bits b4 through b8 into an analog signal by means of a conventional r - 2r ladder , which signal is supplied on the output lines 54 and 56 . a remainder current is supplied to the slave ladder network 52 by the collector of q24 at the emitter of q25 , which remainder current is divided by active current splitting into the four ( 4 ) least significant bits . this arrangement minimizes the range of emitter scaling necessary to generate nine binarily weighted currents . furthermore , note that the ladder resistors in the lower order bits ( b9 through b12 ) have been eliminated because the tolerance for error as a percent of the bit current value is much higher . such resistors would not be useful anyway , since the voltage drop across them would be very small . for a given 3 - bit code at the input of the segment decoder 50 , a segment current i s ( e . g ., i 3 ) is selected and fed to the step generator where it is divided into 512 discrete levels . all the lower order segments ( i . e ., i 0 , i 1 , and i 2 ) are coupled to the output line 54 and summed with the step generator output signal , and all the higher order segments ( i . e ., i 4 through i 7 ) are fed to the differential output line 56 ( or i out ) which for purposes of the present description can be thought of as ground potential . at a segment carry as shown by the inset of fig2 the input code is 011111111111 , and 511 of the 512 levels of the step generator appear on the output line 54 . the 512th level is the remainder current , which is coupled to ground potential . when the binary code is incremented by one count the current i 3 is switched away from the step generator and fed to the i out output line 54 , taking the remainder current with it . thus , the output of the dac increases by one lsb and is inherently monotonic at the segment carries . the segment carries do not depend on resistor matching at all . the most critical resistor in the circuit is now the emitter resistor of the transistor q19 , and its tolerance is eight times lower than that of the traditional r - 2r ladder network , which allows monotonicity to be achieved in the step generator without the trimming of the resistors . accordingly , it may be appreciated that the circuit of this invention is tolerant of component mismatches of the order commonly encountered in semiconductor devices . hence , the circuit of this invention can be built on a single semiconductor chip , or is monolithic . the currents in the step generator are switched with fully differential current switches ( schematically represented by switches s10 through s18 ) capable of switching a one microamp current in about 30 nanoseconds . the high speed current switch is shown in greater detail in fig4 . a pair of pnp transistors q30 and q31 have their emitter terminals connected together and this connection is coupled to a positive voltage source (+ v ) through a current source i . the base terminal of the transistor q30 is coupled to the logic input terminal ( e . g ., one of the terminals b4 - b12 ). the collector terminal of the transistor q30 is coupled to one side of the resistor r30 and to the base terminal of the npn transistor q32 . the collector terminal of the transistor q32 is coupled to the output line 56 . the base terminal of the transistor q31 is coupled to a threshold bias voltage , and the collector terminal thereof is coupled to the base terminal of a second npn transistor q33 and to one side of a resistor r31 . the collector terminal of the transistor q33 is coupled to the output line 54 . the emitter terminals of the transistors q32 and q33 are connected together and this connection is coupled to a minus voltage supply (- v ) through a current source i bit . the second side of the resistors r30 and r31 are connected together and this connection is coupled to a bias voltage supply ( v bias ). high speed operation is possible because the common emitter connection of the npn differential pair ( q32 and q33 ) remains at the same voltage regardless of the logic state and the bit current need not charge or discharge the parasitic capacitance at this node . for a capacitance of 2 picofarads , a single - ended switch which swings 0 . 7 volts would require 1 . 4 microseconds to turn on the one microamp lsb . the use of such a switch as illustrated in fig4 makes possible the high voltage compliance , high impedance and the complementary output ( i out , i out ). that is , the output signals i out and i out are analog complements of each other , which means that i out increases as i out decreases with an increasing digital input code . the sum of the two output signals is equal to the full - scale current regardless of the input code . another advantage of the differential current switch of fig4 includes adjustable logic threshold by varying the base bias on q31 to be compatible with such popular logic types as cmos , ecl , htl etc . also , a logic input range is possible which swings from below ground potential up to and above the positive power supply voltage . furthermore , level shifting is permissible independent of the positive or the negative power supply voltage . referring now to fig5 the segment decoder 50 is illustrated in greater detail . the three most significant digits of the binary number to be converted are supplied on the terminals b1 , b2 and b3 , which are coupled to the base terminals of transistors q40 , q41 and q42 , respectively . the emitter terminals of the transistors q40 , q41 and q42 are coupled to current sources i 30 , i 31 and i 32 , respectively . in addition , the emitter terminals of the transistors q40 , q41 and q42 are coupled to emitter terminals of transistors q43 , q44 and q45 , respectively . the base terminals of the transistors q43 , q44 and q45 are connected together and this connection is coupled to a threshold voltage input terminal v th , which is typically + 1 . 4 volts . the current sources i 30 , i 31 and i 32 are designed to provide typically 200 microamps each . the collector terminals of the transistors q40 , q41 and q42 are coupled to a bias voltage supply on a terminal 61 through resistors r40 , r41 and r42 ; and , each of the collector terminal connections is referred to as vb1 , vb2 and vb3 , respectively . in a similar manner , the collector terminals of the transistors q43 , q44 and q45 are coupled to the same bias voltage terminal 61 through resistors r43 , r44 and r45 ; and , similarly , each of these collector terminal connectons is referred to as vb1 , vb2 and vb3 . moreover , the vb1 terminal is coupled to the base terminals of 4 parallel - connected transistors q46 through q49 . the collector terminals of the transistors q46 through q49 are connected together and this connection is coupled to the output line 56 . the emitter terminals of transistors q46 through q49 are coupled to current sources i 4 through i 7 , respectively . in a similar manner , the vb1 terminal of the transistor q43 is coupled to base terminals of four parallel transistors q50 through q53 . the collector terminals of the transistors q50 through q53 are connected together and this connection is coupled to the output line 54 . the emitter terminals of the transistors q50 through q53 are coupled to current sources i 0 through i 3 . accordingly , it may be seen that the turning on of the transistors q46 through q49 couple the current sources i 4 through i 7 to the output line 56 . in a like manner , the turning on of the transistors q50 through q53 couple the current sources i 0 through i 3 to the output line 54 . note further that the turning on of the transistors q46 through q49 is mutually exclusive of the turning on of the transistors q50 through q53 since the collector of q43 is vb1 and the collector of q40 is vb1 , its complement . the vb2 terminal is coupled to base terminals of transistors q54 through q57 . the collector terminals of the transistors q54 through q57 are connected together and this connection is coupled to the output line 56 . the emitter terminals of the transistors q54 and q55 are coupled to the current sources i 2 and i 3 , respectively . the emitter terminals of the transistors q56 and q57 are coupled to the current sources i 6 and i 7 . the vb2 terminal is connected to base terminals of the transistors q58 through q61 are connected to the output line 54 . the emitter terminals of the transistor pair q58 and q59 are coupled to the current sources i 0 and i 1 , respectively . the emitter terminals of the transistor pair q60 and q61 are coupled to the current sources i 4 and i 5 , respectively . the vb3 terminal is similarly connected to base terminals of transistors q62 through q65 . furthermore , the collector terminals of the transistors q62 through q65 are coupled to the output line 56 , and the emitter terminals of these transistors are coupled to current sources i 1 , i 3 , i 5 and i 7 , respectively . the vb3 terminal is coupled to base terminal of parallel connected transistors q66 through q69 . the collector terminals of the transistors q66 through q69 are connected together and this connection is coupled to the output line 54 . the emitter terminals of these same transistors are coupled to the current sources i 0 , i 2 , i 4 and i 6 , respectively . the three transistors pairs q40 - q43 , q41 - q44 and q42 - q45 form three segment switch drivers which perform the function of switching eight precision current sources i 0 through i 7 in proper priority to three analog outputs on lines 54 , 56 and 58 in response to three digital input signals on the terminals b1 , b2 and b3 . the nodes vb1 , vb2 and vb3 at the collector terminals of the transistors q43 , q44 and q45 , respectively , have three separate high levels which are spaced 0 . 5 volts apart . including the low level of each node there are a total of four logic levels . accordingly , this adds an extra dimension to the switch matrix which simplifies it considerably . the logic levels for the current switches are ranked according to the significance of each input bit . in accordance with one embodiment of this invention that has been reduced to practice , the resistors r40 and r43 are 10 kohms ; the resistors r41 and r44 are 7 . 5 kohms ; and , the resistors r42 and r45 are 5 kohms . also a vbias of - 10 volts is applied to the terminal 61 . in operation , the group of transistors q50 through q53 is capable of overriding all transistors beneath them ( higher ir drop across resistors r40 and r43 ) so that when the msb ( b1 ) is high the current sources i 0 through i 3 will be coupled to the output line 54 . for any given input code , seven of the eight current sources will be switched to the output pair of lines 54 and 56 , and the eighth current source will be coupled to the master - slave ladder network at the segment current ( i s ) output on the line 58 . the table ii below summarizes the relationship between the states of the logic inputs b1 , b2 and b3 , and the voltages developed on the nodes vb1 , vb1 , vb2 , vb2 , vb3 and vb3 . the individual voltages tabulated are given with respect to the value of vbias . for example , with a logic input of 110 , the voltage on the node vb1 is equal to vbias + 2 volts , the voltage on the node vb1 is equal to vbias + 0 volts , etc . table ii______________________________________ inputlogic vb1 ## str1 ## vb2 ## str2 ## vb3 ## str3 ## ______________________________________111 + 2v + ov + 1 . 5v + ov + 1 . ov + ov110 + 2v + ov + 1 . 5v + ov + ov + 1 . ov101 + 2v + ov + ov + 1 . 5v + 1 . ov + ov100 + 2v + ov + ov + 1 . 5v + ov + 1 . ov011 + ov + 2v + 1 . 5v + ov + 1 . ov + ov010 + ov + 2v + 1 . 5v + ov + ov + 1 . ov001 + ov + 2v + ov + 1 . 5v + 1 . ov + ov000 + ov + 2v + ov + 1 . 5v + ov + 1 . ov______________________________________ the table iii below summarizes the relationship between the states of the logic inputs b1 , b2 and b3 , and the routing of the currents from the current sources i 0 through i 7 . the tabulated symbols are i s for the segment current supplied on the line 58 , i 0 for the output current i out supplied on the line 54 , and i 0 for the output current i out supplied on the line 56 . table iii______________________________________logicinput______________________________________111 i . sub . o i . sub . o i . sub . o i . sub . o i . sub . o i . sub . o i . sub . o i . sub . s110 i . sub . o i . sub . o i . sub . o i . sub . o i . sub . o i . sub . o i . sub . s -- i . sub . o101 i . sub . o i . sub . o i . sub . o i . sub . o i . sub . o i . sub . s -- i . sub . o -- i . sub . o100 i . sub . o i . sub . o i . sub . o i . sub . o i . sub . s -- i . sub . o -- i . sub . o -- i . sub . o011 i . sub . o i . sub . o i . sub . o i . sub . s -- i . sub . o -- i . sub . o -- i . sub . o -- i . sub . o010 i . sub . o i . sub . o i . sub . s -- i . sub . o -- i . sub . o -- i . sub . o -- i . sub . o -- i . sub . o001 i . sub . o i . sub . s -- i . sub . o -- i . sub . o -- i . sub . o -- i . sub . o -- i . sub . o -- i . sub . o000 i . sub . s -- i . sub . o -- i . sub . o -- i . sub . o -- i . sub . o -- i . sub . o -- i . sub . o -- i . sub . o i . sub . 0 i . sub . 1 i . sub . 2 i . sub . 3 i . sub . 4 i . sub . 5 i . sub . 6 i . sub . 7______________________________________ another embodiment of this invention is illustrated in fig6 wherein like reference numerals with a prime identify like components or parts described and illustrated hereinabove . as in the circuit shown in fig3 and described hereinabove , the three msb &# 39 ; s b1 , b2 and b3 are coupled to three inputs of the segment decoder 50 &# 39 ;. current sources i 0 &# 39 ; through i 7 &# 39 ; are likewise connected to the segment decoder 50 &# 39 ; in the same fashion . further , the output lines 54 &# 39 ;, 56 &# 39 ;, and 58 &# 39 ; are also connected to the decoder 50 &# 39 ; for providing i out , i out and i s , respectively . the base and emitter terminals of q19 &# 39 ; through q24 &# 39 ; are likewise connected as described above with reference to fig3 ; however , the collector terminals of the transistors q19 &# 39 ; through q23 &# 39 ; are connected to current switches s30 through s34 , which switches are similar to the circuit shown in fig4 and described above . the collector terminal of the transistor q24 &# 39 ; is connected to the emitter terminals of the transistors q25 &# 39 ; through q28 &# 39 ;. a detailed schematic of the switch s30 is shown connected to the collector terminal of the transistor q19 &# 39 ;, while blocks are used to represent the same switch circuit connected to the collector terminals of the transistors q20 &# 39 ; through q23 &# 39 ;. similarly , switches s35 through s38 are coupled to the collector terminals of the transistors q25 &# 39 ; through q28 &# 39 ;. note that the transistor q29 ( fig3 ) has been eliminated in the embodiment shown in fig6 and that the switch s38 is arranged differently from the other current switches . the switches s30 through s37 are arranged identically with the switch illustrated in fig4 and described above . moreover , like reference numerals with a prime identify components of the switch s30 that correspond to like components of the fig4 switch schematic . the emitter terminals of the transistors q32 &# 39 ; and q33 &# 39 ; are connected together and this connection is coupled to the collector terminal of the transistor q19 &# 39 ;, which in fig4 is identified as the current source i bit . the switch s38 , on the other hand , includes six transistors q80 through q85 , wherein the emitters of q80 through q83 are coupled to the collector terminal of the transistor q28 &# 39 ;. the collector terminals of q80 and q83 are connected together and this connection is coupled to ground potential so as to shunt the remainder current to ground . the collector terminal of the transistor q81 is coupled to the i out output line 56 &# 39 ; and the collector terminal of the transistor q82 is coupled to the i out output line 54 &# 39 ;. the base terminals of the transistors q80 and q81 are connected together and this connection is coupled to the collector terminal of the transistor q84 and to one side of a resistor r40 . the second side of the resistor r40 is coupled to the v bias line 62 . the emitter terminals of the transistors q84 and q85 are connected together and this connection is coupled to + v through current source i &# 39 ; in the same manner as the emitter terminals of q30 and q31 shown in fig4 are connected . in a similar manner , the base terminals of the transistors q82 and q83 are connected together and this connection is coupled to the collector terminal of the transistor q85 and to one side of a resistor r41 . the second side of the resistor r41 is coupled to the v bias line 62 . the base terminal of the transistor q85 is coupled to the threshold bias line 63 , and the base terminal of the transistor q84 is coupled to the lsb logic input bit b12 . in order to compensate for a base current loss in the transistors q19 &# 39 ; through q24 &# 39 ; of the step generator , an additional current source circuit is employed in this embodiment . this circuit includes a transistor q90 coupled in parallel with the transistors q10 &# 39 ; through q18 &# 39 ;, a transistor pair q91 and q92 coupled in parallel between the collector terminal of the transistor q90 and the emitter terminal of another transistor q93 . the base terminals of q91 and q92 are connected together and this connection is coupled to the segment current ( i s ) line 58 &# 39 ; so as to provide the compensating base current . the emitter terminals of q91 and q92 are connected together at the collector terminal of q90 , and the collector terminal of q92 is grounded . the collector terminal of q91 is coupled to the emitter terminal of q93 , and the base terminal of q93 is coupled to the emitter terminal of q28 &# 39 ; so as to provide a compensating base current to the transistors q25 &# 39 ; through q28 &# 39 ;. if such base current loss compensation were not used , an error would occur in the output signal . it may be appreciated from the discussion hereinabove that a monolithic digital - to - analog converter has been described in detail . thus , while the invention has been particularly shown and described with reference to only two emodiments , it will be understood by those skilled in the art that the foregoing and other changes in form and details may be made without departing from the spirit and scope of the invention . accordingly , it is intended that the present invention only be limited by the claims set forth hereinbelow . | 7 |
this invention is a dripping evaporation - type insect luring device which comprise an enclosure assembly and a base assembly that provide protection from sunlight and rain . it also has a wooden base plate that increases the surface area over which the insecticide spreads , thus extending the service life of this device to a period of two months . with reference first to fig1 the device shown comprises an enclosure 1 and a base assembly 2 . in an upper extension of the enclosure assembly 1 , there is a hole 11 used for fixing the entire device in a convenient location using a rope . at the middle part of the enclosure assembly 1 , there is a big ventilation opening 12 used for spreading the smell of the insecticide into the nearby atmosphere as the insecticide evaporates and thus luring the fruit flies , melon flies and other insects into the device , killing these insects . as the fruit flies , melon flies and other insects enter and get killed inside this device , the ventilation opening 12 will become blocked by these dead insects if they are allowed to collect in the opening . therefore , the bottom edge of this opening is so designed as to have a slightly inclined slope which causes these dead insects to drop to the ground by themselves as the pile of insects reaches a specific height . fig2 shows a first embodiment of this invention . the enclosure 1 in this drawing has a ventilation opening 12 and a socket base 13 at its lower end . this socket base 13 has screw thread 14 . the inner side of the base assembly 2 in this embodiment also has screw thread which can not be seen in this drawing . the base assembly 2 can be fixed to the enclosure 1 by matching this screw thread with the screw thread 14 the on enclosure 1 . at the center of the base cap 2 , there is a support bar 21 . immediately above the center of this support bar 21 , there is a strut 22 and at the joint between the strut 22 and support bar 21 , there is a wooden base plate 23 . there are several grooves 231 cut around this wooden base plate 23 . through these grooves 231 , insecticide will move to the lower side of the wooden base plate 23 from its upper surface and hence spread the insecticide over the entire surface of the wooden base plate 23 . furthermore , in accordance with a second embodiment of this invention , a cotton pad 24 can be placed around the strut 22 on the base plate 23 as shown in fig3 . an inverted insecticide container 3 is mounted on the strut 22 in the enclosure 1 and the enclosure 1 presses the container 3 onto the cotton pad 24 . after the cotton pad 24 is soaked with insecticide , the insecticide will move toward the base plate 23 from cotton pad 24 gradually . hence , the cotton pad on the base plate will spread insecticide uniformly over the base plate , which extends the device &# 39 ; s service life . the effective service life of the device in this way can be extended from 2 - 3 months to 4 - 5 months , both of which are much longer than the useful life of commonly used cotton pad patch , which is about 7 days . in this embodiment , is base plate is made of cork . it also can be made of fiberous material , such as sponge , polyester , sugar cane , cotton , wood , . . . etc . these materials will spread the insecticide over the base uniformly and extend its service life substantially . first , a filled insecticide container 3 is opened in the up - side - down position and the strut 22 of the base assembly 2 is inserted into the opening 31 of the insecticide container 3 . this insecticide , as is true of well - known insecticides that are used for evaporation lures , possesses some tackiness and the size of the opening 31 in the container 3 is rather small ; therefore the insecticide does not flow out freely . when strut 22 is inserted into the opening 31 , it is not only able to support the weight of the whole insecticide container 3 , hence to stop it from falling over when the device is shaken , but it also makes the insecticide move from the strut 22 onto wooden base 23 gradually . furthermore , there are several grooves 231 cut around the wooden base 23 to assure that the whole wooden base 23 is permeated by insecticide . the insecticide around the wooden base 23 will then evaporate gradually . after joining base assembly 2 with the enclosure 1 , the device is positioned by putting a rope through the opening 11 in the enclosure 1 and then tying up the device in a convenient location . the insect luring effect is produced by this insecticide dripping process . 1 . in this invention , the joining of base assembly 2 and enclosure 1 locates the base plate 23 near the upper end of the ventilation opening 12 ; hence , protecting the base plate from sunlight and rain . at the same time , it will provide insecticide continuously and keep the base plate moist . thus , the service life of the insecticide therein is extended from 2 weeks to 2 months or more . 2 . in this invention , the base assembly 2 and enclosure 1 have an attractive appearance . 3 . when handling the dripping evaporation type device of this invention , the hands of end - users can be kept clean and free from insecticide contamination . 4 . in this invention , the base assembly 2 and enclosure 1 provide good protection from insects without having any of the defects of commonly used cotton pad and prevent bodily contact with insecticide caused by accident or careless insecticide usage . 5 . this invention has the advantages of low cost and long service life . 6 . this invention permits a free selection from among all kinds of insecticides to kill the different insect species , such as mosquito , flies , etc . 7 . after using up the insecticide , end - users can simply change to another bottle of insecticide . it is very easy to reuse this device . | 0 |
in fig1 - 3 and 5 , the numeral 10 generally designates a vertical , high side , rolling piston compressor . compressor 10 is in a refrigeration circuit serially including compressor 10 , discharge line 60 , condenser 70 , expansion valve 80 and evaporator 90 . the numeral 12 generally designates the shell or casing . suction tube 16 is sealed to shell 12 and provides fluid communication between suction accumulator 14 , which is connected to evaporator 90 , and suction chamber s . cylinder 20 , piston 22 , pump end bearing 24 , motor end bearing 28 and vane 30 collectively make up the pump structure . suction chamber s and compression chamber c are defined by bore 20 - 1 in cylinder 20 , piston 22 , bearings 24 and 28 , and vane 30 which separates suction chamber s and compression chamber c . eccentric shaft 40 includes a portion 40 - 1 supportingly received in bore 24 - 1 of pump end bearing 24 , eccentric 40 - 2 which is received in bore 22 - 1 of piston 22 , and portion 40 - 3 supportingly received in bore 28 - 1 of motor end bearing 28 . oil pick up tube 34 extends into sump 36 from a bore in portion 40 - 1 . stator 42 is secured to shell 12 by a shrink fit , welding or any other suitable means . commonly there will be passages in the form of slots or grooves 42 - 2 in the outer surface of the stator 42 running its entire length to provide flow paths for refrigerant gas across the motor defined by stator 42 and rotor 44 and for the return flow of oil to oil sump 36 . rotor 44 is suitably secured to shaft 40 , as by shrink fit , and is located within bore 42 - 1 of stator 42 in a spaced relationship and coacts therewith to define a variable speed motor . vane 30 is biased into contact with piston 22 by spring 31 . discharge port 28 - 2 in motor end bearing 28 is overlain by normally closed valve 29 . valve 29 is within and opens into muffler 32 . as described so far , compressor 10 is generally conventional . the present invention differs in the details of muffler 32 and the resultant differences in operation of compressor 10 . referring specifically to fig3 and 4 it will be evident that muffler 32 differs from conventional mufflers in that it has two downwardly directed discharge tubes 32 - 1 and 32 - 2 which are blocked at their ends and which have a plurality of ports 32 - 1 a and 32 - 2 a , respectively , which are each located within the portion of the 180 ° perimeter of tubes 32 - 1 and 32 - 2 which is not directed towards the other one of discharge tubes 32 - 1 and 32 - 2 or pick up tube 34 . the reason for these locations of ports 32 - 1 a and 32 - 2 a is to avoid discharging gas towards oil pick up tube 34 . referring specifically to fig3 it will be noted that discharge tubes 32 - 1 and 32 - 2 extend into oil sump 36 and that all of ports 32 - 1 a and 32 - 2 a are located above the intake of oil pick up tube 34 . this is to prevent the generation of foam from uncovering oil pick up tube 34 and thereby interfering with compressor lubrication . although two discharge tubes 32 - 1 and 32 - 2 are illustrated with each having a plurality of ports 32 - 1 a and 32 - 2 a , respectively , one discharge tube and any convenient number of ports may be employed . the critical consideration is to avoid unnecessary restrictions . accordingly , the discharge tubes should have a combined cross section at least equal to that of discharge port 28 - 2 and the ports 32 - 1 a and 32 - 2 a should be at least 0 . 25 inches in diameter and have a total cross sectional area on the order of 1 . 2 to 1 . 5 times the area of discharge port 28 - 2 . as best shown in fig1 and 6 , an oil separator 50 is suitably secured to the top of the interior of shell 12 in a surrounding relationship to discharge line 60 . referring specifically to fig5 and 6 , oil separator 50 includes : ( 1 ) a flat portion 50 - 1 facing rotor 44 and having a plurality of ports 50 - 1 a for oil drainage ; ( 2 ) an inner annular wall member 50 - 2 having a plurality of ports 50 - 2 a and being welded or otherwise suitably secured to the interior of shell 12 ; and , ( 3 ) outer annular wall member 50 - 3 having a plurality of ports 50 - 3 a and being spaced from the interior of shell 12 . initially , compressor 10 will be charged with oil up to , or a little above , the top surface of motor end bearing 28 . during operation of compressor 10 , some oil will be carried off to the refrigeration circuit due to the affinity between oil and refrigerant . the generation of foam by the discharge gas will temporarily remove oil from the sump as the foam moves into the space above motor end bearing 28 . foam will be continuously generated , collapsed and drained back into sump 36 but the oil level will drop due to the removal of oil as foam . to prevent the excess loss of oil due to foam generation , ports 32 - 1 a and 32 - 2 a must be located above the inlet of oil pick up tube 34 by a minimum of a quarter of an inch . if the level of oil in sump 36 drops below ports 32 - 1 a and 32 - 2 a , no foam is generated and compressor 10 will be noisier but will operate without problems as long as the oil is able to circulate for compressor lubrication . in operation , rotor 44 and eccentric shaft 40 rotate as a unit and eccentric 40 - 2 causes movement of piston 22 . oil from sump 36 is drawn through oil pick up tube 34 into bore 40 - 4 which acts as a centrifugal pump . the pumping action will be dependent upon the rotational speed of shaft 40 . as best shown in fig2 oil delivered to bore 40 - 4 is able to flow into a series of radially extending passages , in portion 40 - 1 , eccentric 40 - 2 , and portion 40 - 3 exemplified by passage 40 - 5 in eccentric 40 - 2 , to lubricate bearing 24 , piston 22 , and bearing 28 , respectively . the excess oil flows from bore 40 - 4 and either passes downwardly over the rotor 44 and stator 42 to the sump 36 or is carried by the gas flowing from the annular gap between rotor 44 and stator bore 42 - 1 and impinges and collects on the inside of cover 12 - 1 or oil separator 50 before draining to sump 36 . piston 22 coacts with vane 30 in a conventional manner such that refrigerant gas is drawn through suction tube 16 and passageway 20 - 2 to suction chamber s . the gas in suction chamber s is compressed after suction chamber s has been cut off from suction tube 16 and has been transformed into a compression chamber c while a new suction chamber is being formed . the hot compressed gas in compression chamber c passes through discharge port 28 - 2 unseating discharge valve 29 and enters into the interior of muffler 32 . the compressed gas divides in muffler 32 with part flowing into tube 32 - 1 and out ports 32 - 1 a and part flowing into tube 32 - 2 and out ports 32 - 2 a . the gas , at discharge pressure , passing from muffler 32 via ports 32 - 1 a and 32 - 2 a enters oil sump 36 which is also at discharge pressure . depending upon the oil level in sump 36 and the location of ports 32 - 1 a and 32 - 2 a relative to the oil in sump 36 , foam may or may not be generated . the passing of the hot discharge gas into oil sump 36 increases the temperature of the oil in sump 36 and tends to generate foam . under certain operating conditions , such as those encountered in heat pump operation , the solubility of the refrigerant in the oil could be very high due to low ambient temperature . in such a case , the oil lubrication capability may be compromised but refrigerant solubility will be significantly reduced due to the heating of the oil thereby improving its lubricating effectiveness . additionally , the discharge of the gas into the oil sump 36 produces a foam which has a greater volume than the oil forming the foam and so tends to flow through the passages defined by recessed portions 20 - 3 and 20 - 4 and the interior of shell 12 , as best shown in fig2 . there will be a tendency for the lower shell , i . e . the portion of shell 12 below rotor 44 and stator 42 to fill with foam . because the gas / liquid impedance is ineffective for sound transmission and because there is no direct path for sound to travel , the compressor 10 is quieter than conventional compressors . if ports 32 - 1 a and 32 - 2 a are located above the surface of the oil in sump 36 , no foam will be generated but the oil will be heated by the hot discharge gas thereby improving the lubricating effectiveness of the oil . if excessive oil passes from compressor 10 with the discharge gas it can interfere with heat transfer in the refrigeration system and can leave an inadequate amount of oil in oil sump 36 for proper lubrication . the presence of foam greatly increases the amount of oil present with the discharge gas . the discharge gas must however go past the motor and this can only be done by passing through the clearance between rotor 44 and stator bore 42 - 1 or by passing through the slots or grooves 42 - 2 in the outer surface of stator 42 . because the clearance between rotor 44 and stator bore 42 - 1 is small and because the relative movement of rotor 44 with respect to stator 42 results in a shearing force on any foam bubbles entering the clearance , the foam tends to collapse in passing between the rotor 44 and stator 42 . additionally , the relative rotation of rotor 44 with respect to stator 42 tends to cause the discharge gas to move in a spiral path that tends to centrifugally remove oil from the gas . the swirling flow tends to persist into the space between rotor 44 and discharge line 60 . oil separator 50 tends to collect oil and prevents its being entrained with the gas passing from compressor 10 through discharge line 60 to the condenser 70 of the refrigeration circuit . specifically , refrigerant , oil and any remaining foam passing between rotor 44 and stator 42 tends to be moving in a spiral path which tend to move any oil outward . the refrigerant and any entrained oil will flow either through ports 50 - 3 a or between wall member 50 - 3 and the interior of shell 12 before passing through ports 50 - 2 a and the changes in flow direction will tend to separate out entrained oil which will drain through drainage ports 50 - 1 a . the refrigerant and any entrained oil passing through ports 50 - 2 a will undergo a change in flow direction prior to flowing into discharge line 60 which will tend to separate out entrained oil which will drain through drainage ports 50 - 1 a . the oil draining through drainage ports 50 - 1 a will tend to fall into the swirling flow passing between rotor 44 and stator 42 and will thereby be directed towards the interior of casing 12 . while discharge gas may flow past stator 42 via grooves 42 - 2 , it is more likely to be the location of return oil flow to sump 36 given the fact that there is no pressure gradient so that gravity flow of the oil will take place and because of the centrifugal effect on oil in the gap between rotor 44 and stator bore 42 - 1 . although the present invention has been illustrated and described in terms of a vertical , high side , variable speed compressor , other modifications will occur to those skilled in the art . for example , the invention is applicable to both horizontal and vertical compressors . the only significant difference would be the location of the oil sump relative to the muffler and the discharge from the muffler could be straight down into the portion of the oil sump between the pump structure and the stator which would be well removed from the appropriate oil pick up tube . it is therefore intended that the present invention is to be limited only by the scope of the appended claims . | 8 |
the disclosed embodiments of the invention are to provide an inexpensive , discreet apparatus to be worn on the hand that assists the wearer in the holding of a cup , container or other hand held object . in its simplest embodiment the invention is a simple length of flexible material with loops at either end to fit over the thumb and one other finger of the hand . this then allows the weight of containers to be held by the skeletal structure of the hand rather than depending upon the mechanical gripping force exerted by the fingers . fig1 a shows an illustration of the invention , which at its simplest , is a length of flexible material with two loops at either end . one loop 110 is worn over the thumb and the other loop 120 is worn over the pinky finger . a container or glass in now placed on the loop at 140 . the weight of a container , glass or object is now distributed to the skeletal bones , and limited gripping force is needed to successfully hold these items . additionally , the weight of the vessels or items is closer to the whole hand , as opposed to the ends of the fingers or distal joints . this moves the center of gravity inward towards the larger muscles of the hand ( as opposed to the fingers ) thus reducing stress and fatigue on the fingers . the overall result is a more secure “ grip ”. fig1 b shows an illustration of the invention where one loop 110 is worn over the thumb and the other loop 120 is worn over the ring finger 130 . this embodiment might be made due to extensive arthritis in the pinky thus perhaps resulting in pain , a weak or bent pinky , a missing pinky . wearing the embodiment in this way causes the device to sit higher in the hand , for additional strength and comfort , or simply preference of the wearer . the flexible material 200 used to construct the invention can be , but is not limited to , a flexible fabric made from leather , suede , neoprene , nylon or cotton webbing , boiled wool , duct tape , washable fabric , synthetic rubber , scotch guarded fabric , elastic , or any other flexible thin material that will support a vessel to be comfortably held in the hand ; or any combination of fabrics . the length and width of the fabric are variable and are not limited , but are sized such that they are worn over the thumb and “ pinky ” or “ ring finger ” to form a platform 140 . typically , the length and width of the material varies from person to person and depends on the size of the hand , the size ( length and breadth ) of the fingers , and the size of the article to be held . for example , an embodiment for holding a large water bottle will vary from that of holding a small juice glass which would vary still from that of holding a power drill tool . fig2 a shows a non - limiting example embodiment . to manufacture the invention to hold a drinking tumbler for an average person , the apparatus is constructed in the following way : a length of flexible material 200 , such as suede leather , is cut to a length of 32 cm and width of 4 . 5 cm . a loop 120 for the pinky finger of diameter 2 . 25 cm , is constructed by folding over ( wrong sides together ) at the folding point 3 . 5 cm of one end of the length of material ( e . g . fig2 d , 220 ) and attached with stitching 240 , glue or other means of fastening . similarly , a loop 110 for the thumb of diameter 3 . 5 cm is constructed by folding 5 cm of the other end of the flexible material ( e . g . fig2 d , 210 ) on itself ( wrong sides together ) and is also attached with stitching 230 , glue or other means of fastening . fig2 b shows a bottom view of the example embodiment where the flexible material has been folded over and attached , where the crosshatched area indicates the wrong side of the material and the clear the right side of the material . fig2 c illustrates one embodiment of the invention where the ends of the length of material for the thumb and finger holes taper down 110 and 120 for finger comfort . fig2 d shows a bottom view of this same embodiment before the flexible material has been folded to create the loops . this design ( fig2 c and fig2 d ) helps accommodate those who may have shorter fingers or desire flexibility of the end one - third joint of the finger . in addition to sewing to construct the loops , various embodiments can create the loops from a length of material where the ends are folded over and fastened with stitching , glue , adhesive , hook and loop , “ snaps ”, or whatever material best suits the attachment to make a finger loop . in another embodiment , adjustable fasteners can be used with the thumb and finger loops to allow size adjustment . these attaching systems could be but not limited to : hook and loop ; hook and eye ; “ snaps ”; or some other fastening mechanism to allow for adjustability . adjustability installed around the affixing points ( fig2 d 230 and 240 ) allows for loops 110 and 120 to become adjustable in size or the entire length of the device to become longer or shorter depending on hand size , glass size , tool size , or need . in another embodiment , the length of material 200 will be cut with curves ( fig2 e and fig2 f ) rather than a rectangle . fig2 e shows a top view with the thumb hole 110 curved for a right handed user . note the narrower hole for 120 for the pinky finger . fig2 f shows a bottom view of the same embodiment , where the crosshatching indicates the wrong side of the material and the clear the right side . this embodiment can create a more secure , better controlled fit to the hand with additional support to force the vessel back into the crook of the hand and alleviate the possibility of the vessel toppling out of the opening of the hand . other embodiments can be envisioned where the length of material can take regular or irregular shaped sides . fig3 a , 3 b , 3 c , and 3 d illustrate exemplary uses showing that the embodiments can accommodate any type of handled or non - handled vessel . prior solutions do not have this ability . the figures illustrate that the weight of the vessels and their contents form a tight fit due to gravity . fig4 a and 4b illustrate an embodiment of the invention that includes a support strap 430 . the support strap embodiment may be permanently affixed or affixed as an attachment to the apparatus . the strap 430 is affixed at 410 and 420 to ensure that vessels or items do not tip or fall out of the hand . it would be used for a person with little or no finger grip strength , but with adequate arm and shoulder functionality . the strap helps hold the vessel in the hand and pushes the vessel or item closer toward the palm of the hand . this shifts the center of gravity closer to the palm of the hand further reducing stress on the distal joints and ensuring a secure grip . the “ support strap ” attachment 430 could go as high as the finger holes 110 and 120 . one embodiment of the support strap attachment 430 may be with fasteners . another embodiment would use an accessory loop that threads through the finger holes . fig4 b illustrates the top view of the embodiment from fig4 a , to highlight the curve of the support strap . 410 and 420 indicate the points where the support strap attaches to the flexible material that forms the hammock . fig5 illustrates an embodiment of the invention in which each finger is supported by elastic , fabric or other material attached to the flexible material with loop holes for individual fingers 510 , 520 , 530 , 540 to gain additional support . this embodiment would be used for someone who perhaps needed the additional support of all fingers , ( due to severe arthritis or lack of finger strength ) whose fingers were extensively bent , or who required said device be more firmly fastened to each finger to prevent slippage . an additional embodiment would be to make one large loop that could fit over all the fingers 560 . additional embodiments could include various combinations of loops to accommodate various finger combinations . fig6 shows an exemplary use of the invention with a smart phone . this design would work for other small personal electronic devices and tablets as well . an additional embodiment would provide slits in the main material such that the corner of each device would be held in to prevent slippage . fig7 shows a top view of an embodiment with a hole in the center 710 to accommodate a hose , handle or other protuberance to be allowed through the center of the invention for items such as a drill chord , hair dryer handle or electrical cord / air hose . fig8 illustrates how embodiments of the invention can remain on the hand and the hand can still function . in this figure , the apparatus remains on the hand while using a pencil . this may be important in cases of frequent changing of items in the hand or simply for comfort of those who , due to mental or physical restrictions , are not able to remove the device themselves . those skilled in the art will appreciate that various adaptations and modifications of the exemplary and alternative embodiments described above can be configured without departing from the scope and spirit of the invention . therefore , it is to be understood that , within the scope of the appended claims , the invention may be practiced other than as specifically described herein . | 0 |
the embodiment of the present invention will be hereinafter explained in detail . the object compounds which has been produced in multi - steps in the prior art can be produced in one step by introducing a fluorine compound represented by the formula ( iii ) mf , at least one of the sulfonyl halogenides represented by the formula ( ii ) r f so 2 x , and anhydrous ammonia or an ammonium salt into an inert solvent and reacting the mixture as shown by the following formula 2 , 3 , 4 , and 5 . this is due to the basicity of the fluorine compound represented by the formula ( iii ) mf . ( 1 ) in the case where r f 1 and r f 2 in the formula ( i ) mn ( so 2 r f 1 ) ( so 2 r f 2 ) are the same or equal to each other : one mol of anhydrous ammonium , 2 mol of at least one of the sulfonyl halogenides represented by the formula ( ii ) r f so 2 x and 6 mol of a fluorine compound represented by the formula ( iii ) mf are introduced into a reactor and the mixture is reacted in a solvent . after completion of the reaction , 2 mol of the by - produced mx and 3 moles of hydrogendifluoride salt mfhf are removed by filtration , and the filtrate is concentrated . the sulfonylimide compound represented by the formula ( i ) mn ( so 2 r f ) 2 can be thereby produced . ( 2 ) in the case where r f 1 and r f 2 in the formula ( i ) mn ( so 2 r f 1 )( so 2 r f 2 ) are different from each other : a sulfonylamide containing the r f 1 group which is produced by a known process shown below is reacted with at least one of the sulfonyl halogenides having a desired r f 2 group . a sulfonylimide compound with the r f 1 group and the r f 2 group are respectively constituted of an objective group can be thereby produced . wherein r f 1 and r f 2 are the same or different . one mol of an ammonium salt , 2 mol of at least one of the sulfonyl halogenides represented by the formula ( ii ) r f so 2 x and 7 mol of a fluorine compound represented by the formula ( iii ) mf are introduced into a reactor , and the mixture is reacted in a solvent . after completion of the reaction , 2 mol of the by - produced mx and 4 mol of the by - produced hydrogendifluoride mfhf are removed by filtration , and then the filtrate is concentrated . the sulfonylimide compound represented by the formula ( i ) mn ( so 2 r f 1 ) ( so 2 r f 2 ) can be thereby produced . these reactions can occur in a temperature range between about − 30 ° c . and 200 ° c . at a temperature less than this range , the reaction rate is very low whereas at the temperature exceeding the above range , decomposition of the compounds , solvent and product to be used arises . a more preferable temperature range for the reactions is between 0 ° c . and 100 ° c . as to the solvent , any solvent can be used without particular limitations as far as it is inert to the reaction materials . for example , ethers such as diethyl ether and tetrahydrofuran , halogenated hydrocarbons such as dichloromethane and dichloroethane , hydrocarbons such as benzene , heptane and hexane and nitrites such as acetonitrile can be used . in order to produce various sulfonylimide compounds other than those described above , a sulfonylimide compound obtained by these production methods is made into an acid by using concentrated sulfuric acid and the acid is distilled to thereby synthesize a sulfonylimidic acid [ hn ( so 2 r f 1 )( so 2 r f 2 )]. this acid can be further reacted with a compound selected from hydroxides , oxides , carbonates and acetates of metals corresponding to this acid . in this case , fluorine compounds represented by the formula ( iii ) mf to be used in the synthesis of a sulfonylimide compound can be compounded and used . the present invention will be described in more detail by way of examples , which , of course , do not limit the present invention . a flask with four necks was charged with 150 ml of acetonitrile , 23 . 4 g of potassium fluoride and 20 g of trifluoromethylsulfonylamide cf 3 so 2 nh 2 . the reactor was soaked in a 40 ° c . hot water bath , and 25 . 1 g of trifluoromethylsulfonyl fluoride cf 3 so 2 f was introduced with sufficient stirring . the reaction solution was subjected to filtration , and the filtrate was concentrated under reduced pressure to obtain potassium bistrifluoromethylsulfonylimide kn ( so 2 cf 3 ) 2 in an amount of 42 . 7 g . the yield was 99 %. next , 42 . 7 g of this potassium bistrifluoromethylsulfonylimide was added in a flask that was charged with 60 ml of concentrated sulfuric acid , and the mixture was dissolved under heat . under reduced pressure , 34 . 6 g of bistrifluoromethylsulfonylimidic acid hn ( so 2 cf 3 ) 2 was distilled by distillation . the yield was 92 %. then , 34 . 6 g of the resulting bistrifluoromethylsulfonylimidic acid was dissolved in pure water and reacted with 4 . 5 g of lithium carbonate . excess lithium carbonate was removed by filtration , and the filtrate was concentrated to obtain 34 . 6 g of lithium bistrifluoromethylsulfonylimide lin ( so 2 cf 3 ) 2 . the yield was 98 %. an autoclave made of stainless was charged with 200 ml of acetonitrile and 68 . 3 g of potassium fluoride . the reactor was cooled to − 60 ° c . in a dry ice / methanol bath , and 5 g of anhydrous ammonia was introduced . in succession , 90 . 0 g of trifluoromethylsulfonyl fluoride cf 3 so 2 f was introduced , and the temperature of the mixture was returned to ambient temperature with sufficient stirring . after that , the reactor was soaked in a 40 ° c . hot water bath , and the reaction was completed while stirring sufficiently . the reaction solution was subjected to filtration , and the filtrate was concentrated under reduced pressure to obtain 88 . 2 g of potassium bistrifluoromethylsulfonylimide kn ( so 2 cf 3 ) 2 . the yield was 95 %. a flask with four necks was charged with 1 liter of methylene chloride , 10 g of ammonium fluoride and 78 . 4 g of potassium fluoride . the reactor was soaked in a 40 ° c . hot water bath , and 82 . 1 g of trifluoromethylsulfonyl fluoride cf 3 so 2 f was introduced while stirring sufficiently . the reaction solution was subjected to filtration , and the filtrate was concentrated under reduced pressure to obtain 81 . 5 g of potassium bistrifluoromethylsulfonylimide kn ( so 2 cf 3 ) 2 . the yield was 95 %. a flask was charged with 300 ml of dmf ( dimethylformamide ), 30 g of perfluorobutylsulfonyl fluoride c 4 f 9 so 2 f , 15 . 1 g of trifluoromethylsulfonylamide cf 3 so 2 nh 2 and 13 g of sodium fluoride , and the mixure was heated to 100 ° c . and sufficiently stirred to react . the reaction solution was subjected to filtration , and the filtrate was concentrated under reduced pressure to obtain 35 . 1 g of sodium perfluorobutylsulfonyl - trifluoromethylsulfonylimide nan ( so 2 c 4 f 9 )( so 2 cf 3 ). the yield was 78 . 0 %. a flask with four necks was charged with 200 ml of acetonitrile , 12 g of perfluorobuthylsulfonyl fluoride c 4 f 9 so 2 f , 15 . 0 g of cesium fluoride , and 0 . 73 g of ammonium fluoride , and the mixture was heated 50 ° c . and sufficiently stirred to react . the reaction solution was subjected to filtration , and the filtrate was concentrated under reduced pressure to obtain 12 . 5 g of cesium bisperfluorobuthylsulfonylimide csn ( so 2 c 4 f 9 ) 2 . the yield was 89 . 3 %. an autoclave made of stainless was charged with 100 ml of dichloromethane , 100 ml of dmf ( dimethylformamide ) and 30 . 5 g of lithium fluoride . the reactor was cooled to − 60 ° c . in a dry ice / methanol bath , and 5 g of anhydrous ammonia was introduced . in succession , 100 . 0 g of trifluoromethylsulfonyl floride cf 3 so 2 f was introduced , and the temperature of the mixture was returned to ambient temperature with sufficient stirring . after that , the reactor was soaked in a 50 ° c . hot water bath , and the reaction was run while stirring sufficiently . the reaction solution was subjected to filtration , and the filtrate was concentrated under reduced pressure , but only 1 . 7 g of lithium bistrifluoromethylsulfonylimide lin ( so 2 cf 3 ) 2 was obtained ( the yield was 2 . 0 %). although the amount and percentage yield of the product compound in this case were lower than in the case of other examples , this case is expected to be improved by further studies . such an improved case should be indeed in the scope of the present invention . a flask with four necks was charged with 150 ml of acetonitrile , 31 . 2 g of potassium fluoride , and 10 g of trifluoromethylsulfonylamide cf 3 so 2 nh 2 were added . the reactor was soaked in a 40 ° c . water bath , and 11 . 3 g of trifluoromethylsulfonyl chloride cf 3 so 2 cl was introduced while stirring sufficiently . the reaction solution was subjected to filtration , and the filtrate was concentrated under reduced pressure to obtain 21 . 4 g of potassium bistrifluoromethylsulfonylimide kn ( so 2 cf 3 ) 2 . the yield was 96 %. in succession , 21 . 4 g of potassium bistrifluoromethylsulfonylimide was added in a flask that was charged with 30 ml of concentrated sulfuric acid , and the mixture was dissolved under heat . and then , 15 . 6 g of bistrifluoromethylsulfonylimidic acid hn ( so 2 cf 3 ) 2 was distilled by distillation under reduced pressure . the yield was 83 %. the resulting 15 . 6 g of bistrifluoromethylsulfonylimidic acid was dissolved in the pure water and reacted with 2 . 1 g of lithium carbonate . excess lithium carbonate was subjected to filtration , and the filtrate was concentrated to obtain 15 . 4 g of lithium bistrifluoromethylsulfonylimide lin ( so 2 cf 3 ) 2 . the yield was 97 %. a flask with four necks was charged with 200 ml of methylene chloride , 10 g of ammonium fluoride , and 110 g of potassium fluoride . the reactor was soaked in a 40 ° c . water bath , and 91 . 0 g of trifluoromethylsulfonyl chloride cf 3 so 2 cl was introduced while stirring sufficiently . the reaction solution was subjected to filtration , and the filtrate was concentrated under reduced pressure to obtain 81 . 0 g of potassium bistrifluoromethylsulfonylimide kn ( so 2 cf 3 ) 2 . the yield was 94 %. a flask with four necks was charged with 5 g of ammonium fluoride , 143 . 6 g of cesium fluoride , and 200 ml of tetrahydrofuran . with sufficiently stirring the reactor , 22 . 8 g of trifluoromethylsulfonyl chloride cf 3 so 2 cl was introduced , and then 27 . 3 g of pentafluoroethylsulfonyl fluoride c 2 f 5 so 2 f was added . the reaction solution was treated in the same way as example 2 to obtain 62 g of cesium perfluoroethylsulfonyl trifluoromethylsulfonylimide csn ( so 2 c 2 f 5 ) ( so 2 cf 3 ). the yield was 99 . 2 %. in a sus ( stainless )- made autoclave , 200 ml of methylene chloride , 300 ml of dmf ( dimethylformamide ), 45 . 6 g of lithium fluoride , and 99 . 0 g of trifluoromethylsulfonyl chloride cf 3 so 2 cl were added . the reactor was cooled to − 60 ° c . in a methanol / dry ice bath , and 5 g of anhydrous ammonia was introduced . the reaction mixture was returned to the room temperature while stirring sufficiently , and then the reactor was soaked in a 80 ° c . water bath , and the reaction was run while stirring sufficiently . consequently , the reaction solution was treated in the same way as example 2 , but only 0 . 8 g of lithium bistrifluoromethylsulfonylimide lin ( so 2 cf 3 ) 2 was obtained ( the yield was 0 . 9 %). the amount and yield of the product were considerably lower than the cases of other examples , however , further improvement may be expected by the future investigations . this invention naturally includes such a case . in a sus ( stainless )- made autoclave , 200 ml of methylene chloride , 300 ml of dmf ( dimethylformamide ), 74 . 1 g of sodium fluoride , and 49 . 5 g of trifluoromethylsulfonyl chloride cf 3 so 2 cl were added . the reactor was cooled to − 60 ° c . in a methanol / dry ice bath , and 5 g of anhydrous ammonia was introduced . consequently , 88 . 8 g of perfluorobuthylsulfonyl fluoride c 4 f 9 so 2 f was added , and the reaction mixture was returned to the room temperature with stirring sufficiently . and then , the reactor was soaked in a 80 ° c . water bath , and the reaction was run while stirring sufficiently . consequently , the reaction solution was treated in the same way as example 2 , to obtain 18 g of sodium perfluorobuthylsulfonyl trifluoromethylsulfonylimide nan ( so 2 c 4 f 9 ) ( so 2 cf 3 ). the yield was 13 . 5 %. it should be noted that the sulfonylimide compounds obtained in the above examples were respectively confirmed by identifying them using an infrared absorption spectrum . as seen from the above description , the production process of the present invention has such an effect that sulfonylimide compounds useful as lithium battery electrolytes and organic synthetic catalysts are produced industrially easily at a low cost in an efficient manner . furthermore , the production process according to the present invention has such an effect that by reacting a sulfonylamide , a sulfonyl fluoride and a fluorine compound with each other , a sulfonylimide compound useful as lithium battery electrolytes and organic synthtic catalysts is produced under a mild condition that anhydrous ammonia is not always used , and in one stage . also , a specific reactor ( autoclave ) is not required unlike the case that uses anhydrous ammonia . | 2 |
fig1 shows a document interchange system for controlling the creation , retrieval , editing and distribution of shared documents within an electronic office system . a plurality of users , grouped together to form an enterprise 8 , interact with a dialogue manager application 14 to file documents in a system library 12 . an enterprise 8 may be any economic organization . an enterprise 8 may be a conglomerate , a company , a division within a company , a set of departments within a company , or a single department within a company . the dialogue manager application 14 handles , among other things , the gathering of addressing information for access control , contextual - search characteristics , and requester / principle identifiers . the requester application 16 accepts the above - identified information from the dialogue manager application 14 , builds an add or a file request , and transmits the request to the library server 18 . the requester application 16 also passes local documents 20 stored in the enterprise &# 39 ; s local storage to the library 12 . the library server 18 files documents into the library 12 upon a request from a member of the enterprise 8 . the dia system shown in fig1 represents an encoding scheme designed to convey any document . documents can be transmitted irrespective of content from one type of office system to another . in addition , the intent of the person creating or transmitting the document can be conveyed as to the method of processing required . the library server 18 handles the creation of the parameters or descriptors for documents that are to be stored in the library 12 . the dia system requires that these parameters or descriptors be placed in document objects . the descriptors contained in the document objects include the name under which the information is filed , the authors , the subject of the information , and the date the information was filed in the document history . these descriptors enable a document to be searched after it is filed in the library 12 . the descriptors are placed in a document profile and are filed with the document . it is the document profile that enables a document to be searched once it is stored in the library 12 . for purposes of illustration and not limitation , a member of the enterprise 8 can ask the dia system to search for all documents regarding a particular subject and by a certain author which was filed in the library 12 between any two dates . after completing the search , the dia system presents the enterprise 8 with a list of documents meeting the search criteria . the library 12 also provides services for filing documents in and retrieving or deleting documents from the library . enterprise users 8 may update work in progress documents in the library 12 or specify a security level to associate with a document that is being filed . an enterprise user 8 who files a document in the library 12 may authorize other users to retrieve the document from the library . the library server 18 assigns each new document filed in the library 12 a unique name called a library - assigned document name ( ladn ). this ladn is returned to the enterprise user 8 making the file request and can be used to uniquely identify the document at some later time . referring to fig2 each document stored in the library 12 includes the objects shown therein . all of the objects shown in fig2 are created in response to the processing of a file command . a document model object 30 ( dmo ) contains information concerning ownership and attributes of a specific document . this object controls access to the document during its life in the library . the original owner object 34 ( ooo ) contains or points to information used by an owner of a document to control access to the document as filed . the document content object 46 provides for the storage of the document contents and for saving information relating to the actual size of the filed document . the document relation object 42 ( dro ) describes the logical relationships between the document and other documents . if the document is a folder containing related documents , each of the related documents contained therein will have a pointer or ladn entry in this object . the access control model object 32 ( acmo ) is created when a document owner authorizes other users to access the document . structures for all of the objects except the profile content object 44 are a pair of the disoss office system and will not be described herein . every document stored in the document interchange system shown in fig1 has a profile content object 44 ( pco ) associated therewith . when an enterprise user 8 issues a search command to search the library 12 for documents meeting a specific search criteria , the library server 18 will access each document &# 39 ; s profile content object 44 to satisfy the search . turning to fig3 a general scheme is disclosed for enterprise specific search term generation . the term enterprise specific search term ( esst ) is employed to distinguish enterprise search terms from dia architected search terms . the interchange document profile ( idp ) 50 shown in fig3 exists for each document stored in the library 12 , shown in fig1 . the idp 50 for each document is physically stored in the profile content object ( pco ) 44 . as currently implemented , dia systems gather document attribute information from dia - defined attributes shown in block 56 . the dia system can therefore generate search indexes 62 which are stored with the document when it is placed in the library . in order to add enterprise specific search terms ( esst ) to the search indexes 62 , this invention adds the enterprise - defined attributes shown in blocks 52 and 54 . in addition , the invention requires the generation and loading of two tables to generate the enterprise specific search terms . the esst parser table 58 and the esst builder table 60 must be present before the search indexes 62 can be built . these tables represent the formatting information required to parse or build dia search data streams . the tables identify dia structures by name , and illustrate hierarchical relationships between the dia structures . the ordering of the structure entries within the tables represents , unless otherwise specified , the order in which the structures appear in a dia data stream . the library server will check for the presence of the enterprise specific search terms tables before building the search indexes for esst . if the tables have not been properly installed , no search indexes will be built . if the tables have been properly installed , the library server will build the search indexes for the esst based on the validation rules , synonym provision , and standardization defined in the tables . this invention permits an enterprise user to building validation tables based on unique user requirements . therefore , an enterprise user is given the capability to change the validation rules per enterprise requirements , while maintaining an interchangeable , dia - defined syntax and format . each enterprise supported by a dia library may define its own unique esst . if a library supports more than one enterprise , a document may have esst for different enterprises . turning again to fig3 the enterprise defined attributes 52 exist in enterprise - specific sub - profiles . the enterprise - specific sub - profiles 52 , 54 are present only when a supported enterprise has a set of esst associated with a document . if more than one enterprise has search terms associated with a document , there will be more than one enterprise - specific sub - profile defined . therefore , one enterprise - specific sub - profile will exist for each enterprise . the enterprise - specific sub - profiles 52 , 54 are created via a file , modify , copy or file - delivery command . the enterprise - specific sub - profiles 52 , 54 are created only when the essp - option operand is set to &# 34 ; create &# 34 ; in one of these commands . fig4 - 6 show the dia file , modify , and file - delivery commands . note the presence of the enterprise - specific sub - profile option (, essp - option ) in the operand field of each command . the copy command , which is not shown , contains a similar option in its operand - field . when the enterprise - specific sub - profile operand has the value &# 34 ; create &# 34 ; in one of the commands shown in fig4 - 6 , the library server checks whether the esst tables , 58 , 60 in fig3 for the specific enterprise have been installed in the library . if the tables are not found , a warning message is generated . in any case , search indexes are built only if the tables are installed . the enterprise - specific sub - profile is then created and stored in the library with the document . the enterprise - specific sub - profile uses the dia self - defining structured field notation . the sub - profile , as illustrated in fig7 starts with a sub - profile introducer 70 , followed by an enterprise - identification 72 , and one or more enterprise specific search terms 74 - 78 . the sub - profile introducer 70 identifies the sub - profile as enterprise related instead of dia - defined . the invention provides for zero to n enterprise - specific sub - profile introducers . the enterprise - id 72 follows the sub - profile introducers 70 . the enterprise - id 72 is a required parameter in this embodiment and can only appear once . it is the first parameter in the enterprise - specific sub - profile . it is used to identify the enterprise which is associated with the enterprise - specific sub - profile . a user within an enterprise may modify the enterprise - id 72 if the user has at least change authority to the document being file in the library . the structure for the enterprise - id 72 is shown in fig8 . the structure conforms to dia data stream structure and therefore breaks down into the following format . the first 5 bytes of the enterprise - id , shown in fig8 and designated 80 , consist of a 2 byte length specifier , ll , a 2 byte identification field , id , and a 1 byte field , f , specifying the format . blocks 82 and 84 provide additional fields for defining an enterprise . the gcid field in block 82 is an optional field . it specifies the gcid of the enterprise name . if this field is not present , the profile gcid is the default . the language group identification ( lgrpid ) also appears in block 82 . it is a 2 - byte field which identifies the national language group to which the language being identified belongs . the country identification ( ctryid ) and national language identification ( nlngid ) also appear in block 82 . the country identification ( ctryid ) is 2 - byte field which contains the code assigned to the country with which the national language information is being related . the national language identification ( nlngid ) is a 2 - byte field which contains a code assigned to the national language being identified . if the national language support fields lgrpid , ctryid , and nlngid are not present , the profile national language support is the default . block 84 in fig8 contains the final two fields for the enterprise - id . net identification ( netid ) is a 1 to 8 - byte character field . it specifies the office system network . if there is no netid specified , the local network is the default . the last field is the name field . it is 1 to 44 bytes in length . it specifies the name of the enterprises and is a required field . the name field can be repeated to fully identify the enterprise . the order of the repeated name fields is important . the enterprise - specific search terms , shown as blocks 74 - 78 in fig7 have the structure shown in fig9 . the esst , 74 - 78 , are required parameters and can appear multiple times . these terms specify the searchable attributes specific to the enterprise which was defined in the enterprise - id parameter 72 . the esst can be modified by the enterprise user who has the appropriate access authority to the document . although the enterprise - specific search terms 74 - 78 are defined by the enterprise , the structure of the esst parameter must conform to the dia data stream structure . as shown in fig9 the structure of the esst parameter is composed of ll , id , f , and content fields . the ll field is 2 - bytes and defines the length of the search term . the id field is also 2 bytes and identifies the search term . the id field can be any hex value except x ` ca5f ` ( the id for the enterprise - specific sub - profile ) or x ` c74a ` ( the id for the enterprise = id ). the f field is 1 byte and specifies the format of the search term content . the f field must conform to the dia standard for the 0th bit and the 3rd bit . finally , the content field is of variable length and contains the search terms . in summary , this invention discloses a method which allows an enterprise user to define the syntax and semantics of search terms that are specific to that enterprise to create , search , or retrieve information stored in a shared library . the enterprise - specific search terms ( esst ) are associated with a document to be stored in the shared library through the interchange document profile ( idp ). while the esst could also be associated with a document through a library model object ( lmo ), the idp is preferred because it contains dia attributes that are very similar to enterprise specific search terms . an enterprise specific sub - profile is the preferred method of implementing this invention . the sub - profiles contain the enterprise defined search terms and are identified as belonging to a particular enterprise . associated search term tables are required for each enterprise . the enterprise specific sub - profiles are accessed when there is a value of &# 34 ; create essential search profile &# 34 ; in the file , modify , copy or file - delivery commands . index build mechanisms , normally used for dia architected search terms , access the enterprise unique sub - profiles to build combined indicies of user and dia architected search terms . these indicies are stored with each document and are available to document access mechanisms for later retrieval of the documents . while the invention has been particularly shown and described with reference to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention . | 8 |
it is to be understood and appreciated that the method for increasing signal noise ratio described below do not cover a complete system and method . the present invention can be practiced in conjunction with various software and hardware that are used in the art , and only so much of the commonly practiced components and steps are included herein as are necessary to provide an understanding of the present invention . the present invention will be described in detail with reference to the accompanying drawings . it should be noted that the drawings are in greatly simplified form . referring to fig1 , a flow chart of the method for increasing signal to noise ratio in accordance with one embodiment of the invention is shown . under common circumstance , the out voltage of photosensors such as charge coupled devices ( ccd ) or complemental metal oxide semiconductor sensors is lower than the input voltage of the analog to digital converter ( adc ). the method for increasing signal to noise ratio of the invention is used to find out the actual saturation voltage of the photosensors and then increases the output voltage of the photosensors by increasing exposure time tint or lamp illumination to near the actual saturation voltage of the photosensors so that the signal to noise ratio can be increased and image quality can be upgraded . first of all , after step 102 , original exposure time tint t 0 or original lamp illumination l x0 is set in step 104 . since illumination energy e equals the product of exposure time tint t and lamp illumination l , increasing either exposure time tint t or illumination l will increase illumination energy e . next in step 106 , a white target chart is scanned and the photosensors convert the light which it receives into an electric charge . the magnitude of the charge depend on illumination l x0 ( the intensity of the light ) and exposure time tint t 0 set forth . then the charges from the photosensors are converted into analog voltages via the analog amplifier . finally , the analog voltages are digitized to form a maximum data d 0 by the analog to digital converter for digital image processing . if a 8 bit analog to digital converter is utilized , data d 0 is from 0 to 255 . in step 108 , maximum data d 0 is compared to 255 if a 8 bit analog to digital converter is utilized . if maximum data d 0 is smaller than 255 , then exposure time tint t n or lamp illumination l xn should be increased and the white target chart is scanned again in step 110 . the magnitude of the charge now depends on illumination l xn + 1 and exposure time tint t n + 1 . then the charges from the photosensors are converted into analog voltages via the analog amplifier . finally , the analog voltages are digitized to form a maximum data d n + 1 by the analog to digital converter for digital image processing . the maximum data d n + 1 is then compared to the previous maximum data d n ( starting from d 0 ) in step 112 . if the maximum data d n + 1 is not larger than the previous maximum data d n , that means that the output voltage of the photosensors has been saturated and exposure time tint t n or illumination l xn generating the maximum data d n is saved in step 114 . on the contrary , if the maximum data d n + 1 is larger than the previous maximum data d n , that means that the output voltage of the photosensors has not been saturated and the process goes back step 110 until the output voltage of the photosensors is saturated . if maximum data d 0 is not smaller than 255 , then exposure time tint t or lamp illumination l xn should be decreased and the white target chart is scanned again in step 116 . the magnitude of the charge depend on illumination l xn + 1 and exposure time tint t n + 1 . then the charges from the photosensors are converted into analog voltages via the analog amplifier . finally , the analog voltages are digitized to form a maximum data d n + 1 by the analog to digital converter for digital image processing . the maximum data d n + 1 is then compared to the previous maximum data d n ( starting from d 0 ) in step 118 . if the maximum data d n + 1 is smaller than the previous maximum data d n , that means that the output voltage of the photosensors has been saturated and exposure time tint t n + 1 or illumination l xn + 1 generating the maximum data d n + 1 is saved in step 120 . on the contrary , if the maximum data d n + 1 is not smaller than the previous maximum data d n , that means that the output voltage of the photosensors has not been saturated and the process goes back step 116 until the output voltage of the photosensors is saturated . referring to fig2 , a flow chart of how the method of this invention is utilized in a scanning procedure is shown . in step 202 , an user interface operated in personal computer is launched . then default scan parameters are set up in step 204 . next optimum exposure time or optimum illumination is found in step 206 or 208 via the method described above and shown in fig1 . new scan parameters obtained in step 206 or 208 are then set up before starting scan in step 212 . fig3 shows a diagram of output voltage v 0 of photosensors versus input illumination energy e ( l x × t ). as shown in the figure , output voltage v 0 increases linearly with input illumination energy e until saturation exposure se is reached , wherein ads means average dark signal . output voltage v 0 equals saturation voltage v sat at saturation exposure se . other embodiments of the invention will appear to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . it is intended that the specification and examples to be considered as exemplary only , with a true scope and spirit of the invention being indicated by the following claims . | 7 |
the present invention is a phase only measurement system particularly suited for use in an airborne collision avoidance system , such as tcas . fig1 illustrates a preferred receive system for making phase only bearing measurements in accordance with the present invention . a four element antenna array 10 is preferred for use in the tcas equipment of a protected aircraft . each of the elements 12 , 14 , 16 and 18 are arranged in quadrature , that is they are spaced apart at 90 ° around a circumference of the array 10 . the elements 12 and 16 are aligned along the y axis and the elements 14 and 18 are arranged on the x axis which is perpendicular to the y axis . adjacent elements are those which are circumferentially spaced apart by 90 °. opposite elements are those which are circumferentially spaced apart by 180 °. when a response signal from a target aircraft impinges on the array 10 , the bearing of the target aircraft is determined from the relative phases of the response signal at adjacent array elements . each of the elements 12 , 14 , 16 and 18 are connected to a receiver 19 . the receiver 19 includes five swap switches 20 to 24 , three receivers 26 to 28 , two oscillators 30 and 32 and two phase detectors 34 and 36 . the swap switches 20 and 21 selectively interconnect the antenna elements 12 , 14 , 16 and 18 to a first input of the receivers 26 to 28 . the swap switch 20 has six terminals 38 to 43 . two terminals 38 and 41 are connected to the antenna element 12 and two terminals 39 and 40 are connected to the antenna element 16 . the output terminal 42 is connected to the first input of the receiver 26 and the output terminal 43 is preferably connected to ground . the swap switch 20 has two positions : swap a and swap b . in the swap a position , the terminals 42 and 43 are connected to the terminals 38 and 39 , respectively , such that the antenna element 12 is connected to the receiver 26 and the antenna element 16 is connected to ground . in the swap b position , the terminals 42 and 43 are connected to the terminals 40 and 41 , respectively , such that the antenna element 12 is connected to ground and the antenna element 16 is connected to the receiver 66 . the swap switch 21 similarly has six terminals 44 to 49 . the antenna element 14 is connected to the two terminals 44 and 47 . the antenna element 18 is connected to the two terminals 45 and 46 . the output terminal 48 is connected to the first input of the receiver 27 and the output terminal 49 is connected to the first input of the receiver 28 . the swap switch 21 also has a swap a position and a swap b position . in the swap a position , the terminals 48 and 49 are connected to the terminals 44 and 45 , respectively , such that the antenna element 14 is connected to the receiver 27 and the antenna element 18 is connected to the receiver 28 . in the swap b position , the terminals 48 and 49 are connected to the terminals 46 and 47 , respectively , such that the antenna element 14 is connected to the receiver 28 and the antenna element 18 is connected to the receiver 27 . each of the swap switches 20 and 21 are selectively controlled between the swap a and the swap b positions to exchange the signal paths between pairs of antenna elements and the input of pairs of receivers . the swap switches 22 and 23 selectively interconnect the output of the receivers 26 to 28 to the inputs of the phase detectors 34 and 36 . the swap switch 22 has six terminals 50 to 55 . the output of the receiver 26 is connected to two terminals 50 and 53 . the output of the receiver 27 is connected to two terminals 51 and 52 . the output terminal 54 is connected to a first input of the phase detector 34 and the output terminal 55 is connected to a second input of the phase detector 34 . in a swap a position , the terminals 54 and 55 are connected to the terminals 50 and 51 , respectively , such that the output of the receiver 26 is connected to the first input of the phase detector 34 and the output of the receiver 27 is connected to the second input of the phase detector 34 . in a swap b position , the terminals 54 and 55 are connected to the terminals 52 and 53 , respectively , such that the output of the receiver 27 is connected to the first input of the phase detector 34 and the output of the receiver 26 is connected to the second input of the phase detector 34 . the swap switch 23 also has six terminals 56 to 61 . the output of the receiver 26 is connected to the terminals 56 and 59 . the output of the receiver 28 is connected to the terminals 57 and 58 . the output terminal 60 is connected to a first input of the phase detector 36 and the output terminal 61 is connected to a second input of the phase detector 36 . in a swap a position , the terminals 60 and 61 are connected to the terminals 56 and 57 , respectively , such that the output of the receiver 26 is connected to the first input of the phase detector 36 and the output of the receiver 28 is connected to the second input of the phase detector 36 . in a swap b position , the terminals 60 and 61 are connected to the terminals 58 and 59 , respectively , such that the output of the receiver 26 is connected to the second input of the phase detector 36 and the output of the receiver 28 is connected to the first input of the phase detector 36 . each of the swap switches 20 to 23 are simultaneously and selectively controlled between the swap a and swap b positions to exchange the signal paths between a receiver and the first and second inputs of a phase detector . the swap switch 24 and the two oscillators 30 and 32 are preferably used to calibrate the phase detectors 34 and 36 . the swap switch 24 has six terminals 62 to 67 . the output of the oscillator 30 is connected to the terminals 62 and 65 . the output of the oscillator 32 is connected to the terminals 63 and 64 . the terminal 66 is connected to a second input in the receiver 26 and the terminal 67 is connected to a second input in the two receivers 27 and 28 . the second input in each of the receivers 26 to 28 preferably bypass any front end filtering which the receivers 26 to 28 might have , thereby avoiding phase shifted signals . as before , the swap switch 24 has a swap a position in a swap b position . in the swap a position , the terminals 66 and 67 are connected to the terminals 62 and 63 , respectively , such that the oscillator 30 is connected to the second input of the first receiver 26 and the second oscillator 32 is connected to the second inputs of the two receivers 27 and 28 . in the swap b position , the terminals 66 and 67 are connected to the terminals 64 and 65 , respectively , such that the first oscillator 30 is connected to the second inputs of the two receivers 27 and 28 while the second oscillator 32 is connected to the second input of the first receiver 26 . the outputs of the phase detectors 34 and 36 provide sine and cosine components of the target aircraft bearing when the response signal transmitted by the target aircraft impinges the antenna array 10 . it is , however , preferred to calibrate the system before taking phase detection measurements to determine the bearing of a receive signal . calibration is preferably divided into two parts . first , the phase detectors 34 and 36 are calibrated for a given pair of the receivers 26 to 28 . second , the three receivers 26 to 28 and the cabling associated therewith are calibrated . the calibration of the phase detectors 34 and 36 for a given pair of the receivers 26 to 28 will now be discussed with reference to fig2 and 3 . the phase detector 34 is associated with the receiver pair 26 and 27 . the phase detector 36 is associated with the receiver pair 27 and 28 . the calibration of the phase detectors 34 and 36 for the respective pair of receivers is preferably performed in two steps . generally , in the first step , the system is configured such that , for a given phase detector , a first signal is input through a first receiver to a first input of the phase detector and a second signal is input through a second receiver to a second input of the phase detector . then , in the second step , the signal input to the receivers and the receiver connection to the inputs of the phase detector is swapped , such that the first signal is input through the second receiver to the first input of the phase detector and the second signal is input through the first receiver to the second input of the phase detector . the first and second signals have differing frequencies which are not multiples of each other . the first and second signals , therefore , cannot become synchronized . these steps provide a linear phase sweep of the phase detectors to characterize the behavior of the phase detectors . fig2 illustrates the signal paths during the first step of the phase detector calibration procedure . the signal paths are obtained by placing the swap switches 22 to 24 ( not shown ) in the swap a position . the oscillators 30 and 32 generate the first and second signals before mentioned . the oscillators 30 and 32 preferably are highly stable in frequency and differ in frequency by a very small percentage . for example , in a tcas receiver it is preferred to have the oscillator 30 output a frequency of 60 . 00 mhz and to have the oscillator 32 output a frequency of 60 . 01 mhz . other frequencies , however , can be used . referring to fig2 in the first step of the phase detector calibration procedure the 60 . 00 mhz signal from the oscillator 30 passes through the receiver 26 to the first inputs of the phase detectors 34 and 36 . the 60 . 01 mhz signal from the oscillator 32 passes through the receivers 27 and 28 to the second input of the phase detectors 34 and 36 , respectively . each of the phase detectors , therefore , has 60 . 00 mhz at its first input and 60 . 01 mhz at its second input . the voltage output of the phase detector 34 is monitored by an analog to digital converter as the 60 . 00 mhz and the 60 . 01 mhz signals are input and a set of data , calasin , is obtained . this data is graphically illustrated in a graph 100 . a first line 102 and a second line 104 in the graph 100 represents the voltage output of the phase detector 34 . the first line 102 is caused by the first cycles of the 60 . 00 mhz signal and the 60 . 01 mhz signal and , therefore , represents the phase detector 34 output over approximately 360 ° of the input signal . the second line 104 is caused by the second cycles of the 60 . 00 mhz signal and the 60 . 01 mhz signal . it is preferred to sample more than one cycle of data from the output of the phase detector 34 as it is possible that the line 102 does not start at 0 ° since the oscillators 30 and 32 and the phase detector 34 operate asynchronously . a second set of calibration data , calacos , is obtained by sampling the output of the phase detector 36 as the signals from the oscillators 30 and 32 are input . this data is represented on the graph 106 by the lines 108 and 110 . again , it is preferred to sample two cycles of data , however , more or less cycles can be sampled as necessary . referring to fig3 the signal paths for the second step in the preferred phase detector calibration procedure is illustrated . these signal paths are obtained by placing the swap switches 22 to 24 in the swap b position . note that the signal inputs to the receivers 26 to 28 are swapped and receiver connections to each phase detector 34 and 36 are swapped between receiver pairs . as a result , the 60 . 01 mhz signal from the oscillator 32 passes through the receiver 26 to the second input of the phase detectors 34 and 36 . also , the 60 . 00 mhz signal from the oscillator 30 passes through the receiver 27 and 28 to the first input of the phase detectors 34 and 36 , respectively . two more sets of calibration data , calbsin and calbcos , represented on the graphs 112 and 118 , respectively , by the lines 114 , 116 and 120 , 122 , respectively , are obtained by monitoring the outputs of the phase detectors 34 and 36 , respectively . after obtaining the four sets of phase detector calibration data , the second calibration step is performed , wherein the receivers 26 to 28 and the associated cables , are calibrated . the preferred calibration procedure for the receivers 26 to 28 is illustrated in fig4 to 7 . in fig4 two receiver calibration measurements are illustrated . for both of these steps , the swap switches 20 to 23 are in the swap a position . the first measurement is taken with the receive system configured to have signal paths as illustrated within the box 130 . in this measurement , a signal at the frequency of the response signal is transmitted from the element 16 . in aircraft collision avoidance systems , for example , the response signal is preferably transmitted at a frequency of 1090 mhz , and a similar frequency would be used to calibrate . the transmitted signal is received by the element 12 , transmitted through the receiver 26 to the first input of the phase detector 34 . the transmitted signal is also received by the antenna element 14 , transmitted through the receiver 27 to the second input of the phase detector 34 . the output of the phase detector 34 is monitored and the value is plotted on the curve 102 as a data point 132 . the second measurement is taken with the receive system configured to have signal paths as illustrated within the box 134 . in this measurement , a signal is transmitted from the antenna element 18 . the signal is received by the antenna elements 12 and 14 and transmitted through the receivers 26 and 27 , respectively , to the first and second inputs , respectively , of the phase detector 34 . the output of the phase detector 34 is monitored and is plotted on the curve 102 as a data point 136 . the average 0 ° measurement through the receiver pair 26 and 27 is then determined to be the mid point along the curve 102 between the points 132 and 136 . in finding the zero point between adjacent elements , offsets caused by the antenna , the cabling and the receivers are canceled . fig5 illustrates the next two measurements that are taken . the swap switches 20 to 23 are again set in the swap a position . in the third measurement , a signal is transmitted from the antenna element 14 and the signal paths that result are illustrated in the box 138 . the transmitted signal is received by the antenna elements 12 and 18 . the signal received by the antenna element 12 is passed through the receiver 26 to the first input of the phase detector 36 . the signal received by the antenna element 18 is passed through the receiver 28 to the second input of the phase detector 36 . the output of the phase detector 36 is measured and is plotted as a data point 140 on the curve 108 . in the fourth measurement , the element 16 transmits a signal and the signal paths that result are illustrated in the box 142 . the transmitted signal is received by the antenna elements 12 and 18 . the received signals are passed to the second phase detector 36 along the same signal paths as in the third measurement . the output of the phase detector 36 is monitored and is plotted as a data point 142 on the curve 108 . the next two measurements are taken with the swap switches 20 to 23 in the swap b position . in the fifth measurement , a signal is transmitted from the antenna element 12 . the resulting signal paths are illustrated in the box 146 . the transmitted signal is received by the antenna elements 16 and 18 . the signal received by the antenna element 16 is passed through the receiver 26 to the second input of the phase detector 34 . the signal received by the antenna element 18 is passed through the receiver 27 to the first input of the phase detector 34 . the output of the phase detector 34 is monitored and is plotted as a data point 148 on the curve 114 . for the sixth measurement , a signal is transmitted from the antenna element 14 . the resulting signal paths are illustrated in the box 150 . the signals are received again by the antenna elements 16 and 18 . these signals are passed to the inputs of the phase detector 34 along the same signal paths as in the fifth measurement . the output of the phase detector 34 is monitored and is plotted as a data point 152 on the curve 114 . the next two measurements are again made with the swap switches in the swap b position . a signal is transmitted from the antenna element 12 . the resulting signal paths are illustrated in the box 154 . the transmitted signal is received by the antenna elements 14 and 16 . the antenna element 16 receives the signal and transmits it through the receiver 26 to the second input of the phase detector 36 . the signal received by the antenna element 14 is transmitted through the receiver 28 to the first input of the phase detector 36 . the output of the phase detector 36 is monitored and plotted as a data point 156 on the curve 120 . for the eighth measurement , a signal is transmitted from the antenna element 18 . the signal paths are shown in the box 158 . the output of the phase detector 36 is monitored and plotted as a data point 160 on the curve 120 . as previously discussed , the outputs of the phase detectors 34 and 36 provide sinc and cosine components of the bearing of the target aircraft . it is preferred to take two measurements , a first with swap switches 20 to 23 in the swap a position and a second with the swap switches 20 to 23 in the swap b position . fig8 illustrates the signal paths from the antenna element through the receiver to the phase detector when the first measurement is taken ( i . e . with the swap switches in the swap a position ). the output from the phase detector 34 , therefore , is a first component , sina , of the bearing of the target aircraft note that sina results from the phase difference between the antenna elements 12 and 14 . the output from the phase detector 36 is a second component , cos a , of the bearing of the target aircraft note that cosa results from the phase difference of the response signal as measured between the elements 12 and 18 . the antenna element 16 is preferably grounded during this measurement . fig9 illustrates the signal paths from the antenna elements through the receivers to the phase detector when the second measurement is taken , ( i . e . with the swap switches 20 to 23 in the swap b position . the signal from the antenna element 12 is input to the first inputs of the phase detectors 34 and 36 through the receiver 26 . the signal from the antenna element 14 is input to the second input of the phase detector 34 through the receiver 27 and the signal from the antenna element 18 is input to the second input of the phase detector 36 . the output from the phase detector 34 , therefore , is a first component sin b , of the bearing of the target aircraft . note that sin b results from the phase difference between the antenna elements 16 and 18 . the output from the phase detector 36 , is a second component , cos b , of the bearing of the target aircraft . note that cos b results from the phase difference between the antenna elements 14 and 16 . after all the results -- sin a , cos a , sin b and cos b -- are obtained from each measurement , the results from each phase detector 34 and 36 is , preferably , averaged as follows : note that 45 ° must be added to the result since adjacent antenna elements are used to calculate bearing instead of opposite antenna elements . the above - described bearing calculation requires that the antenna array 10 receive the response signal from a target aircraft during both the swap a and the swap b procedures . in other words valid replies are required during the first and second bearing measurements . it is possible , however , for a reply to be missing during either the swap a or the swap b procedures . consider , for example , possibility of interference causing the target aircraft &# 39 ; s response signal not to be received at the protected aircraft &# 39 ; s tcas antenna at the appropriate time . in cases where the reply from one of the swap procedures ( a or b ) is missing , it is preferred to use the following procedure . for each swap a and swap b measurement , the following error equations are determined : these equations are updated each time a valid swap a and a valid swap b measurement are both obtained . if the replies obtained during a swap a measurement , sin a and cos a , are missing , then bearing is determined by the following equation : where the replies from a swap b measurement are missing , then bearing is determined by the following equation : in the above equations , the most current values of sinerr and coserr are used . in this way , some measures of the errors in the receive system are accounted for in the bearing determination . the above &# 34 ; a only &# 34 ; and &# 34 ; b only &# 34 ; measurements provide a rough bearing with 3 db less s / n ratio and less accuracy . further , the antenna characteristics are not completely averaged out . receiver phase errors due to received signal frequency differences ( i . e . different from the 1090 mhz calibration signal ), and , to a lesser extent , amplitude , are not canceled out with &# 34 ; a only &# 34 ; or &# 34 ; b only &# 34 ; measurements . | 6 |
it is an object of the present invention to improve quench - hardening of gears , particularly of large gears with an internal space between two the gear carrying disks . it is a specific object of the present invention to improve a hardening method for gears which includes carburization followed by quenching , so that detrimental effects one of these steps may have on the other and on the final product are excluded . in accordance with the present invention it is suggested to cover the rim carrying a disk or disks during carburization and during quenching in such a manner that carburization of the rim carrying disk or disks is prevented while the same cover subsequently reduces the quenching speed for the rim carrying disk to about the quenching speed of the hub and of the rim . the cover is subsequently removed . the inventive improvement does not only protect the rim carrying disk or disks from carburization , but avoids also deformation of the assembly so that the subsequent grinding work is a minimal one . if , as is contemplated in the preferred form of practicing the invention , the gear has two axially spaced , rim carrying disks , they should have perforations and the supplemental , covering disks should have registering perforations , but suitable elements close to the perforations during carburization to avoid exposure of the interior of the gear to the carbon ( but pressure equalization should be permitted ), while the perforations are opened during quenching to expose the interior of the gear to the quenching liquid . the gear should rotate or pivot back and forth about its axis , in vertical orientation , during quenching to expose the gear at different orientations to the flow pattern of the quenching bath . such motion during quenching also enhances and equalizes the heat transfer in the interior of the gear and will also equalize the rising temperature of the quenching bath . while the specifications concludes with claims particularly pointing out and distinctly claiming the subject matter which is regarded as the invention , it is believed that the invention , the objects and features of the invention and further objects , features and advantages thereof will be better understood from the following description taken in connection with the accompanying drawings in which : fig1 is a schematic view of a complete equipment for hardening gears ; fig2 is an axial section view of a gear to be hardened ; fig3 is a top elevation of the gear shown in fig2 ; and fig4 and 5 are top elevations of certain auxiliary elements to be used on the gear , shown in fig2 and 3 , during the process . proceeding now to the detailed description of the drawings , the hardening equipment shown in fig1 includes a pit furnace 15 , a vessel 18 for a saline bath for quenching , and moving and holding equipment 20 for placing a gear 1 into the furnace , removing it therefrom , moving the gear to the bath , holding it therein and removing the quenched gear from the bath for further working . this figure shows actually two gears 1 , 1 &# 39 ; as two can be processed at a time . the moving and holding equipment 20 is comprised of a lifting structure suspended from a carriage 22 which runs on a rail 23 . a first cage 16 is suspended from equipment 20 by a hook 21 . this figure shows two cages , 16 and 16 &# 39 ;, the latter being placed in the furnace 15 , and a gear 1 &# 39 ; rests on support elements 17 of that cage . the other cage , 16 , is suspended from equipment 20 holding the gear 1 in the saline bath in vessel 18 . reference numeral 24 refers to an agitator which produces a continuous flow of the saline liquid in the vessel 18 , i . e . device 24 causes the liquid to circulate in a particular manner . for practicing the invention , it is not necessary to adapt the resulting flow pattern to different size gears . the furnace 15 contains a carbon atmosphere as is known per se to heat the gear 1 &# 39 ; therein to a temperature between 900 ° and 920 ° c . to obtain carburization . the saline bath in vessel 18 has a temperature of 160 ° which is increased slightly by the heat from the hot gear 1 being quenched . the quenching proper as far as the bath is concerned and the temperatures involved is likewise conventional per se . reference numeral 19 refers to a supplemental equipment for slowly turning the cage 16 in vessel 18 in order to equalize cooling of the gear 1 and to expose different portions of the gear to the flow pattern in that cage . alternatively , cage 16 may be swiveled back and forth over a rather large angular range and for the same purpose . the main point is that the orientation of the gear is changed so that the gear be exposed to different positions of the flow pattern , generated by the agitator 24 and as modified by the cage and the gear in the bath . this swiveling or turning equipment 19 is operated until the gear and bath temperaturs have equalized . the gears to be hardened are prepared in a manner to be explained next with reference to fig2 to 5 . the gear is comprised of a hub element 2 , a gear rim 4 and two annular disks 3a and 3b . the rim element carries or has teeth 5 . the disks 3a and 3b are welded onto the hub 2 in a particular axial distance from each other . reference numerals 6a and 6b respectively refer to the two welding seams . the rim element 4 is welded to the two outer peripheries of the two disks , the two welding seams are respectively identified by numerals 7a and 7b . rim , hub and disks define an interior space or cavity . now , in accordance with the invention , the two disks 3a and 3b are temporarily covered by supplemental disks 8a and 8b which are slightly wider ( radially ) than the disks 3a and 3b so that they also cover , from the outside , the four welding seams 6a , b and 7a , b . actually , each supplemental disk is composed of two segments . fig3 shows particularly that disk 8a is composed of the two segments 8a &# 39 ; and 8a &# 34 ;. it should be noted that the gears 1 , 1 &# 39 ; are held in the cages 16 , 16 &# 39 ; in a horizontal disposition . thus , it suffices to just place the two segments 8a &# 39 ; and 8a &# 34 ; on top of disk 3a . on the other hand , the two segments making up disk 8b are fastened to the lower disk 3b , e . g . by clamps or the like . the disks 3a and 3b have perforations 9 which are a part of their configuration . the perforations i . e . access to the interior space between the disks 3a , b is wanted , e . g . during the quenching ; it is not wanted during the carburization treatment . therefore , supplemental disks 8a , b are also provided with the perforations such as 10 which register respectively with the perforations 9 , but the apertures are temporarily closed . the perforations of the upper disk 8a are closed by wafers or small disks 11 , they may be glued to the disk 8a by means of a protective paste or other bonding agent which will not be destroyed by the thermal carburization treatment . this way carbon is prevented from entering the interior between disks 3a and 3b from above . biparted disks 12 ( the parts being denoted 13 and 14 , in fig5 ) have been slipped through the apertures 9 , 10 of the lower disk elements 8b , 3b and are pasted or glued onto disk 3b to cover the apertures 9 thereof . the radius of these disk segments 13 , 14 should be smaller than the diameter of bores 9 , 10 ; but the diameter of any of these cover disks must be larger . thus , the interior space between disks 3a , b is completely sealed off . the sealing does not have to be air tight , but should filter out carbon while , on the other hand , pressure equalization inside of the gear should be permitted to take place . a gear to be used here should , for example , has its discs fixed by sort of cement . during thermal treatment and carburization , only the exposed portions of the gear , but not the outside of the rim 4 , the teeth 5 and the end parts of hub 2 are carburized . after the gear has been dipped into the saline solution the glue is dissolved so that the covers 11 and 12 are released ; quenching liquid can readily enter the interior space between disks 3a and 3b . there is , of course , a certain delay before the quenching liquid in fact enters that space which is quite desirable . moreover , the covers 8a and 8b remain in place and slow the outflow of heat from disks 3a and 3b so that the quenching is in fact a more uniform one . assuming that the covers 8a , b be made from the same or similar material as the gear proper ( which is a reasonable and practical assumption ), one can see that a uniform quenching in the sense of a uniform reduction in temperatures of the several gear parts requires tha the covers 8a , b have a particular thickness . that thickness should be such that the combined ( axial ) thickness of disks 3a and 8a , and the analogous sum of the thickness of disks 3b , 8b is about equal to the radial width of rim 4 and the radial thickness of hub 2 . it is assumed that the latter two values are about equal . they should not be too unequal , and in the case of a difference , the above identified sum should have value in between . the invention is not limited to the embodiments described above but all changes and modificatons thereof not constituting departures from the spirit and scope of the invention are intended to be included . | 8 |
the present invention shall be described in further detail below by way of the following detailed description and the non - limiting examples . the battery separators according to the instant invention of continuous process comprises singly - ply polyolefin ( preferably pp or pe ) microporous membranes , the thickness of which ranges from 0 . 2 mil to 2 . 0 mil . one mil is equal to 0 . 001 inch . the instant invention uses one or multiple small film - extrusion lines , preferably four blown - film extrusion lines , placed directly before annealing oven at a line speed compatible with the line speed of the annealing process in the annealing oven . so , the extruded multiple - ply films from multiple film - extrusion lines can be continuously and directly fed to the annealing oven . following that , the exit of the annealing oven is aligned with the entrance of stretching oven , which is composed of cold stretching section , then hot stretching section , and then relaxing / heat - set section . at the end of the stretching oven , a winder collects the stretched membrane cut at the desired length for further separate deplying and slitting process . the process of the instant invention produces the dry - stretch microporous membrane separator continuously and directly from extrusion to annealing and to stretching . the process of the instant invention provides the advantages of ( 1 ) higher yield , ( 2 ) more stable quality products , ( 3 ) more machine time usage , ( 4 ) no need to handle and manage the intermediate product rolls , ( 5 ) less manpower needed and ( 6 ) less maintenance with this continuous process . in summary , the inventive continuous process provides a big jump in production efficiency by converting a single large fast film extrusion line into multiple smaller film extrusion lines . the latter runs continuously at a compatible speed with the followed annealing and stretching operations . fig1 shows an example of the set - up for the continuous production line for multiply pp or pe membranes , in which each ply has a thickness ranging from 0 . 2 mil to 2 mil . extruder 1 is hooked up with a rotational circular die 2 . the die 2 extrudes a tubular film going through an air ring 3 to form a bubble . the bubble is collapsed by a pair of collapsing frames 4 and by a pair of collapsing rolls 4 to form two - ply films . four two - ply films are continuously fed to an annealing oven 5 . at the exit of the annealing oven 5 , the total eight - ply annealed films are quenched with a pair of quenching rolls 6 . the eight - ply quenched , annealed films are continuously fed through two pair of cold - stretching rolls 7 , and then through an oven 8 for stretching . at the exit of the stretching oven 8 , the eight - ply stretched membranes are quenched with a pair of quenching rolls 9 before the eight - ply membranes are collected on a winder roll 10 . fig2 shows an example of the film - extrusion set - up for making multiply pp / pe / pp trilayer precursor films , in which each ply has a thickness ranging from 0 . 6 mil to 4 mil . two - ply collapsed pp precursor films 11 with two edges trimmed are separated into two separate plies of films , 12 and 13 . two - ply collapsed pe precursor films 14 with two edges trimmed are separated into two separate plies of films , part of 15 and 16 . one ply of pp film 12 and one ply of pe film from trimmed pe film 14 form pp / pe non - bonded bilayer 15 . below the extrusion lines , a non - bonded pp / pe bilayer 18 is continuously fed to combine with two - ply pp film 17 and with pe / pp non - bonded bilayer 15 to form two - ply non - bonded pp / pe / pp trilayer films 19 . the two - ply non - bonded pp / pe / pp trilayer films 19 are combined with another stream of two - ply non - bonded pp / pe / pp trilayer films to form four - ply non - bonded pp / pe / pp trilayer films 20 . the combined four - ply pp / pe / pp precursor films are continuously fed to annealing oven for annealing and bonding between pp and pe layers . then , the annealed films are continuously fed through the cold stretching unit and through the hot - stretching oven to form pp / pe / pp trilayer membrane as described in fig1 . in this invention , the process is continuous while in the prior art u . s . pat . no . 5 , 952 , 120 , the process is comprised of separate steps . the detailed running conditions in the annealing and stretching ovens are mostly described in the prior art for dry - stretch polyolefin microporous membranes . for example , annealing temperature , stretching temperature , line speeds in the oven , cold stretching ratio , hot stretching ratio and heat - set / relaxing ratio can be the same as or different from those described in the prior art , u . s . pat . no . 4 , 138 , 459 for multiply ( pp or pe ) single - layer separator , u . s . pat . no . 5 , 952 , 120 for multiply pp / pe / pp trilayer separator , u . s . pat . no . 6 , 057 , 060 for multiply ultra - thin ( pp or pe ) separator . they need to be adjusted based on different grades of pp or pe raw materials used . the following lists an example of production efficiency advantage with the continuous method described herein . taking the example shown in fig1 , table 1 list the comparison of production efficiency between the continuous process and the process comprised of separate steps . the separate processes are comprised of three separate steps : film extrusion , annealing and stretching . the estimate yields are 90 % for film extrusion , 90 % for annealing and 85 % for stretching . the yield of stretching is expected to be lower because of losing the film during starting - up and ending under high tension . runnable machine usage is estimated to be 80 % because of idle time during roll change , starting up , and ending . the operation cost is assumed to be 100 % as a comparison basis . so , the total productivity index is estimated to be 54 . 4 %. in contrast , the continuous process of this invention is a single step . the yield of film extrusion is estimated to be 95 %, slightly higher than that in the separate processes because of no roll - collection operation . membrane collection yield at the end of the process is expected to be 98 %. so , the product yield would be 92 %. runnable machine usage is expected to be 100 % because of no idle time for roll change , roll starting up and roll ending . the operation cost is estimated to be 80 % of that in the separate processes because of no need for operation , management and storage for intermediate products . so , the total productivity index is estimated to be 115 . 0 %. the production efficiency of the continuous process in this invention is much greater than that of the conventional separate processes . the extrusion conditions are mainly dominated by the process conditions in the ovens , especially to the film - extrusion line speed . it needs to be compatible with the planned line speed in the annealing oven so that it can be run continuously . for the pp / pe / pp trilayer membrane , the pp film extrusion and the pe film extrusion need to be run at the same speed . the preferred annealing line speed ranges from 15 ft / min and 35 ft / min . the film extrusion speed is preferably in the range of 15 ft / min and 35 ft / min . in the conventional processes of separate steps , the higher line extrusion speed is preferred . in the prior art , with the conventional separate processes , the film extrusion line speed is preferably in the range of 30 ft / min and 700 ft / min for blown film extrusion and preferably in the range of 50 ft / min and 500 ft / min for slit film extrusion as described in the prior art , u . s . pat . nos . 3 , 426 , 754 ; 3 , 558 , 764 ; 3 , 679 , 538 ; 3 , 679 , 540 ; 3 , 801 , 404 ; 3 , 801 , 692 ; 3 , 843 , 761 ; 3 , 932 , 682 . for the line speed of blown film extrusion for the precursor in another prior art u . s . pat . nos . 4 , 994 , 335 ; 5 , 173 , 235 , the line speed of extrusion was in the range of 100 ft / min and 120 ft / min ( 30 meter / min and 36 meter / min ). in this invention , the line extrusion speed is preferred at a compatible speed with the line speed in the annealing oven . film extrusion line speeds can be higher than 35 ft / min , but it needs longer ovens to accommodate the need of the optimized residence time of the film in the ovens . in this case , the investment of oven capital is required more , but it certainly produces even more products . the overall process speeds of this invention need to be considered from technical point of view and from business point of view . the following examples demonstrate the quality precursor produced at a preferable speed described above , and the precursor can be made into the quality membrane . pp ( fina pp 3271 ) produced by fina oil & amp ; chemical has a density of 0 . 905 g / cc and a melt index of 1 . 5 g / 10 min . pe ( hizex 5202b ) produced by mitsui chemical has a density of 0 . 964 g / min and a melt index of 0 . 3 g / 10 min . either pp or pe are blended with 2500 ppm sodium benzoate as a nucleating agent to promote the crystal formation during film formation at a lower speed . a blown - film extrusion line made by lung - meng plastics machinery is equipped with a ˜ 1 . 6 inch diameter of screw with a l / d ratio of 36 . the line is equipped with a 300 - cm circular die with a die gap of ˜ 100 mil . the air ring height is adjusted to a level around 1 . 0 inch above the die . the pp and pe precursor films have been annealed in a batch convention oven , respectively , at 150 ° c . and 120 ° c . for ˜ 12 min . the annealed precursors are further stretched on an instron machine equipped with an environment control chamber . pp films are stretched , respectively , at 150 ° c ., 20 % cold stretch , 140 % hot stretch , 40 % relax ; pe films , at 120 ° c ., 40 % cold stretch , 140 % hot stretch , and 40 % relax . from the above example , the film precursors from lower extrusion speed can yield quality membranes . there are no prior art found that this preferred slower line speed of film extrusion in this invention can result in quality membranes . in the same way , ultra - thin pp and ultra - thin pe precursor films ( 0 . 2 ˜ 0 . 5 mil ) can be extruded at the preferred line speed for making pp / pe / pp trilayer separator , continuously . the intention of the lower extrusion speed is to lower down the line speed in the ovens , which will need smaller size of ovens for the same residence time . the detailed running conditions in the annealing and stretching ovens are mostly described in the prior art for dry - stretch polyolefin microporous membranes . for example , annealing temperature , stretching temperature , line speeds in the oven , cold stretching ratio , hot stretching ratio and heat - set / relaxing ratio can be the same as or different from those described in the prior art , u . s . pat . no . 4 , 138 , 459 for multiply ( pp or pe ) single - layer separator ; u . s . pat . no . 5 , 952 , 120 for multiply pp / pe / pp trilayer separator , u . s . pat . no . 6 , 057 , 060 for multiply ultra - thin ( pp or pe ) separator . they need to be slightly adjusted based on different grades of pp or pe raw materials used . according to the above information , one can estimate the needed length of film path in the annealing oven to be equal to extrusion line speed multiplying 12 min . according to the stretch ratios , one can estimate the needed length of film path in the stretching oven . the slower line speed of extrusion requires shorter length of film path in the ovens . one of the major advantages with it is that the shorter length of film path in the annealing oven and then in the stretching oven allows the smaller needed size of the ovens and then the less investment . another advantage with the preferred line speed of the film extrusion is to allow an excellent control on the overall operation of the continuous process in this invention . the continuous method of this invention will benefit the process at both fast and slow film extrusion speeds . gurley is a resistance to air flow measured by the gurley densometer . gurley is the time in seconds required to pass 10 cc of air through one square inch of product under a pressure of 12 . 2 inches of water pressure . melt index astm d 1238 ; pe : 190 ° c ./ 2 . 16 kg ; pp : 230 ° c ./ 2 . 16 kg . thus the reader will see that the continuous process of this invention can produce dry - stretch pp , pe , and pp / pe / pp trilayer membrane separators in a highly efficiency . the preferred extrusion line speed with multiple blown film extrusion ( or slit film extrusion ) can be a line speed compatible with the line speed in the annealing oven . the membrane thickness can be in the range of 0 . 2 mil and 4 . 0 mil . the annealing conditions and stretching conditions can be the conditions described herein or the conditions in the prior art . the raw material used is polyolefin as defined early . in pp / pe / pp trilayer membrane separators , the pe layer is served as potential shutdown layer as described in u . s . pat . no . 5 , 691 , 077 . in this invention , the pe layer can be a pure pe resin , pe containing particles , as described in u . s . pat . no . 6 , 080 , 507 , and pe containing other additives or minor polymeric components ( less than 30 %). all the membranes obtained from the invented continuous process will not be involved in solvent . the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof , and , accordingly , reference should be made to the appended claims , rather than to the foregoing specification as indicating the scope of the invention . | 1 |
referring to fig1 reference numeral 1 designates a rectifier circuit for full - wave - rectifying ac power supply voltage , 2 designates a choke coil connected to an output terminal of the full - wave rectifier circuit 1 , 3 designates a filter capacitor constituting a filter circuit together with the choke coil 2 , 4 designates an induction heating coil connected to one end of filter capacitor 3 , 5 designates a resonance capacitor constituting a resonance circuit together with the induction heating coil 4 , 6 designates a switching element , such as a transistor , connected in parallel to the resonance capacitor 5 , 7 designates a damper diode connected in antiparallel to the switching element , 8 designates a drive circuit given an on / off signal from a control circuit to be discussed below and turning on / off the switching element 6 , the drive circuit 8 providing at its input stage a differentiating circuit composed of the resistance 9 and capacitor 10 so that switching is rapidly raised or lowered , 11 designates a current transformer provided at the ac power supply line to detect an ac current given into the inverter circuit , and 12 designates a cooking utensil to be heated by the induction heating apparatus of the invention . in such inverter circuit , the switching element 6 , when applied with an on / off signal as shown in fig2 ( a ) through the drive circuit 8 , flows a current ic shown in fig2 ( b ) so that voltage d ce across the terminals of switching element 6 varies as shown in fig2 ( c ), at which time a current i con flowing in the resonance capacitor 5 and that i d flowing in the diode 7 vary as shown in fig2 ( d ). in addition , reference td designates a diode duration of flowing a diode current . such oscillation flows the resonance current in the heating coil 4 to generate a high frequency alternating field , which is supplied to the cooking utensil 12 of iron or 18 - 8 stainless steel series metal positioned in proximity to the induction heating coil 4 , the cooking utensil being induction - heated . in addition , reference v con designates full - wave rectification voltage given from the full - wave rectifier circuit through the choke coil 2 . referring to fig3 ( a ), reference numeral 13 designates an a / d converting circuit which converts the input current value detected by the current transformer 11 into input data p ad digital and of m - bits relatively smaller in bit number , 14 designates a timing generator circuit for generating a sample signal giving the timing for a / d conversion of the a / d converting circuit 13 and a mint signal in synchronism with the near zero level of a cycle in a pulsating current full - wave - rectifying ac power supply voltage , the sample signal and mint signal being output with the predetermined timing for the full - wave - rectified ac voltage , 15 designates an unsuitable utensil detecting circuit given input data pad from the a / d converting circuit 13 to detect the state where a small object , such as a knife or a fork , is disposed , or the no - load state where nothing is disposed , the unsuitable utensil detecting circuit 15 outputting an inhibiting signal when the input data pad is smaller than the predetermined value , 16 designates a power setting circuit for setting power setting data p ref corresponding to the heating output to be output from this apparatus at the digital value of m - bits . referrence numeral 17 designates a subtraction circuit ( to be hereinafter called the sub circuit ) given the set data pref of m - bits from the power setting circuit 16 and the input data pad from the a / d converting circuit 13 , so that a value of pref - pad : a remainder in a subtraction of input data pad from set data pref , is output as a signal represented by the bit of sign bit and m + 1 - bits , and 18 designates an on - duration setting circuit for setting as the digital data of n - bits ( n ≧ m ) on - duration data pcon corresponding to the duration during which the switching element 6 is turn on . the on - duration setting circuit 18 is given from the sub circuit 17 difference data pref - pad : the remainder in a subtraction of input data pad from the setting data pref , thereby generating the on - duration data pcon . also , reference numeral 19 designates a resonance duration detecting circuit for outputting a detection signal at the &# 34 ; l &# 34 ; level during the resonance period wherein v ce & gt ; dcon is obtained by comparing dc voltage dcon from the full - wave rectifier circuit 1 with terminal voltage d ce at the switching element 6 , which circuit 19 serves also as an on timing detecting circuit indicating the timing of turning on the switching element 6 by extinction of detection signal when v ce & lt ; vcon occurs , 20 designates an overcurrent protection circuit which measures a resonance duration length by the detection signal from the resonance duration detecting circuit 19 so as to set limiting data icp of n - bits for limiting the on - time of switching element 6 corresponding to the resonance duration length , thereby preventing a flow of an excessive current into the switching circuit . reference numeral 21 designates a time counter for on duration which is given the detection signal from the over current protection circuit 20 and starts counting from a finish of detection signal and outputs a coincident signal when the counted value is equal to the on - duration data pcon held by the on - duration setting circuit 18 , or the limiting data icp at the overcurrent protection circuit 20 , and 22 designates a flip - flop circuit which is set when the detection signal from the resonance duration detecting circuit 19 finishes , in other words , when v ce & lt ; vcon , and reset by the coincident signal from the time counter for on duration 21 , so that the control signal changing in the level of &# 34 ; h &# 34 ; or &# 34 ; l &# 34 ; by setting or resetting the flip - flop circuit 22 and controlling on or off of switching element 6 is sent to the drive circuit 8 , the flip - flop circuit 22 being so constructed that the inhibiting signal from the unsuitable utensil detecting circuit 15 ( an unsuitable load detection signal ) inhibits the aforesaid operation . in such control circuit , when the detection signal at the &# 34 ; l &# 34 ; level from the resonance duration detecting circuit 19 disappears and its output is at a &# 34 ; h &# 34 ; level , the flip - flop circuit 22 is set to transmit an on signal therefrom to the drive circuit 8 for the switching element 6 . the on signal actuates the drive circuit 8 to turn on the switching element 6 , whereby the time counter for on duration 21 is actuated to start counting so that when the on duration data pcon obtained by the on duration setting circuit 18 coincides with the counted value , usually the reset signal is transmitted to the flip - flop circuit 22 , whereby the flipflop circuit 22 is reset and the off signal for the switching circuit 6 is transmitted to the drive circuit 8 . hence , when in normal operation , the on duration data pcon output from the on duration setting circuit 18 decides the actual on duration length of switching element 6 , in other words , the duration for actually flowing a current with the switching element 6 . on the other hand , the power setting data pref set by the power setting circuit 16 and the input data pad obtained by a / d converting the input current value in comparison with the ac input current by use of the a / d converting circuit 13 , are transmitted to the sub circuit 17 corresponding to the sample signal , the sub circuit 17 transmitting to the on duration setting circuit 18 difference data pref - pad in subtraction of input data pad from the power setting data pref . upon receiving the difference data pref - pad , the on duration setting circuit 18 adds the difference data pref - pad to the on duration data pcon initially set , therby obtaining new on duration data pcon , which functions to increase the on duration data to elongate the on duration of switching element to thereby increase the input power when the input data pad is smaller than the power setting data pref . on the other hand , when the input data pad is smaller than the power setting data pref , the new data pcon reduces the on duration data pcon to reduce the on duration of switching element 6 , thereby reducing the input power . such operation is repeated until the input data pad coincides with the power setting data pref , in other words , until the difference data : pref - pad = 0 is obtained . therefore , the input power , which varies due to material , shape or conductivity , of the cooking utensil such as a pot in use , is automatically adjusted to be always constant . in a case where the heating operation of the inverter is carried out when no - loaded or loaded by a small object , an input current value detected by the current transformer 11 decreases and the input data pad from the a / d converting circuit 13 also becomes smaller , the unsuitable utensil detecting circuit 15 detecting the value of such input data pad smaller than the predetermined value , thereby giving inhibition to the flip - flop circuit 22 . accordingly , the on / off signal from the flip - flop circuit 22 to the drive circuit 8 for the switching element 6 is inhibited . in addition , it is preferable that the predetermined value , when the value of power setting data pref at the power setting circuit 16 is set larger , largely changes in association with a power setting nob ( not shown ) and , when the value of pref is set smaller , changes to be smaller in a similar manner . in a case where a cooking utensil of non - magnetic material , such as aluminum , is disposed in proximity to the heating coil 4 and heated thereby , equivalent inductance thereof becomes lower than when the magnetic cooking utensil is used , thereby reducing the length of resonance duration wherein the terminal voltage v ce of switching element 6 , after the switching element 6 is off , becomes higher than dc voltage vcon from the full - wave rectifier circuit 1 . the resonance duration detecting circuit 19 detects the duration and the overcurrent protection circuit 20 reduces the value of limiting data icp which limits the actual duration of switching element 6 corresponding to the detected length of resonance duration . hence , the time counter for on duration 21 , even when the on duration data pcon at the on duration setting circuit 18 is set to be of larger value so as to enlarged the on duration of switching element 6 , is limited of its counting by the value of limiting data icp of overcurrent protection circuit 20 , and there is no fear that the on duration of switching element 6 is reduced to lead to a flow of an excessive current in the switching element 6 . next , detailed explanation will be given on each block in the induction heating apparatus of the invention . in the fig4 showing the circuit diagram of an embodiment of a / d converting circuit 13 , reference numeral 23 designates a full - wave rectifier circuit for full - wave - rectifying ac voltage from the current transformer 11 , 24 designates a first operational amplifier for amplifying the signal from the rectifier circuit 23 , 25 designates a peak holding capacitor charged by the first operational amplifier 24 , 26 designates a field effect transistor ( fet ) connected in parallel to the peak holding capacitor 25 and given at the gate electrode thereof the sample signal from the timing generator circuit through a parallel circuit comprising a diode 27 and a capacitor 28 . in addition , the sample signal uses the pulsating current which full - wave - rectifies the ac voltage and is given with the timing of the peak of pulsating current . also , reference numeral 29 designates a second operational amplifier for amplifying the terminal voltage of the peak holding capacitor 25 , 30 designates a first comparator given at its ⊕ input terminal an output v ct of the second operational amplifier 29 , 31 designates a successive approximation registers which is given at its drive terminal d the signal from the first comparator 30 , so that a start signal is given to the terminal sc for starting operation and an on / off signal p tr on / off for the switching element 6 is given to the clock input terminal clock , whereby successive approximation registers 31 , develops outputs , for example in this invention , q 0 to q 3 of 4 - bits in variation , 32 designates a d / a converter to d / a convert the successive approximation registers 31 output , which is given to the ⊖ input terminal at the first comparator 30 , 33 designates a latch circuit for latching the output from the successive approximation registers 31 , which carries out latching when the a / d conversion by the a / d converter circuit is complete and the outputs q 0 to q 3 from the successive approximation registers 31 as the aforesaid input data pad . referring to fig5 which shows a construction of the timing generator circuit , reference numeral 34 designates a full - wave rectifier circuit for full - wave - rectifying ac power supply voltage , 35 designates a third comparator which puts into the ⊕ input terminal the full - wave rectified voltage from the full - wave rectifier circuit 34 and devides constant voltage vc by resistances 36 and 36 &# 39 ; to thereby give the divided voltage va into the ⊖ input terminal , the output of the third comparator 35 being the sample signal output through an inverter 37 , and 38 designates a fourth comparator which puts into the ⊕ input terminal the full - wave - rectified voltage from the full - wave rectifier circuit 34 and into the ⊖ input terminal voltage v b : constant voltage + vc devided by resistances 39 and 40 , the output of the same being the mint signal . in addition , the voltage v a has been set to be slightly lower than the peak voltage of ac power supply voltage and the voltage v b slightly higher than zero voltage , whereby the sample signal at the &# 34 ; h &# 34 ; level , as shown in fig6 is generated in the vicinity of the peak of voltage of full - wave - rectified supplied power , the mint signal at the &# 34 ; l &# 34 ; level being generated in the vicinity of zero voltage of power supply voltage full - wave - rectified . in the a / d converter circuit 13 and timing generator circuit 14 , the signal detected by the current transformer 11 and corresponding to the input current is transmitted to the terminal of peak holding capacitor 25 through the first operational amplifier 24 . when the full - wave rectified voltage value of ac power supply voltage is low , no sample signal is generated , whereby fet26 is on and the capacitor 25 is not charged . in the vicinity of the peak of full - wave rectified voltage of ac power source , the sample signal is transmitted from the timing generator circuit 14 to the gate of fet26 , so that fet26 is off , at which time the input current given through the current transformer 11 and full - wave rectifier circuit 23 is the peak of each pulsating current , thereby conserving in the peak holding capacitor 25 the charge corresponding to the peak of input current . thus , voltage developed at the capacitor 25 terminal is given as v ct to the ⊕ terminal of first comparator 30 through a second operational amplifier 29 , the signal of voltage v ct allowing the first comparator 30 to output the signal at &# 34 ; h &# 34 ; level . the successive approximation registers 31 is given at its sc terminal a start signal generated by the sample signal and on / off signal for switching element 6 given at the clock terminal , thereby starting operation of a / d converting circuit 13 . when the on signal at first is given to the clock terminal of successive approximation registers 31 , since the d terminal of the same is at the &# 34 ; h &# 34 ; level , the outputs from terminals q 0 , q 1 , q 2 and q 3 of the same become logical &# 34 ; 1000 &# 34 ;, which is d / a - converted by the d / a converter circuit 32 and given to the ⊖ input terminal at the first comparator 30 . in this condition , for example , when voltage at the ⊕ input terminal of the first comparator 30 is higher than that at the ⊖ input terminal , the signal given from the first comparator 30 to the d terminal at the successive approximation registers 31 is kept at the &# 34 ; h &# 34 ; level . therefore , the successive approximation registers 31 synchronizes with the rising of the next on signal and outputs a logical &# 34 ; 1100 &# 34 ; of the former output &# 34 ; 1000 &# 34 ; added with a logical &# 34 ; 0100 &# 34 ;, which is fed to the ⊖ input terminal at the first comparator 30 through the d / a converter circuit 32 , at which time , for example , when voltage at the ⊖ input terminal at the first comparator 30 is higher than that at the ⊕ input terminal of the same , the output is at the &# 34 ; l &# 34 ; level and given to the d terminal at the successive approximation registers 31 . since the d terminal at the successive approximation registers 31 thus is given the &# 34 ; l &# 34 ; level signal , the successive approximation registers 31 in synchronism with the rising of the next on signal outputs a logical &# 34 ; 1010 &# 34 ;: the remainder in subtraction of &# 34 ; 0010 &# 34 ; from the former output logical &# 34 ; 1100 &# 34 ;. such successive comparison operation is continuously repeated and then finishes at the time when the successive approximation registers 31 is given five times the on signal . after the comparison , while keeping the outputs q 0 through q 3 set by the above operation , for example , logical &# 34 ; 1001 &# 34 ;, the successive approximation registers 31 gives a signal from the eoc terminal thereof to the latch circuit 33 , which latches by said signal the outputs q 0 through q 3 from successive approximation registers 31 and then gives the latched outputs q 0 to q 3 into the unsuitable utensil detecting circuit 15 and subtraction circuit 17 . in addition , the a / d converting circuit 13 of the invention is not defined to the successive approximation registers 31 . the timing chart of a / d conversion and the timing of latch operation of latch circuit 33 will be shown in fig7 in which the term &# 34 ; duty &# 34 ; designates the timing for commanding inverter oscillation and stop by control from a duty control circuit ( not shown ) and that &# 34 ; duty &# 34 ; designates the timing for actual oscillation of the inverter . referring to fig8 reference numeral 41 designates an data clear circuit which is given the power setting data pref from the sub circuit 17 and also a difference pref - pad from the power setting circuit 16 , which outputs logical &# 34 ; 0 &# 34 ; during the initial oscillation of the inverter circuit . the reason is that the data clear circuit 41 makes the difference data pref - pad be zero to carry out a soft start operation . reference numeral 42 designates an adder which adds the digital value of n - m - bits , that of m - bits , and that of m + 1 - bits applied with sign bit which represents positive or negative sign so as to output the on duration data pcon to a decoder 42 &# 39 ;, so that m - bits in lower order of the input to the adder 42 are given the logical &# 34 ; 0 &# 34 ; from the data clear circuit 41 during the initial oscillation of inverter and n - m - bits in upper order are always given a logical &# 34 ; 0 &# 34 ;, the sign of the difference data pref - pad being given to a sign bit . the decoder 42 &# 39 ; changes whole n - bits into logical &# 34 ; 0 &# 34 ; when a carry signal is output from adder by reaching the whole n - bits of the on duration data pcon output from the adder 42 to logical &# 34 ; 1 &# 34 ;( for example &# 34 ; 111111 &# 34 ; when n = 6 ) and fixes the data given to a latch circuit 43 in &# 34 ; 111111 &# 34 ;. 43 designates a latch circuit which stores and holds the output pcon from adder 42 through the decoder 42 &# 39 ; until the next data is given , the latch timing of latch circuit 43 synchronizing with the leading edge of mint signal and the output of the same being given to the time counter for on duration 21 , 44 designates a soft start setting circuit storing therein data soft of initial value of n - bit at the low level , 45 designates a data selector given the output pcon of latch circuit 43 and that soft of soft start setting circuit 44 to select which data is output , the initial data soft being selected when the inverter starts oscillation , and 46 designates a latch circuit to latch the output of data selector 45 , the latched signal by data selector 45 being given to another input terminal at the adder 42 . in such on duration setting circuit 18 , during the initial oscillation of the inverter , since the data clear circuit 41 is kept in the inhibiting condition , data from subtraction circuit 17 is changed into logical &# 34 ; 0 &# 34 ; and given to the adder 42 , whereby the m - bit data transmitted from the sub circuit 17 to the adder 42 through the data clear circuit 41 has each bit of zero apparently . also the data selector 45 is in the state where it outputs the data soft of soft start setting circuit 44 , in which the data soft is given to the latch circuit 43 through the data selector 45 , latch circuit 46 and adder 42 , the latch circuit 43 outputting to the time counter for on - duration 21 and latch circuit 43 the data soft as the on - duration data pcon with the timing nearly in synchronism with the mint signal . also , after the inverter starts its oscillation , the data clear circuit 41 is released from initial state in synchronism with the next mint signal , whereby the sub circuit 17 gives the difference data pref - pad to the adder 42 , the data selector 45 selecting the output from the latch circuit 43 . therefore , the output pcon from the latch circuit 43 , in other words , the former output of adder 42 , is given to the adder 42 through the data selector 45 and latch circuit 46 . the adder 42 adds or subtracts the absolute value of difference data pref - pad given from the sub circuit 17 corresponding to the positive or negative sign of absolute value to or from the m - bits in lower order of the n - bit on - duration data pcon given from the latch circuit 43 , the pcon +( pref - pad ) being output as the new on - duration data at the timing of mint signal to the latch circuit 43 and once latched to be output to the time counter for on duration 21 . the above operation successively corrects the on - duration data pcon corresponding to the difference between pref and pad . such variation in the data is given in the following recurrence formula : fig9 shows a timing chart of the timing at this time and a table indicating data transition , in which reference τ2m - 1 (= 1 , 2 , 3 . . . , i . e ., 2m - 1 is odd number ) designates the timing when the input to the latch circuit 46 appears at its output , and τ2m ( m = 1 , 2 , 3 . . . , i . e ., 2m : even number ) designates the timing when the input to the latch circuit 43 appears at its output . since the correction of on - duration data pcon by addition in the adder 42 is carried out with respect only to the m - bits in low order of n - bit on - duration data pcon , variation in the on - duration of switching element 6 due to once resetting the on - duration data pcon decreases to lead to decrement in variation in the input power . next , fig1 ( a ) is a block diagram of the time counter for on duration . in fig1 ( a ), reference numeral 47 designates an on clock generator which starts oscillation when the resonance duration detection signal disappear from the resonance duration detecting circuit 19 , that is , with the on timing of the switching element 6 , the oscillation operation being stopped corresponding to the off - timing of switching element 6 , 48 designates an on - duration counter for count - up by a clock signal from the on clock generator 47 , which is cleared when the detection signal from the resonance duration detecting circuit 19 disappears , 49 designates a first comparator for comprising the counting output of on - duration counter 48 with the on duration data pcon of output from the latch circuit 43 at the on duration setting circuit 18 so as to output a coincident signal when both the outputs coincide with each other , 50 designates a second comparator which compares the counting output from the on duration counter 48 with the limiting data icp of output from the overcurrent protection circuit 20 so as to output a coincident signal when both the outputs coincide with each other , and 51 designates an or gate given the coincident signal from the first and second comparators 49 and 50 , which gives the reset signal to the flip - flop circuit 22 in fig3 and sends a stop signal to the on clock generator 47 when given the coincident signal from at least one comparator circuit 49 or 50 . accordingly , in the time counter for on duration 21 , at the time when the detection signal at the &# 34 ; l &# 34 ; level from the resonance duration detecting circuit 19 disappears , the switching element 6 is on , the on clock generator 47 starts its oscillation to generate a clock pulse . at the same time , the on duration counter 48 is cleared to the initial condition and counted - up by the clock pulse from the on clock generator 47 , the output of on duration counter 48 being transmitted successively to the first and second comparators 49 and 50 corresponding to the counting up . the first comparator 49 compares the output from the on duration counter 48 with the output of on duration data pcon each time the output of on duration counter 48 is transmitted to the same . the second comparator 50 compares the output of on duration counter 48 with the output of limiting data icp from the overcurrent protection circuit 20 each time the on duration counter 48 output is transmitted to the same . since the on duration data pcon in normal condition , for example , an enamel pot or the like having a relatively large equivalence resistance is used , is smaller than the limiting data icp , when the content of on duration counter 48 becomes to coincide with the on duration data pcon , the coincident signal is transmitted from the first comparator 49 to the reset terminal r and on clock generator 47 through the or gate 51 . therefore , the flip - flop 22 is reset and the switching element 6 is off to start the resonance duration by means of heating coil 4 and resonance capacitor 5 in the inverter circuit and also the oscillation of on clock generator 47 is stopped by the above coincident signal . upon disappearing of detection signal from the resonance detecting circuit 19 after completion of resonance duration , the flip - flop 22 is reset and the switching element 6 is on , thereby repeating the on duration counting . on the other hand , in a case where a pot of material , such as aluminum , of non - magnetic and high conductivity , is used as the cooking utensil , the limiting data icp is smaller than the on duration data pcon . in such case , when the output of on duration counter 48 and the value of limiting data icp coincide with each other on the process of counting - up of on duration counter 48 , the second comparator 50 outputs the coincident signal , which is transmitted to reset terminal r at the flip - flop 22 and resets it , in other words , the limiting data icp limits the on duration . fig1 ( a ) is a block diagram of the resonance duration detecting circuit 19 and overcurrent protection circuit 20 , in which the components corresponding to those in fig3 are designated by the same reference numerals . in fig1 , reference numeral 52 designates a fifth comparator whose ⊕ input terminal is given power supply voltage vcon transmitted through the full - wave rectifying circuit 1 and choke coil 2 and divided by dividing resistances 53 and 54 and whose ⊖ input terminal is given terminal voltage v ce at the switching element 6 divided by dividing resistances 55 and 56 , 57 designates a resonance clock generator which is given the resonance duration detection signal from the fifth comparator 52 to start oscillation , 58 designates a resonance duration counter for counting up by a clock pulse from the resonance clock generator 57 , 59 designates a latch circuit to latch the contents counted - up by the resonance duration counter 58 , and 60 designates a controller given the output from the fifth comparator 52 , which generates a clear signal sent to the resonance duration counter 58 and the latch - timing signal to the latch circuit 59 . while the switching element 6 is kept on at such resonance duration detecting circuit 19 and overcurrent protection circuit 20 , terminal voltage v ce at the switching element 6 is zero , so that the ⊕ input terminal at the fifth comparator 52 is higher in voltage than the ⊖ input terminal , thereby outputting a signal at the &# 34 ; h &# 34 ; level . while the &# 34 ; h &# 34 ; level signal is being given , the resonance clock generator 57 and controller 60 are not - operative . when the flip - flop 22 is reset and the switching element 6 is off as above - mentioned , the heating coil 4 and resonance capacitor 5 starts resonance to raise the terminal voltage v ce at the switching element 6 to plot the resonance wave form as shown in fig2 ( c ). a length of the resonance duration depends on material of cooking utensil 12 . for example , when a cooking utensil of material , such as aluminum , non - magnetic and of high conductivity is used , the equivalent inductance of heating coil becomes lower to reduce the resonance duration , while , that of metal in iron series and ferromagnetic and of relatively high resistance elongates the same . when the resonance duration starts to raise the terminal voltage v ce at the switching element 6 more than the full - wave rectified power supply voltage vcon , the fifth comparator 52 outputs a resonance duration detection signal at the &# 34 ; l &# 34 ; level . the controller 60 is given the detection signal to clear the contents of resonance duration counter 58 and the resonance clock generator 57 receives the detection signal and starts to give the clock pulse to the cleared resonance duration counter 58 , which is counted - up corresponding to the clock pulse . upon a finish of resonance duration , when the terminal voltage v ce of switching element 6 becomes lower than the power supply voltage vcon , the fifth comparator 52 outputs the signal at the &# 34 ; h &# 34 ; level , the flip - flop 22 being set corresponding to the above and the switching element 6 is on . at the same time , the resonance clock generator 57 stops its oscillation to stop the count - up of resonance duration counter 58 , thereby holding into the resonance duration counter 58 data corresponding to the resonance duration . furthermore , at the same time , the controller 60 transmits a latch signal to the latch circuit 59 , whereby the data held by the resonance duration counter 58 is output as the limiting data icp for limiting the on duration length to the time counter for on duration 21 through the latch circuit 59 . in addition , fig1 shows the relation between the resonance voltage v ce and the full - wave rectified power supply voltage . fig3 ( b ), 10 ( b ) and 11 ( b ) show a second embodiment of the control circuit of the induction heating apparatus of the invention . the control circuit of the second embodiment provided with a diode duration detecting circuit 19d for detecting the diode duration wherein the terminal voltage v ce at the switching element 6 is negative , thereby outputting a diode duration detecting signal , which rises when the diode current is eliminated . the diode duration detecting signal output from diode duration detecting circuit 19d is given to the on clock generator 47 of time counter for on duration 21 instead of the resonance duration detecting signal of the first embodiment . in this second embodiment , also , power setting circuit 16 and time counter for on duration are constructed that when the heating output is set to a maximum by the power setting circuit 16 , the maximum output signal pmax is given to a time counter for on duration 21 to cut off the output of the first comparator 49 thereof . in such construction , in operation of the apparatus , when the on signal actuates the drive circuit 8 to turn on the switching element 6 , the resonance capacitor 5 is changed in the reverse direction for a while to thereby obtain v ce & lt ; o . hence , a feedback current id begins to flow through the diode 7 and the diode duration detecting circuit 19d detects that the terminal voltage of switching element 6 becomes negative , thereby outputting the diode duration detecting signal . thereafter , the accumulated charge is emitted from the resonance capacitor 5 to obtain v ce = 0 and when the feedback current id at the diode 7 is zero , the diode duration detecting signal is extinct . whereby the time counter for on duration 21 is actuated to start counting . on the other hand , when the maximum heating output is set at the power setting circuit 16 , the time counter for on duration is given the maximum output signal pmax from the power setting circuit 16 , the first comparator 49 outputs no coincident signal and the second comparator 50 only outputs the coincident signal , in other word , only the limiting date icp output from the overcurrent protection circuit 20 , will decide the on duration of switching element 6 . hence , in a case where the maximum heating output is set at the power setting circuit 16 , the maximum heating output is obtainable in a range wherein the switching element 6 leads to no thermal breakdown . next , a third embodiment of the control circuit for the induction heating apparatus of the invention is shown in fig1 , in which the components corresponding to those in the first and second embodiment are designated by the same reference numerals . in the third embodiment , an ac input current is peak - held by a peak hold circuit 61 , and after converted into input data pad by an a / d converting circuit 62 , transmitted to a latch circuit 63 . on the other hand , the power setting circuit 16 comprises an analog circuit using variable resistances , an output of which is converted into the power setting data pref by the a / d converting circuit 62 with the timing different from the a / d conversion timing of peak hold voltage and then transmitted to a latch circuit 64 . in other words , this embodiment uses the a / d converting circuit 62 in time division . in addition , this time division operation is carried out in such a manner that an analog switch as1 is on with the timing for sample signal generated by the timing generator circuit 14 to connect the peak hold circuit 61 to the a / d converting circuit 62 so that an analog switch as2 is on with the timing for the mint signal , thereby connecting the power setting circuit 16 to the a / d converting circuit 62 . also , in this embodiment , the on duration setting circuit 18 is given input data pad and power setting data pref from the latch circuits 63 and 64 respectively so that a first arithmetic circuit 65 generates the on duration data pcon and a second arithmetic circuit 66 generates data soft of pref reduced at a predetermined ratio , the data pcon and soft being selectively output by a data selector 67 . in other words , the data selector 67 generates data soft when the inverter starts oscillation and outputs pcon after the lapse of predetermined time from the start of oscillation . referring the fig1 , a fourth embodiment of the control circuit at the induction heating apparatus of the invention is shown , in which the components corresponding to those in the former embodiments are designated by the same reference numerals . in the fourth embodiment , a leading edge detecting circuit 68 is provided which detects the difference pad2 - pad1 between the initial input data pad1 after the start of oscillation of inverter and the next input data pad2 , thereby inhibiting the flip - flop 22 when pad2 - pad1 is smaller than the predetermined value . the overcurrent protection circuit 20 is provided with a resonance duration counting circuit 69 for counting the resonance duration , a magnitude comparator 70 for outputting signals when the counting content of resonance duration counting circuit 69 is lower than a certain set value , and an arithmetic circuit 71 which receives the content of counting circuit 69 and normally outputs the counting content as the limiting data icp for limiting the on duration of switching element 6 , thereby correcting the counting content of counting circuit 69 to be decreased only when the magnitude comparator 70 gives signal to the same . in other words , the arithmetic circuit 71 , when the resonance duration is short , further reduces the count content of counting circuit 69 and outputs it as the limiting data icp . in addition , in case that a shift register is used as the arithmetic circuit 71 so that when a signal is given from the magnitude comparator 70 , the content is once shift , for example , from logical &# 34 ; 0101 &# 34 ; to &# 34 ; 0010 &# 34 ;, the above correction is easy . as seen from the above , the induction heating apparatus of the invention realizes largely accurate measurement of on duration and accurate output adjustment as compared with conventional one which uses the analog circuit , such as cr time constant circuit , to set the on duration of switching elements . also , the on duration of switching element can be easily set by changing the on duration data in the on duration setting circuit . also , such inverter &# 39 ; s control circuit is digitized to enable the control circuit to be the monolithic integrated circuit , thereby expecting a small - sized control circuit , in turn the induction heating apparatus small - sized , light - weight and smaller in thickness . furthermore , the second embodiment of the induction heating apparatus of the invention is so constructed that when the maximum heating output is set , means for clear off the signal output from the means for obtaining the on duration of switching element 6 , that is , the on duration setting circuit 18 , decides the on duration of switching element 6 through the switching element protection means only , that is , the overcurrent protection circuit 20 . hence , the rapid heating is possible to a maximum while preventing the switching element 6 from thermal breakdown . in a fifth embodiment of the invention shown in fig1 , in which the components corresponding to those in the former embodiments are designated by the same reference numerals , only the portion encircled by the broken line is the monolithic - integrated circuit , in other words , an on clock generator 47 is an external part . the on clock generator 47 comprises inverters 47a and 47b , nand gate 47c , resistance element 47d and capacity element 47e , for example , as shown in fig1 , which are packaged to one chip ic . accordingly , the on clock generator 47 is only externally attached which is capable of changing the values of resistance element 47d and capacity element 47e to be adjusted in the predetermined clock cycle period corresponding to power supply voltage in a region wherein the apparatus is used , whereby the induction heating apparatus of the same output mode , even in a region where the power supply voltage differs , can be provided . thus , this embodiment will increase the general use of control circuit at the induction heating apparatus and saves the number of parts to be prepared in the shop , thereby improving the productivity . next , a sixth embodiment of the invention is shown in the block diagram in fig1 , in which a control circuit includes means for computing a variation δpcon of the on duration data pcon , means for computing a variation δpad of the input data pad , and means for comparing both the variations . in a case where the comparator detects that δpad is smaller than δpcon as a result of comparison , a load is decided to be unsuitable to thereby turn off the switching element 6 . hence , such construction enables detection of unsuitable load immediately after the inverter circuit starts its oscillation . next , explanation will be given on the sixth embodiment in fig1 , in which the components corresponding to those in fig3 ( a ), ( b ) and 8 are designated by the same reference numerals . in fig1 , an on duration setting circuit 18 comprises an adder 42 for outputting the on duration data pcon , a delay circuit 81 for delaying the on duration data pcon from the adder 42 by one data , i . e ., one mint signal , thereby outputting the delay signal as pcond , a soft start setting circuit 44 for setting the relatively smaller initial on duration data soft when the apparatus of the invention starts its oscillation , and a data selector 45 which selects either data soft from the soft start setting circuit 44 or data pcond from the delay circuit 44 , the adder 42 being given the output from the data selector 45 and difference data pref - pad : the output from the sub circuit 17 . in brief , in the on duration setting circuit 18 , when the inverter starts oscillation , the initial on duration data soft from the soft start setting circuit 44 is selected by the data selector 45 , the data soft being output as the on duration data pcon through the adder 42 . once oscillation starts , the on duration data pcon output from the adder 42 is delayed by the delay circuit 81 and regiven to the adder 42 through the data selector 45 so that the adder 42 adds to pcon the difference data pref - pad given from the sub circuit 17 , thereby operating to output new on duration data pcon . such operation in the adder 42 is carried out in synchronism with the mint signal . in fig1 , reference numeral 82 designates a lowest frequency certifying circuit for certifying the lowest frequency of this apparatus , which limits the maximum value of on duration data pcon computed by the adder 42 to prevent the oscillation frequency of the apparatus from lowering below the audible compass , 83 designates a second subtraction ( sub ) circuit given the on duration data pcon output from the adder 42 and the on duration data pcond delayed by the delay circuit 81 to an extent of one data , which computes a difference between pcon and pcond , that is , the variation δpcon = pcon - pcond of the on duration data , 84 designates a delay circuit which delays the input data pad output from the a / d converting circuit 13 to an extent of one data , i . e ., one mint signal , 85 designates a third subtraction circuit ( sub circuit ) which is given the data padd from the delay circuit 84 and also the input data pad from the a / d converting circuit 13 and computes the variation δpad = pad - padd in the input data , and 86 designates a comparator receiving the data δpcon and δpad from the sub circuits 85 and 84 and inhibiting the flip - flop 22 when | δpcon |& gt ; k | δpad | is obtained with respect to the proper positive constant k , thereby stopping switching operation of switching element 6 . such induction heating apparatus as aforesaid successively increases the on duration data pcon when oscillation starts , resulting in that the input data pad made by a / d converting an input current will increase . the δpcon in the on duration data pcon and δpad in the input data pad are computed to be generated , the comparator 86 checks whether or not k | δpcon |& gt ;| δpad | is obtained . normally , when a proper load of magnetic metal , such as iron , is used as the cooking utensil , since | δpad | is relatively larger than | δpcon | as shown in the line a in fig1 to result in k | δpcon |& gt ;| δpad |, the comparator 86 applies no inhibition to the flip - flop circuit 22 , thereby continuing the oscillation . on the contrary , in case where a cooking utensil of weak magnetic metal , such as aluminum , is used , or oscillation is carried out by a small object load , such as a knife or a fork , or in the no - load condition , since | δpad | is relatively small with respect to | δpcon | as shown in the lines b and c in fig1 to result in that k | δpcon |& lt ;| δpad | is obtained , the flip - flop circuit 22 is inhibited by the comparator 86 to stop the inverter oscillation . in a case where the cooking utensil 12 is taken off which is properly used to carry out the inverter oscillation , the input current quantity detected by the current transformer 11 is reduced corresponding to the timing of taking off of cooking utensil 12 as shown in fig1 , the input current being converted into input data pad by the a / d converting circuit 13 corresponding to the sample signal from the timing signal generator circuit 14 , whereby the control circuit resets the on duration data pcon in synchronism with mint signal so as to increase the input current . hence , the input current rises to increase the input data pad and converted with the timing for the next sample signal . at this time , however , the oscillation is carried on in the no - load condition , so that variation δpad in the input data is not so large . accordingly , the variation δpcon in the on duration data and that δpad in the input data have therebetween a relation of k | δpcon |& gt ;| δpad |, thereby giving inhibition from the comparator 86 to the flip - flop circuit 22 . as seen from the above , the control circuit in this embodiment compares the variation δpcon in the on duration data with that δpad in the input data so that when δpad is larger than δpcon , the inverter oscillation is stopped , so that the unsuitable load is detectable immediately after the oscillation starts , thereby saving useless power consumption . also , since an abnormal load detection depends on the set output , any complicated circuit is not required and simple construction enables abnormal load detection . a seventh embodiment of the invention shown in the fig2 block diagram , is provided with a read only memory ( rom ) 97 which receives as an address input an output from an analog system power setting circuit 16 &# 39 ; and stores different small - object detection level pls with respect to each address and with a comparator 96 which compares the input data pad with the small object detection level pls to carry out small object detection . such construction facilitating setting and change of small object detection characteristic and each induction heating apparatus can set each different small object load detecting characteristic . next , explanation will be given on the seventh embodiment in accordance with fig2 . in fig2 , reference numeral 91 designates an input power detecting circuit for rectifying - smoothing the current transformer 11 and detecting an input current , 16 &# 39 ; designates a power setting circuit for setting the heating output of this apparatus and comprising a volume or the like , 92 designates an a / d converting circuit which converts the output of input power detecting circuit 91 into digital input data pad in synchronism with the peak of cycle at the full - wave rectified voltage of ac power source and the output of power setting circuit 16 &# 39 ; into digital setting data pref in synchronism with the low potential portion of full - wave rectified voltage at ac power source , the outputs of a / d converting circuit 92 being given to latch circuits 93 and 94 respectively , 95 designates an on duration setting circuit given the input data pad and power setting data pref from the latch circuits 93 and 94 respectively , which is somewhat different from the on duration setting circuit 18 in each embodiment abovementioned so as to make variable the on duration data pcon corresponding to the duration to be on by the switching element 6 so that the input data pad is equal to the power setting data pref , 21 designates a time counter for on duration given the on duration data pcon from the on duration setting circuit 95 , which counts up a counter housed in the apparatus similarly to that contained in the aforesaid embodiments , when the switching element 6 is on so that when the content of count - up is equal to the on duration data pcon , the switching element 6 is turned off through the drive circuit 8 , 97 designates a rom ( read only memory ) given the power setting data pref as the address , the content of each address is stored in the small object detection level pls corresponding to the power setting data pref specifying said address , and 96 designates a comparator given the input data pad from the latch circuit 93 and the small object detection level pls from the rom 97 , which when pls & gt ; pad , applies an inhibiting signal to the drive circuit 8 . in detail , the control circuit adjusts the on duration length of switching element 6 so that the power setting data pref is equal to the input data pad by means of the on duration setting circuit 95 , and uses the rom 97 to generate the small object detection level pls corresponding to the power setting data pref , thereby comparing through the comparator 96 the small object detection level pls with the input data pad , thus detecting the small object load . accordingly , the induction heating apparatus of such construction is unnecessary of complex conversion circuit such that the power setting data pref generates the small object detection level pls . the characteristic for variation in the small object detection level pls corresponding to the power setting data pref need only be executed by storing a desired content when the memory contents of rom is set . fig2 is a block diagram of the seventh embodiment using a microcomputer 98 instead of rom 97 , in which the components corresponding to those in fig2 are designated by the same reference numerals . in fig2 , a signal from power setting circuit 16 &# 39 ; is given to the microcomputer 98 controlling display of the set power , the microcomputer 98 having therein an a / d converter and rom ( both are not shown ) and using them to generate the small object detection level pls . in addition , reference numeral 99 in fig2 designates a display for displaying the set power or the like . this embodiment as abovementioned is provided with storing means given the output as the address input from the output setting means and storing the small object detection level changeable corresponding to each address , that is , rom 97 or microcomputer 98 , and a comparator 96 for comparing the input data pad with the small object detection level pls to detect the small object . thus , the memory content of the storing means is written in every induction heating apparatus , whereby every apparatus can set the desired small object detection characteristic with ease and there is no need of using the complicated converter circuit to obtain the desired small object detecting characteristic , thereby expecting miniaturization of the control circuit . referring to fig2 , explanation will be given on the eighth embodiment of the control circuit when used for thermally controlling the apparatus of the invention . the former embodiments each compare the power setting data pref from the power setting circuit with the input data pad corresponding to the input current to thereby detect the unsuitable load and stop the inverter oscillation . in such induction heating apparatus , however , even when the power setting data pref from the power setting circuit changes , the input data pad does not change until the next a / d conversion timing , i . e ., the sampling timing , whereby it cannot be said that the unsuitable load is not inevitably exactly detected during the change in the power setting data . in fact , even when an oscillation carries out with proper load , it cannot be said that there is no possibility for oscillation stop . while , this embodiment is so constructed that the oscillation stop by the unsuitable load detection circuit is inhibited until the input current value is a / d converted and new input data is given after a value of power setting data pref changes . next , explanation will be given on the eighth embodiment of the control circuit 4 in accordance with fig2 , in which reference numeral 113 designates an input power detecting circuit which rectifies and smoothing the output from the current transformer 11 and detects the input and corresponds to the input power detecting circuit 91 in fig2 and 21 , 114 designates a temperature detecting circuit disposed in proximity to a top plate on which the cooking utensil 12 is placed and comprising a thermister or the like , 115 designates a temperature setting circuit so that a difference between the detected temperature at the temperature detection circuit 114 and the set temperature at the temperature setting circuit 115 is detected by a temperature difference detection circuit 116 , 117 designates a power setting circuit for setting the heating output of induction heating apparatus , which corresponding to the power setting circuit 16 at the respective former embodiments , the input power detection circuit 113 , temperature difference detection circuit 116 and power setting circuit 117 giving the outputs thereof to an a / d converting circuit 121 , 122 designates a control switch for switching temperature control and output control , which switches to decide whether the power setting circuit 117 develops the maximum setting output to make variable the setting temperature by the temperature setting circuit 115 , or the set output of power setting circuit 117 is made variable and the set temperature of temperature setting circuit 115 is set to a detecting temperature for preventing miss heating , that is , the maximum set temperature , 123 designates a timing generator circuit , the same as in the former embodiments and corresponding to the circuit 14 in the former embodiment , for generating a sample signal giving the timing for the high potential portion in a pulsating current of full - wave rectifying the ac power supply voltage and the mint signal in synchronism with the low potential portion in the same , the sample signal being given to an analog switch 118 , the mint signal being given selectively to analog switches 119 and 120 not to be simultaneously given , in other words , the different timings turn on the analog switches 118 , 119 and 120 respectively , whereby the a / d converting circuit 121 converts through time division the output signals from the input power detection circuit 113 , temperature difference detection circuit 116 and power setting circuit 117 , into the digital input data pad , temperature difference data δtemp . and power setting data pref respectively , 124 designates a first latch circuit for latching the temperature difference data δtemp ., 125 designates a second latch circuit for latching the power setting data pref , 126 designates a third latch circuit for latching the input data pad , 158 designates a switching circuit connected to the second latch circuit , which switches selection either of the output pref from the second latch circuit 125 or of the data p &# 39 ; ref set in the switching circuit 158 and corresponding to 500 w heating , the switching circuit 158 , when in heating operation by output control , always selecting the output pref of second latch circuit 125 ; 127 designates an on duration setting circuit connected to the switching circuit 158 and third latch circuit 126 , which corresponds to the on duration setting circuit 18 at the respective former embodiments and comprises a sub circuit 128 for taking the difference pref - pad between the power setting data pref and the input data pad , an adder 129 which sets on duration data pcon corresponding to the on duration of switching element 6 and adds pref - pad to pcon to make new on duration data pcon , a soft start setting circuit 130 setting soft as the on duration data in the initial oscillation , and a data selector 131 for selecting that either the soft from the soft start setting circuit 130 or the output pcon from the adder 129 is to be given into the adder 130 . in other words , the on duration setting circuit 127 , in the initial oscillation selects by the data selector 131 the data soft from the soft start setting circuit 130 and gives said data into the adder 129 so that the adder 129 outputs the data soft as first on duration data pcon , and after the starting of oscillation , the data selector 131 selects the output pcon from the adder 129 to give pcon to the input of adder 129 , whereby the adder 129 adds pref - pad to pcon to set new on duration data . also , reference numeral 132 designates a comparator whose ⊕ input terminal is given power supply voltage vcon supplied through the full - wave rectifying circuit 1 and choke coil 2 and whose ⊖ input terminal is given terminal voltage vce of switching element 6 , 133 designates a resonance duration counter given an output vot from the comparator 132 and corresponding to the resonance duration counter 19 at the respective former embodiments , the resonance duration counter 133 counting the duration wherein the output vot is at the &# 34 ; l &# 34 ; level , in turn the resonance duration length of inverter circuit , 134 designates a fourth latch circuit for latching the output from the resonance duration counter 133 , 135 designates a lowest frequency certifying circuit which is given on / off signal from the switching element 6 and corresponds to the lowest frequency certifying circuit 82 in fig1 , which circuit 135 measures a period from the beginning of switching - off of the on / off signal by the switching element 6 to a start of the next switching - off period , so that when such period exceeds 50 μsec , that is , when the frequency is below 20 khz , the switching element 6 is off and also a value at that time of an on duration counter 141 to be discussed below is held in a data holding circuit 161 ; 136 designates a data selector for selecting a smaller value of the outputs from the fourth latch circuit 134 and data holding circuit 136 ; 137 designates a correcting circuit for correcting a data value from the data selector 136 corresponding to the power setting data pref , the correcting circuit 137 having a characteristic such that when the power setting data pref changes from a minimum to a maximum , the output ipcon from the correcting circuit 137 gradually rises to correspond to the data value ip &# 39 ; con from the data selector 136 , thereby outputting the ipcon as the on duration limiting data , 138 designates a minimum value setting circuit for setting a minimum value of on duration limiting data ipcon from the correcting circuit 137 , thereby controlling ipcon not to be below the set value , in other words , preventing a difficulty of decision of unsuitable load detection because when ipcon becomes smaller and the input current too smaller , a difference between the input currents in the cases where a cooking utencil ( which has relatively large equivalent resistance ) easy to accept the input is used and that ( which has relatively small equivalent resistance ) not so is used ; 139 designates a flip - flop circuit of d type , which corresponds to the flip - flop circuit 22 at the respective former embodiments , the flip - flop circuit 139 being given at the data terminal d a duty signal representing the inverter oscillation duration and at the cp terminal the output vot of comparator 132 , the output q being an on / off signal for switching element 6 . in other words , the flip - flop 139 synchronizes with the leading edge of signal vot to put the output q at the &# 34 ; h &# 34 ; level . in addition , when no duty control is carried out , the data terminal d at the flip - flop circuit 139 being given always the &# 34 ; h &# 34 ; signal . also , reference numeral 8 designates a drive circuit receiving the on / off signal to drive the switching element 6 on or off , 141 designates an on duration counter which starts counting in synchronism with the leading edge of output q of flip - flop circuit 139 and stops counting in synchronism with the trailing edge of output q of flip - flop circuit 139 and thereafter clears the count value , the count value being given to the lowest frequency certifying circuit 135 , 142 designates a first comparator comparing the on duration data pcon from the adder 129 with the count value of on duration counter 141 so as to output a signal when both the pcon and count value coincide with each other ; and 143 designates a second comparator which compares the limiting data ipcon from the minimum value setting circuit 138 with the count value of on duration counter 141 so as to output a signal when both coincide with each other , this output signal and the output signal from the first comparator 142 being transmitted to the clear terminal cl at the flip - flop circuit 139 through the or gate 144 and nor gate 145 . in the d - type flip - flop circuit 139 , during the oscillation duty , the q output is &# 34 ; h &# 34 ; by the signal vot output when the terminal voltage vce at the switching element 6 is smaller than the power supply voltage vcon so that the comparator 132 detects completion of resonance duration , and the q output gives an on signal to the drive circuit 8 and starts counting operation of on duration counter 141 . on the other hand , when the counting value of on duration counter 141 is compared at the first or second comparator 142 or 143 so that when the value coincides with the on duration data pcon or the limiting data ipcon , the flip - flop circuit 139 is cleared through the or gate 144 and nor gate 145 , the output q of flip - flop circuit 139 is at the &# 34 ; l &# 34 ; level , and the drive circuit 8 turns off the switching element 6 . at the same time , the on duration counter 141 , after the counting once stops , is cleared of its contents . reference numeral 146 designates a circuit for setting level of small object for receiving the power setting data pref sent through the second latch circuit 125 , which outputs the small object detection level pls , 147 designates a small object detecting circuit which compares the small object detection level pls with the input data pad transmitted through the third latch circuit 126 , so that when pad & lt ; pls , the clear terminal cl of the flip - flop circuit 139 is given a clear signal through a nor gates 148 and 145 , resulting in that the output q of flip - flop circuit 139 is of the &# 34 ; l &# 34 ; level and the drive circuit 8 turns off the switching element 6 ; 149 designates a first circuit for inhibiting detection of small object , whose inhibiting signal is given to the nor gate 148 through an or gate 150 , whereby it is inhibited that the flip - flop circuit 139 is cleared from the small object detection circuit 47 through the nor gate 148 ; and 151 designates a variation detection circuit for detecting a variation in the power setting data pref from the second latch circuit 125 , the variation detecting circuit 151 comprising a latch circuit 152 which is given data pref ( t ) from the second latch circuit 125 and outputs pref ( t - 1 ) received with the timing once before and a comparator 153 for comparing the output pref ( t - 1 ) of latch circuit 152 with the power setting data pref ( t ). when the comparison in the comparator 153 results in pref ( t )& gt ; pref ( t - 1 ), its output is given to a second circuit for inhibiting detection of small object 154 , which gives a signal to the or gate 150 through the signal from the comparator 153 . also , reference numeral 155 designates a detected gate for inhibiting oscillation which is given temperature difference data δtemp from the first latch circuit 124 so as to detect that a value of δtemp is logical &# 34 ; 000000 &# 34 ; for example digital data consists 6 - bits ), 156 designates a detected gate for inhibiting oscillation which is given temperature difference data δtemp from the first latch circuit 124 so as to detect that the value of δtemp is , for example , logical &# 34 ; 000001 &# 34 ; or more , and 157 designates gates of data selector connected to the detected gate for inhibiting oscillation 155 and detected gate for restarting oscillation 156 . the gates of data selector 157 acts on a switching circuit 158 to stop and start the oscillation corresponding to the detection signal obtained from the detected gate for inhibiting oscillation 155 and detected gate for restarting oscillation 156 , thereby switching the value of pref given to the sub circuit 128 . also , the gates of data selector 157 is given the bit signal at , for example , the third bit number in low order of the temperature difference data δtemp output from the first latch circuit 124 , thereby switching the switching circuit 158 . in detail , the switching circuit 158 selects the data p &# 39 ; ref so that the heating output is 500 w when the bit signal is logical &# 34 ; 1 &# 34 ;, and is the set value at the on duration setting circuit 127 when the same is logical &# 34 ; 0 &# 34 ;. accordingly , in a case where the control switch 122 selects the thermal operation , the temperature adjusting operation starts while switching the heating output of 1300 w or 500 w due to the third bit in low order of logical &# 34 ; 138 or &# 34 ; 0 &# 34 ; output from the first latch circuit 124 , and after the set temperature is obtained , the outputs of detected gate for inhibiting oscillation 155 and detected gate for restarting oscillation 156 repeat the oscillation stop and heating operation at 1300 w ( the maximum set input power ). also , reference numeral 159 designates a timer which starts time - counting when the bit signal output from the first latch circuit 124 is logical &# 34 ; 1 &# 34 ; at the third bit number in low order , and after the counting for the predetermined time period , indicates to the gates of data selector 157 switching from 500 w to 1300 w , the timer 159 stops to clear its contents when the bit signal becomes logical &# 34 ; 0 &# 34 ;, the gates of data selector 157 serving as the abovementioned when the control switch 122 is set at the temperature control side , and 160 designates a third circuit for inhibiting detection of small object which is connected to the gates of data selector 157 , and when indication is given therefrom of switching from 500 w to 1300 w , gives the detection output to the or gate 150 . fig2 a through 23h are circuit diagrams exemplary of concrete construction of the control circuit at the induction heating apparatus of the invention , in which the components corresponding to those in fig2 and the signal lines corresponding to those in these drawings are designated by the same reference numerals . next , explanation will be given on operation of the control circuit of the embodiment constructed as foregoing , which is under thermal operation . in a case where the control switch 122 selects the thermal operation , the cooking utensil 12 is heated while the heating output is being switched to 1300 w from 500 w due to the third bit signal in low order and either of logical &# 34 ; 1 &# 34 ; or &# 34 ; 0 &# 34 ; at the temperature difference data δtemp output from the first latch circuit 124 . after the time when the detected temperature tth by the temperature detecting circuit 114 reaches the set temperature tref set by the temperature setting circuit 115 ( the time when temperature difference data δtemp is logical &# 34 ; 000000 &# 34 ;), the output signals from the detected gate for inhibiting oscillation 155 and detected gate for restarting oscillation 156 repeat the oscillation stop and heating by the heating output of 1300 w ( the maximum set power ). fig2 shows the detected temperature by the temperature detecting circuit 114 ( shown by the solid line ) and the actual measured temperature toil ( shown by the broken line ) of oil within the cooking utensil 12 when the aforesaid thermal operation is carried out , in which fig2 ( a ) shows the above when in use of cooking utensil 12 whose bottom is smaller in thickness and apart at the central portion from the top plate at the apparatus , fig2 ( b ) shows the above when in use of the same having high thermal conductivity and the bottom in close contact with the top plate , and fig2 ( c ) shows the above when using the cooking utensil of the bottom larger in thickness and in close contact with the top plate . also , fig2 ( a ), ( b ) and ( c ) show the conventional induction heating apparatus as abovementioned . in this embodiment , since the actual heating , is repeated alternatively 1300 w and 500 w until the detected temperature reaches the time of obtaining the set temperature tref , the cooking utensil 12 and oil therein are gradually heated , and the overall system comprising the apparatus of the invention , cooking utensil 12 and the contents therein , is in about thermal equilibrium condition . hence , this embodiment displays the cooking possible at the time ta when the detected temperature tth reaches the set temperature tref . on the contrary , the conventional example shown in fig2 displays the cooking possible at the time t 1 after the lapse of several minutes from the aforesaid time ta . accordingly , this embodiment of the invention saves power consumption because of no useless heating . next , explanation will be given on operation for detecting an unsuitable load by the control circuit in this embodiment . in the control circuit of this embodiment , the heating output , when the output operation is selected , is detected by the input power setting circuit 117 and converted by the a / d converting circuit 121 into the power setting data pref with the timing for the mint signal and then transmitted to the switching circuit 158 and circuit for setting level of small object 146 through the second latch circuit 125 , the switching circuit 158 during the output operation selecting the power setting data pref to send it to the on duration setting circuit 127 . the input current value detected by the input detecting circuit 113 is converted by the a / d converting circuit 121 into the input data pad with the timing for the sample signal and then transmitted to the one duration setting circuit 127 and circuit for setting level of small objecr 147 through the third latch circuit 126 , wherein the on duration setting circuit 127 as above - mentioned corrects the on duration data pcon by the power setting data pref and input data pad and sends corrected pcon to the first comparator 142 , which is given in the following recurrence formula : the timing chart at that time is shown in fig2 , in which reference numerals # 14 , # 27 and # 28 designate the flip - flop circuits shown in fig2 g , a and b . on the other hand , the small object detection level pls of power setting data pref corrected by the circuit for setting level of small object 146 is compared with the data pad to thereby carry out the small object detection . in other words , in a case where the value of pad becomes smaller than the small object detection level pls adjusted corresponding to an increase and decrease of power setting data pref , assuming that the small object load is disposed in proximity to the heating coil 4 , the small object detecting circuit 147 gives a clear signal to the flip - flop circuit 139 through a nor gate 148 and a nor gate 145 . however , since the soft start is carried out in the initial oscillation of inverter , the value of power setting data pref is larger , but the on duration data pcon is smaller so that there is a fear that the small object detecting circuit 147 carries out the small object detection . hence , during the soft start operation , the first circuit for inhibiting detection of small object 149 gives the signal to the nor gate 148 , but the small object detecting circuit 147 is adapted not to give the signal to the flip - flop 139 . in addition , the timing chart at that time is shown in fig2 , in which reference numerals # 13 and # 14 designate two flip - flop circuits constituting the first circuit for inhibiting detection of small object 149 as shown in fig2 g . even when the input power setting circuit 117 is operated to raise the power setting data pref , the input data pad does not change until the next sampling time . hence , the input data pad does not change in spite that the small object detection level pls rises due to a rise of power setting data pref , whereby there is a fear that the small object detecting circuit 147 carries out the small object detection . the variation detecting circuit 151 , however , detects whether or not the value of power setting data pref increases , so that when the power setting data pref rises , that is , when pref ( t )& gt ; pref ( t - 1 ) is obtained , the q output at the flip - flop circuit # 51 of the first circuit for inhibiting detection of small object 149 is put at the &# 34 ; h &# 34 ; level to inhibit the small object detection for the period from the latch timing for the power setting data pref , that is , the timing for the dint signal in synchronism with the mint signal , to the latch timing for the input data pad , that is , the timing for the sample signal , by the third latch circuit 126 . the timing chart at this time is shown in fig2 . in addition , the flip - flop circuits # 50 and # 51 and nor gate 62 are shown in fig2 g . furthermore , in such apparatus , when the thermal operation is carried out , the set value by the input power setting circuit 117 , as abovementioned , is set 1300 w and the gates of data selector 157 operates to allow the switching circuit 158 to select pref or p &# 39 ; ref to thereby decide the heating output to be 1300 w or 500 w . hence , when the heating output is switched from 500 w to 1300 w , even proper load has the fear of being decided to be a small object similarly to the above . in order to avoid the fear , this control circuit , when the gates of data selector 157 operates the switching circuit 158 to switch the heating output from 500 w to 1300 w , the third circuit for inhibiting detection of small object 160 also sends the inhibiting signal to the or gate 150 , so that the inhibiting signal is output continuously until the timing for subsequently latching the input data pad , in other words , until the timing for the next sample signal . fig2 is a timing chart showing operation of the lowest frequency certifying circuit 135 for certifying the oscillation frequency of the inverter to be 20 khz or more . the lowest frequency certifying circuit 135 detects for a period of sample signal whether the oscillation frequency is 20 khz or more , in other words , whether the time period from the beginning of off duration of switching element 6 to the next off duration is 50 μsecond or less , so that when the time period exceeds 50 μsec , the switching element 6 is off and a count value of on duration counter 141 at this time is held in a data holding circuit 161 comprising hc 40174 ( shown in fig2 g ), thereby being adapted to be given to the selector 136 . as seen from fig2 , in the lowest frequency certifying circuit 135 , when the q terminal output of flip - flop # 37 : the component of circuit 135 , rises , whose signal is given to the kb terminals of 4019 &# 34 ; ol &# 34 ; and 4019 &# 34 ; om &# 34 ; constituting the data selector 136 , whereby the data from the data holding circuit 161 is adapted to be selected by the date selector 136 . in such induction heating apparatus , when the output operation system carries out the heating operation , the heating output by the input power setting circuit 117 may at starting be set smaller to be 200 w . in such case , the power setting data pref a / d converted by the a / d converting circuit 121 and latched by the second latch circuit 125 , is small , whereby the input current value detected by the input power detecting circuit 13 is also small . accordingly , the input data pad of a / d converted input current value becomes small , so that a difference in pad in a loading condition is difficult to appear to make it difficult to discriminate an unsuitable load , such as a small object load . in order to eliminate such inconvenience , the switching circuit 158 operates as follows : encoders 63 and 64 ( both shown in fig2 b ) within the switching circuit 158 set data apref at the predetermined level and the first power setting data pref ( 1 ) a / d converted after oscillation of inverter starts , is compared by comparators 4585 &# 34 ; cil &# 34 ; and &# 34 ; cim &# 34 ; ( both shown in fig2 b ), so that a larger one either of pref ( 1 ) or apref is selected by data selectors 4019 &# 34 ; ul &# 34 ; and &# 34 ; um &# 34 ; ( both shown in fig2 b ) and sent to the sub circuit 128 . hence , when pref ( 1 )& lt ; apref , the following equations are obtained : the next on duration data pcon is converted to obtain the following equation : thus , a normal output control condition is restored . such timing control is carried out by the aforesaid flip - flop circuits # 26 and # 27 ( see fig2 a ). therefore , coupled inductance with the heating coil is larger so that even a load , whose input is not so rapidly raised , is not detected as the small object by mistake . the timing chart at this time is shown in fig3 . also , such switching circuit 158 operates to vary pcon , in which the small object detection level pls at the circuit for setting level of small object 146 corresponding to the change in pcon is corrected to be twice reset . fig3 shows the timing of a / d conversion at the a / d converting circuit 121 , in which the duration of base clock is enlarged . in this drawing , the input current detected by the input detection circuit 113 , as abovementioned , is a / d converted into input data pad with the timing for the sample signal , and the temperature difference detected by the temperature difference detecting circuit 116 and the set input set by the input power setting circuit 117 are converted into a temperature difference data δtemp and power setting data pref with the timings for the mint signal not to superpose the timing to each other . in other words , in this embodiment , the a / d conversion from the set input value to the digital power setting data pref is carried out with the timing for receiving the mint signal once per four times and that from the temperature difference signal to the digital temperature difference data δtemp is done with the timing for receiving mint signal once per 16 times not to superpose the timing to each other . also , in the control circuit of this embodiment , the count value of on duration counter 141 is limited corresponding to that at the resonance duration counter 133 , thereby limiting an on duration length to expect the overcurrent protection similarly to the above - mentioned . also , the lowest frequency certifying circuit 135 , as the same as in the fig1 embodiment , limits the on duration length to keep the oscillation frequency of inverter not less than 20 khz . accordingly , in a case where the cooking utensil 12 is smaller in equivalent inductance , or larger in the same , such construction is limited in the on duration even when the set value by the on duration setting circuit 117 is made larger , whereby the actual heating output , as shown in fig3 , does not increase over a certain set value , resulting in the inconvenience for use . in order to eliminate such inconvenience , the control circuit of the embodiment generates by the 4008 &# 34 ; fl &# 34 ; and &# 34 ; fm &# 34 ; ( see fig2 f ) within the correction circuit 137 a difference 52 - pref of subtracting pref from a count value 52 ( in binary notation , &# 34 ; 110100 &# 34 ;) of the count value by the on duration counter 141 and corresponding to the maximum set input power of 1300 w , the value 52 - pref and the data ip &# 39 ; con from the data selector 136 are used to compute ip &# 39 ; con -( 52 - pref )/ 2 by 4008 &# 34 ; gl &# 34 ; and &# 34 ; gm &# 34 ; ( see fig2 g ), which value is output as the limiting data ipcon for the on duration , ipcon being compared with bpcon set by the minimum value setting circuit 138 . when ipcon ≧ bpcon , ipcon is adapted to be given to the second comparator 143 , and when ipcon & lt ; bpcon , bpcon is adapted to do so . hence , the heating output , as shown in fig3 , increases corresponding to an increase in the set value of input power , thereby being inconvenient to usage . also , the minimum value setting circuit 138 sets the minimum value of ipcon to clarify a difference between the input powers due to the unsuitable load and suitable one , thereby enabling accurate load detection . fig3 shows the timing chart representing operations of the fourth latch circuit 134 , data selector 136 , correcting circuit 137 and minimum value setting circuit 138 , where the time base of base clock is enlarged . in addition , for reference , parts used in the control circuits shown in fig2 a through h are shown of article number , function , and makers , in the following table . table______________________________________ manu - article no . function facturer______________________________________hd 14559 successive approximation hitachi registersμ pd 603d d / a converter ( 6 bits ) nec40174 d - ff ( 6 bits ) toshiba4019 and - or ( 4 bits ) tokyo sanyo data selector4008 full adder ( 4 bits ) toshiba4585 comparator ( 4 bits ) moto rora4024 7 - stage counter nechc 85 comparator ( 4 bits ) moto rorals 283 full adder ( 4 bits ) hitachi40175 d - ff ( 4 bits ) toshibahc 4024 7 - stage counter moto rora4015 shift register ( 4 bits ) nec______________________________________ as seen from the above , in this embodiment , when in thermal operation , the heating output is switched alternatively 500 w and the maximum 1300 w while the detected temperature tth by the temmperature detecting circuit 114 is rising up to the set temperature pref . hence , the power is effectively used in the heating process until the detected temperature tth reaches the set temperature tref . also , this embodiment has inhibiting means for inhibiting oscillation stop by the unsuitable load detecting circuit from a change in the value of power setting data pref until the input current value next is a / d converted to give new input data pad , thereby inhibiting the oscillation stop due to the unsuitable load detection circuit from a change in pref to that in pad , thereby being free from the inconvenience to stoppage of apparatus due to malfunction by a proper load during the heating operation , thus enabling exact load detection . in addition , the control circuit of the induction heating apparatus of the invention is applicable to an induction heating apparatus which is controlled by duty controlling . as this invention may be embodied in several forms without departing from the spirit of essential characteristics thereof , the present embodiment is therefore illustrative and not restrictive , since the scope of the invention is defined by the appended claims rather than by the description preceding them , and all changes that fall within meets and bounds of the claims , or equivalence of such meets and bounds thereof are therefore intended to be embraced by the claims . | 7 |
with initial reference to fig1 and 2 , an appliance anti - tip device constructed in accordance with the present invention is shown in connection with an electric range 2 . range 2 includes a cabinet 4 having a front panel 5 , side panels 6 , with the foremost side panel 6 being shown having a lower rear portion broken away to depict an anti - tip bracket 7 in accordance with the present invention , and a range top 8 . range top 8 can take various forms in a manner known in the art . in the embodiment shown , range top 8 incorporates various surface heating elements 11 - 14 . cabinet 5 further includes a rear , upstanding control panel 18 . control panel 18 supports a plurality of knobs 21 - 24 for controlling the activation / de - activation of surface heating elements 11 - 14 respectively . furthermore , control panel 18 is shown to include a central control and display unit , generally indicated at 26 , for use in controlling upper and lower ovens 29 and 30 respectively . at this point , it should be noted that , although range 2 is shown to include both upper oven 29 and lower oven 30 , it should be understood that the anti - tip bracket 7 of the invention is also applicable to more conventional ranges having a single , large upper oven and a storage drawer or the like there below . in addition , anti - tip bracket 7 can also be utilized with various other appliances , such as dishwashers . in any event , in the embodiment shown , upper oven 29 has associated therewith a door 33 which can be pivoted by means of a handle 35 . door 33 preferably includes a window 37 for viewing the interior of oven 29 . in a similar manner , lower oven 30 has associated therewith a door 40 , a handle 42 and a window 44 . in a manner known in the art , ovens 29 and 30 define respective oven cavities ( not separately shown ). range 2 is adapted to be mounted upon a supporting surface 50 , such as a kitchen floor or the like , and against an upstanding wall 54 . more specifically , a plurality of leg members , two of which are indicated in fig1 and 2 at 76 and 77 , respectively extend from front and rear portions of cabinet 4 along side panel 6 . of course , corresponding leg members are also provided on the opposing side of range 2 . in any event , the various leg members 76 and 77 are preferably vertically adjustable to also act as levelers for range 2 . such type of leg leveler arrangements are widely known in the art of appliances , including ranges and refrigerators , such that the general function of leg members 76 and 77 does not form part of the present invention . in general , each leg member 76 , 77 includes a threaded shaft 80 and a foot 82 . however , in accordance with the present invention , it is important to note that leg members 76 and 77 maintain cabinet 4 of range 2 at a position spaced , to at least some extent , above supporting surface 50 . reference will now be made to fig3 - 6 in describing the preferred construction for anti - tip bracket 7 . as shown , bracket 7 is generally l - shaped and includes a first leg 92 , a second leg 93 and a generally central , interconnecting portion 94 . in the most preferred embodiment , first and second legs 92 and 93 are arranged perpendicular to each other , while central portion 94 is angled therebetween such that central portion 94 forms an obtuse angle with each of the first and second legs 92 and 93 . each of legs 92 , 93 is defined by a pair of outwardly extending side flanges 101 and 102 , upstanding walls 104 and 105 and a connecting portion 107 . the side flanges 101 and 102 of legs 92 and 93 are provided with respective apertures 109 - 112 . in the most preferred embodiment , apertures 109 - 112 are preferably , slightly elongated to permit a limited degree of adjustability in mounting of bracket 7 as will be detailed more fully below . as clearly shown in these figures , first leg 92 is specifically designed to be longer than second leg 93 . for example , in one preferred form of the invention , first leg 92 is in the order of 5½ inches ( 14 cm ) in length , while second leg 93 is 4⅜ inches ( 11 cm ). in addition , first leg 92 includes an additional aperture 115 provided in connecting portion 107 . first leg 92 also includes a slot 120 formed within connecting portion 107 , with slot 120 opening at a terminal end 122 of first leg 92 . as clearly shown , terminal end 122 preferably tapers at 124 and 125 leading into slot 120 . in a similar manner , second leg 93 is formed with an elongated slot 128 which opens at an associated terminal end 130 . terminal end 130 also tapers at 133 and 134 leading into slot 128 . in the preferred embodiment shown , each of slots 120 and 128 is approximately ½ inch ( 1 . 25 cm ) in length , while having a width of approximately { fraction ( 3 / 16 )} inch ( 0 . 50 cm ). central portion 94 preferably includes a recessed section 137 . as perhaps best shown in fig3 and 6 , recessed section 137 is generally v - shaped in cross - section . as also clearly shown in these figures , recessed section 137 is preferably formed with a plurality of holes 140 - 143 . with this construction , bracket 7 can be mounted to supporting surface 50 and / or wall 54 with a selected one of first and second legs 92 and 93 being supported upon surface 50 . in either position , side flanges 101 and 102 will directly abut supporting surface 50 , while connecting portion 107 will be spaced above and substantially parallel to surface 50 due to the presence of upstanding walls 104 and 105 . as will be further discussed below , bracket 7 can be mounted in its desired position , preferably through the use of various mechanical fasteners extending through one or more of apertures 109 - 112 , aperture 115 and holes 140 - 143 . once bracket 7 is mounted in its desired location , range 2 can be slid back into a position wherein rear leveling leg 77 can be captured by bracket 7 . more particularly , foot 82 of leveling leg member 77 is adapted to slide beneath a respective connecting portion 107 , while threaded shaft 80 protrudes through a respective slot 120 , 128 . [ 0026 ] fig7 and 8 will now be referenced to more fully describe the versatile nature of bracket 7 based on the different ways in which bracket 7 can be easily , selectively repositioned to assume various configurations for use in establishing and maintaining a desired positioning for range 2 . with initial reference to fig7 shown protruding from upstanding wall 54 , directly above supporting surface 50 , is an electrical socket 152 . when positioning range 2 for use , it is desired to assure that range 2 is maintained a requisite distance from electrical socket 152 . that is , range 2 in this embodiment constitutes an electrical range which needs to be plugged into socket 152 . obviously , given the manner in which electrical socket 152 protrudes from wall 54 , range 2 will have to be spaced from wall 54 . unfortunately , many consumers installing a range 2 will have a tendency to plug the range 2 in and then force range 2 as far back to upstanding wall 54 as possible . more preferably , it is desired to establish and maintain a reasonable spacing for range 2 . in connection with the present invention , bracket 7 is arranged with first leg 92 extending along supporting surface 50 and second leg 93 extending up wall 54 . given the difference in lengths of first and second legs 92 and 93 , it will be appreciated that slot 120 is spaced further from upstanding wall 54 in this configuration than slot 128 would be if second leg 93 was positioned along supporting surface 50 . in any event , in this position , bracket 7 can be secured , such as through the use of various screws 155 which extend through bracket 7 at selected ones of apertures 109 - 112 , aperture 115 and holes 140 - 143 . in this figure , a single screw 155 is only shown aligned with hole 141 for the sake of simplicity . with this mounting , it should be realized that bracket 7 is adapted to be aligned with a left rear leveling leg member 77 of range 2 . for the sake of clarity , range 2 has not been shown in fig7 but rather only leveling leg member 77 is depicted . in any event , when range 2 is shifted back towards wall 54 , leveling leg member 77 will be shifted until foot 82 is received beneath connecting portion 107 and threaded shaft 80 is received within slot 120 . any slight misalignment of range 2 relative to bracket 7 will cause the tapered portions 124 and 125 of terminal end 122 to guide threaded shaft 80 into slot 120 . of course , if desired , a second bracket 7 could be provided on the other side of protruding electrical socket 152 at a distance equal to the lateral spacing between the respective rear leveling leg member 77 of range 2 . however , it should be realized that a single bracket 7 could also be employed . in any event , given that protruding electrical socket 152 is of a type commonly found in the art and the positioning of rear leg members 77 at a rear portion of range 2 is pre - established , bracket 7 is specifically designed to provide a desired spacing for range 2 from upstanding wall 54 . on the other hand , it is also known in the art to employ a recessed electrical socket such as that indicated at 160 in fig8 . obviously , since socket 160 does not protrude from wall 54 to the extent of socket 152 , range 2 can be positioned further against wall 54 . with such a mounting arrangement , bracket 7 is reversed such that first leg 92 is arranged to extend up wall 54 and second leg 93 extends along supporting surface 50 . again , bracket 7 is fixed in a desired position by means of one or more screws 155 . in the embodiment shown , screw 155 is aligned with hole 143 and is adapted to extend through wall 54 and into a wooden footer 165 as clearly shown in fig2 . with this arrangement , range 2 will be able to be positioned closer to wall 54 then in the configuration of fig7 given that second leg 93 is shorter than first leg 92 such that slot 128 is actually located closer to wall 54 in fig8 than slot 120 in fig7 . in any event , in a manner directly analogous to that described above with reference to fig7 leveling leg member 77 will be received beneath connecting portion 107 of bracket 7 when range 2 is slid back into an operating position . concurrently , threaded shaft 80 will be received within slot 128 . once in this position , range 2 cannot undesirably tip over as foot 82 would abut an underside of connecting portion 107 . based on the above , it should be readily apparent that bracket 7 represents a versatile arrangement for establishing and maintaining a desired positioning for range 2 whereby range 2 cannot tip over during use . due to its construction , bracket 7 can be mounted in different configurations depending upon the particular environment in which range 2 is to be located . in addition , by providing the various apertures 109 - 112 , aperture 115 and holes 140 - 143 , bracket 7 can be advantageously secured in the most convenient and efficient manner to one or more of supporting surface 50 , wall 54 and / or footer 165 . the inclusion of recessed section 137 not only enables the heads of screws 155 to be recessed , but advantageously enables the angling of holes 140 - 143 based on the overall mounting configuration . | 5 |
while our invention is suitable for use with vinyl halides in general , the preferred vinyl halide is vinyl chloride . furthermore , our invention preferably is used with water - polyvinyl chloride slurries . the amount of vinyl chloride which is present in the slurry can vary over a wide range . usually , the vinyl chloride will be present in an amount of less than 0 . 1 % to about 5 %. for reason of simplicity , the remainder of the description will be directed to water - polyvinyl chloride slurries . the amount of hot water used is a matter of some importance since the amount of vinyl chloride removed is related to the amount of hot water . in order to produce a product having a significantly reduced amount of vinyl chloride the amount of water suitably is at least 1 volume per volume of water - polyvinyl chloride slurry . preferably , the amount of water is at least 3 volumes per unit volume of water - polyvinyl chloride slurry . it is to be understood that larger volumes of water can be used . it is apparent , however , that use of larger volumes of water increases the cost of the process . the temperature of the water used suitably is in the range of about 15 ° to about 205 ° c ., preferably in the range of about 65 ° to about 121 ° c . with regard to pressure , the only requirement is that it be greater than the vapor pressure of water at the operating temperature . the optimum contact time can readily be determined by those skilled in the art . usually , the minimum contact time is one minute per stage . preferably , the contact time is from 2 to 10 minutes per stage . an important feature of the process is counter - current flow of the hot water to the flow of the water - polyvinyl halide . knowing this any person skilled in the art can readily select suitable equipment for conducting the process . a particularly suitable vessel for conducting the process is a vertical column extractor . such a vessel is well - known in the art . preferably the vessel has a plurality of compartments ( e . g . 10 to 100 ). also , the vessels are equipped with agitators so that agitation is attained in each compartment . usually the vessels have a bottom settling zone . the hot water is introduced into the column just above the bottom settling zone and leaves the column at or near the top . the slurry is introduced into the column near the top . the action of the agitator blades throw the resin particles outward against the wall where they collect and slide by gravity to the next compartment and eventually to the bottom settling zone . a water - polyvinyl chloride slurry containing a reduced amount of water and a greatly reduced amount of unreacted vinyl halide is removed from bottom settling zone of the extractor . in order to illustrate the nature of the present invention still more clearly , the following examples will be given . it is to be understood , however , that the invention is not to be limited to the specific conditions or details set forth in these examples except insofar as such limitations are specified in the appended claims . a 1 , 000 ml . three - necked flask was fitted with a three inch diameter stirrer and a thermometer . to the flask , 100 mls . of commercially produced polyvinyl chloride ( pvc )-- water slurry was added . the slurry contained forty - three weight % pvc having the following dry to the flask were then added 300 mls . of hot ( 99 ° c .) water . the water was not boiling . the resulting mixture was stirred at 100 rpm for two minutes at atmospheric pressure . the stirrer was shut off and the mixture then allowed to settle for two minutes . the top water layer was drawn off and discarded . the bottom pvc layer was sampled for vcm content . then an additional 300 mls . of hot water was added to the pvc resin in the flask and the process repeated . the pvc was extracted five times in this manner . the results are shown in the following table . ______________________________________ combined water - mls stir settle ppmw vcm * slurry water time time in pvcsample temp ., ° c added min . min . dry basis______________________________________feed -- -- -- -- 8 , 700 ( 1 ) 1 65 300 2 2 11 , 968 ( 1 ) 2 76 300 2 2 6 , 1203 79 300 2 2 3 , 1874 80 300 2 2 1 , 3475 82 300 2 2 968______________________________________ * vinyl chloride example 1 was repeated with the exception that the stirring time was ten minutes for each extraction . ______________________________________ combined water - mls stir settle ppmw vcm slurry water time time in pvcsample temp ., ° c added min . min . dry basis______________________________________feed -- -- -- -- 9 , 844 ( 1 ) 1 64 300 10 2 5 , 3982 71 300 10 2 2 , 0023 73 300 10 2 1 , 3274 74 300 10 2 7085 74 300 10 2 385______________________________________ example 3 used the same apparatus as example 1 with the exception that hot water was continuously added to the flask and continuously decanted from the flask . ______________________________________ combined time from water - hot water start of hot ppmw vcm slurry addition water add ., in pvcsample temp ., ° c rate , ml / min min . dry basis______________________________________feed -- -- 0 9 , 808 ( 1 ) 1 78 45 70 2 , 4072 76 45 130 862______________________________________ ( 1 ) the difference in values is due to an analytical anomaly which occurs in the technique used . this example illustrates the invention using a vertical column extractor of the type described in the foregoing . the column extractor has ten stages each of which is 1 . 72 meters in diameter and 1 . 72 meters in height . the volume of each stage is 2 . 63 kiloliters . a water - polyvinyl chloride containing 43 weight percent and 10 , 000 ppm vinyl chloride ( by weight on dry basis ) is fed into the top of the column extractor at a rate of 0 . 38 kiloliters per minute . the temperature of this feed stream is 54 ° c . hot water ( 116 ° c ) containing less than 1 ppm ( wt .) vinyl chloride is fed into the bottom of the column extractor at a rate of 1 . 14 kiloliters per minute . the residence time of the slurry in each stage is two minutes for a total of twenty minutes . the concentration of the vinyl chloride in each stage as the slurry proceeds down the column is shown in the following ( expressed on a weight basis on the dry resin ). ______________________________________ ppmw vinyl chloridestage ( dry basis ) ______________________________________feed 10 , 0001 5 , 0002 2 , 5003 1 , 2504 6255 3136 1567 788 399 2010 - outlet 10______________________________________ the extracted slurry leaves the column to be centrifuged and dried . the water leaves the top of the column nearly saturated with vinyl chloride . it is sent to a stripping column where the vinyl chloride is removed by counter - currently passing stream through the column . thus , having described the invention in detail , it will be understood by those skilled in the art that certain variations and modifications may be made without departing from the spirit and scope of the invention as defined herein and in the appended claims . | 2 |
hereinafter , a method of relocating wavelet packet coefficients according to each embodiment of the present invention is described in reference to the accompanying drawings . fig4 is a block diagram for illustrating an image compression process according to the present invention . as shown in the figure , the image compression process can includes a wavelet transform process 100 for filtering and subsampling the image data , and then transforming the image data into wavelet packet coefficients having several frequency bands . the image compression process then executes a coefficient relocating process 200 for collecting , among the wavelet packet transformed coefficients , coefficients corresponding to same location of frequency bands ( subbands ), and relocating them in same location on a frequency band , in which the subbands are integrated . then a zerotree coding process 300 is executed for coding the wavelet packet coefficients by assembling the wavelet packet coefficients , relocated on the same location on the frequency band , into a tree structure . fig5 exemplary shows an image transformed by the wavelet packet transmission process 100 . as shown in the figure , as the frequency band is lower , the size of the frequency band does not become smaller , unlike the wavelet coefficient . therefore , it would be comprehended that the size of the frequency band can be any shape , not limited to the level of the frequency . therefore , because the tree structure for the zerotree coding cannot be assembled , the location of the coefficients on the frequency bands are relocated for efficiently accomplishing the zerotree coding in the present invention . fig6 a shows a wavelet packet region and a relocated wavelet packet region on the frequency band for illustrating one embodiment of the wavelet packet coefficient relocating process . and , fig6 b shows a coefficient distribution of each band in the tree structure , assembled for executing the zerotree coding . as shown in the figure , in the one embodiment of the coefficient relocating process , each of the wavelet packet coefficients corresponds to same locations in subbands , at first . the subbands can have different frequencies , as described above . the wavelet packet coefficients are then relocated to lie adjacent each other in a location in the integrated frequency band corresponding to the locations in the subbands . therefore , the coefficients in the corresponding location in the subband can be distributed as a child under a coefficient of the low - frequency band on a high level of the tree structure , or parent . fig7 a shows a wavelet packet region and a relocated wavelet packet region on the frequency band for illustrating another embodiment of the wavelet packet coefficient relocating process . and , fig7 b shows a coefficient distribution of each band in the tree structure , assembled for executing the zerotree coding according to the another embodiment . as shown in fig7 a , in the another embodiment of the coefficient relocating process , adjacent four wavelet packet coefficients in the subbands having same frequency are defined as one unit . similar to fig6 a , the units corresponding to same locations in the subbands can have different frequencies . the units are then relocated to lie adjacent each other in the integrated frequency band . therefore , in the tree structure as shown in fig7 b , coefficients of one of the subbands can be distributed as a child under a coefficient of each upper low - frequency band ( namely , one parent ). as more wavelet coefficients collects at a specific frequency band , the above unit relocating method is more effective . in addition , according to characteristics of the image data , the relocating method can relocate 8 , 16 , 32 wavelet coefficients in a unit . fig8 shows a process that the wavelet packet image transforms into a final relocated image . referring to the figure , it would be understood that the coefficient relocating process is repeatedly executed until each subband becomes a wavelet coefficient . in the relocating process from the step 1 to the step 2 , four smallest subbands are selected on the frequency band . the four smallest subbands are virtually integrated in one bigger band . in the relocating process from the step 2 to the step 3 , the bigger band , integrated in the step 2 , and other adjacent bands , having same size as the bigger band , are relocated and integrated again into one much bigger band . in the relocating process from the step 3 to the step 4 , the much bigger band , integrated in the step 3 , and other adjacent bands , having same size as the much bigger band , are relocated and integrated again in one biggest band . the step 4 shows a desired final structure same as the wavelet transformed coefficient . after the steps 1 to 4 , the zerotree coding is executed in the same conventional manner . operation and effect of the present invention as constructed above , are described as follows . the wavelet packet transform process 100 , which is the first step of the present invention , is accomplished by one of a top - down transform and a bottom - up transform . the top - down transform is a method of executing the filtering and the subsampling , and further dividing the band when determined that the compression for the high frequency band is effective after the wavelet transform . on the other hand , the bottom - up transform is a method of integrating the divided bands by executing the filtering and an up - sampling ( or , reverse wavelet transform ). the bottom - up transform is required when it is determined that the compression is effective after repeatedly executing the filtering and subsampling for the frequency bands until a predetermined level . though the wavelet packet transform process is accomplished by one of the methods , the zerotree coding cannot be executed directly because the frequency bands do not have regular sizes . therefore , in order to accomplish the zerotree coding for the wavelet packet transformed coefficients , the wavelet packet coefficients should be relocated as shown in fig6 a . the coefficient relocating process 200 gives same effect as integrating the divided frequency bands without executing the reverse wavelet transform . each of the wavelet packet coefficients has a location information of a before - transform image . therefore , when relocating the wavelet packet coefficients , coefficients corresponding to same location in each frequency band are collected and located in a corresponding location in the integrated band . when executing the zerotree coding about the wavelet packet coefficients , relocated as shown in fig6 a , each of the trees is constructed with coefficients in different frequency bands . as a result , when collecting and relocating the four coefficients in a unit in fig7 a , the last branches of each tree is consisted of coefficients from the same band as shown in fig7 b . therefore , coding performance is enhanced more than the relocating process in fig6 a . the unit relocating method will be more effective when the wavelet coefficient has strong correlation with the frequency . furthermore , by using the unit relocating method , 8 , 16 , 32 wavelet coefficients can be relocated in a unit , depending on the respective image data characteristics . whole coefficient relocating method is accomplished by repeatedly executing the relocating process in fig6 a or fig7 a from small bands by using the above described method . after searching and relocating smallest bands , four smallest bands are virtually integrated in one bigger band . then , the integrated bigger band and other adjacent bands having same size as the bigger band are relocated and integrated again . that process is repeated until the wave packet coefficients are to have same configuration as the wavelet packet transformed coefficients . after the coefficient relocating process , the zerotree coding is accomplished in same manner as the wavelet transform . the decoder passes by reverse processes against the above process for obtaining a recovered image . because the zerotree coding is applied to the wavelet packet transform , which is more generalized type than the wavelet transform , the present invention as described above can raise image quality at the same bit rate more than the prior art . in addition , the present can decrease amount of the data in case of having equal image quality . furthermore , the present invention has an advantage of providing the highest image quality in the off - line coding applications such as an on - demand video service , an image service in web , or an image storing and recovering device for a medical usage . | 7 |
the term “ 2 - aryl content ” is defined as the percentage of total alkylate ( the alkylate species in which the alkyl chain derived from the olefin employed in the present alkylation process is attached to the aromatic ring ) that is comprised of those chemical species in which the attachment of the alkyl chain to the aromatic ring is at the 2 - position along the alkyl chain . the term “ binder ” means any suitable inorganic material which can serve as matrix or porous matrix to bind the zeolite particles into a more useful shape . the term “ branched - chain olefins ” means olefins derived from the polymerization of olefin monomers higher than ethylene and containing a substantial number of branches wherein the branches are alkyl groups having from about one carbon atom to about 30 carbon atoms . mixtures of ethylene and higher olefins are also contemplated . the term “ calcining ” as used herein means heating the catalyst to about 400 ° c . to about 1000 ° c . in a substantially dry environment . the term “ carbonated , overbased ” is used to describe those alkaline earth metal alkyl aromatic sulfonates in which the ratio of the number of equivalents of the alkaline earth metal moiety to the number of equivalents of the aromatic sulfonic acid moiety is greater than one , and is usually greater than 10 and may be as high as 20 or greater . the term “ cumulative pore volume ” obtained by mercury intrusion porosimetry as used herein refers to that part of the total volume in milliliters per gram derived from the graphical , cumulative pore volume distribution , measured by section 14 . 1 . 6 of astm d 4284 - 03 , or the corresponding tabular presentation of the same data between defined upper and lower pore diameters . when no lower diameter limit is defined , the lower limit is the lowest detection limit or lowest radius measured by section 14 . 1 . 6 of astm d 4284 - 03 . the terms “ dry basis ”, “ anhydrous basis ”, and “ volatiles - free basis ” shall refer to the dry weight of catalyst composite or raw materials expressed on a metal oxides basis such as na 2 o . al 2 o 3 . xsio 2 . the term “ flush ” as used herein means contacting the deactivated mordenite catalysts and mordenite catalyst composites of this invention in the reactor with a suitable solvent , such as an aromatic hydrocarbon for reactivation of the mordenite catalysts and mordenite catalyst composites . the term “ loss - on - ignition ( loi )” as used herein means the percent weight loss of the zeolite composite and raw material samples which volatilize or evaporate when heated to 538 ° c . for 1 hour . when the temperature is greater than or equal about 538 ° c ., the “ loss - on - ignition ” approximates the percent volatiles . the terms “ macropore ”, “ mesopore ”, and “ micropore ” as used herein follow the definitions set forth by the international union of pure and applied chemistry ( iupac ), division of physical chemistry , in manual of symbols and terminology for physicochemical quantities and units , appendix ii definitions , terminology and symbols in colloid and surface chemistry part i , adopted by the iupac council at washington , d . c ., usa , on 23 jul ., 1971 . pores with widths or diameters exceeding ˜ 50 nanometers ( 500 angstroms ) are called “ macropores ”. pores with widths or diameters not exceeding ˜ 2 . 0 nanometers ( 20 angstroms ) are called “ micropores ”. pores of intermediate size ( 2 . 0 nanometers & lt ; width or diameter ≦ 50 nm ) are called “ mesopores ”. the term “ mercury intrusion porosimetry ” refers to the astm test no . d 4284 - 03 used to determine pore volume distribution of catalysts by mercury intrusion porosimetry . mercury pore distribution was measured using a quantachrome scanning mercury porosimeter model sp - 100 . the software version used by the instrument is v2 . 11 ( dated oct . 27 , 1993 ). surface tension used in the calculation is 473 dynes per centimeter and the contact angle is 140 degrees . the terms “ normal alpha olefin ” and “ linear alpha olefin ” mean those straight - chain olefins without a significant degree of alkyl branching in which the carbon to carbon double bond resides primarily at the end or “ alpha ” position of the carbon chain , i . e ., between c 1 and c 2 . normal alpha olefins are derived from polymerization of ethylene . the term “ normal alpha olefin isomerization ” means the conversion of normal alpha olefins into isomerized olefins having a lower alpha olefin content ( the double bond is between c 1 and c 2 ), higher internal olefin content ( the double bond is in positions other than between c 1 and c 2 ), and optionally a higher degree of branching . the term “ partially - branched chain olefin ” is defined as the olefin product of isomerization of normal alpha olefins wherein the degree of branching is higher than in the starting normal alpha olefins . the term “ peak macropore diameter ” as used herein means the peak diameter ( i . e ., the diameter within the macropore region at which the differential plot of pore size distribution , as defined by section 14 . 2 , reaches a maximum ) in the macropore range determined by astm test no . 4284 - 03 for the macropore peak in the catalysts of the present invention . the term “ peptizing ” means the dispersion of large aggregates of binder particles , including hydrated aluminas , into much smaller primary particles by the addition of acid . the term “ percent volatiles ” as used herein means the difference between the actual weight of the catalyst composite or the raw materials and the weight of the material on a dry , anhydrous , or volatiles - free basis , expressed as a percentage of the actual sample weight . the term “ sar ” or “ silica to alumina ratio ” refers to the molar ratio of silicon oxide to aluminum oxide ; mol sio 2 : mol alo 3 . the term “ sufficient water to shape the catalyst material ” means quantity of water required to make an acid peptized mixture of zeolite and alumina powders into an extrudable mass . the term “ tabletting ” as used herein refers to the process of forming a catalyst aggregate from zeolite powder or a mixture of zeolite and binder powders by compressing the powder in a die . the term “ total pore volume ” obtained by mercury intrusion porosimetry as used herein refers to the total pore volume in milliliters per gram derived from the graphical , cumulative pore volume distribution ( section 14 . 1 . 6 of astm d 4284 - 03 ) or the corresponding tabular presentation of the same data . as used herein , all percentages are weight percent , unless otherwise specified . as noted above , the present invention is directed to novel alkylated aromatic compositions and their sulfonated and carbonated products . the alkylation of the aromatic hydrocarbons is carried out in the presence of the zeolite catalyst compositions of the present invention having a controlled macropore structure comprising zeolite y and mordenite zeolite . the catalysts of the present invention were characterized by pore volume distribution obtained by mercury intrusion porosimetry , astm test no . d 4284 - 03 . mercury intrusion porosimetry provides a graph of cumulative pore volume ( pv ) versus pore diameter ( pd ). mercury intrusion porosimetry also is used to determine the macropore peak diameter from the derivative , delta pv ( δpv ) divided by delta pd ( δpd ). the graphs are used to characterize the catalysts of the present invention . the zeolite catalyst compositions were prepared using zeolite y and mordenite zeolite . zeolite y and mordenite zeolite may also be combined to prepare zeolite catalyst compositions of the present invention . when the zeolite catalyst compositions contain both zeolite y and mordenite zeolite , the zeolite catalyst composite may be prepared by mixing zeolite y and mordenite zeolite powders before the binding and shaping steps . the zeolite y cbv 760 ® and cbv 600 ® available from zeolyst international having a nominal silica to alumina ratio of 60 and 6 . 7 , respectively , may be used for preparing the zeolite catalyst compositions of this invention . however , zeolite y having a silica to alumina ratio between 5 and 110 may be used for the preparation of the zeolite catalysts compositions of the present invention . the mordenite zeolite 90a ® having a nominal silica to alumina ratio of 90 , also available from zeolyst international , may be used for preparing the zeolite catalyst compositions of this invention . mordenite zeolite having a silica to alumina ratio of 50 to 105 may be used in the preparation of the zeolite catalyst compositions of this invention . the catalysts of the present invention may be shaped or formed into tablets , extrudates or any other shape using procedures well known in the prior art . the preparation of extrudates requires the presence of a binder , such as alumina . the tabletted catalysts do not require the presence of a binder , but a binder may be present in a tabletted zeolite catalyst . the crystalline zeolite powder may be compressed to form a tablet . the tabletted catalysts of the present invention provide exceptionally low deactivation rates in alkylation reactions . the alkylation of aromatic hydrocarbons with one or more olefins may be carried out in a fixed bed reactor in the presence of the zeolite catalysts compositions of the present invention comprising only zeolite y , only mordenite zeolite , or both zeolite y and mordenite zeolite . the alkylation process is conducted without the addition of water and using dried aromatic hydrocarbon and olefin feed . it is believed that the presence of water during the alkylation increases the deactivation rate of the catalysts of this invention . when the alkylation using zeolite y and mordenite zeolite is carried out in separate fixed bed reactors , the alkylated aromatic hydrocarbons may be combined to obtain the desired amount of alpha olefins versus branched - chain olefins . alkylation reactions using normal alpha olefins and zeolite catalysts compositions comprising only mordenite zeolite give predominantly alkylated aromatic hydrocarbons wherein the attachment of the of the alkyl chain to the aromatic ring is at the 2 - position along the alkyl chain . on the other hand , alkylation reactions using zeolite catalysts compositions comprising only zeolite y and normal alpha olefins give predominantly attachments at other than the 2 - position along the alkyl chain . the alkylation reaction may be carried out by any conventionally known process . the aromatic hydrocarbon is reacted with one or more olefins in the presence of a catalyst of the present invention under alkylation reaction conditions . the above alkylation process is conducted without the addition of water and using dried aromatic hydrocarbon and olefin feed . it is believed that the presence of water during the alkylation process increases the deactivation rate of the catalysts of this invention . the aromatic hydrocarbon may be single - ring or double - ring , preferably the aromatic hydrocarbon is a single - ring aromatic hydrocarbon . the aromatic hydrocarbon may be an alkylated aromatic hydrocarbon , such as a mono - alkylated aromatic hydrocarbon , wherein the alkyl group has from about 4 carbon atoms to about 80 carbon atoms . when the aromatic hydrocarbon used is a mono - alkylated aromatic , the product of the alkylation reaction is a di - alkylated aromatic hydrocarbon . the olefins useful for alkylation of the aromatic hydrocarbons may be linear - chain olefins or branched - chain olefins having from about 4 carbon atoms to about 80 carbon atoms . in addition , normal alpha olefins may be isomerized to obtain partially - branched - chain olefins for use in alkylation process of the present invention . these resulting partially - branched - chain olefins may be alpha - olefins , beta - olefins , internal - olefins , tri - substituted olefins , and vinylidene olefins . alkylated aromatic hydrocarbon sulfonic acids of the alkylated aromatic hydrocarbons of the present invention may be prepared by any known sulfonation reaction . the alkylated aromatic sulfonic acids may be further reacted with an alkaline earth metal and carbon dioxide to obtain carbonated , overbased alkylated aromatic sulfonates useful as detergents in lubricating oils . carbonation may be carried out by any conventionally known process . the degree of overbasing may be controlled by changing the reaction conditions and the amount of the alkaline earth metal and carbon dioxide used in the carbonation process . the novel alkylation compositions of the present invention may be obtained by conducting the alkylation reactions as described above in the presence of the zeolite catalyst compositions of the present invention prepared as described in examples 1 – 4 below . the isomerization process may be carried out in batch or continuous mode . the process temperatures can range from 50 ° c . to 250 ° c . in the batch mode , a typical method is to use a stirred autoclave or glass flask , which may be heated to the desired reaction temperature . a continuous process is most efficiently carried out in a fixed bed process . space rates in a fixed bed process can range from 0 . 1 to 10 or more weight hourly space velocity . in a fixed bed process , the isomerization catalyst is charged to the reactor and activated or dried at a temperature of at least 150 ° c . under vacuum or flowing inert , dry gas . after activation , the temperature of the isomerization catalyst is adjusted to the desired reaction temperature and a flow of the olefin is introduced into the reactor . the reactor effluent containing the partially - branched , isomerized olefins is collected . the resulting partially - branched , isomerized olefins contain a different olefin distribution ( alpha olefin , beta olefin , internal olefin , tri - substituted olefin , and vinylidene olefin ) and branching content than the unisomerized olefin . alkylation of aromatic hydrocarbons with normal alpha olefins , partially - branched - chain isomerized olefins , and branched - chain olefins may be carried out by any method known by a person skilled in the art . the alkylation reaction is typically carried out with an aromatic hydrocarbon and an olefin in molar ratios from 1 : 15 to 25 : 1 . process temperatures can range from about 100 ° c . to about 250 ° c . the process is carried out without the addition of water . as the olefins have a high boiling point , the process is preferably carried out in the liquid phase . the alkylation process may be carried out in batch or continuous mode . in the batch mode , a typical method is to use a stirred autoclave or glass flask , which may be heated to the desired reaction temperature . a continuous process is most efficiently carried out in a fixed bed process . space rates in a fixed bed process can range from 0 . 01 to 10 or more weight hourly space velocity . in a fixed bed process , the alkylation catalyst is charged to the reactor and activated or dried at a temperature of at least 150 ° c . under vacuum or flowing inert , dry gas . after activation , the alkylation catalyst is cooled to ambient temperature and a flow of the aromatic hydrocarbon compound is introduced , optionally toluene . pressure is increased by means of a back pressure valve so that the pressure is above the bubble point pressure of the aromatic hydrocarbon feed composition at the desired reaction temperature . after pressurizing the system to the desired pressure , the temperature is increased to the desired reaction temperature . a flow of the olefin is then mixed with the aromatic hydrocarbon and allowed to flow over the catalyst . the reactor effluent comprising alkylated aromatic hydrocarbon , unreacted olefin and excess aromatic hydrocarbon compound are collected . the excess aromatic hydrocarbon compound is then removed by distillation , stripping , evaporation under vacuum , or any other means known to those skilled in the art . sulfonation of alkylated hydrocarbons may be carried out by any method known by a person skilled in the art . the sulfonation reaction is typically carried out in a falling film tubular reactor maintained at about 65 ° c . the alkylated aromatic hydrocarbon is placed in the tube and sulfur trioxide diluted with nitrogen is added to the alkylated aromatic hydrocarbon . the molar ratio of alkylated aromatic hydrocarbon to sulfur trioxide is maintained at about 1 . 05 : 1 . the resulting alkylated aromatic sulfonic acid may be diluted with about 10 % 100 neutral oil followed by thermal treatment with nitrogen bubbling at a rate of about 10 liters per kilogram of product and stirring while maintaining the temperature at about 85 ° c . until the desired residual sulfuric acid content is obtained ( maximum of about 0 . 5 %). carbonation , overbasing of alkylaromatic sulfonic acids may be carried out by any method known by a person skilled in the art to produce alkylaromatic sulfonates . generally , the carbonation , overbasing reaction is carried out in a reactor in the presence of the alkylated aromatic sulfonic acid , diluent oil , an aromatic solvent , and an alcohol . the reaction mixture is agitated and alkaline earth metal and carbon dioxide are added to the reaction while maintaining the temperature between about 20 ° c . and 80 ° c . the degree of carbonation , overbasing may be controlled by the quantity of the alkaline earth metal and carbon dioxide added to the reaction mixture , the reactants and the reaction conditions used during the carbonation process . once the mordenite zeolite catalysts and catalyst composites are completely deactivated , the alkylation reaction stops because of the polymerization of the olefin into large molecular species that cannot diffuse out of the crystal micropores containing the active sites in the zeolitic material . however , reactor bed need not be changed to remove the deactivated mordenite zeolite catalysts and catalyst composites . the deactivated mordenite zeolite catalysts and catalyst composites are reactivated at the end of an alkylation run by stopping the olefin feed stream to the reactor and permitting the aromatic hydrocarbon stream to continue to be flushed through the reactor for a sufficient time , typically from about 12 hours to about 24 hours . zeolite catalyst composition 1 is prepared by mixing zeolite y powder and mordenite zeolite powder available from zeolyst international or any other commercial source . the zeolite y and mordenite zeolite powders are mixed in any proportion based on the desired alkylated aromatic product . as an example , zeolite y catalyst powder is mixed with mordenite zeolite catalyst powder to obtain a final ratio of 85 : 15 in the final zeolite catalyst composition . loss - on - ignition ( loi ) is determined for samples of commercially available zeolite y ( cbv 760 ® and cbv 600 ®) and mordenite zeolite ( cbv 90a ®) available from zeolyst international by heating the samples to 538 ° c . for 1 hour . the loi obtained provides the percent volatiles in the zeolite y and mordenite zeolite batches being used . the loi of a commercial sample of versal ® hydrated aluminum oxide available from sasol is also obtained by heating the samples to 538 ° c . for 1 hour . next , based on the results obtained from the loi of the zeolite y , mordenite zeolite and the alumina powders the amount of alumina powder is weighed out to obtain 80 % ( volatile - free basis ) zeolite content of the composite consists of 85 % zeolite y and 15 % mordenite zeolite on a volatile - free basis . the three dry powders are added to a baker perkins mixer and dry mixed for 4 minutes . the amount of concentrated ( 70 . 7 %) nitric acid to give 0 . 7 weight % ( based on 100 % nitric acid ) of the dry weight of the zeolite and the alumina powders is calculated . this amount of 70 . 7 % nitric acid was weighed out and dissolved in deionized water . the total amount of water and 70 . 7 % nitric acid needed to obtain a final concentration of approximately 50 % total volatiles is calculated as follows . volatiles in the y zeolite , mordenite zeolite and alumina powders is calculated . nitric acid solution is considered to be 100 % volatiles . thus , the amount of deionized water that must be added is the difference between the final concentration of volatiles of 50 % minus the total volatiles in the three powders . deionized water is added over a period of 5 minutes to the powders in the mixer using a peristaltic pump . the mixer is then stopped so that the walls of the mixer can be scraped down . mixing is then resumed and the solution of nitric acid in water is added over 5 minutes using the peristaltic pump . at the end of acid addition , mixing is continued for a total time of 40 minutes , with occasional holds to allow for scraping the sides of the mixer . at the end of the mixing period , the percent volatiles are measured . additional amounts of deionized water is added until the mixture appears extrudable and the percent volatiles are again measured . the wet mixture is extruded through 1 . 27 millimeters , asymmetric quadrilobe die inserts , in a bonnot extruder . the wet long cylindrical strands are dried at 121 ° c . for 8 hours . the long cylindrical strands are then broken to give extrudates with length to diameter ratio of 2 : 6 . the extrudates are sieved and the portion larger than 1 . 0 millimeter is retained . the extrudates are then calcined in a muffle furnace using the following temperature program : the extrudates are heated to 593 ° c . over two hours , then held at 593 ° c . for ½ hour and next cooled to 204 ° c . a total weight of the extrudates is obtained . mercury intrusion porosimetry is used to characterize the extrudates . a peak macropore diameter in angstroms and a cumulative pore volume at diameters less than 300 angstroms is obtained from the mercury intrusion porosimetry data . the zeolite catalyst composition is charged to a pilot plant reactor used for the alkylation of aromatic hydrocarbons . the reaction effluent of this reactor has greater than or equal to 99 % conversion of the olefin feed stream . when benzene is used as the aromatic hydrocarbon and the alkylation reaction is conducted using the zeolite catalyst composition , there is a much higher attachment of the alkyl chain to the aromatic ring at the 2 - position along the alkyl chain in the alkylated benzene than when the zeolite y catalyst composite is used alone in the alkylation reaction . excess benzene is removed by distillation , stripping or any other suitable means and the alkylated benzene is sulfonated using sulfonation procedures well known in the art . the alkyl benzene sulfonic acid is further carbonated with an alkaline earth metal and carbon dioxide . zeolite y catalyst composite was prepared are described above in example 1 using zeolite y cbv 760 ® available from zeolyst international . mordenite zeolite catalyst composite was prepared are described above in example 1 using mordenite zeolite cbv 90a ® available from zeolyst international . zeolite catalyst composition 2 is prepared by mixing zeolite y catalyst composite and mordenite zeolite catalyst composite prepared in examples 2 and 3 . the zeolite y catalyst composite and mordenite zeolite catalyst composite are mixed in any proportion based on the desired alkylated aromatic product . as an example , zeolite y catalyst composite is mixed with mordenite zeolite catalyst composite to obtain a final ratio of 85 : 15 in the zeolite catalyst composition 2 . the resulting zeolite catalyst composition 2 is charged to a pilot plant reactor for the alkylation of aromatic hydrocarbons as described below in example 5 . typically , alkylation of aromatic hydrocarbons with normal alpha olefins , partially - branched - chain isomerized olefins and branched - chain olefins was carried out as described below : a fixed bed reactor constructed from 15 . 54 millimeters schedule 160 stainless steel pipe was used for this alkylation test . pressure in the reactor was maintained by an appropriate back pressure valve . the reactor and heaters were constructed so that adiabatic temperature control could be maintained during the course of alkylation runs . a 192 gram bed of 850 micrometer to 2 millimeters alundum particles was packed in the bottom of the reactor to provide a pre - heat zone . next , 100 grams of a zeolite y catalyst composite similar to the zeolite y catalyst composite prepared in example 2 above was charged to the fixed bed reactor . the reactor was gently vibrated during loading to give a maximum packed bulk density of catalyst in the reactor . finally , void spaces in the catalyst bed were filled with 351 grams 150 micrometers alundum particles as interstitial packing . the reactor was then closed , sealed , and pressure tested under nitrogen . next , the alkylation catalyst was dehydrated during 15 hours at 200 ° c . under a 20 liters per hour flow of nitrogen measured at ambient temperature and pressure and then cooled to 100 ° c . under nitrogen . benzene was then introduced into the catalytic bed in an up - flow manner at a flow rate of 195 grams per hour . temperature ( under adiabatic temperature control ) was increased to a start - of - run temperature of 182 ° c . ( measured just before the catalyst bed ) and the pressure was increased to 14 . 6 atmospheres . when temperature and pressure had lined out at desired start - of - run conditions of 182 ° c . and 14 . 6 atmospheres , a feed mixture , consisting of benzene and c 20 - 24 nao at a molar ratio of 10 : 1 and dried over activated alumina , was introduced in an up - flow manner . as the feed reached the catalyst in the reactor , reaction began to occur and internal catalyst bed temperatures increased above the inlet temperature . after about 8 hours on - stream , the reactor exotherm was 20 ° c . at 26 hours on - stream , the olefin conversion in the product was 99 . 1 %. the run was stopped after 408 hours on - stream , although the run could have continued . at this time , the olefin conversion was 99 . 45 %. alkylated aromatic hydrocarbon products containing excess benzene were collected during the course of the run . after distillation to remove excess aromatic hydrocarbon , analysis showed that greater than 99 % conversion of olefin was achieved during the course of the run . a fixed bed reactor was constructed from 15 . 54 millimeters schedule 160 stainless steel pipe . pressure in the reactor was maintained by an appropriate back pressure valve . the reactor and heaters were constructed so that adiabatic temperature control could be maintained during the course of alkylation runs . a small amount of 850 micrometer to 2 millimeters acid - washed alundum was packed in the bottom of the reactor to provide a pre - heat zone . next , 100 grams of whole alkylation extrudate catalyst was charged to the fixed bed reactor . finally , void spaces in the catalyst bed were filled with 150 micrometers acid - washed alundum interstitial packing . the zeolite y or the mordenite zeolite alkylation catalyst was then dehydrated for at least 8 hours at 200 ° c . under a flow of nitrogen gas and then cooled to ambient temperature under nitrogen gas . benzene was then introduced into the catalytic bed in an up - flow manner . temperature ( isothermal temperature control ) and pressure were increased at start of run conditions . normal operating pressure was 11 . 91 atmospheres . the initial temperature of approximately 150 ° c . was chosen so that the temperature in the catalytic bed increased under adiabatic temperature control to about 160 ° c . to about 175 ° c . when temperature and pressure had lined out at desired start - of - run conditions , the reactor system was switched to adiabatic temperature control . a dried feed mixture , consisting of olefin and benzene , was introduced in an up - flow manner . the benzene to olefin molar ratio was 10 : 1 . as the reaction began to occur , temperature increased in the catalyst bed above the inlet temperature . alkylated benzene product containing excess benzene was collected during the course of the run . after distillation to remove excess benzene , analysis showed that greater than 99 % conversion of olefin was achieved during the course of the run . typically , alkylation of aromatic hydrocarbons with normal alpha olefins , partially - branched - chain isomerized olefins and branched - chain olefins was carried out as described below : a fixed bed reactor was constructed from 15 . 54 millimeters schedule 160 stainless steel pipe . pressure in the reactor was maintained by an appropriate back pressure valve . the reactor and heaters were constructed so that adiabatic temperature control could be maintained during the course of alkylation runs . a bed of 170 grams of 850 micrometer to 2 millimeters alundum particles was packed in the bottom of the reactor to provide a pre - heat zone . next , 100 grams of mordenite catalyst composite similar to the mordenite catalyst composite prepared in example 3 above was charged to the fixed bed reactor . finally , void spaces in the catalyst bed were filled with 309 grams of 150 micrometers alundum particles interstitial packing . the reactor was gently vibrated while charging catalyst and alundum to ensure a high packed bulk density . after charging , the reactor was closed , sealed , and the pressure was tested . the alkylation catalyst was then heated to 200 ° c . under a 20 liters per hour flow of nitrogen measured at ambient temperature and pressure and dehydrated for 23 hours at 200 ° c . the catalyst bed was then cooled to 100 ° c . under nitrogen . benzene was then introduced into the catalytic bed in an up - flow manner at a flow rate of 200 grams per hour . temperature ( under adiabatic temperature control ) was increased to a start of run inlet temperature of 154 ° c . ( measured just before the catalyst bed ) and the pressure was increased to 12 . 66 atmospheres . when temperature and pressure had lined out at desired start - of - run conditions of 154 ° c . and 12 . 66 atmospheres , a feed mixture , consisting of benzene and c 20 - 24 nao at a molar ratio of 15 : 1 and dried over activated alumina , was introduced in an up - flow manner at 200 grams per hour . as the feed reached the catalyst in the reactor , reaction began to occur and internal catalyst bed temperatures increased above the inlet temperature . after about 8 hours on - stream , the reactor exotherm was 20 ° c . in the first 57 hours on - stream , the olefin conversion decreased from 100 % to 98 . 8 % ( run period 1 ). at this point , the catalyst bed was flushed with benzene at 200 grams per hour during 18 hours . following the benzene flush , the benzene and olefin feed flow was resumed . inlet temperature was increased to 162 ° c . at 57 run hours . feed was continued until 351 run hours ( run period 2 from 57 to 351 run hours ). olefin conversion was initially 98 . 9 % during run period 2 but declined to 98 . 1 % at 321 run hours and further to 95 . 3 % at 351 run hours . a second benzene flush was performed at 351 run hours during 17 hours . after the second benzene flush , feed flow was resumed again to start run period 3 . feed was continued until 550 run hours . olefin conversion was initially 98 . 5 % but declined to 98 . 3 % at 519 run hours and to 97 . 0 % at 550 run hours . a third benzene flush was done during a weekend . feed flow was resumed after the third benzene flush to begin run period 4 . at the beginning of run period 4 , olefin conversion was 98 . 8 % and at 942 run hours the olefin conversion was 98 . 4 %. the run was stopped after 942 hours on - stream but could have continued longer . alkylated aromatic hydrocarbon products containing excess benzene were collected during the course of the run . after distillation to remove excess aromatic hydrocarbon , analysis showed that greater than 97 % conversion of olefin was achieved during most of the course of the run . a mixture of 85 weight % of the alkylated benzene prepared using the zeolite y catalyst and 15 weight % of the alkylated benzene prepared using mordenite zeolite catalyst as in examples 5 and 6 above was sulfonated by a concurrent stream of sulfur trioxide ( so 3 ) and air with in a tubular reactor ( 2 meters long , 1 centimeter inside diameter ) in a down flow mode using the following conditions : reactor temperature was 60 ° c ., so 3 flow rate was 73 grams per hour , and alkylate flow rate was 327 grams per hour at a so 3 to alkylate molar ratio of 1 . 05 . the so 3 was generated by passing a mixture of oxygen and sulfur dioxide ( so 2 ) through a catalytic furnace containing vanadium oxide ( v 2 o 5 ). the resulting crude alkylbenzene sulfonic acid had the following properties based on the total weight of the product : weight % of hso 3 was 15 . 61 % and weight % of h 2 so 4 was 0 . 53 . the crude alkylbenzene sulfonic acid ( 1665 grams ) was diluted with 83 grams of 100 neutral diluent oil and placed in a 4 liter four - neck glass reactor fitted with a stainless steel mechanical agitator rotating at about 300 rpm , a condenser and a gas inlet tube ( 2 millimeters inside diameter ) located just above the agitator blades for the introduction of nitrogen . the contents of the reactor were placed under vacuum ( 40 millimeters hg ) and the reactor was heated to 110 ° c . with stirring and nitrogen was bubbled through the mixture at about 30 liters per hour for about 30 minutes until the weight % of h 2 so 4 is less than about 0 . 3 weight %. this material is the final alkylbenzene sulfonic acid . the final alkylbenzene sulfonic acid had the following properties based on the total weight of the product : weight % of hso 3 was 14 . 95 and weight % of h 2 so 4 was 0 . 17 . to a 5 liter four - neck glass reactor equipped with heating and cooling capability and fitted with a stainless steel mechanical agitator rotating at between 300 and 350 rpm , a gas inlet tube ( 2 millimeters inside diameter ) located just above the agitator blades for the addition of co 2 , a distillation column and condenser under nitrogen gas was charged 129 . 4 grams of centrate . the centrate was a mixture of the sludge fractions previously produced during the purification of high tbn carbonated , overbased synthetic sulfonates by centrifugation and decantation and was added to the reaction mixture of this example for recycling the contents of the centrate . the centrate had a tbn of 197 and contained approximately 73 grams of xylene solvent , 12 grams active calcium sulfonate , 9 grams calcium hydroxide and calcium carbonate , 8 grams of carbon dioxide , and 23 grams of 100 neutral diluent oil . next , 40 grams of methanol , 207 grams of xylene solvent , 296 . 5 grams ( 0 . 59 mole ) of the alkylbenzene sulfonic acid ( hso 3 was 14 . 95 weight % based on the total weight of the reaction mixture ) from example 6 above was charged to the reactor over 15 minutes at room temperature . a slurry of 160 grams ( 2 . 16 mole ) of calcium hydroxide , 362 grams of xylene solvent and 94 . 2 grams of methanol was added to the reactor and the contents of the reactor were cooled to 25 ° c . subsequently , 33 grams ( 0 . 79 mole ) of co 2 was added to the reactor through the gas inlet tube over 39 minutes while the temperature of the reactor increased to about 32 ° c . a second slurry composed of 160 grams ( 2 . 16 mole ) of calcium hydroxide , 384 grams xylene solvent , and 131 grams of methanol was then added to the reactor concurrently with 0 . 9 grams of co 2 over about 1 minute . then 92 grams of co 2 was added to the reactor over 64 minutes while the temperature of the reactor was increased from about 30 ° c . to about 41 ° c . a third slurry composed of 82 grams of oxide and 298 grams of xylene solvent was then charged to the reactor concurrently with 1 . 4 grams of co 2 over about 1 minute . next , 55 grams ( 1 . 25 mole ) of co 2 was added to the reactor over approximately 60 minutes while keeping the reactor temperature at approximately 38 ° c . the water and methanol were then distilled from the reactor by first heating the reactor to 65 ° c . over about 40 minutes at atmospheric pressure and then to 93 ° c . over about 60 minutes at atmospheric pressure and then finally to 130 ° c . over about 30 minutes at atmospheric pressure . the temperature of the reactor was then decreased to 110 ° c . over about 60 minutes at atmospheric pressure and next then cooled to approximately 30 ° c . and 475 . 7 grams of 600 neutral diluent oil was added to the reactor followed by 413 grams of xylene solvent . the sediment in the product was then removed by centrifugation . the xylene solvent in the product was distilled by heating the product to 204 ° c . over approximately 45 minutes at 30 millimeters hg vacuum and holding the product at 204 ° c . and 30 millimeters hg vacuum for 10 minutes . the vacuum was replaced with nitrogen gas and the contents allowed to cool to room temperature to obtain the overbased sulfonate having the following properties based on the total weight of the product : the weight % of calcium was 16 . 2 , tbn was 429 , weight % of sulfur was 1 . 70 , weight % of calcium sulfonate was 0 . 94 , and viscosity was 111 cst at 100 ° c . | 8 |
fig1 is a block diagram of components of an elevator system 10 in an exemplary embodiment . although embodiments are described with respect to an elevator system , it is understood that embodiments may be applied to other conveyance systems ( e . g ., trains , automobiles , marine ). elevator system 10 includes a source of ac power 12 , such as an electrical main line ( e . g ., 440 volt , 3 - phase ). the ac power 12 is provided to a regenerative drive system 20 . as described in further detail herein , drive system 20 includes a plurality of drives arranged in a parallel electrical configuration . each drive may include a converter to convert the ac power 12 to a dc voltage . each drive may include an inverter to convert the dc voltage to multiphase , ac drive signals . drive signals from the drive system 20 are supplied to a multiphase machine 22 to impart motion to elevator car 23 . in an exemplary embodiment , machine 22 includes a multiphase , permanent magnet synchronous motor . fig2 is a block diagram of a 2 level , 3 phase drive 30 used in exemplary embodiments . drive 30 includes a converter 32 having 3 phase legs , r , s and t . each phase leg , r , s and t , includes switches controlled by control signals from a drive controller to convert ac power to dc power across a first dc bus 34 ( e . g ., positive ) and a second dc bus 36 ( e . g ., negative ). drive 30 includes an inverter 40 having 3 phase legs , w , v , u . each phase leg , w , v , and u , includes switches controlled by control signals from a drive controller to convert dc power across the dc bus 34 , 36 to ac drive signals to power motor 21 , which is part of machine 22 . fig3 a is a block diagram of a 3 level , 3 phase drive 50 used in an exemplary embodiment . drive 50 includes a converter 52 having 3 phase legs , r , s and t . each phase leg , r , s and t , includes switches controlled by control signals from a drive controller to convert ac power to dc power across a first dc bus 34 ( e . g ., positive ) and a second dc bus 36 ( e . g ., negative ). converter 52 is a neutral point clamped ( npc ) converter , in which the neutral points in each phase leg r , s , and t are connected at a common , converter neutral point 53 . drive 50 includes an inverter 54 having 3 phase legs , w , v , u . each phase leg , w , v , and u , includes switches controlled by control signals from a drive controller to convert dc power across the dc bus 34 , 36 to ac drive signals to power motor 21 , which is part of machine 22 . inverter 54 is a neutral point clamped ( npc ) inverter , in which the neutral points in each phase leg w , v , and u are connected at a common , inverter neutral point 55 . an optional neutral point link 58 may be used to electrically connect the converter neutral point 53 to the inverter neutral point 55 . fig3 b is a block diagram of a 3 level , 3 phase drive 51 used in an exemplary embodiment . drive 51 includes a converter 52 having 3 phase legs , r , s and t . each phase leg , r , s and t , includes switches controlled by control signals from a drive controller to convert ac power to dc power across a first dc bus 34 ( e . g ., positive ) and a second dc bus 36 ( e . g ., negative ). converter 52 is a t - type converter . drive 51 includes an inverter 54 having 3 phase legs , w , v , u . each phase leg , w , v , and u , includes switches controlled by control signals from a drive controller to convert dc power across the dc bus 34 , 36 to ac drive signals to power motor 21 , which is part of machine 22 . inverter 54 is a t - type inverter . an optional neutral point link 58 may be used to electrically connect a converter neutral point to an inverter neutral point . fig3 c is a block diagram of a 3 level , 3 phase drive 53 used in an exemplary embodiment . drive 53 includes a converter 52 having 3 phase legs , r , s and t . each phase leg , r , s and t , includes switches controlled by control signals from a drive controller to convert ac power to dc power across a first dc bus 34 ( e . g ., positive ) and a second dc bus 36 ( e . g ., negative ). converter 52 is an at - type converter . drive 53 includes an inverter 54 having 3 phase legs , w , v , u . each phase leg , w , v , and u , includes switches controlled by control signals from a drive controller to convert dc power across the dc bus 34 , 36 to ac drive signals to power motor 21 , which is part of machine 22 . inverter 53 is an at - type inverter . an optional neutral point link 58 may be used to electrically connect a converter neutral point to an inverter neutral point . fig4 is a block diagram of a drive system including paralleled drives in an exemplary embodiment . as shown in fig4 , two drives 30 and 30 ′ are connected in parallel to provide drive signals to motor 21 . each drive 30 and 30 ′ is controlled by a separate drive controller , 60 and 62 , respectively . drive controllers 60 and 62 provide control signals to the drives 30 and 30 ′, respectively , to control generation of the drive signals to motor 21 . drive controllers 60 , 62 may be implemented using a general - purpose microprocessor executing a computer program stored on a storage medium to perform the operations described herein . alternatively , drive controllers 60 , 62 may be implemented in hardware ( e . g ., asic , fpga ) or in a combination of hardware / software . drives 30 and 30 ′ are 2 level , 3 phase drives , such as that shown in fig2 . drives 30 and 30 ′ are placed in parallel by electrically connecting the positive dc bus 34 of drive 30 to the positive dc bus 34 of drive 30 ′ and electrically connecting the negative dc bus 36 of drive 30 to the negative dc bus 36 of drive 30 ′. the 3 phase drive signals from drives 30 and 30 ′ are connected to an inductive interface 70 , which combines each respective phase from the drives 30 and 30 ′ through inductive elements ( e . g ., inductors ). for example , phase w from drive 30 and phase w from drive 30 ′ are connected to each other through separate inductive elements in the inductive interface 70 , and then applied to one winding of 3 - phase motor 21 . phases v and u are connected in a similar manner . inductive interface 70 allows for combining phases from two separate drives 30 and 30 ′. inductive interface 70 also acts as a voltage suppression filter . although two drives 30 and 30 ′ are shown in fig4 , it is understood that embodiments may include more than two drives connected in parallel . fig5 is a block diagram of a drive system including paralleled drives in an exemplary embodiment . as shown in fig5 , two drives 50 and 50 ′ are connected in parallel to provide drive signals to motor 21 . each drive 50 and 50 ′ is controlled by a separate drive controller , 60 and 62 , respectively . drive controllers 60 and 62 provide control signals to the drives 50 and 50 ′, respectively , to control generation of the drive signals to motor 21 . drives 50 and 50 ′ are 3 level , 3 phase drives , such as that shown in fig3 a - 3c . drives 50 and 50 ′ are placed in parallel by electrically connecting the positive dc bus 34 of drive 50 to the positive dc bus 34 of drive 50 ′ and electrically connecting the negative dc bus 36 of drive 50 to the negative dc bus 36 of drive 50 ′. further , the inverter neutral point 55 of drive 50 is connected to converter neutral point 53 of drive 50 ′. alternatively , the converter neutral point 53 of drive 50 is connected to inverter neutral point 55 of drive 50 ′. in other embodiments , the connection between the inverter neutral point 55 ( converter neutral point 53 ) of drive 50 to the converter neutral point 53 ( inverter neutral point 55 ) of drive 50 ′ may be eliminated , and only the dc buses connected between drives 50 and 50 ′. the 3 phase drive signals from drives 50 and 50 ′ are connected to an inductive interface 70 , which combines each respective phase from the drives 50 and 50 ′ through inductive elements . for example , phase w from drive 50 and phase w from drive 50 ′ are connected to each other through separate inductive elements in the inductive interface 70 , and then applied to one winding of 3 - phase motor 21 . phases v and u are connected in a similar manner . inductive interface 70 allows for combining phases from two separate drives 50 and 50 ′. although two drives 50 and 50 ′ are shown in fig5 , it is understood that embodiments may include more than two drives connected in parallel . to facilitate combining the drive signals of separate drives ( e . g ., 30 / 30 ′ or 50 / 50 ′) at the inductive interface 70 , it is beneficial that the drive signals at the output of the drives be synchronized . due to variations in the drive controllers and drives , using identical control signals may not result in synchronized outputs from the drives . in order to aid in synchronizing the outputs from two or more drives , drive controllers 60 and 62 execute a process to align the control signals provided to the respective drives . fig6 depicts a first control signal 80 from drive controller 60 for one phase of the inverter 40 of drive 30 , for example , and a second control signal 82 from drive controller 62 for one phase of the inverter 40 of drive 30 ′, for example . the control signals may be pulse width modulation signals , commonly used in n - level drives . in operation , a reference point 84 of the control signal is defined . as shown in fig6 , the reference point 84 is a minimum value of the control signal , however , any reference point may be used . during operation , first drive controller 60 communicates to the second drive controller 62 when the reference point has occurred in control signal 80 . second drive controller 62 then determines when the reference point occurs in control signal 82 . if there is a difference between when the reference point occurs in the first control signal 80 and when the reference point occurs in the second control signal 82 , then one or both of the drive controllers 60 and 62 may adjust the period of the drive signal such that the reference points occur at the same time . the first drive controller 60 or second drive controller 62 may use known techniques to adjust the period of the drive signal , such as a phase locked loop technique to reduce error between when the reference point occurs in control signal 82 and when the reference point occurs in control signal 84 . this improves synchronization of the drive signals between drives 30 and 30 ′, which allows smaller inductive elements to be used in inductive interface 70 . the control signal synchronization of fig6 may be used with any number of drives , and is not limited to two drives . the control signal synchronization of fig6 may be used with the drives other than those shown in fig4 . fig7 is a block diagram of a drive system including paralleled drives in an exemplary embodiment . drive controllers 60 and 62 may be used in the embodiment of fig7 to control drives 90 and 90 ′. fig7 depicts the use of hybrid drives 90 and 90 ′, where the converter sections are 3 level , 3 phase converters 52 and the inverter sections are 2 level , 3 phase inverters 40 . fig7 also depicts an architecture that does not use an inductive interface 70 . in fig7 , motor 21 is a 6 phase motor . each phase of the 3 phase drive signals from drives 90 and 90 ′ is connected to an individual phase of motor 21 . motor 21 may have two ( or four ) sets of galvanic electrically isolated windings sharing the same stator and generating torque on a common rotor . this architecture can be expanded by adding additional drives and using a motor with a higher number of phases ( e . g ., 3 three - phase drives with a 9 phase motor , 4 three - phase drives with a 12 phase motor ). fig8 is a block diagram of an architecture including paralleled drive systems , each including parallel drives , in an exemplary embodiment . fig8 depicts the use of multiple drive systems 100 and 100 ′, each including parallel drives 50 and 50 ′. drive controllers 60 and 62 may be used in the embodiment of fig8 to control drives 50 and 50 ′. in the example of fig8 , two drive systems 100 and 100 ′ ( each similar to that in fig5 ) are used to power a 6 phase motor 21 . each drive system 100 and 100 ′ generates a 3 phase drive signal output , where each phase is applied to a winding of motor 21 . motor 21 may have sets of galvanic electrically isolated windings sharing the same stator and generating torque on a common rotor . it is understood that other drive systems may be used in parallel , and embodiments are not limited to the drive system of fig5 . each drive system 100 and 100 ′ may employ control signal synchronization as described with reference to fig6 . this architecture can be expanded by adding additional drive systems 100 and using a motor with a higher number of phases ( e . g ., 3 drive systems with a 9 phase motor , 4 drive systems with a 12 phase motor ). in general terms , the system may include n drive systems , with a motor being 3n phase motor . fig9 is a block diagram of a drive system including paralleled converters and paralleled inverters in an exemplary embodiment . ac power 12 is provided to separate reactors 120 and 120 ′ and then to converters 122 and 122 ′. the output of converters 122 and 122 ′ is supplied to a dc bus 124 , which parallels the positive and negative dc outputs from converters 122 and 122 ′. an inverter 126 is made up of two parallel , 3 level igbt inverters controlled by a single controller and single gate drive . the inverters use identical or nearly identical igbts , and thus may be controlled by a single controller and gate drive signal , applied to the igbts in parallel . embodiments include the use of paralleled drives in order to meet high load demands without the need to design or source a single , high power drive . using parallel drives , and optionally parallel drive systems , allows the drive system to meet load demands through multiple , lower power drives . this eliminates the cost and / or development time associated with a single , higher power drive . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting . while the description has been presented for purposes of illustration and description , it is not intended to be exhaustive or limited to the form disclosed . many modifications , variations , alterations , substitutions , or equivalent arrangement not hereto described will be apparent to those of ordinary skill in the art without departing from the scope of the disclosure . additionally , while the various embodiments have been described , it is to be understood that aspects may include only some of the described embodiments . accordingly , embodiments are not to be seen as being limited by the foregoing description , but is only limited by the scope of the appended claims . | 7 |
the technology of the present application will now be described with reference to the figures . although described in the context of a cloth diaper , one of ordinary skill in the art would recognize that the technology may be used for other reusable protective garments . moreover , the technology of the present application is explained with reference to exemplary embodiments . the word “ exemplary ” is used herein to mean “ serving as an example , instance , or illustration .” any embodiment described herein as “ exemplary ” is not necessarily to be construed as preferred or advantageous over other embodiments . additionally , unless otherwise provided , all embodiments provided herein should be considered exemplary . fig1 illustrates an exemplary embodiment of a double gusset cloth diaper 10 . diaper 10 includes a front waistband portion 12 and a rear waistband portion 14 . diaper 10 also includes an exterior panel 40 having a surrounding outer edge margin and an interior panel 20 joined to a majority of the outer edge margin . diaper 10 includes tabs 16 and 18 which support fasteners for securing the diaper to a wearer . preferably , tabs 18 and 16 are constructed from an elastic or resilient material such as spandex . fig2 is a view of diaper 10 looking down on the rough side of interior panel 20 . interior panel 20 is comprised of a micro - chamois material . one of ordinary skill in the art will recognize other materials are possible . the outer edge margin of diaper 10 includes side margins 13 and 15 which are configured to confront the legs of a wearer . in this case side margins 13 and 15 correspond to right and left legs respectively . the side margins 13 and 15 are generally arcuate as shown , but could have other shapes . a first pair of gussets 22 ( 1 ) and 22 ( 2 ) is disposed along the arcuate side margins 13 and 15 respectively . a second pair of gussets 24 ( 1 ) and 24 ( 2 ) is disposed between the first pair of gussets 22 ( 1 ) and 22 ( 2 ). it can be seen in fig2 that the first pair of gussets extends along the arcuate edge margins 13 and 15 , while the second pair of gussets are approximately parallel to each other and offset inward from the first pair of gussets . second pair of gussets 24 ( 1 ) and 24 ( 2 ), alternatively , may conform to the shape or arc of first pair of gussets 22 ( 1 ) and 22 ( 2 ). with further reference to fig3 , it can be seen that interior panel 20 also includes an opening 26 for receiving an absorbent material , shown here in the form of a pad 30 , such that it is interposed between interior panel 20 and exterior panel 40 in the interior 28 of diaper 10 . opening 26 may be in the form of a slit with an accompanying elastic member 29 . the opening 26 may be reinforced by placement of reinforcing material , such as additional micro - chamois material , about the opening cut in the interior panel 20 . opening 26 optionally may have a closure flap ( not shown ) as is generally known in the art ; although a closure flap inhibits access to interior 28 and may hinder removal of soiled pad 30 . as shown in fig3 , it can be appreciated that the second pair of gussets 24 ( 1 ) and 24 ( 2 ) define a first or primary containment region 32 . the first pair of gussets 22 ( 1 ) and 22 ( 2 ), in conjunction with the second pair of gussets , defines a pair of auxiliary ( or secondary ) containment regions 34 ( 1 ) and 34 ( 2 ). for example , with reference to the right arcuate side margin 13 , gusset 22 ( 1 ) and 24 ( 1 ) create first auxiliary containment region 34 ( 1 ). in this embodiment , each gusset 22 ( 1 ), 22 ( 2 ), 24 ( 1 ), and 24 ( 2 ) includes a channel 21 ( 1 ), 21 ( 2 ), 27 ( 1 ), and 27 ( 2 ) respectively . disposed in each of these channels is a respective elongate elastic member 23 ( 1 ), 23 ( 2 ), 25 ( 1 ), and 25 ( 2 ). with reference to fig4 , the double gusset diaper 10 includes a plurality of fasteners disposed on the exterior panel 40 for fastening the diaper to a wearer as well as for adjusting the waist size and rise of the diaper to better conform to different sized wearers . for example , a pattern of fasteners 44 is provided along the front waistband portion 12 of diaper 10 , which is operative to fasten the diaper 10 to a wearer as well as to accommodate different waist sizes . in this case , the fasteners are cooperative snaps comprising female sockets and mating male studs . pattern 44 includes sockets 45 ( 1 )- 45 ( 18 ). as can be better appreciated with further reference to fig5 , sockets 45 ( 1 )- 45 ( 18 ) are placed such that when the diaper is being worn , they are in a position to receive studs 43 ( 1 )- 43 ( 4 ). it can be appreciated that pattern 44 provides multiple locations at which tabs 16 and 18 may be fastened to front waistband portion 12 . each column of pattern 44 may receive a corresponding pair of studs 43 . accordingly , the waistband is adjustable in diameter such that it can conform to different waist sizes for larger and smaller wearers . while pattern 44 is shown here as an array of studs , the positions of the studs and mating sockets could be reversed . also , shown in fig4 and 5 are additional sockets 47 ( 1 ) and 47 ( 2 ), which may receive studs 43 ( 1 ) and 43 ( 2 ) respectively when diaper 10 is worn by a person with a waist sized such that in order to fit properly about their waist , tab 16 must overlap tab 18 . the rise of diaper 10 is also adjustable by employing socket pattern 46 . pattern 46 in this case , includes sockets 45 ( 19 )- 45 ( 27 ). each row of pattern 46 may engage stud pattern 48 , which includes studs 43 ( 5 )- 43 ( 7 ). accordingly , in this case , there are three rise adjustment rows . it should be understood that while the patterns are shown here with a particular number of rows and columns , the number of rows and / or columns may vary as well as the corresponding number of mating fasteners . furthermore , different types of fasteners may be used other than those shown here . for example , cooperative hook and loop material , such as aplix ® 800 , may be employed for the waistband adjustment and / or rise adjustments as is described more thoroughly below . fig6 is an enlarged view of left arcuate side margin 15 that , when in the worn state , substantially surrounds a left leg opening of diaper 10 . as shown , gussets 22 ( 2 ) and 24 ( 2 ) provide a double gusset which confronts a wearer &# 39 ; s leg . this double gusset arrangement provides for both the primary containment region 32 and the auxiliary containment region 34 ( 2 ). accordingly , the double gusset arrangement provided herein provides an added measure of containment in that if liquid and / or solid waste escapes from containment region 32 past gusset 24 ( 2 ), gusset 22 ( 2 ) will retain such spills in auxiliary containment region 34 ( 2 ). with initial reference to fig7 , a method for making a reusable diaper with double gussets is provided . interior panel 20 is made from a micro - chamois material having an overall length of approximately 19 . 5 inches and an overall width of 15 . 75 inches while the provided size is for typically babies or toddlers , the diaper may be sized accordingly for smaller babies , e . g ., premature , older children , or even adults . interior panel 20 may be prepared as shown in fig7 by marking the cuts and then cutting out the shapes and openings . this may be facilitated by a pattern template similar to that shown in fig7 . throughout the description of the methods , the side of each piece that faces the interior 28 of the diaper is referred to as the wrong or rough side . conversely , the side of each piece that is opposite the interior 28 of diaper 10 is referred to as the right or finish side of the material . viewing interior panel 20 from the rough side , as shown in fig7 , the construction of the inner gussets 24 ( 1 ) and 24 ( 2 ) is described . elongate elastic members 25 ( 1 ) and 25 ( 2 ) are sewn to the interior panel . elastic members 25 ( 1 ) and 25 ( 2 ) comprise ⅛ inch elastic and have a length of approximately 5 . 5 inches when in the relaxed state although other sizes of elastic are usable . starting at the end closest to waistband portion 14 , the elastic members are tacked down using a forward and backward straight stitch to secure the elastic to the fabric . while the below descriptions are generally with relation to stitching , and in some cases specific stitches , one of ordinary skill in the art will recognize on reading the disclosure that other stitches may be used . also , instead of stitching , connections may be made using adhesives , glues , tapes , welds , or the like . as an example , elastic piece 25 ( 1 ) is attached to the inner surface by zigzagging the stitch along the length of the elastic . ideally , the stitch is just wide enough to zigzag over the elastic and catch on each side . the elastic is stretched as it is stitched into place resulting in a finished length of approximately 13 inches . at the end of the elastic member , a straight stitch is used to tack down the end of the elastic with forward and backward stitches . elastic member 25 ( 2 ) is attached to interior panel 20 in substantially the same manner . next , each elastic member 25 ( 1 ) and 25 ( 2 ) is sewn into a channel 27 ( 1 ) and 27 ( 2 ) respectively . for instance , the wrong sides of the fabric are folded together using elastic member 25 ( 1 ) as a fold line to form a channel in which the elastic resides . once folded , stitch guides 60 ( 1 ) and 60 ( 2 ) will overlap each other . similarly , stitch guides 62 ( 1 ) and 62 ( 2 ) will overlap . starting at the end closest to the rear waistband portion 14 , stitching is sewn along the full length of the elastic along stitch lines 60 ( 1 ) and 60 ( 2 ). a straight stitch is also sewn along stitch guides 62 ( 1 ) and 62 ( 2 ), which is ¼ inch out from the stitch guides 60 ( 1 ) and 60 ( 2 ). channel 27 ( 2 ) is formed around elastic member 25 ( 2 ) in substantially the same way as described with respect to channel 27 ( 1 ) above . stretch tabs 52 and 54 are attached to interior panel 20 by placing the finish side of interior panel 20 facing up ( opposite that shown in fig7 ) and the finish side of tab 52 down against the finish side of interior panel 20 . the ends of the materials are serged together along seam lines 64 ( 1 ) and 64 ( 2 ), which are aligned with each other . the attachment procedure for tab 54 is substantially the same as that for tab 52 . with the finish side of interior panel 20 facing up ( opposite that shown in fig7 ), pocket opening reinforcement piece 36 is placed finish side down . reinforcement piece 36 is approximately 1 . 5 . times . 8 inches of micro - chamois and includes a cut that lines up with cut 37 . a straight stitch is sewn ⅛ inch from cut 37 around the full perimeter of the cut . the finish side of the interior panel 20 is placed down and the reinforcement piece 36 is pulled through cut 37 . reinforcement piece 36 is then top stitched to the rough side of interior panel 20 . reinforcement piece 36 is sewn around its perimeter at approximately ⅛ inches from the edge . elastic member 29 is encased between the reinforcement piece and interior panel 20 . each end of elastic member 29 is tacked down as the reinforcement piece is top stitched . elastic piece 29 is ⅛ inch elastic and is approximately 3 . 5 inches long in the relaxed state . once fully stretched , elastic piece 29 should be approximately 7 inches long corresponding to the length of cut 37 . referring now to fig8 , preparation and attachment of the exterior panel 40 is discussed . exterior panel 40 is comprised of polyurethane laminate material ( pul ). the exterior panel is shown in fig8 with the finish side up . initially , both the stud and socket snap fasteners of patterns 44 , 46 , and 48 are attached to the finish side of the exterior panel 40 . stretch tabs 51 and 53 are attached to exterior panel 40 in substantially the same way as tabs 52 and 54 were attached to interior panel 20 , as described above . exterior panel 40 is placed with the finish side of the fabric up as shown in fig8 and interior panel 20 is placed directly on top with the rough side of the fabric up as shown in fig7 . at this point , the finish sides of both panels are touching . the full perimeter of the diaper is serged together . as the perimeter of the diaper is serged together , the tip of elastic piece 42 is attached at point “ a .” the remaining free end of elastic piece 42 is attached at point “ b .” at point “ c ”, the tip of elastic piece 23 ( 1 ) is attached . the remaining free end of elastic piece 23 ( 1 ) is attached at point “ d .” the tip of elastic piece 23 ( 2 ) is attached at point “ e ” and the remaining free end of elastic piece 23 ( 2 ) is attached at point “ f ”, just before the diaper body meets the bottom of stretch tab 16 . elastic pieces 42 , 23 ( 1 ), and 23 ( 2 ) are each made from ¼ inch elastic that is 5 . 5 inches long when in the relaxed state . after the diaper is serged together , the diaper will be inside out . the diaper is turned right side out by pulling it through the pocket hole opening 26 . the perimeter of the diaper is then top stitched clockwise along the rear waistband portion 14 , stitching in ½ inch from the edge of the diaper . the elastic member 42 should be between the needle and the edge of the diaper . this creates a “ channel ” for the elastic to run in and gather the fabric around it . except for portions of the perimeter that contain elastic , the perimeter is top stitched approximately ⅛ inches in from the edge of the diaper . where elastic is encased , the perimeter is sewn approximately ½ inches in from edge of the diaper , thus , creating a “ channel ” for each elastic member . with the inside or interior panel of the diaper facing up ( the micro - chamois ), 2 studs 43 ( 1 )- 43 ( 4 ) are attached to both the right 16 and the left 18 stretch tabs with the studs facing up and their caps facing down . with the inside of the diaper facing down ( the micro - chamois ), and using the guide line provided in the pattern template for placement , 2 sockets 47 ( 1 ) and 47 ( 2 ) are attached to the left stretch tab 18 with the sockets facing up and the caps facing down . in an alternate construction , the waistband fasteners of pattern 44 are replaced with hook and loop style fasteners . in this case , the diaper is constructed similarly to that as described above . however , exterior panel 140 shown in fig9 , includes a strip of loop material in place of pattern 44 . also , tabs 16 and 18 are formed of spandex tabs 151 and 153 , which have a rounded configuration . tabs 16 and 18 each include one hook and one loop piece . each hook and loop piece is die cut to 1 . times . 1 . 5 inches . with exterior panel 140 facing up , the loop pieces are facing up and the hook pieces are facing down . accordingly , each stretch tab is sandwiched between hook and loop die cut pieces . in this construction , the finish side of the interior panel includes a pair of laundry tabs 155 ( 1 ) and 155 ( 2 ). laundry tabs 155 ( 1 ) and 155 ( 2 ) are die cut loop pieces attached to the finish side of the interior panel as shown in fig7 . the laundry tabs provide a means to secure the hook material on the stretch tabs thereby preventing the hook material from snagging the soft micro - chamois material of the interior panel during washing . accordingly , the double gusset cloth diaper has been described with some degree of particularity directed to the exemplary embodiment . it should be appreciated , though , that the double gusset cloth diaper is defined by the following claims construed in light of the prior art so that modifications or changes may be made to the exemplary embodiment without departing from the inventive concepts contained herein . | 0 |
reference now will be made in detail to the presently preferred embodiments of the invention , one or more examples of which are illustrated in the accompanying drawings . each example is provided by way of explanation of the invention , which is not restricted to the specifics of the examples . in fact , it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention . for instance , features illustrated or described as part of one embodiment , can be used on another embodiment to yield a still further embodiment . thus , it is intended that the present invention cover such modifications and variations as come within the scope of the appended claims and their equivalents . referring to fig2 a radio receiver circuit 20 is shown comprising , in series between an rf input 21 and an rf output 22 , a matching circuit 23 , a controllable attenuator circuit 24 and a low - noise amplifier ( lna ) 25 . the attenuator circuit 24 and the lna 25 may be integrated onto a single chip , whereas the matching circuit 23 may be external . an input 26 of the attenuator circuit 24 is biased by connection to a voltage source vr via a high value first resistor 27 . a bypass n - type field - effect transistor 28 is connected between the input 26 and an output 29 of the attenuator 24 via a first capacitor 30 . the capacitor 30 allows the lna 25 and the attenuator 24 to be biased independently . a second capacitor 31 and a second resistor 32 are connected in series between the attenuator input 26 and the first capacitor 30 . a first grounding transistor 33 is connected between a node formed at the connection of the second resistor 32 and the first capacitor 30 and ground potential via a third resistor 34 . the impedance of the second capacitor 31 is approximately equal to the value of the imaginary part of the input impedance of the lna 25 . the capacitance of the first capacitor 30 is preferably much higher than the capacitance of the second capacitor 31 . the sum of the resistances of the second resistor 32 and the third resistor 33 is approximately equal to the real part of the input impedance of the lna 25 . operation of the attenuator circuit 24 is as follows . when no attenuation is required , control signal x 2 , applied to the gate electrode of the grounding transistor 33 , is low and signal x 1 , applied to the gate electrode of the bypass transistor 28 , is high . this switches the grounding transistor 33 off , isolating the output 29 from ground , and switches the bypass transistor 28 on , which connects the input 26 to the output bypassing the second resistor 32 . if the bypass transistor 28 is wide , the parasitic capacitance of its source and drain shunts the input signal and makes it susceptible to substrate noise . if it is narrow , however , its series resistance is high , which generates noise . the width of the bypass transistor 28 is selected as a compromise depending on the receiver with which it is used . when attenuation is required , x 1 goes low and x 2 goes high . this switches the bypass transistor 28 off , resulting in the second resistor 32 becoming active insofar as it then attenuates signals received at the input . the grounding transistor 33 is switched on , which shunts part of the signal received at the input 26 to ground . in this condition , the value of attenuation provided is determined by the resistance of the second resistor 32 and by the ratio of the resistance of the second resistor to the resistance of the third resistor 34 . the input impedance of the attenuator 24 is approximately the same regardless of whether or not the attenuator 24 is controlled to attenuate . the attenuator 24 has two states , on and off . an attenuator having three states is shown in fig3 . referring to fig3 a radio receiver 40 is shown , with reference numerals retained from the fig2 radio receiver for like elements . interposed between the second resistor 32 and the first capacitor 30 is a first series transistor 41 , which has its gate electrode connected to receive the signal x 2 . a fourth resistor 42 and a second series transistor 43 are connected in series between the second capacitor 31 and the first capacitor 30 . a second grounding transistor 44 is connected between a node formed at the junction of the first and second series transistors 41 , 43 and the first capacitor 30 and ground potential via a fifth resistor 45 . the second series transistor 43 and the second grounding transistor 44 commonly receive a control signal x 3 at their gate electrodes . with the fig3 arrangement , when signal x 2 is high , the first series transistor 41 is switched on and the first grounding transistor is switched on . when signal x 2 is high , signals x 1 and x 3 are low . in this condition , the resistors 32 and 34 determine the amount of attenuation provided . as with the fig2 arrangement , the sum of the resistances of these resistors 32 , 34 is preferably approximately equal to the real part of the input impedance of the lna 25 . the sum of the resistances of the resistors 42 and 45 is also preferably approximately equal to the real part of the input impedance of the lna 25 . however , the values of these resistors are different than the values of the resistors 32 and 34 . in this way , provision of a high signal x 3 and low signals x 1 and x 2 , which results in the resistor 42 being active in the path between the input and the output , results in a different degree of attenuation yet the input impedance of the attenuator 24 is substantially unchanged . when no attenuation is required , a high signal x 1 and low signals x 2 and x 3 are provided . the fig3 attenuator thus provides three different levels of attenuation . further levels may be provided by including still further stages , as will be appreciated by those skilled in the art . if a high level of attenuation is required by one such stage , the grounding transistor of that stage may be connected directly to ground , i . e ., its resistor may be omitted . attenuators having two or more attenuation levels may be described as programmable , controllable or switchable . in certain circumstances , the bias voltage vr can be set to zero volts , or ground , which allows the attenuator 24 to be used without a dc current supply in any operating state . the noise figure of a circuit constructed with the attenuator 24 may be improved through the use of capacitors which are shielded from the substrate on which they are formed . although the embodiments disclosed herein use field - effect transistors , it should be appreciated that the invention may also be implemented using bipolar transistors or other appropriately configured transistor elements . while at least one presently preferred embodiment of the invention has been described using specific terms , such description is for illustrative purposes only , and it is to be understood that changes and variations may be made without departing from the spirit or scope of the following claims . | 7 |
while the following discussion is directed to a split keyboard system having two keyboards associated with a common host computer , it is to be understood that the principles of the present invention can be readily applied to system having more than two split keyboards , and can be applied to other communication systems . it should be appreciated that in fig1 - 3 , the split keyboards are depicted as unconnected blocks to emphasize their independent nature . in implementation , the keyboards would typically be mechanically connected . fig1 shows a block diagram of a first embodiment of a system according to the present invention . according to this embodiment , split keyboards 10a and 10b are peers which simultaneously and independently communicate with a common host electronic device 12 via , e . g ., a wireless infra - red protocol . the keyboards 10a and 10b can transmit key code data to the electronic device using the same carrier frequency or different carrier frequencies . the device 12 includes a receiving means , such as one or more receive buffers , and determines the proper sequence of asynchronous key codes as they are sent to the receive buffer ( s ) in a manner to be described in more detail below . no modifications to the existing receiver hardware are necessary ; the receiver in the device 12 simply receives each byte of data as it is transmitted by the keyboards and stores the received bytes in the one or more receive buffers . while not necessary , it may be desirable to increase the size and / or number of the receive buffers in the device 12 or to service the receive buffers more frequently . this is because the average rate at which the electronic device receives data from the keyboards 10a and 10b will be similar to the normal transmission rate of a single keyboard , but the transmission rate of the split keyboards 10a and 10b ( each transmitting at the normal rate ) is theoretically higher than the normal transmission rate . therefore , it may be desirable to increase the size , number , or servicing rate of the receive buffer in order to prevent buffer overflow errors . it will be appreciated that the embodiment of fig1 presumes that the two wireless keyboards 10a and 10b will rarely , if ever , transmit data to the device 12 simultaneously . if the keyboards 10a and 10b do transmit simultaneously , the device 12 will either detect an error condition and ignore the data , or misinterpret the data as a keystroke which was not intended by the user ( s ) of the keyboards 10a and 10b . some form of error correction coding ( e . g ., even / odd parity bits , checksum bits , and / or stop bits ) can be used in the communication protocol to allow the receiver to detect and correct errors ( e . g ., invalid keyboard codes , etc .). alternatively , the split keyboards 10a and 10b can be peers which monitor each other to determine ( by , e . g ., detecting whether a carrier frequency is present ) whether the other is transmitting data to the host device 12 . for example , if a user of keyboard 10a attempts to transmit data to the device 12 , keyboard 10a will first determine if keyboard 10b is transmitting data to the device 12 . if keyboard 10b is transmitting data to the device 12 , keyboard 10a will wait until the transmission from keyboard 10b stops . if keyboard 10b is not transmitting data to the device 12 , then keyboard 10a will transmit its data to the device 12 . keyboard 10b ( and all other split keyboards , if more than two split keyboards exist in the system ) follows the same protocol . fig2 shows a second embodiment of a split keyboard system according to the present invention . in this second embodiment , the split keyboards are each assigned a priority level . for purposes of explanation , it will be assumed that keyboard 10a is the higher - priority keyboard and keyboard 10b is the lower - priority keyboard . based on these assumptions , the higher - priority keyboard 10a can transmit data to the device 12 asynchronously at any time the user of higher - priority keyboard 10a desires to transmit data . the data is received in the one or more receive buffers of device 12 at a predetermined rate . the lower - priority keyboard 10b can transmit data to the device 12 only when the higher - priority keyboard 10a is not transmitting data to the device 12 . accordingly , prior to transmitting data to the device 12 , the lower - priority keyboard 10b detects whether the higher - priority keyboard &# 39 ; s carrier frequency is present and if so , the lower - priority keyboard 10b will inhibit the transmission of its data and store the inhibited data in a buffer until the higher - priority keyboard &# 39 ; s carrier frequency is no longer present , at which time the buffered data will be transmitted to the device 12 . preferably , the higher - priority keyboard 10a and the lower - priority keyboard 10b only transmit a carrier frequency when they are sending data . the lower - priority keyboard 10b can transmit data at a different predetermined rate , and may transmit data on the same or a different carrier frequency as the higher - priority keyboard 10a . fig3 shows a third embodiment of the present invention . in this embodiment , the lower - priority keyboard 10b transmits data to the higher - priority keyboard 10a rather than directly to the electronic device 12 . the higher - priority keyboard 10a receives the data from the lower - priority keyboard 10b , stores the data in a buffer , synchronizes the data with its own data , and transmits the synchronized data to the device 12 . this embodiment is particularly beneficial in that the infrared power consumption of the lower - priority keyboard 10b is significantly reduced , since it need only transmit data over a much shorter distance than the higher - priority keyboard must transmit . regardless of whether the split keyboards are peers or have an assigned priority level , the data signals transmitted from the keyboards must be reliably combined and organized for processing by the host electronic device 12 . this requirement holds regardless of whether the signals are combined at a higher - priority keyboard or at the device 12 . accordingly , an exemplary embodiment of a method for combining signals from multiple keyboards will now be described . most keyboard protocols include scan codes known as &# 34 ; make &# 34 ; and &# 34 ; break &# 34 ;. the make code is typically a single byte and is transmitted by the keyboard when a key is depressed . a break code is typically two or more bytes and is sent when a key is released . if the break code is interrupted , the device will not receive a complete break code and errors will result . because the reception of a complete break code is so important , break codes are typically only two bytes in length and the first byte is typically the same for all break codes . according to an aspect of the present invention , if the device 12 detects that a break code is being sent from one keyboard , the device 12 will then store any other data received from any other keyboard until the device receives the complete break code sequence from the first keyboard . once the complete break code sequence is received , the stored data can be sent to the device 12 ( if the synchronization of data from multiple keyboards is performed in a keyboard ) or processed by the device 12 ( if the synchronization takes place in the device itself ). this break code procedure can be better explained by the following examples , in which a first key has a make code of 2d and a break code of f0 2d , while a second key has a make code of 54 and a break code of f0 54 . the first example assumes that the following codes are transmitted in the following order : the device performing the synchronization receives the following codes ( in order ): 2d ( from 10a ), 54 ( from 10b ), f0 ( from 10a ), f0 ( from 10b ), 2d ( from 10a ) and 54 ( from 10b ). once the device receives f0 ( from 10a ), it realizes that keyboard 10a has initiated the break code , but the break code was interrupted by the f0 from keyboard 10b . accordingly , the device stores the first f0 ( from 10a ) in a transmit buffer , stores the second f0 ( from 10b ) in another buffer , stores the next code from keyboard 10a ( in this case , 2d ) in the transmit buffer , and then transfers the stored data from the other buffer ( here , the f0 from 10b ) to the transmit buffer such that the final sequence transmitted to or processed by the device 12 is : 2d , 54 , f0 , 2d , f0 , 54 . in this example , the code &# 34 ; 54 &# 34 ; ( first occurrence ) from keyboard 10b is stored in the second buffer as described above with respect to the first example , and the final sequence transmitted to or processed by the device 12 is : 2d , f0 , 2d , 54 , f0 , 54 . if the synchronization is not properly performed in this example , the device 12 may match the first &# 34 ; 54 &# 34 ; from keyboard 10b with the &# 34 ; f0 &# 34 ; from keyboard 10a , which would be an erroneous break code for the key depressed on keyboard 10a . fig4 a - b are flow charts describing first and second portions of a synchronization procedure according to the present invention in detail . this synchronization procedure can be implemented by a synchronization means present within a keyboard or the device 12 , and ensures that data code bytes from each of the split keyboards remain intact for transmission to , or processing by , the device 12 . in fig4 a , the synchronization means determines in step 100 whether a new data byte has been received . if no new data byte has been received , the process returns to step 100 . if a new data byte has been received , the process continues in step 102 , where the synchronization means determines if the received byte is the first part of a multi - part code . if the received byte is the first part of a code , then the byte and its associated port number ( i . e ., identifier assigned to the keyboard which transmitted the byte ) is stored in a temporary buffer in step 103 , and the process returns to step 100 . alternatively , if the received byte is not the first part of a multi - part code , the method proceeds to step 104 , where the synchronizing means determines whether the temporary buffer is empty . if the temporary buffer is empty , then the synchronization means determines whether the received byte is a valid data code by itself in step 106 . if the byte represents a valid data code , the code is transmitted to the receiver in step 108 ( i . e ., is transmitted to the device 12 if the synchronization is performed in a keyboard or is processed by the device 12 if the synchronization is performed in the device 12 ), and then the process returns to step 100 . if the temporary buffer is determined to be not empty ( step 104 ) and the received byte is not a valid data code by itself ( step 106 ), then the byte ( with associated port number ) is stored in the temporary buffer in step 110 . new bytes are preferably added to the end of the temporary buffer in order to maintain correct chronological sequence . after a byte which is not the first part of a code and not a valid code by itself is stored in the temporary buffer , the synchronization means performs a scanning operation of the temporary buffer in step 112 . the scanning operation will be described in more detail with respect to the flow chart of fig4 b . fig4 b is a flow chart describing a second portion of the synchronization process , the temporary buffer scanning operation . this operation begins in step 114 , which starts the scanning of the temporary buffer at the beginning of the buffer . in step 116 , the byte value contained in the buffer is read . in step 118 , the synchronization means initiates a &# 34 ; current code &# 34 ; set to the value of the first byte in the buffer . the current code is a memory space in which a complete keyboard code is reconstructed one byte at a time . in step 120 , the synchronization means determines whether the current code is a valid code . if the code is valid , it is transmitted / processed in step 122 , the buffer is cleared in step 124 , and the scanning operation ends , returning the process to step 100 ( fig4 a ). if the code is not valid , the byte is added to the current code in a memory space in step 126 , and the synchronization means scans the temporary buffer for the next byte having the same port identifier in step 128 . if the end of the temporary buffer is reached in step 130 without finding a data byte having the same port identifier , then the synchronization means determines that a complete code has not been received in step 132 , clears the current code sequence in step 134 , advances to the next location in the temporary buffer in step 136 ( i . e ., assuming the data byte read in step 116 was the first data byte in the temporary buffer , step 136 returns the process to the second data byte in the temporary buffer ), and the process exits or returns to step 116 . if a data byte having the same port identifier is reached before the end of the temporary buffer is reached as determined in step 130 , the synchronization means takes this next byte value having the same port identifier as the previous byte in step 138 , and adds this byte value to the end of the current code in step 140 . the process then returns to step 120 to determine whether the current code is a valid code . it should be appreciated that although the embodiments described above assume a wireless connection between the split keyboards 10a and 10b , the schemes of the present invention can be implemented using a wired link between the split keyboards . in a wired implementation , an asynchronous data protocol can be used to communicate over the wireline connection . the higher - priority keyboard can combine the serial outputs of the matrix keyboard decoding circuits and then communicate serially with the device 12 by standard infrared or wired protocols for serial asynchronous data . while the foregoing description includes numerous details and specificities , it is to be understood that these are for purposes of explanation only . many modifications will be readily apparent to those of ordinary skill in the art which are clearly within the spirit and scope of the invention , as defined by the following claims and their legal equivalents . | 6 |
with reference to the figures , a panel fastener 10 in accordance with this invention comprises an active member 12 and a passive member 14 . the active member is attached to a wall panel 16 and the passive member 14 is attached to an independent wall panel 18 . in the exemplary embodiment of the figures , the wall panels 16 , 18 are of the insulated type suitable for a cooler unit and comprise an insulating material 20 enclosed between rigid outer skins , for example , of metal . the panel fastener members 12 , 14 are enclosed within and anchored to the insulating material 20 . the end surfaces 26 , 28 of the wall panels 16 , 18 are contoured for mating when the adjacent panels are moved together in the direction as indicated by the arrows 30 in fig2 . the active member 12 of the panel fastener 10 in accordance with this invention includes a pair of casings 32 , 34 joined together to provide a hollow compartment 36 isolated from the insulating material 20 . the casings 32 , 34 extend beyond the compartment 36 and are turned outwardly and back to form an anchor 38 in the insulating material which resists forces , which as explained more fully hereinafter , tend to pull the active member out of the insulating material 20 through the end surface 26 . it should be appreciated that all external surfaces of the members 12 , 14 in the panel fastener 10 in accordance with this invention aid in resisting forces tending to separate the members 12 , 14 from the insulating material 20 . a crank shaft 40 extends from the hollow compartment 36 through an opening 42 in the casing 34 . a hollow shield 44 engages a circular groove 46 around the crank shaft 40 and extends outwardly to terminate beneath but substantially flush with the outer skin 22 . an opening 48 in the skin 22 provides access to the interior of the hollow shield 44 and to the end of the crankshaft 40 , which , as best seen in fig3 - 7 includes a hexagonal socket 50 . attachment of the shield 44 to the casing 34 prior to foaming in place , assures free access to the crank shaft 40 excepting perhaps a very thin layer of insulating material 20 which is easily penetrated between the end of the hollow shield 44 and the outer skin 22 . the end 52 of the crank shaft 40 is rotatably seated in an opening 54 in the casing 32 . a crank 56 is fixedly attached to the crank shaft 40 for rotation therewith . a hook member 58 includes an extended arm 60 having at one end a hook 62 and at the other end an enlarged portion 64 including an internal opening 65 having its periphery contoured to form a cam surface 66 . the crank shaft 40 extends transversely through the internal opening 65 of the hook member 58 . as seen in fig3 - 6 , a pin 68 fixedly attached to the crank 56 extends through the opening 65 and rides on the internal cam surface 66 . as explained more fully hereinafter , when the crank shaft 40 is rotated , the pin 68 presses against the cam surface 66 causing the hook member 58 to pivot . a pin 70 fixedly attached to the hook member 58 at a position opposite from the hook 62 extends transversely to engage in a cam surface 72 formed in the casing 34 . the cam surface 72 is in two portions , a circular portion 73 concentric with the rotating axis 41 of the crank shaft 40 . the circular portion 73 of the cam surface 72 joins a linear portion 74 extending transversely away from the end surface 26 of the wall panel 16 ( fig3 ). a crank backplate 76 is fixedly positioned on the crank shaft 40 for rotation therewith by means of a key 78 engaging a rectangular notch 80 in the backplate 76 . accordingly , the hook member 58 is sandwiched between the crank 56 and the crank backplate 76 . the crank 56 and the backplate 76 bear on the casings 32 , 34 respectively , thereby substantially centering the hook member 58 between the casings 32 , 34 . casings 82 , 84 in the wall panel 18 are joined together leaving a hollow compartment or housing 86 open at the interface surface 28 and having an anchor 88 similar to the anchor 38 in the panel 16 for the same purpose of retention within the insulating material 20 against forces which tend to extract the passive member 14 . a lock pin 90 connects between the two opposed casings 82 , 84 . the pin 90 is located at an elevation ( fig3 ) within the passive member 14 such that when the members 12 , 14 are opposed at the interface 26 , 28 of wall panels to be connected , there is a horizontal alignment between the pin 90 and the rotating axis 41 of the crank shaft 40 . it should also be noted in fig3 that there is sufficient height in the housing 86 to permit the hook member 58 to pivot and extend across the interface 26 , 28 to engage the lock pin 90 , as explained more fully hereinafter . it should also be noted that there is substantial horizontal alignment between the lock pin 90 , the rotating axis 41 of the crank shaft 40 and the linear portion 74 of the cam surface 72 . joining and fastening of two panels using the panel fastener 10 in accordance with this invention , is now described . with the hook member 58 in the vertical position as shown in fig1 - 3 , that is , withdrawn between the casings 32 , 34 of the active member 12 , the wall panels 16 , 18 to be fastened together are moved into abutting contact . this motion is indicated by the arrows 30 in fig2 . the wall panel 16 in the figures is shown with a compressible gasket 92 . the members 12 , 14 of the panel fastener 10 have been foamed in - place in the wall panels 16 , 18 at equal heights so that when the wall panels 16 , 18 are moved together the opened compartments or housings 36 , 86 have their openings opposed one to the other . then a key or wrench 94 , having a hexagonal cross section , is inserted into the hexagonal socket 50 of the crank shaft 40 passing through the opening 48 in the outer skin 22 and through the hollow shield 44 . it should be noted that the cam surface 66 in the hook member 58 is in the shape of an asymmetrical heart with the crank pin 68 constrained from above ( fig3 ) by the cam contour 66 whereby the hook member 58 cannot pivot in a clockwise direction unless the crank 56 and crank shaft 40 are also rotated . further , the pin 70 on the hook member 58 is located at the extreme end of the cam surface 72 such that the hook member 58 cannot readily turn in a counter - clockwise direction ( fig3 ). after the key or wrench 94 is inserted in the crank shaft 40 , the wrench 94 is rotated in a clockwise direction . as shown in fig4 the hook member 58 moves in a clockwise direction in substantially rotational motion . the hook member 58 is driven by the crank pin 68 which remains nested within the contours of the cam surface 66 as described above . the pin 70 , attached to the hook member 58 moves along the circular portion 73 of the cam surface 72 formed in the casing 34 . the pin 70 moves without interference because , as stated above , the circular portion 73 of the cam surface is concentric with the axis of rotation 41 of the crank shaft 40 . during this clockwise rotation of the hook member 58 , the hooked end 62 extends across the interface 26 , 28 between the panel 16 , 18 , into the open housing 86 with the hook extending above and beyond the pin 90 as shown in the broken lines of fig4 . the rotary motion continues until the inner surface 96 rests on top of the pin 90 . as the key or wrench 94 is further turned in a clockwise direction , the arm 60 of the hook , unable to move downwardly because of its obstruction by the pin 90 , moves horizontally in the direction indicated by the arrow 98 ( fig5 ) with the pin 70 on the hook member 58 moving within the confines of the horizontal linear portion 74 of the cam surface 72 . in the process , the gasket material 92 is compressed ( fig6 ) and the wall panels 16 , 18 abutt at the interface 26 , 28 . protrusions 106 extend inwardly into the housing 86 from the casings 82 , 84 . as best seen in fig4 and 5 , the extreme end of the moving hook member 58 slides between the protrusions 106 such that the hook member 58 is substantially centered between the casings 82 , 84 ( fig6 ). when lateral misalignment exists between the panels 16 , 18 prior to joining , the increasd width at the entrance to the housing 86 at the interface surface 28 allows for entrance of the hook member 58 . the protrusions 106 then guide the hook member 58 to a centered position thereby laterally aligning the panel in the process . as best seen in fig7 the horizontal linear portion 74 of the cam surface 74 has a height which is substantially greater than the diameter of the pin 70 . thus , even when the panels 16 , 18 are vertically misaligned at the interface 26 , 28 , the pin 70 nevertheless enters the horizontal portion 74 of the cam surface 72 . the panels are drawn together and in the process are vertically aligned . as the panels are drawn together by continued clockwise rotation of the key or wrench 94 , the crank pin 68 moves upwardly along the cam surface 66 and achieves a position substantially in line with the pins 70 , 90 and the crank shaft 40 ( fig5 ). it is also possible to have the final position of the crank pin 68 above ( fig5 ) the axis of rotation 41 of the crank 56 thereby providing an over - center condition rather than a dead - center condition as illustrated in fig5 . with the gasket material 92 under compression at the interface , a force tending to drive the panels 16 , 18 apart in a direction opposite from the arrows 98 , may exist . this causes the pin 90 to push on the hook 62 in the direction of the arrow 100 . however , the dead - center condition of the crank pin 68 and the pin 70 relative to the axis of rotation 41 of the shaft prevents motion which would allow the fastener to release unintentionally . in an overcenter condition ( not shown ) of the crank pin 68 the compressive forces on the gasket material 92 would act to prevent the unintentional release of the panel members . the panels can be released by turning the key or wrench 94 in a counter - clockwise direction as would be seen in the fig1 - 6 . disengagement then proceeds in a reverse sequence with the hook member 58 moving in the horizontal direction opposite to the arrow 98 , thereby allowing the panels 16 , 18 to move apart . then , the hook member 58 pivots and rotates in a compound motion counter - clockwise and returns to the condition shown in fig3 . the procedures of fastening and disengaging the panels can be repeated without damage to the panel fastener or to the panels themselves . it is not necessary to tilt either panel to assure that the hook 62 will pass around the pin 90 for engagement . a dimple 102 in the circular portion 73 of the cam opening 72 provides a minor obstruction which further assures that the pin 70 is retained in the position shown in fig3 during shipment of a panel 16 . however , when the crank 56 rotates , the pin 70 easily rides over the dimple 102 . other indents and protrusions 104 serve various functions which are not a novel portion of this invention , and accordingly , require no description herein . for example , these indents and protrusions may be used to position the fastener members 12 , 14 between the outer skins 21 - 24 prior to foaming in - place . they also serve in anchoring the members 12 , 14 within the foam material 20 . it should be noted that small amounts of foam within the compartments or housings 36 , 86 are easily broken through by the motion of the crank and hook member and no clean - out is required . also , should foam obstruct the entrance to the hollow shield 44 , there is no need for cleaning as this thin foam barrier is readily penetrated by insertion of the key or wrench 94 . the compound motions produced by means of the two cams and followers reduces friction and wear on the internal components and substantially extends the life of the panel fastener in accordance with the invention . as previously stated , the joint between the panel members can be repeatedly opened and closed without damage to the fastener or the wall members . it is not necessary to tilt either panel in these processes . the fastened position ( fig5 ) of the pin 68 against the cam surface 66 is the limit of compression on the interface surface . the panels cannot be damaged by excessive torque on the wrench 94 . it should be readily understood that the members 12 , 14 in alternative embodiments may be located on the outside surfaces of the panels and not buried within the core materials . in such embodiments , the anchors 38 , 88 are unnecessary and any suitable fastener , for example , screw fasteners , may be used to hold the members to the wall panels . also , it should be readily understood that the interface between the wall panels need not be as illustrated in fig2 but may be , for example , entirely planar , curved , etc . it should also be understood that in an alternative embodiment in accordance with this invention , the hook 62 and lock pin 90 can be replaced with a t - shaped yoke at the end of the hook member 58 and a receptacle in the passive member 14 . in effect , the pin may become a transverse portion of the hook member 58 which is received in a notch , socket or other receptacle in the passive member . further , it should be understood that in alternative embodiments in accordance with this invention , the positions of the pins 68 , 70 and the cam surfaces 66 , 72 can be reversed . that is , a pin corresponding to pin 68 can be fixedly attached to the hook member 58 and extend through an opening and engage a cam surface which is part of the crank 56 . similarly , a pin corresponding to the pin 70 can be attached to and extend from the housing 34 and engage a cam surface formed in the enlarged portion 64 of the hook member 58 . the cam surfaces may be contoured to produce the same compound motions as previously described . it will thus be seen that the objects set forth above , among those made apparent from the preceding description , are efficiently attained and , since certain changes may be made in the above constructions without departing from the spirit and scope of the invention , it is intended that all matter contained in the above description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described and all statements of the scope of the invention which , as a matter of language , might be said to fall therebetween . | 8 |
in a variable dividing circuit according to the present invention , each stage of a shift register is configured by a high - speed d - type flip - flop , and selecting one output , the flip - flop is reset or preset by the selected signal , so that it is preferable that a high - speed element is used for a selector and a switch as a selecting means . the embodiments of the present invention will be described below with reference to the drawings . each drawing schematically illustrates the present invention to a degree that the present invention can be appreciated , and the present invention is not limited only to the examples shown in the drawings . in addition , to the components having common elements and the same functions through the drawings , the same reference numerals are given , and duplicate explanation is omitted . fig1 is a circuit diagram of a variable dividing circuit according to a first embodiment , and a shift register circuit is configured in such a manner that plural stages of d - type flip - flops with a synchronization reset function ( d 11 , d 12 , . . . , d 1 n ) are arranged , a fixed input signal 10 at a h level ( or at a l level ) is inputted in an input of a flip - flop d 11 at a first stage , and hereinafter , the output of the flip - flop at the former step is made the input of the flip - flop at the next stage . in addition , the output of the flip - flop at each stage is connected to each input terminal of a multiplexer ( mux ) 12 . then , by making any one signal of input signals s 11 , s 12 , . . . , s 1 n connected to an input terminal of a selected signal effective , one signal is selected and outputted ( a signal out ). this signal is feed - backed to a reset terminal of each flip - flop and is synchronized with a clock signal ( clk ) so as to reset each flip - flop . by the way , according to the above - described example , it is described that the shift register is configured by the d - type flip - flops with the reset function , however , it is possible to configure the shift register by using the d - type flip - flops with a synchronization preset function , a l level is inputted in the input signal at the first stage , and its out signal is feed - backed to a preset input terminal of the flip - flop at each stage ( see a later - described timing chart ( fig4 )). the operation of the variable dividing circuit in the case that the shift register is configured by the d - type flip - flops with the reset function will be described in detail below . as shown in fig3 , when the input data of the first stage of the shift register is set at a h level , an output n 11 of the flip - flop at the first stage becomes the h level at a leading edge of a first clock signal , at the leading edge of the next clock , an output n 12 of the flip - flop at the second stage is changed into the h level , and at the leading edge of the third clock , an output n 13 of the flip - flop at the third stage is changed into the h level . in this case , if the selected signal of the multiplexer ( mux ) as the selecting means of the output signal of the flip - flop at each stage is set at s 13 , at a time when the output signal n 13 of the flip - flop at the third stage is changed into the h level , the signal of a node n 13 is outputted to an output out . since this signal is connected to a synchronization reset terminal of each flip - flop , at the leading edge of the next clock , the output of the flip - flop at each stage is initialized from the h level into the l level . further , if the next clock signal is inputted , at the leading edge thereof , the output n 11 of the flip - flop at the first stage is made the h level , and hereinafter , the same operation is repeated . thereby , in this case , a clock of a fourfold period of an original clock ( clk ) signal is outputted , and the original clock is divided into four . as being obvious from the above description , in the variable dividing circuit according to the present embodiment , by arbitrarily setting the selected signal of the multiplexer as the selecting means of the output signal of each flip - flop ( setting one signal among a plurality of selected signals effective ), it is possible to configure the variable dividing circuit . by the way , if the l level is inputted in the flip - flop at the first stage of the shift register , by configuring the shift register using the flip - flop as the d - type flip - flop with the synchronization preset function , it is possible to configure the variable dividing circuit which performs the operation as shown in the timing chart in fig4 . fig2 is a circuit diagram a variable dividing circuit according to a second embodiment , and a shift register is configured in such a manner that plural stages of d - type flip - flops with a synchronization reset function ( d 11 , d 12 , . . . , d 1 n ) are arranged , a fixed input signal 10 at a h level ( or at a l level ) is inputted in an input of a flip - flop d 11 at a first stage , and hereinafter , the output of the flip - flop at the former step is made the input of the flip - flop at the next stage . in addition , the output of the flip - flop at each stage is connected to each input terminal of switches ( sw 1 , sw 2 , . . . , swn ). then , by making any one signal of control signals sw 1 , sw 2 , . . . , swn connected to the control signal of each switch effective , a signal connected to one switch is selected and outputted ( a signal out ). this signal is feed - backed to a reset terminal of each flip - flop and is synchronized with a clock signal ( clk ) so as to reset each flip - flop . by the way , according to the above - described example , it is described that the shift register is configured by the d - type flip - flops with the reset function , however , as same as the first embodiment , it is possible to configure the shift register by using the d - type flip - flops with a synchronization preset function , a l level is inputted in the input signal at the first stage , and the out signal is feed - backed to a preset input terminal of the flip - flop at each stage . in the present embodiment , the multiplexer in the first embodiment is replaced with the switch , and the other configurations are identical with the first embodiment , so that the detailed explanation of the operation of the variable dividing circuit according to the present embodiment is herein omitted . | 7 |
self light emission display devices with a power consumption detecting function according to embodiments of the present invention will be described below . it should be understood that parts and details that belong to and are neither shown nor described in the embodiments of the present invention are of known nature in the art . the embodiments of the present invention which will be described below are shown by way of example only , and the present invention should not be limited to the illustrated embodiments . fig1 shows in block form a basic arrangement of a power consumption detecting device for detecting power consumption according to a fully digital process . as shown in fig1 , a display device 1 includes a power consumption detecting device 3 and a self light emission panel 5 . the self light emission panel 5 includes an organic el display panel module . the power consumption detecting device 3 includes a frame memory 31 , a pixel power consumption calculator 33 , a gradation / power conversion table 35 , a one - frame power consumption calculator 37 , and a power consumption transition recognizer 39 . the frame memory 31 includes a buffer memory for delaying the supply of an input display data signal ( gradation value ) to the self light emission panel 5 . the frame memory 31 may delay the supply of the input display data signal by any desired time . if the light emission of the self light emission panel 5 is controlled based on the power consumption detected by the power consumption detecting device 3 , then the frame memory 31 should delay the supply of the input display data signal by a period of time long enough to synchronize the light emission control with the image displayed by the display device 1 . the pixel power consumption calculator 33 is a processing device for calculating power consumption of each pixel based on the input display data signal ( gradation value ). a gradation value is converted into a power consumption value by the gradation / power conversion table 35 . fig2 shows an example of the gradation / power conversion table 35 . in fig2 , the gradation / power conversion table 35 has eight - bit gradation values ranging from 0 to 255 , 256 values in total . fig3 shows a general pixel circuit 7 for use in the organic el display panel module as the self light emission panel 5 . the pixel circuit 7 includes an organic el element 71 and a drive transistor 73 . the pixel circuit 7 corresponds to each of pixels that make up the self light emission panel 5 . as shown in fig3 , a drive current i d corresponding to a gradation value is determined by the drive transistor 73 . specifically , the drive current i d is determined depending on the gate - to - source voltage v gs of the drive transistor 73 . fig4 shows a v gs - i d characteristic curve of the drive transistor 73 . the v gs - i d characteristic curve may be calculated logically based on the design values or may be measured actually based on the self light emission panel 5 . in fig4 , a constant fixed power supply voltage v cc is applied to the drive transistor 73 . power consumption values p 0 through p 255 corresponding to the respective gradation values are given as the products of drive currents i d corresponding to the respective gradation values and the power supply voltage v cc . fig5 shows an association between the gradation values and the power consumption values . the value calculated by the above calculating formula represents the power consumption value of each pixel . the gradation / power conversion table 35 stores power consumption values p calculated by the above calculating formula in association with the respective gradation values . the one - frame power consumption calculator 37 is a processing device for adding the calculated power consumption values p of the respective pixels of a frame thereby to calculate a power consumption value for the engine screen , i . e ., the entire frame . the power consumption value calculated for the frame by the one - frame power consumption calculator 37 is output as digital data from the power consumption detecting device 3 and is also output to the power consumption transition recognizer 39 . the power consumption transition recognizer 39 is a processing device for generating information representative of a transition of power consumption required by the system of the display device 1 . the information representative of the transition of power consumption includes , for example , a power consumption value itself , a rate of change of a power consumption value from a power consumption value calculated in the past , an average power consumption value ( a power consumption value per unit time ), and a total power consumption value ( a cumulative power consumption value ). the processing sequence that is performed by the power consumption transition recognizer 39 differs depending on how the power consumption value per frame is to be used . details of the processing sequence will be described later . the power consumption detecting device 3 shown in fig1 allows the power consumption of the self light emission panel 5 to be detected only according to a digital signal processing sequence . therefore , there is no need for a feedback loop for an actual current that is detected . the accuracy with which to detect power consumption is high because the power consumption detecting device 3 is free of noise and error caused by the detection of analog currents . the power consumption detecting device 3 shown in fig1 is capable of detecting electric power to be consumed by the display of an image on the self light emission panel 5 before the image is actually displayed on the self light emission panel 5 . for example , the power consumption detecting device 3 can predict what power consumption fluctuation will occur in a next frame . therefore , the power consumption detecting device 3 can perform any of various signal processing sequences with respect to the power consumption fluctuation . since power consumption can be detected in advance , the system of the display device 1 can have an extra period of processing time , which may be two frames or more . using the extra period of processing time , it is possible to optimize any of various signal processing sequences including power consumption fluctuations over several frames ahead . for example , according to a specific example , the power consumption predicting capability is effective to suppress an instantaneous current when the self light emission panel switches from a dark screen to a bright screen . if changes in power consumption are known over some frames ahead , then the rate of change of the luminance as well as the performance of the power supply circuit can be optimized . representative examples of use of the information representative of the transition of power consumption will be described below . a process of controlling an emission time ratio ( duty ratio ) of the self light emission panel 5 using the power consumption value of an entire frame calculated before the image is displayed , to control the peak luminance of the screen will be described below with reference to fig6 . fig6 shows a display device 1 for controlling the peak luminance of a frame based on the calculated power consumption value which corresponds to the frame . in fig6 , the power consumption transition recognizer 39 operates as a peak luminance controller . specifically , the power consumption transition recognizer 39 determines a change in the displayed image based on the transition of power consumption and supplies an emission time ratio controller 91 with a peak luminance control signal depending on the determined change . for example , if the power consumption is continuously constant regardless of its magnitude , then the power consumption transition recognizer 39 judges that a still image is being input ( displayed ) and gives the emission time ratio controller 91 a control signal for progressively reducing the peak luminance over the entire screen , i . e ., for progressively reducing the power consumption . this is because even when the peak luminance of a still image is reduced , the degradation of the image quality is not perceived by the viewer . the emission time ratio controller 91 generates an emission time ratio control signal based on the control signal from the power consumption transition recognizer 39 , and supplies the emission time ratio control signal to the self light emission panel 5 . fig7 shows an example of a pixel circuit whose emission time ratio can variably be controlled . those parts of the pixel circuit shown in fig7 which are identical to those shown in fig3 are denoted by identical reference characters . the pixel circuit shown in fig7 additionally has an emission time control transistor 75 connected in series to the drive transistor 73 . the emission time ratio control signal from the emission time ratio controller 91 is applied to emission time control transistor 75 . when the emission time control transistor 75 is turned on , the drive current i d depending on the gradation value flows through the organic el element 71 . when the emission time control transistor 75 is turned off , the drive current i d stops being supplied to the organic el element 71 . fig8 b shows an emission time ratio control signal by way of example . fig8 a shows the period of one frame . the maximum light emission period in one frame can be varied by varying the ratio of an on - state to an off - state , as shown in fig8 b . a process of controlling a gradation level of the input display data signal using the power consumption value of an entire frame calculated before the image is displayed , to control the peak luminance of the screen will be described below with reference to fig9 . fig9 also shows a display device 1 for controlling the peak luminance of a frame based on the calculated power consumption value which corresponds to the frame . in fig9 , the power consumption transition recognizer 39 operates as a data value controller . specifically , the power consumption transition recognizer 39 determines a change in the displayed image based on the transition of power consumption and supplies a data value variable processor 93 with an entire luminance control signal depending on the determined change . for example , if the power consumption is continuously constant regardless of its magnitude , then the power consumption transition recognizer 39 judges that a still image is being input ( displayed ) and gives the data value variable processor 93 a control signal for progressively reducing the peak luminance over the entire screen , i . e ., for progressively reducing the power consumption . the data value variable processor 93 uniformly increases or reduces the input display data signal ( gradation value ) based on the control signal from the power consumption transition recognizer 39 , and supplies a display data signal representing the increased or reduced input display data signal to the self light emission panel 5 . for example , each gradation value of the input display data signal is increased or reduced uniformly by the same value . alternatively , each gradation value of the input display data signal is increased or reduced at a uniform ratio . a process of controlling a power supply current using the power consumption value of an entire frame calculated before the image is displayed , to suppress an abrupt change in the load will be described below with reference to fig1 . in fig1 , the power consumption transition recognizer 39 operates as a drive power supply controller . specifically , the power consumption transition recognizer 39 detects an abrupt change in the displayed image based on the transition of power consumption and supplies a power supply current limiting controller 95 a control signal for limiting an abrupt change in the drive current depending on the detected change . for example , based on the supplied control signal , the power supply current limiting controller 95 reduces an amount of current flowing in a current source of the power supply circuit to reduce the drive voltage of the organic el element 71 , for thereby reducing the power consumption . a process of recognizing an amount of remaining battery energy using the power consumption value of an entire frame calculated before the image is displayed will be described below with reference to fig1 . in fig1 , the power consumption transition recognizer 39 operates as a total power consumption recognizer . specifically , the power consumption transition recognizer 39 accumulates power consumption values calculated for respective frames to calculate the sum of electric power consumed in the past , and gives the calculated total amount of power consumption to a remaining battery energy recognizer 97 . since the total amount of power consumption can be calculated according to a fully digital process , the power consumption requisite to detect the total amount of power consumption is minimized , and the accuracy with which to predict a remaining amount of battery energy is increased . fig1 shows in block form another basic arrangement of a power consumption detecting device for detecting power consumption according to a fully digital process . as shown in fig1 , a display device 101 includes a power consumption detecting device 103 and a self light emission panel 5 . the power consumption detecting device 103 includes a frame memory 31 , a pixel power consumption calculator 33 , a gradation / power conversion table 35 , a block power consumption calculator 1031 , and a block - specific power consumption transition recognizer 1033 . those parts of the power consumption detecting device 103 shown in fig1 which are identical to those shown in fig1 are denoted by identical reference characters . the power consumption detecting device 103 according to the basic arrangement 2 shown in fig1 differs from the power consumption detecting device 3 according to the basic arrangement 1 shown in fig1 as to the block power consumption calculator 1031 , and the block - specific power consumption transition recognizer 1033 . the block power consumption calculator 1031 is a processing device for adding power consumption values p calculated for all the pixels in each of blocks , to calculate electric power values consumed by the respective blocks . fig1 shows an example of the layout of blocks . in fig1 , the screen of one frame is divided into 12 blocks arranged in three rows × four columns . the block power consumption calculator 1031 calculates power consumption values of the respective 12 blocks . the power consumption values calculated by the block power consumption calculator 1031 are output directly from the power consumption detecting device 103 and are also output to the block - specific power consumption transition recognizer 1033 . the block - specific power consumption transition recognizer 1033 is a processing device for generating information representative of the transition of the power consumption values specific to the blocks required by the system of the display device 101 . the information representative of the transition of the power consumption values includes , for example , a block distribution of the power consumption values , a rate of change of the power consumption value of each block from a power consumption value thereof calculated in the past , an average power consumption value of each block ( a power consumption value per unit time of each block ), a total power consumption value of each block ( a cumulative power consumption value of each block ), a temperature distribution of each block , and an estimated degradation in view of the temperature distribution . the processing sequence that is performed by the block - specific power consumption transition recognizer 1033 differs depending on how the power consumption value per block is to be used . depending on the information representative of the transition of the power consumption values , the block - specific power consumption transition recognizer 1033 functions as a recognizer for recognizing a block distribution of the power consumption values , a recognizer for recognizing a rate of change of the power consumption value of each block , a recognizer for recognizing an average power consumption value of each block , a recognizer for recognizing a total power consumption value of each block , a recognizer for recognizing a temperature distribution of each block , and an estimator for estimating a degradation in view of the temperature distribution . the power consumption detecting device 103 shown in fig1 allows the electric power consumed when the input image data signal is displayed to be detected according to a fully digital signal processing sequence . therefore , there is no need for a feedback loop for an actual current that is detected . the accuracy with which to detect power consumption is high because the power consumption detecting device 103 is free of noise and error caused by the detection of analog currents . the power consumption detecting device 103 shown in fig1 is capable of detecting electric power to be consumed by the display of an image on the self light emission panel 5 before the image is actually displayed on the self light emission panel 5 . for example , the power consumption detecting device 103 can predict what power consumption fluctuation will occur in a next frame with respect to each block . therefore , the power consumption detecting device 103 can perform any of various signal processing sequences with respect to the power consumption fluctuation . since power consumption can be detected in advance , the system of the display device 101 can have an extra period of processing time , which may be two frames or more . using the extra period of processing time , it is possible to optimize any of various signal processing sequences including power consumption fluctuations over several frames ahead . ( a ) in the above arrangements , an organic el display panel has been illustrated as the self light emission display device . however , the present invention is applicable to other self light emission display devices including , for example , a field emission display ( fed ), an inorganic el display panel , an led panel , a plasma display panel ( pdp ). ( b ) in the above arrangements , the power consumption detecting devices 3 , 103 incorporated in the display devices 1 , 101 have been illustrated . however , the power consumption detecting devices 3 , 103 may be incorporated as part of an image processor including a display device . for example , the power consumption detecting devices 3 , 103 may be incorporated in an image capturing device such as a video camera , a digital camera , a video or digital camera combined with a recorder , an information processing terminal such as a portable computer , a cellular phone unit , a portable game console , a personal digital assistant , and a game machine . ( c ) in the above arrangements , the power consumption detecting devices 3 , 103 incorporated in the display devices 1 , 101 have been illustrated . however , the power consumption detecting devices 3 , 103 may be incorporated in an image processor for supplying an input display data signal to a display device or an image processor . ( d ) in the above arrangements , the functions of the power consumption detecting devices 3 , 103 have been described . these functions of the power consumption detecting devices 3 , 103 may be hardware - or software - implemented . though the functions of the power consumption detecting devices 3 , 103 may be fully hardware - or software - implemented , they may be partially hardware - or software - implemented , i . e ., they may be a combination of hardware - and software - implemented functions . ( e ) the above arrangements may be modified without the scope of the present invention . various modifications and applications created or combined based on the above description fall in the scope of the present invention . although certain preferred embodiments of the present invention have been shown and described in detail , it should be understood that various changes and modifications may be made therein without departing from the scope of the appended claims . | 6 |
fig1 - 6 depict one embodiment of a reel cutting unit according to this invention generally as 2 . cutting unit 2 is very similar to cutting unit 2 disclosed in u . s . pat . no . 5 , 628 , 169 , owned by the toro company , the assignee of this invention , and the &# 39 ; 169 patent is hereby incorporated by reference for teaching various details of cutting unit 2 and the gang mower ( not shown herein ) with which cutting unit 2 may be used . a plurality of cutting units 2 may be placed in a gang configuration on the gang mower disclosed in the &# 39 ; 169 patent or on other known reel gang mowers , including toro &# 39 ; s reelmaster 3100 - d . by way of overview , cutting unit 2 comprises a pair of laterally spaced apart side plates 4 that may be joined by various other members , such as a top wall 6 or a back wall ( not shown ). a rotatable reel 8 having a plurality of helical blades is rotatably journalled between side plates 4 of cutting unit 2 . a bedknife 10 is placed beneath a lower portion of the orbit of reel 8 such that the blades of reel 8 will sweep grass against a sharpened cutting edge of bedknife 10 for cutting the grass using a shearing action . front and rear ground engaging rollers 12 and 14 extend between side plates 4 for allowing cutting unit 2 to roll independently on the ground during forward motion of the gang mower ( not shown ) to which cutting unit 2 is attached . the structure of cutting unit 2 as described thus far is conventional and corresponds to that disclosed in the &# 39 ; 169 patent . a cutting unit carrier frame 16 overlies cutting unit 2 and for the purposes of longitudinal propulsion is , in effect , part of the frame of the gang mower . in other words , carrier frame 16 is moved forwardly or rearwardly as the frame of the gang mower moves forwardly or rearwardly . carrier frame 16 includes a hollow roll sleeve 18 for mounting on one of the lift arms of the gang mower to allow carrier frame 16 and cutting unit 2 to roll together about a longitudinal roll axis . however , for the purposes of this invention , this rolling action is not important and could be dispensed with if so desired , in which case roll sleeve 18 would be absent and carrier frame 16 could be coupled in a non - rolling fashion to the lift arm . again , this type of carrier frame 16 with a roll sleeve 18 is conventional and corresponds to that disclosed in the &# 39 ; 169 patent . a four - bar linkage 20 that includes front and rear pivot links 22 and 24 is used to couple each side plate 4 on cutting unit 2 to one side of carrier frame 16 . as shown in fig1 and 2 , pivot links 22 and 24 of each four - bar linkage 20 are pivotally coupled at their upper ends to carrier frame 16 and at their bottom ends to the adjacent side plate 4 of cutting unit 2 . pivot links 22 and 24 converge towards one another as they extend downwardly . once again , this type of four - bar linkage 20 including the converging front and rear pivot links 22 and 24 is conventional and corresponds to that disclosed in the &# 39 ; 169 patent . in cutting unit 2 of this invention , front pivot link 22 attaches to the side of carrier frame 16 at a single pivot location as show at 26 in fig1 - 6 . there are two holes 28 shown in the side of carrier frame 16 above and below the single pivot location 26 of front pivot link 22 implying that front pivot link 22 could be repositioned on carrier frame 16 , but this is not the case . the additional holes 28 that are shown are not the right size for receiving the pivot pin or bolt that secures the upper end of front pivot link 22 and are used for attaching a grass catcher ( not shown ) to cutting unit 2 . thus , the reader hereof should ignore the two holes 28 shown above and below the single pivot location 26 of front pivot link 22 as these holes 28 form no part of this invention . insofar as cutting unit 2 of this invention shows a single pivot location 26 for front pivot link 22 on carrier frame 16 , this is also conventional and corresponds to that disclosed in the &# 39 ; 169 patent . however , unlike the cutting unit disclosed in the &# 39 ; 169 patent , cutting unit 2 of this invention includes a plurality of holes 30 to which the upper end of rear pivot link 24 can be pivotally attached . all holes 30 are sized to receive the pivot pin or bolt on the upper end of rear pivot link 24 and rear pivot link 24 can be interchangeably and alternatively coupled to any one of the holes 30 . holes 30 are arranged on side plate 4 such that holes 30 are longitudinally spaced apart by approximately 1 inch from one another , the holes 30 being disposed in an arc that is at a constant distance or radius from the pivot axis of the lower end of rear pivot link 24 . thus , there is a front hole 30 f , a middle hole 30 m , and a rear hole 30 r with front hole 30 f being higher than middle hole 30 m and middle hole 30 m being higher than rear hole 30 r . referring now to fig3 , when the upper end of rear pivot link 24 is coupled to middle hole 30 m , pivot links 22 and 24 converge at a focal point that establishes a first virtual pull point 32 a for cutting unit 2 . the propulsive forces that are transmitted from carrier frame 16 to cutting unit 2 act on cutting unit 2 as if they were being directly applied to cutting unit 2 at pull point 32 a . as seen in fig3 , pull point 32 a is located slightly below and slightly rearwardly of the centerline of reel 8 . the location of pull point 32 a is substantially longitudinally aligned with the center of gravity ( c . g .) of cutting unit 2 . thus , there is no moment arm tending to cause cutting unit 2 to tip or pivot about the pull point ( or there is only a very small moment arm tending to tip or pivot cutting unit 2 slightly towards rear roller 24 ), such that pull point 32 a establishes a generally neutral or balanced fore - and - aft weight distribution on cutting unit 2 . there is approximately as much weight on front roller 22 as on rear roller 24 . pull point 32 a is the pull point which would probably be used most often on cutting unit 2 . however , with the addition of the front and rear holes 30 f and 30 r for rear pivot link 24 , the user has the option of connecting the upper end of rear pivot link 24 to one of these other holes . if the user selects rear hole 30 r as shown in fig4 , a second virtual pull point 32 b is established that is shifted upwardly and forwardly from pull point 32 a . since the location of the c . g . is still the same , the longer moment arm established by this shift in pull point 32 b creates a tail heavy fore - and - aft weight distribution that shifts more weight to rear roller 24 as compared to front roller 22 . with less weight now on front roller 22 , the aggressiveness of cutting unit 2 in cutting grass is lessened . in some grass conditions , as explained hereafter , this is desirable . similarly , by referring to fig5 , one can see that use of front hole 30 f establishes a third virtual pull point 32 c that is moved downwardly and rearwardly from pull point 32 a . in fact , pull point 32 c preferably moves in back of , at least slightly , the c . g . of cutting unit 2 . this creates a nose heavy fore - and - aft weight distribution in which more weight is placed on front roller 22 as compared to rear roller 24 . this increases the aggressiveness of cutting unit 2 in cutting grass , which can be desirable in other grass conditions . as a result , user can easily and quickly vary the aggressiveness of cut by moving the upper end of rear pivot link 24 from one hole 30 to another , a more aggressive cut being provided by front hole 30 f , a cut of normal aggressiveness being provided by middle hole 30 m , and a cut a lessened aggressiveness being provided by rear hole 30 r . one way a user can use this feature is to configure the front and rear cutting units 2 f and 2 r of a reel gang mower differently as shown in fig6 . in this depiction , rear pivot links 24 of front cutting units 2 f are coupled to middle hole 30 m to provide a cut of normal aggressiveness . however , if certain grass conditions are present , trailing cutting units 2 r will leave marks due to double cutting in those portions of the cut grass swath in which trailing cutting units 2 r overlap the sides of front cutting units 2 f . if this occurs , the applicants have found that configuring rear cutting units 2 r differently from front cutting units 2 f can effectively solve or mitigate this problem , namely by using rear holes 30 r to provide a less aggressive cut on rear cutting units 2 r . the less aggressive cut is visually suggested in fig6 by showing front roller 22 of rear cutting units 2 r up slightly off the ground . this is an exaggeration since front roller 22 would be in contact with the ground when cutting grass , but the exaggeration is simply meant to be a visual indicator that there is less weight on front rollers 22 of rear cutting units 2 r than there is on front rollers 22 of front cutting units due to the use of the rearward hole location 30 r on rear cutting units 2 r as opposed to the use of middle hole location 30 m on front cutting units 2 f . thus , this invention and the versatility in the aggressiveness of cut that is provided by multiple holes 30 for rear pivot link 24 can enhance the aftercut appearance of the cut grass swath , which is obviously desirable to some users of reel gang mowers . however , the example of how this might be done set forth in the preceding paragraph is not meant to be limiting . other combinations of different holes 30 might be used at the same time on the front and rear reel cutting units 2 f and 2 r in different grass conditions . it would also be the case that the same holes 30 might be used on all cutting units 2 of a given reel gang mower , i . e . both the front and rear reel cutting units 2 f and 2 r are using middle holes 30 m at one time in one set of grass conditions , or front holes 30 f at another time in a second set of grass conditions , or rear holes 30 r at a third time in a third set of grass conditions . in some cases , a rear roller brush attachment ( not shown ) is installed atop rear roller 24 of cutting unit 2 to help keep rear roller 24 free of grass clippings or other debris . this has some impact on the location of the c . g . and shifts the c . g . further rearwardly . thus , the supposedly neutral fore - and - aft weight distribution of cutting unit 2 using pull point 32 a is changed into a slightly more tail heavy weight distribution which , in some grass conditions , might not be desired . thus , with a rear roller brush attachment in place , shifting the upper end of rear pivot link 24 to front hole 30 f can help compensate for the added weight of rear roller 24 brush attachment and helps maintain a generally neutral fore - and - aft weight distribution . the various adjustments holes 30 that are used to adjust the pull point locations have been shown in connection with the upper end of rear pivot link 24 , but this need not necessarily be the case . the virtual pull point location could have been varied by placing the series of adjustment holes 30 on the side plate of reel cutting unit 2 rather than on carrier frame 16 , or adjustment holes 30 could have been used in connection with the upper or lower ends of front pivot link 22 . moreover , adjustment holes 30 could be used in different pivot linkages in which actual pull points , rather than virtual pull points , are used . for example , such a pivot linkage might include one where a single pivot link or arm transfers propulsive force from the gang mower frame to the reel cutting unit . such a single pivot link would be connected at one end by a pivot connection to the gang mower frame and at the other end by a pivot connection to the reel cutting unit . in this case , the pull point is located at the actual location at which the other end of the pivot link connects to the reel cutting unit . in this case , the reel cutting unit might have a plurality of adjustment holes thereon for receiving the other end of the pivot link for varying where the pivot link actually connects to the reel cutting unit . thus , this invention is applicable whether actual or virtual pull points are employed in transferring propulsive force from the gang mower frame to the reel cutting unit . various other modifications of this invention will be apparent to those skilled in the art . for example , and not by way of limitation , rather than use a set of discrete adjustment holes 30 on carrier frame 16 , the upper end of rear pivot link 24 could be shifted in an infinite manner if it were connected to carrier frame 16 by some type of threaded adjuster that could be rotated to move the upper end of rear pivot link 24 in a fore - and - aft direction . accordingly , the scope of this invention will be limited only by the appended claims . | 0 |
reference will now be made in detail to the preferred embodiments , examples of which are illustrated in the accompanying drawings . in the following description of the embodiments , it will be understood that , when an element such as a layer ( film ), region , pattern , or structure is referred to as being “ on ” or “ under ” another element , it can be “ directly ” on or under another element or can be “ indirectly ” formed such that an intervening element may also be present . also , terms such as “ on ” or “ under ” should be understood on the basis of the drawings . in the drawings , dimensions of layers are exaggerated , omitted or schematically illustrated for clarity and description convenience . in addition , dimensions of constituent elements do not entirely reflect actual dimensions thereof . fig1 a and 1b illustrate light emitting device modules according to first and second embodiments , respectively . in the light emitting device module according to each embodiment , a light emitting device 240 is disposed in a cavity formed at a heat transfer member 210 . the light emitting device 240 may include a vertical light emitting device , a horizontal light emitting device , or a flip - chip type light emitting device . in these embodiments or other embodiments , the light emitting device 240 may be semiconductor light emitting device , for example light emitting diode . the heat transfer member 210 may be made of a material having excellent thermal conductivity . for example , copper ( cu ) or aluminum may be used for the material of the heat transfer member 210 . the light emitting device 240 may be disposed on a bottom of the cavity formed at the heat transfer member 210 . the cavity may have side walls extending vertically . in the illustrated embodiments , the side walls of the cavity are outwardly inclined as they extend upwardly such that the width of the cavity is increased as the cavity extends upwardly , when viewing in the drawings . although the heat transfer member 210 , which defines the cavity , is illustrated as being sharply bent , it may be bent in a streamlined shape . an insulating layer 220 is formed over the heat transfer member 210 . the insulating layer 220 may be made of , for example , polyimide . the insulating layer 220 may be patterned to expose at least a portion of the heat transfer member 210 at the bottom of the cavity . that is , the insulating layer 220 may not be formed on at least a portion of the bottom of the cavity . a first conductive layer 230 a and a second conductive layer 230 b are formed such that the insulating layer 220 is interposed between the heat transfer member 210 and the first conductive layer 230 a and the second conductive layer 230 b . in accordance with this structure , the first conductive layer 230 a the and second conductive layer 230 b , which supply current to the light emitting device 240 , are electrically insulated from the heat transfer member 210 by the insulating layer 220 . this will be described later the first conductive layer 230 a and the second conductive layer 230 b may have the same shape as the insulating layer 220 . however , each of the first conductive layer 230 a and the second conductive layer 230 b may be formed to have an open region at a portion thereof adjacent to a circuit board 270 , so as to expose a portion of the insulating layer 220 . this will be described later . the first conductive layer 230 a and the second conductive layer 230 b may be made of a copper foil . the light emitting device 240 is electrically connected to the first conductive layer 230 a and the second conductive layer 230 b . this electrical connection may be achieved through bonding of wires 250 as in the illustrated embodiments . a resin layer 260 fills the cavity to protect the light emitting device 240 and wires 250 . a fluorescent substance is contained in the resin layer 260 . accordingly , it may be possible to vary the wavelength of light emitted from the light emitting device 240 . a portion of the heat transfer member 210 extends horizontally at a region around a top of the cavity . a circuit board 270 is connected to the horizontal portion of the heat transfer member 210 via the insulating layer 220 and the first conductive layer 230 a and the second conductive layer 230 b . the circuit board 270 may be coupled to the first conductive layer 230 a and the second conductive layer 230 b by a conductive adhesive 280 . the circuit board 270 may include a printed circuit board ( pcb ), a metal pcb ( mpcb ), or a metal core pcb ( mcpcb ). as shown in a portion “ a ” of fig1 a , the insulating layer 220 is partially exposed in a region between the cavity and the circuit board 270 . that is , the first conductive layer 230 a and the second conductive layer 230 b are not formed in the above - described region such that they are opened in the region to expose a portion of the insulating layer 220 corresponding to the region . in this case , the conductive adhesive 280 may also not be formed on the exposed portion of the insulating layer . in the embodiment of fig1 b , a reflective layer 235 is formed on the first conductive layer 230 a and the second conductive layer 230 b within the cavity . the reflective layer 235 may be made of a material capable of reflecting light emitted from the light emitting device 240 in order to send the reflected light to an outside of the cavity . a silver ( ag ) may be coated over the reflective layer 235 . the heat transfer member 210 may be coupled to a substrate 100 via an adhesive layer 110 . the substrate 100 may function as a body of the light emitting device module . when the substrate 100 is made of a metal , it may function as a bracket to support a light source module in a backlight unit or a lighting apparatus . the adhesive layer 110 has excellent thermal conductivity . the adhesive layer 110 may bond the heat transfer member 210 to the substrate 100 . when the substrate 100 is made of a metal to function as a bracket , heat emitted from the light emitting device 240 is directly transferred to the substrate 100 because it is unnecessary to use a resin such as polyphthalamide ( ppa ) in the backlight unit or lighting apparatus . fig2 and 3 are views illustrating light emitting device module arrays according to exemplary embodiments , respectively . the above - described light emitting device module may be manufactured from an array of light emitting devices . that is , such a light emitting device array may be separated into individual light emitting device modules after being subjected to a process in which an insulating layer , a conductive layer , etc . are laminated over the heat transfer member . fig2 is a view illustrating a state in which the light emitting device array has not been separated into individual light emitting device modules . fig3 illustrates a structure in which a plurality of light emitting devices can be disposed in each cavity . fig4 is a sectional view illustrating a light emitting device module according to a third embodiment . the light emitting device module according to this embodiment is similar to that of fig1 , except that the heat transfer member 210 has a step due to formation of a cavity , so that it is spaced apart from the substrate 100 in a region corresponding to the circuit board 270 , and a support 10 is formed at the substrate 100 to withstand the weight of the circuit board 270 , etc in the region . fig5 a is an enlarged view corresponding to a portion “ f ” of fig4 . referring to fig3 a , the support 10 is formed at the substrate 100 in the region corresponding to the circuit board 270 in order to support the heat transfer member 210 . practically , in one light emitting device module , supports 10 are provided in regions at opposite sides of the cavity , respectively . for simplicity of description , the following description will be given only in conjunction with the support 10 provided in the region at one side of the cavity . the support 10 is disposed on the substrate 100 in a region where the heat transfer member 210 does not contact the substrate 100 . referring to fig3 a , three regions , namely , first to three regions , are defined . in the third region , the substrate 100 contacts the heat transfer member 210 via the adhesive layer 110 . accordingly , it is unnecessary to dispose the support 10 in the third region . in the second region , the heat transfer member 210 has an inclination . this inclination is caused by the fact that the heat transfer member 210 has different heights in a region where the cavity is formed and a region where the circuit board is disposed , while extending horizontally in the regions . in the first region , the heat transfer member 210 is spaced apart from the substrate 100 by a certain distance . to this end , in the first region , the support 10 is formed on the substrate to contact the heat transfer member 210 , and thus to support the heat transfer member 210 . in this case , the support receives a load applied from the circuit board 270 to the heat transfer member 210 . therefore , at least a portion of the support 10 should contact the heat transfer member 210 . in the case of fig5 a , the support 10 includes a first support portion 10 a and a second support portion 10 b . the support 10 may include at least one support portion , taking into consideration the magnitude of load and the width of the first region . the support 10 may be formed of an elastic member to withstand the above - described load . the support 10 may also be made of a heat transferable material to function as a heat transfer layer capable of transferring heat generated from the circuit board 270 to the substrate 100 , which is made of a metal material . such configurations may also be applied to the embodiments , which will be described later . the height h of the support 10 may be equal to the sum of the height difference in the heat transfer member 210 and the height of the adhesive layer 110 . fig5 b to 5g are enlarged views corresponding to the portion “ f ” of fig4 to illustrate different embodiments from that of fig5 a . in the embodiment of fig5 b , the support 10 is formed in accordance with patterning of the substrate 100 in the region where the substrate 100 does not contact the heat transfer member 210 , namely , the first region . that is , in this embodiment , the support 10 is made of the same material as the substrate 100 . in this case , the substrate 100 is made of a metal , so that it may be possible to increase the area of the substrate 100 to absorb heat emitted from the circuit board 270 . similarly to the previous embodiment , the support 10 may include a first support portion 10 a and a second support portion 10 b in this embodiment . the support 10 may include at least one support portion , taking into consideration the magnitude of load and the width of the first region . the embodiment of fig5 c is similar to the embodiment of fig5 b , except that the substrate 100 has the same pattern at the upper and lower surfaces thereof . that is , when it is assumed that the direction of the substrate 100 to face the heat transfer member 210 is a first direction of the substrate 100 , and the direction opposite to the first direction is a second direction of the substrate 100 , the substrate 100 has the same pattern in the first and second directions . the embodiments of fig5 b and 5c are different in terms of manufacturing processes . that is , in the case of fig5 b , the substrate 100 may be injection - molded to have the support 10 , whereas , in the case of fig5 c , the substrate 100 is injection - molded without having the support 100 , and then pressed to form the support 10 . the embodiment of fig5 d is similar to the embodiment of fig5 c , except that the pattern forming the support 10 is subjected to a rounding process . that is , the support 10 has a round edge to prevent impact from being generated at a portion of the support 10 contacting the heat transfer member 210 . in each embodiment of fig5 e to 5g , the support 10 is formed in accordance with patterning of the substrate 100 . the size or area of the support 10 in the direction of the support 10 contacting the heat transfer member 210 is smaller than that of the support 10 in the direction of the support 10 contacting the substrate 100 . for example , the support 10 has a shape similar to a trapezoidal shape . that is , the support 10 has a surface facing the heat transfer 210 member and another surface facing the substrate 100 , the cross - sectional area of the surface facing the heat transfer member 210 is less than the cross - sectional area of the surface facing substrate 100 . the cross - sectional area of the support 10 may be greatest in a side closest to the substrate 100 . and , the cross - sectional area of the support 10 may be decreased in corresponding to a distance from the substrate 100 . in the above - described structure , the support 10 , which has a trapezoidal shape , stably supports the heat transfer member 210 . the support 10 may be protruded from the substrate 100 , as in the structure of fig5 a . the support 10 may also be formed by pressing the substrate 100 after injection molding thereof to respectively form patterns at two surfaces of the substrate 100 , as in the structure of fig5 f . alternatively , the patterns of the substrate 100 in the structure of fig3 f may be subjected to a rounding process to form the structure of fig5 g . fig6 a to 6i are views illustrating a method for manufacturing the light emitting device module of fig4 in accordance with an exemplary embodiment . in accordance with the illustrated method , as shown in fig6 a , the insulating layer 220 and a conductive layer 230 are first formed over a base substrate 290 . in this case , the insulating layer 220 may be fixed to the base substrate 290 by an adhesive 295 . for the conductive layer 230 , which is bonded to the insulating layer 220 , a copper foil , to which a polyimide film is bonded , may be used . since the polyimide film has a small thickness of , for example , 5 μm , it is very advantageous in terms of thermal resistance . as shown in fig6 b , a mask 300 is selectively formed on the conductive layer 230 . using the mask 300 , the conductive layer 230 and insulating layer 220 are subsequently patterned . in this case , the conductive layer 230 may be divided into two portions , namely , the first conductive layer 230 a and the second conductive layer 230 b . the middle region of fig6 c , from which the insulating layer 220 , etc . are removed , corresponds to the bottom of the cavity in fig4 . as shown in fig6 d , the base substrate 290 is then removed . subsequently , the heat transfer member 210 is bonded to the insulating layer 220 . in this case , the bonding may be achieved using the previously - coated adhesive 295 or an additional adhesive 295 . the base substrate 290 is removed after functioning as a stiffener in the manufacturing procedure . in this case , the insulating layer 220 and adhesive 295 form two layers between the heat transfer member 210 and each of the firs and second conductive layers 230 a and 230 b . since the polyimide of the insulating layer 220 function as an electrical insulator , and the adhesive 295 performs a bonding function , an optimal structure capable of achieving an improvement in heat transfer characteristics may be obtained . since the heat transfer member 210 , which has a metal structure thicker than the copper foil , supports the light emitting device 240 , it may be possible to achieve a remarkable enhancement in reliability . it is also unnecessary to achieve an increase in stiffness using a transparent resin . accordingly , the material of the resin layer may be selected from more various materials , and thus , cost reduction may be achieved . furthermore , it may be possible to achieve a great enhancement in heat dissipation characteristics in accordance with a combination of the insulating layer 220 and adhesive 295 . for example , when only the insulating layer 220 , which is made of polyimide , is applied between each of the first conductive layer 230 a and the second conductive layer 230 b , which is made of a copper foil having a thickness of , for example , 18 μm , and the heat transfer member 210 , which is made of a copper foil having a thickness of 125 μm , the insulating layer 220 is required to have a thickness of , for example , 20 to 30 μm , when tolerance and bonding force are taken into consideration . however , when the insulating layer 220 is applied along with the adhesive 295 , it may be possible to reduce the thickness of the polyimide insulating layer 220 . this may be achieved by thinly coating polyimide over the conductive layer 230 made of a copper foil , to form the insulating layer 220 . thus , the thickness of the polyimide insulating layer 220 may be reduced to 5 μm . since the thin polyimide insulating layer 220 , which has a thickness of 5 μm , provides insulation characteristics , the adhesive 295 may achieve an enhancement in thermal conductivity . thereafter , a pressure is applied to the edges of the heat transfer member 210 to form a step at the heat transfer member 210 , as shown in fig6 e . at this time , the insulating layer 220 and the first conductive layer 230 a and the second conductive layer 230 b are also stepped in the same manner as the heat transfer member 210 . the above - described step may be formed using a method for pressing the heat transfer member 210 or the like . the step may be formed as the heat transfer member 210 is bent in a vertical direction or in a streamlined shape . thereafter , a pressure is applied to the heat transfer member 210 to bend the heat transfer member 210 , and thus to form the cavity . at this time , the insulating layer 220 and the first conductive layer 230 a and the second conductive layer 230 b are also bent . the cavity may have a shape in which the edges of the cavity have a curved shape or a shape in which the edges of the cavity have a point of inflection , as shown in fig3 . the support , which will be described later , may have a height varying in accordance with the bending degree of the heat transfer member 210 . subsequently , the light emitting device 240 is mounted on the bottom of the cavity , as shown in fig6 f . the light emitting device 240 is wire - bonded to the first conductive layer 230 a and the second conductive layer 230 b by the wires 250 . in this case , electrode pads 255 may be formed on the first conductive layer 230 a and the second conductive layer 230 b . the wires 250 are bonded to the electrode pads 255 . thereafter , a resin layer 260 fills the cavity to protect the light emitting device 240 and wires 250 , as shown in fig6 g . a fluorescent substance is contained in the resin layer 260 . accordingly , it may be possible to vary the wavelength of light emitted from the light emitting device 240 . subsequently , the support 10 is prepared to be provided at the substrate 100 , as shown in fig6 h . the support 10 may be prepared in the form of a separate member made of a material different from that of the substrate 100 , as in this embodiment , or in the form of a structure integral with the substrate 100 , as in other embodiments . an adhesive layer 110 is formed on the substrate 100 to bond the support 10 to the substrate 100 . as shown in fig6 , the heat transfer member 210 is boned to the substrate 100 by the adhesive layer 110 while coming into contact with the substrate 100 via the support 10 . the shape in a portion “ f ” of fig6 has been described with reference to fig5 a , etc . fig7 a to 7g are views illustrating a method for manufacturing the light emitting device module of fig4 according to another embodiment of the present invention . in this embodiment , the base substrate 290 is not used , different form the embodiment of fig6 a , etc . also , the insulating layer 220 may be fixed to the heat transfer member 210 without using the adhesive 295 . in this case , a material having a bonding property such as polyimide may be used for the insulating layer 220 . in other embodiments , the adhesive 295 may be dispensed with . first , the heat transfer member 210 is prepared , as shown in fig7 a . the heat transfer member 210 may be made of a material having excellent thermal conductivity . for example , copper ( cu ) or aluminum ( al ) may be used for the material of the heat transfer member 210 . as shown in fig7 b , the insulating layer 220 and the conductive layer 230 are fixed on the heat transfer member 210 by the adhesive 295 . the conductive layer 230 is then patterned as shown in fig7 c . in this case , the conductive layer 230 is partially removed to partially expose the insulating layer 220 . the conductive layer 230 is divided into first conductive layer 230 a and the second conductive layer 230 b by the region s where the insulating layer is exposed . the process of partially removing the conductive layer 230 may be achieved using a mask , which is coated , as shown in fig7 b , etc ., to selectively remove a portion of the conductive layer 230 . although opposite ends of the conductive layer 230 are not removed , namely , portions of the insulating layer 220 corresponding to the opposite ends are not exposed , in the illustrated embodiment , an open region , through which the insulating layer 220 is exposed , may be formed around the cavity , as shown in fig7 c , etc . thereafter , a pressure is applied to the heat transfer member 210 to bend the heat transfer member 210 , and thus to define the cavity , as shown in fig7 d . at this time , the insulating layer 220 and the first conductive layer 230 a and the second conductive layer 230 b are also bent . the cavity may be formed to have a shape in which the edges of the cavity have a curved shape , or a shape in which the edges of the cavity have a point of inflection . the reflective layer 235 is then formed over the first conductive layer 230 a and the second conductive layer 230 b , as shown in fig7 e . the reflective layer 235 may be made of a material capable of reflecting light emitted from the light emitting device 240 in order to send the reflected light to an outside of the cavity . a silver ( ag ) may be coated over the reflective layer 235 . the light emitting device 240 is then disposed in the cavity of the heat transfer member 210 . thus , a light emitting device module as shown in fig7 f is completely obtained . when the heat transfer member 210 of the light emitting device module is bonded to the substrate 100 by the adhesive layer 110 , a light emitting device module as shown in fig7 g is completely obtained . since it is unnecessary to form a package body using a polyphthalamide ( ppa ) resin , the effect of transferring heat emitted from the light emitting device 240 to the heat transfer member 210 is great . in this case , the supports 10 are formed on the substrate 100 outside the cavity to support the load applied to the heat transfer member 210 . as described above , circuit boards ( not shown ) may be arranged on the first conductive layer 230 a and the second conductive layer 230 b corresponding to the supports 10 , respectively . in a light emitting device module according to an eighteenth embodiment of fig8 , the light emitting device 240 is electrically connected to the first conductive layer 230 a and the second conductive layer 230 b without using wire bonding . that is , in this embodiment , the light emitting device 240 is of a flip - chip type so that it may be directly bonded to the first conductive layer 230 a and the second conductive layer 230 b . the above - described light emitting device module may be manufactured from an array of light emitting devices . that is , such a light emitting device array may be separated into individual light emitting device modules after being subjected to a process in which an insulating layer , a conductive layer , etc . are laminated over the heat transfer member . each of the separated light emitting device modules is then bonded to the bracket . alternatively , the separation into the individual light emitting device modules may be achieved after the bonding of the heat transfer member to the bracket . fig9 shows cross - sectional views respectively taken in directions corresponding to a longer axis and a shorter axis in the light emitting device module of fig4 a . fig9 omits illustration of the light emitting device , etc . fig9 ( b - b ′), which is a cross - sectional view taken in the longer axis direction of the light emitting device module , shows exposure of the heat transfer member 210 in a central portion of the cavity . however , in fig9 ( c - c ′), which is a cross - sectional view taken in the shorter axis direction of the light emitting device module , the heat transfer member 210 is not exposed at the bottom of the cavity . that is , the heat transfer member 210 is exposed in a short - axis direction within the cavity . referring to fig9 ( b - b ′), the supports 10 are formed between the substrate 100 and the heat transfer member 210 to support the weights of the circuit boards 270 , respectively . at the regions shown in fig9 ( c - c ′), however , the circuit boards 270 are not disposed , so that the supports 10 may not be provided at the regions . fig1 is a sectional view illustrating a light emitting device module according to a fifth embodiment of the present invention . in this embodiment , a plurality of light emitting devices 240 is disposed in the cavity . the light emitting devices are wire - bonded to one another by wires 250 . the light emitting devices 240 arranged at opposite side edges of the cavity are wire - bonded to the first conductive layer 230 a and the second conductive layer 230 b by wires 250 . similarly to the previous embodiments , the heat transfer member may be exposed at the central region c of the cavity . each light emitting device 240 directly contacts the heat transfer member 210 exposed at the bottom of the cavity . circuit boards ( not shown ) may be disposed on the first conductive layer 230 a and the second conductive layer 230 b in regions outside the cavity , respectively . supports 10 are disposed on the substrate 100 beneath the regions outside the cavity , respectively , to support the heat transfer member 210 . fig1 is a sectional view illustrating a light emitting device module according to a sixth embodiment of the present invention . this embodiment is similar to the embodiment of fig1 , except that the heat transfer member 210 is not exposed at the bottom of the cavity . that is , the insulating layer 220 and the first conductive layer 230 a and the second conductive layer 230 b are completely disposed on the heat transfer member 210 in a region corresponding to the bottom of the cavity where the light emitting devices 240 are disposed . in order to avoid short of current supplied to each light emitting device 240 , the first conductive layer 230 a and the second conductive layer 230 b are removed from a region c corresponding to a portion of the bottom of the cavity . circuit boards ( not shown ) may be disposed on the first conductive layer 230 a and the second conductive layer 230 b in regions outside the cavity , respectively . supports 10 are disposed on the substrate 100 beneath the regions outside the cavity , respectively , to support the heat transfer member 210 . fig1 is a perspective view illustrating a light emitting device module according to a seventh embodiment of the present invention . in this embodiment , two light emitting devices 240 are disposed in the cavity . wires are connected to two electrode pads 242 and 244 provided at each light emitting device 240 , respectively . the two light emitting devices 240 are connected to the first conductive layer 230 a and the second conductive layer 230 b by wires , respectively . the light emitting devices 240 are electrically connected to each other via a third conductive layer 258 , which is of an island type . electrode pads 255 are formed at each of the first conductive layer 230 a and the second conductive layer 230 b connected to respective light emitting devices 240 by wires . a resin layer 260 fills the cavity to protect the light emitting devices 240 and wires . similarly to the above - described embodiments , each of the first conductive layer 230 a and the second conductive layer 230 b is partially patterned in a region between the cavity and an external circuit board ( not shown ) to expose a portion of the insulating layer 220 in this embodiment . hereinafter , a lighting apparatus and a backlight unit will be described as an embodiment of a lighting system in which one of the above - described light emitting device module is arranged . fig1 is an exploded perspective view illustrating a lighting apparatus including the light emitting device module according to one of the above - described embodiments . the lighting apparatus includes a light source 600 for projecting light , a housing 400 in which the light source 600 is mounted , a heat dissipation unit 500 to dissipate heat generated from the light source 600 , and a holder 700 for coupling the light source 600 and heat dissipation unit to the housing 400 . the housing 400 includes a socket connection part 410 connected to an electric socket ( not shown ), and a body part 420 connected to the socket connection part 410 . the light source 600 is received in the body part 420 . a plurality of air holes 430 may be formed through the body part 420 . although a plurality of air holes 430 are formed through the body part 420 of the housing 400 in the illustrated case , a single air hole 430 may be formed through the body part 420 . although the plural air holes 430 are circumferentially arranged , various arrangements thereof may be possible . the light source 600 includes a circuit board 610 and a plurality of light emitting device modules 650 mounted on the circuit board 610 . here , the circuit board 610 may be shaped to be fitted in an opening formed at the housing 400 . also , the circuit board 610 may be made of a material having high thermal conductivity so as to transfer heat to the heat dissipation unit 500 , as will be described later . the holder 700 is disposed under the light source 600 . the holder 700 includes a frame and air holes . although not shown , an optical member may be disposed under the light source 600 so as to diffuse , scatter or converge light projected from the light emitting device modules 650 of the light source 600 . the above - described lighting apparatus , which employs the above - described light emitting device modules according to one of the above - described embodiments , exhibits an improvement in brightness because it is possible to reduce the amount of light absorbed into the insulating layer of each light emitting device module after being emitted from the corresponding light emitting device . also , since the distance between each of the first conductive layer ( lead frame ) and the light emitting device in each light emitting device module is appropriate , it may be possible to reduce the cost of materials used in wire boding and to secure convenience in the manufacturing process . fig1 is a view illustrating a display apparatus including the light emitting device module according to one of the above - described embodiments . as shown in fig1 , the display apparatus according to the illustrated embodiment , which is designated by reference numeral 800 , includes a light source module , a reflective plate 820 provided on a bottom cover 810 , a light guide plate 840 disposed in front of the reflective plate 820 to guide light emitted from the light source module 830 to a front side of the display apparatus 800 , first and second prism sheets 850 and 860 disposed in front of the light guide plate 840 , a panel 870 disposed in front of the second prism sheet 860 , and a color filter 880 disposed in front of the panel 870 . the light source module includes a circuit board 830 and light emitting device modules 835 mounted on the circuit board 830 . here , a printed circuit board ( pcb ) may be used as the circuit board 830 . the light emitting device module 835 may have the above - described configuration . the bottom cover 810 serves to receive the constituent elements of the display apparatus 800 . the reflective plate 820 may be provided as a separate element , as shown in fig1 , or may be provided as a material having high reflectivity is coated over a rear surface of the light guide plate 840 or a front surface of the bottom cover 810 . here , the reflective plate 820 may be made of material having high reflectivity and capable of being formed into an ultra thin structure . polyethylene terephthalate ( pet ) may be used for the reflective plate 820 . the light guide plate 840 serves to scatter light emitted from the light source module so as to uniformly distribute the light throughout all regions of a liquid crystal display apparatus . therefore , the light guide plate 840 may be made of a material having high refractivity and transmissivity . the material of the light guide plate 840 may include polymethylmethacrylate ( pmma ), polycarbonate ( pc ) or polyethylene ( pe ). the first prism sheet 850 may be formed by coating with a polymer exhibiting light transmittance and elasticity over one surface of a base film . the first prism sheet 850 may have a prism layer having a plurality of three - dimensional structures in the form of a repeated pattern . here , the pattern may be a stripe type in which ridges and valleys are repeated . the second prism sheet 860 may have a similar structure to the first prism sheet 850 . the second prism sheet 860 may be configured such that the orientation direction of ridges and valleys formed on one surface of the base film of the second prism sheet 860 is perpendicular to the orientation direction of the ridges and valleys formed on one surface of the base film of the first prism sheet 850 . such a configuration serves to uniformly distribute light transmitted from the light module and the reflective sheet 820 toward the entire surface of the panel 870 . although not shown , a protective sheet may be provided on each of the prism sheets 850 and 860 . the provision of the protective sheet may be achieved by forming a protective layer including light - diffusing particles and a binder at each surface of the base film in each of the prism sheets 850 and 860 . the prism layer may be made of a polymer selected from the group consisting of polyurethane , styrene - butadiene copolymer , polyacrylate , polymethacrylate , polymethyl methacrylate , polyethyleneterephthalate elastomer , polyisoprene and polysilicon . although not shown , a diffusion sheet may be disposed between the light guide plate 840 and the first prism sheet 850 . the diffusion sheet is made of a polyester or polycarbonate - based material . the diffusion sheet may maximally increase a light projection angle through refraction and scattering of light incident from the display apparatus . the diffusion sheet may include a support layer including a light diffusing agent , and first and second layers formed on a light emitting surface ( in the direction of the first prism sheet ) and a light incident surface ( in the direction of the reflective sheet ) the first and second layers do not include a light diffusing agent . the support layer may include 0 . 1 to 10 parts by weight of a siloxane - based light diffusing agent having an average particle size of 1 to 10 μm and 1 to 10 parts by weight of an acryl - based light diffusing agent having an average particle size of 1 to 10 μm , based on 100 parts by weight of a resin including a mixture of a methacrylate - styrene copolymer and methacrylate methyl - styrene copolymer . the first and second layers may include 0 . 01 to 1 part by weight of an ultraviolet absorbing agent and 0 . 001 to 10 parts by weight of an antistatic agent , based on 100 parts by weight of a methacrylate methyl - styrene copolymer resin . the support layer of the diffusion sheet has a thickness of 100 to 10 , 000 μm . each layer may have a thickness of 10 to 1 , 000 μm . in the illustrated embodiment , the optical sheet may include a combination of the diffusion sheet , the first prism sheet 850 and the second prism sheet 860 . however , the optical sheet may include other combinations , for example , a microlens array , a combination of a diffusion sheet and a microlens array , and a combination of a prism sheet and a microlens array . a liquid crystal display panel may be used as the panel 870 . further , instead of the liquid crystal display panel 870 , other kinds of display devices requiring light sources may be provided . the display panel 870 is configured such that a liquid crystal layer is located between glass substrates , and polarizing plates are mounted on both glass substrates so as to utilize polarizing properties of light . here , the liquid crystal layer has properties between a liquid and a solid . that is , in the liquid crystal layer , liquid crystals which are organic molecules having fluidity like the liquid are regularly oriented , and the liquid crystal layer displays an image using change of such molecular orientation due to an external electric field . the liquid crystal display panel used in the display apparatus is of an active matrix type , and uses transistors as switches to adjust voltage applied to each pixel . the color filter 880 is provided on the front surface of the panel 870 , and transmits only an r , g or b light component of light projected from the panel 870 per pixel , thereby displaying an image . the above - described lighting apparatus , which employs the above - described light emitting device modules according to one of the above - described embodiments , exhibits an improvement in brightness because it is possible to reduce the amount of light absorbed into the insulating layer of each light emitting device module after being emitted from the corresponding light emitting device . also , since the distance between each of the first conductive layer ( lead frame ) and the light emitting device in each light emitting device module is appropriate , it may be possible to reduce the cost of materials used in wire boding and to secure convenience in the manufacturing process . in the light emitting device module according to one of the embodiments of the present invention and the lighting system using the light emitting device , the insulating layer , which includes a polyimide film , is opened at the top of the cavity . accordingly , the amount of light absorbed into the insulating layer after being emitted from the light emitting device is reduced , so that an enhancement in optical efficiency is achieved . it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit or scope of the inventions . thus , it is intended that the present invention covers the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents . | 7 |
as will be appreciated by those of ordinary skill in the art , printed circuit board design tools are conventionally implemented using computer - executable software instructions executed by one or more programmable computing devices . accordingly , one or more aspects of the invention may be embodied by the execution of software instructions on a programmable computing device to perform one or more functions according to the invention . alternately or additionally , one or more aspects of the invention may be embodied by computer - executable software instructions stored on a computer - readable medium for performing one or more functions according to the invention . accordingly , the components and operation of a generic programmable computer system through which various embodiments of the invention may be employed will first be described with reference to fig7 . it should be noted that this operating environment is only one example of a suitable operating environment , however , and is not intended to suggest any limitation as to the scope of use or functionality of the invention . still other implementations of the invention , for example , could employ purpose - specific hardware , firmware , or some combination of hardware , firmware and software . turning now to fig7 , this figure shows an illustrative example of a computing device 701 . as seen in this figure , the computing device 701 includes a computing unit 703 with a processing unit 705 and a system memory 707 . the memory 707 may be implemented using any combination of computer readable media that can be accessed by the processing unit 705 . the computer readable media may include , for example , microcircuit memory devices such as read - write memory ( ram ), read - only memory ( rom ), electronically erasable and programmable read - only memory ( eeprom ) or flash memory microcircuit devices , cd - rom disks , digital video disks ( dvd ), or other optical storage devices . the computer readable media may also include magnetic cassettes , magnetic tapes , magnetic disks or other magnetic storage devices , punched media , holographic storage devices , or any other medium that can be used to store desired information . the processing unit 705 may be any type of programmable electronic device for executing software instructions , but will conventionally be a microprocessor . for example , the processor unit 705 may be a commercially generic programmable microprocessor , such as an intel ® pentium ® or xeon ™ microprocessor , an advanced micro devices athlon ™ microprocessor , or motorola 68k / coldfire ® microprocessor . alternately or additionally , the processing unit 705 may be a custom - manufactured processor , such as a microprocessor designed to optimally perform specific types of mathematical operations . with some implementations of the invention , the processing unit 505 may have more than one processor core . accordingly , fig8 illustrates an example of a multi - core processor unit 505 that may be employed with various embodiments of the invention . as seen in this figure , the processor unit 505 includes a plurality of processor cores 801 . each processor core 801 includes a computing engine 803 and a memory cache 805 . as known to those of ordinary skill in the art , a computing engine contains logic devices for performing various computing functions , such as fetching software instructions and then performing the actions specified in the fetched instructions . these actions may include , for example , adding , subtracting , multiplying , and comparing numbers , performing logical operations such as and , or , nor and xor , and retrieving data . each computing engine 803 may then use its corresponding memory cache 805 to quickly store and retrieve data and / or instructions for execution . each processor core 801 is connected to an interconnect 807 . the particular construction of the interconnect 807 may vary depending upon the architecture of the processor unit 801 . with some processor units 801 , such as the cell microprocessor created by sony corporation , toshiba corporation and ibm corporation , the interconnect 807 may be implemented as an interconnect bus . with other processor units 801 , however , such as the opteron ™ and athlon ™ dual - core processors available from advanced micro devices of sunnyvale , calif ., the interconnect 807 may be implemented as a system request interface device . in any case , the processor cores 801 communicate through the interconnect 807 with an input / output interfaces 809 and a memory controller 811 . the input / output interface 809 provides a communication interface between the processor unit 801 and the bus 713 . similarly , the memory controller 811 controls the exchange of information between the processor unit 801 and the system memory 707 . with some implementations of the invention , the processor units 801 may include additional components , such as a high - level cache memory accessible shared by the processor cores 801 . the processing unit 705 and the system memory 707 are connected , either directly or indirectly , through a bus 713 or alternate communication structure , to one or more peripheral devices . for example , the processing unit 705 or the system memory 707 may be directly or indirectly connected to one or more additional memory storage devices , such as a “ hard ” magnetic disk drive 715 , a removable magnetic disk drive 717 , an optical disk drive 719 , or a flash memory card 721 . the processing unit 705 and the system memory 707 also may be directly or indirectly connected to one or more input devices 723 and one or more output devices 725 . the input devices 723 may include , for example , a keyboard , a pointing device ( such as a mouse , touchpad , stylus , trackball , or joystick ), a scanner , a camera , and a microphone . the output devices 725 may include , for example , a monitor display , a printer and speakers . with various examples of the computer 701 , one or more of the peripheral devices 715 - 125 may be internally housed with the computing unit 703 . alternately , one or more of the peripheral devices 715 - 125 may be external to the housing for the computing unit 703 and connected to the bus 713 through , for example , a universal serial bus ( usb ) connection . with some implementations , the computing unit 703 may be directly or indirectly connected to one or more network interfaces 727 for communicating with other devices making up a network . the network interface 727 translates data and control signals from the computing unit 703 into network messages according to one or more communication protocols , such as the transmission control protocol ( tcp ) and the internet protocol ( ip ). also , the interface 727 may employ any suitable connection agent ( or combination of agents ) for connecting to a network , including , for example , a wireless transceiver , a modem , or an ethernet connection . such network interfaces and protocols are well known in the art , and thus will not be discussed here in more detail . it should be appreciated that the computer 701 is illustrated as an example only , and it not intended to be limiting . various embodiments of the invention may be implemented using one or more computing devices that include the components of the computer 701 illustrated in fig7 , which include only a subset of the components illustrated in fig7 , or which include an alternate combination of components , including components that are not shown in fig7 . for example , various embodiments of the invention may be implemented using a multi - processor computer , a plurality of single and / or multiprocessor computers arranged into a network , or some combination of both . it also should be appreciated that the description of the computer system illustrated in fig7 and 8 is provided as an example only , and it not intended to suggest any limitation as to the scope of use or functionality of alternate embodiments of the invention . according to various implementations of the invention , an escape outline is provided in a printed circuit board design . the escape outline , which typically will enclose a component object , automatically distinguishes escape traces of a breakout from other traces , such as hanger traces . with some embodiments of the invention , for example , a designer may designate a trace as an escape trace for a component simply by routing the trace from a pin of the component to or through the escape outline around that component . some implementations of the invention may even assist a designer in creating escape traces , by “ snapping ” traces to the escape outline if the traces have an endpoint within a predetermined distance from the escape outline . still further , a designer may use an escape outline to automatically route escape traces using an automatic trace routing tool . as previously noted , various embodiments of the invention are related to tools for the design of printed circuit boards . in particular , some implementations of the invention may be used to improve the operation of printed circuit board design tools for creating and modifying breakout routes in a printed circuit board design . as used herein , the terms “ design ” and “ design data ” are intended to encompass data describing an entire printed circuit board . this term also is intended to encompass a smaller set of data describing a subset of an entire printed circuit board , however , such as a layer of an printed circuit board , or even a portion of a layer of an printed circuit board . still further , the terms “ design ” and “ design data ” also are intended to encompass data describing more than one printed circuit board , such as data to be used to create a system of interconnected printed circuit boards . further , as used herein , the term “ designer ” is intended to encompass a single person creating , modifying , or otherwise editing a printed circuit board design . this term also is intended to encompass a group of persons , collaborating as a team or working as individuals , that creates , modifies , or otherwise edits a printed circuit board design . to facilitate an understanding of various embodiments of the invention , one type of software tool for printed circuit board design will now be generally described . more particularly , fig9 illustrates a printed circuit board design tool 901 that may incorporate one or more aspects of the invention . as seen in this figure , the design tool 901 includes a user interface module 903 and a design editing module 905 . the user interface module 903 may , for example , provide a graphical user interface that allows a designer to add a trace to a printed circuit board design , modify the route of a trace that already exists in a printed circuit board design , specify one or more properties for a trace , or any other conventional trace editing operation for a printed circuit board design . the design editing module 905 then modifies a printed circuit board design to implement the additions or revisions input through the user interface module 903 . in addition , the design editing module 905 may perform one or more automatic editing operations . for example , if a user changes the route of a first trace so that it is too close or overlays a second trace , then the design editing module 905 may automatically revise the route to the second trace to maintain some minimum distance between the first trace and the second trace . as shown in fig9 , the design tool 901 also includes an escape outline definition module 907 and an escape trace identification module 909 . as will be discussed in more detail below , the escape outline definition module 907 receives input from a designer , through the user interface module 903 , specifying the parameters of an escape outline . in response , the escape outline definition module 907 creates an escape outline in the printed circuit board design based upon the instructions provided by the designer . once an escape outline has been added to a printed circuit board design , the escape trace identification module 909 will use the escape outline to determine if a trace is an escape trace or some other type of trace . according to various examples of the invention , the printed circuit board design being edited by the design tool 901 may be stored in a design storage 911 . the design storage 911 typically will be implemented by a magnetic disc , such as the type employed by a magnetic hard disc drive . of course , the design storage 911 alternately may be implemented by any desired memory medium , including , for example , a magnetic disc , an optical disc , a flash or other solid state memory device , including a ram or rom memory device , or some combination of these devices . further , while the design storage 911 is shown as separate from the design tool 901 in fig9 , it should be appreciated that some or all of the design storage 911 may be incorporated into the design tool 901 . the operation of the design tool 901 according to various examples of the invention will now be described with reference to the flowchart illustrated in fig1 a and 10b . initially , in step s 1001 , the designer defines an escape outline in a printed circuit board design so that it is affiliated with a component object in the printed circuit board design . as previously noted , a component object is a data object in a printed circuit board design representing an electrical component that will be mounted on the printed circuit board . the component object may represent any type of component , including active components , such as field programmable gate array device or other powered integrated circuit device . the component object alternately may represent a passive component , such as a connector . fig1 a illustrates an example of a component object 1101 representing a component having an array of 1760 pins in a ball grid array . accordingly , the component object 1101 includes 1760 pins 1103 , with the location of each pin 1103 corresponding to the location of a physical solder ball pin of the component . the designer may input the parameters defining the escape outline through the user interface module 903 . with various examples of the invention , the user will specify one or more perimeters for the escape outline , as well as the component object with which the escape outline will be affiliated . according to various examples of the invention , the designer also may specify one or more properties for the escape outline . as will be discussed in more detail below , these properties may be imparted to traces associated with the escape outline . next , in step s 1003 , the escape outline definition module 907 adds the escape outline to the printed circuit board design . typically , the designer will create an escape outline so that it surrounds its affiliated component object , like the escape outline 1105 shown in fig1 b . in this illustrated example , the perimeter of the escape outline 1105 is the same distance from the corresponding side of the component object 1101 . it should be appreciated , however , that with various examples of the invention , the escape outline definition module 907 may allow a designer to specify any desired shape for the perimeter of the escape outline . a user may thus create an escape outline with a perimeter that has some edges closer to its affiliated component object than other edges . also , in addition to having a rectangularly - shaped perimeter , various implementations of the invention may allow a designer to create an escape outline having a perimeter with other shapes , such as other polygons , circles , ellipses , etc . it also should be appreciated that an escape outline may exist in a plurality of layers of a printed circuit board design . as previously noted , modern printed circuit boards may have a two or more layers . accordingly , a designer may specify an escape outline having a perimeter in each of one or more different layers of the printed circuit board design . for example , if the printed circuit board design is for a printed circuit board having six layers , the designer may create an escape outline having a perimeter in the design for each of the six layers . moreover , the escape outline may exist on only specific layers in a printed circuit board design . thus , if only the middle four layers of a printed circuit board will be used for routing signal - carrying traces ( with the first and sixth layers being used , e . g ., only for ground or power planes ), then a designer may specify that escape outline exist in only the middle four layers of the printed circuit board design . still further , with various examples of the invention , the perimeter of the escape outline may vary from layer to layer of the printed circuit board design . for example , in the top layer of a printed circuit board design , the perimeter of the escape outline may be outside of the periphery of its affiliated component object . in other layers , however , the perimeter of the escape outline may be substantially smaller than the periphery of its affiliated component object . this may be particularly useful , for example , where only a few vias extend from the component object to inner layers of the printed circuit board design . by configuring the perimeter of the escape outline to encompass only those few vias extending from pins of the component object , the designer can preserve space on these inner layers for routing traces unrelated to the component object . it should be noted that various implementations of the invention may allow a user to modify or change features of an escape outline at anytime , include the size and shape of a perimeter of the escape outline , and properties assigned to the escape outline . returning now to fig1 a , in step s 1005 , the designer employs the design editing module 905 to edit a trace that extends from a pin of the component object . as used herein , the term “ edit ” is intended to encompass both creating a new trace and modifying an existing trace . also , as used herein , the term “ extend ” is intended to encompass both a direct electrical connection and an indirect electrical connection through one or more intermediary vias or traces . thus , a trace extending from a pin , as described herein , may extend directly from that pin , or may be connected to the pin through a via which itself is connected to the pin through another trace ( or a combination of multiple vias and traces ). next in step s 1009 , the design editing module 905 provides the trace edit to the escape trace identification module 909 . in response , the escape trace identification module 909 determines if the end of the trace is within a threshold distance of the perimeter of the escape outline ( more particularly , the perimeter of the escape outline for the layer in which the trace is routed ). if the end of the trace is within the threshold distance of the perimeter of escape outline , then the escape trace identification module 909 instructs the design editing module 905 to “ snap ” the trace to the escape outline . for example , the design editing module 905 may shorten or extend the trace so that the unconnected end of the trace is positioned on the perimeter of the escape outline . it should be noted that this type of “ snap ” commonly employed in computer - aided design programs , such as the visio design program available from microsoft corporation of redmond , wash . moreover , any desired technique for implementing this type of “ snap ” operation may be employed according to various embodiments of the invention . accordingly , the implementation of the “ snap ” operation will not be discussed in further detail . returning now to fig1 b , in step s 1015 the escape trace identification module 909 determines if the trace intersects the escape outline . more particularly , the escape trace identification module 909 determines if the trace crosses over the perimeter of the escape outline or if the end of the trace falls on the perimeter of the escape outline . if the trace does intersect the escape outline , then in step s 1017 the escape trace identification module 909 determines that the trace is an escape trace for the component object . with some implementations of the invention , the escape trace identification module 909 may determine that the entire trace is an escape trace . alternately , with other implementations of the invention , the escape trace identification module 909 may determine that one the portion of the trace falling within the perimeter of the escape outline is an escape trace . if the trace does not intersect the escape outline , then in step s 1019 the escape trace identification module 909 determines that the trace is not an escape trace for the component object . with various implementations of the invention , each of steps s 1015 through s 1017 may be performed for each trace extending from a pin of the component object as it is edited . the escape trace identification module 909 may , for example , update a boolean flag value for the trace after it has been edited . with still other examples of the invention , however , steps s 1015 through s 1017 may be performed concurrently for every trace extending from a pin of the component object . for example , with some implementations of the invention , the escape trace identification module 909 may postpone performing steps s 1015 through s 1017 until , e . g ., a designer makes an edit to the printed circuit board design that would implicate all of the escape traces for the component object , such as a rotation or movement of the component object . the design editing module 905 would then perform steps s 1015 through s 1017 for each trace extending from a pin of the component object concurrently , identifying the escape traces for the component object at the same time . it also should be noted that , while a “ snap ” operation is described above and illustrated in fig1 b , various embodiments of the invention may omit this feature . that is , various embodiments of the invention may not provide a snap operation , and may instead require a designer to specifically intersect a trace with the escape outline for that trace to be identified as an escape trace by the escape trace identification module 909 . while the use of escape outlines can assist a designer in manually creating escape traces , as discussed in detail above , various examples of invention may alternately or additionally facilitate the automatic routing of escape traces using an autorouting operation . for example , rather than manually routing each escape trace to ( or through ) a point on the escape outline , a designer may instead simply designate a variety of connection points on the escape outline . based upon these connection points , an autorouting operation can then automatically route traces from pins of the affiliated component object to a corresponding connection point . this aspect of various embodiments of the invention will be discussed with reference to the flowchart shown in fig1 . initially , in step s 1201 , the designer defines an escape outline affiliated with a component object , as discussed in detail above . as previously noted , the perimeter of the escape outline may have any desired shape . as also discussed in detail above , the escape outline may have a perimeter on multiple layers of a printed circuit board design . next , in step s 1203 , the designer designates one or more connection points along the perimeter ( or perimeters ) of the escape outline , such that each connection point corresponds to a particular pin of the component object . for example , a designer may create a connection point , c 12 , which corresponds with pin p 12 of the component object . the designer may then create a second connection point , c 637 , which corresponds with pin p 637 of the component object . next , in step s 1205 , the design editing module 905 employs an autorouting operation to automatically route breakouts from the pins of the component object to their corresponding connection points along the perimeter ( or perimeters ) of the escape outline . thus , the design editing module 905 will automatically route a breakout from the pin p 12 to the connection point c 12 . it also will automatically route another breakout from the pin p 637 to the connection point c 637 . in this manner , the designer can create a connection point for each pin of the object component that will be connected to another component object . in response , the design editing module 905 ( or any other desired routing tool with automatic breakout routing capability ) will automatically create a breakout from each pin to its corresponding connection point . moreover , by specifying the location of each connection point , the designer can control where the breakout terminates . for example , if the designer wishes to connect the pin p 12 to another device that positioned to the left of the component object , then the designer can locate the connection point c 12 on the left side of the perimeter of the escape outline . similarly , if the designer wishes to connect the pin p 637 to another device that positioned to the right of the component object , then the designer can locate the connection point c 637 on the right side of the perimeter of the escape outline . in addition to directing breakouts in particular directions , a designer can order the connection points along the perimeter of an escape outline to effectively reorder the corresponding pins of the component object . this may be particularly useful for , e . g ., application specific integrated circuits , since the pin outputs of this circuit cannot ordinarily be changed as with connectors or field programmable gate array circuits . further , by allowing a designer to place connection points along perimeters of the escape outline in different layers of the printed circuit board design , various embodiments of the invention may assist an autorouting operation to create breakouts including one or more vias to those different layers . thus , as will be appreciated from the above description , the escape outline features provided by various implementations of the invention can assist a designer in creating escape traces for breakouts of a component object . by employing various aspects of the invention , a designer can create a breakout for every desired pin of a component object , as illustrated in fig1 c . once the breakouts have been routed , a designer can then perform a second routing operation to route traces from the breakouts to other component objects . because the breakouts extend outside of the dense pin area of the component object , however , this second routing operation typically will be much simpler than attempting to route traces directly to each relevant pin of the component object . moreover , because the escape traces of the breakouts extend to or through the escape outline , escape traces of breakouts can be readily distinguished from hanger traces that extend from pins of the component object , but which were not created to extend those pins to any particular net . as noted above , in addition so simply identifying escape traces , various implementation of the invention may employ an escape outline to associate desired properties with the identified escape traces . for example , with various examples of the invention , a designer can specify a minimum width for escape traces identified by the escape outline that is different from other traces ( e . g ., non - breakout traces ). similarly , a designer may specify a minimum trace clearance for escape traces identified by the escape outline that are different from other , traces . still further , the designer can specify that escape traces ( or breakouts containing escape traces ) identified by the escape outline be moved or otherwise manipulated with their corresponding component object . thus , if a designer rotates or inverts a component object , the escape traces ( or breakouts containing escape traces ) extending from pins of that component object will similarly be rotated and / or inverted , so as to maintain their routing relative to the component object . similarly , if a designer moves a component object , the escape traces ( or breakouts containing escape traces ) extending from pins of that component object will similarly be moved , to maintain their routing relative to the component object . non - escape traces , on the other hand , may be left in their original position and orientation . additionally , various implementations can ensure that an identified escape trace will continue to be treated as an escape trace unless the designer specifically indicates otherwise . for example , some editing tools provide a “ push and move ” or similar feature that automatically edits a trace in response to the designer editing an adjacent trace . thus , if a designer “ pushes ” a portion of a trace in a leftward direction , these editing tools will automatically push the portions of one or more adjacent traces in a similar manner , in order to maintain a minimum separation distance between the traces . with various implementations of the invention , if these adjacent traces are identified escape traces , then the editing tool will modify these identified escape traces so that they continue to extend to or through the escape outline ( and thus will continue to be identified as escape traces ). further , various implementations of the invention may prevent traces from having corners or otherwise being routed along a perimeter of an escape outline . in addition to associating properties with escape traces , various implementations of invention may be used to associate various properties with non - escape traces ( e . g ., hangers ) falling within a perimeter of the escape outline . for example , in addition to providing a minimum width and / or minimum spacing properties for escape traces , various implementations of the invention may permit a designer to specify minimum width and / or minimum spacing properties for all traces falling within a perimeter of an escape outline , including hangers . still further , various implementations of the invention may allow a designer to specify that traces within a perimeter of an escape outline be treated differently than traces that exist outside the perimeter ( or perimeters ) of the escape outline . for example , if a designer activates an automatic operation that globally removes hangers from the printed circuit board design , the designer may specify that hangers existing with a perimeter of an escape outline be exempted from removal . in addition to associating properties with escape traces or other traces within an escape outline , some implementations of the invention may further allow a designer to associate different properties with escape traces or other traces within an escape outline depend upon the layer in which those traces are routed . for example , a designer may assign a first set of properties to escape traces or other traces falling within the perimeter of an escape outline in a first layer of the printed circuit board design . the designer may then assign a second set of properties to escape traces or other traces falling within another perimeter of the escape outline in a second layer of the printed circuit board design . while various aspects of the invention have been discussed above with regard to the creation of a new escape outline , it should be appreciated that some implementations of the invention may provide pre - configured escape outlines . for example , according to some implementations of the invention , an object component may included as part of a library item retrieved from a library . with these implementations , the library item also may include a pre - defined escape outline for the component object . further , the library item also may include pre - routed escape traces that extend to or through the escape outline . with these implementations of the invention , the escape outline can still be used to associate desired properties with escape traces or other traces falling within the escape outline , as discussed above . alternately or additionally , a designer may use a predefined escape outline to control editing of escape traces or other traces within the escape outline , as also discussed above . still further , some implementations may allow the designer to modify the perimeters or other aspects of a pre - defined escape outline as desired . it should be noted that , while an escape outline has been described above with response to a single component object , a designer may employ a plurality of escape outlines in a printed circuit board design , each affiliated with a different component object . accordingly , each escape outline typically will identify escape traces for pins of only its affiliated component object . some implementations of the invention may allow a designer to specify different properties for each escape outline , while still other implementations of the invention may alternately or additionally allow a designer to specify one or more global properties for multiple escape outlines . while different implementations of the invention can assist a designer in creating and identifying breakouts , various examples of the may alternately or additionally assist a designer in organizing netlines for traces the include or connect to breakouts . for example , as discussed above , the use of breakouts may reduce the effectiveness of netline optimization analysis . while a netline optimization analysis can be performed at anytime during the design of a printed circuit board , it typically is performed as part of the task of placing component objects in a printed circuit board design . moreover , netline optimization analysis is usually completed before general routing of traces in the printed circuit board design is begun . referring back to fig2 , this figure shows how pins of a component object were reconfigured to prevent the netlines from crossing , to thereby simplify the process for routing traces to the pins . when breakouts extending from these pins subsequently are created , however , the breakouts may undo or otherwise frustrate the routing advantages provided by reconfiguring the pins based upon a netline optimization analysis . this potential disadvantage to employing breakouts is illustrated in fig6 , which show netlines extending from the endpoints of the breakouts rather than the pins . as previously noted , crossing netlines indicate the that corresponding traces would either need to be routed through different layers of the printed circuit board , require a relatively complex routing path , or both . various embodiments of the invention may address this potential disadvantage of using breakouts by treating the ends of breakouts as pseudo - pins . these pseudo - pins are then mapped to a netline optimization analysis rather in place of the actual pins from which the breakouts extend . by performing a pin - swapping operation based upon these pseudo - pins rather than the corresponding pins of the component object , the pin - swapping operation can minimize the likelihood that traces extending from the breakouts will cross . fig1 illustrates an example of a pseudo - pin mapping tool 1301 that may be employed according to various examples of the invention . as seen in this figure , the pseudo - pin mapping tool 1301 includes a breakout identification module 1303 and a breakout endpoint determination module 1305 . the pseudo - pin mapping tool 1301 may receive a printed circuit board design from , e . g ., a design storage 911 . the design storage 911 typically will be implemented by a magnetic disc , such as the type employed by a magnetic hard disc drive . of course , the design storage 911 alternately may be implemented by any desired memory medium , including , for example , a magnetic disc , an optical disc , a flash or other solid state memory device , including a ram or rom memory device , or some combination of these devices . further , while the design storage 911 is shown as separate from the pseudo - pin mapping tool 1301 in fig1 , it should be appreciated that some or all of the design storage 911 may be incorporated into the pseudo - pin mapping tool 1301 . as will be explained in more detail , the pseudo - pin mapping tool 1301 provides pseudo - pin information to a pin - swapping module 1307 . the pin - swapping module may employ any desired conventional pin - swapping tool , such as the pin - swapping tool provided in the io designer family of printed circuit board design tools available from mentor graphics corporation of wilsonville , oreg . the pin - swapping module 1307 then performs a netline optimization analysis using the pseudo - pin information , and swaps the corresponding pins in the printed circuit board design accordingly . it should be noted that , while the pin - swapping module 1307 also is shown as separate from the pseudo - pin mapping tool 1301 in fig1 , some or all of the pin - swapping module 1307 may be incorporated into the pseudo - pin mapping tool 1301 . the operation of the pseudo - pin mapping tool 1301 will be discussed in more detail with regard to the flowchart illustrated in fig1 . initially , in step s 1401 , the breakout identification module 1303 receives trace information for a component object . next , in step s 1403 , the breakout identification module 1303 identifies the breakouts for the component objects . with various examples of the invention , the breakout identification module 1303 may simply identify any trace extending from a pin of the object component as part of a breakout . still other examples of the invention may identify only those traces extending from a pin of the object component that have a minimum length as part of a breakout . still other implementations of the invention , however , may additionally provide an escape outline for the object component . with these implementations of the invention , the breakout identification module 1303 can easily identify the escape traces of breakouts as discussed in detail above . next , in step s 1405 , the breakout endpoint determination module 1305 identifies an endpoint for each breakout . for those examples of the invention that do not implement escape outlines ( or where an escape outline has not been provided for the component object ), the breakout endpoint determination module 1305 may simply determine the endpoint of a breakout as the end point of the trace in the breakout extended furthest from the object component . where , however , an embodiment of the invention provides an escape outline for the object component , the breakout endpoint determination module 1305 may easily identify the endpoint of the breakout as the point at which a trace of the breakout intersects a perimeter of the escape outline . in step s 1407 , the breakout endpoint determination module 1305 provides pseudo - pin information , including the endpoint for each breakout to the pin from which the breakout extends , to the pin - swapping module 1307 . that is , the breakout endpoint determination module 1305 designates the identified endpoint of the breakout as a pseudo - pin , and provides the location of this pseudo - pin to the pin - swapping module 1307 . the pseudo - pin is information will also include the name of the actual component object pin represented by the pseudo - pin . with various examples of the invention , the pseudo - pin information also may include other information , such as the name of the net to which the object component pin should be connected , layer information for the pseudo - pin where the breakout may traverse multiple layers , the name of the signal to be conveyed by the breakout , etc . in response to receiving the pseudo - pin information from the breakout endpoint determination module 1305 , the pin - swapping module 1307 will perform a netline optimization analysis using the pseudo - pins provided by the pseudo - pin mapping tool 1301 , rather than the actual pins of the component object . as known in the art , conventional pin - swapping routines for netline optimization currently build structures that represent a map of the pins of an object component and their associated netlines . if an actual pin has a corresponding pseudo - pin , however , then the pin - swapping module 1307 will use include the location of the pseudo - pin in its map rather than the actual pin . as the pin - swapping operation is performed based upon the netline optimization analysis , the pseudo - pin mapping tool 1301 can then use the pseudo - pin information to determine which actual pins of the component object should be reordered to optimize the netline arrangement . for example , the pin - swapping module 1307 may create a first netline extending from a pseudo - pin p 21 ′ and a second netline extending from a pseudo - pin p 365 ′. in the course performing a netline optimization analysis to optimize the arrangement of the netlines , the pin - swapping module 1307 may determine that the location of pseudo - pin p 21 ′ should be swapped with the location of pseudo - pin p 365 ′. in response , the pseudo - pin mapping tool 1301 can then correctly swap the actual pin p 21 with the actual pin p 365 . in this manner , the actual pins of the component object can be reordered so as to reduce the likelihood that their corresponding breakouts will create crossing netlines , as illustrated in fig1 . while the invention has been described with respect to specific examples including presently preferred modes of carrying out the invention , those skilled in the art will appreciate that there are numerous variations and permutations of the above described systems and techniques that fall within the spirit and scope of the invention as set forth in the appended claims . for example , while specific terminology has been employed above to refer to electronic design automation processes , it should be appreciated that various examples of the invention may be implemented using any desired combination of electronic design automation processes . | 6 |
the image forming apparatus according to an embodiment of the present invention will now be described with reference to the drawings . fig1 is a block diagram for explaining a color digital copying machine 1 comprising a scanner section , as one example of an image scanning apparatus of the present invention . as shown in fig1 , the color digital copying machine 1 comprises a control section ( cpu ) 101 , a scanner section 102 having an automatic document feeder ( adf ) 17 described below , a color printer section 103 , and an operation panel 104 , and is connected to an external apparatus 106 such as a personal computer , via a line 105 such as a lan . the control section ( cpu ) 101 is to control the whole color digital copying machine 1 . the scanner section 102 is to read the image information of an object to be copied ( not shown ) placed on a document table by the automatic document feeder ( adf ) 17 as contrast of light , to thereby generate an image signal . the color printer section 103 is to form an image corresponding to the image signal supplied from the scanner section 102 or the external apparatus 106 . fig2 and 3 are diagrams showing the inner structure , respectively , for explaining the color digital copying machine 1 . on the upper part of the apparatus body 10 , the automatic document feeder ( hereinafter referred to as “ adf ”) 17 which also serves as a cover , and feeds a document in sheet form one by one , is provided so as to be freely opened or closed . a platen may be attached as the cover instead of this adf 17 . on the front upper face of the apparatus body 10 , there is provided an operation panel 104 comprising various operation keys for instructing copying conditions and copy start or setting the magnification , and various displays . on the right side of the apparatus body 10 , a paper feed cassette 57 which can store paper in a small quantity , and a large capacity paper feed cassette 55 which can store paper in a large quantity are provided respectively detachably . the paper feed cassette 57 comprises a manual feed tray 56 to supply paper manually . on the lower part of the apparatus body 10 , there are provided paper feed cassettes 52 , 53 and 54 detachably . in each paper feed cassette , sheets of paper in the same size are stored in the horizontal direction and in the vertical direction , so as to be selected according to need . on the left side of the apparatus body 10 , there is provided a finisher 80 to receive copied paper . in the apparatus body 10 , there are provided the scanner section 102 as obtaining means for obtaining image data , and the color printer section 103 as image forming means , for realizing the copying function and the facsimile function . on the upper face of the apparatus body 10 , there are arranged a document table 13 comprising a transparent glass , on which an object to be scanned , that is , a document d is placed , and the adf 17 for automatically feeding the document d onto this document table 13 . this adf 17 is arranged freely openably with respect to the document table 13 , and also functions as a cover for bringing the document d placed on the document table 13 into intimate contact with the document table 13 . the adf 17 comprises a document tray 8 where the document d is set , an empty sensor 9 which detects the presence of the document , a pick - up roller 14 to pick up the document d one by one from the document tray 8 , a feed roller 15 for carrying the picked up document d , a registration roller pair 16 for registering the tip of the document d , a registration sensor ( not shown ) provided on the upstream side of the registration roller pair 16 to detect when the document d arrives , a size sensor ( not shown ) to detect the size of the document d , and a carrier belt 18 arranged so as to cover substantially the whole document table 13 . plural sheets of documents set upwards in the document tray 8 are picked up sequentially from the lowest paper , that is , from the last page , registered by the registration roller pair 16 , and then transferred to a predetermined position on the document table 13 by the carrier belt 18 . in the adf 17 , a reversing roller 20 , a non - reversing sensor 21 , a flapper 22 , and a feeder output roller 23 are arranged at the end portion on the side opposite to the registration roller pair 16 , putting the carrier belt 18 therebetween . the document d whose image information has been scanned by the scanner section 102 described later is carried from the document table 13 by the carrier belt 18 , onto a document ejection section 24 on the upper face of the adf 17 , via the reversing roller 20 , the flapper 22 , and the feeder output roller 23 . in the case of scanning the reverse of the document d , by changing over the flapper 22 , the document d carried by the carrier belt 18 is reversed by the reversing roller 20 , and carried again to a predetermined position on the document table 13 by the carrier belt 18 . the adf 17 comprises a paper feed motor to drive the pick - up roller 14 , the feed roller 15 and the registration roller pair 16 , and a carrier motor to drive the carrier belt 18 , the reversing roller 20 , and the feeder output roller 23 . the scanner section 102 arranged in the apparatus body 10 has , as shown in fig2 and 4 , a light source 25 , such as a fluorescent lamp , to illuminate the document d placed on the document table 13 , and a first mirror 26 to deflect the reflected light from the document d to a predetermined direction . these light source 25 and first mirror 26 are mounted on a first carriage 27 arranged below the document table 13 . on this first carriage 27 , there is mounted the size sensor 28 to detect the size of the document placed on the document table 13 . the first carriage 27 is movably arranged parallel with the document table 13 , and is moved back and forth below the document table 13 , by a drive motor via a toothed belt or the like ( not shown ). moreover , a second carriage 29 is movably arranged parallel with the document table 13 , below the document table 13 . on the second carriage 29 , there are mounted a second mirror 30 and a third mirror 31 at a right angle with respect to each other , which sequentially deflects the reflected light from the document d , which has been deflected by the first mirror 26 . the second carriage 29 is driven with respect to the first carriage 27 by a toothed belt which drives the first carriage 27 , and is also moved parallel with the first carriage 27 along the document table 13 , at a rate of half the rate of the first carriage 27 . also , below the document table 13 , there are arranged an image formation lens 32 which focuses the reflected light from the third mirror 31 on the second carriage 29 , and a ccd line sensor 34 comprising three ccd line sensors 34 a , 34 b and 34 c , which receives the reflected light focused by the image formation lens 32 and performs photoelectric exchange therewith . the image formation lens 32 is arranged movably via a drive mechanism within a plane including the optical axis of the light deflected by the third mirror 31 , and forms an image of the reflected light at a desired magnification ( in the horizontal scanning direction ). the ccd line sensors 34 a , 34 b and 34 c photoelectrically exchange the incident reflected light , in accordance with a shift gate signal and an image processing clock ( transfer clock ) provided from a red color signal processing section ( salt ) 122 , a green color signal processing section ( salt ) 123 and a blue color signal processing section ( salt ) 124 , and outputs an electric signal corresponding to the scanned document d . the magnification in the vertical scanning direction can correspond thereto , by changing the transfer speed by means of the adf 17 or the moving speed of the first carriage 27 . the light from the light source 25 respectively corresponds to the ccd line sensors 34 a , 34 b and 34 c , and a difference in the scanning timing is corrected by means of the shift gate signal , a timing of the transfer clock and a circuit in the latter step . when the document d carried by the adf 17 is scanned , the irradiation position of the light source 25 is fixed to a position shown in fig1 . moreover , when the document d placed on the document table 13 is scanned , the irradiation position of the light source 25 is shifted from the left to the right along the document table 13 . on the other hand , the color printer section 103 comprises a laser exposure apparatus 40 serving as the exposure means . the laser exposure apparatus 40 comprises a semiconductor laser 41 as a light source , a polygon mirror 36 as a scanning member which continuously deflects the laser beam emitted from the semiconductor laser 41 , a polygon motor 37 as a scanning motor which rotates and drives the polygon mirror 36 at a predetermined number of revolution described later , and an optical system 42 which deflects and guides the laser beam from the polygon mirror 36 to photosensitive drums 44 a to 44 d described above . the laser exposure apparatus 40 having such a construction is secured and supported by a support frame ( not shown ) of the apparatus body 10 . the semiconductor laser 41 is on / off controlled according to the image information of the document d scanned by the scanner section 102 , and this laser beam is respectively directed to the photosensitive drums 44 a to 44 d via the polygon mirror 36 and the optical system 42 , and by scanning the peripheral face of the photosensitive drums 44 a to 44 d , an electrostatic latent image is formed on the peripheral face of each photosensitive drums 44 a to 44 d . the image forming section 12 has the freely rotatable photosensitive drums 44 a to 44 d as an image carrier arranged substantially in the center of the apparatus body 10 , and a desired electrostatic latent image is exposed and formed on the peripheral face of each photosensitive drums 44 a to 44 d , by the laser beam from the laser exposure apparatus 40 . on the periphery of the photosensitive drums 44 a to 44 d , there are arranged sequentially : electrification chargers 45 which respectively charge the peripheral face of the photosensitive drums 44 a to 44 d to a predetermined charge ; developers 46 which supply toner as a developer to the electrostatic latent image formed on the peripheral face of the photosensitive drums 44 a to 44 d to develop the image at a desired image density ; peeling chargers 47 to separate a material to be transferred ( recording medium ) that is , the copy paper p fed from a paper feed cassette 52 , 53 , 54 , 55 or 57 from the photosensitive drums 44 a to 44 d ; transfer chargers 48 which make the toner image formed on the photosensitive drums 44 a to 44 d to be transferred onto the paper p ; a peeling claw ( not shown ) which peels the copy paper p from the peripheral face of the photosensitive drums 44 a to 44 d ; cleaning devices 50 which clean the toner remaining on the peripheral face of the photosensitive drums 44 a to 44 d ; and discharging devices 51 which discharge the peripheral face of the photosensitive drums 44 a to 44 d . image forming units 45 a to 45 d are constituted of each above described photosensitive drum 44 a ( 44 b to 44 d ) and each peripheral equipment , respectively . in this example of the invention , in order to overlap four colors of the y image , m image , c image and b image , from the upstream side in the direction that an optional point of the carrier belt 67 is moved , that is , in the direction that the copy paper p is carried , each image forming unit 45 a to 45 d is arranged in the order of y , m c and b . in the lower part of the apparatus body 10 , the paper feed cassettes 52 , 53 and 54 capable of being pulled out from the apparatus body 10 , respectively , are arranged in the laminated state , and copy paper having a different size is loaded in each cassette 52 , 53 and 54 . the large - capacity paper feed cassette 55 is provided by the side of these cassettes 52 , 53 and 54 , and in this large - capacity paper feed cassette 55 , copy paper having a size which is most frequently used , for example , a4 size copy paper is stored in an amount of about 3000 sheets . moreover , above the large - capacity paper feed cassette 55 , the paper feed cassette 57 also serving as the manual tray 56 is detachably mounted . in the apparatus body 10 , there is formed a carrier passage 58 extending from each cassette through a transfer section located between photosensitive drums 44 a to 44 d and the transfer chargers 48 , and at the end of the carrier passage 58 , there is provided a fixation apparatus 60 . on the sidewall of the apparatus body 10 facing the fixation apparatus 60 , an ejection port 61 is formed , and the finisher 80 is mounted in the ejection port 61 . in the vicinity of the paper feed cassettes 52 , 53 , 54 , 55 and 57 , a pick - up roller 63 which picks up the paper from the cassette one by one is provided , respectively . in the carrier passage 58 , there are provided a plurality of feed roller pairs 64 which carry the copy paper p picked up by the pick - up roller 63 through the carrier passage 58 . on the upstream side of the photosensitive drums 44 a to 44 d in the carrier passage 58 , a resist roller pair 65 is provided . the resist roller pair 65 corrects the inclination of the picked up copy paper p , registers the end of the toner image on the photosensitive drums 44 a to 44 d with the end of the copy paper p , and feeds the copy paper p to the transfer section at the same speed as the moving speed of the peripheral face of the photosensitive drums 44 a to 44 d . this side of the resist roller pair 65 , that is , on the feed roller 64 side , an aligning sensor 66 which detects the arrival of the copy paper p is provided . the copy paper p picked up one by one from each cassette by the pick - up roller 63 is carried to the resist roller pair 65 by the feed roller pair 64 . then , after the end of the copy paper p is registered by the resist roller pair 65 , the copy paper p is carried to the transfer section by the carrier belt ( transfer belt ) 67 . in the transfer section , the developer image formed on the photosensitive drums 44 a to 44 d , that is , the toner image is transferred to the paper p by the transfer charger 48 . the copy paper p on which the toner image has been transferred is peeled off from the periphery of the photosensitive drums 44 a to 44 d by the action of the peeling charger 47 and the peeling claw ( not shown ), and carried to the fixation apparatus 60 via the carrier belt 67 which constitutes a part of the carrier passage 58 . then , after the developer image has been fused and fixed on the copy paper p by the fixation apparatus 60 , the copy paper p is ejected to a feeder output tray 81 of the finisher 80 via the ejection port 61 by the feed roller pair 68 and the ejection roller pair 69 . below the carrier passage 58 , there is provided an automatic reversing apparatus ( add ) 70 which reverses the copy paper p having passed the fixation apparatus 60 and sends it again to the resist roller pair 65 . the automatic reversing apparatus 70 comprises a temporary accumulation section 71 which accumulates the copy paper p temporarily , a reversing passage 72 separated from the carrier passage 58 , which reverses the copy paper p having passed the fixation apparatus 60 and guides to the temporary accumulation section 71 , a pick - up roller 73 which picks up the copy paper p accumulated in the temporary accumulation section one by one , and a feed roller 75 which feeds the picked up paper to the resist roller pair 65 via a carrier passage 74 . moreover , at the branching section of the carrier passage 58 and the reversing passage 72 , there is provided a distribution gate 76 which selectively distributes the copy paper p to the ejection port 61 or to the reversing passage 72 . in the case where two - sided copy is to be performed , the copy paper p having passed the fixation apparatus 60 is guided to the reversing passage 72 by the distribution gate 76 , and temporarily accumulated in the temporary accumulation section 71 in the reversed state , and then carried to the resist roller pair 65 via the carrier passage 74 , by the pick - up roller 73 and the feed roller pair 75 . after having been registered by the resist roller pair 65 , the copy paper p is carried again to the transfer section , so that the toner image is transferred to the back face of the copy paper p . thereafter , the copy paper p is ejected to the feeder output tray 81 in the finisher 80 , via the carrier passage 58 , the fixation apparatus 60 and the ejection roller 69 . by using this automatic reversing apparatus 70 , it is also possible to eject the paper with the printed face of the paper facing downwards . that is to say , at first , the image is transferred and fixed on the surface of the paper in the manner that the two - sided copy is performed , the paper is accumulated temporarily in the temporary accumulation section 71 , passed through the carrier passage 74 by the pick - up roller 73 and the feed roller pair 75 and registered by the resist roller pair 77 , and then , ejected to the feeder output tray 81 in the finisher 80 , via the carrier passage 58 , the fixation apparatus 60 and the ejection roller 69 . the three ccd line sensors 34 a , 34 b and 34 c described above are for red , for green and for blue in the order of from the bottom , as shown in fig5 . for example , the ccd line sensors 34 a , 34 b and 34 c are configured to have 8000 pixels , respectively , and arranged on one printed board , parallel therewith . the size per one pixel of the ccd line sensors 34 a , 34 b and 34 c is 8 × 8 μm , and the number of pixels in one line is 8000 . the 8000 pixels are constituted of an effective pixel area formed by 7500 pixels , and a dummy pixel area formed by 250 pixels on the both sides thereof . the interval between the ccd line sensors 34 a , 34 b and 34 c for each color is 64 μm , and it corresponds to an 8 - line interval , calculated as the number of pixels of the ccd line sensors 34 a , 34 b and 34 c . at this time , the 8 lines in the document d on the document table 13 correspond to 8 lines per 42 . 3 μm , as shown in fig4 . at the time of scanning by the adf 17 at the equal magnification , movement of the document d by 42 . 3 μm corresponds to one line . therefore , in the case where the original image is scanned at the equal magnification , there is a difference of 8 lines in the vertical scanning direction , at the document scanning position between the ccd line sensors 34 a , 34 b and 34 c for each color . hence , in order to obtain the image information for the same line in the original image , this line difference has to be corrected in the data . therefore , in the case where the original image is scanned at the equal magnification , the ccd line sensors 34 a , 34 b and 34 c for each color scan the image of the original image away from each other by 8 lines . hence , it is necessary to correct the line difference in the data , in order to obtain the image information for the same line on the original image . if it is assumed that the scanning order of the same line in the original image is in the order of from red to green to blue ( in the order of from the ccd line sensor 34 a , 34 b and 34 c ), in order to obtain the image data for the same line with the image that is now being scanned with the blue ccd line sensor , the green image needs only to be delayed by 8 lines , and the red image needs only to be delayed by 16 lines . moreover , when an enlarged image at 400 % is to be obtained by changing the shift speed of the scanning position to ¼ , it is necessary to delay the green image by 32 lines , and the red image by 64 lines . conversely , when a reduced image at 50 % is to be obtained by making the shift speed double , the green image needs only to be delayed by 4 lines , and the red image by 8 lines . the ccd line sensors 34 a , 34 b and 34 c are configured by photodiodes 110 r , 110 g and 110 b , shift gates 111 r , 111 g and 111 b , ccd analog shift registers 112 r , 112 g and 112 b , and output buffers 113 r , 113 g and 113 b , as shown in fig6 . the photodiodes 110 r , 110 g and 110 b are to perform photoelectric exchange of the original image , and the photoelectrically exchanged electric charge for each pixel is respectively output to the shift gates 111 r , 111 g and 111 b . the shift gates 111 r , 111 g and 111 b are to transfer the photoelectrically exchanged electric charge to the ccd analog shift registers 112 r , 112 g and 112 b , respectively , based on the shift gate signals sh - r , sh - g and sh - b , shown in fig7 a . the shift gate signals sh - r , sh - g and sh - b are output by the red color signal processing section ( salt ) 122 , the green color signal processing section ( salt ) 123 and the blue color signal processing section ( salt ) 124 , for each light accumulation time ( tint ) for one line . the shift gate signals sh - r , sh - g and sh - b can be supplied independently for each shift gate 111 r , 111 g and 111 b , to thereby independently control the transfer timing . the ccd analog shift registers 112 r , 112 g and 112 b output the electric charge for one line sequentially pixel by pixel to the output buffers 113 r , 113 g and 113 b , based on the transfer clock ( charge transfer clock ) φ 1 r , φ 2 r , φ 1 g , φ 2 g , φ 1 b and φ 2 b shown respectively in fig7 b to 7e . the transfer clock φ 2 r ( φ 2 g , φ 2 b ) are the reversed phase ( opposite phase ) of the transfer clock φ 1 r , ( φ 1 g , φ 1 b ). the transfer clock φ 1 r , φ 2 r , φ 1 g , φ 2 g , φ 1 b and φ 2 b are supplied from a clock generation section ( not shown ), so as to be supplied independently for each ccd analog shift register 112 r , 112 g , 112 b , so that the transfer timing can be controlled separately . the output buffers 113 r , 113 g and 113 b are to output the electric charge transferred , respectively , from the ccd analog shift registers 112 r , 112 g and 112 b as a voltage signal ( ccd output signal ), as shown in fig7 f . for example , the ccd output signal is in the order of from an idle portion , an optical shield portion , a dummy pixel portion , an effective pixel portion , a dummy pixel portion and an idle portion , between the shift gate signals . these ccd line sensors 34 a , 34 b and 34 c perform scanning processing , taking into consideration a difference in the scanning timing in the horizontal scanning direction and in the vertical scanning direction . fig8 shows the relation of the pitch ( line ) between the respective ccd line sensors 34 a , 34 b and 34 c , based on the scaling magnification described above . the interval between the ccd line sensor 34 a and the ccd line sensor 34 b , and the interval between the ccd line sensor 34 b and the ccd line sensor 34 c respectively change as follows according to the magnification . for example , when the magnification is 95 %, the interval therebetween is 7 . 6 lines ; when 96 %, 7 . 68 lines ; when 97 %, 7 . 76 lines ; when 98 %, 7 . 84 lines ; when 99 %, 7 . 92 lines ; when 100 %, 8 lines ; when 101 %, 8 . 08 lines ; when 102 %, 8 . 16 lines ; when 103 %, 8 . 24 lines ; when 104 %, 8 . 32 lines ; when 105 %, 8 . 4 lines ; and when 106 %, 8 . 48 lines . also , the pitch ( interval between sensors ) gradually changes by 1 % in the range of from 25 % to 400 %, other than the ones described above . the above change occurs because the optical system such as the light source 25 moves in the vertical scanning direction at a different shift speed based on the magnification . the relation of the pitch ( line ) between the respective ccd line sensors 34 a , 34 b and 34 c , based on the scaling magnification described above is registered beforehand in the internal memory 101 a in the control section 101 described later , or in the internal memory 120 a in the scan cpu 120 . next , the circuit construction of the above scanner section 4 will be described with reference to fig9 . that is to say , an scn - cpu 120 is provided as a control section which controls the whole scanner section 4 . this scn - cpu 120 is connected to the control section 101 . to this scn - cpu 120 are connected the red color signal processing section ( salt ) 122 , the green color signal processing section ( salt ) 123 , the blue color signal processing section ( salt ) 124 and an arithmetic unit ( lake ) 125 , via a cpu bus 121 . these respective processing sections are constructed by asic . an output from the above - described ccd line sensor 34 a ( ccd output signal ) is amplified by an amplifier 126 a , and the signal converted to a digital signal by an analog - to - digital converter 127 a is supplied to the red color signal processing section 122 . the red color signal processing section 122 is to output a red color signal ( r ) in a unit of a pixel , which has been subjected to processing such as signal detection in the digital signal of the red color component supplied from the analog - to - digital converter 127 a , level adjustment and mixing ratio adjustment , and this red color signal ( r ) is output to the arithmetic processing section 125 . the red color signal processing section 122 is to output the shift gate signal sh - r to the ccd line sensor 34 a at a different timing in accordance with the magnification supplied from the scn - cpu 120 . an output from the above - described ccd line sensor 34 b ( ccd output signal ) is amplified by an amplifier 126 b , and the signal converted to a digital signal by an a / d converter 127 b is supplied to the green color signal processing section 123 . the green color signal processing section 123 is to output a green color signal ( g ) in a unit of a pixel , which has been subjected to processing such as signal detection in the digital signal of the green color component supplied from the analog - to - digital converter 127 b , level adjustment and mixing ratio adjustment , and this green color signal ( g ) is output to the arithmetic processing section 125 . the green color signal processing section 123 is to output the shift gate signal sh - g to the ccd line sensor 34 b at a different timing in accordance with the magnification supplied from the scn - cpu 120 . an output from the above - described ccd line sensor 34 c ( ccd output signal ) is amplified by an amplifier 126 c , and the signal converted to a digital signal by an analog - to - digital converter 127 c is supplied to the blue color signal processing section 124 . the blue color signal processing section 124 is to output a blue color signal ( b ) in a unit of a pixel , which has been subjected to processing such as signal detection in the digital signal of the blue color component supplied from the analog - to - digital converter 127 c , level adjustment and mixing ratio adjustment , and this blue color signal ( b ) is output to the arithmetic processing section 125 . the blue color signal processing section 125 is to output the shift gate signal sh - b to the ccd line sensor 34 c at a different timing in accordance with the magnification supplied from the scn - cpu 120 . the arithmetic processing section 125 is to perform the arithmetic processing such as white balance and gamma control with respect to each color signal ( r , g , b ) in a unit of a pixel from the red color signal processing section 122 , the green color signal processing section 123 and the blue color signal processing section 124 , and each color signal ( r , g , b ) is output to an image processing section 92 as a result of the processing . moreover , two line memories 125 a and 125 b are connected to the arithmetic processing section 125 . the arithmetic processing section 125 stores a pixel signal delayed in a unit of a line by a delay circuit , in the line memories 125 a and 125 b , at a delay timing corresponding to the magnification supplied from the scn - cpu 120 , thereby the pixel signal can be used for correction of misregistration in a unit of a line of the respective ccd line sensors 34 a , 34 b and 34 c . for example , when a pixel signal for one line is supplied from the blue color signal processing section 124 , the image data of the line supplied from the signal processing section 123 , which is 8 lines ahead , is stored in the line memory 125 a , and the image data of the line supplied from the signal processing section 123 , which is 16 lines ahead with respect to the line supplied from the signal processing section 124 , is stored in the line memory 125 b . as a result , the image data for each color on the same line in the document d is output to the image processing section 140 . when the magnification is 100 %, since the shift gate signals sh - r , sh - g , sh - b are synchronous , each color image data becomes complete by the shift gate signal for 16 times . when the magnification is 106 %, since the shift gate signals sh - r , sh - g , sh - b are asynchronous , and deviated by ½ line , each color image data becomes complete by the shift gate signal for 17 times . to the above - described scn - cpu 120 are connected a scanner motor driver ( sdv ) 126 which drives the scanner motor 16 , a regulator ( lrg ) 127 which controls lighting of the light source 25 , a cooling fan ( fan ) 128 , a platen sensor 129 which detects the existence of a document on the document table 8 , a home position sensor 130 which detects the top position of the document on the document table 8 , and an automatic paper size ( aps ) sensor 131 which detects the size of the document on the document table 8 . in the above - described construction , the scanning processing based on the magnification will now be described . at first , the scanning processing when a copy at magnification setting of 100 % is instructed will be described . that is to say , based on turning on of the copy key , the control section 101 reads 8 lines as a pitch between sensors based on the magnification setting of 100 % from the internal memory 101 a , and outputs it to the scan cpu 120 . as a result , the scan cpu 120 outputs a timing signal of the shift gate signals sh - r , sh - g , sh - b , synchronized with respect to the respective signal processing sections 122 , 123 and 124 . as a result , the signal processing sections 122 , 123 and 124 output the synchronized shift gate signals sh - r , sh - g , sh - b , as shown in fig1 a . moreover , the scan cpu 120 does not set a delay with respect to the output from the signal processing section 122 by means of the arithmetic processing section ( lake ) 125 , and sets a delay for 8 signals of the shift gate signal sh - r with respect to the output from the signal processing section 123 , and sets a delay for 16 signals of the shift gate signal sh - r with respect to the output from the signal processing section 124 . by the above setting , the signal processing sections 122 , 123 and 124 output the shift gate signals sh - r , sh - g , sh - b at the synchronized same timing , respectively . moreover , the transfer clocks φ 1 r , φ 2 r , φ 1 g , φ 2 g , φ 1 b and φ 2 b are supplied at the same timing , as shown in fig1 b and 10c . as a result , the ccd output signal for each color of the ccd line sensors 34 a , 34 b and 34 c becomes image data shifted by 8 lines , as shown in fig1 d , 10 e and 10 f , and guided to the signal processing sections 122 , 123 and 124 . thereby , the signal processing sections 122 , 123 and 124 output the image data in a unit of a line to the arithmetic processing section 125 , synchronous to the respective shift gate signal . moreover , the arithmetic processing section 125 receives the image data for each line of each color of the signal processing sections 122 , 123 and 124 , synchronous to the shift gate signal sh - r , and the image data from the signal processing section 122 is subjected to the delay processing for 16 lines based on the shift gate signal sh - r , and the image data from the signal processing section 123 is subjected to the delay processing for 8 lines based on the shift gate signal sh - r . these delayed image data are stored in the line memories 125 b and 125 a , respectively . that is to say , at present , the image data of the line supplied from the signal processing section 123 which is 8 lines ahead with respect to the line supplied from the signal processing section 124 is stored in the line memory 125 a , and the image data of the line supplied from the signal processing section 123 which is 16 lines ahead with respect to the line supplied from the signal processing section 124 is stored in the line memory 125 b . therefore , when the image data for the blue color of the 17th line is supplied from the signal processing section 124 , based on the shift gate signal sh - r , as shown in fig1 g , the arithmetic processing section 125 outputs the image data for the green color of the 17th line stored in the line memory 125 a , and the image data for the red color of the 17th line stored in the line memory 125 b , together with the image data for the blue color , at the same time to the image processing section 140 , as shown in fig1 h , 10 i and 10 j . next , the scanning processing when a copy at a magnification setting of 106 % is instructed will be described . that is to say , based on turning on of the copy key , the control section 101 reads 8 . 48 lines as a pitch between sensors based on the magnification setting of 106 % from the internal memory 101 a , and outputs it to the scan cpu 120 . as a result , the scan cpu 120 outputs a timing signal of the shift gate signals sh - r , sh - g , sh - b , corresponding to the shift amount based on the above - described pitch between sensors , with respect to the respective signal processing sections 122 , 123 and 124 . as a result , the signal processing sections 122 , 123 and 124 output the shift gate signals sh - r , sh - g , sh - b corresponding to the shift amount , as shown in fig1 a , 11 b and 11 c . at this time , the shift gate signals sh - r and sh - b are shifted substantially by one line , and hence , a synchronized signal is used . moreover , the scan cpu 120 sets a delay for one signal of the shift gate signal sh - r , with respect to the output from the signal processing section 122 by means of the arithmetic processing section ( lake ) 125 , sets a delay for 9 signals of the shift gate signal sh - r with respect to the output from the signal processing section 123 , and sets a delay for 17 signals of the shift gate signal sh - r with respect to the output from the signal processing section 124 . by the above setting , the signal processing sections 122 and 124 output the shift gate signals sh - r and sh - b at the synchronized same timing , respectively , and the signal processing section 123 outputs the shift gate signal sh - g at a timing delayed by ½ line . moreover , the transfer clocks φ 1 r , φ 2 r , φ 1 b and φ 2 b are supplied at the same timing , as shown in fig1 d , 11 e , 11 h and 11 i . the transfer clocks φ 1 g and φ 2 g are supplied at a timing delayed by ½ line , as shown in fig1 f and 11g . as a result , the ccd output signal for each color of the ccd line sensors 34 a , 34 b and 34 c becomes image data shifted by 8 lines , as shown in fig1 j , 11 k and 11 l , and the ccd output signal of the ccd line sensor 34 b is guided to the signal processing section 123 at a timing delayed by ½ line . thereby , the signal processing sections 122 , 123 and 124 output the image data in a unit of line to the arithmetic processing section 125 , synchronous to the respective shift gate signal . moreover , the arithmetic processing section 125 receives the image data for each line of each color of the signal processing sections 122 , 123 and 124 , synchronous to the shift gate signal sh - r . the image data from the signal processing section 122 is subjected to the delay processing for 17 lines based on the shift gate signal sh - r , the image data from the signal processing section 123 is subjected to the delay processing for 8 lines based on the shift gate signal sh - r , and the image data from the signal processing section 124 is subjected to the delay processing for one line based on the shift gate signal sh - r . the delayed image data from the signal processing section 123 is stored in the line memory 125 b , and the delayed image data from the signal processing section 122 is stored in the line memory 125 a . that is to say , at present , the image data of the line supplied from the signal processing section 123 which is 8 lines ahead with respect to the line supplied from the signal processing section 124 is stored in the line memory 125 a , and the image data of the line supplied from the signal processing section 123 which is 16 lines ahead with respect to the line supplied from the signal processing section 124 is stored in the line memory 125 b . therefore , when the image data for the blue color of the 17th line is supplied from the signal processing section 124 , based on the shift gate signal sh - r , shown in fig1 m , the arithmetic processing section 125 outputs the image data for the green color of the 17th line stored in the line memory 125 a , and the image data for the red color of the 17th line stored in the line memory 125 b , together with the image data for the blue color , at the same time to the image processing section 140 , as shown in fig1 n , 11 o and 11 p . as a result , the registered image data is supplied . this registered image data is subjected to the image processing in the image processing section 140 , and thereafter , is printed out in a color printer section 103 . the above example is a case where the magnification is 106 %, and in the case of other magnifications , the processing is performed similarly . as described above , the scanning timing of the ccd line sensor is changed , in accordance with the scanning misregistration amount , thereby enabling accurate correction with respect to the misregistration of less than one line . with the scanner using the color ccd sensor , misregistration of less than one line which occurs at the time of enlargement and reduction can be corrected . moreover , when the magnification is 106 %, since the scanning timing is delayed by ½ line , the mtf is not degraded , and hence image reproduction with fidelity becomes possible . furthermore , by adjusting the timing of the shift gate signal and the transfer clock for each color of the ccd line sensor , that is , by controlling the shift gate signal and the transfer clock , the transfer clock can be output continuously for one line , and hence adaptation for high - speed driving is possible . with respect to the image scanning misregistration of less than one line , the input timing of the shift gate signal to each ccd line sensor of red , green and blue can be controlled corresponding to the scanning misregistration , independently for each ccd line sensor of red , green and blue . furthermore , the input timing of the shift gate signal and the transfer clock to the ccd line sensor can be controlled corresponding to the scanning misregistration , independently for each ccd line sensor of red , green and blue . by designating the shift amount of the shift gate signal as a multiple of the transfer clock , the correction can be performed at accuracy for the number xx of pixels of the ccd line sensor . in the above embodiment , the description has been made of a case where the transfer clock is supplied separately to each ccd line sensor . however , the present invention is not limited thereto , and as shown in fig1 , the operation is similarly performed even in the case where the transfer clocks φ 1 and φ 2 are supplied commonly to each ccd line sensor . in this case , however , as shown in fig1 a , 13 b and 13 c , while the shift gate signals sh - r , sh - g , sh - b are output , the transfer clocks φ 1 and φ 2 halt , as shown in fig1 d and 13e . by the halt of these transfer clocks φ 1 and φ 2 , the output of the ccd output signal for each color of the ccd line sensors 34 a , 34 b and 34 c is interrupted , as shown in fig1 f , 13 g and 13 h . therefore , when the image data for the blue color of the 17th line is supplied from the signal processing section 124 , based on the shift gate signal sh - r , as shown in fig1 i , the arithmetic processing section 125 outputs the image data for the green color of the 17th line stored in the line memory 125 a , and the image data for the red color of the 17th line stored in the line memory 125 b , together with the image data for the blue color , at the same time to the image processing section 140 , as shown in fig1 j , 13 k and 13 l . the above embodiment is for the case where the magnification is 106 %, but is similarly performed for the case where other magnifications are used . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents . | 7 |
next , preferred embodiments of the present invention are explained with reference to the drawings . the following embodiments explain the embodiments in which the present invention is applied to an information recording apparatus for recording information on a dvd - r . at first , a generally physical format for recording record information on the dvd - r and an error correcting process in the record information are explained with reference to fig1 and 2 . the error correcting process in the dvd - r of this embodiment and an ecc block , serving as an error correction unit , in the error correcting process are firstly explained with reference to fig1 a and 1b . generally , the record information recorded on the dvd - r has a physical structure including a plurality of data sectors 20 shown in fig1 a . one data sector 20 is composed of , from a head portion thereof , an id information 21 indicative of a start position of the data sector 20 , an id information error correction code ( iec ) 22 for correcting errors of the id information 21 , a reserve data 23 , a data 24 which is the main data to be recorded , and an error detection code ( edc ) 25 for detecting errors in the data 24 . the record information to be recorded is constituted by a continuous plurality of the data sectors 20 . next , process for constituting the ecc block by the data sectors 20 are explained with reference to fig1 b . when constituting an ecc block 30 by the data sectors 20 , one data sector 20 is firstly divided into plural blocks each of which is 172 bytes data , as shown in fig1 b , and each divided data ( this is hereafter referred to as a “ data block 33 ”) is arranged in a vertical direction ( refer to the left side of fig1 b ). at this time , the data blocks 33 are arranged in 12 lines in the vertical direction . for each data block 33 arranged in the vertical direction , ecc internal code ( pi ( parity in ) sign ) 31 having 10 bytes data is affixed to the end of the data block 33 to constitute one correction block 34 ( refer to right side of fig1 b ). at this stage , the correction blocks 34 to which the ecc internal codes 31 are affixed are arranged in 12 lines in the vertical direction . after that , this process is repeated with respect to 16 data sectors 20 . accordingly , the correction blocks 34 of 192 lines are obtained . then , the correction blocks 34 of 192 lines are divided in the vertical direction from the beginning thereof , for each one byte , in the state that the 192 lines of the correction blocks 34 are arranged in the vertical direction . 16 ecc external codes ( po ( parity out ) signs ) 32 are affixed to each of the vertically divided data blocks . it is noted that the ecc external code 32 is also affixed to a portion of the ecc internal code 31 within the correction block 34 . from the above mentioned process , one ecc block 30 including 16 data sectors 20 is produced as shown in fig1 b ( right side ). at this time , a total amount of the information included within one ecc block 30 is expressed by an equation described below . the actual data 24 ( i . e ., other than ecc codes ) in it is expressed by an equation described below . in the ecc block 30 shown in fig1 b , data of one byte is indicated by [ d #. *]. for example , [ d1 . 0 ] indicates the data of one byte positioned at a first line and a zeroth column , and [ d190 . 170 ] indicates the data of one byte positioned at a 190th line and a 170th column . thus , the ecc internal codes 31 are positioned at 172nd to 181st columns , and the ecc external codes 32 are positioned at 192nd to 207th lines . the correction blocks 34 are consecutively recorded on the dvd - r . the reason why the ecc block 30 is constituted so as to include both the ecc internal code 31 and the ecc external code 32 , as shown in the right side of fig1 b , is that the data arranged in the horizontal direction in fig1 b is corrected by the ecc internal code 31 and the data arranged in the vertical direction is corrected by the ecc external code 32 . that is , it is possible to perform the error correction in both the horizontal and vertical directions within the ecc block 30 shown in fig1 b . thus , the effective and stable error correction can be performed as compared with the error correcting process used in the conventional cd ( compact disk ) and the like . more concretely , for example , even if a certain one of the correction blocks 34 ( as mentioned above , consecutively recorded on the dvd - r and each totally having the data of 182 bytes including the ecc internal codes 31 for one line ) is entirely broken by defect and the like existing on the dvd - r , it is merely the one - byte data break with respect to the ecc external codes 32 at one column , as viewed in the vertical direction . thus , by carrying out the error correction using the ecc external codes 32 at each column , it is possible to appropriately carry out the error correction to restore the original correct information from the broken information , even though one correction block 34 is entirely broken . the manner of actually recording on the dvd - r the data sectors 20 included in the ecc blocks 30 shown in fig1 b is explained with reference to fig2 . in fig2 the data indicated in [ d #. *] corresponds to the data described in the right side of fig1 b . in recording the ecc blocks 30 , on the dvd - r , the ecc blocks 30 are firstly aligned along one line in a horizontal direction for each correction block 34 , as shown in a top stage of fig2 and then are interleaved to be divided into 16 recording sectors 40 . at this time , one recording sector 40 includes information of 2366 bytes (= 37856 bytes / 16 ), and the data sectors 20 and the ecc internal codes 31 and the ecc external codes 32 are included in the manner being mixed with each other in the recording sector 40 . however , the id information 21 ( refer to fig1 a ) in the data sector 20 is positioned at a head portion of each recording sector 40 . the recording sector 40 is divided into a plurality of data 41 each having 91 bytes , and a header h is added to each data 41 . after that , one sync frame 42 is produced from one data 41 by 8 - 16 - modulating the recording sector 40 including the pairs of the header h and the data 41 . at this time , one sync frame 42 is composed of a header h ′ and data 43 . further , an information amount within one sync frame 42 is expressed by an equation described below . then , the information is written to the dvd - r 1 in a form of the continuous sync frames 42 . at this time , one recording sector 40 includes 26 sync frames 42 . by constituting the above explained physical format to record the information on the dvd - r , the 8 - 16 - demodulation and de - interleave ( refer to fig2 ) are performed at the time of reproducing the recorded information to thereby reproduce the original ecc block 30 and to perform the effective error correction to accurately reproduce the information . next , an embodiment of an information recording apparatus , in accordance with the present invention , for recording information on the dvd - r 1 according to the physical format explained with reference to fig1 and 2 is explained with reference to fig3 to 7 . here , the following assumptions are made in the embodiment described below . that is , in the dvd - r 1 , pre - pits carrying address information on the dvd - r 1 and the like are formed in advance on the information tracks , on which the record information is to be recorded . then , in recording the record information , the address information on the dvd - r 1 is obtained by detecting the pre - pits . by this , a record position on the dvd - r 1 where the record information is to be recorded is detected , and then the record information is recorded . a configuration of the information recording apparatus in accordance with the present invention is firstly explained with reference to fig3 . as shown in fig3 an information recording apparatus s of the embodiment is provided with a pick - up 2 , a reproduction amplifier 3 , a decoder 4 , a pre - pit signal decoder 5 , a spindle motor 6 , a servo circuit 7 , a processor 8 , an encoder 9 , a switch 10 , a power control circuit 11 and a laser drive circuit 12 . the pick - up 2 includes a laser diode , a deflection beam splitter , an objective lens , light detectors and the like ( not shown ), and irradiates a light beam b onto the information record surface of the dvd - r 1 on the basis of a laser drive signal s dl , and detects the pre - pits on the basis of a reflected light thereof to thereby record the record information . moreover , in a case of the existence of old record information that has already been recorded , the pick - up 2 detects the old record information on the basis of the reflected light of the light beam b . then , the reproduction amplifier 3 amplifies a detection signal s dt including the pre - pits outputted by the pick - up 2 and the information corresponding to the old record information that has already been recorded , outputs a pre - pit signal s pp corresponding to the pre - pits , and also outputs an amplification signal s p corresponding to the old record information . after that , the decoder 4 applies the 8 - 16 - demodulation and the interleave to the amplification signal s p to thereby decode the amplification signal s p and then outputs a demodulation signal s dm and a servo demodulation signal s sd . on the other hand , the pre - pit signal decoder 5 decodes the pre - pit signal s pp to thereby output the demodulation pre - pit signal s pd . the servo circuit 7 outputs a pick - up servo control signal s sp for focus servo control and tracking servo control in the pick - up 2 , on the basis of the demodulation pre - pit signal s pd and the servo demodulation signal s sd , and also outputs a spindle servo signal s ss for servo - controlling the rotation of the spindle motor 6 for rotating the dvd - r 1 . along with this , the processor 8 temporally stores and outputs a record information signal s r corresponding to the record information that is inputted from an external portion , and also outputs to the external a reproduction signal s ot corresponding to the old record information on the basis of the demodulation signal s dm , and further outputs a switch signal s sw described later , on the basis of the demodulation pre - pit signal s pd . the encoder 9 affixes the ecc internal code 31 and the ecc external code 32 to the record information signal s r to thereby constitute the ecc block 30 , and also applies the interleave and the 8 - 16 - modulation to the ecc block 30 to thereby output an encode signal s re . at this time , the switch 10 switches between the encode signal s re and a ground signal to thereby output as an output signal s pc . then , the power control circuit 11 outputs a drive signal s d for controlling an output of the laser diode ( not shown ) within the pick - up 2 on the basis of the output signal s pc . after that , the laser drive circuit 12 actually drives the laser diode on the basis of the drive signal s d to thereby output a laser drive signal s dl for emitting the light beam b . further , the information recording apparatus s may reproduce the information recorded on the dvd - r 1 . in that case , the reproduction signal s ot is outputted to the external through the processor 8 on the basis of the demodulation signal s dm . an operation for finishing the recording of record information and an operation for starting the additional recording of new record information , according to the present invention , are explained with reference to fig4 to 7 , with classifying the cases . the first embodiment of the recording operation of the record information is firstly explained with reference to fig4 and 5 . in the information recording operation of the first embodiment , when the recording of old record information ( hereinafter referred to as “ old data ”) is finished , old dummy information ( hereinafter referred to as “ old dummy data ”) 44 having an information amount corresponding to two sync frames 42 is recorded , with an id information 21 at a head portion , subsequent to the old data . when the additional recording of new record information ( hereinafter referred to as “ new data ”) is started , new dummy information ( hereinafter referred to as “ new dummy data ”) 45 having the same content as the old dummy data 44 is firstly recorded ( i . e ., overwritten ) on an area corresponding to the second sync frame 42 of the areas on which the old dummy data 44 is previously recorded . at this time , a data amount of the new dummy data 45 is determined in such a way that a total data amount of the remainder of the old dummy area after the additional recording of the new dummy data 45 and an area of the new dummy data 45 is equal to or less than the data amount of a single recording sector 40 . after that , the new data which is to be primarily recorded is recorded subsequent to the new dummy data 45 . [ 0072 ] fig4 is a flow chart indicating the process of additionally recording information on the dvd - r . fig5 shows the information recording manner of the dvd - r 1 before and after the new data is recorded , according to the first embodiment of the information recording operation . in fig4 and 5 , it is assumed that the id information 21 in the final recording sector 40 of the old data is recorded at the address n , and that the id information 21 in the recording sector 40 of the old dummy data 44 is recorded at the address ( n + 1 ). in the first embodiment of the information recording operation , as shown in fig4 when the additional recording of the new data is started , the address n corresponding to the id information 21 in the recording sector 40 of last old data is searched ( step s 1 ). this operation is performed by the processor 8 , on the basis of the demodulation signal s dm supplied from the decoder 4 . when the id information 21 corresponding to the address n is detected , the old data recorded on a recording sector 40 subsequent to the detected id information 21 is detected ( step s 2 ). then , it is judged by the processor 8 , on the basis of the demodulation signal s dm from the decoder 4 , whether or not the id information 21 corresponding to the address ( n + 1 ) is detected ( step s 3 ). if the id information 21 corresponding to the ( n + 1 ) is not detected yet ( step s 3 ; no ), the detection of the old data is continued until it is detected . if it is detected , ( step s 3 ; yes ), the new dummy data 45 , which contents is [ 0000 . . . ], for example , having an information amount corresponding to : is supplied from the processor 8 to the encoder 9 to be temporarily stored therein . then , a record information signal s r corresponding to new record information to be recorded subsequent to the new dummy data 45 is supplied to the encoder 9 , which encodes it and temporarily stores the encoded data therein ( step s 4 ). at this time , an ecc block 30 for the new data may include the new dummy data 45 , or may not include it , i . e ., the ecc block 30 for the new data begins from an end position of the new dummy data 45 and is composed of only new data . next , old dummy data 44 ( for example , [ 0000 . . . ]) recorded subsequent to the id information 21 corresponding to the address ( n + 1 ) is detected , and header h at the head portion of each sync frame 42 is detected on the basis of the demodulation signal s dm supplied from the decoder 4 . then , it is judged by the processor 8 whether or not the area corresponding to a second sync frame 42 is detected in the area of the old dummy data 44 ( step s 5 ). if the area corresponding to the second sync frame 42 is not detected yet ( step s 5 ; no ), the detection of the old dummy data 44 is continued until it is detected . if it is detected ( step s 5 ; yes ), the switch 10 is changed over to the terminal a side thereof , on the basis of the switch signal s sw from the processor 8 . by this , the new dummy data 45 temporarily stored in the encoder 9 and new data subsequent thereto are read out as the encode signal s re , and then are outputted as the output signal s pc via the switch 10 ( step s 6 ). accordingly , the new dummy data 45 and the new data subsequent thereto are recorded on the dvd - r 1 by means of the light beam b emitted from the pick - up 2 . the power of the light beam b is maintained to be a constant reproducing power , until the switch 10 is changed over to the terminal a side , as shown in fig5 . after the switch 10 is changed over to the terminal a side ( on and after the position corresponding to the head portion of the second sync frame 42 in the area of the old dummy data 44 ), the power of the light beam is repeatedly switched between the recording power and the reproducing power in correspondence with the contents of the new dummy data 45 included in the output signal s pc and the new data subsequent thereto . the reason why the emission of the light beam b is continuously kept at the reproducing power even when the data is not recorded is that the reflected light used for the tracking servo control is required in order to permit the light beam b to trace the information track on the dvd - r 1 , even if the data is not recorded there . at the step 6 , when the switch 10 is changed over to the terminal a side and thereby the new dummy data 45 and the new data are recorded , it is judged by the processor 8 whether or not the new data from the encoder 9 ends ( step s 7 ). if it does not end ( step s 7 ; no ), the recording of the new data is continued while maintaining its original state . if the new data ends ( step s 7 ; yes ), the dummy data ( for example , [ 0000 . . . ]) having an information amount corresponding to two sync frames 42 is outputted by the encoder 9 and recorded subsequent to the last new data ( step s 8 ). when the recording of the dummy data is finished , the switch 10 is changed over to the terminal b side ( i . e ., the ground side ), and the power of the light beam b is changed to the reproducing power ( step s 9 ). by this , the additional recording process for the new data is completed . in the above mentioned process shown in fig4 the new data is recorded subsequent to the new dummy data 45 as shown in fig5 . moreover , when the recording of the new data is finished , the dummy data is recorded , for the information amount corresponding to two sync frames 42 , subsequent to the new data thus recorded ( the old data in fig5 have been recorded previously by this operation ), and then the process is finished . the additional recording of the record information is performed by repeating the above mentioned process . however , in this case , as for the state of the dvd - r 1 at the linking portion between the old data and the new data , the dummy data ([ 0000 . . . ]) is recorded for the information amount equal to or less than one recording sector 40 , as shown in the lowest stage of fig5 . here , in a portion where the old dummy data 44 and the new dummy data 45 are overlapped with each other ( this is the information amount corresponding to the one sync frame 42 and indicated as the data broken area d ( hatched area ) in fig5 ), both of the old dummy data 44 and the new dummy data 45 may be broken due to the overwriting of the new dummy data 45 . however , in the case of consecutively reproducing the old data and the new data later , it is known that the dummy data at a boundary between the old data and the new data is [ 0000 . . . ], even if the data in the d is broken . therefore , by replacing the data detected from the data broken area d with the known data [ 0000 . . . ], it is possible to perform the consecutive reproduction without disturbing the error correction in the consecutive reproduction ( without deteriorating the error correcting performance in the consecutive reproduction ). in this embodiment , the dummy data is recorded for the data amount corresponding to at most only one recording sector 40 . as a result , it is possible to record more record information by effectively using the recording capacity of the dvd - r 1 , as compared with a case of providing a linking area for one ecc block 30 in the conventional manner . moreover , the id information 21 ( at the address ( n + 1 )) corresponding to the recording sector 40 positioned at the linking portion between the old data and the new data is never broken because no overwriting is executed on the id information area 21 ( see . address ( n + 1 ) in fig5 ). as a result , it is possible to accurately perform the consecutive reproduction of the recorded information . the second embodiment of the recording operation of record information is explained with reference to fig6 and 7 . in the information recording operation of the second embodiment , similarly to the first embodiment , old dummy data 44 of an information amount corresponding to two sync frames 42 is recorded , with an id information 21 at the head portion , subsequent to the record information . on the other hand , at the time of the additional recording of new data , the recording is started from the second sync frame of new data , i . e ., new data corresponding to first one sync frame 42 is removed from the beginning of the new data . [ 0089 ] fig6 is a flow chart indicating the operation of additional recording of the new data after the old data which has already been recorded . fig7 shows the recording manner of the dvd - r 1 before and after the new data is recorded by the second embodiment of the information recording operation . in fig6 and 7 , it is assumed that the id information 21 in the final recording sector 40 of the old data is recorded at the address n , and that the id information 21 in the recording sector 40 of the old dummy data 44 is recorded at the address ( n + 1 ). moreover , the identical step numbers are given to the operations identical to those of the first embodiment of the information recording operation shown in fig4 and the explanation of the detailed portions is omitted for those steps . in the second embodiment of the information recording operation , as shown in fig6 when the additional recording of the new data is started , the operations identical to the steps s 1 to s 3 shown in fig4 are firstly executed . then , the id information 21 at the head portion of the area of the old dummy data 44 is detected . if the id information 21 corresponding to the address ( n + 1 ) is detected ( step s 3 ; yes ), a record information signal s r corresponding to the new record information to be recorded is outputted , without inserting the dummy data , from the processor 8 to the encoder 9 , which encodes the new data and temporarily stores the encoded data therein ( step s 10 ). after that , the operations identical to those of the steps s 5 to s 9 shown in fig4 are executed . new data from the second sync frame ( i . e ., after new data of first one sync frame 42 is removed from the beginning of the new data ) is recorded from the position corresponding to the second sync frame 42 of the area of the old dummy data 44 . when the all new data is recorded , dummy data of an information amount corresponding to two sync frames 42 is recorded subsequent to the new data . then , the recording of the new data ends . the power of the light beam b is maintained to be a constant reproducing power , until the switch 10 is changed over to the terminal a side , as shown in fig5 . after the switch 10 is changed over to the terminal a side ( on and after the position corresponding to the head portion of the second sync frame 42 in the area of the old dummy data 44 ), the power of the light beam is switched between the recording power and the reproducing power in correspondence with the contents of the new dummy data 45 included in the output signal s pc and the new data subsequent thereto . according to the above mentioned process shown in fig6 at the time of the additional recording of the new data , the recording is performed from the new data of second sync frame , i . e ., the new data from which first one sync frame 42 thereof is removed from its beginning , as shown in fig7 . moreover , when the recording of the new data is finished , the dummy data is recorded for the information amount corresponding to two sync frames 42 , subsequent to the new data thus recorded ( like the manner of old data shown in fig7 ). in this way , the process is finished . the additional recording of the record information is performed by repeating the above mentioned process . in this case , as for the state of the dvd - r 1 at a linking portion between the old data and the new data in the additional recording , data different from the new data is recorded in a portion of first two sync frames 42 from the beginning of the new data , as shown in the lowest stage of fig7 . that is , the old dummy data 44 is recorded at the first one sync frame 42 , and the second sync frame 42 subsequent to it becomes the data broken area d ( hatched area ). however , in the case of the consecutive reproduction of the old data and new data , since both the ecc blocks of the old data and the new data have the structures of the ecc blocks 30 shown in fig1 the data amount of the two sync frames 42 corresponds to the one correction block 34 in the ecc block 30 . thus , as mentioned in the explanation of the ecc block 30 , according to the structure of the ecc block 30 in which the error correction is performed in both the vertical and horizontal directions using the ecc internal code 31 and the ecc external code 32 , even if one correction block 34 is entirely broken , it is only the data break of one byte for the ecc external code 32 at one column as viewed in the vertical direction . therefore , by carrying out the error correction using the ecc external code 32 at each column , it is possible to appropriately carry out the error correction for the two sync frames 40 ( i . e ., one correction block 34 ) to thereby perform the accurate reproduction . as a result , the consecutive reproduction can be performed without having substantial influence on the error correction . further , the total data amount of the dummy data area and the data broken area d is at most equal to two sync frames 42 , this may not put any substantial influence on the error correction in the consecutive reproduction . therefore , the consecutive reproduction can be performed without providing relatively large linking area between the old data and the new data ( the dummy area becomes a meaningless area in the consecutive reproduction of the old data and the new data ). as a result , it is possible to record more information by effectively utilizing the record area on the dvd - r 1 , as compared with the case of providing the linking area corresponding to one ecc block 30 in the conventional manner . further , the second embodiment provides more improved use of data capacity of the dvd - r 1 , compared with the first embodiment . in the first embodiment , the dummy data is recorded in first one recording sector 40 beginning from the address ( n + 1 ), and hence one recording area 40 is used entirely in vain ( see . fig5 lowest stage ). in contrast , according to the second embodiment , the recording sector 40 beginning from the address ( n + 1 ) is recorded with new data , and even though the data brake takes place there , the broken data can be corrected by the ecc function as described above . therefore , no recording sector is vainly filled with dummy data in the second embodiment , and the data recording efficiency is further improved . furthermore , the id information 21 ( corresponding to the address ( n + 1 )) in the recording sector 40 at the linking portion of the old data and the new data is never broken because , in either of the first and the second embodiments , no data is overwritten on the id information 21 at the address ( n + 1 ). as a result , the consecutive reproduction is not suffered by the lack or break of the id information 21 , thereby enabling the stable consecutive reproduction . | 6 |
a first embodiment of the invention will be described with reference to fig3 in which parts and elements corresponding generally to those in fig1 are designated by the same reference numerals . in the active equalizer of fig3 a first or input resistor 11 is connected between a signal input terminal t 1 and a first resistive member of portion 3a of the resistance element of a potentiometer 3 . a center tap 3c of the potentiometer 3 is connected to a source of a reference potential for example , to ground . a second resistive member or portion 3b of the resistance element is connected to the signal output terminal t 2 through a second or feedback resistor 2 , whose resistance value may usefully be the same as that of the first resistor 1 . both resistive members or portions 3a and 3b are also connected together and to an inverting input of an inverting amplifier 4 , whose non - inverting input is connected to a source of a reference potential , for example , to ground , and whose output is connected to output terminal t 2 . the potentiometer 3 is completed by a wiper 3m which is movable to selectively contact resistive members 3a and 3b and the center tap 3c therebetween . there is also provided a switch 7 , which includes a movable contact 7m and first and second fixed contacts 7a and 7b . the movable contact 7m is ganged with wiper 3m of potentiometer 3 . the first and second fixed contacts 7a and 7b are respectively connected to the signal input and output terminals t 1 and t 2 . a transfer impedance circuit 5 which , in this embodiment , is an active filter , is connected at its input to the movable contact 7m of switch 7 , while the output of active filter 5 is connected to wiper 3m of potentiometer 3 through a resistor 6 . practical examples of the construction of potentiometer 3 and switch 7 will now be described with reference to fig4 . in that figure , the center tap of potentiometer 3 is seen to be constituted by an arcuate conductor 3c . this center tap subtends an angle of β with respect to its center of curvature . the resistive members 3a and 3b are shown to be arcuate and symmetrically located at opposite sides of the center tap 3c . the members 3a and 3b are connected , at one end , to center tap 3c and are selectively engaged by wiper 3m , which is in slidable contact with members 3a and 3b as well as center tap 3c . as seen in fig3 resistive members 3a and 3b are connected , at their other ends , to first and second resistors 1 and 2 , respectively , and to each other for connection to the inverting input of amplifier 4 . as also shown in fig4 in switch 7 , fixed contacts 7a and 7b are arcuate and disposed in a generally circular arrangement . between contacts 7a and 7b is a gap 7c subtending an angle of α with respect to the center of curvature of contacts 7a and 7b , which angle α is less than the angle β . movable contact 7m rotates about said center of curvature , and is in selective sliding engagement with fixed contacts 7a and 7b . the overall angle subtended by members 3a and 3b and center tap 3c of potentiometer 3 is selected to be substantially equal to the overall angle subtended by contacts 7a and 7b and gap 7c of switch 7 . wiper 3m and movable contact 7m are ganged together , for example , by shaft means represented in the figures by a dashed line , such that they are always in the same angular position with respect to a line passing through the centers of curvature of the elements of the potentiometer and switch . thus , whenever movable contact 7m is located in gap 7c , wiper 3m is in engagement with center tap 3c for grounding the output of filter 5 . on the other hand when wiper 3m engages the first or second resistive member 3a or 3b , movable contact 7m is in engagement with first or second contact 7a or 7b , respectively . the operation of the active equalizer according to the embodiment of the invention described above will now be described . ( a ) when movable contact 7m of switch 7 engages fixed contact 7a and wiper 3m of potentiometer 3 engages first resistive member 3a , the input signal from terminal t 1 and the resulting output of active filter 5 are added together and supplied as the input to the inverting input of amplifier 4 . in this case , the result is a boosting of the amplitude of the input signal for those frequencies thereof determined by filter 5 . as wiper 3m is moved to the end of member 3a away from center tap 3c , the boosting effect is increased , and , when the wiper is moved in the direction toward center tap 3c , the boosting is diminished . ( b ) when movable contact 7m of switch 7 is located in gap 7c , and wiper 3m is in engagement with center tap 3c , the active filter 5 is effectively disconnected from the circuit and the frequency response of the latter becomes flat . ( c ) when movable contact 7m of switch 7 engages fixed contact 7b and wiper 3m engages second resistive member 3b , the output signal at output terminal t 2 is received as the input to active filter 5 and fed back through the latter to inverting input of amplifier 4 , the effect being an attenuation of selected frequencies of the input signal received at terminal t 1 . as wiper 3m approaches the end of member 3b away from center tap 3c , the attenuating effect is increased , and , when the wiper is moved toward center tap 3c , the attenuation is reduced . a functional analysis of the operation of the above - described active equalizer according to this invention will now be set forth . in this analysis , v in represents the input signal voltage applied to input terminal t 1 , and v out represents the output signal voltage appearing at output terminal t 2 . the resistance values of input and feedback resistors 1 and 2 are both designated r , and the resistance value of resistor 6 is designated r t . k designates a voltage dividing ratio determined by the setting of potentiometer 3 , and has a value of from 0 to 1 . the transfer function of active filter 5 is f ( ω ), where ω is the angular frequency . the transfer function v out / v in in the situations discussed at ( a ), ( b ) and ( c ) above can be expressed by equations ( 1 ), ( 2 ) and ( 3 ), respectively , as follows : ## equ1 ## for equation ( 1 ), the ratio k is assumed to approach the value 1 when the wiper 3m nears the end of member 3a away from center tap 3c , while k nears 0 as the wiper approaches the center tap . similarly , for equation ( 3 ), when wiper 3m is in contact with end member 3b away from center tap 3c , k is at its maximum value 1 and , as the wiper approaches the center tap , k again approaches 0 . another embodiment of an active equalizer according to this invention is shown in fig5 in which a plurality of sub - circuits comprised of potentiometers 3a , 3b , 3c , . . . , active filters 5a , 5b , 5c , . . . , and switches 7a , 7b , 7c , . . . , respectively , connected with each other in the same manner as the correspondingly numbered parts on fig3 in conjunction with a common first resistor 1 , a second resistor 2 , and an inverting amplifier 4 in a fashion analogous to that described previously with references to fig3 . the potentiometer and switch of each such sub - circuit , for example , the potentiometer and switch 3a and 7a , are ganged for simultaneous adjustment as set forth above . further , the frequency response of each of the plurality of active filters 5a , 5b , 5c , . . . , may be either the same or different from the frequency response of the other active filters . in each active equalizer according to the described embodiments , and in which each potentiometer is located between the output of an active filter and the inverting input to the amplifier , any noise generated by an active element in the active filter , such as a transistor or the like , is diminished by the respective potentiometer in the same proportion as the desired signal . thus , the signal - to - noise ratio remains constant and may be optimized without risk of later deterioration when a weak signal is the input to the equalizer . when a plurality of active filters present , as shown in fig5 the foregoing desirable characteristic is particularly advantageous . in addition , if the movable contact of 7 , 7a , 7b or 7c switch is located in the gap of that switch , then the wiper of the respective potentiometer 3 , 3a , 3b , 3c engages the center tap , thus grounding the output of the respective active filter 5 , 5a , 5b , 5c . thus , even if no input signal is being supplied to a given active filter , no noise is introduced from that filter to the input of the inverting amplifier , eliminating any risk that the signal - to - noise ratio of the input signal to the inverting amplifier will be deteriorated by an increase in the number of active filters included in the equalizer and some of which may not be supplying an input signal at a given time . in the embodiments of the invention , the potentiometers 3 , 3a , 3b , 3c and switches 7 , 7a , 7b , 7c have been described in mechanical terms , for example , as rotary devices . it is of course possible , however , that they may be of a linear type , or be constituted by electronic components in whole or in part . although illustrative embodiments of this invention have been described in detail herein with reference to the accompanying drawings , it is to be understood that the invention is not limited to these precise embodiments , and that various changes and modifications may be effected therein by one skilled in the art without departing from the spirit and scope of the invention , as defined in the appended claims . | 7 |
compounds of formula ( i ) for use in the invention include ( but are not limited to ) novel compounds such as : it is understood that the invention refers to salts , e . g . the hydrochloride of compounds ( i ). the compounds may also be provided as metabolites and pro - drugs thereof . the compounds are chiral , and the invention includes substantially single diastereomers and enantiomers of ( i ). aryl and heteroaryl groups are know , and typically have up to 12 atoms . the compounds of formula ( i ) according to the invention are used to treat inflammatory diseases including , but not exclusive to , autoimmune diseases involving multiple organs , such as systemic lupus erythematosus ( sle ) and scleroderma , specific tissues or organs such as the musculoskeletal tissue ( rheumatoid arthritis , ankylosing spondylitis ), gastro - intestinal tract , ( crohn &# 39 ; s disease and ulcerative colitis ), the central nervous system ( alzheimers , multiple sclerosis , motor neurone disease , parkinson &# 39 ; s disease and chronic fatigue syndrome ), pancreatic beta cells ( insulin dependent diabetes mellitus ), the adrenal gland ( addison &# 39 ; s diseae ), the kidney ( goodpasture &# 39 ; s syndrome , iga nephropathy , interstitial nephritis ) exocrine glands ( sjogrens syndrome and autoimmune pancreatitis ) and skin ( psoriasis and atopic dermatitis ), chronic inflammatory diseases such as osteoarthritis , periodontal disease , diabetic nephropathy , chronic obstructive pulmonary disease , artherosclerosis , graft versus host disease , chronic pelvic inflammatory disease , endometriosis , chronic hepatitis and tuberculosis , ige mediated ( type i ) hypersensitivities such as rhinitis , asthma , anaphylaxis , dermatitis and ophthalmic conditions . dermatitis conditions include ; actinic keratosis , acne rosacea , acne vulgaris , allergic contact dermatitis , angioedema , atopic dermatitis , bullous pemiphigoid , cutaneous drug reactions , erythema multiforme , lupus erythrametosus , photodermatitis , psoriasis , psoriatic arthritis , scleroderma and urticaria . opthalmic conditions include age related macular degeneration , diabetic retinopathy , choroidal neovascular membrane , cystoid macular edema , epi - retinal membrane , macular hole , dry eye and uveitis . these compounds may be used according to the invention when the patient is also administered or in combination with another therapeutic agent selected from corticosteroids ( examples including cortisol , cortisone , hydrocortisone , dihydrocortisone , fludrocortisone , prednisone , prednisolone , deflazacort , flunisolide , beconase , methylprednisolone , triamcinolone , betamethasone , and dexamethasone ), disease modifying anti - rheumatic drugs ( dmards ) ( examples including , azulfidine , aurothiomalate , bucillamine , chlorambucil , cyclophosphamide , leflunomide , methotrexate , mizoribine , penicillamine and sulphasalazine ), immunosuppressants ( examples including azathioprine , cyclosporin , mycophenolate ,) cox inhibitors ( examples including aceclofenac , acemetacin , alcofenac , alminoprofen , aloxipirin , amfenac , aminophenazone , antraphenine , aspirin , azapropazone , benorilate , benoxaprofen , benzydamine , butibufen , celecoxib , chlorthenoxacine , choline salicylate , chlometacin , dexketoprofen , diclofenac , diflunisal , emorfazone , epirizole , etodolac , feclobuzone , felbinac , fenbufen , fenclofenac , flurbiprofen , glafenine , hydroxylethyl salicylate , ibuprofen , indometacin , indoprofen , ketoprofen , ketorolac , lactyl phenetidin , loxoprofen , mefenamic acid , metamizole , mofebutazone , mofezolac , nabumetone , naproxen , nifenazone , oxametacin , phenacetin , pipebuzone , pranoprofen , propyphenazone , proquazone , rofecoxib , salicylamide , salsalate , sulindac , suprofen , tiaramide , tinoridine , tolfenamic acid , zomepirac ) neutralising antibodies ( examples including , etanercept and infliximab ), antibiotics ( examples including , doxycycline and minocycline ). compounds of formula ( i ) exhibit analgesic activity in animal models . the activity of these compounds may be determined by the use of the appropriate in vivo assay . this invention also relates to a method of treatment for patients ( including man and / or mammalian animals raised in the dairy , meat or fur industries or as pets ) suffering from chronic , acute or neuropathic pain ; and more specifically , a method of treatment involving the administration of the analgesic of formula ( i ) as the active constituent . accordingly , the compounds of formula ( i ) can be used among other things in the treatment of pain conditions such as acute and chronic pain ( as well as , but not limited to , pain associated with cancer , surgery , arthritis , dental surgery , trauma , musculo - skeletal injury or disease , visceral diseases ) and migraine headache . additionally the painful conditions can be neuropathic ( post - herpetic neuralgia , diabetic neuropathy , drug induced neuropathy , hiv mediated neuropathy , sympathetic reflex dystrophy or causalgia , fibromyalgia , myofacial pain , entrapment neuropathy , phantom limb pain , trigeminal neuralgia . neuropathic conditions include central pain related to stroke , multiple sclerosis , spinal cord injury , arachnoiditis , neoplasms , syringomyelia , parkinson &# 39 ; s and epilepsia . it will often be advantageous to use compounds of formula ( i ) in combination with another drug used for pain therapy . such another drug may be an opiate or a non - opiate such as baclofen . especially for the treatment of neuropathic pain , coadministration with gabapentin is preferred . other compounds that may be used include acetaminophen , a non - steroidal anti - inflammatory drug , a narcotic analgesic , a local anaesthetic , an nmda antagonist , a neuroleptic agent , an anti - convulsant , an anti - spasmodic , an anti - depressant or a muscle relaxant . any suitable route of administration can be used . for example , any of oral , topical , parenteral , ocular , rectal , vaginal , inhalation , buccal , sublingual and intranasal delivery routes may be suitable . the dose of the active agent will depend on the nature and degree of the condition , the age and condition of the patient and other factors known to those skilled in the art . a typical dose is 1 . 0 - 100 mg given one to three times per day . the compounds of the invention may be prepared via a multistep synthetic route of a type familiar to those skilled in the art , and it is assumed that functional groups present in the molecules can be protected and deprotected as needed . the synthesis begins with a substituted acetophenone or analogue which is reacted initially with bromine to give the bromo derivative , and then the amino alcohol to generate the target molecule . the final compounds are generally isolated via precipitation which may require purification via a technique such as recrystallisation . bromine ( 63 ml , 1 . 22 mol ) was added to a mixture of 4 - amino - 3 , 5 - dichloroacetophenone ( 1 ) ( 250 g , 1 . 22 mol ) in chcl 3 ( 3 l ml ) at room temperature . the mixture was stirred for 1 h then etoh ( 500 ml ) was added . the mixture was cooled to 0 ° c . and stirred for 1 h . the precipitate was filtered and air - dried ( 4 . 7 g , 67 %). 1 h nmr ( 400 mhz , dmso ): 4 . 77 ( 2h , s ), 6 . 61 ( 2h , bs ), 7 . 86 ( 2h , s ); 13 c nmr ( 100 mhz , dmso ): 63 . 39 , 117 . 89 , 128 . 57 , 129 . 75 , 146 . 17 , 195 . 99 . 2 - amino - 2 - methyl - propan - 1 - ol ( 180 ml , 2 . 49 mol ) was added to a mixture of bromo -(- 4 - amino - 3 , 5 - dichloro ) acetophenone ( 2 ) ( 237 g , 0 . 83 mol ) in chloroform ( 650 ml ). the mixture was stirred at room temperature for 2 h , then water ( 380 ml ) was added . the mixture was stirred for 1 h , and then the solid was filtered . the solid was triturated with water ( 1 l ) to give the desired compound ( 3 ) ( 223 g , 91 %). 1 h nmr ( 400 mhz , dmso ): 0 . 94 ( 6h , s ), 3 . 18 ( 2h , d j = 4 . 4 hz ), 3 . 93 ( 2h , s ), 4 . 55 ( 1h , m ), 6 . 40 ( 2h , s ), 7 . 84 ( 2h , s ); 13 c nmr ( 100 mhz , dmso ): 24 . 21 , 48 . 87 , 53 . 73 , 68 . 52 , 117 . 92 , 124 . 57 , 125 . 79 , 128 . 62 , 146 . 07 , 195 . 30 ; lc - ms : 291 , 292 , 293 ( m + h + ). bromine ( 6 . 07 ml , 0 . 12 mol ) was added to a solution of 3 ′- chloropropiophenone ( 20 g , 0 . 12 mol ) in chloroform ( 250 ml ) at room temperature . the reaction was followed by tlc in dcm . when all of the starting material was consumed the mixture was washed with a saturated solution of sodium bicarbonate . the organic phase was dried over magnesium sulphate , filtered and evaporated . recrystallisation from chloroform gives the desired compound in 60 % yield as a pale yellow solid ( 18 g , 73 mmol ). 1 h nmr ( 400 mhz , cdcl 3 ): 7 . 99 ( 1h , m ), 7 . 89 ( 1h , m ), 7 . 55 ( 1h , m ), 7 . 43 ( m ), 5 . 21 ( 1h , q j = 6 . 5hz ), 1 . 9 ( 3h , j = 6 . 5hz ) 2 - amino - 1 - methyl - propan - 1 - ol ( 14 ml , 0 . 15 mol ) was added to α - bromo - 3 ′ chloro propiophenone ( 18 g , 73 mmol ) in suspension in chloroform ( 50 ml ), with two crystals of sodium iodide . the reaction was heated under reflux overnight . after filtration the organic phase was extracted twice with a 2m hcl solution ( 2 × 100 ml ). the aqueous phase wash washed with dcm then neutralised with sodium carbonate . the aqueous layer was extracted with dcm . the organic phase was dried over magnesium sulphate , filtered and evaporated . recrystallisation from chloroform gives the desired compound in 55 % yield as a white solid ( 10 . 2 g , 40 mmol ). 1 h nmr ( 400 mhz , cdcl 3 ): 7 . 57 ( 1h , m ), 7 . 27 - 7 . 26 ( 2h , m ), 3 . 77 - 3 . 74 ( 1h , m ), 3 . 37 - 3 . 34 ( 1h , m ), 3 . 14 - 3 . 11 ( 1h , m ), 1 . 37 ( 3h , s ), 1 . 04 ( 3h , s ), 0 . 76 ( 3h , s ). 13 c nmr ( 100 mhz , chcl 3 ): 16 . 23 , 22 . 69 , 27 . 06 , 49 . 85 , 53 . 41 , 69 . 33 , 95 . 91 , 124 . 52 , 126 . 62 , 128 . 04 , 129 . 34 , 134 . 05 , 144 . 11 . lc - ms : 256 ( m + h + ). guinea - pig trachea ring preparations were suspended in kreb &# 39 ; s solution containing indomethacin . after 15 minutes stabilisation , the preparations were repeated contracted using carbachol and simultaneously treated with increasing cumulative doses test compounds ( 0 . 1 nm to 0 . 1 μm ). beta2 agonism for each test compound was determined by its dose dependant inhibition of carbachol stimulated tracheal muscle twitch . compound ( 3 ) was a very poor beta2 agonist , with an ic50 of 13 μm . 7 week old balb c byj mice ( 24 - 28 g ) were administered , either by i . p . ( 5 ml / kg ) or oral ( 10 ml / kg ) administration , with vehicle or test article . 30 minutes later these animals were challenged with an intraperitoneal injection of 1 mg / kg lps . 2 hours after lps challenge blood samples were collected under light isoflurane anaesthesia into normal tubes by retro - orbital puncture . samples were allowed to clot at room temperature and then spun at 6000 g for 3 min at 4 ° c . serum was stored at − 20 ° c . until use . serum tnfα and il - 10 levels were analysed in duplicate by elisa technique . compound ( 3 ) had strong inhibitory effects on tnfα and potentiating effects on il - 10 . these effects are unlikely to be due to beta2 agonism . fasted ( 18 hour ) male wistar rats ( 105 - 130 g ) were weighed and a basal mercury plethysmometer reading was taken of the right hind paw by submerging the paw in the mercury up to the tibiotarsal joint . subsequently , vehicles , reference items and test articles were administered by oral gavage ( 10 ml / kg ). half an hour after treatment 0 . 1 ml of 2 % carrageenan in 0 . 9 % saline was injected into the subplanatar area of the right hind paw . the right paw was measured again with the plethysmometer at 1 , 2 , 3 , 4 and 5 hours after carrageenan administration . compound ( 3 ) had a dose - dependant inhibitory effect on inflammation induced by carrageenan paw injection . | 0 |
a photosensitive layer forming liquid was prepared by mixing the following ingredients : ______________________________________water 100 mlphosphoric acid 2 gnaphthalene - 1 , 3 , 6 - trisodium sulfonate 1 g2 - hydroxy - 3 - naphthoic acid morpholinopropyl amide 0 . 6 gaforesaid compound ( i ) 0 . 2 g4 - diazo - 2 , 5 - dibutoxyphenyl morpholine 2 gchloride . 1 / 2zncl . sub . 2 2 gsaponin 0 . 1 g______________________________________ subsequently , by coating this liquid on a white stencil paper for diazo copying material and drying thereafter , there was obtained a binary diazo copying material a . when this copying material was superposed on an original having an appropriate image , exposed to a fluorescent light of 160 w for about 4 seconds and thereafter developed with a liquid developer 1 having the following composition , there was formed a genuine black dye image . ______________________________________liquid developer 1 ( ph value : 12 . 0 ): water 100 mlpotassium carbonate 2 gpotassium metaborate 8 g______________________________________ when the same copying material was exposed to light in the same way as above and thereafter developed with ammonia by the use of a commercial dry diazo copying machine , there was formed a black dye image like in the case of the wet developing . further , when the same copying material was exposed to light in the same way as above and thereafter developed with a liquid developer 2 having the following composition using a commercial semi - dry diazo copying machine , there was formed a genuine black dye image like in the foregoing case . ______________________________________liquid developer 2 : monoethanol amine 15 % by weightdiethylene glycol monomethyl ether 50 % by weightethylene glycol 35 % by weight______________________________________ next , for the purpose of comparing with general yellow - developing couplers , another binary diazo copying material b was prepared by replacing compound ( i ) with the same amount of acetoacetoanilide in the present example . after exposing this copying material to light in the same way as in the present example , by developing it by the foregoing 3 varieties of developing process , there was formed a black dye image respectively . when the thus obtained samples were subsequently subjected to forced light fastness test for 3 hours by means of a commercial fade meter , it was confirmed that the copying material a of this invention can manifest a superb light fastness compared with the comparative copying material b as shown in the following table - 1 . table - 1______________________________________ before test after testdeveloping color image color imageprocess sample tone density tone density______________________________________wet a black 1 . 25 black 1 . 20process b black 1 . 24 bluish 0 . 95 purpledry a black 1 . 28 black 1 . 24process b black 1 . 29 bluish 0 . 93 purplesemi - dry a black 1 . 18 black 1 . 05process b black 1 . 20 bluish 0 . 72 purple______________________________________ ( the density of image was measured by macbeth densitometer , the manufacture of macbeth co . of u . s . a .). a photosensitive layer forming liquid was prepared by mixing the following ingredients : ______________________________________water 100 mlconcentrated sulfuric acid 1 mltheophylline 1 gmagnesium sulfate 1 gafoesaid compound ( ii ) 1 g4 - diazo - 2 , 5 - dibutoxyphenyl morpholine 3 gchloride . 1 / 2zncl . sub . 2saponin 0 . 1 g______________________________________ subsequently , by coating this liquid on a thick tracing paper and drying thereafter , there was obtained a binary diazo copying material c . when this copying material was exposed to light according to the procedure described in example 1 and thereafter developed with the liquid developer 1 , liquid developer 2 and ammonia gas , respectively , by the use of the wet , dry and semi - dry copying machine , respectively , there was formed an orange - yellow dye image of equal degree in each case . this image proved excellent in ultraviolet - interceptivity , and was well useful as a secondary original . meanwhile , for the purpose of comparing with general yellow - developing couplers , another binary diazo copying material d for use as a comparative secondary original was prepared by replacing compound ( ii ) with the same amount of acetoacetonaphthalide in the present example . next , by developing this copying material by 3 varieties of developing process in the same way as in example 1 , there was obtained an orange - yellow dye image respectively . when the thus obtained samples were subsequently subjected to forced light fastness test for 3 hours by means of a fade meter , it was confirmed that the copying material c of this invention can manifest a superb light fastness compared with the comparative copying material d as shown in the following table - 2 . table - 2______________________________________ before test after testdeveloping color image color imageprocess sample tone density tone density______________________________________ c orange - 0 . 73 orange - 0 . 71wet yellow yellowprocess d orange - 0 . 71 orange 0 . 52 yellow c orange - 0 . 76 orange - 0 . 71dry yellow yellowprocess d orange - 0 . 78 orange 0 . 49 yellow c orange - 0 . 62 orange - 0 . 59semi - dry yellow yellowprocess d orange - 0 . 58 orange 0 . 37 yellow______________________________________ a precoating layer forming liquid was prepared by mixing the following ingredients : ______________________________________water 100 mlfine - particle corn starch ( particle diameter : 1 to 5 μ ) 2 . 5 gpolyvinyl acetate emulsion ( solid content : 50 %) 5 gnaphthalene - 2 , 4 - disodium sulfonate 1 gmethylene blue 0 . 003 g______________________________________ a photosensitive layer forming liquid was also prepared by mixing the following ingredients : ______________________________________water 100 mlcitric acid 2 gcaffeine 1 galuminum sulfate 1 gaforesaid compound ( iii ) 0 . 2 g2 - hydroxy - 3 - napthoic acid ethanol amide 0 . 5 g4 - diazo - n , n - dimethylaniline chloride . 1 / 2zncl . sub . 2 2 . 4 gzinc chloride 10 gsaponin 0 . 1 g______________________________________ next , after forming a precoating layer on a white stencil paper for diazo copying material by coating the foregoing precoating layer forming liquid thereon and drying , the foregoing photosensitive layer forming liquid was coated on said precoating layer and dried thereafter , whereby there was prepared a binary diazo copying material . when the thus obtained copying material was exposed to light in the same way as in example 1 and developed by the respective developing processes , there was formed a genuine black dye image having a high density and an excellent light fastness . a photosensitive layer forming liquid was prepared by mixing the following ingredients : ______________________________________water 80 mlethylene glycol 10 mltartaric acid 3 gzinc chloride 2 g2 , 3 - dihydroxy - 6 - sodium sulfonate 1 gaforesaid compound ( iv ) 0 . 3 g4 - diazo - 2 , 5 - diethoxymorpholine chloride . 1 / 2zncl . sub . 2 1 . 6 gcolloidal silica ( particle diameter : 1 μ ) 2 gsaponin 1 g______________________________________ next , after forming a precoating layer on a white stencil paper by coating the same precoating layer forming liquid as in example 3 thereon and drying , the foregoing photosensitive layer forming liquid was coated on said precoating layer and dried thereafter , whereby there was prepared a binary diazo copying material . when the thus obtained copying material was exposed to light in the same way as in example 1 and developed by the respective developing processes , there was formed a genuine black dye image having a high density and an excellent light fastness . | 6 |
before describing the embodiments in detail , switched capacitor circuits and ad conversion circuits and their associated problems will be described below . fig1 a is a block diagram illustrating one example of a pipelined ad converter and its pipeline stage circuit , fig1 b is a timing chart for explaining the operation of the ad conversion circuit in fig1 a , and fig1 c is a proceeding for explaining the operation of the ad conversion circuit in fig1 a . the ad conversion circuit hereinafter described with reference to fig1 a , fig1 b , and fig1 c is a pipelined ad conversion circuit . in the pipelined ad conversion circuit , the circuit that becomes important in achieving higher speed , lower power consumption , and smaller die size is the mdac ( multiplying dac : switched capacitor circuit ) that is used as the basic building block of the cell array . as illustrated in fig1 a , the pipelined ad conversion circuit 1 includes a sample - and - hold ( s / h ) circuit 11 , a number , n − 1 , of stage circuits ( stg - 1 to stg -( n − 1 )) 10 - 1 to 10 -( n − 1 ), a flash ad converter ( flash adc ) 12 at the last stage , and a digital correction circuit ( code conversion circuit ) 13 . the sample - and - hold circuit 11 samples an input voltage vin and holds it , and the flash adc 12 outputs a signal don , i . e ., the ad - converted result , without further processing to the digital correction circuit 13 . the digital correction circuit 13 receives the output signals do 1 to do ( n − 1 ) of the respective stage circuits 10 - 1 to 10 -( n − 1 ) as well as the output signal don of the flash adc 12 , and outputs a digital signal do as the result of the ad conversion of the input voltage vin . each stage circuit 10 includes a mdac 100 and a sub - ad converter ( adc ) 110 , and the mdac 100 includes a sub - da converter ( dac ) 101 and an analog computation unit 102 . the sub - dac 101 outputs a voltage + vr , 0 ( sg ), or − vr to the analog computation unit 102 in accordance with a signal da ( i ) supplied from the sub - adc 110 . as will be described later , the mdac 100 is constructed from a switched capacitor circuit which includes two or more capacitors ( internal capacitors ), an amplifier , and a switch ( internal switch ), and performs an analog computation to add or subtract a constant multiple of the reference voltage vr by using the amplified result of the input signal vin ( i ) and the ad - converted result da ( i ) of the input signal . the output ( vo ( i )) of each mdac ( one of the stage circuits 10 - 1 to 10 -( n − 1 )) is supplied as an input signal to the subsequent stage circuit ( one of the stage circuits 10 - 2 to 10 -( n − 1 ) or the flash adc 12 ). for example , consider the case where the analog input signal vin is converted into a 4 - bit digital signal ( n = 4 ) for output , as illustrated in fig1 b ; first , for vin ( 1 ), the signal do 1 ( 1 ) representing the most significant bit ( msb ) is output in period t ( 1 ), which is followed by the signal do 2 ( 1 ) in period t ( 2 ). next , the signal do 3 ( 1 ) is output in period t ( 3 ), and the signal do 4 ( 1 ) representing the least significant bit ( lsb ) is output in period t ( 4 ). then , in period t ( 5 ), the digital output adco ( 1 ) binarized by the digital correction circuit 13 is produced . similarly , for vin ( 2 ), the signal do 1 ( 2 ) representing the most significant bit is output in period t ( 2 ), which is followed by the signal do 2 ( 2 ) in period t ( 3 ). next , the signal do 3 ( 2 ) is output in period t ( 4 ), and the signal do 4 ( 2 ) representing the least significant bit is output in period t ( 5 ). then , in period t ( 6 ), the digital output adco ( 2 ) binarized by the digital correction circuit 13 is produced . in the above process , each stage carries out the computation vo ( i )= m *[ vin ( i )−{ da ( i )/ m }* vr ]. for example , when the signals do 1 to do 4 are “ 1 , 0 , − 1 , 1 ”, respectively , as illustrated in fig1 c , the digital correction circuit 13 outputs the binarized digital output “ 0111 ”. here , m represents the signal amplification factor . by thus performing a plurality of processes concurrently through the cascaded mdacs 100 on a per clock basis , the pipelined ad conversion circuit 1 achieves faster conversion speed , though the delay ( latency ) from input to output increases . furthermore , since higher resolution may be achieved by appropriately determining the number of stages according to the resolution needed , the pipelined ad conversion circuit may be designed flexibly according to its performance requirements . since the pipelined ad conversion circuit covers a wide range of resolution and conversion speed , as described above , this type of conversion circuit is widely used in various electronic apparatus such as digital av equipment and radio communication circuits . fig2 a is a simplified circuit schematic for explaining one example of a stage circuit and its operation , fig2 b is a timing chart ( part 1 ) for explaining the stage circuit in fig2 a , and fig2 c is a timing chart ( part 2 ) for explaining the stage circuit in fig2 a . fig2 b illustrates the processing performed by mdac 1 and mdac 2 , while fig2 c illustrates only the processing performed by mdac 1 . further , in fig2 a , reference characters op 1 and op 2 designate operational amplifiers ( op amps ). in fig2 a , fig2 , and fig2 c , the conversion time ( t ) is divided into four periods ( 1 ) to ( 4 ) to correspond with the description of each embodiment to be given later , but actually , the operation may be described by dividing it into two periods made up of the period ( 1 )+( 2 ) and the period ( 3 )+( 4 ). that is , the time during which a series of operations is repeated ( the conversion time t ) is depicted as being divided into the four periods ( 1 ) to ( 4 ). accordingly , the length of each period is defined by ( 1 )+( 2 )=( 3 )+( 4 )= t / 2 . in this patent specification and the accompanying drawings , the description is given by dealing with the case where the signal to be processed is a single - ended signal , but the configuration is basically the same for the case of a differential signal . further , while two mdacs , mdac 1 and mdac 2 , are depicted in fig2 a , the basic operation is described for the first - stage mdac 1 , and the second - stage mdac 2 is depicted for the purpose of facilitating an understanding of the load condition of the first - stage mdac 1 . as illustrated in fig2 a , the mdac as a circuit for processing an analog signal is constructed using a switched capacitor ( sc ) circuit that includes a capacitor ( c ), a switch ( sw ), and an operational amplifier ( op : op amp ). to describe the basic operation of the mdac , first in the period ( 1 )+( 2 ), the mdac 1 samples the analog input signal ( vin ) by using the sampling capacitor c 1 s (= c 1 n1 + c 1 n2 ). further , in the same period ( 1 )+( 2 ), the digital output result do ( do 1 ) and the add / subtract coefficient da ( da 1 ) of the reference voltage vr are determined by using the sub - ad converter adc 1 ( 110 ) which includes a comparator . next , in the period ( 3 )+( 4 ), the analog computation result vo 1 is output by applying a dac output voltage using the op amp op 1 , the capacitors c 1 n1 and c 1 n2 , and the comparison result from the adc 1 . the output result is supplied as the input signal vin 2 to the second - stage mdac ( mdac 2 ) and sampled on the sampling capacitor c 2 s (= c 2 n1 + c 2 n2 ); the output result is also supplied as an input signal to the second - stage sub - ad converter adc 2 ( 110 ). in fig2 c , during the period ( 3 )+( 4 ) when the mdac 1 performs computation , the capacitor c 1 n1 acts as a computation capacitor ( c 1 mdac ) and the capacitor c 1 n2 as a hold capacitor ( c 1 h ), and the sampling capacitor c 2 s (= c 2 n1 + c 2 n2 ) in the second - stage mdac 2 acts as the load . more specifically , in the period ( 3 )+( 4 ), the hold capacitor c 1 h ( c 1 n2 ) is connected between the output terminal and negative input terminal of the op amp op 1 , and the computation capacitor c 1 mdac ( c 1 n1 ) is connected between the output terminal of the sub - da converter ( 101 ) and the negative input terminal of the op amp op 1 . then , the sampling capacitor c 2 , (= c 2 n1 + c 2 n2 ) in the second - stage mdac 2 is coupled to the output terminal of the op amp op 1 . fig3 a is a simplified circuit schematic of a 1 . 5 - b stage for sampling mode and in hold mode operation , respectively , and fig3 b is a timing chart for explaining the 1 . 5 - b stage circuit in fig3 a . further , fig3 c is a transfer function for the 1 . 5bmdac of the stage circuit in fig3 a , and fig3 d is an operation table for the 1 . 5b - adc and the 1 . 5bmdac of the stage circuit in fig3 a . in fig3 a , reference character swc 1 designates a switch control unit which receives signals mclk and shsel and outputs switch control signals ; further , 101 is a sub - dac , cmp 1 and cmp 2 are comparators , dff 1 and dff 2 are flip - flops , and lo 1 is a logic unit . first , as illustrated in the left half of fig3 a and in the periods ( 1 ) and ( 2 ) (( 1 )+( 2 )) of fig3 b , in the sampling ( s ) mode of the mdac 1 the switch control unit swc 1 sets the control signals for the switches sws 1 a / 1 b / 2 a / 2 b and swadcin to a high level “ h ”, causing these switches to turn on . when the switch swadcin is turned on , the comparators cmp 1 and cmp 2 compare the input voltage v , applied as the compare voltage v cmp , with the reference voltages ( ¼ )* vr and −( ¼ )* vr , respectively , and supply the comparison results to the input terminals of the flip - flops dff 1 and dff 2 , respectively . further , in the sampling mode of the mdac 1 in the period ( 1 )+( 2 ), the switch control unit swc 1 sets the control signals for the switches swh 1 a / 1 b / 2 b and clkadc to a low level “ l ”. in this means , the switches swh 1 a / 1 b / 2 b to turn off , and the flip - flops dff 1 and dff 2 are disabled . as earlier described , in the sampling capacitor c 1 s on which the mdac 1 samples the input signal vin , the capacitors c 1 n1 and c 1 n2 are connected in parallel with each other with the switches sws 1 a , sws 1 b , and sws 2 b turning on ; as a result , the sampling capacitor c 1 s is c 1 s = c 1 n1 + c 1 n2 . here , if c 0 = c 1 s and c 1 n1 = c 1 n2 , then c 1 n1 = c 1 n2 = c 0 / 2 . next , as illustrated in the right half of fig3 a and in the periods ( 3 ) and ( 4 ) (( 3 )+( 4 )) of fig3 b , in the hold ( h : computation ) mode of the mdac 1 the switch control unit swc 1 sets the control signals for the switches sws 1 a / 1 b / 2 a / 2 b and swadcin to “ l ”, causing these switches to turn off . further , in the hold mode in the period ( 3 )+( 4 ), the switch control unit swc 1 sets the control signals for the switches swh 1 a / 1 b / 2 b and clkadc to “ h ”. this causes the switches swh 1 a / 1 b / 2 b to turn on , and the flip - flops dff 1 and dff 2 are enabled to latch and hold the input data . here , the output signals from the flip - flops dff 1 and dff 2 are supplied to the logic unit lo 1 , and the logic unit lo 1 outputs the digital output do and the add / subtract coefficient da 1 . the add / subtract coefficient da 1 is supplied to the sub - dac 101 . further , the hold capacitor c 1 h and the computation capacitor c 1 mdac are c 1 h = c 0 / 2 and c 1 mdac = c 0 / 2 , respectively , the feedback ratio β is β = c 1 h ( c 1 h + c 1 mdac )= ½ , and the signal amplification factor , m , is m = c 1 s / c 1 h = 2 . that is , in the period ( 3 )+( 4 ), the hold capacitor c 1 h ( c 1 n2 ) is connected between the output terminal and negative input terminal of the op amp op 1 , and the computation capacitor c 1 mdac ( c 1 n1 ) is connected between the output terminal of the sub - da converter ( 101 ) and the negative input terminal of the op amp op 1 . when the signal amplification is m = 2 , the relation depicted in fig3 c holds between vin / vr and vo / vr . further , the input voltage vin ( the compare voltage v cmp ), the digital output do , the add / subtract coefficient da 1 , the output voltage vda 1 of the sub - dac 101 , and the output voltage vo of the op amp op 1 are as depicted in fig3 d . here , since the output voltage vo is vo = m *{ vin −( da / m )* vr }, and m = 2 , it follows that vo = 2 * vin − da * vr . that is , when the input voltage vin is in the range defined by + vr ≧ vin ≧+( ¼ )* vr , do is + 01 , da is + 1 , vda 1 is + vr , and vo is 2 * vin − vr ; on the other hand , when the input voltage vin is in the range defined by +( ¼ )* vr ≧ vin ≧−( ¼ )* vr , do is 00 , da is 0 , vda 1 is 0 , and vo is 2 * vin . further , when the input voltage vin is in the range defined by −( ¼ )* vr ≧ vin ≧− vr , do is − 01 , da is − 1 , vda 1 is − vr , and vo is 2 * vin + vr . fig4 a is a simplified circuit schematic of a 2 . 5 - b stage for sampling mode and in hold mode operation , respectively , fig4 b is a transfer function for the 2 . 5bmdac of the stage circuit in fig4 a , and fig4 c is an operation table for the 2 . 5b - adc and the 2 . 5bmdac of the stage circuit in fig4 a . as is apparent from a comparison between fig4 a and the previously described fig3 a , the capacitor c 1 n1 in the 2 . 5bmdac is divided into two capacitors c 1 n11 and c 1 n12 each of which is provided with a sub - dac 101 a or 101 b and switches sws 11 b and swh 11 b or sws 12 b and swh 12 b . further , the two comparators cmp 1 and cmp 2 in fig3 a are replaced by six comparators cmp 11 to cmp 16 , and six split voltages ⅝ * vr , ⅜ * vr , ⅛ * vr , − ⅛ * vr , − ⅜ * vr , and − ⅝ * vr are applied to the respective comparators and compared with the input voltage vin ( v cmp ). the output signals from the respective comparators cmp 11 to cmp 16 are supplied to the logic unit lo 1 via the respective flip - flops dff 11 to dff 16 , and the logic unit lo 1 outputs the digital output do along with two add / subtract coefficients da 1 and da 2 that are supplied to the sub - dacs 101 a and 101 b . then , as illustrated in the left half of fig4 a , in the sampling mode of the mdac 1 the switch control unit swc 1 sets the control signals for the switches sws 1 a / 2 b / 11 b / 12 b and swadcin to “ h ”, causing these switches to turn on . further , in the sampling mode of the mdac 1 , the switch control unit swc 1 sets the control signals for the switches swh 1 a / 2 b / 11 b / 12 b and clkadc to “ l ”, causing the switches swh 1 a / 2 b / 11 b / 12 b to turn off and disabling the flip - flops dff 1 to dff 16 . at this time , since the capacitors c 1 n11 , c 1 n12 , and c 1 n2 are connected in parallel with each other with the switches sws 11 b , sws 12 b , and sws 2 b turning on , the sampling capacitor c 1 s is c 1 s = c 1 n11 + c 1 n12 + c 1 n2 . here , if c 0 = c 1 s , c 1 n2 = c 1 s / 4 and c 1 n11 = 2 * c 1 n2 , then c 1 n2 = c 0 / 4 , c 1 n12 = c 0 / 4 , c 1 n11 = c 0 / 2 . next , as illustrated in the right half of fig4 a , in the hold mode of the mdac 1 the switch control unit swc 1 sets the control signals for the switches sws 1 a / 2 b / 11 b / 12 b and swadcin to “ l ”, causing these switches to turn off . further , in the hold mode of the mdac 1 , the switch control unit swc 1 sets the control signals for the switches swh 1 a / 2 b / 11 b / 12 b and clkadc to “ h ”. this causes the switches swh 1 a / 2 b / 11 b / 12 b to turn on , and the flip - flops dff 1 to dff 6 are enabled to latch and hold the input data . that is , the flip - flops dff 1 to dff 6 latch and hold the output signals of the corresponding comparators cmp 11 to cmp 16 . here , the output signals from the flip - flops dff 1 to dff 6 are supplied to the logic unit lo 1 , and the logic unit lo 1 outputs the digital output do and the add / subtract coefficients da 1 and da 2 . the add / subtract coefficients da 1 and da 2 are supplied to the sub - dacs 101 b and 101 a , respectively . further , the hold capacitor c 1 h and the computation capacitor c 1 mdac are c 1 h = c 0 / 4 and c 1 mdac =( ¾ )* c o , respectively , the feedback ratio β is β c 1 h /( c 1 h + c 1 mdac )= ¼ , and the signal amplification , m , is m = c 1 s / c 1 h = 4 . when the signal amplification is m = 4 , the relation depicted in fig4 b holds between vin / vr and vo / vr . further , the input voltage vin ( the compare voltage v cmp ), the digital output do , the add / subtract coefficients da 1 and da 2 , the output voltages vda 1 and vda 2 of the sub - dacs 101 b and 101 a , and the output voltage vo of the op amp op 1 are as depicted in fig4 c . here , since the output voltage vo is vo = m *{ vin −( da / m )* vr }, and m = 4 , it follows that vo = 4 * vin − da * vr . that is , when the input voltage vin is in the range defined by + vr ≧ vin ≧+( ⅝ )* vr , do is + 011 , da is + 3 , vda 2 is + vr , vda 1 is + vr , and vo is 4 * vin − 3 * vr ; on the other hand , when the input voltage vin is in the range defined by +( ⅝ )* vr ≧ vin ≧+( ⅜ )* vr , do is + 010 , da is + 2 , vda 2 is + vr , vda 1 is 0 , and vo is 4 * vin − 2 * vr . further , when the input voltage vin is in the range defined by +( ⅜ )* vr ≧ vin ≧+( ⅛ )* vr , do is + 001 , da is + 1 , vda 2 is 0 , vda 1 is + vr , and vo is 4 * vin − vr ; on the other hand , when the input voltage vin is in the range defined by +( ⅛ )* vr ≧ vin ≧−( ⅛ )* vr , do is 000 , da is 0 , vda 2 is 0 , vda 1 is 0 , and vo is 4 * vin . further , when the input voltage vin is in the range defined by −( ⅛ )* vr ≧ vin ≧−( ⅜ )* vr , do is − 001 , da is − 1 , vda 2 is 0 , vda 1 is − vr , and vo is 4 * vin + vr ; on the other hand , when the input voltage vin is in the range defined by −( ⅜ )* vr ≧ vin ≧−( ⅝ )* vr , do is − 010 , da is − 2 , vda 2 is − vr , vda 1 is 0 , and vo is 4 * vin + 2 * vr . finally , when the input voltage vin is in the range defined by −( ⅝ )* vr ≧ vin ≧− vr , do is − 011 , da is − 3 , vda 2 is − vr , vda 1 is − vr , and vo is 4 * vin + 3 * vr . it will be recognized that each of the embodiments to be described later is also applicable to mdacs of other configurations such as 3 . 5 - b and 4 . 5 - b , though such applications will not be described herein . fig5 is a simplified circuit model of a switched capacitor circuit ( ex . mdac ) for explaining the relationship between its operating speed and the current consumption of an op amp for an mdac circuit in the hold mode operation , and more specifically , the relationship between the speed of computation in the operation mode of the mdac 1 and the current consumption of the amplifier . here , denoting the load as cl t , the feedback ratio as β 1 , and the current of the op amp op 1 as i amp , the time t 1 taken to accomplish the conversion is defined by the following relation ( see equation ( 5 )). [ mathematical 1 ] cl t = cl 1 + c 2 s ( 1 ) cl 1 = c 1 h · c 1 mdac ( c 1 h + c 1 mdac ) ( 2 ) β 1 = c 1 h ( c 1 h + c 1 mdac ) ( 3 ) 1 β 1 = ( c 1 h + c 1 mdac ) c 1 h = 1 + c 1 mdac c 1 h ( 4 ) t 1 = k i amp · cl t β 1 ( 5 ) where k is a proportionality constant independent of β 1 and i amp . that is , here , tl 1 * i amp and t 2 s * i amp are related as illustrated below ( see equations ( 7 ) and ( 8 )). while fig3 a , fig3 b , fig3 c , fig3 d , fig4 a , fig4 b , and fig4 c have been described by assuming that c 1 mdac + c 1 h = c 1 s for ease of explanation , it makes no difference if this assumption is eliminated . since the sampling capacitor c 1 s in the mdac ( mdac 1 ) is determined by thermal noise ( kt / c ), a constant value c 0 is used as the reference value in fig3 a , fig3 b , fig3 c , fig3 d , fig4 a , fig4 b , and fig4 c . the signal amplification factor ( m ) is expressed by c 1 s / c 1 h . more specifically , in the case of fig3 a , fig3 b , fig3 c , and fig3 d ( 1 . 5bmdac ), m = 2 , and in the case of fig4 a , fig4 b , and fig4 c ( 2 . 5bmdac ), m = 4 . accordingly , the mdac in fig3 a , fig3 b , fig3 c , and fig3 d and the mdac in fig4 a , fig4 b , and fig4 c are defined as illustrated below if c 1 h and c 1 mdac are expressed using the signal amplification factor , m ( see equations ( 10 ) and ( 11 )). the sampling capacitor c 2 , in the next - stage mdac ( mdac 2 ) may generally be multiplied by ( 1 / m ) relative to the signal amplification factor ( m ), but the limitation by the minimum capacitance value needs to be considered . that is , the following two points ( a ) and ( b ) need to be considered . ( a ) primarily in the first half stage : the sampling capacitor c 2 s in the mdac 2 is scaled relative to c 1 s by a factor of ( 1 / m ). c 2 s = c 1 s m = c 0 m ( 12 ) ( b ) primarily in the second half stage : no scaling is applied to c 2 s relative to c 1 s ( the size is the same ) because the former is limited by the minimum capacitance value . c 2 s = c 1 s m = c 0 m ( 13 ) fig6 is a comparison table of the performance for some kind of mdac circuits with considering some kind of load conditions for the output of each mdac ; that is , the performance under no load conditions and the performance under load conditions with and without scaling are compared for each of the signal amplification factors m = 2 and m = 4 . here , the term “ with scaling ” indicates that the capacitance of the mdac is reduced , for example , in increments of ½ for each subsequent stage relative to the preceding one in the case of m = 2 ( 1 . 5bmdac ), and in increments of ¼ for each subsequent stage relative to the preceding one in the case of m = 4 ( 2 . 5bmdac ). on the other hand , the term “ without scaling ” indicates that the capacitance of the mdac remains the same at each stage . as illustrated in fig6 , under load conditions , the conversion time ( see t * i amp ) increases by a factor of two or more compared with no load conditions ; in particular , it is seen that when no scaling is applied to the capacitor c 2 s in fig5 , the decrease in conversion speed becomes more pronounced . further , in the multi - bit case ( m = 4 ), it is seen that when no scaling is applied to the capacitor c 2 , the conversion speed ( operation speed ) decreases by a factor of six or more compared with no load conditions . this indicates that when the supply current to the amplifier ( op amp ) is held constant , the time taken to accomplish the conversion increases by a factor of two or more compared with no load conditions ( the conversion speed decreases by a factor of two or more ). in this way , in the mdac ( switched capacitor circuit ), when there is a load associated with the sampling capacitor at the subsequent stage , for example , the time taken to accomplish the conversion ( computation ) increases by a factor of two or more compared with the time taken when there is no such load . furthermore , if no scaling is applied , the decrease in the conversion speed of the mdac becomes more pronounced ; further , as the number of bits increases , the decrease in speed becomes greater . fig7 is a simplified circuit model of a switched capacitor circuit ( ex . mdac ) in the hold operation mode that is used for both analog computation of mdac and sampling the output voltage of mdac to a loading capacitance ; more specifically , the operation in the earlier described analog computation mode ( hold mode ) is illustrated in simplified form . as illustrated in fig7 , in the sc circuit 11 ( mdac 1 ) that performs analog computation , the capacitors c 1 mdac and c 1 h are connected ( used ). further , the sampling capacitor c 2 s in the sc circuit 12 ( mdac 2 ) at the subsequent stage is coupled to the output of the operational amplifier ( op amp ) op 1 in order to sample its output voltage vo ( 0 ). more specifically , in the sc circuit 11 , the hold capacitor c 1 h is connected between the output terminal and negative input terminal of the op amp op 1 , and the computation capacitor c 1 mdac is connected between the output terminal of the sub - da converter ( 101 ) and the negative input terminal of the op amp op 1 . then , the sampling capacitor c 2 s in the sc circuit 12 at the subsequent stage is coupled to the output terminal of the op amp op 1 . accordingly , when the sc circuit 11 is performing analog computation , since the sampling capacitor c 2 s in the sc circuit 12 at the subsequent stage is connected as the load for the op amp op 1 , the supply current to the amplifier needs to be increased . this not only increases power consumption but also increases the size of the amplifier , thus increasing the die size it occupies and hence leading to an increase in cost . next , embodiments of a switched capacitor circuit and an ad conversion circuit will be described in detail with reference to the accompanying drawings . fig8 a is a simplified circuit model of a first embodiment switched capacitor circuit ( ex . mdac ) in the first hold operation mode that is used for only analog computation of mdac without loading capacitance , and fig8 b is a simplified circuit model of a first embodiment switched capacitor circuit ( ex . mdac ) in the second hold operation mode that is used for sampling the output voltage of mdac in the first operation mode to a loading capacitance by using a sampling switch , the amplifier and the capacitance c 1 h . as is apparent by comparing the above - described fig7 with fig8 a and fig8 b , in the first embodiment the analog computation ( hold operation ) is performed by dividing it into two modes , the first - half operation mode and the second - half operation mode . more specifically , in the first - half operation mode depicted in fig8 a , the analog computation is performed in the sc circuit 11 ( mdac 1 ) by disconnecting the sampling capacitor c 2 s in the subsequent - stage sc circuit 12 ( mdac 2 ). on the other hand , in the second - half operation mode depicted in fig8 b , the feedback coefficient β is set to “ 1 ”, i . e ., full feedback , by disconnecting the computation capacitor c 1 mdac in the sc circuit 11 , and the output voltage is stored on the sampling capacitor c 2 , in the subsequent - stage sc circuit 12 . by thus performing the analog computation in two separate modes , it becomes possible to enhance the speed of computation , reduce the power consumption of the amplifier , or reduce the footprint of the circuit , and so on . while the present specification deals primarily with examples in which the sc circuit is employed as the mdac , the embodiments described herein are basically intended to enhance the speed of computation of the sc circuit itself and are therefore extensively applicable not only to sc circuits but also to various circuits employing sc circuits . fig9 a and fig9 b are diagrams for explaining the stage circuit of the first embodiment and its operation with the conversion time ( t ) divided into four periods ( 1 ) to ( 4 ). as is apparent by comparing fig9 a and fig9 b with the previously described fig2 a and fig2 c , the operation of the mdac according to the first embodiment is characterized in that , in the period ( 1 ), the mdac 1 and the adc 1 ( sub - ad converter ) are not used , and the mdac 2 performs computation ( hold : h ). here , just like the op amp op 1 in the mdac 1 in the period ( 3 ) to be described later , the output of the op amp op 2 in the mdac 2 is decoupled from the load ( c 3 s ) in the subsequent - stage mdac ( mdac 3 ) and the op amp op 2 is thus at no load . next , in the period ( 2 ), the adc 1 is used and the mdac 1 performs sampling ( s ), while the mdac 2 performs computation ( full feedback operation ). in the period ( 3 ), the mdac 2 and the adc 2 ( sub - ad converter ) are not used , and the mdac 1 performs computation . here , the output of the op amp op 1 in the mdac 1 is decoupled from the load ( c 2 s (= c 2 n1 + c 2 n2 )) in the subsequent - stage mdac 2 and the op amp op 1 is thus at no load . the operation of the mdac 1 in the period ( 3 ) corresponds to the operation of the sc 11 ( mdac 1 ) described with reference to fig8 a . here , the capacitor c 1 n1 acts as the computation capacitor c 1 mdac and the capacitor c 1 n2 as the hold capacitor c 1 h . then , in the period ( 4 ), the mdac 1 performs computation ( full feedback operation ), while on the other hand , the adc 2 is used and the mdac 2 performs sampling . the operation of the mdac 1 in the period ( 4 ) corresponds to the operation of the sc 11 ( mdac 1 ) described with reference to fig8 . in this way , according to the mdac of the first embodiment , it becomes possible to enhance the speed of computation , reduce the power consumption of the amplifier , or reduce the footprint of the circuit , and so on . here , the ratio between the periods ( 1 ) and ( 2 ) ( or the periods ( 3 ) and ( 4 )) may be varied as needed according to such factors as the operating speed of the circuit and the size of the capacitors used . further , between the periods ( 1 ) and ( 2 ) ( or the periods ( 3 ) and ( 4 )), the supply current to the op amp op 1 may be set to different values . the control of the ratio between the periods ( 1 ) and ( 2 ) ( or the periods ( 3 ) and ( 4 )) and the control of the supply current to the op amp in the periods ( 1 ) and ( 2 ) ( or the periods ( 3 ) and ( 4 )) may be performed not only in the first embodiment but also in the second to fifth embodiments to be described later . fig1 a is a circuit diagram illustrating one example of the stage circuit of the first embodiment , and fig1 b is a timing chart for explaining the operation of the stage circuit in fig1 a . the mdac illustrated in fig1 a and fig1 is a 1 . 5bmdac ( mdac 1 ). the circuit of the mdac 1 in the periods ( 1 ) to ( 4 ) in fig1 corresponds to that of the mdac 1 in ( 1 ) to ( 4 ) depicted in fig9 a . in fig1 a , reference character swc 1 designates a switch control unit which receives signals mclk and shsel and outputs switch control signals ; further , 101 is a sub - dac , cmp 1 and cmp 2 are comparators , dff 1 and dff 2 are flip - flops , and lo 1 is a logic unit . as illustrated in fig1 a , the mdac 1 ( switched capacitor circuit ) includes capacitors c 1 n1 and c 1 n2 ( two or more internal capacitors ), an op amp op 1 ( one or more amplifiers ), and switches sws 1 a / 1 b / 2 a / 2 b , swh 1 a / 1 b , swh 2 a / 2 b , and swadcin ( two or more internal switches ). as is apparent by comparing fig1 a and fig1 b with the previously described fig3 a and fig3 b , the mdac 1 is similar between the two , but differs in the way the switch control unit swc 1 controls the respective switches . first , in the period ( 1 ) of fig1 b , the switch control unit swc 1 sets the control signals for the switches sws 1 a / 1 b / 2 b , swh 1 a / 1 b , swh 2 a / 2 b , and swadcin to a low level “ l ”, causing these switches to turn off . the signal clkadc is at “ l ”, so that the flip - flops dff 1 and dff 2 are disabled . next , in the period ( 2 ) of fig1 , the switch control unit swc 1 sets the control signals for the switches sws 1 a / 1 b / 2 a / 2 b and swadcin to a high level “ h ”, causing these switches to turn on . here , the control signals for the switches swh 1 a / 1 b and swh 2 a / 2 b and the signal clkadc remain at “ l ”. as a result , in the period ( 2 ), the switches sws 1 a / 1 b / 2 a / 2 b and swadcin turn on , and the mdac 1 performs sampling ( s ). that is , the input voltage vin ( the compare voltage v cmp ) is coupled to the comparators cmp 1 and cmp 2 where it is compared with the reference voltages ( ¼ )* vr and −( ¼ )* vr , respectively , and the comparison results are supplied to the input terminals of the respective flip - flops dff 1 and dff 2 . further , in the period ( 2 ), the input voltage vin is sampled by the sampling capacitor c 1 s ( c 1 n1 + c 1 n2 ). next , in the period ( 3 ) of fig1 b , the switch control unit swc 1 sets the control signals for the switches sws 1 a / 1 b / 2 a / 2 b and swadcin to “ l ”, causing these switches to turn off , and sets the control signals for the switches swh 1 a / 1 b and swh 2 a / 2 b to “ h ”. the signal clkadc is also set to “ h ”. as a result , in the period ( 3 ), the comparison results from the comparators cmp 1 and cmp 2 are latched into the flip - flops dff 1 and dff 2 and held therein . since similar control is performed on the subsequent - stage mdac 2 , the op amp op 1 is disconnected from the load ( c 2 s ) in the subsequent - stage mdac 2 and is thus held at no load . more specifically , the hold capacitor c 1 h ( c 1 n2 ) is connected between the output terminal and negative input terminal of the op amp op 1 , and the computation capacitor c 1 mdac ( c 1 n1 ) is connected between the output terminal of the sub - da converter 101 and the negative input terminal of the op amp op 1 . then , the op amp op 1 operates at no load with its output terminal decoupled from the sampling capacitor c 2 s ( c 2 n1 + c 2 n2 ) in the subsequent - stage mdac 2 . the operation of the mdac 1 in the period ( 3 ) is the same as that described with reference to fig8 a , fig9 a , and fig9 b . next , in the period ( 4 ) of fig1 b , the switch control unit swc 1 sets the control signal for the switches swh 1 a / 1 b from “ h ” to “ l ” to turn off the switches swh 1 a / 1 b thereby disconnecting the capacitor c 1 n1 . the other switches sws 1 a / 1 b / 2 a / 2 b , swadcin , and swh 2 a / 2 b are each held in the same state as in the period ( 3 ). thus , in the period ( 4 ), the mdac 1 performs full feedback operation . the operation of the mdac 1 in the period ( 4 ) is the same as that described with reference to fig8 a , fig9 a , and fig9 b . fig1 is a comparison table of the performance for the 1 . 5bmdac of the first embodiment for comparison with the mdac depicted in fig3 a , that is , the amount of performance improvement achieved by the 1 . 5bmdac , i . e ., the mdac with m = 2 . as seen from the “ t * i amp ” section in fig1 that relates to the operating speed or power consumption of the mdac , the mdac of the first embodiment is capable of improving the speed or the power consumption by about 33 % when scaling is applied and by about 40 % when no scaling is applied , as compared with the mdac of fig3 a . more specifically , when the mdac operating speed ( t ) is the same , the power consumption ( the op amp current i amp ) may be reduced , while on the other hand , when the op amp current ( i amp : power consumption ) is the same , the mdac operating speed ( t ) may be enhanced . regarding the operating speed and power consumption described above , their magnitude may be designed appropriately as needed by giving priority to one or the other of the two factors . in this case , an alteration may be made , for example , by adjusting the duration of each of the periods ( 1 ) to ( 4 ) ( duty ratio ). further , when applying the mdac to a cyclic ad conversion circuit , the circuit may be designed by adjusting the switch timing ( clock period ) so as to increase the processing time in the starting or first - half period and reduce the processing time in the last or second - half period . fig1 is a comparison table of the performance for the 2 . 5bmdac of the first embodiment for comparison with the mdac depicted in fig4 a , that is , the amount of performance improvement achieved by the 2 . 5bmdac , i . e ., the mdac with m = 4 . as seen from the “ t * i amp ” section in fig1 , the 2 . 5bmdac as a modified example of the first embodiment is capable of improving the speed or the power consumption by about 43 % when scaling is applied and by about 63 % when no scaling is applied , as compared with the mdac of fig4 a . regarding “ t * i amp ”, by giving priority to the operating speed ( t ) or the power consumption ( i amp ), whichever is desired , their magnitude may be designed appropriately as needed , as just described with reference to fig1 ; further , the duration of each of the periods ( 1 ) to ( 4 ) may also be adjusted as needed . here , the duration of the first - half operation mode ( period ( 3 )) during analog computation of the mdac ( mdac 1 ) and the duration of the second - half operation mode ( period ( 4 )) are denoted by tl 1 and tl 2 , respectively , and the feedback ratio β in the first - half operation mode and that in the second - half operation mode are denoted by β 1 and β 2 , respectively . the first - half operation mode ( period ( 3 )) during analog computation of the mdac of the first embodiment is the same as the operation under no load conditions for the case of m = 2 described in the previously given fig6 . on the other hand , in the second - half operation mode ( period ( 4 )) during analog computation of the mdac of the first embodiment , since the capacitor c 1 mdac is disconnected , the feedback ratio β becomes equal to unity , and the capacitor cl 1 may be regarded as almost zero . when the value of t 2 s * i amp is compared between the equation ( 15 ) for the mdac of fig3 a and the equation ( 18 ) for the mdac of the first embodiment , it is seen that the mdac of the first embodiment is faster by a factor of m . the above description has dealt with the case where only the switch timing of each switch is controlled by the switch control unit swc 1 , but if , for example , the duty ratio between the periods ( 1 ) and ( 2 ) ( or the periods ( 3 ) and ( 4 )) or the supply current to the op amp is also controlled , performance close to the ideal may be achieved . fig1 a and fig1 b are diagrams for explaining a stage circuit according to a second embodiment and its operation with the conversion time ( t ) divided into four periods ( 1 ) to ( 4 ). as is apparent by comparing fig1 a and fig1 b with the previously described fig9 a and fig9 b , the operation of the mdac according to the second embodiment is characterized in that , in the period ( 1 ), the mdac 1 is not used but the adc 1 is used . on the other hand , the mdac 2 performs computation ( hold : h ). that is , in the case of the mdac of the second embodiment , the adc 1 is used in the period ( 1 ) so that in the period ( 1 ) the add / subtract coefficient da 1 is supplied to the sub - dac not depicted ( refer , for example , to the sub - dac 101 in fig3 ) in the mdac 1 . on the other hand , in the case of the mdac of the first embodiment , the adc 1 supplies the add / subtract coefficient da 1 to the sub - dac in the period ( 2 ). next , in the period ( 2 ), the mdac 1 performs sampling ( s ), while the mdac 2 performs computation ( full feedback operation ). the adc 1 continues to perform the same operation as that in the period ( 1 ). in the period ( 3 ), the mdac 2 is not used but the adc 2 is used , and the mdac 1 performs computation . here , the output of the op amp op 1 in the mdac 1 is decoupled from the load ( c 2 s (= c 2 n1 + c 2 n2 )) in the subsequent - stage mdac 2 and the op amp op 1 is thus at no load , as in the first embodiment . that is , in the second embodiment , the adc 2 is used in the period ( 3 ) so that in the period ( 3 ) the add / subtract coefficient da 2 is supplied to the sub - dac ( not depicted ) in the mdac 2 . then , in the period ( 4 ), the mdac 1 performs computation ( full feedback operation ), while on the other hand , the mdac 2 performs sampling . the adc 2 continues to perform the same operation as that in the period ( 3 ). in this way , the mdac of the second embodiment aims to relax the constraints on the conversion speed of the comparators in the adc 1 ( for example , the comparators cmp 1 and cmp 2 in fig1 a ) by utilizing , for example , the fact that the analog computation result of the mdac 1 is output in the two periods ( 1 ) and ( 2 ). that is , according to the second embodiment , the comparators cmp 1 and cmp 2 in the adc 1 need only perform the comparisons over the entire duration of the period ( 2 ) by using the final data obtained from the period ( 1 ); this serves to alleviate the need for higher operating speeds demanded of the comparators cmp 1 and cmp 2 . fig1 a is a circuit diagram illustrating one example of the stage circuit of the second embodiment , and fig1 b is a timing chart for explaining the operation of the stage circuit of fig1 a . the stage circuit ( mdac ) illustrated in fig1 a and fig1 b is a 1 . 5bmdac ( mdac 1 ). the circuit of the mdac 1 in the periods ( 1 ) to ( 4 ) in fig1 b corresponds to that of the mdac 1 in ( 1 ) to ( 4 ) in the above - described fig1 a . as is apparent from a comparison between fig1 a and the previously described fig1 a , the mdac ( mdac 1 ) of the second embodiment differs from the mdac 1 of the first embodiment by the inclusion of a capacitor c s ( cmp ) which is provided between the switch swascin and the adc 1 and which acts as a sampling capacitor c s in the period ( 1 ). as illustrated in fig1 a , the mdac 1 ( switched capacitor circuit ) includes capacitors c n1 , c n2 , and c s ( cmp ) ( two or more internal capacitors ), the op amp op 1 ( one or more amplifiers ), and switches sws 1 a / 1 b / 2 a / 2 b , swh 1 a / 1 b , swh 2 a / 2 b , and swadcin ( two or more internal switches ). in the period ( 1 ) of fig1 b , the switch control unit swc 1 sets the control signals for the switches sws 1 a / 1 b / 2 a / 2 b , swh 1 a / 1 b , and swh 2 a / 2 b to a low level “ l ”, causing these switches to turn off , and sets the control signal for the switch swadcin to a high level “ h ”, causing the switch swadcin to turn on . the signal clkadc is at “ l ”, so that the flip - flops dff 1 and dff 2 are disabled . that is , the difference from the embodiment earlier described with reference to fig1 a and fig1 is that , in the period ( 1 ), the switch swadcin is turned on so that the compare voltage v cmp ( the input voltage vin ) is sampled onto the sampling capacitor c s ( cmp ). next , in the period ( 2 ) of fig1 b , the switch control unit swc 1 sets the control signal for the switches sws 1 a / 1 b / 2 a / 2 b to “ h ”, causing these switches to turn on , and sets the control signal for the switch swadcin to “ l ”, causing the switch swadcin to turn off . here , the control signals for the switches swh 1 a / 1 b and swh 2 a / 2 b and the signal clkadc remain at “ l ”. that is , upon entering the period ( 2 ), the compare voltage v cmp sampled by the sampling capacitor c s ( cmp ) in the period ( 1 ) is coupled to the comparators cmp 1 and cmp 2 in the adc 1 where it is compared with the reference voltages ( ¼ )* vr and −( ¼ )* vr , respectively , and the comparison results are supplied to the input terminals of the respective flip - flops dff 1 and dff 2 . next , in the period ( 3 ) of fig1 b , the switch control unit swc 1 sets the control signals for the switches sws 1 a / 1 b / 2 a / 2 b and swadcin to “ l ”, causing these switches to turn off , and sets the control signals for the switches swh 1 a / 1 b and swh 2 a / 2 b to “ h ”, causing these switches to turn on . the signal clkadc is also set to “ h ”. as a result , in the period ( 3 ), the comparison results from the comparators cmp 1 and cmp 2 are latched into the flip - flops dff 1 and dff 2 and held therein . here , the op amp op 1 is disconnected from the load ( c 2 ) in the subsequent - stage mdac 2 , but its output voltage vo 1 is sampled onto the sampling capacitor c s ( cmp ) in the adc 2 at the subsequent stage . next , in the period ( 4 ) of fig1 b , the switch control unit swc 1 sets the control signal for the switches swh 1 a / 1 b from “ h ” to “ l ” to turn off the switches swh 1 a / 1 b thereby disconnecting the capacitor c 1 n1 . the other switches sws 1 a / 1 b / 2 a / 2 b , swadcin , and swh 2 a / 2 b are each held in the same state as in the period ( 3 ). thus , in the period ( 4 ), the mdac 1 performs full feedback operation . fig1 a and fig1 are diagrams for explaining a stage circuit according to a third embodiment and its operation with the conversion time ( t ) divided into four periods ( 1 ) to ( 4 ). further , fig1 a is a circuit diagram illustrating one example of the stage circuit of the third embodiment , and fig1 is a timing chart for explaining the operation of the stage circuit of fig1 a . as is apparent by comparing fig1 a , fig1 b , fig1 a , and fig1 with the previously described fig9 a , fig9 , fig1 a , and fig1 b , the third embodiment differs from the first embodiment in that the two comparators cmp 1 and cmp 2 in the first embodiment are replaced by one common comparator cmp 0 . that is , in the third embodiment , as is apparent from a comparison between fig1 a and the previously described fig1 a , the adc 1 is provided with two switches seladc 1 and seladc 2 , and the one comparator cmp 0 is made to perform the same functions as the comparators cmp 1 and cmp 2 of the first embodiment in the periods ( 1 ) and ( 2 ), respectively . further , the common signal clkadc supplied to the clock terminals of the flip - flops dff 1 and dff 2 in the first embodiment is replaced by two separate signals clkadc 1 and clkadc 2 so that the activation of each of the flip - flops dff 1 and dff 2 is controlled independently of each other . as illustrated in fig1 a and fig1 b , the mdac according to the third embodiment is characterized in that , in the period ( 1 ), the mdac 1 is not used but the adc 1 is used , while on the other hand , the mdac 2 performs computation ( h ). the purpose of using the adc 1 in the period ( 1 ) is , for example , to compare the input voltage vin ( the compare voltage c cmp ) with the reference voltage ( ¼ )* vr and output the result to the flip - flop dff 1 . next , in the period ( 2 ), the adc 1 is used and the mdac 1 performs sampling ( s ), while the mdac 2 performs computation . the purpose of using the adc 1 in the period ( 2 ) is , for example , to compare the compare voltage c cmp with the reference voltage −( ¼ )* vr and output the result to the flip - flop dff 2 . that is , in the third embodiment , in the period ( 1 ) the adc 1 is used to compare the compare voltage c cmp with the reference voltage ( ¼ )* vr , and in the period ( 2 ) the adc 1 is used to compare the compare voltage c cmp with the reference voltage −( ¼ )* vr . in this way , in the periods ( 1 ) and ( 2 ), the same comparator is used to compare the compare voltage with the respective reference voltages . in the period ( 3 ), the mdac 2 is not used but the adc 2 is used , while on the other hand , the mdac 1 performs computation . then , in the period ( 4 ), the adc 2 is used , the mdac 1 performs computation , and the mdac 2 performs sampling . the purpose of using the adc 2 in the periods ( 3 ) and ( 4 ) is to compare the compare voltage at the subsequent stage with difference reference voltages , and the same comparator is used for this purpose . as illustrated in fig1 a , in the third embodiment , the compare voltage c cmp is applied to one input of the comparator cmp 0 in the adc 1 , and the reference voltage ( ¼ )* vr or −( ¼ )* vr , whichever is selected , is applied to the other input via the switch seladc 1 or seladc 2 , respectively . here , the switches seladc 1 and seladc 2 are controlled by signals from the switch control unit swc 1 . as illustrated in fig1 a , the mdac 1 ( switched capacitor circuit ) includes capacitors c 1 n1 and c 1 n2 ( two or more internal capacitors ), an op amp op 1 ( one or more amplifiers ), and switches sws 1 a / 1 b / 2 a / 2 b , swh 1 a / 1 b , swh 2 a / 2 b , and swadcin ( two or more internal switches ). in the period ( 1 ) of fig1 b , the switch control unit swc 1 sets the control signals for the switches sws 1 a / 1 b / 2 a / 2 b , swh 1 a / 1 b , swh 2 a / 2 b , and seladc 2 to “ l ”, causing these switches to turn off , and sets the control signals for the switches swadcin and seladc 1 to “ h ”, causing these switches to turn on . as a result , the compare voltage c cmp ( the input voltage vin ) and the reference voltage ( ¼ )* vr selected via the switch seladc 1 are applied to the comparator cmp 0 which then compare these voltages and outputs the result of the comparison . here , the signals clkadc 1 and clkadc 2 are both “ l ”, so that the flip - flops dff 1 and dff 2 are disabled . next , in the period ( 2 ) of fig1 b , the switch control unit swc 1 sets the control signals for the switches sws 1 a / 1 b / 2 a / 2 b and seladc 2 to “ h ”, causing these switches to turn on , and sets the control signal for the switch seladc 1 to “ l ”, causing the switch seladc 1 to turn off . the other switches are each held in the same state as in the period ( 1 ). in the period ( 2 ), the signal clkadc 1 changes from “ l ” to “ h ”, so that the flip - flop dff 1 is enabled to latch and hold the result of the comparison made between the compare voltage c cmp and the reference voltage ( ¼ )* vr by the comparator cmp 0 . further , in the period ( 2 ), since the switch seladc 1 turns off and the switch seladc 2 turns on , as described above , the comparator cmp 0 compares the compare voltage c cmp with the reference voltage −( ¼ )* vr applied via the switch seladc 2 . next , in the period ( 3 ) of fig1 b , the switch control unit swc 1 sets the control signals for the switches sws 1 a / 1 b / 2 a / 2 b , swadcin , and seladc 2 to “ l ”, causing these switches to turn off , and sets the control signals for the switches swh 1 a / 1 b and swh 2 a / 2 b to “ h ”, causing these switches to turn on . in the period ( 3 ), the signal clkadc 2 changes from “ l ” to “ h ”, so that the flip - flop dff 2 is enabled to latch and hold the result of the comparison made between the compare voltage c cmp and the reference voltage −( ¼ )* vr by the comparator cmp 0 . as a result , the result of the comparison between the compare voltage c cmp and the reference voltage ( ¼ )* vr , held in the flip - flop dff 1 , and the result of the comparison between the compare voltage c cmp and the reference voltage −( ¼ )* vr , held in the flip - flop dff 2 , are supplied to the logic unit lo 1 which performs a prescribed logic operation between them . then , in the period ( 4 ) of fig1 b , the switch control unit swc 1 sets the control signal for the switches swh 1 a / 1 b from “ h ” to “ l ” to turn off the switches swh 1 a / 1 b . in other respects , the operation in each of the periods ( 1 ) to ( 4 ) is apparent from the description given in the first and second embodiments , and therefore will not be further described herein . thus , according to the third embodiment , it becomes possible to reduce the amount of hardware by making provisions to share the same comparator for the operation of the adc 1 . fig1 is a diagram depicting the number of comparators of the sub - adc needed in the stage of the third embodiment for comparison with the number of comparators needed in each of the mdacs depicted in fig3 a and fig4 a . as illustrated in fig1 , in the case of the signal amplification factor m = 2 ( 1 . 5bmdac ), the comparators cmp 1 and cmp 2 in the adc ( adc 1 ) may be replaced by one common comparator cmp 0 , thus halving the number of comparators . further , in the case of the signal amplification factor m = 4 ( 2 . 5bmdac ), the number of comparators cmp 11 to cmp 16 ( six comparators ) in fig1 , for example , may be reduced by one half , i . e ., to three , when the third embodiment is applied . the examples given in fig1 are only illustrative and not restrictive , and it is to be understood that the effect of reducing the number of comparators becomes greater as the signal amplification factor , m , ( the number of bits ) becomes larger . fig1 a and fig1 b are diagrams for explaining another example of the mdac and its operation ; in the illustrated mdac configuration , provisions are made to share one common op amp in order to reduce the footprint and power consumption of a pipelined ad conversion circuit . in the drawings hereinafter described , the earlier described sub - ad converts adc 1 and adc 2 are not depicted since they are not directly relevant to the fourth and fifth embodiments . as is apparent by comparing fig1 a and fig1 b with fig2 a and fig2 b , the mdac configuration depicted in fig1 a and fig1 b is characterized in that the op amps op 1 and op 2 in the mdacs depicted in fig2 a and fig2 b are substituted by one common op amp ( op 1 ). that is , in the mdac 1 , the op amp is not needed in the sampling mode ( the period ( 1 )+( 2 ): s ) that samples the input voltage vin , but is needed only in the hold mode ( the period ( 3 )+( 4 ): h ) that performs computation . on the other hand , the mdac 2 which operates 180 degrees out of phase with the mdac 1 , the op amp is not needed in the sampling mode ( the period ( 3 )+( 4 ): s ) that samples the input voltage ( the output voltage vo 1 = vin 2 of the mdac 1 at the preceding stage ). the op amp is used only in the hold mode ( the period ( 1 )+( 2 ): h ) that performs computation . in view of the fact that the period in which the op amp is needed differs between the mdac 1 and the mdac 2 , the op amp ( op 1 ) is used as the op amp 2 for the mdac 2 during the period ( 1 )+( 2 ), and the op amp op 1 is used as the op amp 1 for the mdac 1 during the period ( 3 )+( 4 ). in like manner , the comparators in the sub - ad converts adc 1 and adc 2 not depicted may also be substituted by one common comparator . however , the capacitors in the respective mdacs ( the computation capacitor c 1 n1 , c 1 n2 in the mdac 1 and the computation capacitor c 2 n1 , c 2 n2 in the mdac 2 ) need to be provided separately , and it is therefore not possible to share the same capacitor between them . fig1 a and fig1 b are diagrams for explaining the mdac of the earlier described first embodiment and its operation . as illustrated in fig1 a and fig1 b , it is possible to share one op amp ( op 1 ) between adjacent mdacs ( for example , between the mdac 1 and the mdac 2 ) even in the case of the mdac of the first embodiment such as depicted , for example , in fig9 a . further , as earlier described with reference to fig1 a , fig1 b , fig1 a , fig1 b , and fig1 , in the mdac of the third embodiment , it has been possible to reduce the number of comparators by taking advantage of the fact that the computation result of the mdac is output twice ( h ( 1 ) and h ( 2 )). here , as illustrated in fig1 a and fig1 , c 1 n1 is not used in the periods ( 1 ) and ( 4 ), c 1 n2 is not used in the period ( 1 ), c 2 n1 is not used in the periods ( 2 ) and ( 3 ), and c 2 n2 is not used in the period ( 3 ). in the mdacs of the fourth and fifth embodiments to be described later , the capacitors are also shared by utilizing the periods in which the respective capacitors in the mdacs ( c 1 n1 and c 1 n2 in the mdac 1 and c 2 n1 and c 2 n2 in the mdac 2 ) are not used . for the mdac circuit configuration , more specifically , in the case of the 1 . 5bmdac , for example , two types of circuit configuration are possible , that is , the first configuration example ( type i ) and the second configuration example ( type ii ). fig2 a is a circuit diagram illustrating the first configuration example ( type i ) of the 1 . 5bmdac in sampling mode and in hold mode , respectively , and fig2 b , fig2 , and fig2 d are diagrams for explaining the operation of the mdac of fig2 a . on the other hand , fig2 a is a circuit diagram illustrating the second configuration example ( type ii ) of the 1 . 5bmdac in sampling mode and in hold mode , respectively , and fig2 b , fig2 c , and fig2 d are diagrams for explaining the operation of the mdac of fig2 a . here , fig2 a , fig2 , fig2 c , and fig2 d correspond to the previously described fig3 a , fig3 b , fig3 c , and fig3 d , except that the signals associated with the adc 1 ( sub - ad converter ) in the mdac 1 in fig3 a , fig3 b , fig3 c , and fig3 d are omitted . the mdacs of the first to third embodiments illustrated in fig8 a , fig8 b , fig9 a , fig9 b , fig1 a , fig1 b , fig1 , fig1 a , fig1 b , fig1 a , fig1 , fig1 a , fig1 , fig1 a , fig1 b , and fig1 are each based on the type i circuit , but it is also possible to apply the mdacs of the first to third embodiments to the type ii circuit . first , as illustrated in fig2 a , fig2 , fig2 c , and fig2 d , that is , as previously described with reference to fig3 a , fig3 b , fig3 c , and fig3 d , the relations c 1 s = c 1 n1 + c 1 n2 = c 0 , c 1 h = c 0 / 2 , and c 1 mdac = c 0 / 2 hold in the 1 . 5bmdac 1 of the type i illustrated in fig2 a . here , the feedback ratio β is β = c 1 h /( c 1 h + c 1 mdac )= ½ , and the signal amplification factor , m , is m = c 1 s / c 1 h = 2 . on the other hand , the relations c 1 s = c 1 s11 + c 1 s12 = c 0 , c 1 h = c 0 / 2 , and c 1 mdac = c 1 s = c 0 hold in the 1 . 5bmdac 1 of the type ii illustrated in fig2 a . here , the feedback ratio β is β = c 1 h / c 1 h + c 1 mdac )= ⅓ , and the signal amplification factor , m , is m = c 1 s / c 1 h = 2 . more specifically , as illustrated in the left half of fig2 a and in the periods ( 1 ) and ( 2 ) (( 1 )+( 2 )) of fig2 b , in the sampling ( s ) mode of the mdac 1 the switch control unit swc 1 sets the control signal for the switches sws 1 a / 11 b / 2 a / 12 b to a high level “ h ”, causing these switches to turn on . further , in the sampling mode of the mdac 1 in the period ( 1 )+( 2 ), the switch control unit swc 1 sets the control signal for the switches swh 1 a / 11 b / 12 b / 2 b to a low level “ l ”. this causes the switches swh 1 a / 11 b / 12 b / 2 b to turn off . here , in the sampling capacitor c 1 s on which the mdac 1 samples the input signal vin , the capacitors c 1 s11 and c 1 s12 are connected in parallel with each other with the switches swh 1 a / 11 b / 12 b turning on ; as a result , the sampling capacitor c 1 s is c 1 s = c 1 s11 + c 1 s12 . here , if c 1 s11 = c 1 s12 = c 0 / 2 , then c 1 s = c 1 s11 + c 1 s12 = c 0 , as earlier described . next , as illustrated in the right half of fig2 a and in the periods ( 3 ) and ( 4 ) (( 3 )+( 4 )) of fig2 b , in the hold ( h : computation ) mode of the mdac 1 the switch control unit swc 1 sets the control signal for the switches sws 1 a / 11 b / 12 b / 2 b to “ l ”, causing these switches to turn off . further , in the hold mode in the period ( 3 )+( 4 ), the switch control unit swc 1 sets the control signal for the switches swh 1 a / 11 b / 12 b / 2 b to “ h ”. this causes the switches swh 1 a / 113 / 123 / 23 to turn on . as a result , as earlier described , the hold capacitor c 1 h and the computation capacitor c 1 mdac are c 1 h = c 0 / 2 and c 1 mdac = c 1 s = c 0 , respectively , the feedback ratio β is β = c 1 h /( c 1 h + c 1 mdac )= ⅓ , and the signal amplification factor , m , is m = c 1 s / c 1 h = 2 . when the signal amplification is m = 2 , the relation depicted in fig2 c holds between vin / vr and vo / vr ; on the other hand , the input voltage vin ( the compare voltage v cmp ), the digital output do , the add / subtract coefficient da 1 , the output voltage vda 1 of the sub - dac 101 , and the output voltage vo of the op amp op 1 are as depicted in fig2 d . here , fig2 c and fig2 d are the same as the earlier given fig2 c and fig2 d , respectively . fig2 a and fig2 b are diagrams for explaining the basic operation of the mdac of the second configuration example ( type ii ); the above - described fig2 a and fig2 b are redrawn here in an easier to understand manner . in the mdac configuration depicted in fig2 a , one common op amp ( op 1 ) is shared between two mdacs ( mdac 1 and mdac 2 ). to simplify the explanation , c 1 s = c 1 mdac = c 0 , c 1 h = c 0 / m , c 2 s = c 2 mdac = c 0 / m , and c 2 h = c 0 / m . here , m represents the signal amplification factor . first , as illustrated in the top half of fig2 a and in the period ( 1 )+( 2 ) of fig2 b , when the mdac 1 is in the sampling ( s ) mode and the mdac 2 in the computation ( h ) mode , the op amp ( op 1 ) in the mdac 1 is not used , but the op amp ( op 2 ) in the mdac 2 is used ( operating ). further , in the period ( 1 )+( 2 ), the capacitor c 1 s in the mdac 1 and the capacitors c 2 mdac and c 2 h in the mdac 2 are used , while the capacitor c 1 h in the mdac 1 is reset . on the other hand , as illustrated in the bottom half of fig2 a and in the period ( 3 )+( 4 ) of fig2 b , when the mdac 1 is in the computation mode and the mdac 2 in the sampling mode , the op amp ( op 1 ) in the mdac 1 is used , but the op amp ( op 2 ) in the mdac 2 is not used . further , in the period ( 3 )+( 4 ), the capacitors c 1 mdac and c 1 h in the mdac 1 and the capacitor c 2 , in the mdac 2 are used , while the capacitor c 2 h in the mdac 2 is reset . in view of the above , the op amp ( op 1 : common op amp ) is shared between the two mdacs ( mdac 1 and mdac 2 ). however , in the mdac configuration of fig2 a and fig2 b , it is not possible to share the capacitors between the mdac 1 and the mdac 2 . in the fourth and fifth embodiments hereinafter described , the same capacitor is shared between the mdac 1 and the mdac 2 in order to further reduce the footprint of the switched capacitor circuit or ad conversion circuit . fig2 a and fig2 are diagrams for explaining the mdac of the fourth embodiment and its operation . the mdac of the fourth embodiment is a mdac of the second configuration example ( type ii ), and is controlled by dividing the conversion time t into four periods ( 1 ) to ( 4 ), as in the case of the mdacs of the earlier described first to third embodiments . first , as is apparent from a comparison between fig2 a and the above - described fig2 a , in the mdac configuration according to the fourth embodiment , not only the op amp ( op 1 : common op amp ) but also the capacitor ( csc : common capacitor ) is shared between the two mdacs ( mdac 1 and mdac 2 ). that is , as illustrated in fig2 a and fig2 b , the capacitor csc is used as c 2 mdac in the period ( 1 ), as c 1 s in the period ( 2 ), as c 1 mdac in the period ( 3 ), and as c 2 s in the period ( 4 ). as is apparent from fig2 a and fig2 , the hold capacitors c 1 h and c 2 h need to be provided exclusively for the mdac 1 and the mdac 2 , respectively , but the sampling capacitors c 1 s and c 2 s and computation capacitors c 1 mdac and c 2 mdac in the mdac 1 and mdac 2 may be replaced by one common capacitor . in the mdac of the fourth embodiment , the op amp ( common op amp op 1 ) is shared between the mdac 1 and the mdac 2 in the same manner as earlier described with reference to fig2 a and fig2 . in the case of a pipelined ad conversion circuit constructed by cascading a plurality of mdacs , the value of the sampling capacitor in the mdac at the subsequent stage ( for example , the capacitor c 2 s in the mdac 2 ) may be made smaller than the value of the sampling capacitor in the mdac at its preceding stage ( for example , the capacitor c 1 s in the mdac 1 ). that is , the sampling capacitor ( c 2 s ) in the mdac at the subsequent stage may be formed using a portion of the sampling capacitor ( c 1 s ) in the mdac at its preceding stage . fig2 a is a circuit diagram illustrating one example of the mdac of the fourth embodiment , and fig2 b is a diagram for explaining the operation of the mdac of fig2 a . in fig2 a , reference characters csc 11 and csc 12 designate the common capacitor ( csc ) shared for use , while ch 1 designates the hold capacitor ( c 1 h ) when used for the first mdac ( mdac 1 ) and ch 2 designates the hold capacitor ( c 2 h ) when used for the second mdac ( mdac 2 ). in the description of the mdac of the fourth embodiment , ch 1 = ch 2 = c 0 / 2 and csc 1 = csc 11 + csc 12 = c 0 , assuming the case of no scaling . as illustrated in fig2 a , the mdac 0 ( switched capacitor circuit ) includes the capacitors ch 1 , ch 2 , csc 11 , and csc 12 ( two or more internal capacitors ) and the op amp op 0 ( one or more amplifiers ). the mdac 0 further includes switches swvin 1 , swvin 2 , swsc 1 a / 11 b / 12 b , swhc 1 a / 11 b / 12 b , swsh 1 a / 1 b , swhh 1 a / 1 b , swsh 2 a / 2 b , and swhh 2 a / 2 b ( two or more internal switches ). first , in the period ( 1 ) of fig2 b , the switch control unit swc 1 sets the control signals for the switches swvin 1 , swhc 1 a / 11 b / 12 b , and swhh 2 a / 2 b to a high level “ h ”, causing these switches to turn on . further , in the period ( 1 ), the switch control unit swc 1 sets the control signals for the switches swvin 2 , swsc 1 a / 11 b / 12 b , swsh 1 a / 1 b , swhh 1 a / 1 b , and swsh 2 a / 2 b to a low level “ l ”, causing these switches to turn off . as a result , in the mdac 0 , the capacitor csc 11 acts as the computation capacitor c 2 mdac for the second mdac ( mdac 2 ), as illustrated in the period ( 1 ) of fig2 a . on the other hand , the capacitor ch 2 is connected so as to act as the hold capacitor c 2 h for the second mdac ( mdac 2 ). next , in the period ( 2 ) of fig2 b , the switch control unit swc 1 sets the control signals for the switches swsc 1 a / 11 b / 12 b and swsh 1 a / 1 b to “ h ”, causing these switches to turn on , and sets the control signal for the switches swhc 1 a / 11 b / 12 b to “ l ”, causing these switches to turn off . in the period ( 2 ), the other switches swvin 1 , swvin 2 , swhh 1 a / 1 b , swsh 2 a / 2 b , and swhh 2 a / 2 b are each held at the same level as in the period ( 1 ). as a result , the capacitors csc 11 and csc 12 act as the sampling capacitor c 1 s for the first mdac ( mdac 1 ), as illustrated in the period ( 2 ) of fig2 a . the capacitor ch 2 remains connected so as to act as the hold capacitor c 2 h for the second mdac ( mdac 2 ), while the capacitor ch 1 is reset . next , in the period ( 3 ) of fig2 b , the switch control unit swc 1 sets the control signals for the switches swvin 2 , swhc 1 a / 11 b / 12 b , and swhh 1 a / 1 b to “ h ”, causing these switches to turn on . further , the switch control unit swc 1 sets the control signals for the switches swvin 1 , swsc 1 a / 11 b / 12 b , swsh 1 a / 1 b , and swhh 2 a / 2 b to “ l ”, causing these switches to turn off . in the period ( 3 ), the control signal for the swsh 2 a / 2 b is held at the same level as in the period ( 2 ). as a result , in the mdac 0 , the capacitor csc 11 acts as the computation capacitor c 1 mdac for the first mdac ( mdac 1 ), as illustrated in the period ( 3 ) of fig2 a . on the other hand , the capacitor ch 1 is connected so as to act as the hold capacitor c 1 h for the first mdac ( mdac 1 ). then , in the period ( 4 ) of fig2 b , the switch control unit swc 1 sets the control signals for the switches swsc 1 a / 11 b / 12 b and swsh 2 a / 2 b to “ h ”, causing these switches to turn on , and sets the control signal for the switches swhc 1 a / 11 b / 12 b to “ l ”, causing these switches to turn off . in the period ( 4 ), the other switches swvin 1 , swvin 2 , swsh 1 a / 1 b , swhh 1 a / 1 b , and swhh 2 a / 2 b are each held at the same level as in the period ( 3 ). as a result , in the mdac 0 , the capacitors csc 11 and csc 12 act as the sampling capacitor c 2 , for the second mdac ( mdac 2 ), as illustrated in the period ( 4 ) of fig2 a . the capacitor ch 1 remains connected so as to act as the hold capacitor c 1 h for the first mdac ( mdac 1 ), while the capacitor ch 2 is reset . in the mdac of the fourth embodiment , the op amp op 1 ( common op amp ) may be shared between the mdac 1 and the mdac 2 in the same manner as earlier described with reference to fig2 a and fig2 b . in this way , according to the mdac configuration of the fourth embodiment , not only the op amp but the capacitor ( csc : csc 11 and csc 12 ) may also be shared between the two mdacs , thus making is possible to further reduce the footprint of the switched capacitor circuit or ad conversion circuit . in the above - described fourth embodiment , scaling may be applied , and the sampling capacitor c 2 s in the mdac 2 at the subsequent stage , for example , may be made smaller in size than the sampling capacitor c 1 s in the mdac 1 at its preceding stage . more specifically , when the scaling factor is denoted by γ , generally γ = ½ in the case of a 1 . 5bmdac and γ = ¼ in the case of a 2 . 5bmdac ; accordingly , the sampling capacitor c 2 s in the mdac 2 at the subsequent stage may be formed using a portion of the sampling capacitor c 1 s in the mdac 1 at its preceding stage . next , before describing the mdac configuration according to the fifth embodiment , two configuration examples of a parallel mdac ( double - sampling mdac ) system will be described below with reference to fig2 , fig2 a , and fig2 . the double - sampling ad conversion circuit includes two paralleled mdacs and operates them in interleaved fashion thereby aiming to double the conversion speed of the ad conversion circuit without increasing the power consumption . fig2 is a diagram for explaining the basic operation of the mdac of the first configuration example ( type i ) as applied in the parallel mdac system . the double - sampling mdac ( parallel mdac ) system depicted here corresponds , for example , to one that performs processing by paralleling two mdacs ( mdac 1 and mdac 2 ) which perform processing in time sequential fashion as described above . further , since channel 1 and channel 2 operate 180 degrees out of phase of each other , the double - sampling mdac system depicted in fig2 may be implemented , for example , by reconfiguring the mdac 1 and mdac 2 in the earlier described fig1 a to operate as mdac 1 ( e : even mode ) and mdac 2 ( o : odd mode ), respectively . more specifically , as illustrated in fig2 , in the period ( 1 )+( 2 ), the mdac 1 ( e ) samples the input voltage vin 1 ( e ) by using the sampling capacitor c 1 n1 ( e )+ c 1 n2 ( e ), while on the other hand , the mdac 1 ( o ) performs computation . here , the computation capacitor in the mdac 1 ( o ) is c 1 n1 ( o ), and the hold capacitor is c 1 n2 ( o ). in the period ( 1 )+( 2 ), only the op amp op 1 ( o ) in the mdac 1 ( o ) that performs computation is used , and the op amp op 1 ( e ) in the mdac 1 ( e ) that performs the sampling is not used . next , in the period ( 3 )+( 4 ), the mdac 1 ( e ) performs computation , and the mdac 1 ( o ) samples the input voltage vin 1 ( o ) by using the sampling capacitor c 1 n1 ( o )+ c 1 n2 ( o ). here , the computation capacitor in the mdac 1 ( e ) is c 1 n1 ( e ), and the hold capacitor is c 1 n2 ( e ). in the period ( 3 )+( 4 ), only the op amp op 1 ( e ) in the mdac 1 ( e ) that performs computation is used , and the op amp op 1 ( o ) in the mdac 1 ( o ) that performs the sampling is not used . in view of the above , the op amp ( op 1 ( e )) is configured to act at the op amp op 1 ( o ) in the period ( 1 )+( 2 ) and as the op amp op 1 ( e ) in the period ( 3 )+( 4 ). however , while the op amp may thus be shared between the mdac 1 ( e ) and the mdac 1 ( o ), it is not possible to share the capacitors in the parallel mdac configuration of type i depicted in fig2 . fig2 a and fig2 b are diagrams for explaining the basic operation of the mdac of the second configuration example ( type ii ) as applied in the parallel mdac system . here , the double - sampling mdac ( parallel mdac ) system depicted in fig2 a and fig2 b may be implemented , for example , by reconfiguring the mdac 1 and mdac 2 in the earlier described fig2 a and fig2 b to operate as mdac 1 ( e ) and mdac 2 ( o ), respectively . that is , as illustrated in the left half of fig2 a and in the period ( 1 )+( 2 ) of fig2 b , when the mdac 1 ( e ) is in the sampling ( s ) mode and the mdac 1 ( o ) in the computation ( h ) mode , the op amp ( op 1 ( e )) in the mdac 1 ( e ) is not used , but the op amp ( op 1 ( 0 )) in the mdac 1 ( o ) is used ( operating ). further , in the period ( 1 )+( 2 ), the capacitor c 1 s ( e ) in the mdac 1 ( e ) and the capacitors c 1 mdac ( o ) and c 1 h ( o ) in the mdac 1 ( o ) are used , while the capacitor c 1 h ( e ) in the mdac 1 ( e ) is reset . on the other hand , as illustrated in the right half of fig2 a and in the period ( 3 )+( 4 ) of fig2 b , when the mdac 1 ( e ) is in the computation mode and the mdac 1 ( o ) in the sampling mode , the op amp ( op 1 ( e )) in the mdac 1 ( e ) is used , but the op amp ( op 1 ( 0 )) in the mdac 1 ( o ) is not used . further , in the period ( 3 )+( 4 ), the capacitors c 1 mdac ( e ) and c 1 h ( e ) in the mdac 1 ( e ) and the capacitor c 1 s ( o ) in the mdac 1 ( o ) are used , while the capacitor c 1 h ( o ) in the mdac 1 ( o ) is reset . in view of the above , the op amp ( op 1 : common op amp ) is shared between the two mdacs ( mdac 1 ( e ) and mdac 1 ( o )). however , in the mdac configuration of fig2 a and fig2 b , it is not possible to share the capacitors between the mdac 1 ( e ) and the mdac 1 ( o ). fig2 a and fig2 b are diagrams for explaining the mdac of the fifth embodiment and its operation ; the mdac illustrated here is a mdac of the second configuration example ( type ii ). the mdac of the fifth embodiment is implemented by applying the mdac of the fourth embodiment to a double - sampling mdac ( parallel mdac ) system . more specifically , in fig2 a , fig2 b , fig2 a , and fig2 b , the mdac 1 and mdac 2 in the earlier described fig2 a , fig2 b , fig2 a , and fig2 b are reconfigured to operate as mdac 1 ( e ) and mdac 1 ( o ), respectively . that is , as illustrated in fig2 a and fig2 b , the capacitor csc is used as c 1 mdac ( o ) in the period ( 1 ), as c 1 s ( e ) in the period ( 2 ), as c 1 mdac ( e ) in the period ( 3 ), and as c 1 s ( o ) in the period ( 4 ). as is apparent from fig2 a and fig2 b , the hold capacitors c 1 h ( e ) and c 1 h ( o ) need to be provided exclusively for the mdac 1 ( e ) and the mdac 1 ( o ), respectively . however , the sampling capacitors c 1 s ( e ) and c 1 s ( o ) and computation capacitors c 1 mdac ( e ) and c 1 mdac ( o ) in the mdac 1 ( e ) and mdac 1 ( o ) may be replaced by one common capacitor . in the mdac of the fifth embodiment , the op amp ( common op amp op 1 ( e )) is shared between the mdac 1 ( e ) and the mdac 1 ( o ) in the same manner as earlier described . fig2 a is a circuit diagram illustrating one example of the mdac of the fourth embodiment , and fig2 b is a diagram for explaining the operation of the mdac of fig2 a . in fig2 a , reference characters csc 11 and csc 12 designate the common capacitor ( csc ) shared for use , while ch 1 e designates the hold capacitor ( c 1 h ( e )) when used for the first mdac ( mdac 1 ( e )) and ch 1 o designates the hold capacitor ( c 1 h ( o )) when used for the second mdac ( mdac 1 ( o )). in the description of the mdac of the fifth embodiment , ch 1 e = ch 1 o = c 0 / 2 and csc 1 = csc 11 + csc 12 = c 0 , assuming the case of the signal amplification factor m = 2 . as illustrated in fig2 a , the mdac 0 ( switched capacitor circuit ) includes the capacitors ch 1 e , ch 1 o , csc 11 , and csc 12 ( two or more internal capacitors ) and the op amp op 0 ( one or more amplifiers ). the mdac 0 further includes switches swvin 1 e , swvin 1 o , swsc 1 a / 11 b / 12 b , swhc 1 a / 11 b / 12 b , swsh 1 a / 1 b , swhh 1 a / 1 b , swsh 2 a / 2 b , and swhh 2 a / 2 b ( two or more internal switches ). first , in the period ( 1 ) of fig2 b , the switch control unit swc 1 sets the control signals for the switches swvin 1 e , swhc 1 a / 11 b / 12 b , and swhh 2 a / 2 b to a high level “ h ”, causing these switches to turn on . further , in the period ( 1 ), the switch control unit swc 1 sets the control signals for the switches swvin 1 o , swsc 1 a / 11 b / 12 b , swsh 1 a / 1 b , swhh 1 a / 1 b , and swsh 2 a / 2 b to a low level “ l ”, causing these switches to turn off . as a result , in the mdac 0 , the capacitor csc 11 acts as the computation capacitor c 1 mdac ( o ) for the second mdac ( mdac 1 ( o )), as illustrated in the period ( 1 ) of fig2 a . on the other hand , the capacitor ch 1 o is connected so as to act as the hold capacitor c 1 h ( o ) for the second mdac ( mdac 1 ( o )). next , in the period ( 2 ) of fig2 b , the switch control unit swc 1 sets the control signals for the switches swsc 1 a / 11 b / 12 b and swsh 1 a / 1 b to “ h ”, causing these switches to turn on , and sets the control signal for the switches swhc 1 a / 11 b / 12 b to “ l ”, causing these switches to turn off . in the period ( 2 ), the other switches swvin 1 e , swvin 1 o , swhh 1 a / 1 b , swsh 2 a / 2 b , and swhh 2 a / 2 b are each held at the same level as in the period ( 1 ). as a result , the capacitors csc 11 and csc 12 act as the sampling capacitor c 1 s ( e ) for the first mdac ( mdac 1 ( e )), as illustrated in the period ( 2 ) of fig2 a . the capacitor ch 1 o remains connected so as to act as the hold capacitor c 1 h ( o ) for the second mdac ( mdac 1 ( o )), while the capacitor ch 1 e is reset . next , in the period ( 3 ) of fig2 b , the switch control unit swc 1 sets the control signals for the switches swvin 1 o , swhc 1 a / 11 b / 12 b , and swhh 1 a / 1 b to “ h ”, causing these switches to turn on . further , the switch control unit swc 1 sets the control signals for the switches swvin 1 e , swsc 1 a / 11 b / 12 b , swsh 1 a / 1 b , and swhh 2 a / 2 b to “ l ”, causing these switches to turn off . in the period ( 3 ), the control signal for the swsh 2 a / 2 b is held at the same level as in the period ( 2 ). as a result , in the mdac 0 , the capacitor csc 11 acts as the computation capacitor c 1 mdac ( e ) for the first mdac ( mdac 1 ( e )), as illustrated in the period ( 3 ) of fig2 a . on the other hand , the capacitor ch 1 e is connected so as to act as the hold capacitor c 1 h ( e ) for the first mdac ( mdac 1 ( e )). then , in the period ( 4 ) of fig2 b , the switch control unit swc 1 sets the control signals for the switches swsc 1 a / 11 b / 12 b and swsh 2 a / 2 b to “ h ”, causing these switches to turn on , and sets the control signal for the switches swhc 1 a / 11 b / 12 b to “ l ”, causing these switches to turn off . in the period ( 4 ), the other switches swvin 1 e , swvin 1 o , swsh 1 a / 1 b , swhh 1 a / 1 b , and swhh 2 a / 2 b are each held at the same level as in the period ( 3 ). as a result , in the mdac 0 , the capacitors csc 11 and csc 12 act as the sampling capacitor c 1 s ( o ) for the second mdac ( mdac 1 ( o )), as illustrated in the period ( 4 ) of fig2 a . the capacitor ch 1 e remains connected so as to act as the hold capacitor c 1 h ( e ) for the first mdac ( mdac 1 ( e )), while the capacitor ch 1 o is reset . in the mdac of the fifth embodiment , the op amp op 1 ( e ) may be shared between the mdac 1 ( e ) and the mdac 1 ( o ) in the same manner as earlier described . in this way , according to the mdac configuration of the fifth embodiment , not only the op amp but the capacitor ( csc : csc 11 and csc 12 ) may also be shared between the two mdacs , thus making is possible to further reduce the footprint of the switched capacitor circuit or ad conversion circuit . fig2 is a diagram illustrating the performance of the mdacs of the fourth and fifth embodiments for comparison with the performance of the mdacs depicted in fig2 a and 26a . fig2 provides data not only for the case of the signal amplification factor m = 2 but also for the case of m = 4 . while the mdacs depicted in fig2 a and 26a and the mdacs of the fourth and fifth embodiments have each been described by dealing with a 1 . 5bmdac with m = 2 , fig2 also deals with 2 . 5bmdacs with m = 4 such as described with reference to fig4 a , fig4 b , and fig4 c . that is , fig2 also provides data for the m = 4 version of the mdacs depicted in fig2 a and 26a and the m = 4 version of the mdacs of the fourth and fifth embodiments . in fig2 , for the fourth embodiment , data is provided for the case of no scaling applied as well as the case of scaling applied , and the coefficient 2 is given by considering the capacitance for two mdacs . further , for the input voltage ( signal amplitude ), data has been obtained by calculating ( c 1 mdac + c 1 h )× coefficient 2 , without regard to the magnitude of the input voltage . as is apparent from fig2 , the mdac of the fourth embodiment achieves , by virtue of the capacitor sharing , a reduction in capacitance , i . e ., the footprint of the capacitors ( the circuit ), by about 33 % in the case of no scaling applied and about 22 % in the case of scaling applied . it is also seen that the m = 4 version of the mdac of the fourth embodiment achieves a reduction in capacitance , i . e ., the footprint of the circuit , by about 40 % in the case of no scaling applied and about 16 % in the case of scaling applied . it is further seen that the mdac of the fifth embodiment achieves a reduction in capacitance , i . e ., the footprint of the circuit , by about 33 % and also that the m = 4 version of the mdac of the fifth embodiment achieves a reduction in capacitance , i . e ., the footprint of the circuit , by about 40 %. here , the signal amplification factors m = 2 and m = 4 are only examples , and it will be appreciated that larger bit - width versions of the mdacs of the fourth and fifth embodiment also achieve the effect of reducing the footprint of the circuit . fig3 is a block diagram schematically illustrating one example of a pipelined ad conversion circuit to which the stage circuit that has the mdac of each embodiment or the sub - adc of each embodiment is applied , and fig3 is a block diagram schematically illustrating one example of a cyclic ad conversion circuit to which the stage circuit that has the mdac of each embodiment or the sub - adc of each embodiment is applied . the mdac of any one of the first to fifth embodiments described above may be applied , for example , as an mdac in a cascade of mdac circuits 202 - 1 to 202 -( n − 1 ) such as used in the pipelined ad conversion circuit 200 of fig3 . as illustrated in fig3 , the pipelined ad conversion circuit 200 includes a sample - and - hold ( s / h ) circuit 201 , ( n − 1 ) stages of mdac circuits 202 - 1 to 202 -( n − 1 ), a flash adc 203 at the last stage , and a logic operation circuit ( digital correction circuit ) 204 . the sample - and - hold circuit 201 samples the input voltage vin and holds it , and supplies its output signal to the mdac circuits 202 - 1 to 202 -( n − 1 ). the logic operation circuit 204 receives the output signals db ( 1 ) to db ( n − 1 ) of the mdac circuits 202 - 1 to 202 -( n − 1 ) as well as the output signal db ( n ) of the flash adc 203 at the last stage , and produces an output code ( adc output ) by analog - to - digital converting the input voltage vin with a resolution corresponding to the number of stages of the mdac circuits . further , the mdac of any one of the first to fifth embodiments described above may be applied , for example , as an mdac circuit 303 such as used in the cyclic ad conversion circuit 300 of fig3 . that is , as illustrated in fig3 , the cyclic ad conversion circuit 300 includes , in addition to the mdac circuit 303 , a switch 301 , a sample - and - hold ( s / h ) circuit 302 , and a logic operation circuit 304 . the sample - and - hold circuit 302 may be omitted . the sample - and - hold circuit 302 samples the input voltage vin or the output voltage vo ( i )= vi ( i + 1 ) of the mdac circuit 303 , whichever is selected by the switch 301 , and holds the sampled voltage , and the switch 301 causes the output voltage vo ( i ) of the mdac circuit 303 to cycle a plurality of times . the signal db ( i ) output from the mdac circuit 303 in each cycle is supplied to the logic operation circuit 304 , and the logic operation circuit 304 produces an output code ( adc output ) by analog - to - digital converting the voltage with a resolution corresponding to the number of cycles through the mdac circuit . while the mdacs ( switched capacitor circuits ) of the first to fifth embodiments have been described in detail above , it will be appreciated that various modifications may be made , for example , to the number of switches or capacitors in each mdac or their connections or to the switch timing of each switch controlled by the switch control unit . it will also be appreciated that the mdacs of the first to fifth embodiments may be applied not only to pipelined ad conversion circuits and cyclic ad conversion circuits but also extensively to various other circuits such as da converts and filters . all examples and conditional language recited herein are intended for pedagogical purposes to aid the reader in understanding the invention and the concepts contributed by the inventor to furthering the art , and are to be construed as being without limitation to such specifically recited examples and conditions , nor does the organization of such examples in the specification relate to a showing of the superiority and inferiority of the invention . although the embodiments of the present invention have been described in detail , it should be understood that the various changes , substitutions , and alterations could be made hereto without departing from the spirit and scope of the invention . | 7 |
as mentioned above , various techniques have been proposed for accurately measuring load power , but they suffer from limitations that affect their accuracy . fig1 shows a technique for detecting power that squares the voltage at the output of a transmitter , and calculates power based on pout = v 2 out / z l . however , a difficulty with this technique is that the load impedance z l may vary , which may lead to an inaccurate power calculation . fig2 shows a technique that can reduce the error caused by the change in the load impedance . the voltage at the transmitter output and the current of the transmitter are measured and multiplied to obtain an indication of output power . specifically , the current of the transmitter is measured by multiplying the transmitter input voltage with a replica of a transconductance cell . a phase shifter may account for the phase difference between the current and the voltage . however , the sensed current may not track the output current , which may lead to an inaccurate power measurement . fig3 a and 3b show another technique in which an additional coil is added to a transformer to measure current , and output voltage is sensed capacitively . however , the measured voltage and current are not equal to the load current and voltage , which may lead to an inaccurate power measurement . in some embodiments , power may be detected by measuring the load current and the load voltage from conductors coupled to the load . a selected phase adjustment may be introduced to correct the phase difference between the measured current and the measured voltage that may arise due to the load impedance . fig4 shows a transmitter system with power control loop 1 having a transmitter 2 , a power control circuit 4 , and a power detection circuit 6 . power detection circuit 6 detects the load power p l . in some embodiments , the load may be an antenna and the power p l may be the power delivered to the antenna . however , the techniques described herein are not limited to detecting the power delivered to an antenna . the transmitter 2 may produce a signal having any suitable frequency above 0 hz . in some embodiments , the transmitter 2 may produce a signal having a frequency between 300 khz and 300 ghz , however , the techniques described herein are not limited as to particular frequencies . the power detection circuit 6 may produce a tssi ( transmitter signal strength indication ) that is proportional to p l . the power control circuit 4 controls the transmitter 2 based upon the tssi signal . accurate power detection by the power detection circuit 6 is important for appropriate control of the transmitter 2 . fig5 illustrates a challenge with detecting the load power . if the load impedance z l is variable , the gain or attenuation between load power and detected power changes as z l changes . fig6 illustrates that in some embodiments , the transmitter system with power control loop 1 may include a switching power amplifier 2 a . the switching power amplifier 2 a may be any suitable type of amplifier , including class d , e , and f power amplifiers , and digital power amplifiers . the power produced by switching power amplifier 2 a may be controlled using any suitable control technique , such as pulse - width modulation , for example . in some embodiments , the switching power amplifier 2 a may be controlled by power control circuit 4 based upon the tssi signal . since the switching power amplifier 2 a is non - linear , it can be more effective to measure the power at the load rather than the input or output of the power amplifier 2 a . fig6 also shows that passive components 7 may be included between the output of the switching power amplifier 2 a and the load . in some embodiments , the passive components 7 may tune out undesired harmonics . in some embodiments , passive components 7 may include an impedance matching network . fig7 shows that in some embodiments , the transmitter system with power control loop 1 may include a power amplifier 2 b having a plurality of power amplifier circuits . the power from the plurality of power amplifier circuits may be combined and delivered to a load . examples of such amplifiers include doherty power amplifiers , outphasing power amplifiers and digital power amplifiers , power control circuit 4 may control the power amplifier circuits based on the tssi signal . individual power amplifier circuits may be controlled to produce the same amount of power or different amounts of power . as with the circuit of fig6 , it can be more effective to measure the power at the load rather than the input or output of the power amplifier 2 b . fig8 a illustrates a technique for detecting load power , according to some embodiments . in the embodiment of fig8 a , a drive circuit 82 such as a power amplifier , for example , drives a load 84 having an impedance z l with a current i l , a voltage v l and power p l . load current i l may be measured by using a current sensor 86 . load voltage v l may be measured by using a voltage sensor 88 . the inventors have recognized and appreciated that the magnitudes and phases of the measured current signal s i and the measured voltage signal s v0 may vary as the load impedance z l varies . variation in the load impedance changes the voltage standing wave ratio ( vswr ), which can produce different magnitudes and phases in the voltage and current measurements . in some embodiments , a phase delay θ may be added to the measured voltage signal s v0 by a phase delay unit 90 . the phase delayed voltage signal s v is multiplied by the measured current s i by a multiplier 92 . the multiplied value may be low pass filtered by a low pass filter or averaging unit 94 to produce a determined load power p det . however , the techniques described herein are not limited to adding a phase delay to the signal measured by the voltage sensor 88 , as in some embodiments a phase delay may be added to the signal measured by the current sensor 86 , or different phase delays may be added to both the current and voltage measurements to achieve the same result . the inventors have recognized and appreciated that a properly selected phase delay θ may accurately compensate for the variation in load impedance , which can produce an accurate power measurement . although the power detector is capable of rms power detection , sinusoidal waves are used to demonstrate the concept in the following analysis for simplicity . assuming a complex load z l , with magnitude of | z | and phase of φ , is presented to the drive circuit 82 , the load voltage v l and load current i l can be represented by the following equations , where v m and i m are the magnitudes of the load voltage and the load current , respectively : the output of voltage sensor s vo has a linear relationship with the output voltage v l , which does not change with | z | or φ s vo = a v × v l cos β v = a v × v m cos ( ω t + φ + β v ) ( 5 ) similarly , the output of current sensor s i has a linear relationship with the output current i l , which does not change with | z | or φ the multiplier multiplies s v and s i . the generated product is filtered by an averaging unit or low pass filter ( lpf ) 94 : therefore , p det is linearly proportional to the delivered load power and independent of the load impedance variation , if ( θ + β v − β i )= 0 . the inventors have appreciated that mathematically , accurate power detection may be obtained by properly selecting θ , which makes the measurement insensitive to vswr changes . the phase delay θ that is appropriate for a particular implementation may be selected by calibration , modeling and / or simulation . in some embodiments , the phase delay θ is tunable , which allows compensating for variations in temperature and frequency as well as processing variations . in some embodiments , one or more attenuators and / or amplifiers may be included in the signal path ( s ) before or after the sensor ( s ), which may extend the dynamic range of the power detector . such attenuator ( s ) and / or amplifier ( s ) may be considered part of the current sensor 86 and / or the voltage sensor 88 . this is illustrated in fig8 a as a gain a i of the current sensor 86 and a gain a v of the voltage sensor 88 . the gain a i and / or the gain a v may have a value less than one to attenuate a detected signal , equal to one to produce no attenuation or amplification , or greater than one to amplify a detected signal . the attenuators and / or amplifiers may be implemented in analog and / or digital circuitry . as shown in fig8 f , in some embodiments , the gain a i and / or the gain a v may be variable . for example , the one or more attenuators and / or amplifiers may be tunable to produce selected gain ( s ) in the current and / or voltage sense path . fig8 b shows an embodiment in which the phase delay θ is tunable and may be calibrated . fig8 b shows a phase shift controller 96 may be included in power detection circuit 6 that can control the phase delay θ . in some embodiments , the phase shift controller 96 may calibrate the phase delay θ based on a programmed calibration sequence . phase shift controller 96 and power control circuit 4 may be implemented by the same controller ( e . g ., a microprocessor or control circuit ) or different controllers . fig8 c shows an embodiment for detecting load power , according to some embodiments , in which a phase delay unit 90 is present in the current sensing path . in such embodiments , the phase delay may be tunable and / or may be calibrated , as discussed above . in some embodiments , phase delays may be introduced in both the current sensing path and the voltage sensing path . fig8 d shows an embodiment in which a phase delay may be introduced in the voltage and / or current sensing path in the voltage and / or current sensors . for example , a phase delay θ v may be introduced in the signal measured by the voltage sensor 86 , a phase delay θ i may be introduced in the signal measured by the current sensor 88 , or both phase delays θ v and θ i may be introduced . phase delays θ v and θ i may be introduced digitally or using analog components . fig8 e shows an embodiment in which a phase delay may be introduced in the voltage and / or current sensing path in a multiplier 92 , which may be a circuit and / or software . for example , a phase delay θ v may be introduced to s v , a phase delay θ i may be introduced to s i , or both phase delays θ v and θ i may be introduced . thus , as seen from the above , one or more phase delays may be introduced anywhere in the voltage and / or current sensing paths . referring to fig8 a , in some embodiments , the voltage sensor 88 may include a conductor or other circuit element coupled to the load . for example , as discussed below , the conductor of the voltage sensor 88 may be a bondwire , trace , solder ball , via , coupled line or and / or any other suitable conductor . in some embodiments , the current sensor 86 may be a conductor that is positioned to inductively sense the load current from a conductor that provides the load current to the load . for example , as discussed below , the conductor of the current sensor 86 may be a bondwire , trace , solder ball , via , coupled line or and / or any other suitable conductor . the phase delay unit 90 , multiplier 92 and low pass filter and / or averaging unit 94 may be implemented using analog or digital component ( s ). for example , the phase delay unit 90 may be an analog circuit element that delays a signal . as another example , the phase delay unit 90 may be implemented digitally using a digital delay element or by converting s v0 and / or s i to digital values and digitally delaying one or both signals . as discussed above , phase delay unit 90 may produce a delay θ that is tunable . if phase delay unit 90 is implemented digitally , the phase delay unit 90 may be controlled to change the delay using a programmable delay line , software or firmware , for example . similarly , multiplier 92 may be implemented using an analog circuit or digitally using digital components and / or software or firmware . also , the low pass filter and / or averaging unit 94 may be implemented using an analog circuit , a digital circuit , or in software or firmware . the low pass filter and / or averaging unit 94 need not be a “ filter ” per se , as it may implement any suitable time - averaging technique . fig9 shows an embodiment in which a conductor l 0 connects the drive circuit 82 to the load 84 . a second conductor l 1 is coupled to the load 84 to make a voltage measurement s v0 that is provided to the phase delay unit 90 . conductor l 1 is an example of a voltage sensor 88 . phase delay unit 90 may be a circuit that presents a high impedance to l 1 , thus the current i l1 flowing through l 1 is zero , so s v0 is a faithful copy of v l . a third conductor l 2 , coupled between the multiplier 92 and ground , is positioned proximate the conductor l 0 , and due to inductive coupling , a current through conductor l 0 induces a current in conductor l 2 , which is provided as a measurement s i of the load current i l . thus , conductor l 2 is an example of a current sensor 86 . if l 0 and l 2 are inductors , s i will be a faithful copy of i l with close to a 900 phase shift if the multiplier input impedance is high . by inserting a θ = 90 ° phase shift between l 1 and the multiplier 92 , p det will be a faithful copy of p l , independent of the change of | z | or φ . in some embodiments , the conductors l 0 , l 1 may be bondwires . however , the techniques described herein are not limited in this respect , as any suitable conductors may be used such as solder balls , vias , traces , or coupled lines , by way of example and not limitation . fig1 a - d address possible implementation issues related to parasitics , especially for high frequency applications . for the sake of discussion , l 0 and l 2 are assumed to be inductors . in fig1 a , the sensed current s i deviates from i l because of current flowing through the parasitic capacitor c 3 . the effect of the parasitic capacitor c 3 can be compensated as shown in fig1 b . in fig1 b , an inductor l 3 is coupled between the ground and the output node coupled to the load , having an inductance selected to resonate with c 3 at the operating frequency , which cancels the current through c 3 . accordingly , s i will be a faithful copy of i l . fig1 c shows an example in which s v0 is measured from the output of the drive circuit 82 . due to the current flowing through l 0 , which has an inductance , s v0 deviates from v l . as shown in fig1 d , a capacitor c 0 can be inserted coupled between l 0 and the drive circuit 82 , with a capacitance selected to resonate with l 0 at the operating frequency . thus , s v0 is a faithful copy of v l . fig1 e shows a differential implementation of a power detector that can detect power from a drive circuit 82 that is differentially connected to a load 84 . conductors l 3 and l 0 couple the positive and negative output terminals of the drive circuit 82 to the positive and negative terminals of the load 84 , respectively . conductors l 5 and l 1 are coupled to the load 84 to make a voltage measurement at the positive and negative terminals of the load 84 , respectively . the voltage measurements from conductors l 5 and l are provided to phase delay unit 90 , which delays the differential voltage measurement and provides it to multiplier 92 . conductors l 4 and l 2 are inductively coupled to conductors l 3 and l 0 , respectively , and produce current measurements that are provided to multiplier 92 . multiplier 92 multiplies the differential current measurement and delayed voltage measurement . in some embodiments , and as discussed above , the phase delay may be introduced in the current sensing path , or in both the voltage sensing path and current sensing path . in the example of fig1 e , both current and voltage are measured differentially . however , the techniques described herein are not limited to measuring both current and voltage differentially , as a combination of a single - ended measurement and differential measurement may be used . for example , voltage may be measured differentially and current may be measured using a single - ended configuration , or current may be measured differentially and voltage may be measured using a single - ended configuration . fig1 a and 11b show ways to implement the above - described techniques with different packages . fig1 a shows a way to implement the power sensing technique in a soc ( system on chip ) with a qfn ( quad flat no - lead ) package . a bondwire l 0 is used to couple the output of the drive circuit 82 to the qfn load pin . a separate bondwire l 1 is arranged to sense the load voltage , coupled to the phase delay unit 90 . an additional bondwire l 2 , coupled to the qfn ground terminal , is placed proximate l 0 to sense the load current . similarly , as shown in fig1 b , the power sensing scheme can be implemented in csp ( chip - scale package ) type package . the current sensing can be accomplished with magnetic couplings between either the vias ( k 1 ) or the coupled lines ( k 2 ). solder balls are shown as connecting the die , substrate and pcb . in some embodiments , controller 96 and / or power control circuit 4 may be implemented using hardware or a combination of hardware and software . when implemented using software , suitable software code can be executed on any suitable processor ( e . g ., a microprocessor ) or collection of processors . the one or more controllers can be implemented in numerous ways , such as with dedicated hardware , or with general purpose hardware ( e . g ., one or more processors ) that is programmed using microcode or software to perform the functions recited above . various aspects of the apparatus and techniques described herein may be used alone , in combination , or in a variety of arrangements not specifically discussed in the embodiments described in the foregoing description and is therefore not limited in its application to the details and arrangement of components set forth in the foregoing description or illustrated in the drawings . for example , aspects described in one embodiment may be combined in any manner with aspects described in other embodiments . use of ordinal terms such as “ first ,” “ second ,” “ third ,” etc ., in the claims to modify a claim element does not by itself connote any priority , precedence , or order of one claim element over another or the temporal order in which acts of a method are performed , but are used merely as labels to distinguish one claim element having a certain name from another element having a same name ( but for use of the ordinal term ) to distinguish the claim elements . also , the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting . the use of “ including ,” “ comprising ,” or “ having ,” “ containing ,” “ involving ,” and variations thereof herein , is meant to encompass the items listed thereafter and equivalents thereof as well as additional items . | 6 |
the invention will now be described more fully herein after with reference to the accompanying drawings , in which certain embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein . rather , these embodiments are provided by way of example so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . in the following , the different entities on which embodiments of the invention are based are described with reference to fig1 , which shows a system 100 for performing an operation on a data storage 101 for storing data 106 which is encrypted with a data key k d associated with an owner 102 of the data 106 . besides the data storage 101 , which may be a pdv or any other network or cloud based data storage , and the owner 102 , the system 100 comprises a pep 103 , a ttp 104 , and one or more client devices 105 , also referred to as clients 105 . for the sake of simplicity , only two client devices 105 ( having identifiers c j and c j ′ , respectively ), are shown in fig1 , but embodiments of the invention are not limited to this and may involve any number of clients 105 . note that it is assumed here that only one key k d is used for encrypting the data of the owner . it is , of course , straightforward to extend the solution disclosed herein to different types or categories of data , each type or category being associated with a separate data key . that is , the owner may use one data key for encrypting pictures , another data key for encrypting music files , and yet another data key for encrypting work related documents . in this way , the owner may separately control access to the different categories of data , in accordance with embodiments of the invention . in fig1 , it is further illustrated which keys and related information the entities 101 to 105 have access to . the data storage 101 is assumed to not have access to any of the data key k d , the first , or the second key . rather , data 106 which is stored in the data storage 101 is encrypted with the data key k d before it is transferred to the data storage 101 , or decrypted after it has been retrieved from the data storage 101 . the key k d which is used for encrypting data 106 stored in the data storage 101 is associated with the owner 102 . that is , the owner 102 is assumed to be the only entity of the entities described herein which has unlimited access to the key k d . the key k d may be generated and / or distributed to the owner 102 in any suitable way known in the art . for instance , the key may generated by the owner 102 , e . g ., by an application which is executed on a device used by the owner 102 , or by the pep 103 on request by the owner 102 . alternatively , the key k d may be generated by a hardware component , i . e ., an electronic circuitry , which such a device is provided with . the pep 103 is assumed to not have unlimited access to any of the keys but is entrusted to retain the data key k d during a limited period of time until an operation on the data storage , such as retrieving data 106 , searching for data 106 , or storing data 106 , is completed . thus , the pep 103 is trusted to erase the data key k d when no longer needed . while outside the scope of the invention , it is noted that assurance of proper key handling ( and , in general , assurance of correct operation of the pep ) may be obtained by various means known in the art , e . g ., trusted computing techniques such as remote attestation of the pep &# 39 ; s configuration / software . in order to enable a client 105 to perform an operation on the data storage 101 even while the owner 102 is offline , and henceforth not available for providing the requesting client 105 with the key k d , each of the clients 105 is entrusted to store one part of a two - part secret sharing , i . e ., the first key , whereas the other part of the secret sharing is kept by the ttp 104 . in order to facilitate the discussion , it is here assumed that each client 105 is identified by a , preferably unique , identifier c j . accordingly , the first key which is stored at the client c j 105 is denoted as k cj , whereas the corresponding part of the secret sharing , the second key , is denoted as k tj , and is stored at the ttp 104 . the first key k cj associated with client c j 105 is preferably unique . that is , another first key k cj ′ associated with another client c j ′ 105 is assumed to be different from the first key k cj . accordingly , the corresponding second keys k tj and k tj ′ are assumed to be distinct . the ttp 104 is entrusted to keep small amounts of data on the owner &# 39 ; s 102 behalf . specifically , the ttp 104 keeps , for each client c j 105 which is authorized to perform an operation on the data storage 101 , a second key k tj representing the other part of the secret sharing associated with the client c j 105 . that is , the ttp 104 keeps a set of the second keys , { k tj }, one for each authorized client . optionally , an identifier id j may be used in order to facilitate the handling of keys . to this end , for each client c j 105 which is authorized to perform operations on the data storage , a preferably unique identifier id j is associated with the second key k tj and is distributed to the client c j 105 , preferably together with the first key k cj . subsequently , a client requesting to perform an operation on the data storage 101 may provide the pep 103 with the identifier , which is then forwarded to the ttp 104 where it is used to look up the corresponding second key for the requesting client . the identifier may , e . g ., be an identifier of the client with which the keys are associated , i . e ., “ c j ”. in this case the identifier id j may also be provided to the ttp 104 , where it is stored together with the second key k tj and subsequently used for looking up the corresponding second key when a client requests to perform an operation on the data storage 101 . as an alternative , the identifier id j may be a hash of the second key k tj . in that case , the identifier id j may be generated at the ttp 104 upon receiving the second key k tj , and stored together with the second key k tj . in the following , an embodiment of the invention is described with reference to fig2 , which illustrates a method 200 of distributing keys , in particular the first keys and the second keys , among the entities described with reference to fig1 . note that , for the sake of simplicity , certain known security procedures are omitted from the procedures and the accompanying figures . for example , it may be advantageous that the parties involved in the message exchanges described hereinafter have authenticated each other by some well - known means , e . g ., using tls or a generic bootstrapping architecture ( gba ), thereby establishing trust in the authenticity / identity of all involved parties . method 200 starts with generating 201 the data key k d by the owner 102 . the key k d may be generated 201 using software , such as an app or application , which is executed by a device used by the owner 102 for accessing the data storage 101 . in response to receiving 202 a request from a client c j 105 for authorization to perform operations on the data storage 101 , the owner 102 decides 203 whether to grant the request or not . for instance , the owner 102 may be notified by means of email or a notification which is made visible on the device used by the owner 102 for accessing the data storage 101 . as an alternative , the decision 203 may be based on a policy . for instance , clients may be authorized to perform operations automatically , based on credentials received with the request 202 , such as login information , a password , or the like . as yet a further alternative , a client may be authorized based on an organization which the client belongs to , or an address of the client , such as an internet protocol ( ip ) address or a medium access control ( mac ) address . optionally , if the request 202 for access is rejected , the client c j 105 may be notified 204 . if it is decided 203 that the client c j 105 is authorized to perform operations on the data storage 101 , the first key k cj and the second key k tj are derived 205 from the data key k d . for instance , the first key k cj may be generated randomly , and the second key k tj may be derived from the first key k cj and the data key k d , e . g ., as k tj = k d xor k cj , or any other method for two - part secret sharing which is known in the art . as an alternative , the second key k tj may be generated randomly and the first key k cj may be derived from the second key and the data key , e . g ., as k cj = k d xor k tj . optionally , an identifier id j may be associated 205 with the second key k tj , as was described hereinbefore . subsequent to deriving 205 the first and the second key , the client c j 105 is notified 206 that it may perform operations on the data storage 101 . this may , e . g ., be effected by transmitting 206 the first key k cj to the client c j 105 . optionally , the identifier id j may be transmitted to the client c j 105 as part of the message 206 . in response to receiving 206 the first key k cj , the client c j 105 stores 207 the first key k cj and , optionally , the identifier id j associated with the second key . in addition to transmitting 206 the first key to the client 105 , the owner 102 transmits 208 the second key k tj to the ttp 104 , where it is stored 209 . optionally , the identifier id j is transmitted 208 together with the second key and stored 209 at the ttp 104 . alternatively , the identifier id j is generated at the ttp 104 and stored 209 together with the second key k tj , as was described hereinbefore . in addition to deriving and distributing the first key and the second key , the method 200 may comprise notifying 210 the pep 103 that the client c j 105 is authorized to perform operations on the data storage 101 . in response to receiving the notification 210 , the pep 103 may store 211 information pertaining to the authorized client c j 105 , such as an identifier of the client ( e . g ., “ c j ” or “ j ”), for the purpose of performing a policy check when a request for performing an operation is received from a client , as is described further below . an alternative method 300 of distributing keys is now described with reference to fig3 . method 300 starts with the owner 102 login 301 into the pep 103 , where the data key k d is generated 302 similar to what was described before with reference to step 201 . subsequently , the key k d is transmitted 303 to the owner 102 where it is stored 304 for the purpose of encrypting and / or decrypting data . subsequently , the pep 103 receives 305 a request for authorization to perform operations on to the data storage 101 from a client c j 105 . the request is forwarded 306 to the owner 102 where a decision 307 is taken whether to authorize the requesting client or not , in correspondence to what was described before with reference to step 203 . optionally , if the decision 307 is to reject the request , the pep 103 and the client 105 are notified 308 / 309 accordingly . in response to a decision 307 to authorize the client c j 105 to perform operations on the data storage 101 , the pep 103 is notified 310 . in response to receiving 310 the notification , the pep 103 derives 312 the first key k cj and the second key k tj in accordance with what was described before with reference to step 205 . optionally , the pep 103 may store 311 information pertaining to the client c j 105 , such as an identifier of the client ( e . g ., “ c j ” or “ j ”), for the purpose of performing a policy check when a request for performing an operation is received from a client , as is described further below . similar to what was described with reference to fig2 , the first key k cj is transmitted 313 to the client cj 105 , where it is stored 314 , and the second key k tj is transmitted 315 to the ttp 104 , where it is stored 316 . optionally , the step of deriving 312 the first and the second key may further comprise associating an identifier id j with the second key . the identifier id j is transmitted 313 to the client c j 105 , where it is stored 314 together with the first key k cj . optionally , the identifier id j is also transmitted 315 to the ttp 104 , where it is stored 316 together with the second key k tj . alternatively , the identifier id j is generated at the ttp 104 and stored 316 together with the second key k tj . for instance , the identifier id j may be a hash of the second key . after the pep 103 has distributed the first key and the second key to the client 105 and the ttp 104 , respectively , the pep 103 preferably deletes 317 the data key k d , the first key k cj , and the second key k tj . once a client 105 is in possession of its first key , and the ttp 104 is in possession of the corresponding second key , that client 105 may perform operations on the data storage 101 , as is described in the following , without requesting authorization from the owner 102 . that is , after the owner 102 has authorized a client to perform operations on the data storage 101 in accordance which what is described with reference to fig2 and 3 , no further authorization by the owner 102 is required for subsequent requests from the authorized client . such operations may , e . g ., relate to retrieving data from the data storage 101 , searching data stored in the data storage 101 , or storing data , on behalf of the owner 102 , in the data storage 101 . it will be appreciated that a client may be authorized to perform any type of operations on the data storage or only one or several specific operations . for instance , a certain client my only be authorized to retrieve data from the data storage , while another client may be authorized to retrieve data from the data storage and store data in the data storage . such policies may be configured using policy languages such as xacml . accordingly , with reference to fig2 , the owner 102 may notify 210 the pep 103 that the client c j is authorized to perform a certain type of operation , or certain types of operations , on the data storage 105 , and the pep 103 may store 211 such policy . correspondingly , with reference to fig3 , the owner 102 may notify 310 the pep 103 that the client c j is authorized to perform a certain type of operation , or certain types of operations , on the data storage 105 , and the pep 103 may store 311 such policy . with reference to fig4 , a method 400 of retrieving data 106 from the data storage 101 , on request by a client c k 105 , is described . it is assumed that the client c k 105 is in possession of a first key k ck and an identifier id k , and the ttp 104 is in possession of a second key k tk and the identifier id k . the first key k ck , the second key k tk , and the identifier id k , are generated in accordance with was described hereinbefore , in particular with reference to fig2 and 3 . the method 400 starts with the client c k 105 transmitting 401 a request for retrieving data to the pep 103 . the request 401 comprises the first key k ck and information identifying the requested data ( in fig4 illustrated as info ), e . g ., a file name , or any other suitable identifier of a data item 106 stored in the data storage 101 , and the identifier id k . preferably , but omitted from fig4 , the pep 103 and client c k 105 have authenticated each other , e . g ., using tls , before the message exchange shown in fig4 takes place . in response to receiving the request 401 , the pep 103 may optionally check 402 whether the client c k 105 is authorized to perform operations , or the requested operation , on the data storage 101 . this may , e . g ., be achieved by comparing an identifier of the requesting client , such as “ c k ” or “ k ”, with a policy configured by the owner 102 . if the client c k 105 is not authorized to perform operations , or the requested operation , on the data storage 101 , the client c k 105 may optionally be notified 403 that the request is rejected . subsequently , the pep 103 , having received 401 the first key k ck from the client c k 105 , requests 404 the corresponding second key k tk from the ttp 104 . this may , e . g ., be achieved by transmitting the identifier id k together with the request 404 . preferably , the ttp 104 also authenticates the pep 103 ( not shown in fig4 ). in response to receiving 404 the request , the ttp 104 retrieves 405 the requested second key k tk , e . g ., from a local storage , such as a database for storing the second keys for all clients which have been authorized to perform operations on the data storage , and transmits 406 the second key k tk to the pep 103 . at the pep 103 , the data key k d is derived 407 from the first key k ck , received 401 from the client c k 105 , and the second key k tk , received 406 from the ttp 104 . the data key k d is derived in a way which corresponds to the way the first and second keys are derived as part of the methods 200 and 300 of generating and distributing keys . for instance , the key k d may be derived as k d = k ck xor k tk . then , the pep 103 retrieves 408 the requested data from the data storage 101 which looks up the one or more data items 106 identified by info and transmits 410 the requested data to the pep 103 . in response to receiving 410 the requested , encrypted , data , the pep 103 decrypts 411 the received data and transmits 412 the decrypted data to the requesting client c k 105 . optionally , the data is re - encrypted before transmission 412 to the client c k 105 , e . g ., using tls or ipsec . after the retrieved data is decrypted 411 , unless there are further , pending , data retrieval requests from the client c k 105 , the pep 103 deletes 413 the key k d which it has derived 407 , as well as the first key k cj and the second key k tj . with reference to fig5 , a method 500 of searching 106 data stored in the data storage 101 , on request by a client c k 105 , is described . it is assumed that the client c k 105 is in possession of a first key k ck and an identifier id k , and the ttp 104 is in possession of a second key k tk and the identifier id k . the first key k ck , the second key k tk , and the identifier id k , are generated in accordance with what was described hereinbefore , in particular with reference to fig2 and 3 . the method 500 starts with the client c k 105 transmitting 501 a request for searching data to the pep 103 . the request 501 comprises the first key k ck and information identifying the data to which the search request pertains ( in fig5 illustrated as info ), i . e ., one or more search terms or a search phrase , and the identifier id k . preferably , but omitted from fig5 , the pep 103 and client c k 105 have authenticated each other , e . g ., using tls , before the message exchange shown in fig5 takes place . in response to receiving the request 501 , the pep 103 may optionally check 502 whether the client c k 105 is authorized to perform operations , or the requested operation , on the data storage 101 , similar to what was described before with reference to step 402 . if the client c k 105 is not authorized to perform operations , or the requested operation , on the data storage 101 , the client c k 105 may optionally be notified 503 that the request is rejected . subsequently , the pep 103 , having received 501 the first key k ck from the client c k 105 , requests 504 the corresponding second key k tk from the ttp 104 . this may , e . g ., be achieved by transmitting the identifier id k together with the request 504 . preferably , the ttp 104 also authenticates the pep 103 ( not shown in fig5 ). in response to receiving 504 the request , the ttp 104 retrieves 505 the requested second key k tk , e . g ., from a local storage , such as a database for storing the second keys for all clients which are authorized to perform operations on the data storage , as was described with reference to fig2 and 3 , and transmits 506 the second key k tk to the pep 103 . at the pep 103 , the data key k d is derived 507 from the first key k ck and the second key k tk . the data key k d is derived in a similar way as was described with reference to step 407 . the pep 103 encrypts 508 the search terms or the search phrase , i . e ., info , using a search key k s which may be identical to the data key k d or different from the data key k d . for instance , the key k s may be derived from the key k d . further , the key k s may be split into a first key and a second key , in correspondence to what is described herein with respect to the key k d . it will be appreciated that , regardless how the key k s is obtained , the index which is stored at the data storage 101 and the search term or search phrase have to be encrypted using the same key . then , the pep 103 forwards 509 the search request to the data storage 101 , the search request 509 comprising the encrypted one or more search terms or search phrase . the data storage 101 looks up 510 the one or more data items 106 matching info , as is known in the art , and transmits 511 the encrypted data , i . e ., one or more data items matching info , to the pep 103 . in response to receiving 511 the encrypted data , the pep 103 decrypts 412 the received data and transmits 513 the decrypted data to the requesting client c k 105 . optionally , the retrieved data is re - encrypted before transmission 513 to the client c k 105 , e . g ., using tls or ipsec . after the retrieved data is decrypted 512 , unless there are further , pending , search requests from the client c k 105 , the pep 103 deletes 514 the key k d which it has derived 507 , as well as the first key k cj and the second key k tj . with reference to fig6 , a method 600 of storing data 106 in the data storage 101 , on request by a client c k 105 , is described . the data is stored on behalf of the owner 102 since the data key k d , which is associated with the owner 102 , is utilized in performing the storage operation . it is assumed that the client c k 105 is in possession of a first key k ck and an identifier id k , and the ttp 104 is in possession of a second key k tk and the identifier id k . the first key k ck , the second key k tk , and the identifier id k , are generated in accordance with what has been described hereinbefore , in particular with reference to fig2 and 3 . the method 600 starts with the client c k 105 transmitting 601 a request for storing data to the pep 103 . the request 601 comprises the first key k ck , the data to be stored ( in fig6 illustrated as data ), and the identifier id k . the data to be stored may be one or more data items , e . g ., files . the request 601 , or at least the data to be stored , is preferably encrypted , e . g ., using tls or ipsec . preferably , but omitted from fig6 , the pep 103 and client c k 105 have authenticated each other , e . g ., using tls , before the message exchange shown in fig6 takes place . in response to receiving the request 601 , the pep 103 may optionally check 602 whether the client c k 105 is authorized to perform operations , or the requested operation , on the data storage 101 , similar to what was describe before with reference to step 402 . if the client c k 105 is not authorized to perform operations , or the requested operation , on the data storage 101 , the client c k 105 may optionally be notified 603 that the request is rejected . subsequently , the pep 103 , having received 601 the first key k ck from the client c k 105 , requests 604 the corresponding second key k tk from the ttp 104 . this may , e . g ., be achieved by transmitting the identifier id k together with the request 604 . preferably , the ttp 104 also authenticates the pep 103 ( not shown in fig6 ). in response to receiving 604 the request , the ttp 104 retrieves 605 the requested second key k tk , e . g ., from a local storage , such as a database for storing the second keys for all clients which have been granted access to the data storage , as was described with reference to fig2 and 3 , and transmits 606 the second key k tk to the pep 103 . at the pep 103 , the data key k d is derived 607 from the first key k ck and the second key k tk . the data key k d is derived in a similar way as was described with reference to step 407 . then , the pep 103 encrypts the data to be stored , i . e ., data , using the derived key k d , and transmits 609 the encrypted data to the data storage 101 . in response to receiving 609 the encrypted data , the data storage 101 stores 610 the data 106 . optionally , the data storage 101 may notify the pep 103 whether the storage operation was successful or not ( not shown in fig6 ). after the data to be stored is encrypted 608 , unless there are further , pending , storage requests from the client c k 105 , the pep 103 deletes 611 the key k d which it has derived 607 , as well as the first key k cj and the second key k tj . in the present context , “ storing data ” is not limited to storing new data items 106 in the data storage 101 , but may also encompass updating an existing data item 106 which is stored in the data storage 101 . for instance , a client 105 may retrieve a data item 106 from the data storage 101 , update the data item , and store the updated data item 106 in the data storage 101 . with reference to fig7 , an embodiment of the method of performing an operation on a data storage 101 for storing data , the method being performed by a pep 103 , is described . the data 106 stored in the data storage 101 is encrypted with a key k d associated with an owner 102 of the data . the method 700 comprises receiving 703 a request for performing the operation on the data storage 101 . the request is received from a client c k 105 of one or more clients which are authorized to perform operations on the data storage 101 . preferably , the client c k 105 is authenticated by the pep 103 . the method 700 further comprises acquiring 704 a first key k ck from the client c k 105 and acquiring 705 a second key k tk from the ttp . the first key may , e . g ., be comprised in the request for performing an operation which is received 703 from the client c k 105 . the method 700 further comprises deriving 706 the key k d from the first key k ck and the second key k tk , and performing 707 the operation on the data storage using the derived key k d . optionally , the method 700 may further comprise deriving 701 the first key k cj and the second key k tj for each client c j 105 which is authorized to perform operations on the data storage , and distribute 702 the keys , i . e ., provide the client c j 105 with the first key k cj and the ttp 104 with the second key k tj . as an additional , optional , step , the method 700 may comprise deleting 708 the key k d after the operation on the data storage 101 is completed . with reference to fig8 , an embodiment of the method of performing an operation on a data storage 101 for storing data , the method being performed by a ttp 104 , is described . the data stored in the data storage 101 is encrypted with a key k d associated with an owner 102 of the data . the method 800 comprises receiving and storing a second key k tj for each client c j 105 which is authorized to perform operations on the data storage 101 . the second key k tj is derived such that the key k d can be derived from a first key k tj associated with the client c j 105 and the second key k tj . the method 800 further comprises receiving 802 a request for a second key k tk associated with a client c k 105 requesting to perform the operation on the data storage 101 . the request is received 802 from the pep 103 and is preferably authenticated . the method 800 further comprises providing 803 the pep 103 with the second key k tk . optionally , the request for the second key may comprise an identifier id k which is associated with the second key k tj , and the identifier id k is used for providing the pep 103 with the second key k tj . to this end , the identifier id k may be used for looking up the second key which is associated with the requesting client c k 105 in a database of the ttp 104 . with reference to fig9 , an embodiment of the method of performing an operation on a data storage 101 for storing data , the method being performed by a client c k 105 , is described . the data stored in the data storage 101 is encrypted with a key k d associated with an owner 102 of the data . the method 900 comprises receiving and storing 901 a first key k ck . the first key k ck is derived such that the key k d can be derived from the first key k ck and a second key k tk associated with the client c k 105 . the method 900 further comprises transmitting 903 a request for performing the operation on the data storage 101 to a pep 103 and providing 904 the pep 103 with the first key k ck . the first key may be comprised in the request . optionally , the method 900 may further comprise receiving and storing 902 an identifier id k which is associated with the second key k tk , and providing 905 the pep 103 with the identifier id k . the identifier may be comprised in the request . embodiments of the methods 700 , 800 , and 900 , may comprise further steps in accordance with what was described hereinbefore , in particular with reference to fig2 to 6 . with reference to fig1 , an embodiment of the pep 103 for performing an operation on a data storage 101 for storing data is illustrated . the data stored in the data storage 101 is encrypted with a key k d associated with an owner 102 of the data . the pep 1000 comprises a communication interface 1001 , a processing means such as a processor 1002 , and a memory 1003 . the memory 1003 comprises instructions 1004 executable by the processor 1002 . the communication interface 1001 is arranged for communicating with the other entities 1010 described with reference to fig1 , in particular the data storage 101 , the owner 102 , the ttp 104 , and one or more clients 105 . the communication may be effected by means of any suitable wired or wireless communication technology , e . g ., ethernet , wireless lan ( wlan ), global system for mobile communications ( gsm ), universal mobile telecommunications system ( umts ), or long term evolution ( lte ). the pep 1000 is operative to receive a request for performing the operation on the data storage 101 from a client c k 105 of one or more clients which are authorized to perform operations on the data storage 101 . the pep 1000 is further operative to acquire a first key k ck from the client c k 105 , acquire a second key k tk from a ttp 104 , derive the key k d from the first key k ck and the second key k tk , and perform the operation on the data storage 101 using the derived key k d . the pep 1000 may further be operative to store the derived key k d in a local storage 1005 , which may be comprised in the memory 1003 of the pep 1000 , for the purpose of using the key k d in performing the requested operation . optionally , the pep 1000 may further be operative to delete the key k d after the performing the operation on the data storage 101 is completed . with reference to fig1 , an embodiment of the ttp 104 for performing an operation on a data storage 101 for storing data is illustrated . the data stored in the data storage 101 is encrypted with a key k d associated with an owner 102 of the data . the ttp 1100 comprises a communication interface 1101 , a processing means such as a processor 1102 , and a memory 1103 . the memory 1103 comprises instructions 1104 executable by the processor 1102 . the communication interface 1101 is arranged for communicating with the other entities 1110 described with reference to fig1 , in particular the data storage 101 , the owner 102 , the pep 103 , and one or more clients 105 . the communication may be effected by means of any suitable wired or wireless communication technology , e . g ., ethernet , wlan , gsm , umts , or lte . the ttp 1100 is operative to receive and store a second key k tj for each client c j of one or more clients 105 which are authorized to perform operations on the data storage 101 . the second key k tj is derived such that the key k d can be derived from a first key k cj associated with the client c j 105 and the second key k tj . the ttp 1100 may be operative to store the second keys in a local storage 1105 , which may be comprised in the memory 1103 of the ttp 1100 . the ttp 1100 is further operative to receive a request from a pep 103 for a second key k tk associated with a client c k of the one or more clients 105 , the client c k 105 requesting to perform the operation on the data storage 101 , and to provide the pep 103 with the second key k tk . with reference to fig1 , an embodiment of the client 105 , or client device , for performing an operation on a data storage 101 for storing data is illustrated . the data stored in the data storage 101 is encrypted with a key k d associated with an owner 102 of the data . the client 1200 comprises a communication interface 1201 , a processing means such as a processor 1202 , and a memory 1203 . the memory 1203 comprises instructions 1204 executable by the processor 1202 . the communication interface 1201 is arranged for communicating with the other entities 1210 described with reference to fig1 , in particular the data storage 101 , the owner 102 , the pep 103 , and the ttp 104 . the communication may be effected by means of any suitable wired or wireless communication technology , e . g ., ethernet , wlan , gsm , umts , or lte . the client 1200 is operative to receive and store a first key k ck . the first key k ck is derived such that the key k d can be derived from the first key k ck and a second key k tk associated with the client c k 105 . the client 1200 may be operative to store the first key in a local storage 1205 , which may be comprised in the memory 1203 of the client 1200 . the client 1200 is further operative to transmit a request for performing the operation on the data storage 101 to a pep 103 and to provide the pep 103 with the first key k ck . embodiments of the pep 1000 , the ttp 1100 , and the client 1200 , may further be operative to perform in accordance with what was described hereinbefore , in particular with reference to fig2 to 6 . even though embodiments of the pep 103 , the ttp 104 , and the client 105 , are hereinbefore described as being implemented by means of software , i . e ., computer programs comprising instructions executable by a processor , it will be appreciated that processing means other than a processor , such as a general purpose processor , may be used . for instance , the processing means may be any suitable electronic circuitry adapted to perform in accordance with an embodiment of the invention , in particular in accordance with what is described with reference to fig2 to 6 . an alternative embodiment of the pep 103 for performing an operation on a data storage 101 for storing data 106 is illustrated in fig1 . the data 106 stored in the data storage 101 is encrypted with a key k d associated with an owner 102 of the data . the pep 1300 comprises a first module 1301 configured to receive a request for performing the operation on the data storage from a client c k of one or more clients 105 which are authorized to perform operations on the data storage , a second module 1302 configured to acquire a first key k ck from the client c k 105 , a third module 1303 configured to acquire a second key k tk from a ttp 104 , a fourth module 1304 configured to derive the key k d from the first key k ck and the second key k tk , and a fifth module 1305 configured to perform the operation on the data storage 101 using the derived key k d . an alternative embodiment of the ttp 104 for performing an operation on a data storage 101 for storing data 106 is illustrated in fig1 . the data 106 stored in the data storage 101 is encrypted with a key k d associated with an owner 102 of the data . the ttp 1400 comprises a first module 1401 configured to , for each client c j of one or more clients 105 which are authorized to perform operations on the data storage 101 , receive a second key k tj which is derived such that the key k d can be derived from a first key k cj associated with the client c j and the second key k tj , a second module 1402 configured to store each received second key k tj , a third module 1403 configured to receive a request from a pep 103 for a second key k tk associated with a client c k of the one or more clients 105 , the client c k requesting to perform the operation on the data storage , and a fourth module 1404 configured to provide the pep 103 with the second key k tk . an alternative embodiment of the client 105 for performing an operation on a data storage 101 for storing data 106 is illustrated in fig1 . the data 106 stored in the data storage 101 is encrypted with a key k d associated with an owner 102 of the data . the client 1500 comprises a first module 1501 configured to receive a first key k ck which is derived such that the key k d can be derived from the first key k ck and a second key k tk associated with the client c k , a second module 1502 configured to store the first key k ck , a third module 1503 configured to transmit a request for performing the operation on the data storage to a pep 103 , and a fourth module 1504 configured to provide the pep 103 with the first key k ck . embodiments of the pep 1300 , the ttp 1400 , and the client 1500 , may comprise further modules being configured to perform in accordance with what was described hereinbefore , in particular with reference to fig2 to 6 . the modules comprised in the pep 1300 , the ttp 1400 , and the client 1500 , may be implemented by means of hardware , i . e ., electronic circuitry , or a combination of hardware and software . for instance , the modules may be implemented using processing means , such as the processors ( 1002 , 1102 , and 1202 ), and , optionally , the memories ( 1003 , 1103 , and 1203 ), described with reference to fig1 to 12 . with respect to the present disclosure , a processor may be a general purpose processor or any kind of processing means capable of executing instructions . further , a memory may be a random access memory ( ram ), a read only memory ( rom ), a hard disk , a flash memory , or the like . a storage medium may , e . g ., be a ram , a rom , a flash memory , a hard disk , a cd - rom , a dvd , a blu - ray disc , or the like . it will also be appreciated that an embodiment of the computer programs may be carried by an electronic signal , an optical signal , or a radio signal . the person skilled in the art realizes that the invention by no means is limited to the embodiments described above . on the contrary , many modifications and variations are possible within the scope of the appended claims . | 6 |
the power tool illustrated in the drawing figures is a pneumatic angle grinder intended for an alternative one - hand or two - hand operation . in both cases , the tool housing is to be grasped by the operator for supporting the tool . in the two - hand alternative , the operator also grasps a laterally extending handle . this means , however , that in any case the operator is in physical contact with the tool housing . the power tool shown in fig1 comprises a housing 10 in which are located a vane type pneumatic motor 11 , a pressure air inlet 12 , a throttle valve 13 manoeuvered by a lever 14 , and a rear end exhaust air outlet 15 . at the front end of the housing 10 , there is disposed an angle head 16 which is formed with a mounting means 17 for attachment of an auxiliary handle and which encloses an angle drive by which the motor 11 is connected to an output shaft ( not shown ). the output shaft carries a grinding wheel 18 , and a safety guard 19 which partly surrounds the grinding wheel 18 is adjustably mounted on the housing 10 by means of a clamping device 20 . on its outside , the housing 10 is provided with a heat insulating plastic lining 21 . as is best seen in fig1 and 2 , the motor 11 comprises a cylinder or stator 22 which is formed with a cylindrical chamber 23 , two axially directed pressure air inlet ports 24 and a laterally directed exhaust air outlet port 25 . within the cylinder chamber 23 there is rotatively journalled a rotor 26 carrying radially movable vanes 27 . the housing 10 comprises a cylindrical wall 28 with a cylindrical inner surface 29 . see fig1 and 4 . between the surface 29 and the motor stator 22 there is formed a substantially tubular space 30 . within the tubular space 30 there is disposed a heat screen in the form of a tubular sheet metal shell 32 . although other types material , as for instance plastics , might be used , sheet metal is superior since it makes it possible to keep down the thickness of the shell 32 to a few tenths of a millimeter , and thereby to keep down the outer transverse dimension of the tool housing for a certain motor size . the heat screening effect of the shell 32 is based on the low heat transition coefficient existing between a gaseous medium and a solid material , and by the introduction of a heat screening shell 32 between the motor stator 22 and the housing 10 there is formed two extra air - to - metal heat transitions which effectively retard the heat transfer between the motor and the housing . accordingly , between the shell 32 and the inner surface 29 of the housing 10 , there is formed a first air gap 33 , and between the shell 32 and the stator 22 there is formed a second air gap 34 . the second air gap 34 , though , is several times wider than the first air gap 33 and is adapted to form a part of the exhaust air passage for communicating exhaust air from the motor outlet port 25 to the rear end of the housing 10 and the exhaust outlet 15 . as illustrated in the drawing figures , the first air gap 33 between the shell 32 and the inner surface 29 of the housing 10 is very narrow , and it is to be noted that the air gap necessary to obtain the low heat transition coefficient could be very small , down to molecule size . this means that there is in fact no need for any means to keep up the size of the air gap . in some cases , though , it might be useful to provide the shell 32 with some kind of distance keeping means . an example to this is illustrated in fig6 which shows a fraction of a heat screening shell 52 which is formed with punched - out dents forming projections 53 on the outside of the shell 52 . by spreading a number of such projections 53 over the shell 52 a certain width of the air gap 33 relative to the surface 29 is positively maintained . it should be noted that the heat screening concept of the invention is based on the low gas - to - solid material heat transition coefficient , and not at all on the heat insulating properties of the very material used for the heat screening shells . this means that the heat screening shells in themselves have substantially no heat insulating properties . should , accordingly , the heat screening shells be made of a plastic material , which material has fairly good heat insulating properties , the shells are thin enough not to offer any heat insulation by themselves . so , regardless of what material is used for the heat screening shells , the shells have in themselves substantially no heat insulating properties . the embodiments of the invention are not limited to heat screening devices comprising just one heat screening shell . in fig5 there is illustrated an embodiment of the invention including two tubular shells 32a , 32b arranged coaxially with each other with one of them disposed inside the other leaving an air gap 36 between them . this arrangement means that the heat transfer between the motor and the housing is further retarded , because the employment of two heat screening shells means four serial gas - to - metal heat transitions , each with a low heat transition coefficient . during operation of the above described pneumatic power tool , pressure air is supplied through the air inlet 12 and fed to the motor 11 via the throttle valve 13 and the air inlet ports 24 . when entering the cylinder chamber 23 , the pressure air starts acting on the rotor vanes 27 , thereby rotating the rotor 26 . having passed the cylinder chamber 23 , the air is exhausted through the outlet port 25 into the tubular space 30 between the stator 22 and the inner surface 29 of the housing 10 , specifically , the second air gap 34 between the stator 22 and the heat screening shell 32 . when passing through the cylinder chamber 23 and performing a work under expansion , the air loses a lot of heat , and when the air leaves the motor through the outlet port 25 , the temperature thereof has decreased substantially . in many cases the temperature of the exhaust air is below zero degrees centigrade . the operator is protected from this low temperature in that the relative heat of the operators hands has to pass : i ) the outer insulating plastic lining 21 and the housing wall 28 , ii ) from the inner surface 29 of the housing wall 28 to the air in the first air gap 33 , iv ) from the shell 32 to the air in the second air gap 34 , and in all four gas - to - metal heat transitions , there is a low heat transition coefficient , which means that the overall heat transfer is very slow . this means in turn that the operator is not exposed to the uncomfortable cold developed in the motor . in the case of employing two or more heat screening shells , like 23a , 23b shown in fig5 the heat transfer is further retarded and the outer temperature of the tool housing 10 is even more comfortable for the operator . though not specifically described by way of example , the invention is equally applicable to an electric power tool where the heat screen is intended to operate the other way round , namely to reduce heat transfer from the motor to the housing . in such applications of the invention , the heat developed in the electric motor has to pass at least four transition steps between gaseous media and metal surfaces before reaching the operators hands . | 1 |
the present invention relates to refined fish oils and the process for production thereof . the object of said invention is in providing novel refined fish oils containing a high concentration of eicosapentaenoic acid ( carbon number 20 , number of unsaturated double bonds 5 ) as the fatty acid residue , and almost free of fishy odor and in providing a method of producing thereof . the inventor of the present invention , as the results of various researches for providing refined fish oils containing a high concentration of epa and free of fishy odors and the process for production of such fish oils , took a hint in the fact that salad oils obtained from vegetable seeds , that are composed of almost pure triglyceride , do not give forth any bad smell even after a long period of storage , and discovered that even in case of fish oils , if they are subjected to molecular distillation after a definite pretreatment , refined fish oils as odorless as salad oils could be obtained ; and based on the discovery , he accomplished the present invention . the refined fish oil of the present invention contains more than 20 % epa as the fatty acid residue and is almost free of fishy odorous substances ; and the process for production thereof is characterized in adding polyhydric alcohol and monoglyderide to a fish oil or winterized fish oil or interesterified fish oil , heating it in vacuo to remove the odor , then subjecting it further to molecular distillation and collecting the vaporized constituents as the refined oil . the fish oils to be used as the starting materials in the present invention include not only the fat and oils obtained from such fish as sardine and / or pilchard , chub mackerel , pacific saury and the like , expressed according to a conventional method , but the fat and oils removed from viscera of pollack , shark , etc . and also from such mollusca as squid and / or cuttle fish , octopus , etc . the fish oil used as the starting material in the present invention may be crude fish oil expressed from fish , but in order to improve the efficiency of deodorization and molecular distillation that are to be operated in the later stages , it is desirable that the crude fish oil is subjected to acid refinement by means of phosphoric acid , sulfuric acid and the like , or to alkali treatment by means of caustic alkali , then further to the preliminary refinement such as deacidification , decoloration , dewaxing , etc . to obtain the product having higher content of triglycerides . particularly for maintaining a transparent liquid state that does not cloud at normal temperature , it is effective to subject the fish oil to winterization for dewaxing . in subjecting fish oil to winterization , any conventional method can be employed , but for effectively removing the solid fat contained in the fish oil , it is desirable to divide the winterization into two stages ; the first winterization for dewaxing at a temperature of from 5 ° to - 2 ° c . and then the second winterization at from - 2 ° to - 10 ° c . for further dewaxing . the object of winterization is to remove the solid glyceride having a boiling point almost the same as that of the liquid triglyceride contained in the fish oil so as to obtain a refined fish oil of high epa content in the molecular distillation that is to be performed thereafter . in the process for producing refined fish oils containing high content of epa , there is a procedure other than the above winterization procedure , namely the procedure in which the fish oil is added with a catalyst such as sodium alcoholate to cause ester interchange reaction in the presence of an inert gas to obtain an interesterified fish oil . as an example for the procedure of interesterification reaction , a fish oil having acid value of less than 0 . 5 % and moisture content of less than 0 . 2 % by weight is added with 0 . 02 - 0 . 5 % by weight of sodium alcoholate , the mixture is stirred under nitrogen gas at a temperature of 5 °- 30 ° c . to be reacted , and when the cloud point of the reaction mixture rises 7 °- 25 ° c . higher than that of the fish oil ( the starting material ), an acid such as phosphoric acid as a neutralizer in an amount corresponding to the neutralization equivalent is added for terminating the reaction to obtain an interesterified oil . although the reaction times vary with the sorts of fish oils or reaction temperatures , they may be within the range of 3 - 36 hours . the reason for carrying out the interesterification reaction is in that the major portion of glycerides in the fish oil is converted to saturated triglycerides , thereby the glycerides can be recovered in higher yields by means of molecular distillation at the later stage . according to the present invention , polyhydric alcohol and monoglyceride are first added to the fish oil or winterized fish oil or interesterified fish oil . as for said polyhydric alcohol , there is no particular restriction only if it is non - toxic , but it is recommendable to use glycerol or a divalent or trivalent alcohol such as dipropylene glycol . it is particularly preferable to use glycerol that has been generally accepted as the additive for foodstuff . the object of use of polyhydric alcohol in the present invention is that amines contained in fish oils have a strong hydration property , and therefore , when polyhydric alcohol that has a boiling point near that of amines is added to the fish oil , it imparts affinity to said amines for the hydroxyl groups of polyhydric alcohol and accelerates distillation and removal of amines caused by the distilling function of polyhydric alcohol in the following deodorization stage so that the amines are removed from the fish oil . and since polyhydric alcohol is insoluble in fish oil , it is impossible to disperse it homegeneously in the fish oil if said polyhydric alcohol is added thereto as it is . then , according to the present invention , monoglyceride that is mutually soluble with polyhydric alcohol is added in the fish oil together with polyhydric alcohol , and by using it as a medium , it tried to disperse polyhydric alcohol homogeneously in the fish oil . as the monoglyceride , there are mono - oleyl glycerides and the like that are obtained from such vegetable oils as soybean oil and coconut oil and / or palm oil . and they can be used regardless of the type if one hydroxyl group of glycerol is ester - bonded with a fatty acid . as the monoglyceride , the crude material separated from fat and oil can be used , but it is more desirable to use distillated monoglyceride because said distillated monoglycerides are odorless . to add to , since said monoglyceride has a boiling point near that of cholesterol , it also acts the role of removing cholesterol , effectively from the fish oil in the following step of molecular distillation . the amount of addition of polyhydric alcohol and monoglyceride is respectively about 1 - 20 parts relative to 100 parts of fish oil , and when stirred and mixed at normal temperature or at the temperature lower than 50 ° c ., a transparent mixed oil can be obtained . in the next place , the mixed oil is heated in vacuo for deodorization . for deodorization , a continuous falling - film type deodorizing apparatus or a centrifugal molecular distillation apparatus is used , and volatile odorous constituents are removed by heating the fish oil in vacuo . as to the relation between the degree of vacuum and the oil - heating condition , they are : degree of vacuum , 10 - 100 mmtorr ; temperature , 90 °- 150 ° c ., respectively , and in this case , it is desirable to set the charging rate of the fat and oil at 20 - 150 kg / h / m 2 . to add to , in deodorization , it is desirable to finish deodorization in as short a period as possible for preventing deterioration of highly unsaturated fatty acids such as epa and the like in the fish oil . since the volatile odorous constituents such as amines , aldehydes , ketones , organic acids , etc . contained in the fish oil are removed by this deodorizing process , the deodorized fish oil , almost free of fishy odor , can be obtained in the yield of 90 - 98 % relative to the fish oil , the starting material . furthermore , in deodorization , polyhydric alcohol , being affinitive for amines , is distilled off , and accompanied therewith , removal of amines is accelerated so that the deodorized fish oil can be obtained in a short time , without deteriorating highly unsaturated fatty acids such as epa , and the like . according to the present invention , the deodorized fish oil thus obtained is further subjected to molecular distillation , and the volatilized constituents formed thereby are collected as the refined oil . for molecular distillation , the use of a centrifugal falling - film type distillation apparatus is desirable . though single operation of molecular distillation could satisfactorily produce the objective refined fish oil , the product containing a high concentration of epa can be produced more efficiently when said molecular distillation is effected with the procedure divided into three stages . to begin with , the first distillation is carried out on the deodorized fish oil at the degree of vacuum 5 - 30 mmtorr , film temperature at 100 °- 260 ° c . to distill off monoglyceride , fatty acid ester of cholesterol , etc . to obtain pure glyceride oil in the yield of 80 - 98 % relative to 100 parts of the fish oil , the starting material . and by this first distillation , accompanied with monoglyceride , cholesterol is removed , and also the odorous substances remaining in a very little amount can completely be removed . in the next place , the second distillation is performed on the pure glyceride oil obtained by the first distillation , at the degree of vacuum 0 . 1 - 50 mmtorr , film temperature 150 °- 300 ° c . to distill off the low molecular glyceride of molecular weight 800 - 880 , having a low epa content , and thereby high molecular glyceride is obtained in the yield of 35 - 65 % relative to 100 parts of the fish oil . the film temperature exceeding 300 ° c . is undesirable because when it exceeds 300 ° c ., epa contained in the fish oil in the form of residue of ester causes pyrolytic reaction , which brings forth a tendency of forming ketones , a constituent of the precursors of fishy odor . finally , the third distillation is effected on the liquid glyceride obtained by the second distillation , at the degree of vacuum 0 . 1 - 30 mmtorr , film temperature 200 °- 300 ° c ., and by cooling the volatilized constituents formed thereby and collecting them as the refined oil , the final refined oil containing more than 20 % epa can be obtained in the yield of 20 - 60 % relative to 100 parts of the fish oil , the starting material . to add to , the protein that is contained slightly in the liquid glyceride and also nitrogen compounds , the decomposed products thereof , are left in the remnant oil as these have different boiling points from those of the volatilized constituents in the third distillation . the economic charging rate in the respective distillation stages are variant depending on the molecular distillation apparatuses to be used , but the rate 20 - 150 kg / m 2 per hour should be appropriate . the refined fish oil thus obtained was confirmed to have the epa content of 20 - 30 % in fatty acid residues . according to the present invention , as we have so far set forth , the low molecular compounds and low molecular glycerides can be removed from fish oil by deodorization and through molecular distillation , and therefore , the material oil can be finished into a refined fish oil having a high epa content . and if winterization or interesterification is performed as a pre - treatment , the starting oil material can be finished into a refined fish oil of much higher epa content . moreover , since amines have been distilled off by the action of polyhydric alcohol in said deodorization stage , and also since in the molecular distillation , there is no possibility of protein or nitrogeneous compounds , that is the decomposed products thereof , being mixed in the refined fish oil , a refined fish oil containing no precursor substances of fishy odor can be obtained thereby . thus , according to the present invention , it is possible to produce a refined fish oil having a high content of epa and emitting almost no fishy odor even in a long period of storage . the refined fish oils of the present invention are of high grade having content of glycerides more than 96 % and content of cholesterol less than 0 . 1 %. a winter oil was obtained by using sardine oil having acid value 0 . 4 , saponification value 191 , iodine value 180 , epa content 18 %, through the process of first subjecting it to the first winterization at - 1 ° c . for 16 hours to effect dewaxing , then subjecting it to the second winterization at - 7 ° c . for 12 hours to effect finish - dewaxing . the yield of the winter oil was 65 % relative to 100 parts of the fish oil , the starting material . to 100 parts of the winter oil thus obtained , 5 parts of glycerol and 5 parts of distilled monooleyl glyceride were added , and the mixture was heated with agitation to 50 ° c ., thereby a transparent mixed oil was obtained . the mixed oil thus obtained was continuously charged into a falling - film type vacuum deodorizing apparatus having vaporization area of 2 m 2 for heating process with hot medium , and deodorization was performed under the conditions : the temperature of the charged oil 70 °- 80 ° c ., degree of vacuum 50 - 30 mmtorr , film temperature 130 °- 150 ° c ., and charging rate 210 kg / hr / m 2 ; thereby 104 parts of deodorized oil was obtained relative to 100 parts of the fish oil . subsequently , the first distillation was carried out by charging the deodorized oil continuously into a high vacuum falling - film type distilling apparatus of heating process with hot medium , having a vaporization area 2 m 2 , and under the distillation conditions : the charging oil temperature 150 °- 170 ° c ., degree of vacuum 7 - 10 mmtorr , film temperature 220 °- 230 ° c ., charging rate 110 kg / hr / m 2 , thereby 95 parts of remnant oil was obtained . then the remnant oil was continuously charged into a heating type centrifugal molecular distillation apparatus , and the second distillation was performed under the distillation conditions : the charging oil temperature 170 °- 180 ° c ., degree of vacuum 3 - 5 mmtorr , charging rate 50 kg / hr / m 2 , thereby 60 parts of remnant oil was obtained . said remnant oil was further charged into a centrifugal molecular distillation apparatus of heating process with hot medium , having vaporization area of 1 m 2 , and the third distillation was effected under the distillation conditions of charging oil temperature 200 °- 210 ° c ., degree of vacuum 3 - 5 mmtorr , film temperature 280 °- 290 ° c ., and charging rate 30 kg / hr / m 2 , and the volatilized substances were collected as the refined oil . as the result 35 parts refined fish oil was obtained relative to 100 parts of the fish oil , the starting material . the properties of the thus obtained refined fish oil were just as given in the following table 1 . table 1______________________________________ ( properties of refined fish oil ) ______________________________________acid value 0 . 01iodine value 215pov 0 . 4content of glyceride 98 . 0 % content of cholesterol 0 . 07 % percentage of epa in 25 . 5 % fatty acidscontent of amines not detectablecontent of ketones not detectable______________________________________ using sardine oil as the starting material having acid value 22 , saponification value 192 , iodine value 178 , and c . p . 11 ° c ., deacidification and decoloration procedures in the usual manner were performed to give a pre - refined sardine oil having acid value 0 . 15 and moisture content 0 . 1 %. to 100 parts by weight of the pre - refined sardine oil thus obtained , 0 . 2 parts by weight of sodium methylate was added , and the interesterification reaction was effected with stirring under nitrogen gas at a temperature of 20 °- 22 ° c . for 12 hours . after confirming the cloud point as 20 ° c ., phosphoric acid in an amount corresponding to neutralization equivalent was added to neutralize the reacted substances . 95 % by weight of interesterified oil having acid value 1 . 2 , saponification value 192 , iodine value 177 . 8 and cloud point 20 ° c . was obtained . to 100 parts by weight of the interesterified oil , 3 parts by weight of dipropylene glycol and 2 parts by weight of distillated monooleyl glyceride were added , the mixture was heated with stirring to 40 ° c ., thereby a transparent mixed oil was obtained . the mixed oil thus obtained was continuously charged into a falling - film type vacuum deodorizing apparatus of heating process , with hot medium , having vaporization area of 2 m 2 , and deodorization was performed under the conditions : the temperature of the charged oil 38 °- 43 ° c ., degree of vacuum 50 - 55 mmtorr , film temperature 65 °- 75 ° c ., and charging rate 130 kg / hr / m 2 , thereby 100 . 7 parts by weight of deodorized oil was obtained . subsequently , the deodorized oil thus obtained was continuously charged into a falling - film type high vacuum distillation apparatus of heating process with hot medium , having vaporization area of 2 m 2 , and the first distillation was carried out under the conditions : the temperature of the charged oil 120 °- 125 ° c ., degree of vacuum 15 - 20 mmtorr , film temperature 240 °- 250 ° c ., and charging rate 125 kg / hr / m 2 , thereby 93 . 3 parts by weight of remnant oil was obtained . the remnant oil was continuously charged into a centrifugal molecular distillation apparatus of heating process , having vaporization area of 1 m 2 , and the second distillation was carried out under the conditions : the temperature of the charged oil 200 °- 210 ° c ., degree of vacuum 9 - 11 mmtorr , and charging rate 50 kg / hr / m 2 , thereby 50 . 1 parts by weight of remnant oil was obtained . further , the remnant oil thus obtained was continuously charged into a centrifugal molecular distillation apparatus of heating process with hot medium , having vaporization area of 1 m 2 , and the third distillation was performed under the conditions : the charging oil temperature 230 °- 235 ° c ., degree of vacuum 8 - 9 mmtorr , film temperature 260 °- 265 ° c ., charging rate 35 kg / hr / m 2 , and the vaporized substances as refined oil were coagulated , thereby 31 . 4 parts by weight of refined fish oil was obtained . the properties of the thus obtained refined fish oil were as given in table 2 . table 2______________________________________ ( properties of refined fish oil ) ______________________________________acid value 0 . 10content of cholesterol 0 . 06 % content of triglyceride 96 . 98 % content of monoglyceride 0 . 54 % content of diglyceride 0 . 62 % content of fatty acids 0 . 50 % percentage of epa in 18 . 7 % fatty acidspercentage of dha in 15 . 9 % fatty acidscontent of amines not detectablecontent of ketones not detectable______________________________________ the refined fish oil obtained according to the above example was used as the test sample and a refined fish oil obtained separately by deacidification , decoloration and deodorization by use of a crude sardine oil according to a conventional method was used as the comparative sample . to the respective samples , 0 . 1 % alpha - tocopherol was added as the antioxidant , and subsequently each 98 g of these samples was filled in a bottle of the capacity 100 ml and subjected to nigrogen gas - sealing , then stored at normal temperature ( 20 ° c . ), and thus the fishy odor - emitting state was observed . the results were as given in the following table 3 . table 3______________________________________ ( fishy odor - emitting state ) right after after after after production a month 2 months 3 months______________________________________test sample completely completely completely slight odor odorless odorless odorless emissioncomparative slight odor emission emission emission ofsample emission of badly of badly badly fishy fishy odor fishy odor odor______________________________________ the refined fish oil obtained in example 2 was used as the test sample and a refined fish oil obtained separately by deacidification , decoloration and deodorization by use of a crude sardine oil according to a conventional method was used as the comparative sample . to the respective samples , 0 . 1 % by weight of alphatocopherol was added , and subsequently each 98 g of these samples was filled in a bottle of the capacity 100 ml , subjected to sealing , stored at normal temperature ( 20 ° c . ), and thus the fishy odor - emitting state was observed . the results were as given in table 4 . table 4______________________________________ ( fishy odor - emitting state ) right after after after after production a month 3 months 6 months______________________________________test sample completely completely completely slight odor odorless odorless odorless emissioncomparative slight emission emission emission ofsample odor of badly of badly badly emission fishy odor fishy odor fishy odor______________________________________ | 2 |
fig1 illustrates a membrane 10 having an electrically conductive circuit pattern 12 deposited on one side thereof . circuit pattern 12 may be printed on the membrane 10 , which is preferably made of a flexible , non - conductive material such as a thin polyester film , by well - known silk screening techniques . membrane 10 is divided by fold line a -- a into a first or lower section 14 having switch circuit contact points 12 - 1 formed thereon and an upper or second section 16 having switch circuit contactor elements 12 - 2 formed thereon . contact points 12 - 1 and contactor points 12 - 2 are positioned on membrane 10 in such a manner so that they will register with each other when the membrane is folded upon itself along fold line a -- a in assembly . in order to couple the circuit pattern 12 to the circuitry of the electrical equipment with which the keyboard is utilized , the circuit pattern terminates in a tail portion 18 which provides terminals for coupling to such equipment . also provided on membrane 10 are cut - out portions 20 along fold line a -- a which facilitate the folding of the membrane upon itself during the assembly operation . furthermore , cut - out portions 22 surround and separate contactor elements 12 - 2 into two flaps 12 - 2a and 12 - 2b for the operational and assembly purposes described below . turning now to fig2 an intermediate spacer sheet 30 is illustrated which has cut - out portion 32 formed therein . spacer sheet 30 is preferably made of a flexible non - conductive electrical insulating material , such as a thin polyester film , and has an adhesive coating on both of its sides in order to facilitate the switch assembly operation . cut - out portions 32 are positioned on spacer sheet 30 in order to register with contact points 12 - 1 and contactor elements 12 - 2 during the switch assembly . in addition , cut - out portions 32 may be formed slightly smaller than the resilient dome 50 shown in fig4 in order to facilitate the assembly operation and the insulation of the dome from the circuit pattern 12 printed on lower membrane section 14 . fig3 shows a second , upper spacer sheet 40 having cut - out portions 42 formed therein . this upper spacer sheet is similar in construction and material to intermediate spacer sheet 30 . however , in the preferred embodiment , cut - out portions 42 may be formed slightly larger than the resilient dome 50 shown in fig4 in order to facilitate the proper operation of the switch . fig4 illustrates a resilient dome 50 which completes the switch actuation of the device and provides a tactile feel to the operation when the switch is actuated . dome 50 , which may be geometrically shaped in any curved resilient shape which provides a snap - type action when depressed , has an upper generally convex - shaped surface 52 which is electrically conductive and a lower generally concave surface 54 which is also electrically conductive and which is in electrical communication with upper surface 52 . it had been found that dome 50 is preferably constructed of a thin spring temper stainless steel having its surfaces silver plated over a copper flash , although any resilient material having electrically conductive surfaces will satisfactorily operate in conjunction with the present invention . in addition , the particular shape of the dome is not critical as long as no portion thereof comes into contact with switch circuit contact points 12 - 1 when the dome is not depressed by the switch operator . as noted above , this may be accomplished by forming the cut - out portions 32 of intermediate spacer sheet 30 slightly smaller than the periphery of dome 50 so that its edges are insulated by the spacer sheet from the printed circuit on the lower membrane section 14 . another means for accomplishing this is to form the diagonal edges 56 of dome 50 in the shape of an arch so that they will not come into contact with the angled printed circuit portions leading to contact points 12 - 1 as is illustrated in fig1 . another manner of insulating the periphery of dome 50 from the printed circuit 12 on lower membrane section 14 is to form the corners 23 of cut - out portions 22 of upper membrane section 16 with protrusions ( not shown ) which extend toward the center of the cut - out area . after the membrane is folded upon itself , the dome 50 is then supported by these protrusions in a spaced - apart relationship from the printed circuit 12 on lower membrane section 14 . these methods of preventing the periphery of the resilient dome 50 from coming into electrical contact with the printed circuit portion formed on lower membrane section 14 will become clearer when the switch assembly procedure and operation of the membrane switch is more fully discussed below . fig5 illustrates a decorative graphic sheet 60 which is positioned on the top of the membrane switch in assembly . as with intermediate spacer sheet 30 and upper spacer sheet 40 , this graphic sheet is preferably made of a flexible non - conductive electrical insulating material , such as a thin polycarbonate film . graphic sheet 60 may have numerals 62 printed thereon which serve to locate the various keyboard switches located therebeneath after assembly of the membrane switch . turning now to fig6 and fig7 the assembly of a preferred embodiment of a membrane switch constructed in accordance with the present invention is illustrated . according to this assembly procedure , intermediate spacer sheet 30 having an adhesive coating on each of its surfaces is mounted on lower section 14 of membrane 10 with its cut - out portions 32 in registry with contact points 12 - 1 . upper section 16 of membrane 10 is then folded along fold line a -- a over the top of lower section 14 and is held in position with its contactor elements 12 - 2 in registry with contact points 12 - 1 by the adhesive on the upper surface of spacer sheet 30 . at this point in the assembly operation , contactor flaps 12 - 2a and 12 - 2b are lifted as is illustrated in fig7 and resilient dome 50 is positioned within the cut - out portion 22 of upper membrane section 16 . contactor flaps 12 - 2a and 12 - 2b are then folded back down on top of dome 50 where the contactor elements 12 - 2 will be brought into electrical contact with its upper convex surface 52 . upper spacer sheet 40 , which also may have an adhesive coating on each of its surfaces in order to secure it to upper membrane section 16 , is positioned on upper membrane section 16 with its cut - out portions in registry with the contact - dome - contactor switch assembly . decorative graphic sheet 60 ( not shown in fig7 ) is then positioned on upper spacer sheet 40 with its numerals 62 or the like located in registry with the appropriate individual switch assemblies . decorative graphic sheet 60 is preferably held in place by the adhesive coating on the upper surface of upper spacer sheet 40 . in this manner , a thin flexible membrane switch is formed having a sandwich - type construction . in addition , the contact - dome - contactor switch elements will be completely sealed from the ambient atmosphere by the lower section 14 of the membrane 10 and the decorative graphic sheet 60 . the operation of the switch assembly is best illustrated by reference to fig6 . after assembly , dome 50 is located above contact point 12 - 1 which is formed on membrane lower section 14 . contactor flaps 12 - 2a and 12 - 2b are located on the upper convex surface 52 of the dome and are held in electrical contact therewith by graphic sheet 60 . upon actuation of the switch , dome 50 will snap downward until its lower concave surface 54 comes into electrical contact with contact point 12 - 1 as is illustrated by phantom line p . since the upper surface 52 of the dome is in electrical communication with its lower surface 54 , the switch circuit will be completed between contact point 12 - 1 and contactor elements 12 - 2 when the dome 50 is depressed into this position . since it is possible for the dome to make electrical contact with contact point 12 - 1 only when it snaps into the position shown by phantom line p , a positive tactile feel is transmitted to the operator when the switching operation is completed by the snap action of the dome . it is to be noted that while a particular embodiment of the present invention has been shown and described in detail , it should be understood that various changes and modifications thereto may be made by those skilled in the art , and it is therefore intended in the following claims to include all such obvious modifications and changes as may fall within the spirit and scope of the present invention . | 8 |
illustrative embodiments of the invention are described below . in the interest of clarity , not all features of an actual implementation are described in this specification . it will of course be appreciated that in the development of any such actual embodiment , numerous implementation - specific decisions must be made to achieve the developers &# 39 ; specific goals , such as compliance with system - related and business - related constraints , which will vary from one implementation to another . moreover , it will be appreciated that such a development effort , even if complex and time - consuming , would be a routine undertaking for those of ordinary skill in the art having the benefit of this disclosure . fig1 illustrates one particular embodiment of an ladar transmitter 100 for use in a multi - beam ladar system built and operated in accordance with the present invention . the ladar transmitter 100 comprises an off - gimbal subassembly 103 , an on - gimbal assembly 106 , and a multi - channel fiber relay 109 between them . the off - gimbal subassembly 103 includes a laser 112 , capable of producing a laser signal 115 , and a plurality of small beam collimators 118 . in the illustrated embodiment , the small beam collimators 118 are arrayed as is shown best in fig2 a , which is a view in the direction of the arrow 119 . the on - gimbal subassembly 106 includes a large beam collimator 121 and a ladar sensor 124 mounted on a gimbal 127 . the multi - channel fiber relay 109 is comprised of , in the illustrated embodiment , the small beam collimators 118 , the large beam collimator 121 , and a plurality of optical fibers 124 , each optical fiber 124 defining a channel . the number of optical fibers 124 in the multi - channel fiber relay 109 is not material to the practice of the invention . the small beam collimators 118 and the large beam collimator 121 are , in the illustrated embodiment , silicon dioxide ( sio 2 ) laser fused collimators . suitable small beam collimators and large beam collimators are commercially available off the shelf and are photonics market commodities . the small beam collimators 118 provide a uniform energy distribution from the laser signal 115 across the optical fibers of the multi - channel fiber relay 109 . as is best shown in fig2 a , the small beam collimators 118 area arrayed in a hex - close pack with a ˜ 75 % fill factor . the multi - channel fiber relay 109 relays the laser signal 115 through the multiple discreet channels defined by the optical fibers to the large beam collimator 121 . the multi - channel fiber relay 109 terminates in the single , large beam collimator 121 with , in the illustrated embodiment , a telecentric input to the large beam collimator 121 . the output 133 of the large beam collimator 121 is a plurality of laser signals , e . g ., beamlets , that comprise a split beam laser signal . the total relay insertion loss of the illustrated embodiment is & lt ; 1 . 5 db . the laser 112 may be implemented using any suitable laser known to the art . suitable lasers 112 may include , for instance , a side - pumped laser , a diode - pump solid state q - switched laser , and a side - pumped diode - pump solid state laser cavity . note that , because it removes the laser 112 from the gimbal 127 , the present invention affords an extra degree of flexibility in implementing the laser 112 relative to the state of the art . thus , some types and / or models of lasers ordinarily unsuitable for conventional ladar systems may be suitable for use with the present invention . exemplary of such lasers are pulsed fiber lasers and fiber coupled solid state lasers with passive or external q - switch , and / or fiber optic amplifiers . for instance , the current expensive end - pumped cavity laser used in conventainal ladar systems may be replaced with a more cost effective side - pumped laser , where the crystal / gain medium may be pumped directly with laser diodes . fiber lasers and / or fiber optic amplifiers also become a practical and cost effective replacement , wherein the fiber is pumped and itself is the gain medium and cavity ). side - pumped laser outputs may also be “ fiber coupled ”. that is , the laser &# 39 ; s output may be launched into the input of a fiber optic cable via a large beam fused collimators and terminated with another fused collimator on the output ( as a means of delivering the laser energy from off gimbal to on - gimbal as suggested in the multi - channel fiber relay concept ). fiber lasers would only need to be terminated on the output with a fused collimator since the laser energy originates in the fiber optic waveguide . however , “ fiber coupled ” side pumped lasers and fiber lasers still represent a single fiber channel with limitations in the power handling capability , non - linear effects , and spectral broadening of a single fiber — risks mitigated by a multi - channel fiber relay concept . naturally , there will be variations on the current multi - channel fiber relay concept that may be designed to accommodate a variety of fiber or fiber coupled lasers with greater power tolerance than a single channel fiber — all while consolidating the segmentation and beam conditioning required for multi - beam ladar as prescribed in the multi - channel baseline herein . the ladar sensor 124 comprises a plurality of mission specific optics . these mission specific optics may include one or more of a folding mirror , a prism , a scanner , an optical switch , and a beam expansion optical component , none of which are shown . the type of considerations that will influence the selection of mission specific optics include the design constraints like near - field beam separation , beam divergence , and far - field beam separation . for instance , some embodiments may add scanners and gimbals for accomplishing specific field of view and field of regard requirements . to further an understanding of the present invention , one particular embodiment of the ladar transmitter 100 of fig1 will now be presented . turning to fig3 , a ladar transmitter 300 is shown . the ladar transmitter 300 has many parts in common with the ladar transmitter 100 , with like parts bearing like numbers . in the off - gimbal subassembly 103 ′, the laser 112 ′ comprises a side - pumped , 1064 nm cavity laser 303 pumped by one or more , preferably at least two , pump diodes 306 . the laser signal 115 ′ produced by the laser 112 ′ has a 0 . 9 mm beam spread . the off - gimbal subassembly 103 ′ also includes an optional diffractive optical element (“ doe ”) 309 or other beam conditioning optics between the laser 112 ′ and the small beam collimators 118 ′. other optics that might be employed include , for instance , an optical attenuator that might be employed for gain control purposes . fig4 a conceptually illustrates how the small beam collimators 118 ′ focus portions of the laser signal 115 ′ onto the individual optical fibers 124 ′ of the multi - channel fiber relay 109 ′. the optical fibers 124 ′ of the multi - channel fiber relay 109 ′ comprises seven single mode optical fibers 124 ′, one for each of the small beam collimators 118 ′. each single mode optical fiber 124 ′ has a numerical aperture (“ na ”) of 0 . 14 . the optical fibers 124 ′ are fused to the small beam collimators 118 ′ and the large beam collimator 121 ′ using well known fabrication techniques . more particularly , with respect to the large beam collimator 121 ′, the single mode optical fibers 124 ′ are fused to a sio 2 seed 400 , shown in fig4 b , of the large beam collimator 121 ′. suitable optical fibers 124 ′, like the small beam collimators 118 ′ and the large beam collimator 121 ′, are commercially available off the shelf . in the illustrated embodiment , the small beam collimators 118 ′ and the large beam collimator 121 ′ are fabricated to create male connector elements , or plugs . each of the off - gimbal subassembly 103 ′ and the on - gimbal subassembly 106 ′ include female connector elements , or sockets , ( not shown ) into which the small beam collimator 118 ′ and the large beam collimator 121 ′ are plugged . in the illustrated embodiment , the connector of the large beam collimator 121 ′ is keyed . the multi - channel optical fiber relay 109 ′ in this particular embodiment therefore includes a simple keyed connector interface that provides a degree of modularity not only to the multi - channel optical fiber relay 109 ′, but also the off - gimbal subassembly 103 ′ and the on - gimbal subassembly 106 ′. in addition to the large beam collimator 121 ′, the on - gimbal subassembly 106 ′ also includes a total internal reflectance (“ tir ”) prism 312 in addition to the ladar sensor 124 ′. the laser signal 133 ′ exiting the large beam collimator 121 ′ comprises seven beamlets , as was discussed above . the beamlets exit the large beam collimator 121 ′ to the prism 312 , which spreads them to a total beam spread of 3 . 7 mm . the operation of the prism 312 is conceptually illustrated in fig4 c . the on - gimbal subassembly 106 ′, like the off - gimbal subassembly 103 ′, may also include other beam conditioning optics . the ladar sensor 124 ′ will typically include such beam conditioning optics to manipulate the laser signal 133 ′ suitable for the particular application . in one particular application , the ladar sensor 124 ′ includes a holed mirror 500 , shown in fig5 , through which the ladar sensor 133 ′ transmits the laser signal 133 ′ with a near - field beam spatial overlap 503 that results in a far - field beam separation 600 , shown in fig6 , for use in a ladar system used in remote sensing applications such as reconnaissance . thus , returning to fig3 , the ladar system 300 includes an off - gimbal laser 112 ′ output ( i . e ., the laser signal 115 ′) coupled to a fiber bundle 315 ( i . e ., the optical fibers 124 ′) via a fused collimator ( i . e ., the small beam collimators 121 ′). the fiber bundle 315 relays the laser signal 115 ′ to the gimbal 127 ′ in discreet channels . the fiber bundle 315 terminates in a linear array fused to the large beam collimator 118 ′. the large beam collimator 118 ′ is selected for the required output beam size and divergence . fiber spacing and lens focal length are selected for the desired angular spacing . the fused , large beam collimator 121 ′ is attached via a keyed connector aligned to the holed mirror . segmented beamlets 603 , shown in fig6 ( only one indicated ), are transmitted through the holed mirror 500 as spatially overlapping but angularly separated beams as in conventional architectures . thus , in its various aspects and embodiments , the invention provides one or more of the following : a common seeker interface for the ladar sensor . channel equalization and elimination of loss due to diffraction efficiency of binary diffraction gratings ( segmenters ) in conventional multi - beam ladar systems . an off - gimbal laser delivery solution that reduces cost and complexity to the transmit optical path while increasing output power per channel and improving reliability over current systems . a fiber coupled relay facilitates the use of end - pumped laser cavities or diode arrays off - gimbal as lower cost alternatives . also , laser generated heat becomes easier to manage , and space becomes available on - gimbal for multi - mode seeker concepts . improved system signal - to - noise ratio . multi - channel fiber relays require fewer components and provide more efficient delivery . the invention increases laser power per channel without risking optical damage to the fiber or inducing other non - linear optical effects . the net result is a lower loss transmit path with higher power handling capability for much greater power per channel in a multi - beam ladar . reduced system size and cost . complex on - gimbal laser and transmit path optics alignment may be replaced with a single line replaceable unit (“ lru ”) with simple keyed connector attachments . enhanced reliability . the simplified approach has smaller part count , shorter optical path , and fewer critical surfaces . the resulting assembly is less susceptible to contamination and therefore has fewer opportunities for defects in environments . a reusable modularity / sensor . a relay provides interface and reformatting necessary to integrate a common ladar sensor on multiple platforms , multi - mode seekers , and laser solutions . upward compatibility : a multi - channel fiber relay concept also facilitates adding cots fiber optics , signal conditioning , and multiplexing products into future ladar architectures . as implied above , not every embodiment or aspect of the invention will necessarily manifest all these advantages . also , further advantages may become apparent to those skilled in the art having the benefit of this disclosure . this concludes the detailed description . the particular embodiments disclosed above are illustrative only , as the invention may be modified and practiced in different but equivalent manners apparent to those skilled in the art having the benefit of the teachings herein . furthermore , no limitations are intended to the details of construction or design herein shown , other than as described in the claims below . it is therefore evident that the particular embodiments disclosed above may be altered or modified and all such variations are considered within the scope and spirit of the invention . accordingly , the protection sought herein is as set forth in the claims below . | 6 |
fig1 illustrates a network 20 that incorporates circuit parameters effective to complete a minimum phase shift equalizer network affording virtually any desired frequency response characteristic with minimum ripple over a broad frequency range , typically the audio range . network 20 has an audio input terminal 21 and an audio output terminal 22 . input terminal 21 is connected to a series chain 23 of n all pass delay stages ; all stages in chain 23 incorporate the same circuit parameters . the first stage 1 in chain 23 includes an operational amplifier 24 having its non - inverting input connected to the audio input terminal 21 by a circuit including a series resistance r and a shunt capacitance c . the inverting input of operational amplifier 24 is connected to the audio input terminal 21 by a series resistance ra ; the output of the operational amplifier is connected back to its inverting input through a corresponding resistance ra . the output of amplifier 24 in stage 1 constitutes the input for stage 2 . the output of the amplifier 24 in stage 2 provides the input to stage 3 , and so on down the chain to stage n . the number of stages n in the series chain 23 may vary substantially , depending upon overall system requirements . an initial output tap t0 is connected to input terminal 21 , the input for the first stage in the all pass delay chain 23 . network 20 further includes n additional output taps t1 , t2 , t3 , . . . , tn each connected to the output of the operational amplifier 24 of a succeeding stage in the chain . thus , tap t1 is connected to the output of the amplifier 24 in stage 1 , tap t2 is at the output of the amplifier in stage 2 , and so on . an initial scaling circuit is connected to the initial output tap t0 of the series chain 23 of all pass delay stages . in network 20 , the initial scaling circuit comprises a resistor r0 that connects tap t0 to a non - inverting bus 25 . network 20 further includes n additional scaling circuits , each comprising a resistor ( r1 . . . rn ) connecting one of the taps t1 through tn to the non - inverting bus 25 or to an inverting bus 26 . the basis for selection of the bus connections for the scaling circuit resistors r1 through rn is described hereinafter . network 20 , fig1 further includes a summing circuit 30 for additively combining the outputs of all of the scaling circuits comprising resistors r0 through rn to develop an output signal having a predetermined frequency response characteristic . summing circuit 30 includes an operational amplifier 27 having its inverting input connected to the non - inverting bus 25 . the non - inverting input to amplifier 27 is connected to system ground ; a negative feedback resistor rb connects the output of amplifier 27 back to its inverting input . another operational amplifier 28 is connected in a similar circuit arrangement except that its inverting input is connected to inverting bus 26 . the outputs of amplifiers 27 and 28 are individually connected , through two series resistors rd , to the inverting and non - inverting inputs , respectively , of another operational amplifier 29 utilized as a summing amplifier . the non - inverting input to amplifier 29 is returned to system ground through another resistor rd . the output of amplifier 29 , which is connected to the audio output terminal 22 of network 20 , is connected through a feedback resistor rd to the inverting input of the amplifier . the network 20 , illustrated in fig1 may be made to produce different frequency response characteristics by varying the magnitude of the scaling resistances r0 through rn and by changing the connections of the individual scaling resistors to buses 25 and 26 . each all pass stage in chain 23 has the property of passing all frequencies over a wide range with unity gain ; hence the derivation of the term &# 34 ; all pass &# 34 ;. however , each delay stage in chain 23 produces a phase shift θ in any signal of any frequency ƒ , within the operational range , where thus , the response of each stage 1 through n in chain 23 is simply a phase shift factor e - i θ . the accumulated phase shift , from the first output tap t0 to the final output tap tn in chain 23 , is nθ and the phase shift factor is e - in θ . the output of each of the all pass delay stages 1 through n contributes to the final output of network 20 through the scaling of weighting circuits for each stage , provided by the resistances r0 through rn . in the bus summing amplifier circuit 30 , amplifiers 27 and 28 convert the total current from buses 25 and 26 , respectively to voltages . those voltages are then additively combined ( subtracted ) in the output stage 29 of the summing circuit 30 . the overall frequency response h ( θ ) of network 20 , fig1 is ## equ4 ## in which a n represents the scaling coefficient for any stage n in chain 23 , determined by where r n is the scaling resistance for stage n . the polarity of the scaling coefficient a n for any tap in chain 23 determines whether the scaling circuit resistance ( r0 through rn ) for that tap is connected to the non - invert bus 25 or to the inverting bus 26 . curve 31 in fig2 illustrates a band pass filter response , based on an idealized characteristic 32 , that may be obtained with the network 20 , fig1 when the circuit parameters for the individual stages of chain 23 are r = 10 kilohms , c = 0 . 015 microfarads , and n = 16 , using scaling coefficients calculated in accordance with the following relationships : ## equ5 ## in which θ m + 1 and θ m are upper and lower frequency limits according to relationship ( 1 ) above . the curves in fig2 have been normalized to give a response of 0 db at 1000 hz . for characteristics 31 and 32 , fig2 the center frequency is 1000 hz . the formulas ( 3 ) assume an ideal band pass 32 expanded in a fourier series . if the series were continued to n = α , then the idealized response of curve 32 would be obtained . however , by truncating the fourier series at a finite value ( e . g ., n = 16 ), the result is a frequency response curve as indicated by dash line 34 . curve 34 illustrates the &# 34 ; gibbs phenomenon &# 34 ; at the edges of the pass band . the overshoot and undershoot of curve 34 can be reduced by gradually reducing the scaling coefficients for the individual stages of network 20 toward zero as n increases . this is the significance of the expression w ( n ) in equation ( 2 ). a preferred formula for the weighting function w ( n ) is ## equ6 ## this is the hamming weighting function , and results in conversion of the distorted characteristic of curve 34 to the frequency response characteristic of curve 31 ( fig2 ). to complete this description of utilization of network 20 , fig1 as a band pass filter , it may be noted that the phase shifts θ m + 1 and θ m based upon the upper and lower frequencies of the pass band represented by the ideal curve 32 in fig2 are given by relationship ( 1 ) as fig3 illustrates an equalizer network 120 constructed in accordance with another embodiment of the invention . equalizer 120 is similar in many respects to network 20 ( fig1 ) when employed as an equalizer network ; however , the scaling circuits and summing circuit have been substantially modified . equalizer network 120 has an input terminal 121 and an output terminal 122 . input terminal 121 is connected to the first stage of a chain 23 of n all pass delay stages , again shown as all pass operational amplifier stages each including an operational amplifier 24 . as before , each stage has a series resistance r and shunt capacitance c providing an input to the non - inverting input of the operational amplifier , with a series resistance ra as the inverting input to the amplifier and a negative feedback circuit of resistance ra . also as before , chain 23 is provided with an initial output tap t0 connected to input terminal 121 and a series of n additional output taps t1 through tn each connected to the output of one of the amplifier stages . in equalizer network 120 , the initial scaling circuit connected to tap t0 is a multiplying digital to analogue converter ( mdac ) 140 . the signal input to mdac 140 is the voltage from tap t0 of chain 23 . a current output from mdac 140 is supplied to the inverting input of an operational amplifier 130 which serves as a summing circuit for network 120 . the scaling circuits connected to the remaining taps t1 through tn in equalizer network 120 each incorporate a multiplying digital to analogue converter . thus , mdac 141 receives an input from tap t1 in chain 23 and has a signal output connected to the bus 131 that is used as an input to amplifier 130 . the mdacs 140 through 14n are each connected to one of the taps t2 through tn . network 120 further includes a data bus 132 connected to a series chain of n + 1 mdacs . data bus 132 is connected to the digital data shift register input ( di ) of mdac 140 . the digital output ( do ) of mdac 140 is connected to the di of mdac 141 , and so on down to mdac 14n . a clock bus 133 and a write bus 134 are connected to the stb and ld inputs , respectively , of each of the mdac circuits . in network 120 , each mdac functions as a settable resistance , the magnitude of that resistance for each mdac being determined by a digital word supplied to the mdac from data bus 132 via a sequence of serial digital words , each identifying the magnitude of resistance and the polarity of output required for a given mdac . bus 133 supplies strobe command signal ( stb ) to each mdac allowing the data on bus 132 to be moved sequentially one bit at a time , down the chain of mdacs 140 through 14n . when all mdacs have the necessary data , bus 134 supplies a load command signal ( ld ) to enable each mdac to record the digital data provided to their shift registers by bus 132 . each mdac retains its setting data in an internal register until such time as a change may be effected by a change of the signals on the data bus , strobed to the correct mdac position , and enabled with the load command signal . a suitable mdac circuit of this kind is manufactured by precision monolithics , inc ., model dac - 8143 . in the operation of equalizer network 120 , each scaling circuit mdac receives a signal input constituting the voltage from the tap ( t0 . . . tn ) of the all pass amplifier chain 23 to which the mdac is connected . the signal output from each mdac , on bus 131 , is a current containing all of the frequency components of the input signal and having an amplitude determined by the data set into the mdac through the digital control signals supplied from data bus 132 , coordinated by information from bus 133 and recorded by a signal on bus 134 . for some of the mdacs , the output is inverted ; the output polarity is also determined by the digital control signal supplied from data bus 132 . all of the output signals from the scaling circuits comprising the mdacs 140 through 14n are additively combined in the summing amplifier circuit 130 , producing an equalized output signal at terminal 122 that has a frequency response characteristic determined by the digital data control signals from bus 132 . thus , network 120 , when provided with the requisite information from data bus 132 , functions to afford a minimum phase shift equalizer network with minimum ripple , no ringing from individual stages , stable operation , and smooth truncation . unlike network 20 of fig1 when employed as an equalizer , network 120 ( fig3 ) can be adjusted to conform to varying system requirements . of course , to utilize the frequency response adjustment characteristics of network 120 , it is necessary to provide a source of appropriate control signals on data bus 132 ; a digital computer 150 and the appropriate software are effective for this purpose . in the equalizer illustrated in fig3 the computer 150 sends a series of data bits to the mdacs 140 through 14n . the computer 150 is a commercially available ibm pc / at or equivalent physically removed from the equalizer network 120 and connected via a parallel connection from the equalizer to a commercially available add - in product , a parallel digital input / output board such as a kiethley / metrabyte pio - 96 . an alternative embodiment would use existing technology to communicate between the computing device 150 and the network 120 via an industry standard such as rs - 232 utilizing available hardware and using sequencing and protocol software such as is currently prior art . another embodiment physically locates the computing device 150 within the package of the equalizer network 120 , allowing coefficient calculations to be performed either locally , or calculated remotely in a separate computer and transmitted by aforementioned and currently available technology to the captive computing device for distribution to the specific mdacs in order to set the tap weighting coefficients . an alternative embodiment groups the mdacs into several serial strings so that data may be passed serially down each string simultaneously to improve speed or performance . another embodiment uses mdacs in which the digital control words are loaded via a parallel data bus , each mdac being separately addressed so as to accept its own specific control word . in the embodiment illustrated in fig3 the software controlling the computer 150 uses currently and commercially available language compilers such as microsoft c for development of the programs incorporating the algorithms to calculate the tap coefficients to be set into the mdacs , arrange the data bits so that the mdacs will receive their specific data correctly , and send that data to the network mdacs 140 through 14n . additional software uses the same mathematical basis to calculate the predicted behavior of the equalizer network to provide this information to the user of the equalizer . wherein the relationship between θ and frequency ƒ is given in ( 1 ), it follows that : furthermore , if ln | d ( θ )| is defined as a series : ## equ7 ## then , by inverse fourier transform it follows that : ## equ8 ## equation ( 8 ) shows that , given the desired response d ( θ ), the coefficients b n can be calculated by methods of fourier analysis . in equation ( 8 ) since ln | d ( θ )| must be an even function , it follows that : ## equ9 ## if ln | d ( θ )| is defined by a group of attenuation values h m , with each setting valid over the frequency band ranges for an equalizer network like network 120 of fig3 and each h m is valid from θ m to θ m + 1 , then the following relationships result : ## equ10 ## from properties of the hilbert and fourier transforms shown in oppenheim and schafer , digital signal processing , pp . 337 - 345 , it can be shown that : ## equ11 ## and therefore ## equ12 ## the unwindowed response of the equalizer is given by : ## equ13 ## comparing the actual unwindowed response of the equalizer network , of equation ( 13 ), to the desired response , of equation ( 12 ), using the exponential series expansion and properties of the complex cepstrum associated with minimum phase systems shown in oppenheim and schafer , digital signal processing , pp . 494 - 506 , it can be shown from equations ( 2 ) and ( 13 ) that : ## equ14 ## since it is impossible to build an infinitely long all pass chain , the series given in equation ( 13 ) above is truncated at n taps by the multiplication of the unwindowed equalizer response from equation ( 13 ) by a windowing function w ( n ), as given by equation ( 4 ), from which results the actual response of the equalizer given by equation ( 2 ). the number of stages required in all pass chain 23 , for either of the previously described embodiments of the invention , may be determined approximately in accordance with the relationship : ## equ15 ## in which : f o = 1 / 2πrc for ƒ l = 200 hz and ƒ h = 5 khz , n = 16 stages . for equalizer networks , such as network 20 of fig1 and network 120 of fig3 it is preferred that in summary , the transversal filter of the present invention results from an initial analysis based on a series of rectangular prototype ( real and even ) filters , as discussed above in connection with fig2 enabling calculation of a basic set of scaling resistors and polarities for an equalizer like fig1 or the digital coefficients for an adjustable equalizer as in fig3 . these scaling values are further weighted by a smooth truncating function , such as , but not limited to , the hamming function , to avoid filter overshoot known as the &# 34 ; gibbs phenomenon &# 34 ;. a complete set of contiguous frequency control bands can thus be devised to cover a broad frequency range , such as the entire audio range . the equalizer networks , illustrated in fig1 and 3 , produce minimum phase shift response . the combination of frequency bands produce a ripple free frequency response characteristic ; that is , in the regions where adjacent frequency bands overlap no individual frequency band stands out as a bump or dip in the overall equalizer frequency response . the transient response of the equalizer shows complete cancelling of ringing of individual frequency bands such that the equalizer network is free of excessive ringing over all . furthermore , the filter is stable because only first order non - resonant circuits are employed . for systems having fixed frequency response characteristics it is possible to use equalizer network 20 ( fig1 ) as the basis for producing greatly simplified low cost equalizers having response characteristics precisely tailored to virtually any requirements . those equalizers , despite their simplicity of construction , as is evident from fig1 afford stable , minimum phase shift frequency response characteristics having minimum ripple with no ringing from individual stages and with smooth truncation effectively eliminating &# 34 ; gibbs phenomenon &# 34 ; errors . for persons skilled in the art of digital filters and synthesis of filters by orthonormal functions , it will be apparent that the all pass amplifier chain 23 used in the embodiments of the invention can be replaced with a chain of pure time delay elements or with circuits described by the exponential , laguerre polynomial , and legendre polynomial functions , as well as the fourier series employed herein . the fourier series technique is preferred for its simple realization , using first order all pass amplifier stages as shown . time delay elements provided by charge coupled devices or digital delay systems currently lack the highly advantageous attributes of simplicity , performance , and cost achieved with the all pass stages as shown in the drawings . the circuit elements required for the exponential and legendre functions are not uniform from stage to stage and impose considerable additional circuit complexities . the laguerre functions , on the other hand , can be shown to be a simple generalization of the fourier method described herein and afford no particular advantages . | 7 |
in the diagrams , like numbers refer to like objects throughout . objects in the diagrams are not necessarily drawn to scale . fig1 shows a very simplified representation of the components of a wind turbine 10 used in the generation of electricity . in a nacelle 40 mounted on a tower 42 , a rotor 13 or main shaft 13 is caused to rotate by pressure applied to a plurality of blades 17 connected to a spinner 21 . the rotating main shaft 13 is connected to a gearbox 20 by means of a shrink disc 14 and a torque arm 21 . the gearbox in turn is coupled to a generator 30 . the components mentioned above must all be secured in some way to a nacelle bedplate 43 , 44 . the main shaft 13 is typically borne by a main bearing 51 such as a fluid bearing or a roller bearing which rests on the bedplate floor 43 . the gearbox 21 , which is essentially mounted on the end on the main shaft , does not rest on the floor of the bedplate 43 , but is supported laterally , usually on a raised frame of the bedplate 43 , by additional bearings or dampers 52 , 1 . to this end , a robust bolt 22 extends through the torque arm 21 ( one bolt 22 on each side of the torque arm 21 ) and is mounted securely in the housing of the damper 52 , 1 . in a prior art wind turbine , such dampers 52 can be elastomeric sockets 52 , conventional hydraulic dampers 52 , etc . this embodiment shows a three - point bearing given by the main bearing 51 and two pairs of dampers 52 , 1 , one pair on each side of the gearbox 20 , as shown in the front view of fig2 . this diagram shows the gearbox 20 and torque arm 21 supported by a pair of bolts 22 held in dampers 52 , 1 that rest on raised sides 44 of the bedplate 43 . the gearbox 20 is effectively suspended over the bedplate 43 . in the three - point bearing , the pair of dampers 52 , 1 arranged fore and aft of each bolt 22 serves to absorb the yaw moment to a certain extent , in addition to absorbing the nodding moment . in the present invention , these dampers comprise smart fluid dampers 1 , as will be explained below . fig3 shows a schematic representation of a smart fluid damper 1 for a gearbox 20 of a wind turbine , in a three - point bearing arrangement , for example for use in a wind turbine in the 2 megawatt range . the diagram shows the main shaft 13 connected to the gearbox 20 by means of the shrink disc 14 and the torque arm 21 . a lateral bolt 22 extending through the front and back faces of the torque arm 21 is connected at each end to the raised bedplate side 44 by means of two mr - dampers 1 ( the gearbox 20 and torque arm 21 are suspended in air above the bedplate floor as shown in fig2 above ). each damper 1 comprises a piston 2 enclosed in a chamber 7 of a closed housing 6 . during operation , vertical motion of the gearbox 20 causes the piston 2 to move vertically in the chamber 7 . channels in the piston 2 allow this to move vertically through an mr - fluid 3 containing very many magnetic dipoles , which are indicated — greatly exaggerated — by the dots in the fluid 3 . although fasteners are not shown in the diagram , it may be assumed that the housing 6 is firmly bolted or otherwise secured to the raised bedplate frame 44 . fig4 shows a more detailed view of an mr - damper 1 in an active damping arrangement 11 according to the invention . the piston 2 is free to move in the direction of travel t on account of a plurality of vertical channels 4 arranged symmetrically about the body of the piston 2 . a bellows 5 forms a flexible seal between the stationary and moving parts of the damper 1 . the speed of motion of the piston 2 is controlled by the viscosity of the smart fluid 3 . this in turn is controlled by the current through an electromagnetic coil 8 . the current through the coil 8 is increased or decreased according to a control signal 81 generated in a control unit 80 in response to a value of rotational velocity measured by a speed sensor 15 and / or a value of torque measured by a torque sensor 16 . an electromagnetic field f generated by the coil 8 results in field lines ( here only a few field lines are shown ) which lie essentially horizontally across the fluid and therefore also across the channels 4 of the piston 2 . in the presence of the magnetic field f , the dipoles of the smart fluid align themselves to the magnetic field lines , as indicated by the transverse ‘ layers ’ of dipoles in the diagram . as a result , the apparent viscosity of the fluid 3 , particularly in the channels 4 , is increased and the speed of the piston 2 decreases accordingly . in this way , the vertical motion of the gearbox 20 can be effectively damped or regulated . furthermore , since the torque and rotational velocity can be continually monitored , the corresponding control signal 81 and the magnetic field f can be generated very quickly , and the dipoles in the smart fluid 3 respond essentially immediately to a change in magnetic field , a ‘ real time ’ response to any sudden alteration in torque or velocity can be achieved , thus providing excellent damping for the gearbox , minimized distortion to the bedplate , and a prolonged lifetime of the relevant components . fig5 shows another embodiment of the wind - turbine active damping arrangement 11 according to the invention , this time as a four - point bearing , for example for use in a larger wind turbine such as a 3 . 5 megawatt turbine . here , the main shaft 13 is borne by two main bearings ( not shown in the diagram ), so that the gearbox is not subject to any significant yaw moment . therefore , the damping of forces exerted on the gearbox 20 can be favourably concentrated in the vertical direction . to this end , a pair of mr dampers 1 according to the invention is arranged vertically above and below the bolt 22 of the torque arm 21 ( another such pair is connected to the bolt on the other side of the torque arm 21 , which cannot be seen in this diagram ). the coil of the mr - damper 1 can be incorporated in the piston 2 , in a wall of the housing 6 ( as shown here ), or wrapped around the housing 6 , as appropriate . fig6 shows a further embodiment of a smart fluid damper 1 in an active damping arrangement 11 according to the invention . in this embodiment , the coil 8 is wrapped around the outside of the housing 6 . the piston 2 is hollow and can move vertically along a piston guide 24 arranged within the hollow interior . the damper 1 also includes a sensor 83 for detecting the speed of travel of the piston 2 , for example an ultrasonic transceiver 83 shown here to be mounted on the underside of the ‘ lid ’ of the damper housing 6 ( which lid moves together with the piston 2 ). the sensor 83 is directed the stationary piston guide 24 and generates a feedback signal 84 for the control unit 80 . in an alternative design , the motion sensor 83 could be mounted on top of the stationary piston guide 24 and directed at the inside of the damper housing lid . in this embodiment , the damper 1 also includes a limit stop 85 that detects when the piston 2 has reached the limit of its travel and forwards an appropriate signal 86 to the control unit 80 . a torque sensor 16 and a wind speed sensor 14 measure the main shaft torque and wind speed respectively , and provide their measurements to the control unit 80 . this is realized to analyse these inputs and to generate an appropriate control signal 81 , which in turn controls a power supply 82 ( in this case by means of a potentiometer 87 ) so that a specific electrical current is delivered via a field generator control signal 88 through the coil 8 . each damper 1 of an active damping arrangement 11 can be equipped with its own control unit 80 and its own power supply regulator 87 . for example , four mr - dampers can all be controlled by a single control unit 80 , which supplies control signals to four regulators , and a shared power supply can be electrically connected to the coils of each of the dampers . alternatively , in a simpler arrangement without feedback sensors or limit stops , a single regulator can be used to control each of the field generators . although the present invention has been disclosed in the form of preferred embodiments and variations thereon , it will be understood that numerous additional modifications and variations could be made thereto without departing from the scope of the invention . for example , the smart fluid damper can also comprise a limit stop , which can for example be located on the outer face of the piston or on an inner wall of the housing , so that the range of motion of the piston is subject to a predefined limit . this may serve to protect the damper from an overly extreme motion during adverse operating conditions . for the sake of clarity , it is to be understood that the use of “ a ” or “ an ” throughout this application does not exclude a plurality , and “ comprising ” does not exclude other steps or elements . | 8 |
the invention and the various features and advantageous details thereof are explained more fully with reference to the non - limiting embodiments that are illustrated in the accompanying drawings and detailed in the following description . descriptions of well - known starting materials , processing techniques , components and equipment are omitted so as not to unnecessarily obscure the invention in detail . it should be understood , however , that the detailed description and the specific examples , while indicating some embodiments of the invention , are given by way of illustration only and not by way of limitation . various substitutions , modifications , additions and / or rearrangements within the spirit and / or scope of the underlying inventive concept will become apparent to those skilled in the art from this disclosure . software implementing embodiments disclosed herein may be implemented in suitable computer - executable instructions that may reside on a computer - readable storage medium . within this disclosure , the term “ computer - readable storage medium ” encompasses all types of data storage medium that can be read by a processor . examples of computer - readable storage media can include , but are not limited to , volatile and non - volatile computer memories and storage devices such as random access memories , read - only memories , hard drives , data cartridges , direct access storage device arrays , magnetic tapes , floppy diskettes , flash memory drives , optical data storage devices , compact - disc read - only memories , hosted or cloud - based storage , and other appropriate computer memories and data storage devices . search engines are often employed by systems and applications such as content servers , document management systems , web sites , etc . for fast retrieval of information . such systems and applications are collectively referred to herein as controlling applications . a search engine can have many features and capabilities that can be useful to various controlling applications . for example , a search engine can search the metadata and text of documents in a search index to determine which documents match search criteria without the controlling application having to parse the document itself . such documents are an example of objects that can be controlled or managed by a controlling application . before describing embodiments in detail , it may be helpful to discuss an example search engine in the context of a search system . fig1 depicts a block diagram illustrating an example of computing environment 100 having object repository 105 , search system 101 , and client computer 130 . object repository 105 may comprise a file server or database system or other storage mechanism remotely or locally accessible by search system 101 . object repository 105 may store objects 107 ( e . g ., documents , images , emails or other objects ) that may be searchable by search system 101 . in the embodiment of fig1 , search system 101 comprises a server having central processing unit 112 connected to memory 114 and storage unit 118 via a bus . central processing unit 112 may represent a single processor , multiple processors , a processor ( s ) with multiple processing cores and the like . storage unit 118 may include a non - transitory storage medium such as hard disk drives , flash memory devices , optical media and the like . search system 101 may be connected to a data communications network ( not shown ). storage unit 118 stores computer executable instructions 119 and index 124 . computer executable instructions 119 can represent multiple programs and operating system code . in one embodiment , instructions 119 are executable to provide object analyzer 120 and search engine 122 . object analyzer 120 and search engine 122 may be portions of the same program or may be separate programs . according to one embodiment , for example , object analyzer 120 is a component of a document management system while search engine 122 is a separate program that interfaces with the document management system . furthermore , object analyzer 120 and search engine 122 can be implemented on different computing systems and can , themselves , be distributed . index 124 includes metadata used to identify objects in response to a search query and may also include text used to identify objects . index 124 can include a single index containing metadata and text , separate metadata and text indices or other arrangements of information . while shown as a single index , index 124 may include multiple indices . client computer system 130 may include components similar to those of the server of search system 101 , such as cpu 138 , memory 136 , and storage 140 . additionally , client computer system 130 may include executable instructions 132 to provide user interface 134 that allows a user to enter a search query . the user interface may be provided through a web browser , file system interface or other program . those skilled in the art will appreciate that search system 101 shown in fig1 is merely an example of a computing system and embodiments of a search system that may be implemented using other computing systems ( e . g ., desktop computers , laptops , mobile computing devices or other computing devices with adequate processing and memory ) including multiple computers acting together to provide a search system ( e . g ., a cluster of servers or other computing devices connected by a network acting together to provide the search system ). similarly , client computer 130 may include any suitable desktop computer , laptop , mobile device , server or other computing system . in operation , object analyzer 120 may analyze objects in object repository 105 to determine information to be indexed in index 124 . when an object is added to search system 101 , two types of information are generally indexed , one or both full text and metadata . as an example , suppose object 107 being added to search system 101 is a text file , the text or content of the file is indexed as well as information about the file . in some cases , the metadata itself may include important information associated with the object . this metadata may need its own descriptive metadata indicating attributes of the metadata . in some cases , the metadata on its own without full text content is sufficient to represent an object . object analyzer 120 can send indexing instructions to search engine 122 to direct search engine 122 to add , modify , or delete metadata or text in index 124 . object analyzer 120 may be a portion of a larger program , such as a document management program , may be a separate program or may be implemented according any suitable programming architecture . in one embodiment , the process of determining metadata and text to be indexed maybe carried out by any number of different programs on a computer system or distributed across computer systems . detailed discussions concerning an example of an object analyzer can be found in u . s . patent application ser . no . 13 / 595 , 570 , filed aug . 27 , 2012 , entitled “ system and method of search indexes using key - value attributes to searchable metadata ,” which is fully incorporated by reference herein . as noted above , one of the tasks performed by a search engine is the complex computation of the relevance of objects . embodiments described herein include a system and method for assessing contribution to relevance based on properties whose importance may decline or increase over time . fig2 illustrates a non - limiting example embodiment of a system for numeric value decay for relevance computation . in the example illustrated , system 200 includes a controlling application 201 , although this is not required . controlling application 201 may define a modifier type metadata field , such as voting popularity or frequency of use , as will be described in greater detail below . advantageously , controlling application 201 provides information on likes and dislikes , set values , etc ., but does not itself perform popularity and / or decay calculations . representing an example of a search system such as search system 101 described above , system 200 may further include search engine 202 . in embodiments disclosed herein , search results can be scored for relevance by search engine 202 with reduced intervention by controlling application 101 . embodiments do not limit or redefine the many other features and capabilities of a search engine . as discussed above , when an object is added to a search system , two types of information may be indexed , one or both of full text and metadata . there are often many metadata fields for an associated object . the metadata may describe the objects being indexed . in certain cases , the metadata itself may include important information associated with the object . this metadata may need its own descriptive metadata indicating attributes of the metadata . metadata values may require or desire to be described by a plurality of attributes such as language , color , and / or country of origin . each of the metadata fields may have one or more values . as will be described in greater detail below , in some embodiments , search engine 202 may implement a numeric data type with defined behaviors . for description purposes , this numeric data type is referred to herein as a modifier . for example , a data field labeled “ popularity ” may be defined as a modifier data type . in this example , the numeric value in modifier type field 207 ( which is also referred to as “ modifier data field ( s )” in this disclosure ) represents a certain degree or level of popularity . in some embodiments , multiple modifier data fields may be defined . in some embodiments , an object may have none , many , or a single modifier data field populated . values for modifier data fields ( modifier values ) may be sparsely populated . a modifier value may be attached to any object indexed within the search engine . objects may have separate and distinct modifier values . in some embodiments , modifier data fields may be “ multi - valued ” in nature . a multi - valued field can retain multiple data points and allow calculations to be performed on the multiple data points in a single modifier data field for an object . as will be described in greater detail below , a modifier value can be incorporated into computations made by a search engine to establish relevance for objects in a search query . an example of a search engine supporting multi - valued fields is provided in the above - referenced u . s . patent application ser . no . 13 / 595 , 570 , filed aug . 27 , 2012 , entitled “ system and method of search indexes using key - value attributes to searchable metadata .” in the example of fig2 , relevance computation 203 represents the functional block or control logic in search engine 202 that computes the relevance of an object to a search query . relevance computation 203 may use metadata value ( s ) with a type of a modifier ( e . g ., value ( s ) in modifier type field 207 ) in addition to other inputs into the relevance computation . relevance computation 203 can include many factors — such as term frequency or object type preference . the contribution of modifier value ( s ) from modifier type field 207 may be only one element of this computation . in operation , a modifier value may be created , set , and / or deleted in the usual manner for a search engine , for instance , as a field for an object to be indexed . to this end , indexing operations 208 may include operations that are common for indexing and updating objects in search engines . in one embodiment , indexing operations 208 may include “ add ”, “ replace , and “ delete ” operations . the modifier values can be manipulated in the same manner as values in other data fields in the search engine . the full text and metadata values that are indexed by search engine 202 may be stored in indexed object storage 205 . indexed object storage 205 may be located in some combination of memory and persistent storage . as illustrated in fig2 , the search index may also include other text and metadata fields 206 storing indexed text and metadata values that are searchable by search engine 202 . as noted above , a modifier may be implemented as a numeric data type with defined behaviors . a modifier can be implemented using integer or real values . for computational purposes , an implied decimal point with integers may also be used . for example , with three implied decimal points , the integer value 17 , 345 would be interpreted as 17 . 345 . a modifier data field may retain the properties of standard search engine metadata fields . for example , the value of a modifier can be retrieved by a search engine . as another example , modifier values can be used in a search query . using a modifier in a query would allow searches such as “ find all objects that have values greater than 6 in the ‘ popularity ’ modifier field ”. the definition of a modifier data type can include some or all of the following attributes : minimum possible value . any attempt to set or adjust a modifier to a lower value is either ignored or limited to this minimum value . maximum possible value . any attempt to set or adjust a modifier to a higher value is either ignored or limited to this maximum value . resting value . a resting value refers to a numeric point at which the value of a modifier should approach and possibly reach , depending on a decay algorithm ( an example of which is described below ). decay parameters . multiple possible types of decay algorithms are possible that would permit modifier values to approach the resting value over time . the definition of a decay algorithm and associated parameters may be configurable . maximum positive adjustment . if an implementation allows relative adjustments , either by value or algorithms such as multipliers , then a maximum upward adjustment may be configured . maximum negative adjustment . if an implementation allows relative adjustments , either by value or algorithms such as multipliers , then a maximum downward adjustment may be configured . the configuration of the example modifier attributes listed above may be made in a number of possible ways , including but not limited to one or more of : default settings creation or definition by means of an application programming interface ( api ) definition with a configuration file , such as an extensible markup language ( xml ) description or a microsoft windows “. ini ” file storage within a database or data repository . additional operations ( e . g ., modifier field operations 210 ) can allow relative adjustment of values in a modifier data field . for example , sample indexing or index update transactions may include : add a value to a current modifier . if the definition of the modifier includes a maximum value , then the search engine will ensure that this limit is not exceeded . subtract a value from a current modifier . if the definition of the modifier includes a minimum value , then the search engine will ensure that the value does not fall below this limit . multiply a current modifier by a value . this value may be referred to as a factor or a multiplier . note that such a multiplier may be relative to the resting value for the modifier data field . for example , if the current value of a modifier data field is 10 , the resting value is 4 , and the multiplier value is + 10 %, the new modifier value for the modifier data field will be ( 10 − 4 )× 1 . 10 + 4 , or 10 . 6 . if the definition of the modifier includes maximum or minimum values , then search engine will ensure that the modifier value stays within these limits . from time to time , a search engine may apply a decay computation to adjust the values contained within modifier data fields ( the “ decay ” of the numeric variables ). the decay computation can be triggered in several possible ways . in some embodiments , a decay computation can be applied at scheduled times , such as daily , weekly , monthly , or any predetermined and / or configurable time interval . in some embodiments , other triggering events such as an external trigger by means of a programming interface are also possible . for example , in one embodiment , a decay computation may be performed only when relevance computation 203 is performed . the decay computation does not need to be applied to all objects at the same time . in some embodiments , decay computations can be performed on subsets of the objects , with idle time between processing subsets . this approach ensures that there are no material delays in the response of the search engine that might occur if applying a decay computation to a very large number of objects . any number of possible methods may be used to compute the decay of the numeric variables . example decay computation methods include , but are not limited to : adding or subtracting a constant to the current value of the modifier field . for example , subtract 1 while the current value is greater than the resting value . factoring by a constant . for example , reduce the modifier value by 10 % each day . halflife . computing a time interval at which the value of the modifier should be reduced by half . a halflife uses factoring by a constant , but determines the constant based on the frequency of applying decay and the desired halflife of the modifier value . embodiments of decay computations may be optimized in various ways . for example , many of the values in a modifier field may be at or near the resting value . each value retained consumes space in the search index , and adds time to the relevance computations . when modifier values are at the resting value , or sufficiently close to the resting value , they can be deleted from the search index to save space . in this case , a system component running the computations for adjusting modifier values or computing relevance understands that absence of a modifier value should be treated as if the modifier is defined and has the resting value . referring to fig2 , relevance computation 203 represents a system component ( e . g ., a relevance computation component ) responsible for computing relevance utilizing values in modifier data fields ( e . g ., modifier type field 207 ) and decay agent 204 represents a system component ( e . g ., a decay computation component ) responsible for adjusting values in the modifier data fields . decay agent 204 can be configured to perform one or more decay computations described above based on some criteria such as time , scheduled events , external triggers ( external to system 200 ), etc . in some embodiments , if there are no external changes or adjustments in the modifier values , then over time decay agent 204 may cause the modifier values to converge on a resting value . in some embodiments , decay agent 204 may update all modifier data fields for all stored objects on a periodic basis or on demand . in one embodiment , decay agent 204 may update modifier data fields for a particular object when a query related thereto is received . accordingly , modifier data fields can be updated responsive to modifier field operations 210 as well as decay agent 204 operations . the modifier values in the modifier data fields can then be used by relevance computation 203 when a query is received . search queries 209 may leverage relevance computations 203 . in some embodiments , search results responsive to search queries 209 may be enhanced depending upon the implementation to indicate when modifier values are at their resting , maximum , or minimum values . modifier field operations 210 describe the new types of transactions that a controlling application 201 may need in order to implement embodiments described herein . this may include the relative increase and decrease operations , or programmatic definitions of the modifier type fields . although these are shown as distinct operations in this illustration , in practice these capabilities may be implemented as variations or extensions to other existing programming interfaces that are exposed by the search engine . by way of illustration , and not of limitation , the chart of fig3 shows an example of a set of operations performed on a single modifier value 208 . this example illustrates exemplary data points 302 , operations 304 , adjustments 306 , and associated resulting value for modifier value 308 . fig4 shows a plot diagram corresponding to the example of fig3 . in this example , a modifier is created ( via a “ create ” operation ) at data point 1 and given a default value of 4 . a linear decay computation is used to adjust modifier value 308 by 1 towards a resting value of 4 . thus , a decay operation is performed at data point 2 . however , since the default value is already at the resting value of 4 , the decay operation does not result in a change to modifier value 208 . at data point 3 , a value ( 8 ) for the modifier is provided during indexing ( via a “ set ” operation that might be , for example , included in indexing operations 108 ). subsequently , the modifier value may be increased ( e . g ., data points 4 , 6 - 9 , and 12 ), decayed ( e . g ., data points 5 , 10 - 11 , 13 - 22 , and 24 - 28 ), and decreased ( e . g ., data point 23 ) via various operations . notice after modifier value 208 reaches the maximum value of 12 at data point 7 and again at data point 12 , the decay computation operates to reduce modifier value 208 towards the resting value of 4 . when modifier value 208 reaches the resting value of 4 at data point 20 , the decay computation operates to maintain modifier value 208 at the resting value of 4 . when modifier value 208 falls below the resting value of 4 due to a “ decrease ” operation at data point 23 , the decay computation operates to increase modifier value 208 towards the resting value of 4 and again maintain modifier value 208 at the resting value of 4 once that value is reached . these adjustments to modifier value 308 are shown in the plot diagram of fig4 . as a specific example , modifier type field 207 may represent the popularity of a document ( an example of an object ) in a document management system . when first created ( data point 1 ), the data field named “ popularity ” of the document has a default popularity score of 4 . a privileged or authorized user ( e . g ., an author of the document ) identifies it to be important and gives it a value of 8 ( data point 3 ). in the next few days , the document is ‘ upvoted ’ by several users of the document management system , increasing the popularity of the document to the maximum value of 12 ( data points 4 , 6 - 9 , and 12 ). over time , the document becomes less important , and decays back to the resting level popularity of 4 ( data point 20 ). one user later ‘ downvotes ’ the document , dropping the popularity down to 1 ( data point 23 ), which recovers back to the resting value of 4 as it decays over time ( data point 26 ). in this example , the adjustment operations are initiated by a controlling document management application ( which can be an example of controlling application 201 ). as described above , the controlling document management application provides some information ( e . g ., the set value , the increase or ‘ upvote ’ value ( s ), and the decrease or ‘ downvote ’ value in fig3 ), but does not perform any relevance computation and / or decay computation . rather , a search engine connected to the document management application ( e . g ., search engine 202 ) can adjust the popularity value with each decay operation and ensure that the values stay within acceptable limits . when a query “ find all documents that have a popularity score higher than 6 ” is received at the search engine , relevance computation 203 can use the popularity value from modifier type field 207 , in addition to other inputs , to compute the relevance of the document to this query . accordingly , a method of relevance computation can be summarized with reference to fig5 . at step 505 , a controlling application , such as controlling application 201 described above , may define a modifier type metadata field of an object . at step 510 , a decay computation component of a search engine , such as decay agent 204 of search engine 202 described above , may create a modifier value in the modifier type metadata field of the object . the decay computation component may be embodied on a non - transitory computer readable medium and the search engine may be communicatively connected to the controlling application over a network connection . at step 515 , the decay computation component of the search engine may adjust the modifier value in the modifier type metadata field of the object toward a predetermined resting value . various types of adjustments may be made , including adding a constant to the modifier value or multiplying a factor to the modifier value . the decay computation component is configured for ensuring that the modifier value does not exceed a maximum value and / or fall below a minimum value . the modifier value may be adjusted on a periodic basis , on demand , or in response to a triggering event such as in response to a transaction issued by the controlling application . the controlling application may issue various types of transactions such as indexing and index updating transactions that may cause the decay computation component to adjust the modifier value of the modifier type metadata field of the object . in some embodiments , the decay computation component may be configured to delete , from an index storing modifier values of indexed objects , certain modifier values that are at or sufficiently close to the predetermined resting value . although the invention has been described with respect to specific embodiments thereof , these embodiments are merely illustrative , and not restrictive of the invention . the description herein of illustrated embodiments of the invention , including the description in the abstract and summary , is not intended to be exhaustive or to limit the invention to the precise forms disclosed herein ( and in particular , the inclusion of any particular embodiment , feature or function within the abstract or summary is not intended to limit the scope of the invention to such embodiment , feature or function ). rather , the description is intended to describe illustrative embodiments , features and functions in order to provide a person of ordinary skill in the art context to understand the invention without limiting the invention to any particularly described embodiment , feature or function , including any such embodiment feature or function described in the abstract or summary . while specific embodiments of , and examples for , the invention are described herein for illustrative purposes only , various equivalent modifications are possible within the spirit and scope of the invention , as those skilled in the relevant art will recognize and appreciate . as indicated , these modifications may be made to the invention in light of the foregoing description of illustrated embodiments of the invention and are to be included within the spirit and scope of the invention . thus , while the invention has been described herein with reference to particular embodiments thereof , a latitude of modification , various changes and substitutions are intended in the foregoing disclosures , and it will be appreciated that in some instances some features of embodiments of the invention will be employed without a corresponding use of other features without departing from the scope and spirit of the invention as set forth . therefore , many modifications may be made to adapt a particular situation or material to the essential scope and spirit of the invention . reference throughout this specification to “ one embodiment ”, “ an embodiment ”, or “ a specific embodiment ” or similar terminology means that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least one embodiment and may not necessarily be present in all embodiments . thus , respective appearances of the phrases “ in one embodiment ”, “ in an embodiment ”, or “ in a specific embodiment ” or similar terminology in various places throughout this specification are not necessarily referring to the same embodiment . furthermore , the particular features , structures , or characteristics of any particular embodiment may be combined in any suitable manner with one or more other embodiments . it is to be understood that other variations and modifications of the embodiments described and illustrated herein are possible in light of the teachings herein and are to be considered as part of the spirit and scope of the invention . in the description herein , numerous specific details are provided , such as examples of components and / or methods , to provide a thorough understanding of embodiments of the invention . one skilled in the relevant art will recognize , however , that an embodiment may be able to be practiced without one or more of the specific details , or with other apparatus , systems , assemblies , methods , components , materials , parts , and / or the like . in other instances , well - known structures , components , systems , materials , or operations are not specifically shown or described in detail to avoid obscuring aspects of embodiments of the invention . while the invention may be illustrated by using a particular embodiment , this is not and does not limit the invention to any particular embodiment and a person of ordinary skill in the art will recognize that additional embodiments are readily understandable and are a part of this invention . embodiments discussed herein can be implemented in a computer communicatively coupled to a network ( for example , the internet ), another computer , or in a standalone computer . as is known to those skilled in the art , a suitable computer can include a central processing unit (“ cpu ”), at least one read - only memory (“ rom ”), at least one random access memory (“ ram ”), at least one hard drive (“ hd ”), and one or more input / output (“ i / o ”) device ( s ). the i / o devices can include a keyboard , monitor , printer , electronic pointing device ( for example , mouse , trackball , stylist , touch pad , etc . ), or the like . rom , ram , and hd are computer memories for storing computer - executable instructions executable by the cpu or capable of being complied or interpreted to be executable by the cpu . suitable computer - executable instructions may reside on a computer readable medium ( e . g ., rom , ram , and / or hd ), hardware circuitry or the like , or any combination thereof . within this disclosure , the term “ computer readable medium ” or is not limited to rom , ram , and hd and can include any type of data storage medium that can be read by a processor . for example , a computer - readable medium may refer to a data cartridge , a data backup magnetic tape , a floppy diskette , a flash memory drive , an optical data storage drive , a cd - rom , rom , ram , hd , or the like . the processes described herein may be implemented in suitable computer - executable instructions that may reside on a computer readable medium ( for example , a disk , cd - rom , a memory , etc .). alternatively , the computer - executable instructions may be stored as software code components on a direct access storage device array , magnetic tape , floppy diskette , optical storage device , or other appropriate computer - readable medium or storage device . any suitable programming language can be used to implement the routines , methods or programs of embodiments of the invention described herein , including c , c ++, java , javascript , html , or any other programming or scripting code , etc . other software / hardware / network architectures may be used . for example , the functions of the disclosed embodiments may be implemented on one computer or shared / distributed among two or more computers in or across a network . communications between computers implementing embodiments can be accomplished using any electronic , optical , radio frequency signals , or other suitable methods and tools of communication in compliance with known network protocols . different programming techniques can be employed such as procedural or object oriented . any particular routine can execute on a single computer processing device or multiple computer processing devices , a single computer processor or multiple computer processors . data may be stored in a single storage medium or distributed through multiple storage mediums , and may reside in a single database or multiple databases ( or other data storage techniques ). although the steps , operations , or computations may be presented in a specific order , this order may be changed in different embodiments . in some embodiments , to the extent multiple steps are shown as sequential in this specification , some combination of such steps in alternative embodiments may be performed at the same time . the sequence of operations described herein can be interrupted , suspended , or otherwise controlled by another process , such as an operating system , kernel , etc . the routines can operate in an operating system environment or as stand - alone routines . functions , routines , methods , steps and operations described herein can be performed in hardware , software , firmware or any combination thereof . embodiments described herein can be implemented in the form of control logic in software or hardware or a combination of both . the control logic may be stored in an information storage medium , such as a computer - readable medium , as a plurality of instructions adapted to direct an information processing device to perform a set of steps disclosed in the various embodiments . based on the disclosure and teachings provided herein , a person of ordinary skill in the art will appreciate other ways and / or methods to implement the invention . it is also within the spirit and scope of the invention to implement in software programming or code an of the steps , operations , methods , routines or portions thereof described herein , where such software programming or code can be stored in a computer - readable medium and can be operated on by a processor to permit a computer to perform any of the steps , operations , methods , routines or portions thereof described herein . the invention may be implemented by using software programming or code in one or more general purpose digital computers , by using application specific integrated circuits , programmable logic devices , field programmable gate arrays , optical , chemical , biological , quantum or nanoengineered systems , components and mechanisms may be used . in general , the functions of the invention can be achieved by any means as is known in the art . for example , distributed , or networked systems , components and circuits can be used . in another example , communication or transfer ( or otherwise moving from one place to another ) of data may be wired , wireless , or by any other means . a “ computer - readable medium ” may be any medium that can contain , store , communicate , propagate , or transport the program for use by or in connection with the instruction execution system , apparatus , system or device . the computer readable medium can be , by way of example only but not by limitation , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , system , device , propagation medium , or computer memory . such computer - readable medium shall generally be machine readable and include software programming or code that can be human readable ( e . g ., source code ) or machine readable ( e . g ., object code ). examples of non - transitory computer - readable media can include random access memories , read - only memories , hard drives , data cartridges , magnetic tapes , floppy diskettes , flash memory drives , optical data storage devices , compact - disc read - only memories , and other appropriate computer memories and data storage devices . in an illustrative embodiment , some or all of the software components may reside on a single server computer or on any combination of separate server computers . as one skilled in the art can appreciate , a computer program product implementing an embodiment disclosed herein may comprise one or more non - transitory computer readable media storing computer instructions translatable by one or more processors in a computing environment . a “ processor ” includes any , hardware system , mechanism or component that processes data , signals or other information . a processor can include a system with a general - purpose central processing unit , multiple processing units , dedicated circuitry for achieving functionality , or other systems . processing need not be limited to a geographic location , or have temporal limitations . for example , a processor can perform its functions in “ real - time ,” “ offline ,” in a “ batch mode ,” etc . portions of processing can be performed at different times and at different locations , by different ( or the same ) processing systems . it will also be appreciated that one or more of the elements depicted in the drawings / figures can also be implemented in a more separated or integrated manner , or even removed or rendered as inoperable in certain cases , as is useful in accordance with a particular application . additionally , any signal arrows in the drawings / figures should be considered only as exemplary , and not limiting , unless otherwise specifically noted . as used herein , the terms “ comprises ,” “ comprising ,” “ includes ,” “ including ,” “ has ,” “ having ,” or any other variation thereof , are intended to cover a non - exclusive inclusion . for example , a process , product , article , or apparatus that comprises a list of elements is not necessarily limited only those elements but may include other elements not expressly listed or inherent to such process , process , article , or apparatus . furthermore , the term “ or ” as used herein is generally intended to mean “ and / or ” unless otherwise indicated . for example , a condition a or b is satisfied by any one of the following : a is true ( or present ) and b is false ( or not present ), a is false ( or not present ) and b is true ( or present ), and both a and b are true ( or present ). as used herein , a term preceded by “ a ” or “ an ” ( and “ the ” when antecedent basis is “ a ” or “ an ”) includes both singular and plural of such term , unless clearly indicated otherwise ( i . e ., that the reference “ a ” or “ an ” clearly indicates only the singular or only the plural ). also , as used in the description herein and throughout the claims that follow , the meaning of “ in ” includes “ in ” and “ on ” unless the context clearly dictates otherwise . although the foregoing specification describes specific embodiments , numerous changes in the details of the embodiments disclosed herein and additional embodiments will be apparent to , and may be made by , persons of ordinary skill in the art having reference to this disclosure . in this context , the specification and figures are to be regarded in an illustrative rather than a restrictive sense , and all such modifications are intended to be included within the scope of this disclosure . accordingly , the scope of the present disclosure should be determined by the following claims and their legal equivalents . | 6 |
referring to fig1 , a patient , typically in an inpatient setting , is monitored by a variety of medical devices , in this example , including non - invasive blood pressure ( nibp ), pulse oximetry ( spo2 ), continuous ecg ( ecgcont ), respiration rate ( resp ), temperature ( temp ), and an infusion pump ( iv i ). the infusion pump ( iv i ) may also be a medical care device , in that it may not only monitor the status of the pump and its operation , but also may provide medical care in the form of medicine to a patient . it should be understood that the devices shown here are exemplary , and there may be any number of type of devices in a particular implementation . a device , referred to as patient care controller ( pcc ) 1 , is interposed between these devices , and possibly one or more electronic medical record systems ( emr ). the pcc may serve as a gateway from the medical devices and emr to remote monitoring systems ( rms ) and clinical information systems ( cis ). the pcc 1 may communicate with each of the devices . the pcc 1 may have an interface to each of the monitoring devices . the pcc 1 may , in some embodiments , have the ability to record all of the data that is provided by the various devices , so that a clinician may review the data provided by each of the devices , and see how it has changed over time . the pcc 1 may , in some embodiments , have the ability to control one or more of the devices . for example , the pcc 1 may be able to cause a monitoring event , such as the measurement and recording of non - invasive blood pressure by the nibp . the pcc 1 may , in some embodiments , have the ability to control the output of the infusion pump ( iv i ), for example to increase or decrease the material provided to the patient by the pump . in some embodiments , a pcc 1 , may include a device input / output ( i / o ) panel . the input / output panel provides an physical interface for external devices and information systems into and out of the system . the i / o panel may contain multiple standard connections for a variety of medical devices , clinical information systems and video , preferably with a capability to easily “ hot swap ” devices . the i / o panel may contain emergency and manual override switches which are assessable in the clinical environment . the i / o panel preferably is compact and sealed so as to be capable of operating in the clinical environment , including , for example , an operating room . the i / o panel may capable of taking data from a variety of monitoring devices , and receiving waveform , discrete , and / or episodic data . the i / o panel may have different connection plates for customization in the clinical environment . these connections would include but not limited to usb , rj - 45 , and rj - 232 connectors . in some embodiments , the i / o panel has a modular design , which allows different interfaces to be provided to the panel , as needed in a particular environment . each of the interfaces may be associated with one or more medical devices . referring to fig2 , the i / o panel also may have a touch screen which would allow for display at the bedside , to enable input by clinicians of trends , event tags and recordings . this display automatically displays a selected set of specific data during an event for instant communication to the clinical staff . this touch screen may be the same or different from a display unit 4 which may provide display , alarms output , and user configuration and input . in one embodiment , the pcc includes the i / o panel and three additional modules 3 , each capable of operating independently . these modules are a closed loop control module ( clc ), clinical decision module ( cd ), and medical information system and clinical event archiving module ( mis / cea ). these modules are described further below . referring to fig3 , an exemplary display may be visible in a patient room and / or available remotely . in this exemplary display , there are three buttons at the top : menu 6 , new device 7 , and new patient 8 . the menu button 6 allows a clinician to set preference and rules for the system . there may security features to control levels of what can and cannot be changeable based on the clinical position . a new device option 7 allows addition of a new item of equipment . the system may have a library of interfaces which enables devices to be plugged in and added , preferably without resetting the system . it may be possible to swap failed or add new devices depending on the patient status . the new patient option 8 allows the system to attach to a new patient , with new demographic and patient data obtained from electronic medical record systems 5 . a patient and demographics display screen 9 provides a display of relevant data . the patient specific display may be a customizable display module depending on the requirements of the patients and clinician preference . for example , in addition to information such as name , and age , allergies , and so forth , it may include special instructions for the patient . a control release button 10 may be a safety interlock that will release control of all devices such that the devices immediately begin running as individual systems . this may be useful in an emergency situation , or other circumstances . a physiological data display 11 may be where physiological data of attached devices is stored and displayed . this display also may show events on each waveform and the time of the event . when a users touches a button it may display the events and current and / or past waveforms as configured . a most recent event log 12 may include a time sequence of each event when the user selects the specific event all physiological data of the event occurs on the screen as well as current physiological data . a most recent event log 12 may be a time stamp description of events which are recorded in the system . events can be defined as any change , from a button push , alarm , or change in physiological data . in some embodiments , an infusion panel display 13 may appear when an infusion pump is plugged in . the infusion pump panel 13 records the device id , type of pump , channel or channels , the current channel status , pharmaceuticals that are being infused , dosage , and rate . information from the infusion pump also may include the device that is the controller or monitoring device and the event count on that specific device and channel . a device status portion 14 may show devices attached , what they are doing , and if they are being controlled or triggered by another device . this may also record errors , alarms , or other information from the devices . for example , the device status screen 14 may show the devices that are attached , and which devices are being monitored and / or integrated with another device . the display also may provide error codes , network connects of each medical device , and so forth . referring to fig4 , a clinical decision module monitors minimum and maximum physiological monitor events , which can be set by the clinician . this portion of the system also may implement advanced clinical decision algorithms and provide diagnostic information to a clinician . this module also may generate and / or validate alarms using information from multiple devices , the medical information system and / or clinical event archiving module . in some implementations , data 15 may be imported from medical devices , the electronic medical record and previously stored data . the system may scan an emr for drug allergies , the date and time of previous surgical events , and potentially important information such as implantable devices . it may acquire pre - surgical testing waveforms and discrete data . discrete data imported from an emr 16 may be the average of a selected time frame or the last value which was measured . these discrete values may be used as the historical baseline for comparison of real - time and stored data 24 . the historical baseline and the discrete value numbers may then be used to calculate percentage changes over clinician set times . there also may be alarm values set 17 to alert a clinician of changes . for example , episodic data may be continuously monitored for errors and alarms . these values may be compared 19 against settings specifically designated , and in some embodiments , default algorithms and automated waveform diagnostics may also be used to make periodic waveform analysis . alarm levels and triggers also may be customizable 18 . when a device output triggers an alarm 22 , this system may provide real time statistics of relevant information in one location . this allow for troubleshooting of events . the combination of alarms and clinical decision data allows for intelligent alarms . for example , clinicians may be provided with a clear past and present set of data and alerts to assist them in determining where a problem is located . this may include smart alarm technology that determines the level of alarms , as well as takes measures before the clinical staff arrives at a bedside , and possibly pausing of medical devices . alarms can be provided to a remote monitoring station , and / or a physician pager 23 . a demonstrative example of an algorithm used in the system involves an infusion pump , spo2 and periodic nibp taken every 30 minutes prior to drug injection . a patient &# 39 ; s noninvasive blood pressure ( nibpb ) and pulse oxide ( spo2b ) are taken at the time that iv is started . as measurements , the pulse may be compared against the previous 100 values , average and each individual pulse oximetry as well as against the baseline . the baseline changes as more and more pulse oximetry values are found . if the pulse oximetry value drops below spo2 min , or if spo2 i varies more than x % ( normally a large amount ) if spo2 i varies more than x % ( normally a large amount ) another demonstrative example involves a patient who goes into the emergency department complaining of chest pains . a diagnostic ecg is taken , but appears normal . the patient is showing signs of discomfort therefore she is held for observation . the patient is hooked up to a continuous 5 lead ecg . the system collects 10 to 15 seconds of continuous ecg data every 2 minutes and compares it to the original ecg taken upon triage in the er . the algorithm utilized to determine if there is a potential decline in the patient &# 39 ; s health is : this data may then be sent to the mis / cea module with an event timeline 20 , 21 . referring to fig5 , a closed loop control module allows for information of one device to monitor or control the activity of another . for example , this may involve requesting the monitored device to activate at a certain phase of a waveform detected by the monitoring device . this module also may determine whether patient medical information would indicate that a warning for the clinician that a potential adverse event is about to occur would be appropriate . embodiments of this module allow for one device to be monitored and controlled by the values of another device 25 , 26 . one device is designated as the monitoring device ; this device is normally a device which is measuring some physiological data 28 . the monitored device is normally a device that is acting on the patient such as an infusion pump or portable x - ray machine 27 . there is a series of clinical decision , settings , limits and algorithms from the 28 module which assist in the monitoring and alarming of the device 29 . each of these decisions are then logged for the clinical event logging 30 at the same time the monitoring device can have the potential of forcing the monitored device to perform an event such as a pause , or take an image . all of this information then may be provided on the display 31 . referring to fig6 , a medical information systems and clinical event archiving module packages imports and exports data to the clinical information systems and other modules within the pcc and clinical event archiving portion of this module is used to establish an event timeline . the module has access to data from device modules 36 , including data from device data , environmental data and / or physiological data . the module may record all events that have occurred during a clinical timeframe . this could be the entire procedure or a set time before and after an event occurring . this timeline is beneficial in training , event review , and legal situations providing a complete event history . this module would send to the mis / cea module for packaging sent to storage in the clinical information system . this module may interface with the rest of the cis . it may be capable of pulling data from the cis which would include the emr system , pharmacy system , lab system , pacs imaging system , as well as a drug interaction database or other commercial drug database 32 . it then converts the data to a format the device can utilize 33 and is stored for referencing by the rest of the device 34 this module is responsible for maintaining an event timeline . therefore all data and events feed through this module to receive a time stamp and sequencing 35 . the timeline of events is then sent to the medical information systems portion of the module for packing to be sent to the cis 35 , 37 . | 6 |
referring initially to fig1 the container 10 of the present invention may be any number of types of vessels , such as a test tube , an erlenmeyer flask , a beaker , or laboratory bottle , and such containers are normally formed of glass or other breakable material . in fig1 container 10 is shown as a test tube 11 for holding a fluid 12 . a container closure , illustrated as a stopper 14 , is located at the open end of test tube 11 for protecting fluid 12 from the atmosphere . although a stopper is shown for illustrative purposes , the container may be permanently closed air tight by a closure which is not intended for removal and which is pierced by a sterile needle or similar device for inserting fluid 12 into the container . this type of closure may be particularly useful for blood measurements . the container 10 of the present invention includes a spherical ball 16 placed within the container prior to the reception of fluid 12 therein . preferably , spherical ball 16 is packaged with container 10 to form an integral unit and to conveniently allow the container to be equipped for determining the viscosity of a fluid contained therein . therefore , spherical ball 16 can be placed within container 10 at the factory and the container with ball can then be evacuated , sealed , sterilized and shipped as an integral unit . container 10 may be of any diameter or length , limited only by the constraints imposed for collecting a specified fluid 12 . moreover , spherical ball 16 could be constructed of any material , such as plastic , glass , or metal , that is substantially inert to the fluid held within container 10 and having an absolute density larger than the density of the fluid . however , because the spherical ball 16 is often shipped with glass or frangible containers , container 10 could be shattered during shipping due to the weight of the ball . the bottom of the container is most vulnerable to breakage during shipment . this is especially true when the ball must have a diameter which is large enough to be easily sensed by sensors , discussed in more detail below . if the spherical ball 16 is constructed small enough to reduce the possibility of damage to the container during shipping , the ball will be difficult to sense with conventional sensing devices and will wander as it travels through fluid 12 past the sensors . moreover , the stokes equations set forth in the background section , require the spherical ball 16 to reach its translational velocity before it moves into the predetermined distance d in fig1 . the diameter required for the spherical ball is greatly affected by the density of the material required to form it , and this material is determined by the density of the fluid to be measured . if a metallic ball with density considerably larger than the density of the fluid 12 is used and if the viscosity of the fluid 12 is in the range of water or even 100 times greater than water , the ball must be sufficiently small to reach its terminal translational velocity within the limited dimensions of container 10 . the limited dimensions of a laboratory container often make it difficult to accurately detect displacement of a spherical ball 16 held within the container , since for some fluids , the ball would be tiny . in accordance with the present invention , the diameter of spherical ball 16 may be increased so that sensors can more readily detect its displacement within container 10 . also , the ball of the present invention can be provided as an integral unit with a frangible laboratory container without causing damage to the container during shipping . specifically , a composite spherical ball 16 includes a core 24 which may be made from a metallic material or another suitable material having a density which exceeds that of the fluid to be measured . the core is formed to a size and weight determined by the size and configuration of the container . in a small volume test tube container of the type shown at 10 in fig1 the ball 16 , if formed from a heavy , dense material such as metal , would be required to be tiny if it is to reach its translational velocity v before entering the measurement area between points 20 and 22 . in fig1 point 18 represents the ball drop point . this point establishes the distance required for the spherical ball 16 to reach its translational velocity , v described in the background section . the distance d represents the measuring distance to determine the velocity of spherical ball 16 as is travels down the wall of test tube 11 . as described in greater detail below , sensors are preferably placed at points 20 and 22 to accurately sense when spherical ball 16 passes each of the sensors to determine speed . the weight of core 24 will allow spherical ball 16 to reach its translational velocity within the confines of container 10 . half - spheres 26 are formed around the core 24 and are made of material having a much lower density than that of the core material . this lower density outer structure provides two important functions , namely , it is preferably made of low density shock absorbent material which protects container 10 during shipping , and it causes spherical ball 16 to have a sufficiently large diameter to be easily detected by conventional sensors during fluid testing . the embodiment illustrated in fig2 shows the use of a plastic material for the half spheres 26 , but however , any suitable light , shock resistant material may be used . the material would be limited to those materials which are inert to the fluid held within the given container . each half - sphere 26 is provided with a cut - out region 28 adapted to receive the core 24 . a conventional adhesive or other bonding method can then be used to bind the half - spheres together around the core 24 before the ball 16 is sealed within the container 10 . fig3 provides a second embodiment of spherical ball 16 wherein a small core 24 &# 39 ; may also be made of a dense , heavy material . a hollow sphere 30 is provided with a slot 32 to allow core 24 &# 39 ; to be slidable therein . again , sphere 30 is shown made of a plastic material , but any material which is inert to the fluid 12 being tested would be acceptable . slot 32 has a cross - sectional area slightly greater than the diameter of core 24 &# 39 ; to facilitate insertion , and a plug 34 is provided to secure core 24 &# 39 ; within sphere 30 to provide a composite spherical ball 16 having an increased diameter . moreover , plug 34 is provided with an arcuate cutout portion 36 to allow adequate support of core 24 &# 39 ; along its surface . again , a conventional adhesive can be used to secure plug 34 within slot 32 . the embodiments illustrated in fig2 and 3 can be reversed under certain circumstances . a less dense material having a desired diameter may be coated with denser material , such as a metallic material , if the metallic components of a metallically composed spherical ball is desired . some shock absorption characteristics may be lost with this coated structure , but often the coating is thin and flexible enough that shock absorption is still provided . the container 10 of fig1 provided with the composite ball of fig2 and 3 facilitates the shipment and use of a small laboratory container for in situ viscosity measurements . the shock absorbent characteristics of the composite ball not only permit the container with the ball to be safely shipped , but also permit the container with the ball to be centrifuged , shaken or otherwise somewhat violently manipulated in a laboratory to treat the liquid in the container without the likelihood of the ball causing damage to the container . since the container and ball can be sterilized and sealed before shipment , fluid to be measured can be injected through the closure 14 for testing , and viscosity measurements can be taken in situ during testing . there is no need to pour fluid from a larger container into a separate viscosity measuring device as is the case with conventional viscosity measuring units . thus a viscosity measurement can be rapidly taken using the container 10 of fig1 without the chance of fluid contamination and without creating fluid disturbances which might either affect or delay the viscosity measuring process . often when a fluid in a laboratory container is being processed , it is desirable to take a viscosity measurement at different points in the process . the fact that the laboratory vessel contains the viscosity measuring ball permits a viscosity measurement to be rapidly taken with a minimum interruption to the process . for some processes , such as one where blood is separated into a plasma and a cellular fraction within the vessel , it is important to be able to take the viscosity measurement without remixing the components in the vessel more than is necessary . if the vessel is inverted to raise the ball to the top of the vessel , excessive mixing of the fluid will occur . fig4 illustrates a measuring support member for use with the container 10 which will provide a viscosity measurement while minimizing any disturbance of the fluid within the container . the test tube 11 is held at an angle θ ° by angular support member 38 to avoid the problems associated with the inversion of test tube 11 . specifically , angular support member 38 is shaped to accommodate the particular container 10 . a curved support surface 39 is provided to adequately support the bottom and an arcuate section of the sidewall of the test tube 11 . although angular support member 38 may be fabricated from any conventional material , it is preferably constructed of a plastic material such as plexiglas . spaced electromagnets 40 are mounted within the angular support member 38 and extend along the support surface 39 thereof to contact the outer surface of test tube 11 . fig5 shows the electric circuit 50 for the angular support member 38 . this electric circuit includes the electromagnets 40 which create a ladder running vertically upward from the bottom of the support member to a point adjacent the top . the top electromagnet will be positioned at the drop point for the spherical ball 16 . moreover , the electromagnets 40 run in an arcuate path to avoid sensors 46 and 48 which are mounted in the support member 38 so as to contact the wall of the container 10 . the sensors are placed at a known distance apart to determine the speed of spherical ball 16 as it travels down the wall of test tube 11 . these sensors are not limited to photoelectric sensors , but may be magnetic , capacitance , inductance or other suitable sensors as long as they are capable of detecting the displacement of spherical ball 16 . a power source 52 is provided on one support member 38 and is connectable in parallel to electromagnets 40 . the circuit to each electromagnet 40 from the power sources is sequentially completed by a slide switch 54 contacting a connector 56 of each electromagnet . slide switch 54 is shown as a manually operated switch , but the switch may be motor driven to automatically provide sequential energization to each of the electromagnets 40 . a flexible cable 58 is provided to allow freedom of movement along the side of angular support member 38 . as referred to above , the concept of measuring the viscosity of a fluid held within a container without requiring the drawing of a sample may be accomplished in a variety of ways . the embodiment of fig6 illustrates a second device 61 for determining the viscosity of a fluid which does not require the inversion of the container and allows a viscosity sensitive member to be present within the container during shipping . specifically , an erlenmeyer flask 62 is provided with a flask stopper 64 to seal fluid 66 from the atmosphere . flask 62 is made to include a rotating member 67 which is located centrally within flask 62 . rotating member 67 is designed to be nonsymmetrical . it includes a permanent magnet 68 from which shafts 70 extend on opposite sides thereof . weighted balls 72 are attached to each end of shafts 70 to complete the rotating member . the weighted balls may be substituted by paddles or the like depending upon the fluid tested . flask 62 is designed to rest upon platform 74 . platform 74 includes a dc shunt motor with speed reducer 76 which is equipped with a rotating shaft 78 to which a magnet 80 is attached . the rotation speed of the motor 76 as well as the rotating member 67 by means of the magnetic coupling between magnets 68 and 80 is controlled by adjusting the dc voltage to motor 76 from dc power supply 82 . finally , a microprocessor 84 may be connected to power supply 82 to calculate torque from the armature current maintained in motor 76 and for calculating the viscosity of fluid 66 using the torque and the rotational speed of the motor and speed reducer 76 . the concept of the present invention may be used in a variety of fields . one such area in which the simple design illustrated in fig1 may be used is in the area of blood analysis . whole blood and plasma viscosities are physical properties that are not routinely determined , yet these measurements help to indicate the state of patient health which may be valuable to health professionals . use of the present invention would not interfere with other measurements for the same blood sample , such as for hemoglobin , electrolyte levels , etc . because no sample is required and the blood can remain free from contaminants . the present invention provides spherical ball 16 to be placed into a blood - collecting tube before the tube is sterilized , sealed and evacuated . the method for determining viscosity is the well - known stokes &# 39 ; law principle that the velocity of a sphere falling by gravity is inversely related to the viscosity . referring to fig1 the velocity of the falling or the elapsed time for spherical ball 16 to travel between point 20 and point 22 , a known distance apart , d , along the length of test tube 11 . various methods to sense displacement of the ball between the two points can be used , such as visually , optical sensors , magnetic sensors or the like . the container 10 can be calibrated by measurements of elapsed time when operated with other reference liquids of known viscosity and the viscosity of the blood can then be calculated from the elapsed time , the distance between the two points , the absolute density of the blood and the ball and the diameter of the ball and the collecting tube . because the density of the fluid may not be known , at least two spheres of known density can be used in the fluid . each sphere can be made to fall or roll and the velocities obtained can be inserted into an equation such as equations ( 1 ), ( 2 ) or a calibration equation . these equations can be solved simultaneously to reach values for both the density and the relative viscosity of the fluid . measurements can be made with the tube in a vertical position or inclined at any angle where the ball can freely roll . repeat determinations by simply inverting the tube or by use of a magnet to manipulate spherical ball 16 , constructed at least partly of magnetic materials , are also possible . the operation of apparatus 1 shown in fig4 and 5 is very simple to perform . after the fluid has been introduced into test tube 11 which is properly sealed with stopper 14 , power source 52 energizes slide switch 54 beginning at lower portion 42 to engage spherical ball 16 . successive connectors 56 are contacted as slide switch 54 moves vertically up angular support member 38 , gradually raising spherical ball 16 to upper portion 44 . when it has reached the drop point at upper portion 44 , the uppermost electromagnet 40 is de - energized to release spherical ball 16 to allow it roll down the inner wall of test tube 11 and pass over sensors 46 and 48 , successively . the time at which the ball passed sensors 46 and 48 is inputted to microprocessor 60 to determine the translational velocity , v , of spherical ball 16 . using this speed determination , microprocessor 60 can calculate the viscosity of the fluid . the apparatus may be initially calibrated using a fluid of known viscosity to set the appropriate parameters and constants used in the stoke &# 39 ; s equation discussed in the background . the operation of device 61 , represented in fig6 is based on similar principles . again fluid 66 is introduced into flask 62 which has been presealed with flask stopper 64 . when a viscosity measurement is desired , motor 76 which is mounted within a platform 74 is activated to cause a rotating shaft 78 to begin movement . a magnet 80 is secured to shaft 78 and magnetically coupled to a permanent magnet 68 for a rotating member 67 which will turn in relation to the torquing force provided by the motor 76 . the rotating member is caused to rotate at a number of constant speeds and includes spherical balls 72 connected to magnet 68 by arms 70 . the torque is calculated from the armature current provided by power supply 82 to the motor and speed reducer 76 required to cause the rotating member 67 to reach each constant speed . these measurements are input to microprocessor 84 . the viscosity of fluid 66 is calculated from the torque required for each constant speed by appropriate mathematical relations stored within microprocessor 94 , or microprocessor 84 can be calibrated by measuring the torque and speed for a number of fluids of known viscosity and comparing those to the parameters input for fluid 66 . the balls 72 may be constructed in the same manner as the balls 16 previously described , and the rotating member 67 is shipped with the container 61 . the advantages of this embodiment , as well as the first embodiment described above , is avoiding the need to remove a sample of the fluid for measurement with conventional viscometers . another advantage is to permit viscosity measurements in closed containers while avoiding a change of pressure caused by opening the container to the atmosphere or causing contamination of the fluid in the container . moreover , because spherical ball 16 can be designed as a composite , these measurements may be accomplished in ordinary laboratory containers , and spherical ball 16 will have a sufficient diameter for displacement detection by conventional sensors while also protecting the container from damage during shipping . by providing containers with components prepackaged therein , viscosity measurements may be calculated more often for one particular fluid . moreover , determining viscosity of the fluid within its original container will greatly decrease the possibility of agitating the fluid while transferring it from another container which may result in a false viscosity determinations . referring now to fig7 and 8 , the tube 10 may be modified to provide a device for measuring the relative viscosity of a supernatant liquid which remains after centrifuging or settling of a fluid to separate suspended particles in the fluid . as shown by fig7 a circular disc 86 including an open mesh 88 is spaced above the bottom of the container 10 . this disc can be held in position by any known means , such as a rubber seal around the outer peripheral edge of the disc or by fingers or ridges formed in the glass inner surface of the container . the disc may also be positioned by three legs 90 extending from the disc at 120 ° intervals . when liquid , such as blood , is contained in the container 10 of fig7 it may be centrifuged in the container to separate the red blood cells . during centrifugation , test tubes are normally positioned at an angle of 33 °- 40 ° from the vertical , and the red blood cells would pass through the mesh 88 and be collected below the disc 86 . since the disc is formed to prevent the ball 16 from reaching the material below the disc , the ball may be used to obtain a viscosity measurement of the fluid remaining above the disc . to prevent the ball 16 from becoming coated with a residue such as settled red blood cells within the container 10 during centrifugation , the container is formed with inwardly projecting fingers or ridges 92 which angle toward the closure 14 . these projections may be formed from the glass used for the container wall and operate to cradle the spherical ball 16 above the liquid in the container and between the container wall and the projections during centrifugation . the ball may be raised magnetically and deposited in the space between the projections and the container wall as shown in fig7 and 8 . after the centrifugation process is complete , the ball may be dislodged from the projections magnetically . the test tube or container 10 may also be formed with spaced projecting fingers 94 to retain the ball 16 above the bottom of the container as illustrated in fig8 . these projecting fingers formed from the glass sidewall of the container may extend into the tube for a sufficient distance to preclude passage of the ball 16 . however , particulate material or materials suspended in fluid , such as red blood cells , can fall between the fingers to the bottom of the container . in some cases , the fingers 94 can be formed to project into the container 10 for only a small distance . to prevent the ball 16 from passing between the fingers , the disc 86 without the legs 90 would be inserted to rest upon the fingers . the foregoing detailed description of the invention is considered exemplary in nature , and it should be appreciated by those skilled in the art that the invention may be practiced otherwise than as specifically described herein without departing from the spirit and scope of the invention . it is , therefore , to be understood that the spirit and scope of the invention be limited only by the following claims . | 6 |
the present invention provides a real - time monitoring system for determining potential loss exposure to hazards . more particularly , this system can be used to monitor virtually any location ( or any number of locations ) for any hazard ( or any group of hazards ) for which hazards data are available . furthermore , this system can be used to predict , by location ( e . g ., by address , by targeted geographic region , by latitude / longitude , by specific x , y coordinates , by census blocks , by geographic boundary lines , etc . ), the potential loss exposure from specific hazard events such as floods , hurricanes , tornadoes , etc . in addition , this new system can be integrated with existing database , analysis and / or visual display systems so as to provide users with dramatically - enhanced levels of information . for the purposes of the present application , the real - time system for monitoring hazards and determining potential loss exposure from those hazards will sometimes hereinafter be referred to as the “ insmap ™ system ”, which refers to one application of the novel system being developed by the harvard design & amp ; mapping division of first american real estate solutions , llc . among other things , the insmap ™ system permits the user to aggregate numerous , but disparate , hazards data sets across broad geographic regions , extract selected hazards data according to user - specific needs , and then utilize the extracted hazards data for modeling purposes so as to determine potential loss exposure resulting from hazard events . by way of example but not limitation , the insmap ™ system permits an insurance underwriter to monitor a real estate portfolio with respect to one or more specific natural hazards ( e . g ., flooding and high winds ) so as to determine potential financial losses resulting from the occurrence of the monitored hazards . in one preferred form of the invention , the insmap ™ system provides three major data products for the user : 1 . portfolio monitoring web services ; 2 . hazard analysis reports ; and 3 . data streams . users provide the insmap ™ system with single locations or entire portfolios of locations for periodic ( e . g ., daily or hourly or “ as it happens ”) analysis vis - a - vis all of the hazards which are being monitored by the insmap ™ system . the specific locations to be monitored may be specified in the form of addresses , geographic regions , longitude / latitude coordinates , specific x , y coordinates , census blocks , geographic boundary lines , etc . there is no limit to the number of locations which may be monitored or to the areas which may be monitored ( e . g ., the system may provide worldwide coverage ). users also provide the insmap ™ system with data regarding entities associated with those locations , e . g ., users provide the insmap ™ system with financial attributes , property characteristics , location - specific information and other data regarding properties and / or populations associated with those locations . the insmap ™ system then , periodically ( e . g ., daily or hourly or “ as it happens ”), automatically reports to users on the hazards affecting the monitored locations and on the potential loss exposure to the entities associated with the monitored locations ( e . g ., the financial loss exposure to properties and / or populations associated with the monitored locations ). users provide the insmap ™ system with single or multiple locations to be monitored , with data regarding the properties ( and / or populations ) associated with those locations , and identify parameters for which these locations are to be monitored , e . g ., a specific date , a specifically - named hazard event ( e . g ., hurricane katrina ), or some other parameter . the insmap ™ system then provides the user with a hazard analysis report on the potential loss exposure to the properties and / or populations associated with the monitored locations . the hazard analysis report may be provided to the user as an xml database , as a fully populated pdf report form , or in another format desired by the user . users provide the insmap ™ system with single or multiple locations to be monitored , and identify parameters for which these locations are to be monitored , e . g ., a specific date , a series of dates , a specifically - named hazard event ( e . g ., hurricane katrina ), or some other parameter . users then receive a data stream from the insmap ™ system which has been pre - processed to include only that hazards data which is relevant to ( i ) the monitored locations , and ( ii ) the pre - determined parameter . for example , a user might specify that they wish to receive precipitation data , but only for selected property locations and only when the precipitation meets a certain pre - determined threshold , e . g ., rainfall which exceeds 3 inches in a 72 hour period . the insmap ™ system then creates a pre - processed data stream which is pushed to the user &# 39 ; s system for integration into the user &# 39 ; s own analysis processes . as noted above , the insmap ™ system is a real - time system for monitoring hazards and determining potential losses and other exposure resulting from those hazards . data processing within the insmap ™ system involves identifying ( i ) the specific locations which are to be monitored , ( ii ) the properties and / or populations which are associated with the monitored locations , ( iii ) the hazard event ( s ) which are to be considered for the monitored location , and then reporting estimated losses and other exposures for the monitored locations based upon the hazards criteria being considered . the functionalities of the insmap ™ system can generally be classified into four categories : 1 . data gathering ; 2 . data processing and geospatial analysis ; 3 . data distribution ; and 4 . hazard reporting and presentation . fig1 illustrates how the insmap ™ system collects , analyzes and reports hazards data . the insmap ™ system collects hazards data on a wide variety of different hazards from numerous , disparate data sources . by way of example but not limitation , the insmap ™ system collects hazards data relating to floods , hail , intense winds , hurricanes , tornadoes , earthquakes , wild fires , etc . from government agencies such as noaa and fema and from commercial sources such as aviation weather services , nautical weather services , etc . and makes this data available for seamless harvesting according to user - specific criteria . in one preferred form of the invention , the insmap ™ system gathers hazards data through three major channels : ftp / secure ftp . external data providers ( e . g ., government agencies , commercial sources , etc .) deposit hazards data in pre - structured file directories of ftp servers . the insmap ™ system periodically scans the file directories of these ftp servers and downloads the desired hazard data sets into a server provided by the insmap ™ system . remote web service / api . the insmap ™ system periodically sends requests across the web to remote servers to request hazard data sets from data providers . these requests are compatible with the api ( application programming interface ) specifications of the data providers so as to facilitate automatic retrieval of the requested hazard data sets for incorporation into the insmap ™ system . remote web content . the insmap ™ system periodically extracts hazard data sets from the web content available from remote web sites ( e . g ., www . usgs . gov , www . nws . noaa . gov , etc . ), and converts the acquired information into usable data formats for incorporation into the insmap ™ system . in addition to the foregoing , the insmap ™ system also permits the user to specify those geographic locations which are to be monitored . furthermore , the insmap ™ system also gathers data with respect to the entities ( e . g ., properties and / or populations ) associated with the user - specified locations which are to be monitored . data regarding the properties and / or populations associated with the user - specified locations may be provided to the insmap ™ system by the user , or this data may be acquired from other sources ( e . g ., government agencies , private sources , etc .). again , the afore - mentioned ftp / secure ftp , remote web service api , and remote web content approaches may be used when acquiring data relating to ( i ) the user - specified geographic locations which are to be monitored , and ( ii ) the properties and / or populations associated with those user - specified locations . as noted above , the insmap ™ system is provided with ( i ) the geographic locations which are to be monitored , ( ii ) data regarding the properties and / or populations associated with those locations , and ( iii ) hazard data sets relating to those locations . the insmap ™ system then automatically overlays the hazards datasets affecting the monitored locations and determines the potential hazards exposure to properties and / or populations associated with the monitored locations . in one preferred form of the invention , the insmap ™ system provides this functionality through four major processes : data loading . the insmap ™ system is loaded with ( i ) the geographic locations which are to be monitored , ( ii ) data regarding the properties and / or populations associated with those locations , and ( iii ) hazard data sets relating to those locations . when new hazards data reaches the insmap ™ system the insmap ™ system automatically executes database scripts to load or append the new hazards data into a hazard database maintained by the insmap ™ system . in one preferred form of the invention , the insmap ™ system has its hazards database configured using the spatial ™ software component available from the oracle corporation . since this new hazards data is automatically loaded into the oracle ® spatial ™ database maintained by the insmap ™ system , the insmap ™ system is immediately capable of conducting comprehensive spatial analysis with respect to the loaded hazards data ( e . g ., earthquakes , severe winds , etc .) against the monitored locations . data filtering . the insmap ™ system is configured to filter the hazards data by pre - defined thresholds relating to the severity of a hazard and / or the risk associated with a hazard . the pre - defined thresholds for different hazard events are stored in tables maintained by the insmap ™ system . geospatial impact analysis . the insmap ™ system is configured to analyze hazards data and determine whether a monitored location will be impacted , i . e ., if , and to what extent , a hazard will affect the monitored location . lists of the impacted locations can be sent to a user &# 39 ; s application program ( e . g ., an application of the sort available from veros software inc .). the insmap ™ system is also configured to analyze hazards data vis - à - vis the monitored locations , and the entities ( properties and / or populations ) associated with those monitored locations , and determine potential losses and other exposure resulting from occurrences of hazards at the monitored locations . the results of this analysis can then be sent to users as reports . data packaging . the insmap ™ system allows a user to specify a desired format for data being sent to the user . the insmap ™ system is configured to automatically convert , as necessary , any data being sent to the user in order to comply with the user &# 39 ; s specified data format . the insmap ™ system is configured so that data may be distributed to the users in a variety of ways . in one preferred form of the invention , the insmap ™ system is configured to distribute data to the users via the following three ( independent ) approaches : upload the filtered data sets to a user &# 39 ; s servers ; load the filtered data sets into a user &# 39 ; s remote geospatial database servers ( optional ); send a notification of hazard events to a user or a user &# 39 ; s web service . upload the filtered data sets to a user &# 39 ; s servers . based on customer - defined thresholds for hazard events , the insmap ™ system uploads the filtered hazard data sets to a user &# 39 ; s servers through a secure ftp service . preferably , the filtered hazard data sets are uploaded in a gis data format ( e . g ., the shape file format of environmental systems research institute , inc . ( esri ®), or the spatial ™ file format of the oracle corporation , etc .). load the filtered data sets into a user &# 39 ; s remote geospatial database servers ( optional ). the insmap ™ system also has the ability to execute database scripts to automatically load the filtered hazard data sets directly into a user &# 39 ; s geospatial databases ( e . g ., an oracle ® spatial ™ database or an esri ® sde geo ™ database ). after the hazard data sets are loaded into a user &# 39 ; s database , the user &# 39 ; s own application software can run various analyses and view the hazard data with the user &# 39 ; s own portfolio . send a notification of hazard events to a user or a user &# 39 ; s web service . based on user - defined thresholds for hazards data , the insmap ™ system sends a hazards alert ( e . g ., in the form of an xml document ) to a user &# 39 ; s e - mail service or to a user &# 39 ; s web service . the hazards alert identifies all monitored locations for which a monitored hazard event exceeds the pre - defined thresholds . users may then use this information to identify impacted entities ( e . g ., properties and / or populations ) and apply additional logic into their analyses ( e . g ., apply additional business logic to insurance underwriting analyses , etc .). as noted above , the insmap ™ system is loaded with ( i ) the geographic locations which are to be monitored , ( ii ) data regarding the properties and / or populations associated with those locations , and ( iii ) hazard data sets relating to those locations . the insmap ™ system then reports determined hazard exposure for the monitored locations based upon the hazards criteria being considered . in one preferred form of the invention , the user provides the insmap ™ system with the geographic locations of a portfolio of properties or other insured entities ( e . g ., individuals ), and with data regarding the properties and / or individuals related to those locations . the insmap ™ system then overlaps the targeted geographic locations with filtered hazards data . this may be done either periodically ( e . g ., daily ) or on demand . by way of example but not limitation , users may submit single or multiple locations to the insmap ™ system via ftp for analysis on demand , or users may deposit an entire portfolio of properties on the insmap ™ system servers for continuous ( e . g ., hourly ) overlay analysis . the insmap ™ system is then configured to automatically generate reports predicting losses for the monitored locations based upon the hazards criteria being considered . the insmap ™ system then provides these reports to the user for use in user - specific applications ( e . g ., insurance underwriting applications ). by way of example but not limitation , the insmap ™ system is configured to issue hazard analysis reports which predict losses for monitored locations based upon the occurrences of hazard events which exceed a pre - determined threshold . by way of further example but not limitation , users identify single or multiple locations to be monitored to the insmap ™ system via standard http protocols , and receive back fully - developed pdf reports with hazards information , including proximity to a hazard event , imagery and / or other data , or the users receive back an xml document from which the users can build their own reports . the insmap ™ system is preferably configured to include a variety of pre - configured hazard analysis reports templates . by way of example but not limitation , appendix a lists a number of exemplary hazard analysis reports and the data contained in each . of course , many other types of pre - configured hazard analysis reports may also be provided . additionally , the insmap ™ system is preferably configured to permit the use of user - defined hazard analysis reports . appendix b shows various exemplary screen displays which may be used to provide information to a user . again , the insmap ™ system is preferably configured to permit the use of various other screen displays . among other things , if desired , the system can be configured to provide the user with news alerts pertinent to the monitored locations and / or the hazard parameters specified by the user . in one preferred form of the present invention , as each monitored location is entered into the system , using any desired specification approach ( e . g ., by address , by targeted geographic region , by latitude / longitude , by specific x , y coordinates , by census block , etc . ), that location is geocoded ( i . e ., provided with a standardized insmap ™ x , y coordinate ). similarly , as property and / or population data associated with a monitored location is entered into the system , this property and / or population data is indexed according to the standardized insmap ™ x , y coordinate system . furthermore , as hazards data is entered into the system , this hazards data is indexed according to the standardized insmap ™ x , y coordinate system . thus , even though numerous kinds of data is drawn from a variety of disparate databases , the insmap ™ system is capable of collecting , analyzing and reporting information on a consistent basis . see , for example , fig2 . as noted above , the present invention preferably comprises an analytical engine for determining potential loss exposure to the entities associated with the monitored locations due to the occurrence of hazards at the monitored locations . more particularly , and looking now at fig3 , the analytical engine ( i ) permits the user to specify the geographic locations to be monitored , ( ii ) permits the user to specify hazard parameters to be monitored for the monitored locations , ( iii ) obtains hazards data for the monitored locations , ( iv ) obtains data regarding entities associated with the monitored locations , and ( v ) determines potential loss exposure to the entities associated with the monitored locations due to the occurrence of the hazards at the monitored locations . by way of example but not limitation , a user might specify the metropolitan houston area as the geographic location to be monitored , and specify rainfall in excess of 3 inches per hour , and winds in excess of 30 miles per hour , as the hazard parameters to be monitored for the monitored location ; and the analytical engine then obtains hazards data for the monitored location , obtains data regarding insured real estate associated with the monitored location , and then determines potential loss exposure to the insured real estate associated with the monitored location due to the occurrence of the specified hazards at the monitored location . as noted above , the analytical engine determines potential loss exposure to the entities associated with the monitored locations due to the occurrence of the hazards at the monitored locations . in this respect , it should be appreciated that the aforementioned entities may constitute substantially any entities associated with the monitored locations . by way of example but not limitation , the aforementioned entities may comprise ( i ) fixed real estate or other stationary structures or equipment located at the monitored locations ( e . g ., a building or house , a fuel storage facility , a pipeline , a water tower , a cooling tower , electrical lines , an airport , a port facility , a real estate feature such as farmland , a mine , a lake , a canal , landscaping , etc . ), ( ii ) movable equipment located at the monitored locations ( e . g ., a ship , an airplane , a barge , a train , a truck , a mobile home , mining equipment , manufacturing equipment , etc . ), ( iii ) populations located at the monitored locations ( e . g ., human beings , livestock , wildlife , etc .) etc . where the entity is mobile ( e . g ., a ship or a member of a population ), association of the entity with a given geographic location may be established by tracking devices attached to the entity ( e . g ., a tracker attached to a ship or an ankle bracelet attached to an individual ). alternatively , association of the entity with a given geographic location may be established by home base ( e . g ., the home base of a ship ) or by domicile ( e . g ., the domicile of an individual ). furthermore , it should be appreciated that the entities may be of interest for a variety of reasons . by way of example but not limitation , the entity may be of interest to a government authority managing emergency situations ( e . g ., the federal emergency management agency when charting the path of a hurricane ), an insurance company ( e . g ., a commercial insurer assessing underwriting risks associated with insured real estate in a flood zone ), etc . in one preferred form of the invention , the insmap ™ system uses the system architecture shown in fig4 . the insmap ™ system provides a foundation for collecting , analyzing and reporting hazard data sets . the insmap ™ system can be used in conjunction with other data products . by way of example but not limitation , the insmap ™ system can be used in conjunction with other data products offered by first american real estate solutions , llc . see fig5 , which displays a few high level concepts for integrating the insmap ™ system with other data products offered by first american real estate solutions , llc . it will be understood that many changes in the details , materials , steps and arrangements of parts , which have been herein described and illustrated in order to explain the nature of the invention , may be made by those skilled in the art without departing from the principles and scope of the present invention . | 6 |
referring now to the drawings , wherein like reference numerals designate identical or corresponding parts throughout the several views , and more particularly to fig2 thereof , there is seen schematically the multiple beam fourth generation ct scanner according to the invention which includes a stationary detector ring 10 formed of plural groups 12 1 through 12 n of individual detectors , with the detectors of each group designated by the reference numerals 14 1 through 14 j . an x - ray source having a schematically illustrated focal spot 16 is disposed within the detector ring and irradiates with x - ray radiation a cross - sectional slice of a patient 18 , the cross - sectional slice schematically illustrated in fig2 as the patient circle 20 . disposed between the x - ray source focal spot 16 and the patient circle 20 is a prepatient collimator 22 having a plurality of collimator apertures 24 1 through 24 n , with each collimator aperture 24 n corresponding to a respective detector group 12 n . as shown in fig3 during a scan , the locus of the x - ray source focal spot 16 defines a circle having a smaller diameter than that of the detector ring . if the focal spot 16 moves clockwise through an angle θ , the collimator 22 is rotated counter - clockwise about the x - ray tube focal spot 16 so that the focal spot 16 and a given collimator aperture 24 n and a corresponding detector group 12 n remain aligned . the angular relationships are depicted in fig3 where φ is the counter - clockwise rotation of the collimator 22 about the focal spot , r is the radius of the circular focal spot locus and r is the radius of the detector ring . assuming that the focal spot 16 and a given collimator aperture 24 n and detector group 12 n are aligned initially ( θ = φ = 0 °), they will also be aligned subsequently when θ and φ are related to the transcendental equation generally , each collimator aperture 24 is sufficiently large so that regardless of the collimator rotation angle φ , the primary x - rays reaching the patient 18 and which are defined by the collimator aperture 24 impinge completely over the entire respective detector group 12 with little overlap , thereby maximizing the radiation dose efficiency to the patient . it is , however , noted that between the initial location and the position given by the angles defined by equation ( 2 ), the collimator aperture will be slightly misaligned with the focal spot and the detector group . however , for practical situations ( i . e ., θ - φ = 10 °; r = 66 cm ; and r = r ·√ 3 ) and detector groups having 3 . 5 cm of arc , the misalignment is extremely small and results in a negligibly small loss of primary x - rays defined by the collimator . a greater loss of primary x - rays results from the unsharpness at the detector group . however , for a 40 cm focal spot - to - collimator distance , a 0 . 4 mm focal spot , and the geometry defined above , the total loss of primary x - rays is approximately 5 %. nevertheless , according to the multiple beam ct scanner of the invention employing a prepatient collimator , the prepatient collimation itself is advantageous since the detector groups are on the order of centimeters and large compared to the collimator unsharpness . that is , whenever the dimension , l , to be defined at the detector ring by a prepatient collimating diaphragm is larger than the projected unsharpness of the diaphragm edge u g , then prepatient collimation will result in a significant improvement in the geometrical efficiency with little loss in detected x - ray flux for a given technique . expressed mathematically , the condition is wherefore focal spot size a , and magnification m , u g is given by where the magnification , m , is defined as the distance from the focal spot to the detector divided by the distance from the focal spot to the collimator . for scanners in which the focal spot lies closer to the patient circle than to the detector ring or midway between prepatient collimation close to the patient circle 20 can be achieved by the configuration illustrated in fig4 . in fig4 the collimator 22 of the invention is shown rotating in the manner shown in fig2 about an axis that passes through the x - ray tube focal spot 16 and is parallel to the long dimension of the detectors 12 . the collimator 22 has a cylindrical shape with the collimating apertures 24 being rectangles which are slightly larger than the size of the detector groups 12 projected back to the collimator 22 . the slightly larger collimator aperture size allows for the slight misalignment discussed previously that occurs during a scan between the focal spot 16 and any given detector group 12 . in order to achieve prepatient collimation close to the patient when the focal spot 16 is positioned closer to the detector ring 10 than to the patient circle 20 , the collimator 22 of the invention in such a configuration employs a tilted frustum design as illustrated in fig5 and 6 . in fig5 the tilted frustum collimator 22 of the invention is shown rotating about an x - ray source 16 and the detector ring 10 , in the manner shown in fig3 . on the other hand , in the embodiment shown in fig5 the tilted frustum collimator 22 of the invention can otherwise be rotated around the center of the patient circle . in the embodiments as noted above , the goal is to locate the collimator 22 as close as possible to the patient , with the collimator aperture 24 disposed in a direct line between the x - ray source 16 and the patient 18 defining a plane perpendicular to this direct line between the x - ray source 16 and the patient 18 . it has been found that the employment of an x - ray tube having a small focal spot in combination with collimator apertures defining a beam of greater than one cm reduces penumbra problems and correspondingly enhances the overall system resolution . it should be understood that the scanner of the invention additionally employs a collimation that determines the beam slice thickness . in prior art scanners the slice thickness is variable , either continuously or in a series of discrete steps . for example , in the ge ct / t 8800 scanner one has a choice of 5 or 10 mm thick slices . in the multiple beam scanner according to the invention slice thickness collimation is not novel and is accomplished in a manner similar to that of the prior art . in fig7 is shown another embodiment of the invention in which the individual detector groups 12 track the focal spot 16 during the revolution of the focal spot 16 around the patient , such that x - ray radiation from focal spot 16 is incident at essentially a 90 ° angle on each detector aperture of the tracking detector groups . in fig7 focal spot position is monitored by a conventional position detector 100 , the output of which is applied to a conventional decoder 102 . decoder 102 converts focal spot position data 104 obtained from detector 100 into respective position tracking signals 106n which are applied to a servo drive unit 108 which outputs respective positioning drive signals 110 n to each of the detector groups 12 n , to maintain tracking of the detector groups 12 n as the focal spot revolves around the patient . the fig7 embodiment allows the use of gas or low atomic number solid state detectors , whereas current detectors employed in 4th generation geometries necessarily have a high x - ray stopping power ( i . e ., a high density and atomic number ). nextly , the theory and terminology for analyzing the performance of the ct scanner of the invention in comparison with that of prior art third and fourth generation ct scanners and the emi 7000 series discussed above is presented . important parameters of ct scanner performance are dose efficiency and resolution . the dose efficiency , ε rad , is defined as the ratio of detected x - ray photons to those emerging from the patient and is equal to product of the geometrical detection efficiency , ξ geo , and the detector &# 39 ; s x - ray conversion efficiency ξ con , or ξ geo is the ratio of the sensitive detector area to the area that x - rays emerging from the patient impinge on , and ξ con is the fraction of x - rays incident on the sensitive detector area that is detected . for a given type of patient compensating filter and x - ray beam quality the patient radiation absorbed dose of a ct scanner is proportional to the number of detected photons , n det , divided by the dose efficiency , or that is , for a given number of detected x - rays patient dose is inversely related to the scanner &# 39 ; s dose efficiency . ξ rad , ξ geo and ξ con are tabulated in table i for the three prior art ct scanners discussed above . the data in table i indicates that the emi 7000 series scanner has the best dose efficiency . the dose efficiency of the 3rd generation ge ct / t 8800 scanner is limited by the x - ray conversion efficiency of its detectors ; while the dose efficiency of 4th generation ohio nuclear δ - scan 2020 is limited by its geometrical detection efficiency . table i______________________________________geometrical , conversion and dose efficienciesfor prior art ct scanners detectionmanufacturer geometrical conversion doseand unit efficiency , % efficiency , % efficiency , % ______________________________________ohio nuclear 50 100 50δ - scan 2020ge ct / t 8800 74 73 54emi 7000 78 90 70______________________________________ as noted previously , the resolution ( i . e ., the highest spatial frequency that can be resolved ) of a ct scanner is limited by either the sampling nyquist frequency f s , the cutoff frequency of the detector aperture f a , or the nyquist frequency of the pixel display f p , with the algorithm cutoff frequency f c generally matched to the limiting factor . for a distance d between samples ( measured at the detector ), the well known sampling theorem indicates that the highest spatial frequency that can be resolved is given by the sampling nyquist frequency . expressed at the center of the reconstructed image ( i . e ., the pivot point ) the sampling nyquist frequency f s is where m is the geometrical magnification factor of the pivot point and is given by the x - ray source - to - detector distance divided by the x - ray source - to - pivot distance . the cutoff frequency expressed at the pivot point for a detector aperture of width w is and the nyquist frequency of the pixel display comprised of square elements of dimension p is the geometrical dimensions and associated cutoff frequencies are tabulated in table ii and iii for three prior art ct scanners . as discussed previously , the factor limiting the resolution of the 4th generation ohio nuclear δ - scan 2020 is its effective detector aperture width ( i . e ., w / m ) and its resolution can only be improved by reducing this parameter . generally , if smaller detectors or a greater magnification is employed , either more detectors are required or a greater dead space occurs between detectors . the former would increase the cost of the system while the latter would reduce its dose efficiency . table ii______________________________________pertinent data for prior art ct scanners______________________________________ focus - to - det . pivot focal detector det . cut - manufacturer dist . point spot aperture frequencyand unit ( cm ) mag . ( mm ) ( mm ) ( cm . sup .- 1 ) ______________________________________ohio nuclearδ - scan 2020 153 . 1 2 . 48 0 . 6 4 6 . 2ge ct / t 8800 110 . 7 1 . 42 1 . 2 0 . 90 15 . 8emi 7000 107 . 9 1 . 62 0 . 6 1 . 79 9 . 1______________________________________ pixel sampling sam . nyquist pixel nyquistmanufacturer distance frequency size * frequency * and unit ( mm ) ( cm . sup .- 1 ) ( mm ) ( cm . sup .- 1 ) ______________________________________ohio nuclearδ - scan 2020 0 . 62 20 0 . 5 10ge ct / t 8800 1 . 21 5 . 9 0 . 78 6 . 4emi 7000 0 . 85 9 . 5 0 . 75 6 . 7______________________________________ * head scan mode , i . e ., a 24 or 25 cm diameter patient circle the factor limiting the resolution of the 3rd generation ge ct / t 8800 scanner is its sampling distance . this distance is the detector - to - detector spacing and reducing it requires that effectively smaller detectors , and therefore more detectors , be employed . the variant 4th generation emi 7000 scanner employs more detectors ( 1 , 112 ) and its resolution in the head scan mode is limited by the pixel display . however , if a display incorporating smaller pixels , say - 0 . 5 mm , is employed , the resolution would also be limited by the effective size of its detector aperture . for further analysis of the factors affecting ct scanner resolution , reference is made to yester and barnes , &# 34 ; geometrical limitations of computer tomography ( ct ) scanner resolution ,&# 34 ; proc . society of photo - optical instrumentation engineers ( spie ), volume 127 , 1977 , pp . 296 - 303 . in addition to the number of x - ray photons comprising an image and the ct scanner &# 39 ; s resolution , the information contained in the image also depends on spatial frequency response of the ct scanner over the ranges of frequencies reconstructed . this is best described employing information theory and it has been shown by other investigators that the information capacity of a ct scanner is given by ## equ1 ## where n neq is the noise equivalent number of quanta comprising the reconstructed image , d is the diameter of the reconstructed image , mtf geo is the ct scanner &# 39 ; s geometrical modulation transfer function f is spatial frequency and f c is the scanner &# 39 ; s cutoff frequency . mtf geo depends on focal spot size , a detector width and the scanner &# 39 ; s geometry . it can be calculated for convention focal spots and detectors from the equation where sinc x =( sin x )/ x and f , a , m and w are as defined previously . for the derivation and further discussion of eqn ( 9 ) reference is made to wagner et al , &# 34 ; the application of information theory to the assessment of computed tomography &# 34 ;, medical physics , volume 6 , 1979 , pp . 83 - 94 . the integral in eqn . ( 9 ) has been defined as the information band width integral ( ibwi ), or ## equ2 ## as one would expect for a given cutoff frequency , the ct scanner with the greatest ibwi will produce superior images or images having a greater signal - to - noise ratio assuming all else equal . due to electronic , mechanical and other sources of noise , the noise equivalent number of quanta comprising the reconstructed image will be less than the detected number of photons . however , for well designed and adjusted scanners this difference will not vary widely from one scanner to another and one can write for the same size patient reconstruction circles . dividing eqn . ( 12 ) by eqn . ( 5 ), one obtains since it is desirable to obtain the maximum information for a given radiation absorbed dose , the right hand side of eqn . ( 13 ) defines a figure of merit for ct scanners . that is , table iii compares the ibwi &# 39 ; s and figures of merit for the three prior art ct scanners discussed above . table iii______________________________________cutoff frequencies , information bandwidth integral ( ibwi ) values and figures of merit for prior art ct scannersmanufacturer cutoff ibwi figure ofand unit frequency , cm . sup .- 1 cm . sup .- 1 merit , cm . sup .- 1______________________________________ohio nuclearδ - scan 2020 6 . 2 2 . 7 1 . 4ge ct / t 8800 5 . 9 4 . 9 2 . 6emi 7000 6 . 7 3 . 9 2 . 8______________________________________ eqn . ( 14 ) indicates that ct scanner performance can be improved either by increasing its dose efficiency , cutoff frequency or geometrical mtf . however , it is doubtful that with current x - ray detector technology that dose efficiencies greater than 70 % are possible for an array of small detectors . as discussed previously the cutoff frequency and mtf geo can be improved by employing smaller or effectively smaller detector apertures in 4th generation geometries and by reducing the sampling distance , which in turn depends on detector size , in 3rd generation designs . at present , it is questionable whether detector elements smaller than 0 . 9 mm for gas and 1 . 8 mm for solid state sensitive volumes can be fabricated with sufficiently good dose efficiency . however , no such problem exists when direct geometrical magnification is employed to reduce the effective detector size . pertinent data for improved scanner geometries and the multiple beam geometry based on the above consideration are tabulated in table iv . the detectors employed in the 4th generation scanner and multiple beam ct scanner according to the invention are assumed to be identical to those currently employed in the emi 7000 scanner . forty - nine groups of detectors were assumed for the multiple beam geometry with each group being comprised of fifteen detectors . in all cases a pixel size of 0 . 5 mm was assumed and the filter function cutoff frequency was taken to be equal to that of the pixel nyquist frequency except for the 3rd generation design where it was taken to be equal to the sampling nyquist frequency . table iv______________________________________pertinent data for improved ct geometries focus - de - sam - to - tector pling det . pivot focal aper - dis - cutoff dist . pt . spot ture tance freq . * ( cm ) mag . ( mm ) ( mm ) ( mm ) cm . sup .- 1______________________________________4thgeneration ( 2400detectors ) 149 . 9 2 . 36 0 . 6 1 . 79 0 . 78 103rdgeneration ( 793detectors ) 167 . 7 2 . 15 1 . 2 0 . 90 1 . 20 8 . 9multiplebeam ( 735detectors ) 180 2 . 73 0 . 4 1 . 79 0 . 90 10______________________________________ * 0 . 5 mm pixel size assumed in the following table v , the dose efficiencies , ibwi &# 39 ; s and geometrical figures of merit of the improved geometries are compared . table v______________________________________dose efficiencies , information bandwidth integral ( ibwi ) values and figures of merit for improved ct geometrical geometrical ibwi figure of merit , geometry efficiency cm . sup .- 1 cm . sup .- 1______________________________________4th generation ( 2400 detectors ) 70 5 . 4 3 . 83rd generation ( 793 detectors ) 54 5 . 7 3 . 1multiple beam ( 735 detectors ) 66 * 6 . 3 4 . 2______________________________________ * 5 % primary beam loss is due to prepatient collimation and penumbra effects due to the small focal spot and large magnification of the multiple beam geometry according to the invention , its ibwi , mtf geo and figure of merit is superior to that of the other proposed improved geometries which in turn are superior to those of the prior art scanners listed in table iii . the large magnification allowed with this geometry is due to the fact that a continuous ring of detectors is not required . if the multiple beam geometry were to employ the same specifications as the 4th generation geometry listed in table iv , its mtf geo would be identical . for further analysis of the comparative performance of other prior art ct scanners , reference is made to barnes et al , &# 34 ; optimizing computed tomography ( ct ) scanner geomerty &# 34 ;, proc . society of photo - optical instrumentation engineers ( spie ), volume 173 , 1979 , pp . 225 - 237 . fig8 the derivation of which is explained in detail in barnes et al ., supra , compares the performance of the multiple beam ct scanner according to the invention . for a 512 by 512 matrix a minimum of ( 512 ) 2 or 262 , 144 independent samples are required in order to reconstruct the matrix . the 0 . 895 mm sampling distance ( i . e ., one - half the detector aperture width as required by sampling theory ) and 2 . 73 magnification factor of the multiple beam geometry results in 780 samples per detector for a 25 . 6 cm diameter patient circle . the 735 detectors obtain 573 , 300 samples which is more than sufficient to reconstruct a 512 by 512 matrix . a variety of mathematical algorithms have been employed to reconstruct cross - sectional images from projections , and for further analysis of reconstruction algorithms , reference is made to brooks and dichiro , &# 34 ; principles of computer assisted tomography ( cat in radiographic and radioisotopic imaging &# 34 ;, physics in medicine and biology , volume 21 , 1976 , pp . 689 - 732 . from the above discussion , it is seen that the multiple beam ct scanner geometry according to the invention allows the use of a limited number of small detectors and data acquisition electronics . presently , the ct scanner of the invention envisions the use of 25 - 99 groups of detectors with each group consisting of from 10 - 60 detectors . in one preferred embodiment , 49 groups of detectors are employed , with each group consisting of 15 detectors . further advantages realized by the ct scanner geometry of the invention is the enhanced resolution due to the selection of detectors having small apertures , and the improved x - ray dose efficiency achieved by the prepatient collimation in which virtually all the x - rays that penetrate the patient are detected , further resulting in low noise scans for a given patient dose . accordingly , the improved multiple beam ct scanner geometry according to the invention results in reduced manufacturing costs while nevertheless yielding maximum information for a given patient radiation dose . high quality ap and lateral scan or scout views can also be obtained by the design according to the invention by placing additional groups of detectors in the appropriate position for the ap and lateral scan views . in that event , the additional detectors would only be used for these views and would then require inactivation of the multiple beam defining collimator . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described herein . | 0 |
fig1 shows a washing apparatus generally at 10 supported on an elevated frame 12 , comprising a superstructure 14 covered by panelling 15 the frame 12 has a plurality of level adjusting feet 13 which can be used to slope the entire apparatus 10 along its length . the apparatus 10 is fed fragments 16 from a fragment bin 18 via an auger or an auger - type material moving device 22 . the auger 22 lifts plastic fragments 16 up to an inlet trough 28 for entry into the apparatus 10 . the inlet trough 28 feeds fragments 16 into a rotatable tube 34 which is rotatably supported along its axis by the superstructure 14 . the superstructure 14 comprises along its length a plurality of longitudinally spaced apart bents 38 which each provide knee braces 40 which , in turn , have mounted thereon rollers 44 . each bent 38 mounts four such rollers 44 . the rolling tube 34 comprises a saddle 48 located at each bent 38 . the saddle 48 reinforces the rolling tube and provides a smooth surface for interaction with the rollers 44 . the saddle 48 is captured between four rollers 44 arranged in a quadrilateral pattern . the rolling tube 34 provides many perforations 50 therethrough sized and disposed to facilitate the passage of liquid and correspondingly sized particles . the tube 34 is axially rotated by a first drive means 51 which can be a drive roller arrangement such as described in fig3 with respect to the second drive means 250 . alternatively , as a first drive means 51 and as shown in fig1 the rolling tube 34 is rotated about its axis by a motor 54 communicating to a right angle gear box 56 , the gear box 56 turning a pulley 58 . the pulley 58 drives a belt 60 which is circumferentially wrapped around the rolling tube 34 . a tension adjuster 70 is utilized to take up slack in the belt and to provide smooth , non - slipping , and efficient communication of rotational power from the pulley 58 to the rolling tube 34 . the tension adjuster 70 as more clearly shown in fig2 comprises a spring 72 mounted by a bracket 74 to a top 14a of the superstructure 14 . the spring 72 acts upon a lever 76 pivotally mounted via a pin 78 to a side 14b of the superstructure 14 . the lever 76 has thereon mounted a counter - pulley or idler roller 80 which can move toward and press against the belt 60 . the spring 72 provides a resilient downward force upon the lever 76 which transmits this force via the idler roller 80 to the belt 60 , thus causing the belt 60 to remain tightly wrapped around the rolling tube 34 . mounted axially extending throughout the rolling tube 34 are a wash header 100 and a rinse header 102 . the wash header 100 and the rinse header 102 are constructed as a continuous span but having appropriate blockage or blinds 103 to prevent mixing of wash water and rinse water in the headers 100 , 102 . the headers are more fully described with respect to fig2 and 3 . the wash header 100 is fed via a wash pipe 108 from an outlet of a wash pump 106 . the rinse header 102 is fed via a rinse pump 110 through a rinse pipe 112 . below the elevated superstructure 14 and below the rolling tube 34 is arranged an effluent trough 118 . the effluent trough 118 receives in a first section 118a , wash water with residue which passes through the perforations 50 from the rolling tube 34 . the effluent trough 118 also receives in a second section 118b , rinse water with remaining residue from the rolling tube 34 . the first section 118a can be separated from the second section 118b by a partition 118c . the wash water with residue flows along the trough to an outlet drain 124 and into a screen separator 128 . residue and particles which do not pass through a screen 129 of the separator 128 are collected in a container 130 via a feed tube 132 . wash water which passes through the screen 129 passes into a tank 128a and is removed by gravity flow to a wash water tank 140 via a discharge line 138 . the separator 128 can be a commercially available vibrating screen type separator . the separator 128 is shown mounted on springs 128c to the base 128b , which houses a drive mechanism for the separator 128 . the wash pump 106 takes suction from the recycle tank 140 via a wash inlet line 144 . toward an outlet end of the apparatus 10 , the effluent trough 118 collects rinse water with any remaining residue from the perforations 50 of the rolling tube 34 and passes such through a second outlet drain 158 through a rinse effluent line 160 to a rinse water tank 166 . the rinse pump 110 takes suction from the rinse water tank 166 via a suction line 170 . the fragments 16 which enter the inlet trough 28 can be given a blast of hot or cold water at the inlet trough 28 from the wash pipe 108 or wash header 100 to help progress the fragments 16 into the rolling tube 34 . once inside the rolling tube 34 the fragments 16 proceed along the length of the rolling tube 34 as the rolling tube 34 rotates or revolves axially . the fragments 16 are washed both by spray from the wash header 100 and by an abrading action caused by the rolling of fragments over each other as the rolling tube rotates axially . the rolling tube 34 , in the preferred embodiment , is sloped from its inlet side 34a toward its outlet side 34b to assist continuous axial progression of the fragments 16 along the tube 34 . at the outlet side 34b a fragment trough 180 directs the fragments 16 downwardly into an outlet bin 184 . a second auger 186 transports the fragments 16 to a succeeding process step , in fig1 the second auger 186 transports the fragments 16 into a holding bin 188 . the outlet bin 184 can be used as a float separator . as show in fig3 fragments which float 16a can be separated from fragments which sink 16b . fig2 shows that the rolling tube 34 comprises at its inlet end 34a and annular plate 34c which prevents spillage of fragments 16 or water from out of the rolling tube 34 . the wash header 100 comprises three subheaders 100a , 100b , 100c . the three subheaders are interconnected by a tee pipe 100d . each of the subheaders 100a , 100b , 100c has progressing downwardly therefrom a plurality of spray nozzles 100e . the three subheaders 100a , 100b , 100c are structurally tied together by use of a plurality of rectangular or triangular gusset plates 100f which give the header pipes rigidity and truss - like bending resistance to span greater distances . fig3 shows the fragment trough 180 , stationary with respect to the superstructure 14 , in position to spill fragments 16 emerging from the outlet end 34b of the rolling tube 34 . the rinse water header 100 is shown connected to the rinse water pipe 112 . the rinse water header 102 can comprise an identical header configuration as the wash water header 100 . however , in the preferred embodiment the wash spray nozzles 100e of the wash water header 100 are arranged to span 57 % of the tube length while the rinse spray nozzles 102e of the rinse water header 102 are arranged to span the last 36 % of the tube length . the rinse water header 102 comprises three header pipes 102a , 102b , 102c , connected by a tee pipe 102d and tied structurally together by rectangular or triangular gussets 102f . rinse nozzles 102e proceed downwardly from the header pipes 102a , 102b , 102c . alternatively , as a simpler arrangement , the rinse water header 102 can comprise only the subheader 102a with a single row of rinse nozzles 102e . no tee pipes 102d would be required , simply vertical droplet pipes down to the nozzles 102e . the bin 184 can be used to separate the fragments that float 16a from the fragments that sink 16b . a skimming outlet 185 is provided at a high level in the bin 184 to remove floating fragments 16a . the second auger removes the fragments that sink 16b . if the tube 34 is sufficiently long , a second drive means 250 is used near the second end 34b of the tube 34 . as shown in fig3 a , the second drive means illustrated is a drive roller configuration . in this embodiment , a hydraulic motor 254 is mounted to the bent 38 using a bracket arrangement 252 . the motor 254 communicates through a shaft 256 , which is itself journaled in bearing journals 258 , to a drive roller 260 which frictionally abuts the saddle 48 and is guided between side walls 48b of the saddle 48 . the saddle 48 thus provides a guideway for rolling engagement of the tire around the circumference of the tube 34 . this saddle 48 also can hold within its side walls 48b the four rollers 44 . thus , when the hydraulic motor 254 turns the drive roller 260 , the frictional engagement causes a rolling of the tube 34 . it should be noted that the embodiment of the second drive means 250 can be readily utilized at either the first end 34a or the second end 34b of the tube 34 , or at both ends 34 a , 34b of the tube 34 . alternatively , the first drive means , of the belt arrangement , can be utilized at either the first end 34a or the second end 34b of the tube 34 , or at both ends of the tube 34 . other combinations involving these two drive means are also readily recognizable , and are encompassed by the present invention . also shown in fig3 and more clearly in fig3 a , is a thrust bearing arrangement 270 . two thrust bearings 274 are utilized . the thrust bearings 274 are mounted for rotation into a u - shaped journal 276 . the u - shaped journal 276 is supported and guided by opposing brackets 277 which are anchored to a cross member 272 . the journal 276 can be displaced toward or away from the cross member 272 by use of a set screw 278 . the thrust bearing 274 abuts the second annular plate 34d at the second end 34b of the tube 34 . as the tube 34 is axially rotated , the thrust bearing 274 rotates within the journal 276 . the thrust bearing 274 has a wheel - like shape and rolls in - place around the annular plate 34d as the annular plate revolves . the thrust bearing arrangement 270 opposes axial displacement of the tube 34 toward the cross member 272 which is itself anchored to the last bent 38 on the downward sloping end of the tube 34 . fig4 shows the rolling tube 34 isolated from the apparatus 10 . shown are a plurality of saddles 48 along the length of the rolling tube 34 . near opposite ends 34a , 34b of the rolling tube 34 are journals or grooves 49 wherein can be held the belt 60 . the journals are formed by attaching annular plates to an outside of the tube 34 . the annular plate 34c can be increased in diameter to serve this function at the first end 34a of the tube 34 . at the second end a second annular plate 34d is welded to an outside of the tube 34 . in one embodiment , the annular plate 34c is spaced axially apart from a saddle 48 to form a journal 49 therebetween for the belt 60 . the second annular plate can be spaced axially apart from a second thrust saddle 48 to form a journal 49 therebetween for a second belt . also shown in fig4 is the saddle 48 . the saddle 48 provides the annular side walls 48b which guide the associated roller 44 therebetween as the tube 34 is axially revolved . the saddle 48 thus guides the four rollers 44 at each bent . the saddle 48 is formed by rolling a channel into a circle with an open side of the channel facing outwardly of the circle . the saddle 48 is attached around an outside diameter of a band 48a or possibly attached directly to the tube 34 without a band 48a . as described above , where a drive roller assembly 250 is utilized at either end , the drive roller 260 is most appropriately located in the saddle 48 , between the side walls 48b . however , the drive roller 260 could also conceivably be located to roll inside the journal 49 as described above . in the preferred embodiment the tube 34 is a 34 inch diameter 11 gauge stainless steel tube , 28 feet long . the saddles 48 are 6 inches wide and in addition to providing a rolling surface for the rollers 44 and reinforcing the tube 34 , the saddles 48 can be used at seams of the tube 44 to join sections of the tube 34 in axial arrangement . the saddle 48 is formed by welding a circularly rolled 2 inch by 1 inch structural channel and welding the channel to a band 48a , or to the tube 34 if a band is not used . the journal 49 is approximately 5 inches wide to hold a 41 / 2 inch belt 60 , 260 . the saddles 48 are arranged along the axis of the tube 34 at every 4 feet . the rollers 44 are 4 or 5 inches by 13 / 4 inch rollers . it has been determined that for a 28 foot long tube 34 the first 16 feet of axial length are preferably used for washing , the next 2 feet of axial length has neither washing nor rinsing nozzles , and serves as a dead space or separation of washing and rinsing , and the remaining 10 feet are used for rinsing the fragments 16 . the wash header and rinse header may be constructed from pipe with a diameter sufficient to carry water supply to 1 / 4 inch pipe droplets , 6 inches apart . the spray nozzles should be large enough to deliver 70 gallons per minute at 30 p . s . i . pressure . the ideal water temperature for most applications is in the 155 °- 180 ° f . range . however , unheated water can be used in certain applications , such as when no labels are involved . higher temperatures actually are counter productive for containers with residue of high temperature motor oils . part of the cleansing is produced by the water spray and part by the abrasive action of the particles over each other as the tube rotates . the inventors have washed 2 , 000 lbs / hr . of plastic fragments with the described embodiment with an average rate in the 1200 - 1400 lbs / hr . range . the rate depends on many factors including the type of fragments , adhesive and other contaminants . fig5 shows a pattern of the perforation holes 50 formed in the rolling tube 34 . in one exemplary a pattern of embodiment , the holes are 1 / 8 inch ( 32 mm ) in diameter and are spaced at a = 3 / 16 inch . ( 48 mm ) and b = 3 / 16 inch ( 48 mm ), essentially so that the holes 50 comprise 40 % of the surface area of the rolling tube 34 . these dimensions corresponds to the typical dimension of plastic fragments being 3 / 8 inch ( 95 mm ) to 1 / 2 inch ( 127 mm ). fig6 shows in schematic representation , the apparatus 10 wherein additional processing components are added . a filter means 282 is added at the rinse water tank to clean rinse water for recycling . known means can be used to remove detergent from the rinse water . a second filter means 284 is added at the wash water tank 140 to remove dirt from the wash water . at both the wash water tank 140 and the rinse water tank 166 a water supply and a water outlet line wo can be provided . these lines can be used to maintain levels in the tanks 140 , 166 or to freshen the water residing in the tanks 140 , 166 by bleeding in a constant flow of &# 34 ; fresh &# 34 ; water and bleeding out a constant flow of &# 34 ; used &# 34 ; water . a wash water heater shown schematically at 290 is added to the wash water tank 140 to provide heated water for washing . a similar rinse water heater shown schematically at 292 can be added to the rinse water tank 166 to provide heated water for rinsing . the heaters 290 , 292 can be fired heater , such as natural gas fired heaters , or can be electric heaters or any appropriate known type of heater . when fired heaters are used for the heaters 290 , 292 the wash water tank 140 and the rinse water tank 166 are provided with a first flue gas outlet duct 294 and a second flue gas outlet duct 296 respectively . a hot air system is added as a feature to the system . a first forced air fan 300 blows ambient air through a duct 304 and through a first heating coil 308 located in a flue gas stream for heat transfer between the flue gas and the ambient air inside the coil 308 . the ambient air exits the coil 308 as hot air , the hot air blows through a duct 312 to a rotary drive 360 as described below . a second hot air system is added as a second feature to the system . a second forced air fan 314 blows ambient air through an inlet duct 316 into a second heating coil 324 located in the flue gas stream from the rinse water heater 292 . the hot air inside the coil thereupon blows through an outlet duct 326 to the rotary drier 360 . the hot air system from the wash water tank and the second hot air system from the rinse water tank can be used together or separately and other variations using a common hot air blower or an induced draft blower can be readily visualized and are encompassed by the present invention . also , the heating coils 308 , 324 can be located at alternate locations with respect to the heaters 290 , 292 rather than in the flue gas stream . it can be visualized that the heating coils 308 , 324 are located in a radiant section or a convection section of the heater depending on the configuration of the heater . such arrangements are also encompassed by the present invention . the hot air systems at the heaters 290 , 292 described above are used to supplement an outside source of hot air 330 for the rotary drier 360 . washed fragments 16 are transported by the second auger 186 via a delivery duct 340 to a spin drier 346 driven by a first rotary mover 348 . the fragment 16 are thereupon moved through an intermediate duct 350 to the rotary drier 360 driven by a second rotary mover 362 and fed hot air from the ducts 312 , 326 from the heating coils 308 , 324 respectively . the dried fragments exit the rotary drier 360 through a discharge conduit 366 to a next step in the recycling process . as fig6 shows this next step to the drying arrangement can be an extrusion process wherein the discharge conduit 366 feeds an extruder 400 through a funnel opening 404 . a third rotary mover 406 turns an auger or screw located inside the extruder ( not shown ) which pushes the plastic fragment 16 through a reduction section 408 . heat is added to the extrusion process ( not shown ). the extruded plastic fragments 16 leave the reduction section 408 and are inserted into a next stage of the operation , which can entail a mold 420 . although the present invention has been described with reference to a specific embodiment , those of skill in the art will recognize that changes may be made thereto without departing from the scope and spirit of the invention as set forth in the appended claims . | 1 |
a tool spindle 2 extends out of the end of the housing of a drill hammer 1 , which end is on the side of the workpiece and is only shown in part . the tool spindle 2 transmits a torque on the one hand and axial strokes , on the other hand , to a tool receptacle 3 which is securely connected with it . the tool shaft 5 of a drill 6 is inserted into the concentric receptacle bore hole 4 of the tool holder 3 . two recesses 7 which are closed in the axial direction at both sides are arranged at the tool shaft 5 so as to be located opposite one another on a diagonal line ; assigned locking bodies 8 of the tool holder 3 are constructed as balls to engage in the recesses 7 . as can be seen in fig2 the slot - or groove - like recesses 7 have a circular - cylindrical cross - sectional shape . the locking bodies 8 can move out of the recesses 7 of the tool shaft 5 by means of axial displacement of a sleeve 12 , so that the drill 6 can be removed from the tool holder 3 . in addition to the recesses 7 , rotary driving grooves 9 opening out at the end of the tool shaft 5 are arranged at the tool shaft 5 . as can be seen in fig2 the rotary driving grooves 9 are situated so as to be offset at different angles relative to the recesses 7 . the rotary driving grooves 9 have two planar flanks 10 which extend at least approximately radially and cooperate with assigned surfaces of strip - shaped rotary drivers 11 which are arranged at the cylindrical inner wall of the receptacle bore hole 4 of the tool receptacle 3 . the rear end of the tool shaft contacts an anvil continuation 2 &# 39 ; of the tool spindle 2 of the drill hammer , which anvil continuation 2 &# 39 ; transmits the axial strokes . the front portion of the drill 6 located in the front of the tool shaft 5 is constructed in a conventional manner , a view of the latter being omitted in the drawing for this reason . a portion of the drill 6 which contains a conveying spiral for carrying away drillings knocked loose from the drilling head adjoins a drillings head comprising carbide cutting edges . as can be seen from fig2 one of the rotary driving grooves 9 is angularly offset by approximately 90 ° relative to the recesses 7 , while the other rotary driving groove is angularly offset in an assymmetrical manner relative to the recesses 7 . it is advisable for reasons of stability to arrange the rotary groove 9 in such a way that the flank 10 &# 39 ; transmitting the torque during operation is farther from the recess 7 adjacent to it than the flank 10 &# 34 ; is from the recess adjacent to it . during rotation of the tool spindle 2 , the torque is transmitted to the tool shaft 5 of the drill 6 via the rotary drivers 11 engaging in the rotary driving grooves 9 . very favorable conditions result from the planar flanks 10 , which extend at least approximately radially , and the assigned surfaces of the strip - shaped rotary drivers 11 , since the forces to be transmitted are approximately normal on the cooperating surfaces . the force transmission always occurs -- even in the state of advanced wear -- at surfaces and not ultimately at the edges of the recesses . the recess 7 arranged in the tool shaft 5 serve only for the axial locking of the drill shaft in the tool receptacle 3 . the stress and accordingly also the wear on the locking bodies 8 , which are constructed as balls , is very sharply reduced by means of this . a second embodiment of the tool shaft designated here by 13 is shown in fig3 and 4 of the drawing . recesses 7 which correspond to the recesses 7 of the first embodiment ( fig1 and 2 ) are again arranged at the tool shaft 13 . with reference to the circumference of the tool shaft 13 , one rotary driving groove 14 is arranged between the two recesses 7 on one side and two rotary driving grooves 15 , 16 are arranged on the other side . fig5 and 6 show an embodiment which is distinguished from that according to fig3 and 4 in that in the first case two rotary driving grooves 18 , 19 ; 20 , 21 are arranged between the recesses 7 in the tool shaft 17 . fig7 and 8 show an embodiment in which two ( 23 , 24 ) driver grooves are arranged in the tool shaft 22 between the recesses 7 on one side and three ( 25 , 26 , 27 ) driver grooves are arranged between the recesses 7 on the other side in the tool shaft 22 . the advantage of the arrangement according to fig3 to 8 consists in that the specific surface loading during the transmission of the driving moment is smaller the more driving grooves are present . the wear is also smaller to this extent . when using a plurality of grooves in the tool shaft , it may happen that , when the tool shaft is inserted into the tool holder and the correct drill position is sought by means of rotating to both sides , the front side of the tool shaft and the front sides of the opposite rotary drivers slide along one another in the manner of a catch until the correct inserting position is found . this not only impedes handling when inserting a tool into the tool receptacle , but is also irritating for the operator . a remedy is provided for this by means of an embodiment form shown in fig9 and 10 . as can be seen from fig9 the tool shaft 28 comprises rotary driving grooves of different depths . in the shown embodiment , a rotary driving groove 29 having a greater depth is located opposite two rotary driving grooves 30 , 31 of shallower depth . strip - shaped rotary drivers 34 , 35 , 36 are arranged at the cylindrical inner wall of the receiving bore hole 33 of the tool receptacle 32 . the rotary driver 34 projecting farther forward is intended for cooperation with the rotary driving groove 29 , the rotary drivers 35 , 36 which project forward less far engage in the rotary driving grooves 30 , 31 . the tool shaft 28 has a conical inserting bevel 37 at its front side . the latter encloses an angle α with the tool axis 38 . the bevel 37 is dimensioned in such a way that it cuts into the bases 39 of the rotary driving grooves 30 , 31 , while leaving the base 40 of the rotary driving groove 29 untouched . the rotary drivers 34 , 35 and 36 are provided with inserting bevels 41 at their front sides on the tool side , which inserting bevels 41 enclose an angle β with the axis of the tool receptacle 32 coinciding with the axis 38 . after the insertion of a tool shaft 28 in the receiving bore hole 33 of the tool receptacle 32 , the rotary driving grooves 29 , 30 , 31 will generally not meet exactly on the respective rotary drivers 34 , 35 , 36 . rather , it is necessary to rotate the tool shaft 28 in the receiving bore hole around the axis 38 until the rotary driving grooves and the rotary drivers are located opposite one another so as to fit in with one another and the tool can be completely inserted into the tool receptacle . until this point , the tool shaft 28 is supported against the inserting bevel 41 of the rotary driver 34 with the edge 42 formed by its front side in connection with the spherical outer surface area of the inserting bevel 37 . during the rotation of the tool , the edge 42 moves smoothly along the inserting bevel 41 in a sliding manner until the rotary driving groove 29 is located opposite the rotary driver 34 and the rotary driving grooves 30 , 31 are located opposite the rotary drivers 35 , 36 and the tool shaft can be completely inserted into the tool receptacle . two additional embodiments of a tool shaft constructed according to the invention are shown in fig1 and 12 . a coding which contains the tool - dependent data is arranged at the base of the rotary driving grooves 49 , 50 opening out at the end of the tool shaft 48 , 58 ( compare xi , xii in fig1 ). this data can refer to the type of tool -- drill or chisel --, the tool dimensions -- drill diameter -- or the material of the tool -- drill comprising heavy - duty tool steel or drill with carbide plating . in the embodiment according to fig1 , the coding consists of a bar code which is painted on . in the embodiment shown in fig1 , the coding is formed by means of areas which are formed in the shape of stripes and comprise different surface roughness at the base of the rotary driving groove 59 . this surface roughness can be produced on the one hand by means of chemical abrasion processes or can also be produced mechanically , e . g . in the manner of file cutting . in addition to these two examples , it is also possible to achieve the coding by means of other geometric differences , e . g . different widths of the rotary driving grooves . the coding is read by mechanical or electrical sensors , known per se , and converted into a mechanical or electrical signal which switches corresponding mechanical or electrical couplings , or is fed , as an electrical signal , to the electronic control unit of the hand machine tool . the selection of determined rates of rotation , striking speeds , individual striking energy , response time of the safety clutch , turning off the drill drive or the striking mechanism , slow starting or changes of other machine parameters can be achieved by means of this . the arrangement of the coding constitutes an advisable feature of the tools , according to the invention , since the rotary driving groove carrying the coding or the recess carrying the coding , which recess is closed on both sides , can always be inserted into the assigned tool receptacle in the same angular position only when using shafts of tools which are constructed according to the invention . this is necessary in order to be effective if the mechanical or electrical sensor for reading the coding in the tool receptacle is to be used . it will be understood that each of the elements described above , or two or more together , may also find a useful application in other types of constructions differing from the types described above . while the invention has been illustrated and described as embodied in a tool shaft for a tool of the percussive and rotative type , it is not intended to be limited to the details shown , since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention . | 1 |
the following detailed description will describe the preparation of the acrylates of this invention , the preparation of the hydroxymethyl fatty compounds useful as starting materials in the preparation of the acrylates of this invention , and the preparation of curable coatings from the acrylates of this invention . the acryloxymethyl fatty compounds of this invention are prepared by reacting the corresponding hydroxyl - substituted fatty compound with an acryloyl compound that is capable of esterifying the respective hydroxymethyl compound . the hydroxymethyl fatty compounds have the general formula : wherein m , n , x and y are as previously defined and one of x &# 39 ; and z &# 39 ; is hydroxymethyl and the other is selected from the group previously defined for x and z . methods of obtaining these hydroxyl - substituted fatty compounds are discussed below . the acryloyl compounds used to esterify the hydroxymethyl fatty compound is preferably an acryloyl halide , such as acryloyl chloride , but may be other reactive acryloyl compounds , such as acryloyl anhydride , acrylic acid or lower alkyl esters thereof . the amount of acryloyl compound used to esterify the hydroxymethyl fatty polyol will depend , in part , on the nature of the hydroxymethyl fatty polyol and the product desired . when a di - acryloxymethyl compound of this invention is desired , i . e . a compound wherein y is acryloxymethyl , an amount of the acryloyl compound in excess of 2 equivalents thereof should be used to ensure the full acrylation of the starting gem - bis ( hydroxymethyl ) fatty compound . when a nonhydroxyl - containing monoacryloxymethyl compound of this invention is desired , i . e . a compound wherein y is hydrogen , an amount of the acryloyl compound in excess of 1 equivalent thereof should be used to ensure the full acrylation of the starting hydroxymethyl fatty compound . when a hydroxymethyl acryloxymethyl fatty compound of this invention is desired , i . e . a compound wherein y is hydroxymethyl , a single equivalent of the acryloyl compound should be used in conjunction with techniques to control the reaction to conditions to ensure completion of the reaction . for example , when the acryloyl compound is acrylic acid , it is convenient to remove the water that is a by - product of the acrylation reaction by techniques such as azeotropic distillation and thereby force the reaction to completion . when the starting hydroxymethyl fatty compound is a hydroxymethyl fatty ester , i . e . when x is -- c ( o )-- or 3 , the starting fatty ester may self trans - esterify when subjected to certain reaction conditions chosen . one or more steps can be taken to minimize this self trans - esterification . for example , ( 1 ) a large excess of the acryloyl compound may be used , ( 2 ) the concentration of the hydroxymethyl fatty ester in the reaction medium can be kept low , and ( 3 ) highly reactive acryloyl compounds can be used to reduce the total reaction time and thereby reduce the time for trans - esterification . the hydroxymethyl fatty nitriles , amides and esters useful as starting materials in preparing the compounds of the present invention wherein z is acryloxymethyl , may be prepared as described in u . s . pat . no . 4 , 356 , 128 to rogier , incorporated herein by reference thereto . briefly , an unsaturated fatty nitrile , amide , or ester is hydroformylated , i . e . reacted with carbon monoxide and hydrogen in the presence of a rhodium catalyst to produce a formyl substituted fatty nitrile , amide , or ester . this formyl substituted compound can then be simply reduced to the corresponding alcohol to prepare the monohydroxymethyl fatty compounds useful as starting materials , i . e . compounds wherein y is hydrogen . when a gem - bis ( hydroxymethyl ) fatty compound is desired , the formyl substituted compound is used in the tollen &# 39 ; s reaction to produce a gem - bis ( hydroxymethyl ) compound . for example , oleonitrile can be reacted with carbon monoxide and hydrogen in the presence of a rhodium catalyst to produce a 9 ( 10 )- formyloctadecanonitrile which can in turn be reacted with 2 equivalents of formaldehyde in the presence of sodium hydroxide to produce 9 , 9 ( 10 , 10 )- bis ( hydroxymethyl ) octadecanonitrile . when an amide of a fatty amine is desired , i . e . a compound wherein x is -- ch 2 -- nr 4 r 5 , it is convenient to acylate and , optionally , alkylate a compound such as oleyl amine and then hydroformylate and acrylate as described above . for example , oleyl amine can be acetylated with acetic acid and methylated to form n - acetyl - n - methyl oleyl amine . this unsaturated amine can then be reacted with carbon monoxide and hydrogen to prepare n - acetyl - n - methyl - 10 ( 11 )- formyl octadecanamine . this formylated amine can then be reduced to prepare n - acetyl - n - methyl - 10 ( 11 )- hydroxymethyloctadecanamine which is finally reacted with an acryloyl compound to prepare n - acetyl - n - methyl - 10 ( 11 )- acryloxymethyloctadecacamine . when compounds wherein x is acryloxymethyl are desired , the synethesis is conveniently accomplished by hydroformylating an unsaturated fatty alcohol to prepare a formyl - substituted fatty alcohol . the formyl - substituted fatty alcohol can then undergo a reductive amination and acylation to prepare a compound wherein x is -- ch 2 -- oh and z is -- ch 2 -- nr 4 r 5 which can then be acrylated as described above . for example , oleyl alcohol can be reacted with carbon monoxide and hydrogen to prepare 9 ( 10 ) formyloctadecanol which can in turn be reacted with methylamine and hydrogen in the presence of rainy nickel to prepare 9 ( 10 )-( n - methhylaminomethyl ) octadecanol . this amino alcohol can then be reacted with acetic acid to prepare 9 ( 10 )-( n - acetyl - n - methyl aminomethyl ) octadecanol which can , in turn be reacted with an acryloyl compound to prepare 9 ( 10 )-( n - acetyl - n - methylaminomethyl ) octadecanyl acrylate . when compounds wherein z is cyano , carboxydialkylamino , or carboxyalkoxy are desired , it is convenient to oxidize the formyl group of the formyl - substituted fatty alcohol to prepare a carboxy - substituted fatty alcohol . the carboxyl group of the carboxy - substituted fatty alcohol can then be derivatized to form a cyano group , a carboxydialkylamino group , or a carboxyalkoxy group . for example , 9 ( 10 )- formyloctadecanol can be reacted with ammonia in the presence of zinc oxide to prepare 9 ( 10 )- cyano - octadecanol , which can be reacted with an acryloyl compound to prepare 9 ( 10 )- cyano - octadecanyl acrylate . the 9 ( 10 )- carboxy - octadecanol can also be reacted ( a ) with dimethylamine to prepare 9 ( 10 )-( carboxydimethylamino ) octadecanol which can , in turn , be reacted with an acryloyl compound to prepare 9 ( 10 )-( carboxydimethylamino ) octadecanyl acrylate , or ( b ) with methanol and then an acryloyl compound to prepare 9 ( 10 )-( carboxymethoxy ) octadecanyl acrylate . the acryloxymethyl fatty compounds of this invention are useful as monomers in the preparation of polymeric coatings . the compounds of this invention can be homopolymerized or the compounds can be mixed with unsaturated monomers to form a composition of comonomers which can then be polymerized . a composition of this invention is applied to a substrate such as wood , metal , paper , or plastics by any convenient method such as knife , blade , brush , dip or spray . the coated surface can then be exposed to radiation to cure the composition through the radiation sensitive pi bonds . the coating is cured by the addition polymerization of the components of the composition . suitable sources of ionizing radiation include ultraviolet light or radioactive sources such as are described in u . s . pat . no . 3 , 935 , 330 to smith et al . the coating can also be cured by including in the composition free radical initiators such as benzoin , benzoin ethers , and michler &# 39 ; s ketone . other suitable free radical initiators are organic peroxides , hydroperoxides , per acids , per esters , azo compounds , ditertiary butyl peroxide , benzoyl peroxide , 2 , 4 - dichlorobenzoyl peroxide , tertiary butyl hydroperoxide , 2 , 5 - dimethyl - 2 , 5 - bis ( hydroxyperoxy )- hexane , peracetic acid , perbenzoic acid , tertiary butyl peroxypivalate , tertiary butyl peracetic acid and azo - bis - isobutyl nitrile . the free radical initiator may be present at from 0 . 01 to about 20 % by weight of the radiation curable components . to ensure that the composition does not polymerize prior to the application of the composition to a substrate , a free radical inhibitor may be added to the composition . examples of suitable inhibitors include hydroquinone and the methyl ether thereof or butylated hydroxy toluene at a level of from about 5 ppm to about 2000 ppm by weight of the radiation curable components . the amount of radiation necessary to cure the composition will of course depend upon the wavelength and intensity of the radiation , the angle of exposure to the radiation , the thickness of the coating to be applied , and the amount of acryloxymethyl fatty compound in the coating composition as well as the presence or absence of a free radical initiating catalyst . for any given composition , experimentation to determine the amount of radiation sensitive pi bonds not cured following exposure to the radiation source is the best method of determining the amount and duration of the radiation required . the coatings produced by the cure of the acryloxymethyl fatty compounds of this invention are useful in a wide variety of applications i . e . decorative , maintenance , or industrial coatings . for example , they can be used as binders in inks . in the electronics area , these materials have applications as non - conductive coatings , e . g . solder masks for circuit boards or moisture resistant coatings for circuit boards or optical fibers . the use of the acryloxymethyl fatty compounds of this invention should provide excellent flexibility in the final coating and offer good compatibility with other compounds in the coating formulation . the presence of the polar nitrile , amide , or ester functionality will also lead to improved surface wetting properties as compared with most commercially available curable coatings resulting in better adhesion to the substrate and improved pigment compatibility . the hydroxyl - substituted mono - acryloxymethyl fatty compound should also have application as raw materials for the preparation of crosslinked copolymers . the reaction of the hydroxyl - substituted monoacryloxymethyl fatty compounds and a polyol with a polyfunctional organic compound copolymerizable therewith , e . g . polybasic acids or polyisocyanates will yield an acrylate terminated copolymer , e . g . a polyester or a polyurethane , which can then be cured by addition polymerization of the acrylate terminal groups to form a crosslinked polymer . these copolymers are especially useful when cured on a substrate to form a crosslinked polymeric coating . the following examples illustrate methods which may be used to prepare acryloxymethyl fatty compounds . ______________________________________materials m . w . weight ( g ) moles______________________________________9 ( 10 )- hydroxymethylstearonitrile 295 200 0 . 68acrylic acid 72 63 . 6 0 . 88hydroquinone 110 8 0 . 073p - toluenesulfonic acid 190 6 0 . 032heptane 100 205 2 . 05______________________________________ a three neck one liter round - bottom flask fitted with magnetic stirrer , dean - stark trap for azeotropic removal of water , vacuum regulator , and capillary tube fitted so that a small stream of air could be continuously introduced beneath the surface of the liquid . the materials were charged to the flask and the pressure was adjusted to 350 mm of mercury . the reaction mixture was then heated to reflux . after 6 . 5 hours , 86 . 8 % of the theoretical amount of water had been collected . the reaction mixture was cooled and poured into a separatory funnel containing 200 mls of heptane . at an o / a of 1 , the organic phase was then washed once with warm water , twice with 2 % potassium hydroxide , and then four times with deionized water until neutral . the organic phase was then filtered and the heptane was removed in vacuo to give approximately 200 g of an oil . thin film ir indicated the presence of the desired product and some residual starting material . ______________________________________materials m . w . weight ( g ) moles______________________________________9 ( 10 )- hydroxymethylstearonitrile 295 100 0 . 34methacrylic acid 86 57 . 8 0 . 67hydroquinone 110 8 0 . 073p - toluenesulfonic acid 190 6 0 . 032heptane 100 205 . 6 1 . 03______________________________________ the reaction was carried out in the same fashion as described in example 1 with the following modifications . initially , only 91 % of the methacrylic acid was charged to the flask . after seven hours at reflux , the pressure was adjusted to atmospheric and the remainder of the methacrylic acid was added . after an additional six hours at reflux , the reaction mixture was cooled and worked up as previously described to yield 115 . 2 g of an oil . that the composition contained the desired product was confirmed by ir and nmr spectroscopy . ______________________________________materials m . w weight ( g ) moles______________________________________9 ( 10 )- bis ( hydroxymethyl ) stearo - 325 100 0 . 31nitrileacrylic acid 72 48 . 7 0 . 67p - methoxyphenol 124 4 0 . 032p - toluenesulfonic acid 190 3 0 . 016heptane 100 68 . 4 0 . 68______________________________________ a three neck 500 ml round bottom flask was fitted with a magnetic stirrer , dean - stark trap for azeotropic water removal , vacuum regulator , and capillary tube positioned so that a small stream of air was continuously introduced beneath the surface of the liquid . the materials were charged to the flask and the pressure was adjusted to 350 mm of mercury . the reaction mixture was then heated to reflux . after 9 hours of reflux , 89 % of the theoretical amount of water had been collected . the reaction mixture was then cooled and then poured into a separatory funnel containing 100 ml of heptane . the resultant organic was then given the following series of aqueous washes at a o / a of 1 : warm tap water , 2 % sodium hydroxide , warm tap water , 2 % sulfuric acid , and then deionized water until neutral . during the course of the washes , a small portion of ethyl acetate was added to the organic phase to improve the solubility of the product . the organic phase was then filtered and the heptane removed in vacuo to yield 113 . 7 g of an oil . the hydroxyl value of the product indicated that the material contained 23 % of the monoacrylate and 77 % of the diacrylate . ______________________________________materials m . w . weight ( g ) moles______________________________________n , n ,-- dimethyl - 9 ( 10 )- hydroxy - 345 200 0 . 58methylstearamideacryloyl chloride 90 79 . 2 0 . 88triethylamine 101 88 . 8 0 . 88phenothiazine -- 0 . 1 -- dichloromethane 84 927 . 5 11 . 04______________________________________ the reaction was carried out in the same fashion as described in kulkarni et al . jaocs , 46 , 396 ( 1969 ). the reaction mixture was worked up in the following fashion . the reaction mixture was poured into 1000 ml of heptane and allowed to stand overnight . the precipitated triethylamine hydrochloride was removed by filtration . the organic was then given a series of aqueous washes . at an o / a of 1 , the organic was washed once with water , three times with 2 % sulfuric acid , once with water , once with 2 % potassium hydroxide , once with water , once with 2 % sulfuric acid , and then deionized water washed to neutrality . the organic was filtered and the solvent removed in vacuo to yield 217 . 8 g of an oil . that the composition contained the desired product was confirmed by ir and nmr spectroscopy . ______________________________________materials m . w . weight ( g ) moles______________________________________4 -[ 9 ( 10 - hydroxymethylstearoyl ] 385 200 0 . 52morpholineacryloyl chloride 90 70 . 2 0 . 78triethylamine 101 78 . 8 0 . 78phenothiazine 190 0 . 1 -- dichloromethane 84 927 . 5 11 . 04______________________________________ the procedure was identical to that of example 4 . there was obtained 208 . 1 g of an oil . that the composition contained the desired product was confirmed by ir and nmr spectroscopy . ______________________________________materials m . w . weight ( g ) moles______________________________________methyl 9 ( 10 )- hydroxymethyl - 328 200 0 . 61stearateacrylic acid 72 48 . 3 0 . 67p - methoxyphenol 124 4 0 . 03p - toluenesulfonic acid 190 3 0 . 016heptane 100 64 . 8 0 . 65______________________________________ a one liter 3 - neck round bottom flask fitted with magnetic stirrer , thermometer , dean - stark assembly for azeotropic water removal , and a vacuum regulator . flask was also fitted with a capillary tube in such a manner that a small stream of air could be drawn through the liquid in the pot during the reaction . the materials were charged into the flask and the pressure adjusted to 400 mm of hg . the contents were then heated to reflux . after four hours at reflux , no additional aqueous phase collected in the decanter . approximately 1 . 4 times the theoretical amount of water was collected as aqueous phase in the dean - stark trap . the contents of the flask were cooled to room temperature and poured into a separatory funnel with an additional 64 . 8 g of heptane . the organic phase was then washed with water , 2 % sodium hydroxide , water , 2 % sulfuric acid , and then deionized water at an o / a of 1 . severe emulsions were encountered during the workup . the organic was the filtered and the heptane removed in vacuo to yield 196 . 9 g of a light yellow oil . that the composition contained the desired product was confirmed by nmr and ir spectroscopy . the aqueous decanted during the reaction contained approximately 16 - 17 % methanol . this indicates that approximately 12 % of the available ester functionality in the starting material had undergone trans - esterification to give polyester acrylates . | 2 |
the illustrations presented herein are , in some instances , not actual views of any particular interlocking components , end caps , plugs , sockets , mounting brackets , connectors , or light bulbs , but are merely idealized representations which are employed to describe the present devices and methods . additionally , elements common between figures may retain the same numerical reference designation . various embodiments of the present disclosure relate to methods , devices and systems for hanging decorative lights and fixtures . fig1 is a three - dimensional or isometric view illustrating an example of an interlocking section 100 of a decorative lighting or fixture system . the interlocking section 100 includes an elongated housing 102 comprising a first longitudinal end 104 and a second longitudinal end 106 . the elongated housing 102 , which may also be referred to as a rail , channel and / or frame , can comprise a rigid or semi - rigid construction . the elongated housing 102 can comprise any of a number of various lengths . the elongated housing 102 further includes an internal cavity ( not shown ) through which an electrical conduit ( not shown ) is run . one or more apertures can also be included for receiving sockets 108 adapted to receive a decorative light bulb 110 . the sockets 108 can comprise any conventional socket adapted to receive a conventional light bulb and to be coupled to an electrical source , such as the electrical conduit running through the internal cavity of the elongated housing 102 . by way of example and not limitation , the sockets 108 can comprise c 7 , c 9 or other conventional sockets coupled to the internal electrical conduit . a male plug 112 having male prongs ( e . g ., a plurality of male conductors ) can be coupled to the first or second longitudinal end 104 , 106 . in the illustrated example , the male plug 112 is coupled to the second longitudinal end 106 . in addition , a female plug 114 ( e . g ., female receptacles corresponding to , and adapted to receive the male prongs ) is coupled to the other of the first or second longitudinal end 104 , 106 of the elongated housing 102 . in the illustrated example , a female plug 114 is coupled to the first longitudinal end 104 , and another female plug 114 is shown coupled to the male plug 112 with a spacer 1000 disposed between the two at the second longitudinal end 106 . both the male and female plugs 112 , 114 at each longitudinal end 104 , 106 are electrically coupled to the electrical conduit running through the internal cavity of the elongated housing 102 . turning to fig2 , an isometric view is shown illustrating a male plug 112 according to at least one embodiment . the male plug 112 comprises a plurality of male prongs ( or male conductors ) 202 positioned in a cavity 204 surrounded and defined by shroud 203 . the male plug 112 also includes a housing attachment end 206 adapted to be received in the elongated housing 102 , as depicted in fig1 . turning to fig3 , an isometric view is shown illustrating a female plug 114 according to at least one embodiment . the female plug 114 includes female receptacles 302 corresponding to the male prongs 202 of the male plug 112 ( see fig2 ) for receiving therein and completing an electrical circuit , as is common among male and female plugs . the female receptacles 302 are positioned in a projection 304 adapted to be received into the cavity 204 of the male plug 112 ( see fig2 ), as illustrated at the second longitudinal end 106 of the elongated housing 102 in fig1 . the female plug 114 also includes a housing attachment end 306 adapted to be received in the elongated housing 102 , as depicted in fig1 . in some embodiments , a collar 305 is disposed about the female plug 114 between projection 304 and housing attachment end 306 , as depicted in fig3 . the male and female plugs 112 , 114 can facilitate electrically coupling multiple interlocking sections 100 together in such a manner as to enable the electrical conduit to continue from one section to the next to form a decorative lighting or fixture system consisting of several interlocking sections 100 . although the example shown illustrates only a straight interlocking sections 100 , in some implementations , an interlocking section 100 can be shaped to provide illuminated or non - illuminated letters or words , illuminated or non - illuminated designs ( such as stars , birthday cakes , etc . ), motorized gadgets , etc . such that each of these sections can be plugged into the system between any two other interlocking sections 100 ( or between an interlocking section 100 and an end cap 400 described below ). turning to fig4 , an isometric view of an end cap 400 is illustrated according to at least one embodiment . the end cap 400 is adapted to cover or “ cap ” a plug coupled to the elongated housing to end a string of a plurality of interlocking sections 100 . the end cap 400 shown is adapted to “ cap ” a male plug 112 and accordingly includes female receptacles 402 adapted to receive the male prongs 202 of the male plug 112 ( see fig2 ). the end cap 400 also includes a projection 404 adapted to be received into the cavity 204 of the male plug 112 ( see fig2 ) and a shoulder 406 . in this manner , the end cap 400 covers the male plug 112 and ends the electrical circuit . in some instances an interlocking section 100 of a decorative lighting fixture assembly ( see , e . g ., fig1 ) may be coupled to another interlocking section 100 of the decorative lighting fixture assembly at a corner or at one of various angles . fig5 illustrates a flexible connector adapted to facilitate such connections between interlocking sections 100 about corners and / or various angles . as illustrated , the flexible connector 500 includes a male plug connector 502 at one longitudinal end , and a female plug connector 504 at an opposing longitudinal end . the male plug connector 502 is electrically coupled to the female plug connector 504 with a flexible cord 506 extending between the two . the female plug connector 504 can be configured similar to the female plug 114 described above with reference to fig1 and 3 . the male plug connector 502 can be configured similar to the male plug 112 described above with reference to fig1 and 2 , or the male plug connector 502 can be adapted to also plug into a standard electrical outlet for providing power to one end of the assembly . the various interlocking sections 100 of a decorative lighting or fixture assembly can be hung or otherwise attached to various surfaces with one or more mechanical or magnetic mounting brackets . such mounting brackets can be attached to each section 100 for hanging each section 100 on various surfaces , such as eaves , rain gutters , walls , etc . fig6 - 9 illustrate various examples of mounting brackets that may be used in various implementations . referring to fig6 , a permanent mounting bracket 600 is shown according to at least one embodiment . the permanent mounting bracket 600 includes a plate 602 with one or more apertures 604 therein , and a hook - shaped protrusion 606 extending from one side of the plate 602 . fig7 shows an example of a mounting bracket embodied as an “ l ”- bracket 700 according to at least one implementation . the “ l ”- bracket 700 is configured with a channel 702 sized and configured to fit over a portion of the projection 304 of the female plug 114 ( see fig3 ). referring briefly to fig1 , the section 100 of the decorative lighting or fixture assembly illustrates an “ l ”- bracket 700 coupled to the female plug 114 at the first longitudinal end 104 . as illustrated , the channel 702 of the “ l ”- bracket 700 is disposed around a portion of the projection 304 ( see fig3 ) of the female plug 114 . returning to fig7 , the “ l ”- bracket further includes an attachment arm 704 extending from the channel 702 and adapted to be coupled to a flat surface . by way of example and not limitation , the “ l ”- bracket 700 may be employed for mounting the section 100 to a flat surface , such as a front surface of a home where no rain gutter is present . fig8 shows an example of a mounting bracket embodied as a “ u ”- bracket 800 , according to at least one implementation . the “ u ”- bracket 800 is configured with a channel 802 that is similar to the channel 702 of fig7 described above . a “ u ”- shaped clip 804 is also included . by way of example and not limitation , the “ u ”- bracket 800 , with its clip 804 , may be employed for mounting to a rain gutter or other surfaces . fig9 is an isometric view of another example of a mounting bracket , where the mounting bracket is embodied as a “ hinged ” bracket 900 . the “ hinged ” bracket 900 also includes a channel 902 similar to the channels 702 and 802 from fig7 and 8 . the “ hinged ” bracket 900 also includes a couple of attachment arms 904 hingedly coupled to the channel 902 . the “ hinged ” bracket 900 may be employed for installations on rigid surfaces . as shown , various mounting brackets may be used , and at least some of which are configured to be coupled to a female plug , such as the female plug 114 of fig1 and 3 . however , in some implementations , no bracket may be employed . in such implementations , a spacer 1000 may be employed between a male plug 112 and a female plug 114 when sections are coupled together , as shown in fig1 at the second longitudinal end 106 . with reference to fig1 , illustrating an isometric view of a spacer 1000 according to at least one embodiment , the spacer 1000 comprises a channel 1002 that is configured similar to the channels 702 , 802 and 902 of the various mounting brackets in fig7 - 9 . the various embodiments described herein above provide for decorative lighting or fixture systems that can be quickly and easily installed to provide uniform , direct , decorative lighting without having to secure each bulb individually . furthermore , one or more embodiments described above results in decorative lighting systems that are not subject to conventional problems relating to tangling wires , as the wiring is at least substantially enclosed within rigid or semi - rigid interlocking sections . the present invention may be embodied in other specific forms without departing from its structures , methods , or other essential characteristics as broadly described herein and claimed hereinafter . the described embodiments are to be considered in all respects only as illustrative , and not restrictive . the scope of the invention is , therefore , indicated by the appended claims , rather than by the foregoing description . all changes that come within the meaning and range of equivalency of the claims are to be embraced within their scope . | 5 |
rolling is a form of contact between two surfaces which is produced in successive form and which is possible only when at least one of the two surfaces is curved . as non - limiting examples , mention may be made of the rolling between two cylindrical surfaces and between one plane and another cylindrical surface . when there is rolling between two solids 1 , 2 of triboelectric nature , the areas where there has been rolling remain charged at the surface with electric charges of opposite signs , as illustrated in fig1 . fig2 illustrates the formation of surface charges as a result of rolling between triboelectric media , one of which has a plane surface 9 and the other has the form of a cylinder or roller 8 . the arrow indicates the direction of advance of the center of the roller 8 . the signs of the charges depend on the respective nature of the materials . the electrical charges generated by rolling on a surface may be removed therefrom by another rolling involving a third surface ( plane or curved , as appropriate ) of material which conducts electricity and which acts as a collecting device . fig3 illustrates this process : the cylinders 5 and 6 , shown in section , are made of materials which are suitable for the rolling between them to cause triboelectrification ; the cylinders 4 and 7 are made of conducting material and , in rolling thereof with the above , act as collectors collecting the electrical charges in the device shown diagrammatically in fig4 triboelectrification is due to rolling between a plane 10 and a cylinder or roller 11 and the charges are collected by means of the conducting cylinders 12 and 12 &# 39 ;. in the arrangement of the generator shown in fig5 the collecting parts are the plane parts 13 and 14 and in the configuration of fig6 the conducting and collecting elements are the concentric tubes 17 and 18 shown in section . in the modular device shown in fig7 the cylinders or rollers which collect the charges are drawn by means of circles of small diameter , the circles of large diameter corresponding to cylinders or rollers of triboelectrifiable materials . having established the operating principles , it is appropriate to define the essential elements of the device proposed , which are : ( a ) at least two active parts or components of suitable and different materials according to a triboelectric series . at least one of them will have a curved surface . ( b ) the collecting parts or components constructed from materials which conduct electricity . there has to be at least one collecting part or collector for each sign of the electrical charges . the surface thereof may be plane or curved when they collect the charges from an active roller , and will necessarily have to be curved when they collect charges accumulated on a plane surface . ( c ) the terminals of the device connected respectively to the positive and negative collectors and capable of acting as contact outlets in order to act on external devices . the device operates when there is rolling between the active components and between the active components and the collectors , all driven by an external mechanical agent . this movement gives rise to accumulations of charges in the active components , which charges are transferred to the collectors and ( via external terminals ) to the external devices receiving electrical charges and currents . an electromotive force arises between said terminals during operation of the device . the electrical energy involved during operation of this device originates from the mechanical energy supplied by the external mechanical agent which determines the rolling process . the nature , characteristics and form of application of this mechanical action lie outside the subject of this patent . this mechanical action may be applied in several ways and may directly affect one or more of the essential elements of the device which were mentioned above . the plane parts which can , alternatively , form the active elements and the collectors permit , in relation to a rolling , mutual movements which are basically those of translation . when the form thereof is cylindrical , they permit rotations and translations . the rolling results , in each case , from relative combinations of these types of movements . according to the description of the essential elements and the operating principles , various proposals of rolling triboelectric generators are defined , which are based on said essential elements and on said basic operating principles , as described in the figures mentioned . fig3 illustrates a proposal or construction which may be considered basic or fundamental . the active parts are two cylinders 5 and 6 of arbitrary and not necessarily equal radius , suitable for rolling on one another . each one of them is in permanent rolling contact with a collecting cylinder 4 and 7 which , in turn , are each provided with respective terminals 3 . the radii of the different cylinders or rollers do not necessarily have to be equal : their values are arbitrary , although they may also be equal . the axes of the different cylinders or rollers have to be parallel , but not necessarily all coplanar . the surface of may be smooth . it may also be provided with teeth so that it has the form of a straight or helical gear . the cylinders having surfaces in form of gears increase the contact surface , enhancing the generation of surface charges , and facilite the entrainment or all of them , thereby enabling applying the external mechanical agent to one or all of them . in the arrangement shown in fig4 the active elements are the plane part 10 and the cylinder 11 . the collecting elements are the rollers , smooth or provided with teeth , which are identified by the numbers 12 and 12 &# 39 ;. when the cylinders , in this arrangement , are provided with teeth , the plane part has to be made in the form of a rack . in this case , electromotive forces are generated by virtue of the relative movement of the parts which remain in contact . according to the arrangement shown in fig5 the active elements , forming pairs , are organized in series , being held in suitable relative positions by means of a retaining structure . as a non - limiting example , in fig5 the existence of three pairs of active elements 15 , 16 as been assumed . their form is cylindrical . the collecting parts are plane in character 13 and 14 . both the plane elements and the cylindrical elements may be smooth on the surface or may be provided with grooves or teeth which couple or mesh together . electromotive forces are generated when the &# 34 ; series &# 34 ; of active elements is displaced relative to the plane parts , causing rolling which determines both the generation and accumulations of and collection thereof by the plane collectors . in the arrangement of the elements shown in fig6 the active elements 21 and 22 have the form of pairs of cylinders or rollers or toothed ) in permanent contact another and with two concentric cylinders 17 and 18 which act as collectors , the larger 17 of which is hollow . the active pairs ( at least one ) are accommodated in the space between the two collecting cylinders whose surfaces intended for rolling are smooth or toothed according to the nature of the surface of the active rollers . in fig6 a generator is shown as a non - limiting example , with three pairs of active elements . the choice of the radii f the respective parts is such that permanent contact is ensured during rolling between the inner face of the outer collector cylinder 17 and the outer surface of the active element or elements of one sign , and also that permanent contact is ensured between the outer face of the inner collector cylinder 18 and the active roller or rollers of the other sign . permanent contact during rolling must also be ensured in respect of each active cylinder and its companion or complementary component . in this case , electromotive forces are generated by any of the r movements of the parts or elements , by means of which relative movements rolling is produced between the rollers and cylinders involved . fig7 shows the grouping together of various individual modules . the grouping together of various modules with the characteristics of that described in fig3 has been taken as a non - limiting example . the left - hand branch and the right - hand branch each include various modules ( to be exact , two ) grouped together in series . the two collecting elements by means of which the series connection is established , 19 and 20 , may be adapted into a single element . the grouping together of modules in series increases the voltage between external terminals . in turn , the two branches ( each comprising two series - connected groups ) are connected in parallel , which increases the current supply . in fig7 the larger circles show , in section , the active rollers , and the smaller circles show , in section , the collecting cylinders . | 7 |
fig1 is a free body diagram of a deposit pin 12 in an assembly that achieves precise , compliant x , y positioning of its micro tip . the tip 12 d is of diameter d less than about 0 . 3 mm , preferably in a range between about 0 . 250 mm and 0 . 025 mm , and is capable of depositing micro dots of fluid of corresponding dimension in a tightly packed array upon a rigid substrate . in the arrays , typically the center - to - center spacing between dots , s d , is no more than three times the diameter of the dots and often only twice or one and a half times the diameter . thus it is understood that dots of diameter between 0 . 25 mm and 0 . 025 mm , at center to center spacings between about 0 . 750 to 0 . 500 mm for the larger dot and 0 . 075 mm and 0 . 050 mm or less for the smallest dots result in a wide range of density of dots , that can be characterized as “ high density ” to “ ultra high density ”, which are all capable of being produced by the principles described here . the pin comprises a relatively large body 12 a and a lower portion 12 b of reduced dimension that leads to micro deposit tip 12 d . the pin also has an upper guide portion 12 c . large body 12 a provides a downwardly - directed surface 12 e that is engaged upon a support , receiving support force f s that bears the pin &# 39 ; s weight . the assembly is constructed to enable a lateral bias force f b to urge pin 12 against a pair of reference surfaces ref 1 , and ref 2 which lie at an angle to each other , as viewed in horizontal cross - section , fig1 a . these reference surfaces are arranged to resist movement of the pin in x and y coordinates by applying reaction forces that have x and y components that balance bias force f b . the reference surfaces are constructed to leave the pin free to move axially along axis a ( z direction ) to provide compliance to the tip 12 d when the substrate s is encountered . in practical embodiments for mounting the pins it is advantageous to employ two vertically spaced horizontal plates 9 and 11 shown in dashed lines , joined to form a carrier 17 that moves in x , y and z directions for carrying the pin through deposit , cleaning and resupply positions . the upper plate 11 is disposed at a selected distance from the lower plate and applies a constraining force f c to constrain the angle of the pin , and hence the position of its tip 12 d , within selected tolerance . lowering carrier 17 causes the precisely positioned tip 12 d to engage the substrate s , whether the substrate be found at position 20 , 20 a or 20 b , over the design range . upon engagement with the substrate the pin stops . further downward movement of the carrier causes the pin to be lifted from its seat , while reverse movement causes the pin to reseat . the bias force f b is applied by structure or arrangement that preferably permits free axial movement of the pin relative to its carrier , in response to the tip encountering the substrate . fig1 b illustrates application of lateral force by miniature spring - loaded bearings that urge the pin toward an inside corner defined by the reference surfaces ref 1 and ref 2 . in this particular case miniature rollers 50 carried on structure 52 , turn with axial motion of the pin . in other cases ball bearings may be employed . fig1 c illustrates tilting the longitudinal axis a of the pin in a manner that the weight of the pin applies to itself a slight turning moment that biases the pin against reference surfaces ref 1 and ref 2 . fig1 d , 1 e and 1 f show that tangent planes p 1 and p 2 to a segment of a conical seat ( fig1 e ) against which a pin is engaged can be considered to define two reference surfaces set at an angle to one another , that act in the manner as explained in fig1 to resist lateral movement of the pin in both x and y directions . the same is true more broadly , encompassing other surfaces of revolution that define seating surfaces . preferential seating upon a given segment of such a seat may be achieved by selected loading techniques described . in fig1 mobile multiwell reservoir mw is shown associated with the pin . it moves over the substrate during the deposition action to be near the deposit pin as the pin progressively forms dots upon the substrate , the pin resupplying itself from the reservoir mw for each dot by small motions that limit evaporation . in fig1 by dotted lines , also shown is an alternative local mobile reservoir in the form of a fluid carrying ring 14 through which the pin can project as described in our prior applications , with the actions and advantages as described there . in fig1 g is shown a preferred form of pin and ring assembly in which fluid contacting surfaces of both ring 14 and pin 12 are defined by a substance having a surface energy in excess of 2500 millinewton per meter ( mn / m ), in this preferred embodiment the surfaces being defined by electroplated tungsten layers t . also shown in fig1 g is an advantageous relationship of pin and ring at the time the ring is resupplied . referring to fig1 h , at the time of immersion of the ring in a selected well w of a multiwell plate , the presence of the pin within the confines of the ring helps the ring pick up the fluid by surface tension effects that effectively compete with the surface tension effects of the well itself , which tend to resist removal of small quantities of fluid . in the presently preferred relationship , the bottom tip surface of the pin is aligned with the lower surface of the ring . thus , referring to fig1 i , withdrawal of the assembly from immersion in the well w results in withdrawing a desired amount of fluid , pendent as a large meniscal drop , bounded by the pick up ring this quantity , protected by the ring is then available for deposit in tiny drops by repeated projection of the pin downward form the ring , see dotted lines in fig1 g . referring now to fig2 a and 2 b , embodiments employing a surface of revolution for seating the pin are exemplified . fluid deposit pin 12 , ( associated with a fluid supply such as mobile multiwell plate mw or an associated supply ring 14 ), is constrained between upper and lower plates 9 and 11 . these plates define a carrier 17 that moves as a unit in the direction of arrow z for supply and deposit actions . in each case , an enlarged portion of the pin 12 a rests normally in a seat which bears the weight of the pin , the pin being free to be displaced relatively upwardly from its seat upon contact of the tip with substrate 20 . when the pin 12 rests in its seat 13 , 13 a or 13 b , in lower plate 11 , the x , y position of its tip 12 d is defined by the degree of perfection of the pin 12 , the relative distance to the upper supporting plate 9 , the clearance between upper portion 12 c of the guide pin and the guide hole 17 , in that plate in which it resides , and a feature in the system that applies a definite ( though permissibly slight ) bias of the pin to a given side of the engaging structure as has been described above . in fig2 compression spring 22 is disposed between upper plate 9 and upwardly directed ledge 24 of pin 12 . the spring is fixed in position and applies its downward force with slight and predictable asymmetry relative to center axis a , to bias the pin to a given side for repeatable positioning . spring 22 is sized and arranged to provide the correct deposition pressure of the tip 12 d of the pin on the substrate 20 in cases where the mass of the pin is insufficient ; concurrently the slight non axi - symmetric effect of this spring introduces the desired lateral bias . in the arrangements of fig2 a and 2b the pin is biased laterally , e . g . employing one of the systems previously described , e . g . by use of a spring , angling the axis of the pin a few degrees from vertical ( with the axes of all adjacent pins being parallel when an array of pins is employed ), or by introducing bias by an eccentric load or by other loading techniques . in the case of magnetics , magnetic attraction can be employed to draw the pin to a defined corner or a particular arc of a conical seat . permanent magnets or electromagnets may be employed . likewise , electrostatic forces can be employed by imparting a charge to one of the members relative to the other , and employing a dielectric layer to prevent discharge of the charge so that the attraction persists at the time of approach of a deposit down towards the substrate . the pin of fig2 a or 2 b is readily formable to a high degree of perfection , for instance of cylindrical form . the distance d is readily selectable , in view of the fact that for a given clearance allowance between the hole of the upper plate and upper pin portion 12 c , increase of distance d decreases the possible disturbance of the pin from its nominal orientation due to any variation in clearance . thus , the bottom plate 11 defines the position of the tip of the pin 12 d , the top plate 9 being located sufficiently remotely that the spacing and angles produced establish the position of the tip of the pin within desired close tolerances for deposit of dense arrays on the surface of substrate 20 . it is seen from fig2 a and 2 b that the driven carrier structure 17 for the pin is arranged to travel sufficiently to ensure that micro tip 12 d can reach the lowest level 20 b of the range of permissible substrate heights , whereas the tip 12 d is compliant in the sense that the pin can yield in position and exerts only a controlled light pressure on the substrate before it lifts from its seat wherever it encounters the substrate over the design range . in fig3 pin 121 and seat 13 c have complementary conical seating surfaces . the upper end 12 f of the enlarged body portion 12 a ′ is sloped in a selected direction explained further below and a ball bearing 38 bears on the sloped surface at a point offset from central axis a . a weight 39 rests upon the ball , being housed by a bore in spacer block 41 upon which the upper and lower plates 9 and 11 are affixed . the spacer block is advantageously of a low - friction engineering plastic such as delryn . the weight 39 is of selected size to adjust the degree of compliance desired for the deposit tip 12 d and to apply , via the eccentrically located ball , a turning moment m to the pin ( see fig1 ). as seen in the cross - section of fig3 a the weight is of cylindrical configuration , free to rotate about axis a with turning of the ball to avoid applying drag . the body portion 12 a ′ of the pin , however , is of square cross - section and is disposed in square channel 42 in spacer block 41 of like configuration to prevent pin rotation so that orientation of end face 12 f remains constant . the slope of surface 12 f relative to axis a and the flat of square section of the pin are cooperatively related to engage square channel 42 . this is accomplished by sloping surface 12 f toward a corner of the square channel . thus micro deposit tip 12 d resides at a constant , precisely defined position by cooperation of weight 39 , the segment of the conical seat against which the pin is urged by the weight , and by the prevention of pin rotation . furthermore , by use of a selected weight ( instead of a spring ), the spotting force upon the substrate is constant over the range of possible heights of the receiving substrate , which in certain circumstances can assure higher repeatability of spot size , than when employing a spring bias system . the general concept of a mobile reservoir , shown in our original application is elaborated in fig1 by employing a mobile multi - celled reservoir , mw , such as a multi - well plate . under computer control , the apparatus brings the appropriate fluid resupply well in alignment under the pin . the pin is then controlled to come down and make contact with the fluid in the reservoir and then raises , taking along a small amount of fluid , in the form of a pendant drop . under certain circumstances , providing the end of the pin with a tungsten layer or other high surface energy material ( surface energy greater than 2500 mn / m ) can enhance the transport capability of the pin . after acquiring its drop , the pin is raised sufficiently to permit the pin and reservoir to separate e . g . by computer controlled sideways movement of the reservoir , such that the pin may subsequently descend unobstructed to deposit the small drop of fluid onto the desired location of the receiving substrate . it can readily be seen that with appropriate lateral motions of the pin and multi - well supply , this process is repeatable at each location on the substrate where a sample of the selected fluid is desired to be deposited , the desired fluid in the proper well being repeatedly brought into alignment with the proper pin for resupply and later to be deposited in suitable amount in the desired location on the substrate on which the array is being created . each time a pin is commanded to receive a fluid from a different well than that of its previous command , the pin is moved by computer control to a wash station and processed through a wash cycle to prevent contamination as desired or necessary , e . g . as is disclosed in our first application referred to above . for efficient operation , a multiplicity of pins may be used advantageously , at spacings matching the pattern of wells so that each pin reaches inside a separate well of the multiple well reservoir such as a “ 96 well plate ” or a “ 384 well plate ”. the pin assembly and its driving mechanisms are preferably mounted on an xy gantry of the instrument as they require the best positional accuracy . the multiple well plate may be provided with two degrees of freedom in a plane parallel to the deposition plane and can be indexed under the pin assembly on a separate structure . because of the relatively large size of many wells , the translation assembly for the plate may have lower positional accuracy than the pin assembly , especially where cost and mass are to be minimized . in the embodiment of fig4 and 4a , however , the multi pin assembly p a and the mobile multiwell reservoir mw share the same x , y gantry . rail support 60 , constructed e . g . to support linear motor movement in the y coordinate is mounted on an x stage 62 , motor not shown . as shown , y direction linear motors # 1 and # 2 respectively drive the pin assembly p a and the multiwell reservoir mw in the y direction . the reservoir has a secondary linear motor x 2 driven by a further driver for relative x movement relative to the pin assembly . the pin assembly also has z freedom of controlled movement , driven by a further driver z . under computer control , the multiwell reservoir separates in the y direction from the pin assembly as shown in fig4 and the z stage is actuated to cause the pins to form deposits upon the substrate s . then , fig4 a , the multiwell reservoir moves under the raised pins into appropriate alignment employing both y 2 and x 2 motions under computer control . by z motion the pins dip into the commanded wells for resupply , the pins rise again , the multiwell reservoir moves laterally with y motion out of deposition the way and the process is repeated at new targeted x , y location of the pins . while this mobile reservoir technique is useful with pins of any construction , the advantage of high accuracy of the linear motor indexing system is enjoyed when the pins are constrained in space to a highly accurate repeatable position relative to their carrier , either with the flexure mountings that have been described in our prior applications to which reference is made , or the high density pin arrangements made possible by the structures described with respect to fig1 . in the preferred embodiment of , fig5 two rows of 4 pins each , preferably constructed according to fig1 - 3 , are spaced apart in a a = 9 mm square grid pattern matching the spacing of the wells of a 96 well plate . such an arrangement permits the transport of fluid from all 96 wells , 8 wells at a time , and directs the composition of 8 spaced apart blocks of approximate dimension each 8 × 8 mm , covering in total approximately 18 × 36 mm sq . one pin deposits in each of 8 squares simultaneously with a single actuation of the z drive . fig8 shows , in a symbolic manner , the array that has been produced employing the system and method described , wherein a = 9 mm , b = 36 mm , c = 8 . 5 mm , d = 25 mm , and e = 75 mm . in a similar preferred embodiment , shown in fig9 and 10 , a grid of 12 pins has 2 rows of 6 pins each , again spaced apart in a a = 9 mm square grid pattern to match the spacing of the wells of a 96 well plate . this arrangement permits the transport of fluid from all 96 wells , 12 wells at a time , and directs the composition of 12 spaced apart blocks of approximate total area 18 × 54 mm sq . fig1 shows , in a symbolic manner , such an array , wherein a = 9 mm , c = 8 . 5 mm , d = 25 mm , e = 75 mm and f = 54 mm . the pin assemblage on a 9 mm square grid can also be used to transport fluid from plates with well spacing constructed on a square grid that is based on sub multiples of 9 mm . such as plates with 384 wells or 864 wells or 1536 wells etc . the high accuracy of the computer controlled gantry system enables accurate placement of the selected wells with respect to the pins , and the pins with respect to the receiving substrate . it is evident that using the same logic , pins can be assembled in denser constructions to fit plates with smaller well spacings . the benefit of constructions with a large number of pins is that they offer the possibility to create a large number of dots simultaneously on one or many microscope slides or substrates . this can substantially reduce the time and cost required to create arrays . the denser the array , the tighter the location tolerances for the location of each dot . the flexure pin support described in patent application ser . no . 09 / 006 , 344 , filed jan . 13 , 1998 , entitled “ depositing fluid specimens on substrates ”, is useful for individualized action but the system just described is presently preferred for repetitive production of high density arrays . using these principles , the mode of supplying the tips with fluid can be selected in reference to the nature of the fluid as well as other operating parameters . in summary , regarding the method aspects of the present invention , fig5 and 6 illustrate a dipping sequence by which the pattern of a multi - well plate is uniquely transformed to a square pattern on a microscope slide , employing an 8 pin array constructed with a spacing pattern that corresponds with the 9 mm well spacing of a 96 well plate , under computer control to form a much more densely packed array of fluid dots e . g . of 0 . 25 to 0 . 025 mm diameter and similar spacing between dots , using all fluids in the plate . just as the pins are located on 9 mm centers , the square arrays of high density dots to be formed are themselves spaced on 9 mm centers over the face of the microscope slide . by following the pickup sequence shown in fig7 ( rows 1 through 12 , and columns a through h ) all wells are visited , the pins being conveyed under computer control to the cleaning station , between samplings as shown in connection with fig1 , 16 a , 16 b , and 17 . the contents of the plate are thus distributed from the low density distribution of the wells in a multiwell plate to high density arrays forming parts of the arrays of 8 squares on the microscope slide . similarly , referring to fig9 - 12 , again using 9 mm pin spacing , with two rows of 6 pins each , a sequence of samplings from the wells under computer control collects samples from all wells and distributes them as deposits in 12 squares on a microscope slide with dimensions as shown in fig1 . as previously suggested , the same pin assemblies as shown in fig1 - 3 can be used with a simple axial ring translation mechanism in a construction analogous to that of the flexure suspension described in our u . s . patent application ser . no . 09 / 006 , 344 . as the ring 14 needs to pick up fluid from a rather large well itself , this does not impose a close tolerance requirement , so a compact construction is possible . fig1 shows the relationships of a pin and ring construction without their support or actuation mechanisms . seen in fig1 are supply ring 14 , pin tip 12 d , ring body 35 from which a support rod segment r extends to the ring 14 , pin shaft 12 b , the pin seat 13 formed on pin body 12 a and pin guide 12 c . fig1 a shows a set of such pin and ring assemblies . it is evident that any number can be assembled in this fashion . fig1 a depicts a 4 pin and ring assembly where one can see the pin holding structure and the ring holding structure and their respective linear stepper motors z 1 , and z 2 that enable relative vertical motion . the respective supporting linear guide rails for x and y motion are not shown in fig1 a , but are shown in fig1 to provide a complete array forming mechanism . as previously mentioned , it is advantageous that surfaces devoted to retaining fluid have a high surface energy , i . e . higher than 2500 millinewton per meter ( mn / m ), with surfaces comprised of tungsten being presently preferred . in preferred embodiments fluid retention rings 14 are provided with tungsten surfaces in regions where fluid is to be retained preferably the tungsten being provided by electroplating the supply ring , deposit pin of other deposition objects formed of stainless steel . this feature is particularly useful with respect to the storage rings of fig1 - 15 . by specifically aligning the pin within the ring shown in fig1 h , the pin serves as a component of the pickup device , and helps extract the desired fluid in center of very narrow wells , in cases where very little of the fluid is present . the system is especially useful for preparing a number of microscope slides as illustrated in fig1 . the central supply cs advantageously is a multiple well plate of a conventional size used in microbiology , such as a 96 well plate . cleaning and drying stations cl are also provided . the deposit sequence includes moving the assembly of deposit device and mobile sub - reservoir through cleaning and drying stations cl , thence to central supply cs at which the sub - reservoir sr is supplied with a selected fluid sample , e . g . from a selected well in a 96 well plate , under computer control . thence the grouping moves over a series of receiving surfaces r - r n , for deposit of fluid dots at selected locations on each , also under computer control . this sequence is repeated a number of times , with controlled selection of different fluid samples ( from , e . g ., the same or different wells of the central supply cs ) for respectively different locations on the microscope slides r or other receiving surfaces . correlation data of respective locations with respective specimens is recorded and used in performing subsequent scanning or reading so that an observed result can be correlated to a given specimen . in the system of fig4 the array of pins and rings of a cluster may be held over a vessel of water for cleaning , as shown in fig1 a . the vessel has water level and a pump constantly stirs the water . also associated in fig1 b is a tile of blotting paper or in some implementations , a cellulose sponge . in operation , following washing , the array of four ring and pins are touched upon the blotting paper for drying . the x , y control of the system of fig4 can accurately position the devices so they contact fresh areas of the blotter each time . the computer keeps track of the positions that have been used and guides the deposit head to new positions . after the deposition sequence is complete , the x and y terminal drives the cluster of depositing elements to the cleaning station . in some embodiments they may be passed over the wells from which the fluid originated and subjected to air blast , see fig1 or by abrupt stopping of rapid downward movement to return excess fluid to the wells . at the cleaning station the depositing elements are positioned over a clean part of the blotting paper or sponge , fig1 b , and then both the pins and the rings are driven to contact the sponge . with a small application of force the parts catch up with each other and become co - planar . after a short interval the fluid is wicked from the rings and pins . then the multiplicity of devices is lifted and thrust into the container of water , fig1 a . the water is constantly agitated and the devices are exposed to substantially fresh water as they are being rinsed . the main servo system of the x or y axis can be employed to move the rings and pins e . g . in swirling motion to effect stirring or agitation . the deposit pins and the rings are then lifted from the water tray , fig1 a , and brought to the blotting tray or a fresh blotting tray where the rinse water is blotted from the rings and pins to provide substantially dry devices for the next fill and deposit cycle . these enumerous other specific arrangements employing principles as we have outlined here will be understood from the text , the drawings and the following claims taken in conjunction with our prior applications which have been incorporated by reference . | 1 |
fig1 shows a preferred embodiment of the present invention physical on demand ( pod ) system 100 . it will be appreciated by those skilled in the art that although the following describes creation of software cds , the present invention may also be practiced with the creation of software , music , or video cds or dvds without departing from the scope and spirit of the present invention . there are three main actors in this system 100 , including a publisher 102 , an e - commerce provider 104 , and warehouses 106 . initially , a client representative of the e - commerce provider 104 introduces 107 the publisher 102 to the pod system 100 . subsequently , the publisher 102 creates 108 a pod product within a commerce system . after creating the pod product , the publisher 102 loads 110 their product source data into the commerce engine 112 . next , the pod product description and source data are submitted 114 to a quality assurance ( qa ) team at the e - commerce provider 104 . once qa is done , an account development manager ( adm ) provides 116 quality assurance results and an approval form to the publisher 102 . at this point the publisher 102 approves or declines 118 publication of their product in the pod system . if the publisher declines , the process returns to the initial state 108 in the publisher &# 39 ; s control . after publisher 102 approval 120 , the adm receives 122 electronic approval back from the publisher / client 102 . thereafter , qa releases 124 the product and the product is ready to sell . whenever commerce engine 112 receives new approved products , it updates a pod library 138 . within approximately one hour , new product information is loaded 140 into local pod systems in various parts of the world . these local pod systems may be located in a north american production lab 142 , a european production lab 144 , or other locations like japan , australia or india . when orders for the product are received 126 by the e - commerce provider 104 for the product , the system dynamically routes the order to the nearest pod warehouse 106 . the nearest pod warehouse 106 is calculated to be the one that saves the customer the most shipping and customs fees . received e - commerce orders are sent 128 to the regional pod production lab 130 where a software cd is produced and shipped via a carrier 132 ( e . g . ups , postal service ) to the end consumer / shopper 134 . at this point , a software publisher 102 is paid 136 . note , a publisher 102 is only charged a processing fee by an e - commerce provider 104 for actual orders , there are no extra fees or hidden costs . fig2 shows a typical order process flow 150 according to a preferred embodiment of the present invention . an end customer / user 148 places 152 an order for a pod product which is received by an e - commerce provider 104 commerce engine 112 . the commerce engine 112 sends 154 a burn request xml message to the pod library / system 138 . the pod library / system 138 sends 156 the pod burn request via a secured copy mechanism to the appropriate pod production lab 130 . in parallel , the commerce engine 112 places 158 an order extract on an ftp server 160 . the warehouse 106 retrieves 162 the order extract file from the ftp server 160 and merges that with the pod burn request 156 . once the pod production lab 130 completes the cd burn , it notifies 164 the ftp server that the order status has changed by placing a file back on the ftp server . additionally , the warehouse 106 matches 166 the burned cd with order extract file , assembles the cd into a case and ships it to the end customer / user 148 . fig3 shows a configuration for a pod production lab 130 . the production lab 130 is connected to the internet 170 through an internet router 172 . the router 172 is coupled to a firewall / vpn server 174 on a dmz network segment 176 . the firewall / vpn server 174 is also connected to a cd burner network segment 178 and protects the production lab 130 from hackers and other bad elements on the internet 170 . depending on the particular request received from the internet 170 , the request is routed by a managed switch 180 to a file cache server 182 that has an external raid storage array 184 or a cd burner module 186 , 188 . each cd burner module 186 , 188 consists of a cd burner 190 , computer 192 , and a printer 194 . fig4 shows a flow chart of a preferred embodiment process 310 for using a pod system 100 to remote manufacture software media from a network . the process begins by providing 311 an interface to a user for selection of a file . an order is received 312 from a user for purchase of the selected file . the order includes a file identifier related to the file and an order identifier related to the order . the order identifier is verified 313 based upon particular information related to the order . verification may be done by verifying one or more of the following : a file identifier ; a version identifier related to the file ; a uniform resource locator for the file ; or a customer identifier associated with the user . the production facility is selected 314 based upon particular information related to the order , including : ( i ) determining the production facility geographically close to the delivery location identified by the user ; ( ii ) determining the time to manufacture based upon current production schedule ; and ( iii ) determining the time to deliver to the location identified by the user based upon identified shipping constraints . the delivery of the file is processed 315 based upon the determining of time to deliver and providing verification of the order to the user . this pod system 100 can be implemented in phases to : allow fulfillment of software cds created on demand ; and implement physical on demand process logic to systematically determine predefined cd burning facilities closet to shopper &# 39 ; s location . fixed pricing for all physical on demand products . no special pricing will be supported . ( i . e . tiered pricing , revenue share , discounts ); the extract will burn the version of the product , which is active at the time the order was received ; the production system can be integrated with other systems so that functionality developed within one system should replicate / integrate with other systems ; each location will be treated separately to support their own internal sku numbers ; cds will use a standard linear file submission to manage the creation process ; process logic should determine nearest shipping location . if unable to determine optimal shipping location , then net fulfillment will be used as the default shipping locale to the shopper ; and the overall system will support more than 1 location per country with an unlimited number of cd creation machines per location . the following items may be added later to enhance the overall process or system : pre - order functionality may be added ; multiple products on a single cd could be added ; and physical on demand products cancellation process could be added . the system will be set up using a catalog manager so that a product can be selected as on demand fulfillment . this will indicate that the product upon purchase will be fulfilled through the creation of the product cd &# 39 ; s at a predefined cd burning facility . at a site level , a cd fulfillment ( whether on demand or to go ) location will systematically be determined and established . process logic should determine nearest shipping location . if unable to determine nearest location , net fulfillment will be used as the default shipping locale . qa is the only group that can release a new or revise physical on demand product or version . only after the release is signed will qa activate cd . one system preferably will handle all north american physical on demand orders . net fulfillment will handle europe ( and service as the default facility ). the united kingdom will handle all other countries . when client need arises , ups shipping can handle the asia - pacific region . for products that are fulfilled through physical on demand , a publisher will have the ability to maintain the following information : case label information ; includes image , spine text and text colour , front case text areas and associated colours ( areas yet to be defined ) cd information ; includes background image and text colour files ; upload and associate files required for product . space required for the files will require validation . the system must ensure that the files take up no more than 2 cd &# 39 ; s worth of space . in the event that this occurs , an error will be displayed to the user the commerce engine 112 shall support an ftp process for moving uploaded binaries and executables to the pod servers 130 upon activation . the commerce engine 112 shall support physical on demand as a global family . ( ex . download , physical , software , physical on demand ). versions of theses products will be handled as variations in the commerce engine 112 . fulfillment centers will support all shipping methods . for example , ups ground , federal express overnight , next - day , second day ups and dss will be treated as separate shipping locations for support of their own internal sku numbers the commerce engine 112 shall support post - cd activation process to alert mail groups of additions / changes to the client dvd insert file . upon upload and activation of a new or existing product , the commerce engine 112 will email two outlook defined mail groups ( operations , print vendors — tbd ). email contents will contain file attachments ( pdf ) of new / updated dvd insert received from vendor . product setup directory ( cd files ) should be limited to a size of 690 mb . this does not apply to images for labeling and jacket creation . those files will be kept in a separate directory . in case of a production failure , the system will be developed to re - queue ; ( event will trigger a configurable email notification with information about systems failure ). at time of purchase for any product requiring cd fulfillment , a fulfillment request 154 will be forwarded to the associated cd fulfiller 130 for the site . ordering a product as physical on demand will not allow the client / customer to receive a backup cd for that same product . physical on demand products will be considered requesting fulfillment at time of fulfillment request . the fulfiller 130 will supply a shipment notice . this notice will act as the indicator of fulfillment ( triggering any events such as costing / accounting and order notifications ). physical on demand machines will require the ability to print cd information in color . pod machines will require the ability to print cd information in black & amp ; white . shipping locale shall generate packing slips in the country &# 39 ; s default language only ( net fulfillment will create packing slips in english only ). in the event a physical on demand machine goes down , the second physical on demand machine will maintain processing of requests . upon receipt of a physical on demand fulfillment request , the machine will extract all files required and burn to a cd . these files include executables and binaries . case label generated for physical on demand will contain : customer name ; barcode ; disc number ( example 1 of x ); and order id . barcodes contained on the case label and the cd label will be scanned and matched to allow the completion of the pick / pack / ship process . for orders containing two cd &# 39 ; s will require the ability to associate each cd barcode with the same label barcode . countries will be defined in a data repository for fulfillment centers of physical on demand products . based on country definitions and logic , a systematic process should invoke which pod extracts and processes the order . countries : north america — handles all north american pod orders ; europe — net fulfillment handles all european pod orders ; united kingdom — handles all other countries ; and apac — ups handles all pod orders . if a country code cannot be determined to process a pod order , europe will be used at the default . once product is shipment ready , the cd fulfiller will create a shipment notice file . this file will contain order information as well as tracking information confirming orders that have been fulfilled . during the implementation , a time frame for these files will be established . the physical on demand delivery will include a cd and case . physical on demand will be processed through typical accounting systems like physical fulfillment of products . the process manager or owner will receive a shipment notice from each cd fulfiller . upon receipt of file , order will be updated with shipment information , and shipment confirmation notification will be forwarded to the customer with provided tracking information . costing / accounting for shipped orders will be processed as they are currently by physical orders . once the order reaches a state of shipped , costing will be triggered and allow for recognition of revenue . accounting will be notified ( via email ) to setup a transaction fee for physical orders based on each pod . once set up , accounting personnel charge a standard fee for each unit . attributes to facilitate accounting / costing for physical on demand are : sku #, version id and price . a preferred system , namely the commerce engine 112 will support : reships . will function as a new order ; and p 1 a zero price will be charged to the customer ; however the system should still charge the pod system . that cost will be transferred back to the vendor . digital ( software ) products cannot be returned physically . therefore for this project we authorize the use of an electronic letter of destruction ( elod ). there is no impact to customer service . physical on demand will be integrated just as current physical fulfillment is integrated with customer service . the commerce engine 112 will generate additional reports to capture the following : number of physical on demand versions live ; sales by pod region , including ( i ) region codes : ( north america , europe , uk , apac ) and ( ii ) filter by pod fulfillment center name ; and average fee charged for physical on demand product . accounting reports such as the penetration report will operate as it currently stands . fulfillment of physical on demand will be integrated to act as any physical fulfillment of product is currently reported standard order confirmation will be utilized for physical on demand fulfillment . this fulfillment process will act as any physical fulfillment currently does . customer will be informed that further notification from e - commerce provider will indicate when fulfillment has been completed . production failure event notification will be utilized for physical on demand . in the case of a system down or failure , the event will be logged in a database . from this status logged operation , a configurable email will be sent to notify a specified user ( s ) to take action . standard shipping confirmation will be utilized for physical on demand fulfillment . upon receipt of shipping notification from the fulfiller , the e - commerce system will generate this notification to the customer to indicate fulfillment has been completed and product should be expected shortly . below is a brief description of the web page flow of user interfaces for this process . the product search page allows a client / administrator to select a product from the catalog manager ( page not shown ). the product selection pages shown in fig5 and 6 allow the client / administrator to select what digital product the physical on demand will correspond to . they will also upload the relevant files / file structure that is to be burnt onto the cd . the upload cd image page shown in fig7 allows the client / administrator to upload an image for the top of the cd itself . they will also be able to view what the cd would look like with the image on it . the upload cd jacket page allows the client / administrator to upload images for the front , back and spine of the cd jacket . they will also be able to preview what the jacket will look like . the print / design specifications for the cd jacket include : label insert measurement , resolution , image format , and bleed zone . more specifically , these specifications are : label insert measurement : ( bleed zone ) the insert for the dvd case will measure 7¼ × 10¾ inches . ( live zone = image size = cut line = 7¼ ″× 10¾ ″). resolution : for both the cd label and the dvd case the resolution is 300 dpi . image format : the image for both the cd label and dvd case label must be a microsoft jpeg . bleed zone : any edge with a full - bleed should extend ¼ ″ beyond the cut line . consequently since the dvd case label is a 4 - edge bleed image , the size would be 7⅝ ″× 11 ″) text should be no closer than ¼ ″ from the edge of the cut line . color range — the printers are cmyk but an “ rgb . eps ” image is preferred for the dvd cover only . for the following description , the following definitions will outline each actor in the physical on demand process . a customer purchases product , which requires cd creation . a client owns product which has physical on demand options available . a fulfiller fulfills orders for cd portions of physical on demand product . the commerce engine 112 hosts and manages sales of physical on demand products for client sites . in the following tables , each major process is outlined . it is to be understood that even though numerous characteristics and advantages of various embodiments of the present invention have been set forth in the foregoing description , together with details of the structure and function of various embodiments of the invention , this disclosure is illustrative only , and changes may be made in detail , especially in matters of structure and arrangement of parts within the principles of the present invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed . for example , the particular elements may vary depending on the particular application for the web interface such that different dialog boxes are presented to a user that are organized or designed differently while maintaining substantially the same functionality without departing from the scope and spirit of the present invention . | 6 |
referring now to the drawings , the device according to the invention comprises a removable module 16 comprising a casing ( reference 28 of fig3 ) which receives a video camera 3 for observing the eye 2 of a patient , and a video camera 5 for observing the scene 7 observed by the patient whose look is directed substantially in the direction represented by arrow 29 . said casing of said removable module may advantageously contain means for pre - processing the video signals delivered by said video cameras 3 , 5 , particularly those described in fig2 and 4 . said module or casing 16 may be easily mounted and dismantled manually on a mask 9 worn by the patient and having the general form of a spectacle frame . said module 16 may be mounted tightly so as to obturate by its face 16a an opening provided in the front part of said mask or said spectacle frame ; said mask may for example comprise two openings respectively located opposite the patient &# 39 ; s eyes , of which one may be equipped with one of said modules and the second opening may for example be equipped with a card likewise obturating in manner tight to the outside visible light , the inner volume 22 located near the patient &# 39 ; s eyes and delimited by said mask , so as to constitute in front of the patient &# 39 ; s eyes a black chamber , i . e . a chamber isolated from the visible light outside said mask , in order , for example , to make vestibular tests . to that end , said mask may be provided on its face coming into contact with the patient &# 39 ; s head , with sealing means 20 ensuring darkness in said chamber 22 . said module 16 is provided to that end , on its inner face , with electroluminescent diodes 21 emitting light in the infrared or near infrared domain , in order to light the eyes of the patient in the dark and to allow said video camera 3 which is sensitive to infrared or near infrared radiation , to observe the movements of the eye 2 of the patient in the darkness of said chamber 22 . according to the invention , said cameras 3 and 5 with respective optical axes xx1 and xx2 which are substantially merged and substantially parallel and close to the direction 29 of the patient &# 39 ; s look , are mounted &# 34 ; head - to - tail &# 34 ; inside and / or on said module 16 . referring to fig3 in the case of it being desired to observe the movements of the patient &# 39 ; s eyes with a pass band higher than 25 hertz which is the usual pass band of the standard video signals delivered by the ccd sensors of cameras conventionally used , it is possible to equip the inner face of said module 16 with photodiodes 30 , 31 or photoreceptors sensitive to the infrared light emitted by said electroluminescent diodes 21 ; to that end , it is advantageous to provide at least three photoreceptors 30 , 31 , for example four , as illustrated in fig3 ; in this embodiment , two photoreceptors 30 mounted on either side of said camera , superposed substantially vertically , make it possible to detect the vertical movements of the eye observed , by digitalizing the voltage delivered by a high frequency analysis stage of which the differential inputs receive the signals of said photodiodes or photoreceptors . in the same way , two photodiodes or photoreceptors 31 located on either side of said camera 3 and located substantially on the same horizontal axis make it possible to deliver a voltage from the differential analysis stage of the signals issuing from these photoreceptors . the inner face of the casing 28 of the module 16 illustrated in fig3 may also be provided with an electroluminescent diode 32 , emitting visible light and also located near the lens of the camera 3 with optical axis xx1 . with reference to fig2 the device may be used for multiplexing the signal 4 delivered by said eye observing camera ( reference 3 in fig1 ) and the video signal 6 delivered by said scene observing camera ( reference 5 in fig1 ). a first multiplexed video signal 12 may be obtained which is constituted for example by the even frame of the first video signal 4 and by the odd frame of the second video signal 6 ; to that end , said video signals 4 and 6 are alternately switched by two switches 26 and 27 which are controlled in phase opposition . to that end , the video signal 6 is presented to a synchro - frame separator 23 which delivers a synchronization signal to a clock or monostable 24 whose output signal serves to control a switch 26 ; said output signal from said monostable also pilots via an inverter 25 said second switch 27 , so that a first multiplexed video signal 12 is obtained at the output . with reference to fig4 a second system for multiplexing said video signals 4 and 6 may be used in order to facilitate and accelerate analysis of said video signals for the purposes of observation of the movement of the eye and the relative movements of the patient &# 39 ; s head with respect to the scene and / or the patient &# 39 ; s chest with respect to the scene . to that end , said signals 4 and 6 are applied to the input of a mixer 33 or multiplexer , which reconstitutes a second multiplexed video signal 13 which comprises in each of its even or odd frames , lines issuing from the respectively even or odd frames of each of said signals 4 and 6 , said multiplexer 33 being synchronized on one of said signals , for example signal 6 , by a synchronization device 23 . with reference to fig5 said eye observing video camera ( reference 3 in fig1 ), essentially comprises a monochrome matrix ccd sensor 10 which receives the light rays via optics or a lens 35 , with optical axis xx1 . said scene observing camera likewise integrated with the casing 28 of the module 16 which may be removably mounted on said mask , comprises a matrix ccd sensor 11 advantageously identical to said ccd sensor 10 , and comprises optics 36 which may also be identical to optics 35 of said eye observing camera except for the adjustment of each focal distance to obtain the desired image sharpnesses . optics 36 may advantageously be equipped with a lens of very wide angle included between 90 ° and 180 ° to allow the objects of the scene always to be localized in the image , despite for example a very considerable rotation of the patient &# 39 ; s head . said matrix ccd sensors 11 and 10 are advantageously respectively located in planes 18 , 17 parallel to said plane of symmetry 15 and located at an equal distance therefrom so that the distance 34 between said ccd sensors 10 and 11 is small . fig6 schematically illustrates a scene 7 with which may be associated a fixed mark 8a of substantially rectangular form and with centre 40 . fig6 schematically shows the limit 37 of the field of vision observed by the scene camera of the device according to the invention , inside which may be predefined a window 38 for observation of the scene , which window is provided with a centre 41 . this figure also illustrates a mark 8b for example of circular form and with centre 42 , which mark 8b may be mobile and constituted by a light spot projected on said scene by a lighting device connected to the patient &# 39 ; s chest and / or his head and / or to said removable module . fig7 illustrates an example of display of the results of measurement of the movement of the eye and of the movement of the head with respect to the scene ( with reference to an initial situation corresponding to fig6 ), using a device according to the invention . the results may be displayed on a screen 47 forming part for example of a micro - computer provided with conventional calculating and processing means . there may be displayed on said screen 47 , preferably simultaneously , for example at a frequency of the order of 25 hertz , an image 19 corresponding to the scene observed by said scene camera , an image 14 corresponding to the image of the eye delivered by said camera of said eye observing module , as well as a timing diagram of the positions calculated at each instant of the centre of gravity of the different marks and of the pupil of the eye . the upper part of fig7 shows that said image 19 of the scene may be limited by said predetermined window 38 with centre 41 &# 39 ;; in the plane of the figure are marked x and y axes passing through said centre 41 of said window . said mark 8a of fig6 may , due to the movement of the patient &# 39 ; s head , be notably transformed into a mark 8 &# 39 ; a of similar shape and with centre 40 &# 39 ;, of which the position with respect to the centre 41 &# 39 ; of said window has moved due to said movement of the head . in the same way , on this image of the scene , a mark 8 &# 39 ; b may be recognized , corresponding to said mark 8b of fig6 and of which the position of the centre 42 &# 39 ; with respect to the position of said centre 41 &# 39 ; of said window 38 has also moved due for example to a movement of the patient &# 39 ; s chest . in the median part of fig7 is also illustrated the image 14 of the eye obtained by said eye observing camera on which may be recognized the image 39 of the pupil of the eye , with centre or centre of gravity 43 , of which the position in the plane of the figure may be detected and measured in order to analyze the movements of the eye in response to stimuli . the variation of the angular position a of the eye may for example be determined by measuring the angular position of a stria 44 which may be observed in a ring located around said pupil . advantageously , in a process according to the invention , the curves or timing diagrams 45 , 46 , 48 may be simultaneously displayed , corresponding to the evolution as a function of time t , respectively of the abscissa x40 of said fixed mark 8 &# 39 ; a with respect to the centre of said observation window 38 , of the abscissa x43 corresponding to the horizontal position of the centre of said pupil of said eye , and of the abscissa x42 corresponding to the horizontal position of said mobile mark 8 &# 39 ; b associated with the position of the patient &# 39 ; s torso . the invention may be carried out by using for example a micro - computer equipped with a video signal acquisition card . advantageously , such a card may comprise a programmable video signal output on which may be connected a video projector ; images comprising marks ( targets or patterns ) which will be projected by the video projector onto the screen which the patient is observing , may thus be synthesized . according to this particular embodiment of the invention , one sole electronic card may be used for ensuring acquisition and digitalization of the signals delivered by said first and second cameras and for ensuring synthesis of one or more target images or marks , which presents a considerable advantage in economy and simplicity with respect to known devices making it possible to deliver targets in the patient &# 39 ; s visual field , and which are generally constituted either by oculomotricity stimulators with electroluminescent diode bar or comprising a laser beam emitter , or by optokinetic reflex tracking stimulators with rotating projector of planetarium , zeitoun mirror mosaic sphere type , these known devices being both very expensive and cumbersome . furthermore , in this embodiment , the possibility of creating patterns is illimited ; moreover , thanks to the fact that the same apparatus ( the micro - computer suitably programmed ) controls both the acquisition and digitalization of the images issuing from the video signals delivered by the cameras and the synthesis of the targets projected in the field of vision of the patient , the calculation of the movement of the eyes and / or of the head is facilitated thanks to the fact that the same software synthesizes said scene marks and this same software seeks the shape and calculates the position of these synthesized marks to calculate the movement of the patient &# 39 ; s head deduced from the signals delivered by the cameras ; it is thus advantageous , when the head movements are inscribed in a reduced angular range ( more or less 60 °), to synthesize by programmation the marks which are used for detecting the movement rather than to have to place contrasted and luminous or highly reflecting fixed marks in the scene , as this facilitates installation and use of the system for analyzing the movement of the eye . according to a particular characteristic of the invention , the device may comprise a portable emitter of radioelectric signals which will be obtained or elaborated from said first and second video signals delivered by said first and second cameras , which emitter is carried by the patient , for example fixed on said frame . this may make it possible to send the image of the patient &# 39 ; s eye directly to a radioelectric signal receiver connected to the micro - computer or to the data - processing system , without using a connecting cable , which improves comfort of use ; this process of use is particularly advantageous in the case of said first and second video signals being multiplexed to constitute one single multiplexed video signal , which , with the aid of one radio emitter assembly ( carried by the patient ) and radio receiver ( connected to the computer or processor ), facilitates receiving the images of the eye and of the scene on one sole acquisition and digitalization card integrated in the computer . | 0 |
the invention is implemented in an environment illustrated in fig1 wherein a plurality of local area networks ( lan ) 10 - 1 , 10 - 2 , 10 - 3 , 10 - 4 are interconnected together by hub 12 including packet switch 14 . the local area networks may be of the type atm , ethernet , or token - ring . each lan is connected to packet switch 14 in hub 12 by means of lan adapter 16 - 1 for lan 10 - 1 , 16 - 2 for lan 10 - 2 , 16 - 3 for lan 10 - 3 and 16 - 4 for lan 10 - 4 . each adapter 16 - 1 to 16 - 4 is connected to packet switch 14 by means of data bus in 13 ( bus 13 - 1 to 13 - 4 ) and data bus out 15 ( bus 15 - 1 to 15 - 4 ). connected to packet switch 14 are input expansion bus 17 and output expansion bus 18 which are respectively used for increasing the number of input ports and the number of output ports as explained hereafter . data bus in 13 carries the data packets coming from the input adapter and data bus out 15 carries the outgoing data packets to the output adapter . as explained hereafter , each incoming packet includes a self - routing header inserted by the adapter , this header being used to independently process the data packet through the different stages of the switch module . [ 0022 ] fig2 represents the format of the data packets exchanged between the lan adapters through the packet switch . it is assumed that the data are packets of 53 bytes . a header of 2 bytes is added to each packet by the adapter . the first byte of the header is composed of an identification field of three bits ( bits 0 - 2 ) and a module address field of 5 bits ( bits 3 - 7 ). the second byte of the header is used in the unicast configuration and gives in bit map the destination output port selection . in reference to fig3 the general data flow structure of switch module 14 according to the invention , is composed of a plurality of input bus like data bus in 13 respectively connected to the input ports of the switch and a plurality of output bus like data bus out 15 respectively connected to the output ports of the switch . for each cross point such as the cross point defined by data bus in 13 and data bus out 15 , there are an input control block 100 , a memory block 200 , an input expansion data block 300 and an output control block 400 . input control block 100 is common for all memory blocks which correspond to data bus in 13 and output control block 400 is common for all memory blocks which correspond to data bus out 15 . input expansion data block 300 is connected in input to input expansion bus 17 and is common to all memory blocks which correspond to data bus out 15 . all the memory blocks corresponding to data bus in 13 are connected to a distributed data bus 50 itself connected to output expansion bus 18 by means of a gate 36 . all the memory blocks corresponding to data bus out 15 are connected to output data bus 60 and to overflow data bus 70 , the function of which will be explained later . the data packets which are received by each memory block 200 from input control block 100 are analyzed and stored into memory , and are then released to output control block 400 through output data bus 60 . then , the data packets are sent by output control block 400 over data bus out 15 . all these operations are synchronized and controlled by scheduler 500 within output control block 400 by means of control lines such as lines 206 , 236 and 242 . as illustrated in fig4 input control block 100 comprises principally data bus in 13 for receiving data packets and means for storing the incoming data packets according to their destination and releasing these packets into distributed data bus 50 . such means include buffer 120 for buffering and validating the data packet received from input bus 104 and input memory unit 122 for storing the data packets under the control of memory control block 114 . the input memory unit is preferably a memory adapted to store a plurality of data packets , the write signal being sent by memory control block 114 after validation of the data in buffer 120 . when a data packet is forwarded over distributed bus 50 , a read signal is sent to memory control block 114 enabling memory control block 114 to know the filling level of input memory unit 122 . assuming that input memory unit 122 is full , the data packet within buffer 120 is not allowed to be transferred into input memory unit 122 and an overflow signal is forwarded to a scheduler on line 236 as described hereafter . as described later , several modules can be grouped together to constitute the packet switch . for this , it is necessary to have multiplexer 116 between data bus in 13 and distributed data bus 50 . input control signal 118 coming from rank selector 800 determines the selection of the input to the multiplexer . in case of several switch modules , only the data packets received by the first module must be buffered to avoid the risk of overflow . in such a case , the multiplexer input selected by control signal 118 is the output of input memory unit 122 for the module 0 wherein data bus in 13 and following bus 106 is directly connected to distributed data bus 50 by multiplexer 116 for the subsequent modules . note that the output of input memory unit 122 is also selected if there is only one switch module in packet switch 14 . fig5 shows memory block 200 composed of memory select block 244 , header detection block 210 , header configuration setting and validation control block 212 , memory controller 234 , data memory unit 226 , data selector block 238 , and header validation control block 216 . header configuration setting and validation control block 212 has the functions of storing the module rank from rank selector 800 , storing the configuration data memory address from configuration interface mechanism 600 , analyzing the data packet type ( multicast , unicast , etc . ), and authorizing ( or not ) the reception of the incoming data packet according to the destination data packet address . a ) at initialization time , header configuration setting block 212 receives the switch module rank from rank selector 800 through bus 118 . the module rank is needed for determining the global physical address of each output port of the switching system . each header configuration - setting block attached to the same column output port has the same decoding address . assuming that each switch module is an 8 × 8 port module , the 1 st column corresponding to the output port 1 has the decoding address ‘ 0 ’; the 2 nd column has the decoding address ‘ 1 ’ and so on until the column 8 . note that the switch module could be an m × m port module with m different from 8 . if the switch module is single , then the decoding address on each column is unchanged . but , in port expansion with several modules interconnected together , the 1 st column of modules has to decode the address range ( 0 - 7 ), the 2 nd column of modules has to decode the address range ( 8 - 15 ), the 3 rd column of modules has to decode the range address ( 16 - 23 ), and so on until the last column of modules . if there are n columns of modules , the block 212 assigns an offset of 8 × k to the output port address in the module , with k being 0 to n − 1 . b ) the second function of the header configuration and setting block 212 allows modifications of the pre - set internal output port memory address through the configuration interface . this function is used in internal speed expansion mode , where 2 or more output ports or columns have to be combined in order to grow the data throughput of the port . configuration interface mechanism 600 configures the memory block through configuration bus 204 . c ) the third function of the header configuration and setting block 212 is to detect whether the packet is a multicast address packet . if so , the header of the packet has a specific configuration determining that all the following packets , which have all a specific header , are the packets of a multicast frame . in such a case , header configuration and setting block 212 analyzes also the 54 bytes of the packet following the header to determine whether the output port associated with the memory block corresponds to one of the output ports to which the multicast frame is addressed . d ) header detection block 210 defines the start of each incoming data packet . this block receives clocking signal through the signal 208 at each clock time . e ) header validation control block 216 uses control signals from block 212 , block 210 , and validation signal 206 from scheduler 500 , to authorize memory controller 234 to store the incoming data packet into data memory unit 226 . f ) data validation block 244 selects either distributed data bus 50 or overflow data bus 70 depending on control signal 248 driven by scheduler 500 . by default , distributed data bus 50 is connected to data memory unit 226 until an overflow is detected . g ) data memory unit 226 stores and releases the data packets under the control of memory controller 234 . h ) data memory controller 234 performs the functions of controlling the address release , enqueue and dequeue mechanisms , generating read and write signals , and generating memory overflow signal 236 to scheduler 500 . i ) overflow data bus 70 ( one per output ), is connected to all memory blocks , along internal output data bus 60 in order to reassign the overflow data packet to another memory block . for this , scheduler 500 activates signal 242 controlling overflow connection block 238 which can be an and circuit connecting distributed data bus 50 to overflow data bus 70 through bus 240 . scheduler takes the decision after receiving flow controls signals 236 from memories connected on the same output port . the decision is to determine the usable memory wherein the overflow data packet can be stored . this is particular useful , due to the fact that the data packet is re - routed to another memory block of the same output port . [ 0041 ] fig6 shows input expansion data block 300 which is composed of header processing block 302 , header validation block 308 , expansion memory unit 312 , and memory controller 314 . input expansion bus in 17 connected to header processing block 302 carries the data packet coming from another switching module in expansion mode . header processing block 302 is also connected in input to overflow data bus 70 for receiving an overflow data packet . header processing module 302 is connected in output to header validation block 308 by data bus 306 . the function of the header processing block is to select the appropriate data bus , according to the configuration mode line 320 from rank selector 800 . this line carries the necessary module rank information . the header validation block 308 receives control signal validation 206 coming from the scheduler 500 . header validation block 308 signals an incoming data packet to memory controller 314 through control signal 324 and sends the data packet to memory block 312 through data bus 310 . the main function of expansion memory unit 312 is to store the incoming data packet coming from the expansion data bus or from the overflow data bus , under the control of memory controller 314 which controls the write / read operations to the memory , and generates memory flow control signal 236 to scheduler 500 . [ 0045 ] fig7 shows output data block 400 which is composed of data selection block 402 , output memory unit 406 , and memory controller 408 . the function of output data block 400 is to receive data packets from internal output bus 60 , to validate data packets from internal output bus 60 , to store into output memory unit 406 the incoming data , and to release data packet on data bus out 15 . the function of data selection block 402 is to receive internal output data bus 60 , to validate the incoming data packet when receiving validation signal 206 coming from the scheduler , and to activate validation data signal 410 to memory controller 408 . output memory unit 406 connected to data selection block 402 by data bus 404 , stores incoming data packets under the control of memory controller 408 . the function of the latter is to store the incoming data packets into the memory block , to release data packets from the output memory unit , to control the storing memory address , and to generate flow control signal 236 to scheduler 500 . the data packets after being released from output memory unit 406 by the memory controller , are sent over output data bus 15 . an essential feature of the invention is to use a scheduler , as illustrated in fig3 and fig8 for each output port of the packet switch rather than a centralized scheduling mechanism as in a crossbar switch . the main functions of scheduler 500 are to receive the necessary information coming from all attached column memory blocks 200 , to activate the validation of the incoming data packet for the selected memory block , to determine the outgoing data packet by choosing the memory block according to a round - robin mechanism which can be based on priority selection and / or any other selections , to control the memory overflow , to flow control the output ports , and , to report flow control signals 710 to overflow control mechanism 700 , and therefore alert back pressure mechanism 900 . rank selector 800 located in the bottom right corner of fig8 is a mechanism using a number of input pins hardwired on the board , that define the module rank in a packet switch including a plurality of switch modules . in the case of single module , this address is ‘ 0 ’. in the case of port expansion , many switch modules may interconnect together . for the ease of comprehension , it is assumed a 16 × 16 switch system configuration using four 8 × 8 switch modules . the 2 modules of the 1 st column of modules have to be hardwired to ‘ 0 ’. the 2 other modules of the 2 nd column of modules have to be hardwired to ‘ 1 ’. the same algorithm applies for an n × n switch system configuration . the physical destination address known by the adapters is the final destination address and is contained in the header of each of the data packets . based upon the overflow signals coming from all memory blocks on lines 236 as illustrated in fig3 and fig8 the scheduler determines the memory blocks which overflow during each data packet time ( internal clock time for storing one data packet ). as illustrated by the flow chart of fig9 the scheduler first checks whether there is a memory block which overflows ( step 30 ). if so , it is then checked whether it is a multiple overflow ( step 32 ). in case of multiple overflows , the scheduler uses a selection algorithm ( generally a round robin selection ) to select the appropriate memory block which can receive the next data packet ( step 34 ). of course , if it is a single overflow , the step of memory selection is not necessary . in such a case or after the selection , the memory block which overflows is disabled by the scheduler on line 206 ( step 36 ) and a usable memory block is enabled by the scheduler on line 248 ( step 38 ). then , overflow bus 70 is enabled by line 242 from the scheduler to carry the data packet into the data memory unit of the memory block which is validated by line 248 ( step 40 ). when there is no memory overflow ( step 30 ) or after the transfer of the data packet over overflow bus 70 , the process is ended ( step 42 ). it must be noted that such an overflow processing by a scheduler associated with each output port , presents the advantages of flow controlling the internal data , avoiding the loss of the data packet , having a better distribution of the data packets , and delaying the generation of a back pressure signal as described hereafter only when it is not possible to process the memory overflow normally . the configuration interface mechanism 600 located on bottom left of fig8 is the mechanism controlling the configuration of each column output port . assuming that the switch is an 8 × 8 output port , at the end of the initialization , the 1 st column corresponding to the output port 1 has the decoding address ‘ 0 ’. the 2 nd column has the decoding address ‘ 1 ’ and so on until the column 8 . the configuration interface mechanism allows the traffic management to modify the address of each column . as an example the packet switch may have the following configuration : this function is used to increase the internal speed . the ports_ 3 and port_ 4 decode the same incoming data packet , which improves the performances of the adapter . the same applies as port_ 7 and port_ 8 . configuration interface mechanism 600 sends information through bus 204 to the configuration setting and detection block 212 of each memory block of each output port ( see fig5 ). configuration interface mechanism 600 receives information through bus 610 from traffic management . in the case of port expansion ( several modules interconnected together ), each module is connected to bus 610 . the traffic management delivers through bus 610 the information about the module physical address , the row / column physical address , and the modified address of the row / column data memory block . the traffic management accesses only one configuration interface 600 at a time . the back - pressure mechanism 900 located in the top left corner of the fig8 has the functions of receiving flow control bus 910 from overflow control block 700 , generating flow control bus 915 to overflow control block 700 , receiving flow control information on bus 924 from the right adjacent switch module , receiving flow control information on bus 925 from the bottom adjacent switch module , generating flow control information on bus 922 to the left adjacent switch module , and generating flow control information on bus 923 to the top adjacent switch module . of course , in a single module configuration there is no information exchanged with other modules . bus 922 , from back - pressure mechanism 900 connected to the input ports , is made of n independent signals , with one signal per input port . the generation of a back - pressure signal to the adapters is to stop ( or reduce ) the flow of the data packets transmitted to the packet switch when there is too much overflow detected by one or several schedulers . the back - pressure signals are generated after receiving flow control information from overflow mechanism 700 through bus 910 . when a memory block is not able to store any more of the data packets , an overflow control signal is sent to the corresponding scheduler through bus 236 . each scheduler alerts overflow mechanism 700 through control bus 710 . overflow mechanism 700 receives overflow control signals from all schedulers and informs back - pressure mechanism 900 through bus 910 to back - pressure the corresponding adapters . in port expansion configuration , back - pressure mechanism 900 receives overflow information from the right adjacent switch module , and from the bottom adjacent switch module , and back - pressure mechanism 900 generates overflow information to the top adjacent switch module . when back - pressure mechanism 900 receives overflow information from the bottom adjacent switch module , back - pressure mechanism 900 informs overflow mechanism 700 through bus 915 , which in turn alerts corresponding schedulers 500 through bus 710 and requests schedulers 500 to decrease the transmission of the data packets . when back - pressure mechanism 900 receives overflow information from the right adjacent switch module , back - pressure mechanism 900 alerts the corresponding input adapters through bus 922 and requests the input adapters to decrease the transmission of the data packets . although specific embodiments of the present invention have been illustrated in the accompanying drawings and described in the foregoing detailed description , it will be understood that the invention is not limited to the particular embodiments described herein , but is capable of numerous rearrangements , modifications and substitutions without departing from the scope of the invention . the following claims are intended to encompass all such modifications . | 7 |
fig1 shows a flow chart of a method for privacy - based representation of a user identity within an online system , according to an embodiment of the present disclosure . the method 100 includes steps that may be automatically executed on a server hosting the online system . in step 102 of the method 100 , a user identity of a user of the online system is requested by a viewer . for example , the request can be made via a user interface ( e . g ., a graphical user interface ) comprising an input interface and an output interface . the viewer may , for example , access a profile of the user , which may display several indications of the user related to his user identity . the user identity may comprise for each such indication at least one element that describes the corresponding characteristic of the user , such as a name or a visual representation of the user . the server hosting the online system can receive the request . the access is handled by the system , which retrieves a status of the viewer with regard to the user in step 104 . the system may , for example , determine if the viewer is a registered user of the online system . if the viewer is registered , the system may determine an affiliation between the viewer and the user . for example , both users may be linked as friends , or the user may be a frequent visitor of content provided by the viewer . furthermore , the system may apply additional rules provided by the user , which may , for example , grant a certain status to viewers identified by their name or a network identification , such as a host name or an ip address . these factors may be combined by the system to determine the status of the viewer . based on the status , the system determines a representation of the user identity in step 106 . the determination may comprise a first step , wherein the status is analyzed to associate a level of privacy to the viewer . each element of the user identity may comprise several definitions which may correspond to the levels of privacy . preferably , a name of the user may vary for each level of privacy . however , a particular definition of an element of the user identity may also be used for several levels of privacy . for example , the user name and the entire profile may be invisible on a first level of privacy according to which the viewer may not be identified at all . on a second level of privacy , the profile may be displayed ; however , the name of the user may still be hidden . this level of privacy may , for example , be applied to unregistered viewers which , however , have supplied any form of identification . on a third level of privacy , the profile may display a nickname or a fantasy name of the user , for example , to viewers that are registered users of the online system which , however , have no link , connection , or affiliation to the user . at a fourth level of privacy , requiring , for example , a status as a friend of the user , the full name of the user may be displayed . lastly , at a fifth level of privacy , which may be reserved to good friends that have possibly been directly identified by the user , the full name with further characteristics may be displayed . further details of this example are disclosed in table 1 . similarly , for each level of privacy , the user identity may comprise different definitions for a visual representation of the user . thus , the content and profile may remain hidden or invisible on a first level of privacy , and only a default icon may be displayed on a second level of privacy , related to anonymous viewers . on a third level of privacy , only a cartoon - like image selected by the user may be presented to other registered users of the online system . a real photograph or image of the user may be shown to friends of the user or other closely affiliated users . lastly , good friends or other users directly identified by the user may be presented a live stream of the user , such as a live profile , whenever the user is connected to the online system . further details of this example are disclosed in table 2 . the definitions of each element of the user identity corresponding to the level of privacy associated with the viewer may be combined in the representation of the user identity , which is thereafter provided to the viewer in step 108 . even though method 100 has been described using examples comprising five different levels of privacy for a representation of the name and of a visual representation of the user , it is to be understood that the user identity may also comprise further elements defining other characteristics of the user and that another number of levels of privacy may be used as well . also , some of the elements may comprise one definition only , which may be used for all levels of privacy . in addition , different levels of privacy may be assigned to a viewer for the respective elements of the user identity . therefore , the present disclosure is not limited by a certain number of levels of privacy or certain characteristics of the user . furthermore , even though methods according to embodiments of the present disclosure have been described , it is to be understood that particular processing steps may be modified , added , and omitted without leaving the scope of the present disclosure . also , the processing steps may be performed in a different order from the examples described . fig2 illustrates a schematic representation of a data structure according to an embodiment of the present disclosure , in combination with retrieval of a representation of the user identity . an online system 200 according to an embodiment may store for each user a user profile 202 , 202 n including a definition of user identity that may comprise several elements 204 , which specify characteristics of the user . furthermore , each element 204 may comprise several definitions related to levels of privacy , such as a real name and a nickname of the user . in addition , the user may specify several groups 206 a , 206 b of other users defining a certain affiliation with the user , such as colleagues , business associates , friends 206 a , close friends 206 b , and others . for example , the user may register in a social network and enter “ karl fischer ” as the real name in a register template and “ k - man ” as his nickname or alter ego name . the user may define several groups of other users , for example , a group of friends , such as the group 206 a , and a group including best friends , such as the group 206 b . he may now set the combined full name “ karl k - man fischer ” as the representation of his name for all users that are marked as friends , such as the user 208 a ( identified in the group 206 a as user u2 ). in addition , the social network may automatically determine the real name “ karl fischer ” for display to other users of the social network connected to him in any suitable way , while everyone else , for example , a public viewer 208 b , may only see the nickname “ k - man ” in the profile of the user . in addition , the user may specify that users marked as best friends , such as his girlfriend , will see “ karl ” as his name in the profile . another user may name himself in the social network “ peter morgan ,” which may correspond to his real name , and may further use the nickname “ madpete .” he may define rules which affect the representation of his profile , such that all his friends or all connected users will see him as “ peter morgan ,” while everyone else will see only his nickname “ madpete ” and nothing else that identifies him . however , it is to be understood that the example is not restricted to a representation of a profile page only . rather , any representation of the identity of the user , for example , coupled to content provided by the user on the social network , may be influenced by the definitions and a respective level of privacy . thus , any shared content of the user that may be visible to the public will preferably be marked with his nickname , as “ from madpete ,” without any trace towards his real identity . yet , if the content is viewed by one of his friends , he will see the content marked as “ from peter morgan .” similar to the definition of the name , a user of the social network may select different pictures for profile icons as a visual representation of himself . the user may set a default picture , such as a grey silhouette of a head , as the default icon for all anonymous or other users to be displayed with his profile . however , if users of the social network , which are somehow connected or affiliated to the user , view the profile , a cartoon picture may be presented . in addition , all users that are in his group “ best friends ” may see a real photograph of the user . furthermore , if the user is online and enables his video chat , all users in his group “ best friends ” may see the video stream as his profile icon . in another example , a user may want to join his friends on the social network and be available for other users he knows , but the user may not want to appear in any public way . therefore , he may set the level of privacy of his profile and user identity to “ invisible ” towards any public users and the user may further specify that the anonymous level of privacy is not applicable to anyone . furthermore , the user may specify that everyone who knows him on the internet will see his nickname only , his colleagues from work will see his real name , and his real world friends , which he may define in a “ friends ” group , such as the group 206 a , which may be users he knows personally outside the internet , will see his combined real name and nickname . even though the processing and data structures of system 200 have been described in connection with examples specifying certain names and identities of users , it is to be understood that the present disclosure is not limited to particular exemplary user characteristics , levels of privacy , and combinations of representation of a user identity . rather , levels of privacy discussed in the examples may be omitted and / or further levels of privacy may be defined . also , it is to be understood that other characteristics of the user , such as an address and further data , and other representations of the user , visual or auditory and others , may be defined as elements with respective definitions for levels of identity in the user identity or profile . also , it is to be understood that many modifications to the example embodiments of the disclosure are possible without leaving the scope of the disclosure . in particular , the embodiments may be practiced within the scope of the claims differently from the examples described and the described features and characteristics may be of importance for the disclosure in any combination . | 7 |
referring to fig1 , the telescopic hot stick or pole of the invention is generally designated by reference numeral 10 . the telescoping hot stick 10 includes a predetermined number of similar length , tubular sections 12 , i . e . 12 a - 12 e , slidably engaged one with the other which provide a variable length for the hot stick 10 , a corresponding number of locking assemblies 14 , i . e . 14 a - 14 d , provided between each adjacent section 12 for securing the adjacent sections 12 in extended engagement , and a tool holder 16 at an extremity 18 thereof . to shorten the overall length of the hot stick 10 , each section 12 is readily movable as described herein . each of the tubular sections 12 a - 12 e has a circular cross section . each tubular section 12 a - 12 d is generally of the same construction except each successive section 12 b - 12 d is of a smaller diameter . the distal - most tubular section 12 e generally will be of a differing construction that does not embrace the thickened wall feature described below . only the tubular section 12 b will be described in detail , it being understood that the tubular section 12 a is of a larger diameter and the successively following sections 12 c and 12 d are of successively smaller diameters . for convenience , the reference numbers used in describing the tubular section 12 b will be used in describing the remaining tubular sections except that the particular tubular section will be referenced by the suffix letter that corresponds to that particular tubular section . referring to fig7 , the elongate tubular section 12 b has a uniform outer diameter throughout its length . on the other hand , the interior wall surface 21 of the section 12 b is composed of a first interior wall surface segment 22 that has a first inner diameter d 1 extending from the left proximal end 23 toward a distal end 24 a finite distance away from the proximal end 23 and a second interior wall surface segment 26 that has a second inner diameter d 2 smaller than the diameter d 1 extending from the distal end 24 a finite distance away from the distal end toward the proximal end 23 . an inclined ramp 27 having an inclined transition surface 28 ( see also fig8 ) joins the mutually adjacent ends of the first and second interior wall surface segments 22 and 26 . referring to fig5 , the locking assembly 14 b includes an end wall portion 31 and a mounting section 32 which are formed of a polymer or any other suitable material . the mounting section 32 is formed with an outer periphery 33 having a circular cross - sectional shape and outer dimension conforming in a close - fit relation to the inner diameter d 1 ( fig7 ) of the interior wall surface segment 22 at the male end 34 so as to permit insertion of the mounting section 32 within the male end 34 . to limit the extent of insertion of the mounting section 32 therein , the end wall portion 31 is dimensioned so as to form an annular flange 36 which extends radially outward so as to be flush or below flush with the outer periphery 29 of the male end 34 . the annular flange 36 ( fig5 ) abuts against an end face 37 of the male end 34 when the locking assembly 14 b is fully inserted therein to close off the male end 34 . the male end 34 is configured to be slidingly inserted into an adjacent female end 35 of the next following tubular section . the locking assemblies 14 b - 14 e are each secured inside the respective male end of each section 12 b - 12 e , respectively , by any conventional and conveniently available means . the tubular section 12 b ( fig5 ) has an aperture 40 adjacent the proximal end 23 thereof . furthermore , the mounting section 32 of the locking assembly 14 b includes a pocket 41 the bottom of which defines a spring seat 42 . a button 43 is reciprocally movably received in the pocket 41 and projects through the aperture 40 when the locking assembly is fully assembled within the male end 34 . a resilient member , here a compression spring 44 is retained between the spring seat 42 and an opposing spring seat 46 formed on the button 43 . to keep the button 43 within the pocket 41 , when the locking assembly 14 b is secured within the male end 34 , outwardly extending flanges 47 are stepped so as to contact the internal wall surface segment 22 at the male end 34 when the button 43 is extended as seen in fig3 . the second interior wall surface segment 26 ( fig7 ) has therein , between the ramp 27 and the distal end 24 , an annular groove 50 fig8 . the depth of the annular groove 50 is , in this particular embodiment , of a diameter that is approximately equal to the diameter d 1 and of an axially oriented width “ w ” that is slightly greater than the corresponding axially extending length dimension of the button 43 . an aperture 51 is located within the annular groove 50 , which aperture is configured to receive the button 43 and without interfering with the ability of the button to move reciprocally radially inwardly and outwardly therein while the button is aligned with the aperture . a modified construction adjacent the distal end of a tubular section is shown in fig8 . it is , for purposes of this disclosure , assumed that the tubular section can be any one of the many sections involved in this hot stick environment but tubular section 12 b has been selected as the particular section for the modified construction and the modified section has been identified by the reference character 12 b ′. here , the circular tubular section 12 b ′ has a uniform wall thickness along its entire length from the proximal end to the distal end . a sleeve 52 circular in cross section of a finite length less than the overall length of the section 12 b ′ and having an outer diameter approximately equaling the inner diameter d 1 of the tubular section 12 b ′ is inserted into the distal end 24 and affixed to the tubular section 12 b ′ by any convenient means , such as , for example , by an adhesive , by sonic welding or utilizing self - adhering materials . it is also within the scope of this invention to mold the product so that the thickened portion is integral with the remainder of the tubular section . the ramp 27 is provided at the proximal end of the sleeve either , such as being a molded construction of the sleeve , before the sleeve is inserted into the tubular section 12 b ′ or is a molded feature on the tube or it is machined into the proximal end of the sleeve after the sleeve has been fixedly secured to the inside of the tubular section 12 b ′. the annular groove 50 is also provided in the sleeve 52 and is either present at the time of inserting the sleeve into the tubular section 12 b ′ or is machined into the sleeve after the sleeve has been fixedly secured to the tubular section 12 b ′. the characteristics of the annular groove 50 in the sleeve 52 are the same as the annular groove 50 described above . an aperture 51 is provided in the tubular section 12 b ′ and the opens into the annular groove 50 and is configured to receive the button 43 and without interfering with the ability of the button to move reciprocally radially inwardly and outwardly therein while the button is aligned with and received in the aperture 51 . the thickened wall thickness at the distal end of each of the tubular sections 12 a - 12 d as well at the distal end of each tubular section having a sleeve 52 inserted and affixed thereto , or is a molded feature of the tube , is designed to have sufficient axial length and a close - fit slidingly engaged relation with a next immediately adjacent inner telescoped tubular section so that the mutually adjacent male ends 34 and female ends 35 of the respective tubular sections will remain coaxial and amply supported with little or no detectable relative movement therebetween when in the extended relation . to extend the telescoping sections from the fig2 position to the fig1 position , the user simply pulls the inner disposed tubular sections sequentially axially outwardly of the proximal tubular section so that the respective buttons 43 will slidingly transition along respective ( a ) first interior wall surface segments 22 , ( b ) the surfaces 28 of the ramps 27 and ( c ) the second interior wall surface segments 26 to a position where the respective buttons will become aligned with the respective annular grooves , at which time the respective springs 44 will urge the respective buttons into the respective annular grooves as shown in the respective positions “ a ”, “ b ” and “ c ” for the respective buttons 43 shown in the representative example of fig8 . thereafter , the pole containing the button 43 will be rotated relative to the groove containing pole to cause the button to become axially aligned with opening 51 and the spring 44 will urge the button through the opening 51 to thereby lock the poles together so that no relative movement will occur therebetween . it is to be recognized that the button 51 can also be urged by application of a manual force to it radially inwardly to that the top surface of the button becomes oriented radially inside the inner surface 26 of the thicker portion of the tube to thereafter facilitate the relative axial movement between the tube sections for purpose of collapsing the pole sections one within the other , or extending any distal section relative to the immediate proximal section for the purpose of removal of the distal pole section from the proximal pole section and all without the use of tools . although particular preferred embodiments of the invention have been disclosed in detail for illustrative purposes to demonstrate the improvement over known constructions , it will be recognized that variations or modifications of the disclosed apparatus of the invention , including the rearrangement of parts , lie within the scope of the present invention . | 8 |
referring to the drawings , fig1 illustrates a part of a semiconductor structure 11 which is a precursor to the photovoltaic device fabrication process described below . the semiconductor structure 11 is formed as a thin semiconductor film applied to a substrate 22 in the form of a glass sheet to which a thin silicon nitride anti - reflection coating 71 has been applied . the anti - reflection coating 71 has a thickness of 80 nm . for optimal performance , the thin semiconductor film comprises a thin polycrystalline silicon film 12 formed with a total thickness in the range of 1 to 2 μm and preferably 1 . 6 μm . the polycrystalline silicon film 12 has an upper p + type region 13 which is 60 nm thick , a lower n + type region 15 which is 40 nm thick , and a 1 . 5 μm thick intrinsic or lightly p type doped region 14 separating the p + and n + type regions . the sheet resistance in both n + type and p + type layers is preferably between 400 and 2500ω /□, with no more than 2 × 10 14 cm − 2 boron in total . typical values are around 750ω /□ for n + type material and 1500ω /□ for p + type material . the thickness of the n + type and p + type layers is typically between 20 and 100 nm . the glass surface is preferably textured to promote light tapping , but this is not shown in the drawings for sake of clarity . as seen in fig2 , the silicon film 12 is separated into cells by scribed isolation grooves 16 . this is achieved by canning a laser over the substrate in areas where isolation grooves 16 are required to define the boundaries of each photovoltaic cell . to scribe the grooves 16 , the structure 11 is transferred to an x - y stage ( not shown ) located under a laser operating at 1064 nm to produce focussed laser beam 73 which cuts the isolation grooves through the silicon . the laser beam is focussed to minimise the width of the groove , which is lost active area . typically , a pulse energy of 0 . 11 mj is required to fully ablate the silicon film and gives a groove width of 50 μm . to ensure a continuous groove , successive pulses are overlapped by 50 %. the optimum cell width is in the range of 5 to 8 mm and cell widths of 6 mm are typical . as seen in fig2 , two layers of insulation are preferably used on the surface of the silicon and are added after the laser scribing step described above . the first insulation layer is an optional thin but tough cap nitride 72 . this layer protects the exposed silicon along the edges of the cell definition grooves 16 after laser scribing and passivates the surface of the silicon . the cap nitride 72 is preferably capable of being etched completely in a few minutes to allow access to the silicon at n type and p type contact locations and typically comprises 60 nm of silicon nitride deposited by pecvd at a temperature of 300 - 320 ° c . before the cap layer 72 is applied , the structure 11 is transferred to a tank containing a 5 % solution of hydrofluoric acid for one minute . this removes any remaining debris and any surface oxides that may have formed . the structure is rinsed in de - ionised water and dried . the second insulation layer 17 is a thin layer of organic resin . the insulating resin is resistant to dilute solutions of hydrofluoric acid ( hf ) and potassium permanganate ( kmno 4 ), and is preferably vacuum compatible to 10 − 6 mbar . the insulation material most often used is novolac resin ( az p150 ) similar to that used in photoresist ( but without any photoactive compounds ). the novolac resin is preferably loaded with 20 - 30 % white titania pigment ( titanium dioxide ) which improves coverage and gives it a white colour that improves its optical reflectivity to help trap light within the silicon . the resin layer 17 serves as an etch mask for etching steps described below and also covers over the rough jagged surface that is formed along the edges of the cell definition grooves 16 , an area that is prone to pinholes in the cap nitride layer 72 . the organic resin layer 17 also thermally and optically isolates the metal layer from the silicon to facilitate laser patterning of a metal layer in contact forming process steps described below . the novolac resin is applied to each module to a thickness of 4 to 5 μm using a spray coater . after the structure 11 is coated it is passed under heat lamps to heat it to 90 ° c . to cure . as seen in fig2 , the insulation layer 17 is applied over the cap layer 72 and extends into the cell separation grooves 16 . in order to make electrical contact to the buried n + type layer and the upper p + type layer with a metal layer which will be subsequently formed , holes must be made through the novolac resin layer 17 and the cap nitride layer 72 in the locations where the n type “ crater ” contacts and the p type “ dimple ” contacts are required . firstly with regard to the “ crater ” contacts to the buried n + type silicon layer , as well opening the novolac resin layer 17 and the cap nitride layer 72 , most of the silicon film 12 must be removed from areas beneath what will later become the n type metal pads to form the n type contact openings 32 . referring to fig3 and 5 ink - jet technology is used to open holes in the novolac resin layer 17 at the crater locations . to achieve this the structure 11 is loaded onto an x - y stage equipped with an ink - jet head 91 having multiple nozzles with a nozzle spacing of 0 . 5 mm and controlled by controller 92 . the glass is held down with a vacuum chuck and initially scanned to ensure that no point is deformed more than 1 mm above the stage . the glass is then scanned beneath the head 91 at a table speed of typically 400 mm / s . droplets 76 of dilute ( 15 %) potassium hydroxide ( koh ) ( see fig4 ) are dispensed at locations intended for n type ‘ crater ’ contacts . the odd - numbered nozzles fire in the odd - numbered cells , and the even - numbered nozzles fire in the even - numbered cells , so that within a given cell , the spacing between lines of droplets is 1 mm . the spacing between droplets within each line is 400 μm , hence the rate of droplet release at a table speed of 400 mm / s is 1 khz . the droplets are sized to etch circular openings in the resin layer that are about 100 μm in diameter . the koh solution removes the resin insulation 17 in the area of the droplet 76 after a few minutes to form the hole 32 seen in fig5 . the openings 32 are spaced holes so that lateral continuity is maintained in the semiconductor layer after contact formation . the ink - jet printing process applies a droplet 76 of the caustic solution in a controlled manner to remove the insulation only where the n type contacts are to be formed . the caustic solution preferably contains potassium hydroxide ( koh ) but can also use sodium hydroxide ( naoh ) and includes glycerol for viscosity control . the print head used for this purpose is a model 128id , 64id2 or 64 - 30 manufactured by ink jet technologies inc ., and will print substances having a viscosity in the range 5 to 20 centipoise . the droplet size deposited by the print head is in the range of 20 to 240 picolitre corresponding to a deposited droplet diameter range of 50 - 150 μm . in the preferred embodiment the droplets are printed at a diameter of 100 μm . it should be noted that novolac is an organic resin closely related to the resins used in photo - resist material and the etchant printing process described above will apply equally to the patterning of other such materials . to extend the opening 32 into the silicon layer 12 as seen in fig6 , the structure 11 is rinsed in water to remove residual koh from the ink - jet printing process , and it is then immersed in a tank containing a 5 % solution of hydrofluoric acid for 1 minute to remove the silicon nitride from the n type contact openings 32 . the sheet is then directly transferred toga tank containing 1 % hydrofluoric acid ( hf ) and 0 . 1 % potassium permanganate ( kmno 4 ) for 4 minutes . this time is long enough to remove all of the p + type layer and etch down along grain boundaries to expose some of the n + type layer for the silicon thicknesses stated above however the time should be adjusted for different silicon layer thicknesses , silicon crystal quality and extent of surface texturing . the structure 11 is then rinsed in de - ionised water and dried . the resulting opening 32 in the silicon 12 has a rough bottom surface 82 , in which some points may be etched through to the anti - reflection layer 71 and some ridges 83 extend into the lightly doped p type region 14 as seen in fig6 . however as long as some of the n + type region is exposed , good contact can be made to the n + type region . because the p type region is very lightly doped in the area near the n + type region there is insufficient lateral conductivity to cause shorting if some p type material is also left in the bottom of the hole 32 . because the side walls of the hole 32 are passing trough the p + type region 13 and the lightly doped region 14 , the walls need to be insulated to prevent shorting of the p - n junction . this is achieved by causing the insulation layer 17 to re - flow whereby a portion of the insulation layer 78 in the vicinity of the edge of the opening 32 flows into the hole to form a covering 79 over the walls as seen in fig7 . to achieve this the sheet is passed through a zone containing a vapour of a suitable solvent . this causes the novolac resin of the insulating layer 17 to reflow , shrinking the size of the crater openings . 32 . as the samples exit this zone , they are heated under heat lamps to a temperature of 90 ° c . to drive out the remaining solvent . the rate of re - flow will vary with the aggressiveness of the solvent used , the concentration and , temperature . there are many suitable , volatile solvents that will dissolve organic resins such as novolac , including substances such as acetone . acetone is a suitable solvent for the process , but acts quite aggressively , requiring only a few seconds to cover the walls of the hole 32 with resin , and making it difficult to control the pus accurately . the preferred solvent is propylene glycol monomethyl ether acetate ( pgmea ) and the device is introduced into an atmosphere containing a saturated vapour of pgmea at room temperature ( eg , 21 ° c .) for 4 minutes until a slight shrinkage of the holes in the insulation is observed . a further set of holes 19 ( see fig8 ) are then formed in the insulation layer 17 , again using the printing and etching process described above with reference to fig3 and 5 . these - openings are formed by printing droplets 81 of caustic solution onto the insulation ( see fig7 ) in the locations where p type contact “ dimples ” are required . following the removal of the insulation layer 17 by the caustic solution to form the openings 19 ( see fig8 ), any residual caustic solution is washed off with water and the cap layer 72 removed in the openings 19 with an etch of 5 % hydrofluoric acid ( hp ) for 1 minute ( note times of from 10 seconds to 10 minutes may be required to remove the nitride layer depending on its stoichiometry ). optionally , any damaged silicon material on the surface of the p + type region 13 is then removed to allow good contact using an etch in 1 % hydrofluoric acid ( hf ) and 0 . 1 % potassium permanganate ( kmno 4 ) for ten seconds followed by a rinse in de - ionised water to provide the slightly recessed contact “ dimple ” 85 seen in fig9 . this length of etch is long enough to remove surface plasma damage without etching all the way through the p + type layer 13 . it is also short enough to have negligible impact on the n type contacts . the final stage of device fabrication involves depositing a metal layer and slicing it up so that it forms a plurality of independent electrical connections , each one collecting current from one line of p type dimple contacts and delivering it to a line of n type crater contacts in the adjacent cell . in this manner , monolithic series interconnection of the cells is achieved . before the metal layer is applied , the structure 11 is immersed into a tank containing a 0 . 2 % solution of hydrofluoric acid for 20 seconds . this acid removes the surface oxide from both the crater and dimple contacts . there is wide latitude for the strength and duration of this etch . the structure is then rinsed in deionised water and dried . turning to fig1 , the contact metal for the n type and p type contacts is applied simultaneously by depositing a thin metal layer 28 over the insulation layer 17 and extending into the holes 32 and 19 to contact the surfaces 82 and 85 of the n + type region 15 and p + type region 13 . the metal layer is preferably a thin layer of pure aluminium , which makes good electrical contact to both n + type and p + type silicon , provides good lateral conductivity , and has high optical reflectance . the aluminium thickness is typically 100 nm . the isolation of the n type end p type contacts is achieved by using a laser 86 ( see fig1 ) to melt and / or evaporate the metal layer 28 to thereby form an isolation groove 31 as seen in fig1 . when the laser is pulsed on , a small amount of metal is ablated directly under the beam creating a hole 31 . the structure 11 is processed using a laser operating at 1064 nm to scribe the isolation grooves in the metal layer 28 . the laser is adjusted so that it scribes through the metal layer 28 without damaging the silicon 12 . these scribes 31 separate the n type contacts 32 from the p type contacts 19 within each cell , while retaining the series connection of each cell to its neighbours . preferred laser conditions are a pulse energy of 0 . 12 mj with the beam defocused to a diameter of about 100 μm . the pulse overlap is 50 % and the scribes are spaced 0 . 5 mm apart . in addition , there are discontinuous scribes 34 along each cell definition groove 16 ( see fig1 ). fig1 illustrates a rear view of a part of a device made by the process described above , from which it can be seen that each of the cells of the device 11 comprises an elongate photovoltaic element 35 a , 35 b , 35 c , 35 d divided across its long axis by a plurality of transverse metal isolation scribes 31 which isolate alternate sets of holes 19 and holes 32 respectively providing contacts to the p + type and n + type regions of the cell . the transverse scribes 31 are made as long substantially straight scribes extending over the length of the device such that each scribe crosses each elongate cell . following the formation of the first set of scribes 31 , a fewer set of metal isolation scribes 34 are formed over the cell separation scribes 16 between adjacent cells 11 , to isolate every second pair of cells . the metal isolation scribes 34 extending to either side of any one of the elongate transverse scribes 31 are offset by one cell with respect to those on the other side of the same transverse scribe 31 such that the cells become series connected by a matrix of connection links 36 with alternating offsets , connecting one set of p type contacts 19 of one cell 35 to a set of n type contacts 32 of an adjacent cell 35 , as shown in fig1 . the metal isolation scribes 31 comprises a first set of long scribes transverse to the cells 35 from 50 - 200 μm wide , preferably about 100 μm wide . the scribes are typically spaced on centres of 0 . 2 - 2 . 0 mm and preferably about 0 . 5 mm to form conducting strips about 0 . 2 - 1 . 9 mm and preferably about 0 . 4 mm wide . the isolation scribes 34 comprises a second set of interrupted scribes parallel to the long direction of the cells 35 and substantially coincident with the cell isolation grooves 16 in the silicon , the isolation scribes 34 are also from 50 - 200 μm wide , preferably about 100 μm wide . it is equally possible to form the isolation scribes 34 before forming the transverse isolation scribes 31 . the scribed areas are illustrated in fig1 with cross - hatching . a portion of the completed - structure is illustrated in fig1 which shows the connection of an n type contact of one cell to the p type contact of an adjacent cell to provide a series connections of cells . in practice there may be several n type contacts grouped together and several p type contacts grouped together however for the sake of clarity only one of each is shown in each cell . the arrangement shown in fig1 is also schematic as the isolation grooves 16 in the silicon and the isolation grooves 31 in the metal run perpendicularly to one mother in practice as is seen in fig1 . it will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described . the present embodiments are , therefore , to be considered in all respects as illustrative and not restrictive . | 8 |
the &# 34 ; eye - piece &# 34 ; system shown in fig1 receives infra - red radiation from a real image position i and collimates that radiation to a scanning space s at which a scanner ( not shown ) operates in known manner . the &# 34 ; eye - piece &# 34 ; system comprises four lens elements 1 , 2 , 3 and 4 . the back ( i . e . to the left as viewed in fig1 ) elements 1 and 2 constitute a back group comprising a pair of positively powered meniscus elements disposed with their convex surfaces r2 and r3 facing each other . their concave surfaces r1 and r4 thus face outwardly , i . e . the concave surface r1 faces rearwardly towards the scanner space s and the concave surface r4 faces forwardly . the forwardly facing convex front surface r2 of the back element 1 of the pair and the rearwardly facing convex back surface r3 of the front element 2 of the pair are closely spaced and define between them an air lens of positive power . the elements 3 and 4 are located in front of the pair of elements 1 and 2 , i . e . between the element 2 and the image position i . the elements 3 and 4 are closely spaced and constitute a front lens group of negative power in which the rear element 3 is of positive power and has a convex rear surface r5 , while the front element 4 is of negative power and has a concave front surface r8 . the rear element 3 of the group has a front concave surface r6 and the front element 4 has a rear concave surface r7 , these concave surfaces r6 and r7 forming or defining between them an air lens of negative power . fig1 shows a further lens element 5 of positive power located on the opposite side of the image position i from the group of elements 3 and 4 . the element 5 , which is of meniscus shape with its convex surface r10 to the front and its concave surface r9 to the back , i . e . facing towards the image position i , can be considered as a field lens or perhaps as part of the objective system with which the &# 34 ; eye - piece &# 34 ; system is used . a catadioptric objective system is shown in fig2 . it comprises a mangin secondary mirror 6 having a first concave surface r11 and an internally convex mirrored surface r12 , and a primary mirror 7 having a concave mirrored front surface r13 . the primary mirror 7 has a central aperture 8 through which radiation passes to the &# 34 ; eye - piece &# 34 ; system . in use infra - red radiation from a distant scene or object is received by the primary mirror 7 and reflected from the surface r13 to the mangin secondary mirror . it is transmitted ( with refraction ) through the surface r11 , reflected internally from the mirrored surface r12 , and then transmitted ( with refraction ) again through the surface r11 . the radiation from the mangin secondary mirror is transmitted through the field lens element 5 to the image position i at which it is focussed to form an image of the distant scene or object . radiation from this intermediate image is transmitted through the refracting elements 4 , 3 , 2 , and 1 of the &# 34 ; eye - piece &# 34 ; system to the scanner space s at which there is effectively formed a collimated magnified view of the scene or object . the negatively powered lens group formed by elements 3 and 4 in the &# 34 ; eye - piece &# 34 ; system has three main purposes . firstly it contributes towards astigmatism correction of the afocal telescope . secondly it matches the &# 34 ; entrance pupil &# 34 ; of the &# 34 ; eye - piece &# 34 ; system and the &# 34 ; exit pupil &# 34 ; of the objective system . thirdly it overcorrects the petzval sum of the &# 34 ; eye - piece &# 34 ; system such that the afocal telescope is truly afocal at all scan angles . additionally and importantly , however , it fulfills these purposes while minimising the aperture requirements in , and in front of , the objective system . it will be understood by those skilled in the art that these three main purposes could in principle by met by a thick meniscus lens element having a back convex surface and a front concave surface . however , if this is done , the concave surface can become excessively steep , giving rise to increased pupil spherical aberration . this increases the aperture requirements in , and in front of , the objective system . thus , in the described embodiment of objective system it could increase the aperture requirements of the primary mirror 7 and of any scanning mirror and / or window which may be located in front of the objective system . by having a negatively powered air lens between elements 3 and 4 in accordance with the invention , the power of the outer negative curve can be reduced relatively and therefore pupil spherical aberration can be correspondingly reduced . thus the radius of curvature of the concave surface r8 may , as in the embodiments shown , be greater than that of the convex surface r5 . in the particular embodiment shown in fig1 by way of example the negative air lens is formed between concave surfaces r6 and r7 . it is not , however , essential that the surfaces defining the air lens should both be concave and one of them could be planar or even convex so long as the air lens is of negative power . further , although the particular preferred embodiment employs a negatively powered air lens , it will be appreciated that the negatively powered lens could be of a suitable gas other than air . thus , while the solid lens elements are in the particuar described embodiment and for convenience air spaced , it will be understood that some other suitable gas could be used with appropriate design or optimisation to allow for the relevant optical properties of the respective gas . it will be understood that the solid lens elements ( 1 to 6 in the particular embodiment of fig2 ) are of an infra - red transmitting material having a useful spectral bandpass in the required infra - red wavelength region , which may be the 8 to 13 micron waveband or could be the 3 to 5 . 5 micron waveband . yet further , in the particular preferred embodiments all the curved lens surfaces are of spherical curvature , but it will be appreciated that one or more aspheric surfaces could be used if desired . further still , it will be understood that a catadioptric objective system is described above by way of illustration and example and that an &# 34 ; eye - piece &# 34 ; system in accordance with the invention could be used in combination with any other suitable form of objective system and in particular an objective system whose powered elements are all refracting elements . fig3 to 6 illustrate further embodiments which are basically similar to that of fig2 but with differences as follows . in fig3 the front lens element 2 of the back group is biconvex instead of meniscus ( i . e . its front surface r4 is convex as well as its back surface r3 ). in fig4 this lens element 2 is meniscus but bent the same way as the back lens element 1 , i . e . with its concave surface r3 facing rearwardly and its convex surface r4 facing forwardly . in fig5 the back group of two lens elements 1 and 2 in the other embodiments is replaced by a single meniscus element 1 whose concave surface r1 faces rearwardly and whose convex surface r2 faces forwardly . also in fig5 the rear surface r7 of the front lens element 4 of the front lens group is planar . in fig6 this surface r7 is convex and the back and front lens groups are closely adjacent ( whereas in the other embodiments they are relatively well spaced ). thus in fig6 the front surface r4 of the back lens group is closely adjacent or virtually in contact with the rear surface r5 of the front lens group . also in fig6 the meniscus field lens element 5 is disposed with its convex surface r9 facing towards the intermediate image and its concave surface r10 facing towards the mangin secondary mirror 6 whose first surface r11 is planar . particular examples of non - galilean afocal infra - red optical systems or telescopes in accordance with the fig2 to 6 embodiments have numerical data as given below under examples 1 to 5 respectively . the dimensiional units are millimeters but the values are relative and can be scaled accordingly . these examples are all designed to operate in the thermal 8 to 13 micron waveband and the material of the lens elements 1 to 6 is germanium in each case . example 4 omits lens element 2 and surfaces r3 and r4 since in that example there is only a single back lens element 1 in accordance with fig5 . each of these examples provides a magnification of x15 , a field view of 46 degrees , and an exit pupil diameter of 17 . 5 mm . ______________________________________ sur - radius of axial thickness / focalelement face curvature separation length______________________________________ r1 - 146 . 541 4 . 20 88 . 5 r2 - 96 . 505 0 . 50 r3 + 125 . 222 4 . 65 123 . 7 r4 + 183 . 66 19 . 75 r5 + 68 . 2853 5 . 50 50 . 0 r6 + 117 . 64 4 . 02 r7 - 500 . 384 6 . 60 - 25 . 4 r8 + 91 . 034 31 . 83 r9 - 196 . 485 6 . 35 60 . 3 r10 - 96 . 505 267 . 8 r11 - 2980 . 46 12 . 7 r12 + 2286 . 0 - 180 . 3 - 12 . 7 r11 - 2980 . 4 - 308 . 17 r13 + 845 . 25______________________________________ back group ( elements 1 and 2 ) focal length : 50 . 7 front group ( elements 3 and 4 ) focal length : - 78 . 7 ______________________________________ radius of axial thickness focalelement surface curvature separation length______________________________________ r1 - 138 . 071 4 . 20 99 . 7 r2 - 96 . 67 0 . 5 r3 + 413 . 562 4 . 65 92 . 8 r4 - 846 . 67 15 . 07 r5 + 66 . 253 5 . 50 48 . 8 r6 + 113 . 36 3 . 42 r7 - 1110 . 34 6 . 60 - 24 . 8 r8 + 80 . 03 36 . 85 r9 - 176 . 215 6 . 35 55 . 1 r10 - 94 . 00 267 . 8 r11 - 3068 . 76 12 . 70 r12 + 2247 . 1 - 161 - 12 . 70 r11 - 3068 . 7 308 . 17 r13 + 845 . 25______________________________________ back group ( elements 1 and 2 ) focal length : 47 . 7 front group ( elements 3 and 4 ) focal length : - 75 . 2 ______________________________________ sur - radius of axial thickness / focalelement face curvature separation length______________________________________ r1 - 135 . 071 4 . 20 109 . 3 r2 - 97 . 94 0 . 5 r3 - 846 . 72 4 . 65 92 . 7 r4 - 210 . 32 15 . 78 r5 + 63 . 323 5 . 50 44 . 4 r6 + 112 . 78 3 . 29 r7 - 1947 . 04 6 . 60 - 24 . 4 r8 + 76 . 42 37 . 58 r9 - 172 . 095 6 . 35 63 . 7 r10 - 93 . 09 267 . 8 r11 - 2812 . 86 12 . 7 r12 + 2367 . 3 - 180 . 2 - 12 . 7 r11 - 2812 . 8 - 308 . 17 r13 + 845 . 25______________________________________ back group ( elements 1 and 2 ) focal length : 50 . 0 front group ( elements 3 and 4 ) focal length : - 88 . 9 ______________________________________ sur - radius of axial thickness / focalelement face curvature separation length______________________________________ r1 - 165 . 651 8 . 32 50 . 0 r2 - 81 . 69 7 . 02 r5 + 61 . 263 5 . 50 42 . 6 r6 + 109 . 63 3 . 03 r7 plane4 6 . 60 - 25 . 3 r8 + 76 . 24 47 . 96 r9 - 202 . 775 6 . 35 71 . 4 r10 - 106 . 68 267 . 8 r11 - 2611 . 36 12 . 7 r12 + 2494 . 6 - 180 . 5 - 12 . 7 r11 - 2611 . 3 - 308 . 17 r13 + 845 . 25______________________________________ back element ( 1 ) focal length : 50 . 0 front group ( elements 3 and 4 ) focal length : - 110 . 9 ______________________________________ sur - radius of axial thickness / focalelement face curvature separation length______________________________________ r1 - 105 . 941 4 . 20 201 . 3 r2 - 92 . 83 0 . 50 r3 + 104 . 662 4 . 65 99 . 9 r4 + 155 . 33 0 . 51 r5 + 60 . 153 6 . 14 84 . 4 r6 + 72 . 83 5 . 21 r7 + 309 . 184 6 . 60 - 50 . 6 r8 + 100 . 24 50 . 47 r9 + 190 . 965 6 . 35 100 . 4 r10 + 508 . 0 267 . 8 r11 plane6 12 . 7 r12 + 1578 . 4 - 186 . 0 - 12 . 7 r11 plane - 320 . 87 r13 + 845 . 25______________________________________ back group ( elements 1 and 2 ) focal length : 65 . 1 front group ( elements 3 and 4 ) focal length : - 217 . 6 | 6 |
the invention is described with reference to a third - generation non - ionic , water soluble contrast agent called ioxilan . toxicological and pharmacological studies of ioxilan indicate that the body has a high overall biological tolerance for ioxilan . however , other water soluble non - ionic contrast agents , including but not limited to iohexol , iopromide , iotrolan , iopamidol , metrizamide , ioglunide , iogulamide , and similar agents , also are suitable for use according to the present invention . generally , water soluble non - ionic contrast agents suitable for use in the present invention are aromatic compounds substituted with an amount of a radiopaque element sufficient to render the compound detectable by standard diagnostic tools , such as computed tomography . even a single radiopaque substituent may be sufficient for purposes of the present invention ; however , the presence of two or more radiopaque substituents renders the material more detectable . therefore , it is preferred to have as many radiopaque substituents on the aromatic ring as possible , preferably three such agents on alternating carbons of the aromatic ring . the radiopaque element can be any suitable non - toxic element ; however , the preferred radiopaque element is iodine . the aromatic compound also has at least one amide substituent with an aliphatic vicinal diol and / or 1 , 3 - diol substituent bound to either the carbon or nitrogen of the amide moeity . this hydrophilic aliphatic polyol substituent renders the contrast agent water soluble . in other words , a preferred embodiment of the invention comprises an aromatic ring alternately substituted at the ring carbons with a radiopaque element , preferably iodine , and an aliphatic amide group . each of the aliphatic amide groups preferably contains at least one hydroxyl group , and at least one of the amide groups must contain a vicinal diol or a 1 , 3 - diol . the following is an illustration of the general structure of suitable water soluble non - ionic contrast agents : ## str1 ## r is a radiopaque element ; r 1 is an amide group bonded to said aromatic ring at either the nitrogen or the carbon of the amide , the unbonded nitrogen or carbon having a substituent selected from the group consisting of an aliphatic vicinal diol and an aliphatic 1 , 3 - diol ; and r 2 is selected from the group consisting of a radiopaque element , a hydrogen , an alkyl group having between about 1 - 4 carbon atoms , and an amide group bonded to the aromatic carbon at either the nitrogen or the carbon of the amide , the unbonded nitrogen or carbon having a substituent selected from the group consisting of hydrogen , an alkyl group having between about 1 - 3 carbon atoms , and a hydroxylated aliphatic side chain having between about 1 - 8 carbon atoms . preferably , the aromatic carbon is substituted with at least two amide groups having a vicinal diol or 1 , 3 - diol substituent and at least two radiopaque elements , preferably iodine . the foregoing non - ionic contrast agents may be chemically modified to form cyclic carbonates and carbamates . one such suitable method is described in kutney , j . p ., and ratcliffe a . h . &# 34 ; a novel and mild procedure for preparation of cyclic carbonates . an excellent protecting group for vicinal diols .&# 34 ; synth . commun . 1975 ; 5 ; 47 - 52 ( incorporated herein by reference ). generally the radiopaque contrast agent is thoroughly mixed with ( a ) an activating and / or coupling agent , such as carbonyldiimidazole ( cdi ), a phosgene , a triphosgene , trichloromethyl chloroformate , or other activating / coupling agents known in the art , in ( b ) a polar aprotic solvent , such as dry dimethyl sulfoxide ( dmso ), dimethylformamide , 1 - methyl - 2 - pyrrolidinone , or other polar aprotic solvents known in the art , in the presence of ( c ) a catalyst capable of catalyzing the formation of cyclic carbonates and carbamates from said water soluble non - ionic cm . suitable catalysts include salts of alkyl oxides , such as sodium methoxide , sodium ethoxide , potassium methoxide or similar salts . the mixing process typically requires about 30 minutes . after mixing , the solution should be stirred for a time and at a temperature sufficient to permit the formation of cyclic carbonates and carbamates . typically , the solution should be stirred between about 2 - 20 hours , preferably at least about 10 hours , at a temperature between about 40 °- 90 ° c ., preferably at about 70 ° c . the reaction then may be terminated by adding an organic solvent , such as methylene chloride , and washing with cold water . the solution should separate into an organic and a water phase , the cyclic carbonates and carbamates remaining in the organic phase , and the dmso remaining in the water phase . once the organic phase has been separated , the organic solvent is dried over dehydrating agents , such as mgso 4 , na 2 so 4 , or a similar agent . the solvent then is filtered and evaporated to dryness so that the product may be collected for further use . fig1 is a diagrammatic representation illustrating the reaction of ioxilan to form ioxilan carbonate according to the present invention . the following is a general formula which , without limiting the present invention , is believed to represent biodegradable contrast prodrug made from water - soluble non - ionic cm prepared according to the method of the present invention : ## str2 ## in the foregoing structure , r is a radiopaque element . preferably all three r groups are radiopaque elements , preferably iodine . r 1 is an amide group bonded to the aromatic ring at either the nitrogen or the carbon of the amide moiety , and the unbonded nitrogen or carbon of the amide moiety is substituted by an aliphatic group which includes a cyclic carbonate and / or a carbamate . r 2 preferably is another amide group which contains another cyclic carbonate and / or a carbamate ; however , r 2 also may be a radiopaque element , hydrogen , an alkyl group having between about 1 - 4 carbon atoms , or any other substituent which will not interfere with the function of the contrast agent -- that is , to opacify the liver parenchyma while biodegrading to water soluble , non - ionic by - products . the prodrugs or precursors of the invention are formulated as injectable microparticles ( mean diameter about 1 - 2 micron ) in the following manner . the cyclic carbonate and carbamate derived from the water soluble non - ionic contrast agent ( s ) is dissolved in organic solvent or solvent mixture , which may include but is not limited to acetone , chlorinated carbon , tetrahydrofuran , dimethylformamide , etc ., preferably a mixture of acetone and methylene chloride . the organic solution containing the prodrug is added to an aqueous solution containing an emulsifier , such as polyvinyl alcohol , tween 80 , cellulose , polyvinylpyrrolidone . a preferred emulsifier is polyvinyl alcohol . the mixture then is emulsified mechanically with or without sonication for up to about 10 minutes , and stirred for about another 4 hrs to ensure complete removal of organic solvent . the resulting microparticles are collected following repeated centrifugation and washing steps . the invention will be more clearly understood with reference to the following examples . for purposes of the following examples , ioxilan was supplied by cook imaging corp . ( bloomington , ind .). carbonyldiimidazole ( cdi ), dimethyl sulfoxide ( dmso ), magnesium sulfate , methylene chloride , and sodium methoxide were obtained from aldrich chemical co . ( milwaukee , wis .). poly ( vinyl alcohol ) ( pva , mw 30 to 70k ) was purchased from sigma chemicals co . ( st . louis , mo .). the cyclic carbonate of ioxilan ( ix - c ) was prepared using the method of kutney and ratcliffe , synth . commun . 1975 ; 5 ; 47 - 52 , incorporated herein by reference . a solution of cdi ( 4 g , 24 mm ) in dry dmso ( 15 ml ) was dropped into a solution of ioxilan ( 4 g , 2 . 5 mm ) in dmso ( 10 ml ) over a period of 30 minutes and stirred at 70 ° c . overnight . a catalytic amount of sodium methoxide was added to facilitate the formation of cyclic carbonates . to terminate the reaction , the dmso solution was diluted with methylene chloride and washed with cold water . the methylene chloride layer was dried over mgso 4 and evaporated to dryness to yield 2 . 2 g product ( yield 50 %). tlc ( silica , chloroform : methanol , 10 : 1 ) indicated only one spot ( rf = 0 . 75 ). ir ( kbr , cyclic carbonate ): 1780 cm - 1 . mass spectrum was determined by fast atom bombardment ( kratos ms50 , england ) using nitrobenzyl alcohol as matrix material : mh + = 870 . elemental analysis , calculated c : 29 . 0 %, h : 2 . 07 %, n : 4 . 83 %, i : 43 . 8 %; found c : 30 . 6 %, h : 2 . 47 %, n : 4 . 63 %, i : 42 . 0 %. carbon - 13 nmr ( dmso - d6 ) revealed the presence of acetyl methyl carbon ( 22 . 3 ppm ), aliphatic carbons ( 40 . 7 to 74 . 9 ppm , 8c ), aromatic carbons ( 91 . 0 , 99 . 5 , 100 . 4 , 146 . 7 , 151 . 0 , and 151 . 9 ppm ), and amide carbonyl carbons ( 167 . 3 to 170 . 2 ppm , 3c ), representing the basic structure of ioxilan . cyclic carbonate carbons and carbamate carbon ( 148 . 6 , 154 . 2 , 154 . 5 ) were also present . ix - c particles were prepared by a solvent extraction / evaporation method . a solution of ix - c ( 3 . 0 g ) in acetone ( 20 ml ) and methylene chloride ( 60 ml ) was added to an aqueous solution of pva ( 400 ml , 1 %, w / v ). the mixture was emulsified with an emulsifier ( tekman , germany ) for 1 minute and then stirred at 400 rpm for 4 hours to ensure complete removal of organic solvent . the resulting emulsion was centrifuged at 3000 rpm , resuspended in distilled water , filtered through a nylon filter ( 5 - μm pore size ), and centrifuged again . the process was repeated three times . finally , the centrifuged product was resuspended in saline and adjusted to proper volume for in vitro and in vivo testing . surface characteristics of the particles were evaluated with a scanning electron microscope ( hitachi model s520 ). for sample preparation , microspheres were placed onto a 0 . 1 - μm nuclepore membrane , mounted onto stubs and sputter - coated with 200å gold - palladium ( 80 : 20 ) in a hummer vi ( technics , springfield , va .). the size distribution of ix - c particles was measured by light scattering with a nicomp 370 submicron particle sizer ( nicomp instruments corp ., goleta , calif .). suspension stability of radiopaque particles were observed under light microscopy 20 × 2 . 5 , zeiss , germany ) and recorded with a video camera . ix - c particle suspensions in saline and in saline solution of tween 80 ( 0 . 1 %, w / w ) were studied . after 5 minutes of observation , fresh rat plasma was added onto the suspensions , and the mixtures were observed for an additional 5 minutes to record any changes . degradation of ix - c particles was investigated by incubating a suspension of the particles ( 25 mg ) in the following solutions ( each 1 ml ) at 37 ° c . : 0 . 1 n hcl , 0 . 1 n naoh , saline , and rabbit plasma . the disappearance of the particles in the suspensions was noted by visual observations and the integrity of the particles was examined by scanning electron microscopy . to identify the degradation products , the residual solutions were subjected to analysis by hplc . the hplc system consisted of a rp - 18 column , a perkin - elmer isocratic lc pump ( model 250 ), a pe nelson 900 series interface , a spectra - physics uv / vis detector ( model sp 8540 ) and a data station . the eluant ( 10 % methanol in double distilled water ) was run at 0 . 8 ml / min . with uv detection at 254 nm . samples in hcl or naoh were neutralized before injection . plasma samples were first treated with pca ( 0 . 4 n ) and centrifuged to remove precipitate proteins . the supernatants were then injected for hplc analysis . ld 50 of ix - c particles was determined by injecting different volumes of particulate suspension ( 80 mg i / ml saline ) into the tail veins of mice . swiss webster mice ( harlan sprague dawley inc ., indianapolis , ind .) weighing between 25 and 30 g were given doses ranging from 0 . 2 to 1 ml / mouse . five animals were used for each dose . no anesthesia was used for injection . following the injection , animals were monitored daily for 7 days . the percentage survival vs . dose curve was constructed to estimate ld 50 . new zealand white rabbits ( male , 3 . 0 to 3 . 5 kg ) were anesthetized by an intramuscular injection of a solution containing xylazine ( 8 . 6 mg / ml ), ketamine ( 42 . 9 mg / ml ), and acepromazine ( 1 . 4 mg / ml ) at a dose of 0 . 4 ml / kg for a long - lasting effect . intravenous catheters ( 22 - gauge ) were placed in a marginal ear vein for the introduction of particle suspension . rabbits were positioned supine in a ge model 9800 quick scanner ( milwaukee , wis .). the particulate contrast agent of proper volume ( 8 % i , w / v in saline ) was injected through the catheterized ear vein over a period of 10 to 15 minutes . ct imaging of radiopaque particles ( 80 mg i / ml ) was carried out at doses of 100 , 200 , and 270 mg i / kg body weight respectively . three rabbits were used for each dose level . ct imaging was done with a scan speed of 1 . 0 seconds , 120 kv , 280 mas , and a 25 - cm field of view . sequential , contiguous 3 - mm - thick slices through the abdomen and 5 - mm - thick - slices through the pelvis were obtained before contrast injection , immediately after injection and at various times ( 15 and 30 minutes , 1 , 2 , and 6 hours , and 1 , 2 , and 7 days after injection ). the rabbits were killed with an overdose of pentobarbital sodium ( 50 mg / kg ) administered via the catheterized ear vein . densitometric analysis of the liver , kidney , aorta , and bladder were performed . the density attenuation ( hu ) was obtained from 10 areas of interest from at least three slices . to minimize the partial volume effect , care was taken to ensure that no visible blood vessels were included in the area of interest . organ enhancement vs . time curves for each dose administered were constructed to determine the pharmacokinetic profiles . four new zealand white rabbits ( 3 . 0 to 3 . 5 kg ) were inoculated at a single site in the liver with a 0 . 5 cc suspension of minced vx2 tumor fragments (˜ 10 6 cells ). the vx2 tumors were maintained through serial animal passage and were available from the university of texas m . d . anderson cancer center . ct scans were performed 5 days after inoculation . after preinjection scanning , ix - c particles ( 80 mg i / ml ) of dose 200 mg i / kg body weight were injected intravenously and abdominal scans were performed immediately after injection and at 15 , 30 , 60 , and 120 minutes after injection . the animals were killed after scanning . the livers were cut transversely into slices of 2 - 3 mm to confirm the size and location of the hepatic tumors . the attenuation of tumor and the surrounding liver parenchyma were measured directly from ct scans . a p value less than 0 . 05 was considered to be significant . an unpaired two - tailed student &# 39 ; s t - test was used to compare liver attenuations between pre - and postcontrast groups . the reaction scheme and the structure of the cyclic carbonate of ioxilan obtained by reacting ioxilan with cdi is shown in fig1 . the structure was confirmed by infrared spectroscopy ( ir ), mass spectroscopy , and elemental analysis . carbon - 13 nmr indicated the presence of cyclic carbonate carbons . the spectrum was complicated by the existence of optical isomers conferred by the chiral carbons of the secondary alcohol and rotational isomers resulted from n - acetylated anilide nitrogens . ix - c particles could be easily prepared by a solvent extraction / evaporation process . because ix - c has limited solubility in methylene chloride , a cosolvent ( acetone ) is necessary to facilitate ix - c solubilization . the presence of water - soluble acetone in the organic phase resulted in rapid phase separation because acetone was quickly extracted by the aqueous phase upon emulsification . when acetone was used alone , irregular particles were produced . ix - c particles thus prepared had an average diameter of 1 . 1 μm , with 95 % of them ranging between 0 . 6 and 2 . 0 μm ( number average ) as determined by a submicron particle analyzer ( fig2 ). the iodine content of the particles was 45 %. scanning electron microscopy revealed that the particles were spherical in shape and had smooth surfaces ( fig3 ). all ix - c particle formulations were stable . no particle aggregation was observed either in saline or in 0 . 1 % tween 80 solution . the ix - c particle suspensions were also stable when mixed with rat plasma ( fig4 ), indicating that the interactions between the ix - c particles and blood components ( e . g ., fibrinogen ) were minimal . cyclic carbonate of 1 , 2 - diol has been prepared as a means to protect hydroxyl groups . it is stable in acidic condition , but is labile towards basic solution . to test their hydrolytic stability , ix - c particles were suspended in hcl . naoh , saline , and plasma solutions at 37 ° c . as expected , when placed in naoh solution , the ix - c particles were completely dissolved within 1 hour . the degradation of ix - c particles in both hcl and saline solutions was much slower . no gross changes in suspension appearance was observed during a 2 - week period . however , the degradation did occur in both solutions as uv absorbance of the supernatants from the ix - c suspension increased steadily over the incubation period . as confirmed by scanning electron microscopy , ix - c started to crumble and disintegrate after being incubated in saline for 2 weeks ( fig5 ). in plasma suspension , where ph is slightly acidic , ix - c particles were completely dissolved in 6 days , indicating that an enzymatic effect played a significant role in the degradation of ix - c particles . in order to determine the identity of ix - c degradation products , the supernatants of all samples were subjected to reverse - phase hplc analysis . all samples had a distinct peak at 6 . 88 minutes . standard ioxilan had the same retention time under the same analytical conditions . thus , it appeared that the degradation of ix - c yielded ioxilan and carbon dioxide . to ascertain that the observed peak was not an artifact from plasma component , the plasma samples were also analyzed by fab mass spectroscopy . the presence of ioxilan was confirmed by the molecular peak ( mh +) of ioxilan at 792 . the ld 50 of ix - c particles determined with swiss webster mice was 1 . 4 g i / kg body weight for males and 1 . 2 g i / kg body weight for females . the doses correspond to 3 . 1 and 2 . 6 g / kg bodyweight ix - c respectively . liver attenuation enhancement (. increment . hu ) is plotted as a function of time for three doses of ix - c particles ( fig6 ). significant attenuation enhancement of the liver was achieved over a period of 6 hours in a dose - dependent manner . following intravenous administration of 100 , 200 , and 270 mg i / kg body weight of ix - c particles , maximum liver ct attenuation increases were 23 , 38 , and 110 respectively . liver attenuation reached maximum at approximately 30 minutes postinjection . at 270 mg i / kg body weight , the attenuation enhancement was much greater compared with those of lower doses and reached maximum earlier . the attenuation enhancement persisted for 1 hour and started to decrease at 2 hours postinjection . liver attenuation decreased to the preinjection value by 48 hours ( fig7 ). the increase in attenuation of the spleen was even more striking . immediately after injection of 200 mg i / kg body weight of radiopaque particles , the hounsfield units increased from a precontrast level of 20 to 265 hu . the attenuation of the spleen had reduced to 63 hu by 2 days postinjection . gallbladder and bowel activity were observed at 6 hours postinjection ( data not shown ). the ct pharmacokinetics of aorta , kidney ( cortex and medulla ), and bladder following the injection of 200 mg i / kg body weight of ix - c particles are presented as a histogram in fig7 . the attenuation of the aorta reached a maximum immediately after injection (. increment . hu 43 ) and decreased rapidly to the preinjection level 1 hour after injection . ix - c or metabolites of ix - c could be visualized in the kidney immediately after injection . the kidney cortex attenuation reached maximum values of 94 hu at 2 hours postinjection , which was 50 hu higher than that of preinjection value . the kidney activity fell back to the preinjection level by 2 days ( fig7 ). for all doses studied , attenuation changes of the lungs were found to be negligible . the ct imaging of a rabbit liver 6 days after tumor inoculation is shown in fig8 . the tumor was barely detectable at any level before contrast injection ( fig8 a ). immediately after the injection of 200 mg i / kg body weight of ix - c particles , a tumor measuring 6 - 8 mm was clearly visible at the anterior - lateral portion of the right lobe ( fig8 b ). the visibility of the tumor persisted up to 2 hours ( fig8 c and 8d ). the presence of the tumor was verified by necropsy in exactly the same location . for all four rabbits , the average increases in liver and tumor attenuation were 39 and 4 hu respectively at 30 minutes after injection . these values reflect an increase in the attenuation difference of 35 hu between the liver and the tumor . the goal of the foregoing experiments is to develop a novel contrast agent that can be selectively delivered to the res and improve the detectability of liver lesions on ct scans . the feasibility of using particulate cm as a hepatic macrophage imaging agent has been demonstrated . however , adverse reactions often have been associated with the administration of particulate cm , which has impeded its further development . one possible solution is to develop particulate cm that can be quickly degraded and cleared from the kupffer cells and the liver . in this way , the impact of foreign particles on the function of the res and the subsequent side reactions can be reduced to a minimum . among the methods used to develop particulate cm , the prodrug approach has the advantage of being easier to prepare , less expensive , and having a higher iodine content on a weight basis . since the degradation product is the original water - soluble cm , it is conceivable that radiopaque particles made of a non - ionic contrast agent would cause less osmotic toxicity than ionic cm . based on the above considerations , a new iodinated compound using ioxilan as the substrate was designed . treatment of ioxilan with cdi in dmso yielded cyclic carbonate and carbamate derivatives of ioxilan , ix - c ( fig1 ). this compound is soluble in acetone , is slightly soluble in methylene chloride , and is insoluble in water . the lipid soluble property of the ix - c compound allowed the easy preparation of ix - c particles by a solvent extraction / evaporation procedure . because phagocytosis of foreign particles by the kupffer cells generally results in kupffer cell activation and disturbance in the microcirculation of the liver ( li et al ., unpublished data ), it is desirable that particulate cm designed for macrophage imaging will quickly be cleared from the liver after their functions are over . as shown in in vitro degradation studies , ix - c particles were extremely unstable in basic solutions . ix - c particle suspensions in saline at neutral ph underwent a slow , yet definite degradation . of interest is the ability of ix - c particles to dissolve completely in rabbit plasma . this observation implies that various enzymes play a significant role in the dissolution of ix - c particles and will be an important factor in the in vivo fate of ix - c particles . the degradation of ix - c particles produced ioxilan and carbon dioxide , both of which are not expected to impose a significant toxicity problem . for the particles to be efficiently taken up by the res and able to pass through capillaries without causing embolization , they must have proper shape , size , and size distribution . furthermore , interactions of plasma components with small particles have to be minimized since they usually lead to particle aggregation . the suspension stability of ix - c in saline and other ix - c formulations was investigated . ix - c particles were stable in saline with no tendency to flocculate upon the addition of rat plasma ( fig4 ). administration of ix - c suspension in saline at concentration as high as 8 % i ( w / v ) did not cause lung embolization in rabbits , confirming the nonaggregation nature of ix - c particles . the ability of ix - c particles to opacify the liver in rabbits was demonstrated in fig6 . the fact that the spleen was also highly opacified confirmed that the selective enhancement of the liver was due to macrophage uptake of the radiopaque particles . at a dose of only 100 mg i / kg body weight , ix - c particles enhanced attenuation to a satisfactory level (. increment . hu & gt ; 20 ). moreover , the attenuation enhancement persisted for a period of 2 hours , allowing adequate time to conduct ct examination . thus , radiopaque particles such as ix - c overcome one of the disadvantages of water - soluble cm , namely , fast distribution to the interstitial space . pharmacokinetic data were obtained by measuring changes in the attenuation of various organs in the rabbits . ix - c particles were rapidly cleared from the blood . significant enhancement of gallbladder attenuation and enhanced bowel activity at 6 hours postinjection , indicating that ix - c particles were cleared via the hepatobiliary system . this observation is consistent with other particulate cm that also produced increased gallbladder opacity . the relatively short time ( 2 days ) for the elimination of ix - c particles from the liver was clearly demonstrated . thus , the degradability of ix - c particles was confirmed in vivo . surprisingly , ix - c particles were found to cause significant kidney attenuation enhancement immediately after contrast injection ( fig7 ). this observation may be attributed to the following . first , ix - c particles were quickly degraded to water - soluble products . the observed kidney activity was due to the excretion of the resulting water - soluble cm . second , ix - c particles were caught in the tubule of the kidney . although the exact cause of ix - c uptake in the kidney is not clear at present , metabolism and eventual excretion of ix - c particles by the kidney pathway was clearly demonstrated . the bladder ct attenuation at 6 hours after contrast injection was 240 hu higher than the precontrast level . hplc analysis of urine samples taken at 2 hours and 6 hours postinjection revealed the presence of the degradation production ioxilan . it was noted that the liver attenuation increased at a much faster pace when the injected dose reached a certain level ( 270 mg i / kg body weight ) ( fig6 ). this observation can also be explained by the saturation of the kidney elimination pathway , which resulted in more particles being redirected to the liver . therefore , unlike other previously reported radiopaque particles , ix - c particles were eliminated via both the hepatic and the urinary pathways . toxicity of particulate cm has been a major concern . the determined ld 50 of ix - c of 1 . 4 and 1 . 2 g i / kg body weight corresponded to 3 . 1 and 2 . 6 g of ix - c / kg body weight for male and female mice respectively . these values are slightly higher than those reported for other particulate cm . since the suspension used in this study was very concentrated ( 800 mg i / ml ), it is possible that the ld50 value would be higher if this suspension was diluted and injection was made in several portions ( to reduce the volume effect ). using data from the ct imaging study , one can predict that the diagnostic dose for ix - c is 100 mg i / kg body weight . this would give a safety margin of more than ten - fold . at a dose of 200 mg i / kg body weight , a tumor ( 6 mm in the smallest dimension ) could be clearly detected in the postcontrast images ( fig8 ). the tumor was not visible in the precontrast image because it was either too small or isodense to liver parenchyma . studies with rabbits bearing vx2 tumors demonstrated that ix - c particles could opacify the liver for about 2 hours without significant reduction of contrast enhancement , which allowed sufficient time for ct examinations . the results showed that ix - c particles were biodegradable , with ioxilan and carbon dioxide as the degradation products . the particles had an average size of 1 - 2 μm , and were stable in saline suspension . the ld 50 determined for ix - c particles was 2 . 6 and 3 . 1 g / kg body weight for females and males respectively . a dose of 200 mg i / kg body weight caused an increase of 38 hu in liver attenuation . in rabbit , hepatic clearance of the contrast medium in 2 days was demonstrated . a tumor barely visible in precontrast scans could be detected after contrast injection . biodegradable ix - c particles have suitable physicochemical characteristics as a particulate ct contrast agent , and are effective as a macrophage imaging agent . the foregoing invention was explained with reference to a particular embodiment . one skilled in the art will recognize that many modifications may be made to the present invention without departing from the spirit and scope of the invention . the embodiment described herein is meant to be illustrative only and should not be taken as limiting the invention , which is defined in the following claims . | 8 |
the drawings illustrate preferred embodiments of the invention as applied to a forward , buckling - type of top feed or top delivery sheet paper feed mechanism . thus , while the preferred embodiments are described in connection with a top feed , foward - buckling feeder , it will be understood that the principles involved herein may be applied to a top feed , rear - buckling or reverse - buckling type of sheet feeder mechanism , and may also be applied to a bottom - feed type of delivery or feed mechanism . in such a top delivery or top - feed mechanism , the stack 10 of sheets , which may be sheets of paper , are received in an elevating tray 11 , and the top sheet 10a is separated by the mechanism of this invention from the stack to the nip of a pair of adjacent take - away rollers 15 . preferably , these rollers are adjusted to rotate at about the same peripheral velocity as the linear velocity of sheet 10a from the stack . for tolerance purposes , the rollers 15 may rotate slightly slower than the linear velocity of the dispensed sheet 10a since this sheet is under control of the paper feed mechansim and it is undesirable to apply a tension to the paper by the take - away rollers which would tend to pull the paper out of control or away from the delivery mechanism during the initial stages or delivery . snubbing and sheet delivery apparatus of conventional construction is shown , for example , in u . s . pat . no . 3 , 713 , 645 issued jan . 30 , 1978 , in which a feed wheel causes the top sheet in a tray to be buckled forwardly against a snubber for separation from the second and subsequent sheets in the stack of sheets . the top sheet is forward fed by frictional engagement with one or more feed wheels in a direction generally parallel to the plane of sheets in the stack , and into the nip of the rollers 15 . such feed wheels , as shown in the above - identified patent , remain at a generally fixed location with respect to the sheet stack . also , they have a width which is relatively narrow with respect to the width of the sheets , so that the imprint force of the wheels on the stack as the stack is elevated by the tray , or as the delivery wheel mechanism is lowered , always impacts against the stack at the same general location . when soft coated papers are employed , such as a receiver sheets made in accordance with the above - identified u . s . pat . no . 4 , 399 , 209 , and when such force exceeds 0 . 1 psi , skid marks may be formed in the immediate underlying sheet , thereby damaging such sheet . in accordance with this invention , marking is avoided by increasing the contact areas of the feed device 20 which come into contact with the exposed sheet 10a , and by causing the feed device to move relatively , following contact with the sheet 10a , in a direction generally parallel to the plane of this sheet . the feed wheel 20 of fig1 and 2 does not remain at a location which is fixed with respect to the geometry of the tray 10 , but is moved relative to the stack so that its imprint force is distributed with respect to the underlying sheets . in the embodiment of the invention as shown diagrammatically in fig1 and 2 , the tray 11 is movable in the direction of the arrows 18 between a lowered and an elevated position . the feed device or wheel is diagrammatically represented by a wide paper feed wheel 20 or 20a ( fig2 ) which is driven counterclockwise in the direction of the arrow 22 as in a conventional forward - buckling sheet feed device . however , and in addition , either the tray 11 ( fig1 ) or the feed wheel 20a ( fig2 ) is bi - directionally driven such that a relative motion occurs parallel to the plane of the top sheet 10a simultaneously with the delivery , and in an additive manner , in the direction of the delivery . in the embodiment diagrammed in fig1 a bi - directional tray drive moves the tray 10 in the direction of the arrow 26 . alternatively , as shown in fig2 a bi - directional drive is used to move the feed wheel 20a in the direction of the arrows 26a ( fig2 ) while the tray 11 remains stationary . as indicated above , the feed wheel 20 or 20a has a substantial width compared to the transverse width of the sheets 10 , so that the pressure imprint is held to a practical minimum , such as 0 . 04 psi or less . fig4 illustrates a preferred bi - directional drive mechanism for moving the wheels 20a in the direction of arrow 26 in fig2 and a mechanism for driving the wheels in the direction of the arrow 22 . in fig4 a rack and pinion type translational drive 30 moves the feed wheels transversely and in an direction generally parallel to a plane which includes the top sheet 10a on the stack 10 of sheets simultaneously with the separation of the top sheet 10a from the stack . in this manner a fixed skid imprint location with respect to the stack is avoided . two wide paper feed wheels 20a are mounted on a common drive shaft 31 . the shaft 31 is received in a drive shaft support housing 32 . as shown , the wheels 20a each have a relatively wide imprint , approximately equal to about one - fourth the width of the sheets 10 in the tray 11 . in a feeder for 8 . 5 &# 34 ; wide paper , the wheels may be approximately 23 / 4 wide . the housing 32 is , in turn , mounted on a generally transversely - extending support or driver rod 35 , the ends of which terminate at spur gears 37 and 38 . the spur gear 38 is mounted between a pair of opposed racks 40 and 42 . the top rack 40 is fixed to a side wall 44 while the lower rack 42 is provided with slotted openings 45 . the openings 45 receive fixed support mounts 47 on the wall 44 for low - friction sliding movement thereon . the remote end of the driver rod 35 extends through a slot 48 in the opposite side wall 49 and runs on a single top rack 40 . the end of the rod 35 extending through the slot 48 supports a clip ( not shown ) to prevent excessive endwise movement of the rod 35 . the lower rack 42 is formed with bottom driven teeth 50 in engagement with a spur gear 52 of a motor 55 , to provide for forward and reverse reciprocating movement of the rack 42 . this is translated into rotational movement of the spur gears 37 and 38 to provide for translational movement in the direction of arrow 57 in a forward buckling and sheet delivery direction , and reverse movement in the direction of arrow 58 to a starting position of the mechanism . advantageously , the rotation of the spur gears by the translational movement of the double - sided rack 42 causes a concurrent rotation of the support rod 35 . this rotation is translated to the wheels 20a through a cog belt 60 within the housing 32 . the direction of feed is in the direction of arrow 57 against the corner snubbers 62 for lifting of the top sheet 10a of the stack and for delivery to the feed rollers 15 ( fig2 ). the operation of the sheet - feed mechanism may be understood by reference to fig1 and 2 in which the bi - directional drive , at the start , moves to place the paper feed wheels 20 or 20a at the left - hand or home position in relation to the feeding end of the tray 10 . the feed wheels are lowered , or alternatively , the tray 10 is elevated to bring the wheels into contact with the exposed upper sheet 10a . the drive , such as the motor 55 , is operated to begin the relative movement of the bi - directional drive , to bring the feed wheels 20 or 20a to the right of fig1 or 2 relative to the tray , and at the same time the feed wheels are turned in the direction of the arrow 22 ( fig1 ). the sheet 10a may thus be separated from the stack and moved into the nip between the rollers 15 to a sensor position 64 just beyond the nip . a sensor may be employed at this point to terminate the bi - directional drive and the concurrent rotation of the rolls , and the elevator supporting the tray 10 may be lowered to clear the stack of sheets from the feed wheels . the second preferred embodiment , as shown in fig3 and 5 , employs a feed device which includes a generally rectangular pad shoe or support 70 . the support 70 is formed with a lower sheet - engaging surface 72 of rubber . the surface 72 may consist of a single pad or a plurality of co - planar pads which have lower surfaces in a common plane for engagement with the upper sheet 10a of the tray 11 when the tray 11 is elevated to the raised position . in the elevated or raised position , the weight of the pad support 70 bears on the upper sheet , and the position of the support 70 is controlled by the shafts 74 and 75 . as shown in fig6 the shaft 75 passes through a narrow vertical front slot 76 , but does not touch the top or bottom of this slot . however , there is a close fit between the shaft 75 and the parallel sides of the slot 76 , so that the shaft acts as a driver for the pad support 60 . the back shaft 74 passes through a clearance 79 in the pad support 70 . each of the shafts 74 and 75 terminate in spur gears 37 , 38 and are driven in the manner previously described in connection with the driver rod 35 . the clearance opening 79 and the slot 76 assures that there is no binding between the pad support 70 and the shafts . when the tray 11 is lowered , the support 70 rests on top of the shafts 74 and 75 , allowing the paper to move easily from beneath . at the same time , the pad support 70 will be moved to the rearward or home position . then , when the tray 11 is elevated or lifted , only the weight of the pad support 70 will be on the paper . accordingly , the unit pressure over the surfaces defined by the pad or pads 72 , carried by the support 70 , is a function of the weight of the support 70 and the area defined by the engaging surfaces 72 . the transport mechanism of fig5 may be used with a conventional paper feed roll 95 which is diagrammatically illustrated in fig3 and shown only in phantom in fig5 . the conventional feed roll 95 need not be in physical or pressure contact with the upper sheet 10 on the stack , but may be spaced slightly above the top sheet and may be free - turning to provide a desired buckle geometry to the paper in relation to the forward corner snubbers 62 . for example , if such a roll is used , it may be positioned to clear the top sheet by 0 . 020 &# 34 ;. the bottom sheet - engaging surface of the pad is positioned in a plane which is generally parallel to a plane including the stack 10 and the top sheet 10a , and may form the surface of a relatively high friction elastomer material such as natural rubber or silicone . a pad 72 may , advantageously , be in the form of one or more individual pad sections 72a a and , for example , four such pad sections may be employed on the lower surface of the pad support 70 . when four pads are used , they may have a total of 5 . 2 square inches . when the pad support 70 weights 8 . 5 ounces , a pressure of 0 . 1 psi is applied to the sheet 10a when the weight of the pad support 70 rests on the stack 10 . however , it is within the scope of this invention to increase this area , as may be desired or required , to prevent marking by scuffing . the pad sections 72a have coplanar bottom sheet - engaging surfaces and are relatively thin , compared to the length of the pad sections in the process direction , and may have an aspect ratio of from approximately 10 to 1 length / thickness up to 20 to 1 length / thickness or more . such relatively thin pad sections provide the necessary ridigity in the process direction in that the pads do not have any tendency to pitch or tilt with respect to the pad support and the top sheet 10a . accordingly , the pressure exerted by the pad section 72a remains relatively uniform during sheet delivery . the operation of the embodiment as shown in fig3 and 6 is in many respects the same as that previously described . when the tray 11 is elevated , the upper sheet will come into contact with the friction pad sections 72a on the lower surface of the pad support 70 and will lift the pad support substantially to the position as shown in fig6 . the operation of the motor 55 will cause movement of the shaft 75 and therefore movement of the pad support 7 in the lead or process direction 57 , causing movement of the pad support in the direction of the arrow 26a of fig3 for dispensing the sheet 10a from the stack . as previously mentioned , the free - turning rollers 95 may be used to engage the top sheet for controlling the extent of buckle and for controlling movement of the sheet to the take - away rollers 15 . the tray 11 may be lowered and the motor 55 reversed to bring the pad support 70 back to its home or start position in the direction of the arrow 58 of fig4 and 5 . while the forms of apparatus herein described constitute preferred embodiments of this invention , it is to be understood that the invention is not limited to these precise forms of apparatus , and that changes may be made therein without departing from the scope of the invention which is defined in the appended claims . | 1 |
certain exemplary embodiments relate to techniques for generating electronic menu ( emenu ) graphical user interface ( gui ) layouts for use in connection with electronic devices such as , for example , tablets , phablets , smart phones , and / or other electronic devices . referring now more particularly to the drawings , fig1 is a block diagram showing elements that may exist in a restaurant in which an emenu made in accordance with certain exemplary embodiments may be used . many patron - operable devices 102 a - 102 j are shown in fig1 . in the fig1 example , the patron - operable devices 102 a - 102 j are grouped such that each member in a party has his or her own patron - operable device 102 . as indicated above , the individual devices may be tablets , phablets , smart phones , and / or other electronic devices . the devices may be the same or different device types in different implementations , and they may be the patrons &# 39 ; own devices ( e . g ., onto which a suitable emenu application has been downloaded and installed ), devices provided by the restaurant and loaned to the patrons ( e . g ., onto which the same or similar suitable emenu application has been downloaded and installed ), or a mixture of the two . the patrons may use the patron - operable devices 102 a - 102 j to browse an emenu made in accordance with certain exemplary embodiments , place orders , call a staff member ( e . g ., with a predefined message such as , fore example , “ ready to order ,” “ please bring refills ,” “ napkins needed ”, “ check please ”, etc . ; a custom message ; and / or as a general matter without a specific message ), play single or multi - player games ( e . g ., table - wide , restaurant - wide , and / or broader - scale games such as trivia ), control a television or other display provided at table or elsewhere , interact with a jukebox , and / or interact with other entertainment offerings . patron - operable devices may be distributed to patrons prior to their being seated for use in the location , e . g ., for ordering drinks from a bar , playing games , receiving notifications when a table is ready , checking on estimated wait times and / or location in a queue , etc . wait staff who serve the patrons may have their own wait staff devices 104 a - 104 c . wait staff operable devices 104 a - 104 c may be used to place orders on behalf of patrons , confirm patrons &# 39 ; orders , etc . a host - operable device 106 , which may run the same or similar application as the wait staff operable devices 104 a - 104 c , also may be provided . these devices may also provide waitlist information , generate estimated wait times , etc . in certain exemplary embodiments , the wait staff operable devices 104 a - 104 c and / or the host - operable device 106 may be phablets or smaller tablets , e . g ., to facilitate mobility , whereas the patron - operable devices 102 a - 102 j may be larger tablets or the like . a local server 108 is provided in the location , e . g ., to provide content caching ( e . g ., useful in the administration of local games such as trivia ), coordination of media output to the displays 110 a - 110 c , distribution of newly downloaded music to the jukebox 112 , generate backups of orders and / or other onsite information , etc . the local server 108 thus may have a connection to the internet and / or another outside network . in addition to or in place of the local server 108 , certain exemplary embodiments may incorporate a management computer 114 . the management computer 114 and / or the local server 108 may receive orders from the wait staff operable devices 104 a - 104 c and / or the patron - operable devices 102 a - 102 j ( e . g ., depending on the implementation in terms of who is allowed to place orders ). it also may relay orders to kitchen staff , manage notifications to wait staff when orders are ready , generate bills , etc . the management computer 114 may also administer the waitlist , potentially keeping track of when parties are seated , how long parties remain seated on average and / or in accordance with a general rule defined by the location and / or an outside party , etc . the host - operable device 106 , the wait staff operable devices 104 a - 104 c , and / or the patron - operable devices 102 a - 102 j may be able to access this waitlist information , e . g ., as indicated above . the local server 108 may backup this and / or other related information in certain exemplary embodiments . the displays 110 a - 110 c may be televisions or other professional displays and , as such , may receive video feeds from cable boxes , satellite receivers , streaming network sources over ip , and / or the like . as alluded to above , the displays 110 a - 110 c may be managed by the local server 108 and / or the management computer 114 . the jukebox 112 may be a digital downloading jukebox or the like . see , for example , u . s . publication no . 2013 / 0070093 , the entire contents of which are hereby incorporated herein by reference . as alluded to above , the jukebox 112 may be interacted with and / or at least partially controlled by host - operable device 106 , the wait staff operable devices 104 a - 104 c , and / or the patron - operable devices 102 a - 102 j . in terms of generating an emenu , the inventors of the instant application have realized that a grid - based approach to locating items can be beneficial when it comes to laying out items in a cohesive and visually interesting manner . the grid - based approach also advantageously facilitates automation when it comes to emenu generation , thereby reducing the need for custom programming and enabling more dynamic menu generation that , in turn , can be helpful when a restaurant wishes to change which items are featured , add items to and / or remove items from a menu , etc . in the examples that follow , the display on each tablet is divided into a grid with four columns and three rows when horizontally oriented . this provides 12 cells total , and menu items may take up one or more cells , depending on a variety of factors . for instance , a menu item that includes text and an image may be a 2 × 1 or 1 × 2 entry on the emenu . a highlighted or otherwise featured menu item may be a 2 × 2 entry on the emenu . other items ( e . g ., basic graphics and / or items with text but lacking images ) may be 1 × 1 entries on the emenu . navigational components also may be provided , e . g ., to browse between breakfast , dinner , lunch , and / or other “ sub - menus ”, to move between the emenu itself and other entertainment - related and / or other features provided on the device ( such as , for example , jukebox control , game play , etc .). several specific approaches for automatically generating emenus are set forth below . in general , these approaches receive input that includes structural information about the main sections of a menu and , optionally , one or more hierarchically arranged sub - sections , of that menu . in addition to this structural information , content information is provided . the content information may include , for example , an identifier of the items ( e . g ., an appetizer &# 39 ; s name ), whether there is an associated image ( and if so , a filename and / or pathname indicating where the image is located ), a flag for whether the item is featured ( optionally with information concerning how long it is to be featured ), pricing information , etc . these pieces are fit together in the grid to , among other things , main structural information and reduce the “ lost space ” in the menu . certain exemplary embodiments may attempt to follow the order of the layout as closely as possible , e . g ., to preserve the layout of the prior menu . however , adjustments may be made to reduce wasted space , etc ., in certain exemplary embodiments , and this may adjust the ordering of certain elements . it also is noted that items may be shuffled , potentially at random , e . g ., to expose users to different items . once the layout is determined , it may be stored to a file in a format readable by applications running on the patron - operable devices , e . g ., so that they can display the emenu . in certain exemplary embodiments , a tag - based and / or other format may be used . for instance , an xml file , json file , and / or the like , that conforms to a predefined schema may be read by applications running on the patron - operable devices and used to generate the displays accordingly . the devices may store the layout file locally or retrieve it from a network location ( e . g ., from a local server , management computer , and / or other location ). central storage and / or distribution may help promote changeability over time . the devices similarly may access the content referenced in the layout file from a local or more centralized location ( e . g ., from a local server , management computer , and / or other location ). it is noted that layout files may be generated for different orientations ( horizontal vs . vertical ), different device types ( e . g ., such that more cells are provided for devices with larger displays as compared to devices with smaller displays , etc .). the application running on the devices may determine orientation ( e . g ., using accelerometers , gyroscopes , and / or the like ), device type and / or hardware components , etc ., and access the appropriate layout file ( s ). a more detailed description of three example approaches for laying out menu items will now be provided . it will , of course , be appreciated that these and / or other approaches may be used in connection with different exemplary embodiments . it is noted that the approaches may be implemented as instructions stored on a non - transitory computer readable storage medium . such instructions may read a source menu file and produce an output file in a specified format , e . g ., after the instructions have been performed by at least one processor of a suitably configured computer system . the first example layout approach assumes that items are to be placed on a device &# 39 ; s display , with as little empty space as reasonably possible while still maintaining the general order of the menu items . more particularly , assumptions are made that menu items are organized in categories and sub - categories , and that menu items within sub - categories should be displayed in the order that is provided . this also approach assumes a four column layout , implying that each row on a display contains four cells . as indicated above , elements can be 1 × 1 ( e . g ., for items without pictures and / or for items that are only pictures ), 1 × 2 and 2 × 1 elements ( e . g ., for items with pictures , respectively organized side - by - side and stacked vertically ), and 2 × 2 items ( e . g ., for items associated with a promotion , that are featured , etc .). the approach also maintains a state object , which describes the current state of the layout . the state object in this example contains information about which cells are available in the “ first row .” the first example layout approach is iterative . for each iteration , the approach : obtains information about available cells from state object , including determining how many cells are available in the “ first row .” adds to a set elements from a source menu item list while the total width of the elements added is less than the number of available cells . attempts to reorder the elements in the set to fill available ( or “ empty ”) cells . if such an order exists , the elements are placed into the layout using this order . all unused items in the set are returned to the beginning of the source list according to their initial order . searches for an appropriately - sized element with the first predetermined number of elements ( e . g ., the first 3 , 5 , or other number of elements ) in the source list , if such an order was not found to exist in the prior point . if such an element exists , it is added to the set and an order for the new set is selected . the elements are placed into the layout using this order . all unused items in the set are returned to the beginning of the source list according to their initial order . if there are no suitable elements , an empty space is left . filler material ( e . g ., a stock image , background , and / or the like ) optionally may be inserted into the area . fig2 a - 2 i help demonstrate an example technique for creating an emenu in accordance with certain exemplary embodiments , and fig3 is an illustrative timeline that helps demonstrate the example approach shown in and described in connection with fig2 a - 2 i . fig2 a shows nine elements to be included in an emenu . moving from left to right , fig2 a shows 1 × 1 , 2 × 1 , 2 × 1 , 1 × 2 , 2 × 2 , 1 × 2 , 2 × 1 , 2 × 1 , and 1 × 2 items . initially , four cells in the first row are available ( the state object is completely empty ), so the first elements are taken from the source list while the total width is less than four . because of the way the loop is structured , the first four elements are taken , as shown in fig2 b . because the total width is more than the number of available cells ( e . g ., 5 & gt ; 4 ), an attempt is made to reorder the elements to fill the row . the set shown in fig2 c ( including elements 1 , 2 , and 4 ) thus is taken . the unused element ( element 3 ) is returned to the beginning of the source list . the reordered elements are added to the layout . at this point , the first row is filled and therefore is no longer needs to be considered . the second row in the emenu thus is treated as the first row , and the end of the first iteration is reached . see fig2 for the emenu layout at the end of the first iteration . at the beginning of the second iteration , the six elements shown at the left of fig2 d remain and the state object shown at the right of fig2 d indicates that the second cell in the first row is filled . thus , there are three empty cells in the first row and , as shown in fig2 e , the first two elements from the source list are taken . the total width is equal to the amount of empty cells . furthermore , there is no need to reorder the elements , as the 2 × 1 entry will fit in the leftmost empty cell , and the 2 × 2 entry will fit in the two farthest right empty cells . the second iteration thus is ended . see fig3 for the emenu layout at the end of the second iteration . at the beginning of the third iteration , the four elements shown at the left of fig2 f remain and the state object shown at the right of fig2 f indicates that the first , third , and fourth cells in the first row are filled . one cell needs to be filled . at this point , the element shown in fig2 g is taken . this set ( with one 1 × 2 element ) cannot be reordered in a manner to make it fit in the empty cell . thus , a search is performed within a predetermined number of elements ( e . g ., 3 ) in the source list . the second element in the source list is determined to be suitable , and it then is used to fill the empty cell . the element that cannot be used is placed at the beginning of the source list . the end of the third iteration is reached . see fig2 for the emenu layout at the end of the third iteration . at the beginning of the fourth iteration , the four elements shown at the left of fig2 h remain and the state object shown at the right of fig2 h indicates that only the second cell is filled . thus , the first , third , and fourth cells in the first row are empty and can be filled . the first two elements from the list are taken and reordered in the manner shown in fig2 i . these elements are then added to the emenu . the end of the fourth iteration is reached . see fig2 for the emenu layout at the end of the fourth iteration . only one element remains at this time , and it is inserted into the emenu in the left - most empty spaces . the end of the fifth iteration is reached . see fig3 for the emenu layout at the end of the fifth iteration . it will be appreciated from fig3 that there are no empty spaces , aside from the very last cell in the bottommost and rightmost corner . in certain exemplary embodiments , checks may be performed to make sure that difficult to place items are not shifted more than a threshold number of times . doing so could result in the specific menu item being forced into a location far outside of its expected and / or most “ natural ” location . some inefficiency in spacing thus may be tolerated . a similar set of assumptions as those discussed above in connection with the first example layout approach applies here , as well . however , in certain exemplary embodiments , an additional assumption may be made concerning two - cell items . more particularly , in certain exemplary embodiments , an assumption may be made that if an item has a picture , it can be displayed either as a 1 × 2 or a 2 × 1 element . thus , in this example approach , the number of cells occupied is deemed more important than the orientation ( e . g ., unless a preferred or required orientation is specified ). the second example layout approach involves a segment - based approach . in the segment based approach : the display area for laying out the menu items is divided into segments . for this example , each segment is a 2 × 4 ( 2 row by 4 column ) segment . it is noted , however , that differently - sized segments may be used in different exemplary embodiments . a layout is generated for each segment , one at a time , starting from the top of each sub - category . as implied above , each menu item will take up either one , two ( horizontally or vertically oriented ), or four ( 2 × 2 ) cells . all possible ways for laying out any combination of menu items are pre - generated . for example , for the 2 × 4 segment example contemplated herein , there is only one possible layout for eight single - cell items ; there are four possible layouts for four two - cell items ; and there are two possible layouts for two four - cell items . it is , however , noted that other use cases are contemplated herein ( e . g ., for a scenario where there is one four - cell item , one two - cell item , two one - cell items ; etc .). the menu items are sorted by their desired display order . starting from the top of sorted menu item list , a search is performed to find the first few items whose total cell space adds up to a number less than or equal to eight ( e . g ., such that if the number of less than 8 , it is the closest it can be without going over and / or optionally while retaining the desired order ). the pre - generated layouts for this combination of menu items are recalled . of the recalled pre - generated layout ( s ), one is selected ( e . g ., at random , in a predetermined order , by a user , and / or in some other manner ). the items are laid out in accordance with the selected recalled pre - generated layout . this process is repeated , moving down the list , until all menu items are placed . if there is an empty space in a segment , a filler image and / or the like may be used . it is noted that this may be performed in line and / or at the end of the process . this approach advantageously is very extensible . it is noted , for example , that the segment size can be changed . in certain exemplary embodiments , different segment sizes can be used simultaneously for displaying one menu . in a similar vein , the menu item sizes can vary . certain exemplary embodiments may incorporate further enhancements . for example , at the end of a menu item list , if the total space of the items left is less than or equal to four , remaining elements may be placed in a single row . as another example , different weights can be given to different layouts for one combination of menu items , e . g ., so that one or more of them are preferred over others . the third example layout approach in essence combines aspects of the two previously discussed approaches . that is , it fills a container segment - by - segment , like the second approach discussed above , and each segment is filled row - by - row and left - to - right like the first approach . for this example , the initial segment size is three rows by four columns . furthermore , this approach attempts to rotate elements , e . g ., in order to try to fill each row as fully as possible . the iterative approach in this example is similar to the iterations performed in the first example approach discussed in detail above . for each iteration in this approach : if the previous “ last row ” was filled completely , it is considered that a new empty segment and a new “ first row ” should be filled . information about the number of available cells in the first row is obtained from the state object . several elements are taken from the source menu items list while the total width of these elements is less than the number of available cells . if the set of taken elements cannot be inserted into the first row , an attempt is made to rotate some of the elements to arrive at a suitable combination . if such a combination exists , the elements that fit are placed into the layout . all unused items are returned to the beginning of the source list according to their initial order . if there is no suitable combination , an attempt is made to reorder and rotate any of the elements to fill the empty cells . if such a combination exists , the elements that fit are placed into the element . all unused items are returned to the beginning of the source list according to their initial order . if no elements were inserted , a search is made for an appropriately - sized element with the first predetermined number of elements ( e . g ., the first 3 , 5 , or other number of elements ) in the source list . attempts to rotate and / or reorder elements in the new set of menu items are made so that a fit is found . if there is a combination that fits , the items are placed in the layout . all unused items in the set are returned to the beginning of the source list according to their initial order . if there are no suitable combinations , an empty space is left . filler material ( e . g ., a stock image , background , and / or the like ) optionally may be inserted into the area . fig4 a - 4 g help demonstrate another example technique for creating an emenu in accordance with certain exemplary embodiments , and fig5 is another illustrative timeline that helps demonstrate the example approach shown in and described in connection with fig2 a - 2 i . fig4 a shows nine elements to be included in an emenu . moving from left to right , fig4 a shows 1 × 1 , 2 × 1 , 2 × 1 , 1 × 2 , 2 × 2 , 1 × 2 , 2 × 1 , 2 × 1 , and 1 × 2 items . the red boxes shown in fig5 and in the state object representations represent segment frames . initially , four cells in the first row are available ( the state object is completely empty ), so the first elements are taken from the source list while the total width is less than four . because of the way the loop is structured , the first four elements are taken , as shown in fig4 b . the combination shown in fig4 b cannot be inserted into the first row , an attempt is made to rotate the elements in order to find a combination that fits , which results in the layout shown in fig4 c . this is the end of the first iteration . at the start of the second iteration , the menu items shown at the left of fig4 d remain and the state object is shown at the right of fig4 d . only one cell needs to be filled , so only the item shown in fig4 e is retrieved . this element cannot fill one cell , even if rotated . thus , a search is made to locate suitable elements in the remainder of the list . the second item in the fig4 d list can be rotated to fit , so it is placed in the layout . the element shown in fig4 e is unused , so it is returned to the beginning of the source list . this is the end of the second iteration . at the start of the third iteration , the menu items shown at the left of fig4 f remain and the state object is shown at the right of fig4 f . at this point , three cells in the last row need to be filled . however , the end of the segment frame is about to be reached . thus , it only is possible to fill the space with a 1 × 2 item ( possibly with a 1 × 1 items ), or with one or more 1 × 1 items . the second element shown in fig4 f is selected , rotated , and inserted . because there is no possible way to fill in the last cell using the elements remaining , that segment is considered filled . this is the end of the third iteration and the completion of the first segment frame . in the fourth iteration , a new segment frame is started , and there is a need to fill in its first row . this can be done using the three remaining items , e . g ., if they are arranged as shown in fig4 g . these elements are added to the layout , and all items have been placed . structured information regarding the emenu to be generated may be provided in any suitable form . in certain example embodiments , four tables may be provided , e . g ., for identifying categories of products , products , drinks , and filler materials . such tables may , for instance , be provided in separate flat text files , as multiple worksheets in an excel workbook , as multiple tables in an access or other database , etc . an example categories table may include a column for the names of the categories . to help maintain some hierarchical information , an optional “ parent category ” column may be provided . for instance , “ wine list ,” “ house ,” “ white ,” and “ red ,” may be category names . the “ wine list ” category optionally may be provided as the parent category for each of “ house ,” “ white ,” and “ red .” descriptions may be provided for some or all categories . categories may have images associated with them , and they may be published to an emenu and / or orderable from an emenu at certain predefined times . table 1 below includes entries for an example categories table : an example products table may include information identifying the name of the product and the category to which the product belongs . an optional description and / or image may be identified , as well . a flag indicating whether the product should be published to the emenu also may be set . optionally , inventory or stock may be maintained . this may , for example , help indicate when items should not be published and / or listed as available . an indication whether the product is “ on special ” or to be featured may also be provided . optionally , time periods defining specials may be included as well ( e . g ., designating lunch specials as times during any given day , themed specials as belonging to a season such as the winter holidays or one or more months for march madness or the like , etc .). pricing information may also be provided . this may take the form of a main price , and optional pricing schemes ( e . g ., for full versus half orders , different numbers of items such as wings or the like , etc .). fig6 includes entries for an example products table . the same information may be provided for an example drinks table , e . g ., as shown in fig7 . in certain exemplary embodiments , the products and drinks tables may be combined . for filler information , images from a filler table may be used . the filler table may specify the height ( in table cells , pixels , or other measure ), and identify an image . an example filler table is provided below in table 2 : once the placement approach has determined the proper coordinates in the table for each menu item , an output file may be generated . as indicated above , the output file may be based on an underlying schema and may be formatted as an xml document , json file , and / or the like . the schema may specify fields for different item types . for instance , for menu items , a size attribute may be defined . acceptable values may be 1 , 2 , or 4 ( e . g ., corresponding to the number of cells occupied by the item ). as another example , coordinates may be defined , e . g ., identifying the cell in the table , pixel location , or other position , where the top left corner of the element is to be placed , etc . an example json file is set forth in the attached code appendix . the file may be accessed locally and / or from a network location via an application running on the patron - operated device . for instance , the application may include code for retrieving and parsing the file , and entering the data in a locally stored database , e . g ., for possible subsequent local - based reproduction . the database may be read when the emenu is opened , with the application retrieving information from the database and displaying the emenu on the patron - operated device . fig8 a - 8 b schematically show how a schema file may be used to organize elements in accordance with certain exemplary embodiments . more particularly , a schema file may direct the menu items to be displayed in the grid , e . g ., as shown in the fig8 a example , or the fig8 b example , based on retrieved information linking the item numbers to specific coordinates , cells , or the like . fig9 is an example emenu made in accordance with certain exemplary embodiments . as can be seen from fig9 , categories of items are provided as discrete and selectable elements in a horizontal line at the top of the example display . the appetizers menu is selected , and the appetizers category title is shown in large type in the center of the screen . menu items derived from the products table associated with the appetizers category are displayed in the table - based approach below the appetizers category title . the entry names are shown , together with their descriptions and prices . in the case of the cheese fries appetizer , two pricing models are provided — one for a full order with a first price , and another for a half order with a second price . as can be seen , there are three rows and four columns . the entries in the first two rows are 2 × 2 entries , with each including a text and an image . there is one 1 × 2 entry and two 1 × 1 entries in the last row . the menu icon in the upper left corner may be used to enable patrons to access other content provided through the device such as , for example , the entertainment offerings noted above . a user may select an item ( e . g ., through a touch interface provided by the device ), confirm that it should purchased , and add it to an order . in certain example embodiments , coordination may be provided between the users at a given table and / or in a given party . for instance , because each person may be provided with his or her own device , all orders may be added to a single order and synchronized so that the order is placed at once . similarly , updates may be pushed to a table at a time , e . g ., once the order has been entered , prepared , delivered , when the check is ready , etc . in certain exemplary embodiments , payment may be processed using the techniques set forth in u . s . application ser . no . 61 / 875 , 195 , filed on sep . 9 , 2013 , the entire contents of which are hereby incorporated by reference herein . it will be appreciated that although certain exemplary embodiments involve a row - by - row top - to - bottom approach , the same or similar techniques may be used on a row - by - row bottom - up basis , in a column - by - column left - to - right or right - to - left approach , etc . similarly , although certain exemplary embodiments involve a left - to - right approach , right - to - left , top - to - bottom , bottom - to - top , and / or the like may be used in different exemplary embodiments . it is noted that the example algorithms discussed herein are sufficiently generic to accommodate different numbers of columns in a grid , different numbers of cells used by menu items , and / or the like . in view of the foregoing , it will be appreciated that certain exemplary embodiments provide automated emenu gui layout generation . the techniques of certain exemplary embodiments can accommodate dynamic patterns instead of simple repetitions , thereby created interesting visual aesthetic effects suitable for use with an electronic device such as a tablet or the like . the techniques of certain exemplary embodiments additionally or alternatively may provide for a coherent flow and organization of items instead of a more random placement . thus , certain exemplary embodiments are able to maintain a desired menu item display order with an acceptable amount of deviation in an easy to implement , fast running , flexible and extensible approach . while the preferred aspects of the invention have been illustrated and described herein , it will be apparent to one of ordinary skill in the art that various changes and / or modifications can be made . thus , the specific description herein is meant to be exemplary only and is not intended to limit the invention beyond the terms of appended claims . | 6 |
referring to fig1 there is shown a simplified cross - sectional view of the communication device 10 , in the open position . the communication device 10 is a portable handset or wireless phone for the present application but can be any other type of electronic devices . the communication device 10 includes a first member or a main housing 12 and a second member or a flip or a flap 14 for the main housing , not necessarily shown in the actual proportionate relationship with each other . for example , the flip 14 is often much thinner and smaller than the main housing 12 . in some applications , the second member may be a sliding or a planar rotating piece sliding or rotating away form the first member , respectively . the second member 14 is rotatably attached to the first member by means of a hinge 24 ( or any other hinge or rotational mounting means ) in a clam - style arrangement . the communication device 10 is shown in an open position where the flip or second member 14 is positioned away from the housing or first member 12 at an obtuse angle 26 preferably within a range of 145 to 155 degrees for ergonomics or greater than 145 degrees for greater capacitive coupling of the antenna array consisting of a main antenna 16 and a parasitic element or radiator 18 . the main antenna 16 is attached to the first member 12 for vertical or angled extension at an acute angle , preferably between 15 and 35 degrees with the flip 14 . the parasitic element or radiator 18 is attached to or disposed on the second member 14 . in this embodiment , the two components of the antenna array , the main antenna 16 and the radiator 18 , are not physically connected . they are , however , electromagnetically coupled to each other due to their substantially parallel arrangement . in the preferred embodiment , the two antenna components 16 and 18 radiate and receive simultaneously in the electric - field mode ( i . e ., they transmit and receive e field waves ) and at the same resonating frequency . alternatively , the main antenna 16 and the parasitic element 18 can resonate at two different frequencies , not too far apart , in case more of an impedance bandwidth is desired . the latter is necessary when an antenna for multimode products is desired . for instance , products operating at both the 800 mhz and 900 mhz range . such products require that the antenna cover close to 200 mhz in bandwidth . this is very difficult to accomplish at such low frequencies due to the inherent bandwidth of the antenna topology and the size of the product . one approach to accommodate the increase in the bandwidth is to use a matching circuit , but these circuits do add losses to the signal path . a workable alternative is presented in the instant application . the ability to increase the bandwidth is becoming more and more common as portable communication devices tend to become more “ world ”- roaming capable . electrically , the incident electric field induces a current j to flow on the parasitic element 18 causing it to become excited and radiate to form an array system with the antenna 16 . the flow of this current on the element 18 radiates back in the direction or beam 32 towards the antenna 16 in such a way that the two elements of the array 16 and 18 constructively interfere with one another . the parasitic element 18 , when thus coupled with the main antenna 16 , forms a new radiation pattern which represents the combination of the main antenna 16 and the parasitic element 18 . this constructive combination is such that the radiated energy undergoes a change which allows an increase in the overall electric field magnitude in a direction opposite to the user . this very phenomenon improves the antenna overall efficiency . in addition , this constructive interference allows an improvement at the points in the radiation pattern where nulls are present in the case of a single element . a display 20 and a keypad 36 are also located on the first member or housing 12 . a speaker 22 and a transparent display screen 28 for allowing the display 20 to show through underneath , when the flip is collapsed or otherwise closed on top of the housing 12 ( as in a closed clam - shell configuration ), is contained in the second member 14 . the speaker 22 is mounted within the second member 14 and a microphone 30 is mounted within the first member 12 so that persons using the communication device 10 may hold to their faces the side containing the exterior portions of the speaker 22 and of the microphone 30 . a keypad 36 may be located on this same side of the communication device 10 . signals 32 and 34 are radiated mostly in the direction shown by the arrow ( i . e ., they are unidirectional in a directed beam of an antenna array ). this direction is intentionally away from the user in order to avoid the adverse loading effects the user presents to the signal . analyzed from a different perspective , the parasitic radiator 18 also operates as an escape route for the highly excited currents from the speaker &# 39 ; s wires or other audio lines connecting the speaker 22 on the flip 14 via the hinge 24 to the rest of the audio circuit in the main housing 12 pcb to flow into . this parasitic radiator 18 has also shown to reduce hand proximity effects when a users hand is holding the flip 14 and the housing 12 . therefore , the communication device 10 has the advantage over other communication devices in that it includes an antenna array which helps to improve the overall radiation and reduce the unwanted hand proximity effects . referring to fig2 a simplified back - view of the communication device 10 is represented to show the different variations contemplated by the teachings of the present invention for the parasitic element 18 of fig3 - 6 . the parasitic radiator or element 18 or 183 - 186 ( fig3 - 6 ) is a quarterwave or a half - wavelength element , at the operating frequency of the antenna 16 . electrically , the parasitic radiator 18 is preferably a self - resonating metallic strip line which is plate or patch shaped in physical dimensions sufficient to result in an appropriate surface impedance which is directly proportional to the incident tangential field and inversely proportional to the amplitude of the surface current density of the surface of the plate . because of the self resonance of the antenna array and proper coupling of elements 16 and 18 , there is no need for a direct connection for the element 18 . in addition to the aforementioned benefits , the strip line 18 will still contribute to the overall radiation of the antenna 16 to increase the overall antenna system gain . the parasitic radiator 18 could be implemented as a metallized layer of paint , a metal plate or patch , on the inside or outside surfaces or within the flip 14 to form the self - resonating metallic strip line . alternatively , the radiator 18 may be implemented as a metallized layer of paint in the form of a self resonance element . due to the presence of the electric field , this element does not need a direct feed point . in this case , even though the parasitic radiator 18 does not need to be grounded , it could be optionally grounded at one end , or anywhere along the path of the element 18 , to a printed circuit board main ground point 48 in the housing 12 . the ground selection and shape variation of the parasitic element 18 are optimized during testing , depending on the actual type of phone used and the frequency of operation . to correspond with the outer contour or otherwise follow the periphery or other portions of the phone to result in a sufficient surface impedance , the parasitic radiator 18 , 183 or 185 can be implemented as a u - shaped metallic patch . alternatively , a substantially d - shaped metallic patch 184 or 186 corresponding to the outer contour of the flip 14 or corresponding to the outer contour of the display screen 28 may be used . optional cuts or openings 52 may be used in the path to add capacitance . an optional center stub or other tabs 54 may be employed to allow for inductance tuning . in summary , an antenna system takes benefit from the form factor of a communication device to accomplish improved performance . this improvement is realized by having multiple elements which combine to produce better radiation and gain performance . while the preferred embodiments of the invention have been illustrated and described , it will be clear that the invention is not so limited . numerous modifications , changes , variations , substitutions and equivalents will occur to those skilled in the art without departing from the spirit and scope of the present invention as defined by the appended claims . | 7 |
how the instant invention may be practiced at the larger end of a wide size range scale respecting an aqueous body - holding reservoir used will be explained with reference to fig1 . the lake - sized water reservoir shown is generally designated 10 , is bounded by a flat - topped wall 9 , and contains its aqueous body covered by a mixed monolayer 11 so composed that in sunlight the surface of the aqueous body would visually appear yellowish to the naked eye of observer 12 on a raised platform 13 to overlook reservoir 10 . the yellowish appearance in this non - limiting example is due to providing that the mixed monolayer 11 be partly composed of a constituent containing iodine and which absorbs a substantial amount of the violet color spectral region of sunlight , namely , octadecyl trimethyl ammonium iodide . this substance is a member of the quaternary ammonium halide family of organic compounds that are simultaneously film - forming surfactants and biocidal . bacteria contacting a biocide of this type tend to adhere to the biocide molecules . the other constituent of which mixed monolayer 11 is composed preferably can be hexadecanol or octadecanol , a blend of these two higher fatty alcohols as has often been used for evaporation suppression , or even the inventor &# 39 ; s recently patented evaporation suppressant composition that includes a minor amount of slaked lime powder with fatty alcohol . in the usual manner , and for molecules of both constituents of film 11 , comparatively long ( 16 - 18 carbon atoms ) carbon chain portions will orient extended away from the bulk of the water of the film - coated reservoir . in a manner believed analogous to how hydrocarbon tails of hexadecyl trimethyl ammonium bromide ( hdtab ) are thought by biochemists to arrange into spaces between cholesterol molecules in bilayer lipid membrane studies , octadecyl trimethyl ammonium iodide chains will similarly fit tails amongst those of monolayer - forming fatty alcohol molecules , thereby creating an interfacial monomolecular film of mixed constituents that coats an aqueous body in the usual manner with the polar or ionic head portions of molecules immersed . presence in film 11 of its special iodide relates causally to its yellowish coloration , since analytical chemistry finds this iodide to have broad bands centered at 360 and 290 nm , respectively near the edge of and inside the ultraviolet range . the yellowish color in daylight conditions may readily be sensed remotely by optical devices possibly carried by aircraft or even a landsat type satellite , or more cheaply by a naked - eye observer 12 on platform 13 . automatic on - site monitoring to obviate need for a reservoir keeper on watch constantly is contemplated , and illustrated schematically by a set of violet - tuned lasers shown in fig1 as 50 a and 50 b , with matching laser light receptors 51 a and 51 b disposed across the reservoir . tuned lasers to monitor for a color change are within known technology and do not require detailed description . basically , the fig1 set - up calls for tuning the two lasers for violet sensitivity , utilizing laser 50 a to produce a reference beam and 50 b to produce a surface - grazing beam . electronic balance means 52 connecting receptors 51 a and 51 b includes appropriate bridging and adjustment circuits ( not shown ), allowing system calibration to give a characteristic reading when monolayer film 11 is in the normal state of maintaining both the fatty alcohol and the iodine - containing constituents together in film 11 . still referring to fig1 the yellowish coloration due to iodide content of monolayer 11 would not be preserved for long after catastrophic reservoir contamination following an attacking overflight of reservoir 10 by a crop - dusting equipped aircraft dispersing any of the pathogenic bacterial species mentioned in the abovecited jansson et al patent and susceptible to biocidal effect of quaternary amines . the major bacterial intrusion from such an attack would encounter the biocide constituent of monolayer 11 , which preferably may constitute from about ten to thirty percent of the total amount of monolayer forming substances utilized . each bacterium contacting a biocide molecule would tend to adhere thereto and the pair , or clumps of such pairs , as a result of interaction between bacteria and biocide , would tend to exit monolayer 11 by falling therefrom into the underlying bulk aqueous phase . this removal mechanism is causative of loss of the yellowish surface coloration because of physical removal of the iodide content of the biocide away from the ultrathin interfacial region grazed by the beam from laser 50 b . absent the iodide constituent at the interface , there would of course be more violet received by receptor 51 b , ie ., less attenuation of violet transmitted by reflection after grazing , less violet being absorbed in the grazing process when the iodide is no longer present in monolayer 11 . given a set up for automatically continuous recording of the difference between the two beams at their receptors , any major departure from the normal difference when the monolayer 11 is constituted as originally spread is a signal of change thereof that would be cause for a reservoir keeper to suspect a contaminating attack . the loss of coloration , detectable optically whether by means of human visual observation or using instruments in known ways , would constitute the looked - for signature change indicating a significant likelihood that a bioattack attempting to contaminate the water of reservoir 10 has occurred . degree of effectiveness of this particular method of practicing the invention would vary depending on local weather factors , which must at least be such as permit maintaining monolayer 11 on reservoir 10 . not controlled , general environmental conditions capable of causing major alteration of the film 11 must at least be themselves monitored so that allowances can be made in order to avoid false automatic indications of a bioattack . rain or strong wind breaking up monolayer 11 could also cause loss of yellowish coloration and thus indication by the tuned laser system of a catastrophic change . for another measure to avoid false signals , water purity monitoring should be practiced to be sure that film deterioration is not being caused by population explosions of naturally occurring pseudomonas or flavobacterium species that may first be attracted to the higher fatty alcohol containing constituent , about 70 - 90 % of a mixed monolayer 11 , as a source of nutrition to them , but which would then be decimated by the biocide constituent . given favorable or at least innocuous environmental conditions , including all those specifically mentioned in the summary above where the third essential element of the method of the invention was specified , the method can be practiced along the lines basically described herein with reference to fig1 and thereby contribute a significant measure of civilian defense preparedness in face of possible bioattacks on large public water reservoirs . considering the advisability in general that someone be employed on a regular basis to look after basic security of a large reservoir holding public drinking water , the option of using a human reservoir keeper / observer 12 periodically mounting a platform 13 as shown in fig1 is recommended . a final detail of fig1 to discuss is use of mobile platforms generally indicated as 55 and 56 to support the components of the laser - based optical monitoring system illustrated and already explained . assuming a fairly large reservoir , it is conceivable that a biological attack attempting its contamination from the air might not have the causative consequence of a film loss of the violet - absorbing constituent evenly operative across the the whole area of water surface in the reservoir . instead , a patch of loss in a particular smaller region contaminated by airdropped bacteria might occur , in which case , unless that affected region were grazed by the grazing beam of laser 50 b the desired warning signal of contamination occurrence would not be forthcoming . this problem is easily resolved , however , by so moving the system components as to check for film loss across the whole reservoir surface , conceived as adjacent band regions to be successively grazed . additionally , mobile platforms 55 and 56 obviously would facilitate moving the reservoir monitoring system of fig1 to another reservoir if desired . it will be understood that above description in detail of embodying or practicing the method of the invention in accordance with what fig1 illustrates does not limit the invention and is exemplary only . turning now to embodying or practicing the method of the invention at the smaller size - scale of relatively compact units of apparatus usable virtually wherever a biological attack might be expected to occur , fig2 provides a second instructive illustration which again is not intended to limit the invention specifically to what is shown . the inventor makes no claim of uniqueness of physical features of the film balance here generally designated 10 and holding an aqueous body 1 coated in the indicated region by monolayer 11 but uncoated in the region indicated by the lead line for the figure element numeral 1 . movable barrier 5 separates the filmed ( monolayer coated ) and nonfilmed ( uncoated ) surface regions in the typical manner of most film balances , also called langmuir troughs . carriage means 4 to support and controllably move barrier 5 is actuated by wormdrive 3 in conjunction with which a revolution counter ( not shown ) would be helpful in calculating interfacial area coated by monolayer 11 at a given pressure . for measurement of the fundamental interfacial pressure and tension properties of monolayer 11 , a wilhelmy plate 15 dipped into aqueous body 1 through monolayer 11 is provided . to measure downward pull on plate 15 by fluid at the penetrated interface , a force transducer 16 is shown with the plate 15 suspended therefrom . plate 15 and transducer 16 are preferably combined in a portable unit that for use is rested atop the film balance 10 as shown but can be removed therefrom easily for transfer to an identical film balance located elsewhere . [ 0045 ] fig2 is partly exploded in the sense that the two rectangular portable , unitary , instrumentation means 25 and 35 , like the plate 15 and transducer 16 unit , are shown removed from resting positions where they can be individually placed atop the film balance 10 at desired times . instrument 25 is intended to represent a surface potential meter , and instrument 26 is intended to represent a viscosimeter . alternatively , instrument 26 may also represent a unit combining the capillary ripple generating and ripple sensing probes described in the mann , jr . and hansen articles cited above , wherein measurement of ripple amplitude attenuation associated with viscoelastic properties of a monolayer has been well taught and described . further , an advantageous hydromechanical feature that also is nothing new is assumed present when needed although not shown , namely , some suitable submerged means for stirring and distributing non - motile bacteria within the bulk of aqueous body 1 , so that such bacteria which do not have the capability of locomotion can be forced into contact with the underside of monolayer 11 after having fallen onto the uncoated region of the surface of aqueous body 1 . such stirring means facilitate an established biochemical investigations technique which has been briefly and clearly described in a passage of the “ lipids in water ” chapter by morris b . abrahamson in the chemistry of biosurfaces , michael l . hair , ed ., marcel dekker inc . ( new york , 1971 ) reading as follows : “ the substance of biological interest ( proteins , anaesthetics , or antibiotics ) in an appropriate solvent is injected behind the movable float into the aqueous phase . by stirring , it is brought to the region below the film where it may react , and changes in surface pressure or potential measure the extent of the reaction .” for the purpose of now systematically reviewing the five essential elements of the method of the present invention , with use supposed of a film balance type small size scale use - setting referenceable to fig2 it is proposed that the substance of biological interest in this instance may be the pathogen , bacillus anthracis , and that the monolayer here to be used is not of mixed composition but is instead 100 % octadecyl trimethyl ammonium iodide . a reservoir holding an aqueous body exposed to the local atmosphere is needed to be located at a site deemed likely to be targeted for biological attack . since the film balance 10 of fig2 is such a reservoir , let it be placed near an air duct outlet into a room inside a postal station , thereby satisfying the first essential element of the method of this invention . it is reasonable to expect that a biological attack releasing a substantial quantity of anthrax spores to travel with moving air through the ductwork until coming out at the air outlet would result in contamination of the aqueous body 1 held by film balance 10 , a smallish reservoir . the second essential element of the method is to establish a monolayer forming an interfacial film coating a significant portion of the surface of the aqueous body held in the pre - placed reservoir . here there is little if any importance attached to evaporation suppression since the small amount of liquid for aqueous body 1 can and likely should be replaced every so often on a regular schedule . the common use of higher fatty alcohols to form evaporation suppressant monolayers may here be disregarded and a 100 % biocidal monolayer forming substance shall be used instead , namely , octadecyl trimethyl ammonium iodide , sufficing to satisfy the second essential element of the method of the invention , which it should be noted does not require total coating of the entire surface of the aqueous body , but only a significant portion thereof . areal size of that portion is adequate if it conveniently allows placement and use of the needed instrumentation to be used to measure monitorable monolayer properties . there is need here to monitor and control general environmental conditions affecting the sited film balance 10 , including relative humidity , air and water temperature , velocity of air moving in the vicinity and of liquid when stirred , spectral radiation intensity , and extent if any of extraneous biological organisms , which are all clearly conditions respecting which established technical means for their control as well as for being monitored may be resorted to without need for developing new technology , when the method is practiced , as here , indoors and at a small scale , since film balance 10 of fig2 provides the reservoir . provision of environmental conditions controls of purely conventional character here satisfies the third essential element of the method of the invention . the fourth element requires provision of suitable instrumentation for enacting at least one known method for measuring monitorable monolayer properties that were mentioned in the background above and / or , equivalently , are known susceptible to measurement according to any prior art suggestions of instruments and monolayer research techniques . here it is apparent from fig2 that three properties - measuring methods are preferable to use and easy to practice : using wilhelmy plate 15 and associated transducer 16 to measure interfacial tension and pressure in the usual way ; using similarly known instrumentation to measure surface potential ; and also using means for measuring the viscoelastic ( rheological ) interface property , thereby amply satisfying the fourth element of the method of the invention . it will be recalled that the fifth element , which in concert with the third element confers collective operability for the purpose of the invention on the first , second , and fourth elements , is pre - use calibration of whatever monolayer monitoring instrumentation has been selected . given that the three examples of instrumentation represented in fig2 are highly familiar to those who use film balances in surface chemistry research , their calibration requirements can be met by following conventional procedures . all then that remains to be done before actual on - alert bioattack detection use of apparatus shown in fig2 is the acquisition beforehand of data for monitorable monolayer property changes in monolayer 11 in film balance 10 that would be characteristic for and amount to the bioattack signature change for the case of contamination of aqueous body 1 by bacillus anthracis . to acquire the pertinent pressure , tension , potential , and other data for the reaction of bacillus anthracis bacteria with monolayer 11 , eg . octadecyl trimethyl ammonium iodide , requires obtaining a sample of this dangerous species with which to contaminate aqueous body 1 . stirring in the usual way may be used to introduce the reactant beneath the monomolecular film 11 of film balance 10 of fig2 . such testing to supply needed data does not invoke an undue or non - routine aspect of experimentation , which instead is essentially routine , notwithstanding lethality of the species . the inventor considers it far more likely than not that a distinctive set of data for the parameters measured will show up , which subsequently can be monitored for , starting an on - watch usage of film balance 10 with a fresh uncontaminated aqueous body 1 and established monolayer 11 . it should be noted that the question of extent of ‘ kill rate ’ by disinfection is not here the issue . the invention is not purported to be a means for complete destruction of the contaminating bacteria ; rather , the aim is to provide a cost effective biological attack detection system . each biocide varies with regard to ‘ kill rates ’ for different species , in different general conditions of humidity and temperature , and so forth . a bioattack signature change in a monolayer subjected to pathogenic contamination is expected to be found even if all bacteria do not die in the monitoring apparatus . finally , the illustrative examples discussed by reference to fig1 and 2 are not meant to specifically limit the invention . only the appended claims do . as co - inventor with r . e . jansson and s . visaisouk of u . s . pat . no . 5 , 104 , 649 ( may 14 , 1992 ) for surface - functionalized biocidal polymers , the present inventor investigated the occlusion of rigid plastic surfaces with dead bacteria , when the plastic surfaces have biocidal agents bonded thereto . such agents include amine salts quaternized in situ per the teachings of the jansson et al patent . distinguishing from such a case , the behaviour of quaternary ammonium halide biocides , if present in a monolayer at the surface of a bacterially contaminated aqueous body , would not involve similar surface occlusion since bonding of the biocide to a rigid plastic surface would not be present . instead , the inventor expects that in a case of having the biocidal agent in a monolayer killed bacteria would adhede together with bacteriocidal molecules , the latter tending to fall out of the monolayer into the aqueous subphase , thus altering the interfacial film . even setting aside the question whether this or that particular monolayer should or should not be equipped chemically for killing particular species of bacteria likely to contaminate the environment and enter the aqueous body , the following proposition would not be doubted by those of skill in monolayer technology : associated with any major intrusion of bacteria to the environment of an established monolayer , there would much more likely than not be a measurable change in one or more of its mnonitorable monolayer properties , that would attend the intrusion . insofar as the inventor is aware , applying the known technological tools for monolayer studies to provision of a method of detecting biological weapon use by monitoring a monolayer has never been previously suggested . | 2 |
the following detailed description is made in the context of an article including a disposable panty for holding a sanitary pad in place during use . it is readily apparent , however , that the present invention can be employed with other disposable articles , such as feminine tampons , incontinent garments and the like . the disposable panty of fig1 illustrates the preferred embodiment of the present invention in a flat configuration prior to assembly . in fig1 a panty 12 is shown having an outer cover 13 which includes a front body portion 14 , a back body portion 15 , a front waist portion 16 , a back waist portion 17 , a crotch portion 18 , waist liner 26 ( not shown ), leg liner 38 ( not shown ) and body liner 80 ( not shown ). the outer cover 13 is compliant and soft feeling to the wearer . the outer cover 13 may be liquid pervious , permitting liquids to readily penetrate into its thickness , or impervious , resistent to the penetration of liquids into its thickness . a suitable outer cover 13 may be manufactured from a wide range of materials , such as natural fibers ( e . g ., wood or cotton fibers ), synthetic fibers ( e . g ., polyester or polypropylene fibers ) or from a combination of natural and synthetic fibers or reticulated foams and apertured plastic films . there are a number of manufacturing techniques which may be used to manufacture the outer cover 13 . for example , the outer cover 13 may be woven , nonwoven , such as spunbonded , carded , or the like . a suitable outer cover 13 is carded , and thermally bonded by means well known to those skilled in the fabric art . alternatively , the outer cover is a spunbond . ideally , the outer cover is a spunbond polypropylene nonwoven with a wireweave bond pattern having a grab tensile of 19 pounds as measured by astm d1682 and d1776 , a taber 40 cycle abrasion rating of 3 . 0 as measured by astm d1175 and handle - o - meter md value of 6 . 6 grams and cd value of 4 . 4 grams using tappi method t402 . suitably , the spunbond material is available from kimberly - clark corporation , located in roswell , ga . the outer cover 13 has a weight from about 0 . 3 oz . per square yard ( osy ) to about 2 . 0 osy and alternatively about 0 . 7 osy . preferably , the outer cover of the undergarment has a printed pattern , is colored or is decoratively embossed . referring to fig1 and 3 , an edge 60 of front body portion 14 is assembled with an edge 62 of the back body portion 15 to form a seal 64 . similarly , an edge 66 of the front body portion 14 is assembled with an edge 68 of the back body portion 15 to form a seal 70 . the waist portions 16 and 17 , when assembled form a waist opening 20 for putting on and taking off the panty 12 . the waist opening 20 is surrounded at least in part by a waist elastic 22 . the waist elastic 22 is stretched and attached to the waist portion 16 . the waist elastic 22 is released after attachment to produce waist folds or pleats 24 to allow expansion of the waist opening 20 so that the panty 12 can fit various sized women . because users of this invention generally prefer a brief style panty , the waist portion 16 of the panty 12 preferably comes to the navel and is even around the wearer &# 39 ; s waist . having the panty 12 at this height and then drawing in the waist portion 16 with the waist elastic 22 provides a snug fit . alternative panty styles include bikini ( e . g . regular leg cut and french leg cut ) and hipster ( e . g . regular leg cut or french leg cut ). referring again to fig1 and 2 , the front body portion 14 and the back body portion 15 together with the crotch portion 18 forms leg openings 28 and 30 , respectively , which are generally circular or oval in shape . the leg openings 28 and 30 are each surrounded at least in part by leg elastics 32 and 34 , respectively . the leg elastics 32 and 34 are stretched and attached to the front and back body portions 14 and 15 and the crotch portion 18 . the elastics are released after attachment to produce leg folds or pleats 36 to allow expansion of the leg openings 28 and 30 to fit various sized legs . the front body portion 14 is usually divided into a front upper portion 40 and a front lower portion 42 . similarly , the back body portion 15 is divided into a back upper portion 41 and a back lower portion 43 . the upper portions 40 and 41 are preferably designed to include body elastics 44 which are capable of stretching to allow the wearer to put on the panty 12 and then readily resume the body elastic &# 39 ; s normal contracted form . this ensures a close or snug fit to different body and size forms . a number of body elastics 44 are positioned on both the front and the back portions 40 and 41 , respectively , at positions between the waist opening 20 and the leg openings 28 and 30 , so that the panty 12 fits the wearer better , particularly around the body . the lower body portions 42 and 43 do not necessarily require elastics . if the outer cover incorporates the body elastic , the basis weight of the outer cover and body elastic laminate may be as high as 5 osy . in reference to the crotch portion 18 of fig1 the functional total capacity of normal pads worn during the menstrual cycle ranges from about 12 grams to about 63 grams . more typically , the capacity of the pads is above 20 grams . the marketing names associated with such pads include “ thin maxi ”, “ maxi ”, “ thick maxi ” and “ super maxi ”. these will be referred to as maxi pads . the entire absorbent core normally contained in a maxi pad and which is used during medium to high menstrual flow periods in the panty 12 is the “ primary ” absorbent 45 . the absorbent which is associated with the crotch portion of the current invention is the “ secondary ” absorbent . the crotch portion 18 of the panty 12 consists of an absorbent barrier composite 46 . the absorbent barrier composite 46 further consists of a liquid barrier 48 and a secondary absorbent 50 . preferably , the thickness of the crotch portion 18 is less than about 4 mm . the thickness is measured on a 4 inch ( 102 mm ) square sample ( leg elastics removed ) with a mitutoyo digamatic indicator using a 3 inch ( 76 mm ) diameter acrylic platen and assembly to produce a pressure of 0 . 05 psi . the liquid barrier 48 is needed to prevent liquid strike through onto the outer clothing when leakage occurs on the panty 12 . the liquid barrier 48 is located on the inside of the crotch portion 18 and consists of a liquid impervious film such as polyethylene . use of only the film would be hot and uncomfortable , would not be durable enough to withstand changing of pads and would smear any menses which leaked off of the primary absorbent 45 . any film crotch material in the prior art that is elastic is nominally undesirable for the attachment of a pad since the stretch could detach the pad . therefore , it is desirable to associate the secondary absorbent 50 with a liquid barrier 48 which is nonelastic . the secondary absorbent 50 should have a liquid capacity great enough to absorb leakage of menses from the primary absorbent 45 . the secondary absorbent 50 should preferably have a capacity ( described below ) and a thickness substantially less than that of the primary absorbent 45 , thus providing a nonbulky and flexible fit . the capacity of the secondary absorbent 50 should have a total capacity of about one - half of the primary absorbent 45 . preferably , the secondary absorbent 50 should have a total capacity of at least about 3 grams and not more than 6 grams . more preferably , the total capacity of the secondary absorbent 50 should be from about 4 grams to about 6 grams . however , the basis weight of or the type of secondary absorbent 50 should be adjusted to provide resistance to flexibility of less than around 400 grams . the absorbent barrier composite of the present invention has a low stiffness . the low stiffness allows the absorbent and barrier to remain attached to the conformable outer cover which conforms to a wide range of body sizes and shapes . preferably the absorbent barrier composite has a stiffness of less than 400 grams along any axis tested , more preferably less than 300 grams along any axis and less than 100 grams along the axis parallel to the waist opening in the invention . the secondary absorbent alone will have a stiffness of less than 250 grams and preferably less than 100 grams along any axis and more preferably less than 75 grams along the axis parallel to the waist opening in the invention . the stiffness of the absorbent barrier composite is measured by peak bending stiffness . peak bending stiffness is measured by inda standard test method ist 90 . 3 - 92 standard test method for handle - o - meter stiffness of nonwoven fabrics . the nonwoven to be tested is deformed through a restricted slot opening by a blade , and the required force is measured . this force is a measure of both flexibility and surface friction of the absorbent . the test apparatus is an electronic digital read - out handle - o - meter , model # 211 - 5 equipped with flat plates . the apparatus is available from thwing - albert instrument company in philadelphia , pa . for each procedure for this test , five samples should be prepared according to the method described in ist 90 . 3 - 92 . for tests involving the absorbent barrier composite , the specimen should include all structural components of the absorbent barrier composite including any materials or methods used to bond that composite together . for tests of the secondary absorbent only , the specimens should be all structural components of the secondary absorbent including materials or methods for bonding that secondary absorbent together . the procedure should be conducted as described in ist 90 . 3 - 92 . the procedure makes provisions for altering specimen dimensions if resultant grams readout exceeds the 100 gram capacity of the instrument . reduction in sample size to result in a read - out within the range of the instrument may be necessary for materials falling in the range of the above description . conduct all such modifications as described in ist 90 . 3 - 92 and use the test unit conversion described in section 7 . 1 of ist 90 . 3 - 92 . the gap should be set at 0 . 25 inches ( 6 mm ) as described in section 10 . 1 of the ist 90 . 3 - 92 . the absorbent barrier composite should be tested along an axis parallel to the direction in which the absorbent composite was manufactured ( so - called machine direction ) as well as the axis perpendicular to the direction of the absorbent composite &# 39 ; s manufacture ( so - called cross direction ). in addition each side should be tested along each axis . these steps are detailed in sections 10 . 1 through 10 . 10 inclusive in ist 90 . 3 - 92 . the maximum reading for each specimen is recorded per ist 90 . 3 - 92 section 10 . 3 . the five values are averaged for each axis and side condition tested . the results are reported as maximum grams reading for each specimen . this differs from the millinewtons called for in ist 90 . 3 - 92 sections 11 and 12 . the average of all five values for each condition is calculated . the total capacity of the primary absorbent 45 and the secondary absorbent 50 are determined as follows . any panty adhesive release paper is removed from the pad to be tested . the total capacity of the primary absorbent 45 is determined using the entire napkin minus any release paper . the total capacity of the secondary absorbent 50 is determined using the absorbent barrier composite 46 of the panty 12 and the outer cover 13 . the specimen is weighed to the nearest 0 . 1 gram and acclimated at standard relative humidity and temperature for two hours . the specimen is then submerged in a beaker of sterile saline ( 0 . 9 % sodium chloride solution obtainable from the baxter travenol company of deerfield , ill . ), such that the specimen is totally submerged and is not bent or otherwise twisted or folded . the specimen is submerged for 10 minutes . the specimen is removed from the saline and suspended for two minutes in a vertical position to allow the saline to drain out of the specimen . the specimen is then placed body facing surface down onto an absorbent blotter , such as filter paper # 631 available from the filtration science corp , eaton - dikmena division of mount holly springs , pa . a uniform 17 . 6 grams per square centimeter load is placed over the specimen to squeeze excess liquid out of the specimen . the absorbent blotter is replaced every 30 seconds until the amount of liquid transferred to the absorbent blotter is less than 0 . 5 grams in a 30 second period . the specimen is then weighed to the nearest 0 . 1 gram and the dry weight of the specimen is subtracted from the final wet weight . the difference in grams is the total capacity of the specimen . in construction of the absorbent barrier composite 46 , the liquid barrier 48 should retard the movement of the liquid through the absorbent barrier composite 46 by making the barrier liquid resistant to penetration normally encountered under wearing conditions . the composite may be rendered liquid impermeable by any method well known in the art such as coating the secondary absorbent 50 or by securing a separate liquid impermeable material to the secondary absorbent 50 . alternatively , the liquid barrier 48 consists of a liquid impervious film or foam which is pervious to water vapor under normal wearing conditions . more preferred , the liquid barrier 48 has a water vapor transmission rate of at least about 3500 grams / m 2 / day measured by astm e96 - 92 . one example of a suitable film is a 39 . 4 grams per square meter microporous film produced by mitsui and sold by consolidated thermoplastics ( ct ) under the tradename of espoir ® n - taf - ct . the secondary absorbent 50 may be any construction which is generally compressible , conformable , non - irritating to the wearer &# 39 ; s skin , capable of absorbing and retaining menstrual fluid . optionally , the secondary absorbent 50 has first and second opposed faces and includes an absorbent rich layer 51 and a support layer 53 . the absorbent rich layer 51 may be manufactured in a wide variety of sizes and shapes ( e . g ., rectangular , hour - glass , etc . ) and from a wide variety of liquid absorbent materials , such as fiberized wood pulp . examples of other suitable absorbent materials include creped cellulose wadding , absorbent foams , absorbent sponges , superabsorbent polymers , or any equivalent material or combination materials . the support layer 53 may be any construction which is generally resistent to deterioration by liquids while being conformable , non - noisy and capable of holding the absorbent rich layer 51 in place . alternatively , the absorbent rich layer 51 can range from 30 to 80 gsm 1 : 1 blend of northern hardwood pulp and southern softwood pulp . the support layer 53 can be a 12 - 15 gsm spunbond . the pulp layer is hydroentangled through the spunbond . alternatively , the combined layers may then be microcreped . the liquid barrier 48 and the secondary absorbent 50 are bonded together using an adhesive 72 add - on of 3 to 7 gsm . optionally , the absorbent rich layer 51 is bonded to the barrier of the absorbent barrier composite 46 . this arrangement permits improved attachment , removal and reattachment of the primary absorbent 45 to the panty 12 . the liquid barrier 48 is bonded to the outer cover 13 on the inside of the panty with an adhesive 74 add - on of 5 to 10 gsm . the liquid barrier 48 may be an adhesive film which bonds the secondary absorbent 50 to the outer cover 13 . a suitable adhesive for both applications includes , for example , national starch ns 34 - 5561 hot melt adhesive which is available from national starch and chemical company located in bridgewater , n . j . the width of the crotch portion 18 between the leg elastics 32 and 34 should be wide enough to lay the primary absorbent 45 between the edges without having the primary absorbent 45 obstruct the leg elastics . this allows the leg elastics 32 and 34 to contract and draw up the sides of the crotch to accommodate the depth of the primary absorbent 45 being used and give surface area within the crotch portion 18 to contain leakage from the primary absorbent 45 . the minimum width of the crotch portion 18 should not be so wide as to seem bulky or uncomfortable , but a suitable width is at least about 2 . 75 inches ( 70 mm ) between the leg elastics . the minimum width is advantageous from about 3 inches ( 76 mm ) to about 3 . 5 inches ( 89 mm ). optionally , the width is about 3 inches ( 76 mm ). preferably , the leg elastics 32 and 34 are from about 0 . 375 inch ( 10 mm ) to about 0 . 625 inch ( 16 mm ) wide . more preferably , the width is about 0 . 5 inch ( 13 mm ). preferably , ruffle material on the edge of the leg openings 28 and 30 outside the leg elastics 32 and 34 is less than about 0 . 25 inch ( 6 mm ). more preferably , the ruffle material is less than about 0 . 125 inch ( 3 mm ). it is most desirable to eliminate the ruffle material from the edge of the leg openings 28 and 30 . the overall width of the crotch portion 18 includes the width between the leg elastics 32 and 34 , the width of the leg elastics 32 and 34 and the ruffle material outside the leg elastics 32 and 34 to the edge of the leg openings 28 and 30 . preferably , the overall width of the crotch portion 18 should be at least about 4 inches ( 102 mm ). the width of the absorbent barrier composite 46 is sized in relation to the width of the crotch portion 18 . preferably , the width of the composite 46 is at least the width of the crotch portion 18 between the leg elastics 32 and 34 . more preferably , the width is equivalent to the width of the crotch portion 18 . the overall length of the absorbent barrier composite 46 should be adequate to extend beyond the ends of the primary absorbent 45 to help prevent liquid strike through at these points when sleeping or sitting . this overall length is at least about 15 inches ( 382 mm ) thus extending beyond the crotch portion 18 along the longitudinal centerline a - a of the panty 12 . alternatively , the length should be in the range of about 15 inches ( 382 mm ) to about 19 inches ( 484 mm ). optionally , the length of the composite 46 is about 17 inches ( 433 mm ). the width of the absorbent barrier composite 46 beyond the crotch portion 18 should be at least as wide as the width of the crotch portion 18 . the width of the absorbent barrier composite 46 could be narrowed beyond the crotch portion 18 but may compromise the leakage containment . more preferably , the width is from about 5 inches ( 127 mm ) to about 12 inches ( 306 mm ), alternatively from about 5 . 5 inches ( 140 mm ) to about 7 . 5 inches ( 191 mm ). optionally , the width is about 6 . 5 inches ( 165 mm ). the present invention contemplates various shapes of the composite 46 . one preferred composite has a non - rectangular shape with rounded ends which provides extensive coverage in the seat of the finished panty 12 . another preferred absorbent barrier composite 46 embodiment is rectangular in shape with rounded ends . the essentially rectangular - shaped absorbent barrier composite 46 is more preferred since it can be squared off at the ends to provide a smoother appearance in the back of the panty 12 . line 76 may be embossed or printed on the inner surface of the crotch portion 18 to aid in placement of the primary absorbent 45 by the wearer . referring to fig3 the waist elastic 22 is shown covered with a waist liner 26 . referring to fig3 and 4 , the leg elastics 32 and 34 are shown covered by the absorbent barrier composite 46 and a leg liner 38 . referring to fig3 the body elastic 44 is shown covered with a body liner 80 . the liner consists of a nonwoven or other soft material for contacting the wearer &# 39 ; s skin . the position and the shape of the leg openings 28 and 30 are important to avoid tightness in the crotch and groin area of the wearer , to obtain adequate buttocks coverage , and to prevent the panty 12 from tilting forward , i . e . tilting such that the front waist edge dips lower in relationship to the back waist edge . fig1 illustrates the most preferred design for leg fit and buttocks coverage . the shape of the curve across the top of the leg may be considered . if the curve is too deep , the panty 12 will shift downward and backward resulting in a short front waist , increased back length and bagginess in the seat of the panty . this causes the panty 12 to appear tilted when worn as evidenced by an unevenness around the waist of the wearer . the leg openings 28 and 30 are important to the correct functioning of the panty 12 . with the panty 12 laid out flat as in fig1 the majority of the back half of the leg opening preferably forms a straight line . more preferably , the back edge of the leg opening is straight for a length , θ , of at least about 70 % of the length of the entire back half . the straight section θ of the back half of the leg opening should form an acute angle with the longitudinal centerline , a - a , of the panty 12 . more preferably , the line , θ , forms an angle , α , with the centerline a - a of the panty 12 of between about 50 ° and 65 ° and most preferably about 60 °. the majority of the edge of front half of the leg opening including lengths β and also preferably forms a straight line . more preferably , the lengths of edge β and of the leg opening is straight for at least about 70 % of the length of the front half . the straight section β of the front half of the leg opening should form an angle with the centerline of the panty 12 of between about 75 ° and 110 ° and most preferably about 90 °. likewise , the shape of the arc at the inner groin area is important . if the arc is too shallow , tightness may be experienced at the inner groin area . the preferred narrow crotch width reduces coverage of the buttocks . to compensate for such reduction , the back curve is preferably adjusted downward . the arc between the crotch edge of the leg opening and the back edge of the leg opening should start slightly in front of centerline b - b of the panty 12 , see fig1 . this allows the leg elastic to be positioned below the lower edge of the buttocks and helps prevent the panty 12 from riding up when walking . this means that the straight portion of the inner edge of the leg opening is entirely forward of the panty 12 centerline b - b . the waist , leg and body elastics 22 , 32 , 34 and 44 , respectively , are attached to the panty 12 on the outer cover 13 in generally a stretched state by means known in the art , such as ultrasonic bonded , heat / pressure bonded or adhesively bonded . materials suitable for elastics include a wide variety including but not limited to elastic strands , yarn rubber , flat rubber , elastic tape , film - type rubber , polyurethane and elastomeric , tape - like elastomeric or foam polyurethane or formed elastic scrim . each elastic may be unitary , multipart or composite in construction . the waist elastic 22 is about 0 . 5 inch ( 13 mm ) wide . the elastic may comprise threads , ribbons , a film or composite . the threads or ribbons may be multiple and may be applied as a composite . preferably , the waist elastic is threads , more preferably four threads are used as the elastic and the threads are spaced about 0 . 17 inch ( 4 . 3 mm ) apart . the threads may be made of any suitable elastomeric material . one suitable material is spandex such as lycra ® threads available from dupont located in wilmington , del . suitable waist elastics include threads having a total decitex ( g / 10000 m ) of about 3760 for 0 . 5 inch ( 13 mm ) wide elastic . adhesive 74 is used to bond the elastic to the outer cover 13 and the waist liner 26 . a suitable adhesive includes , for example , findley h2096 hot melt adhesive which is available from findley adhesives located in milwaukee , wis . the leg elastics 32 and 34 are about 0 . 5 inch ( 13 mm ) wide . the elastic may comprise threads , ribbons , a film or composite . the threads or ribbons may be multiple and may be applied as a composite . the front and crotch leg elastics may be threads , preferably numbering three threads which are spaced about 0 . 17 inch ( 4 . 3 mm ) apart . back elastics numbering up to six threads should have a width of about 0 . 75 inch ( 19 mm ) and a spacing of about 0 . 15 inch ( 3 . 8 mm ) apart . the threads may be made of any suitable elastomeric material . one suitable material is spandex such as lycra ® threads available from dupont located in wilmington , del . suitable leg elastics include threads having a total decitex ( g / 10000 m ) of about 3760 for a 0 . 5 inch ( 13 mm ) wide elastic . adhesive 74 is used to bond the elastic to the outer cover 13 and to the leg liner 38 . to provide a snug leg fit and to draw up the sides of the crotch portion 18 to form the primary absorbent cradle , the leg elastics 32 and 34 are applied to the outer cover 13 under an elongation of about 250 %. preferably , during the application of the elastics , the elastics 32 and 34 are segmented into multiple segments , each segment being elongated to a different degree and applied to the outer cover 13 . in the case of two segments , the front segment is elongated less than the back segment . in the case of three segments , the front and crotch segments are elongated less than the back section . preferably , the front and crotch segments are elongated to about 150 % and the back segment is elongated to about 250 %. the segmenting and differing tensions allow easier pad attachment , less tightness in the groin area , and less bunching of the crotch portion 18 caused by high leg elastic retraction . the back leg elastic is under higher elongation to help keep the seat of the panty from creeping up with movement during use . the body elastics 44 circumferentially surrounding the body portions 14 and 15 of the panty 12 act independently to conform to the contours of various body types and builds . this provides a smooth , snug , and comfortable fit within a given hip size range . using higher elongation , closer spacing , and higher cross - sectional area in the waist elastic 22 than in the body elastics 44 , the panty 12 takes on a rounded shape and provides good waist fit across the waist to hip ratios encountered . preferably , in the front body portion the body elastics 44 adjoin both the waist elastic 22 and leg elastics 32 and 34 . in a panty 12 , the body elastics 44 are about 6 . 5 inches ( 166 mm ) wide in the front and about 6 . 0 inches ( 153 mm ) wide in the back . the body elastics 44 are preferably spaced about 0 . 25 inch ( 6 mm ) apart . the absorbent barrier composite 46 which extends up the front and / or back body portions toward the waist portion is conformed to the wearer &# 39 ; s body by the body elastic 44 . the transition from the front and back lower portions to the front and back upper portions is thus smoothed . the waist elastic 22 is desirably under a greater tension per unit width than the body elastics 44 in the upper body portion 40 to provide the snug waist fit over the range of waist to hip ratios of the various body shapes . in the preferred embodiment , the tension on the waist elastic 22 is coordinated with the tension of the body elastics 44 to form a snug fit about the waist opening while providing a smooth transition from the upper body portion 40 to the waist portion 16 . in the front and back body portions 14 and 15 , the leg , waist and / or body liners may be expanded to cover the interior of the body portions 14 and 15 . the leg , waist and / or body liners may exclude the center crotch portion 18 which is covered by the application of the absorbent barrier composite 46 . in the body portions where the absorbent barrier composite 46 overlaps the liner , the composite is applied on top of any liner present so as to contact the wearer . an acceptable range for the waist elastic tension is from about 380 grams to about 1000 grams . more preferably , the tension at the waist is from about 575 grams to about 750 grams . the preferred leg elastic tension is from about 375 grams to about 1000 grams . more preferably , the tension at the leg is from about 500 grams to about 700 grams . the preferred hip elastic tension is from about 500 grams to about 850 grams . more preferably , the tension at the hip is from about 650 grams to about 750 grams . the waist and leg tensions are determined as follows . the appropriate gauge rod distance is selected from tables 1 and 2 for a given panty size and desired location measurement . this rod distance is the distance between the top of the upper peg and the bottom of the lower peg on the chatillon dfg - 2 tensile tester . measurements are recorded on the tester in kilograms , the hold / norm switch is set at “ norm ”, the t / c switch is set at “ t ” ( tension ). the samples are conditioned and the testing is conducted in a standard laboratory atmosphere of a temperature of 23 ± 2 ° c . and a relative humidity of 50 ± 5 % rh . for determination of the waist tension , the edge along the bonded seam of the panty 12 is placed over the upper peg of the tester . the panty 12 is allowed to hang freely from the upper peg and the weight of the specimen is tared out . the lower block is lifted upwards and the opposing waist edge along the bonded seam is placed over the peg of the lower block . the block is lowered until the magnet of the tensile tester locks into place . the tester is activated and timed for two minutes . at two minutes , the tension displayed on the gauge is recorded . the tension in kilograms is converted to grams and the panty 12 is removed . for determination of leg tension , the edge along the bonded seam near the crotch fold is placed over the upper peg . the panty 12 is allowed to hang freely from the upper peg and the weight of the specimen is tared out . the lower block is lifted upwards and the bonded seam along the opposing leg opening edge is placed over the peg of the lower block . the block is lowered until the magnet of the tensile tester locks into place . the tester is activated and timed for two minutes . at two minutes , the tension displayed on the gauge is recorded . the tension in kilograms is converted to grams and the panty 12 is removed . this measurement represents the right leg tension . the test is repeated for the left leg tension . for determination of hip tension , the top and bottom side seams of the body portion of the panty 12 are placed in the upper and lower 8 inch wide jaws of an instron model 1122 equipped with a sintech software system and the interactive materials analysis program ( imap ). the tension program stretches the elastic body portion at a rate of 500 mm / minute until 1000 grams is reached . the crosshead then returns to the starting position and repeats a second cycle . the stress - strain graph can be plotted and tension data points printed at 50 , 60 , 70 , 80 , 90 % of the full stretch ( defined as length at 1000 grams ) for first and second load and unload cycles . the tensions were taken from the second cycle unload values at about 85 % of full stretch . the side seams 64 and 70 may be made on the inside or outside of the panty 12 or formed flat against the panty 12 to give a more finished look to the panty 12 and to prevent the seams 64 and 70 from showing through clothing . optionally , the lateral edges 60 , 62 , 66 and 68 of the front and back body portions are not overlapped but are formed flat and extend out laterally . the side seams 64 and 70 should be minimal in width while providing sufficient strength to be pulled up and down many times over a 24 hour wear period . the side seams 64 and 70 , respectively , of the outer cover 13 are sealed by means known in the art , such as ultrasonic bonding , stitching , heat / pressure bonding or adhesive bonding . the maximum seam strength attainable is dependent upon materials used , bond pattern , bond width , and process settings of dwell time , power , and pressure . suitable side seams typically utilize ultrasonic bonding to achieve a seam strength of at least 5 kg . the seams 64 and 70 may have an unbonded portion outboard of the bonded area to provide for a soft edge to the seam . this unbonded portion can ranged from 2 to 3 mm in width . alternatively , the entire seam width ( bonded portion plus unbonded portion ) may be less than about 0 . 25 inch ( 6 mm ). if the seam is trimmed or cut close to the outer edge of the bond area , a sharp edge is produced along the seam edge which can catch on clothes or be irritating to the wearer &# 39 ; s skin . the panty 12 was compared to panties constructed of cotton and panties having a barrier but no secondary absorbent 50 . seventeen women were retained for this comparison . each woman wore a selected maxi pad with each panty type until the pad leaked onto that panty type . loose - fitting cotton shorts were worn by each woman over the panty which could be worn under their normal loose - fitting clothing . at the end of each test , the pad , panty and cotton shorts were collected . the pad , panty and shorts were photographed . the results of the comparison found that cotton panties had leakage to outer garments in 35 . 3 % of the women , panties with barriers but no secondary absorbent 50 had leakage in 41 . 2 % of the women and the panty 12 of this invention had leakage in only 23 . 5 % of the women . having thus described the invention in full detail , it will be readily apparent that various changes and modifications may be made without departing from the spirit of the invention . all such changes and modification are contemplated as being within the scope of the present invention , as defined by the following claims . | 0 |
in the following detailed description , specific details are set forth to provide an understanding of the subject technology . it will be apparent , however , to one ordinarily skilled in the art that the subject technology may be practiced without some of these specific details . in other instances , well - known structures and techniques have not been shown in detail so as not to obscure the subject technology . in accordance with some embodiments disclosed herein is the realization that detachment of a medical device from a delivery assembly can be improved by enhancing features to focus the electrolytic corrosion activity . thus , various embodiments provide for detachment zones that can facilitate electrolytic detachment of a delivery mechanism , making the detachment process faster and more reliable . the medical device can be implanted in body cavities or blood vessels . in addition to the medical device , the delivery system can comprise a voltage source , a cathode , and a catheter . the medical device can be slid in the catheter in the longitudinal direction . a delivery wire may engage the medical device and be adapted to serve as an anode , such that a portion of the delivery wire is designed to be electrolytically corroded at one or more points so that while in contact with a body fluid , one or more portions of the medical device may be released from the delivery wire . according to some embodiments , fig1 presents an overview of a treatment system 10 including an implant 20 and a handle 42 . the handle 42 shown provides proximal access to a delivery wire that engages the implant 20 at a distal end . the catheter / pusher shaft 12 can include a simple extrusion ( e . g ., ptfe , fep , peek , etc .) or can be constructed using conventional catheter construction techniques and include a liner , braid support and outer jacket ( not shown ). a loading sheath 48 is typically provided over the shaft of a pusher 12 . a power supply 46 may be coupled to a proximal portion of the delivery wire 44 . the power supply 46 may also be coupled to a proximal portion of the handle 42 or to the patient . a current can flow from the power supply 46 , to a detachment zone at or near the implant 20 , and to a return path via the catheter shaft 12 ( and / or another structure extending near the detachment zone . alternatively , the current from the detachment zone may flow to the patient , and subsequently to ground or to the power supply 46 . power supply 46 , for example , may be a direct current power supply , an alternating current power supply , or a power supply switchable between a direct current and an alternating current . a positive terminal of a direct current power supply , as shown in fig1 , may be coupled to the proximal portion of the delivery wire 44 and a negative terminal of a direct current power supply may be coupled to the proximal portion of the handle 42 . power supply 46 may provide a current through the treatment system 10 to initiate an electrolytic process during use of the assembly in a fluid medium such as a bloodstream , which may be used as an electrolyte . a power supply , such as an alternating or direct current power supply , may additionally be used to initiate an electrothrombosis process . according to some embodiments , as shown in fig2 and 3 , an implant 20 delivered by the system 10 can be a braid ball . the braid ball 20 can be formed from tubular braid stock including a resilient material , such as nitinol , that defines an open volume ( generally round , spherical , ovular , heart - shaped , etc .) in an uncompressed / unconstrained state . the size of the implant can be selected to fill an aneurysm 2 , so the proximal end 53 of the device helps direct blood flow along the surface of the braid from which it is constructed to the branch vessels 8 . a distal end 56 of the ball can be dome - shaped . the braid ball 20 can include a single layer or two layers 26 , 28 ( inner and outer layer , respectively ) construction at least where impacted by flow at the neck 9 of the aneurysm 2 . as shown , one or more turns of a coil ( e . g ., pt wire ) or a band ( not shown ) can provide a distal radiopaque feature to mark the location of the implant 20 . some exemplary implants that can be used in conjunction with the systems described herein are disclosed at u . s . pub . no . 2013 / 0123830 , published on may 16 , 2013 , the entirety of which is incorporated herein by reference . according to some embodiments , the implant 20 can include a hub 50 at a proximal end 53 thereof . the hub 50 can be fixedly attached to the remainder of the implant 20 . for example , the hub 50 can grasp braided filaments of the layers 26 , 28 of the implant 20 . the hub 50 can provide an aperture 54 for receiving engagement and release mechanisms of a delivery system . according to some embodiments , the implant 20 can be set within an aneurysm sac 2 at a vascular bifurcation 4 , formed by trunk vessel 6 and efferent vessels 8 . the implant 20 can be delivered by access through the trunk vessel 6 ( e . g ., the basilar artery ), preferably through a commercially available microcatheter with a delivery system as detailed below . to deliver the implant 20 , the pusher sleeve 12 is positioned such that the implant 20 can be delivered at least partially into the aneurysm sac 2 . after final positioning is achieved as shown in fig3 , engagement members are released from the implant 20 ( e . g ., from a hub 50 of the implant 20 ), as discussed further herein . finally , the pusher sleeve 12 is withdrawn into the delivery catheter 48 . while the implant 20 can be a braid ball as illustrated herein , the implant 20 can have any other form or structure , according to various embodiments . for example , the implant 20 can be a vasoocclusive coil , a cylindrical , tube - like stent , or a filter . other types of implants are generally known . the subject technology can be applied to any such implant for delivery and detachment thereof . for example , a given implant can include a hub 50 for engagement and release by a delivery system , as disclosed further herein . traditional electrolytic detachment members are generally a single wire with a constant diameter . these detach wires are generally as drawn and are very corrosion resistant due to the crystalline structure . generally , when these detach wires are used they will leave behind small particulates and these particulates interfere with mri imaging and also could lead to secondary stroke if particulates flow to distal vessels . detachment time can be reduced by concentrating erosion to a limited area . according to some embodiments , as shown in fig4 and 5 , a delivery system 10 includes an electrolytically corrodible core wire 29 , having a proximal portion 31 , a distal portion 33 , and a detachment zone 30 is between the proximal portion 31 and the distal portion 33 . at least a portion of the core wire 29 , including the detachment zone 30 , can be coated with a conductive material , such as carbon , gold , platinum , tantalum , combinations thereof , and the like . one or more metallic coatings can be applied using known plating techniques . the core wire 29 , including the detachment zone 30 , can include one or more of the following materials : ceramic materials , plastics , base metals or alloys thereof , and preferably stainless steel . some of the most suitable material combinations for forming the electrolytically corrodible points can include one or more of the following : stainless steels , preferably of the type aisi 301 , 304 , 316 , or subgroups thereof ; ti or tini alloys ; co - based alloys ; noble metals ; or noble metal alloys , such as pt , pt metals , pt alloys , au alloys , or sn alloys . further , ceramic materials and plastics employed for forming the medical device can be electrically conductive . according to some embodiments , portions of the core wire 29 can be coated with a nonconductive material . a proximal insulating layer 34 can be provided over at least a portion of an outer surface of the proximal portion 31 of the core wire 29 . for example , the proximal insulating layer 34 can circumferentially surround an outer surface of the proximal portion 31 . a distal insulating layer 32 can be provided over at least a portion of an outer surface of the distal portion 33 of the core wire 29 . for example , the distal insulating layer 32 can circumferentially surround and contact an outer surface of the distal portion 33 . the proximal and distal insulating layers 34 , 32 can be of an electrically nonconductive or insulative polymer , such as polyimide , polypropylene , polyolefins , combinations thereof , and the like . according to some embodiments , proximal and distal insulating layers 34 , 32 leave exposed the detachment zone 30 of the core wire 29 . when in contact with a body fluid , such as blood , the fluid serves as an electrolyte allowing current to be focused on the non - coated detachment zone 30 . the proximal and distal insulating layers 34 , 32 prevent exposure of the proximal portion 31 and distal portion 33 to the fluid . accordingly , electrical energy conducted along the core wire 29 is concentrated at the detachment zone 30 , thereby reducing the time required to erode away the detachment zone 30 . the proximal and distal insulating layers 34 , 32 can be over - molded , co - extruded , sprayed on , or dip - coated with respect to the core wire 29 . laser ablation can be employed to selectively remove the coating to a controlled length minimizing the time required to erode through the component . lengths as small as 0 . 0005 ″ and as large as 0 . 1 ″ or longer can be removed . according to some embodiments , lengths of detachment zone 30 can be greater than 0 . 005 ″ and / or less than 0 . 010 ″ to provide sufficient exposure to achieve detachment times of less than 30 seconds . according to some embodiments , the distal insulating layer 32 is disposed radially between the distal portion 33 of the core wire 29 and the hub 50 of an implant 20 . as shown in fig5 , an inner band 52 of the hub 50 circumferentially surrounds and contacts the distal insulating layer 32 . an outer band 51 surrounds the inner band 52 , such distal portions of the layers 26 , 28 of the implant 20 are grasped between the inner and outer bands 52 , 51 of the hub 50 . as shown in fig5 , the distal insulating layer 32 electrically isolates the implant 20 from an electrical charge conducted along a length of the core wire 29 . a proximal end of the distal insulating layer 32 may be positioned proximal to the hub 50 , and a distal end of the distal insulating layer 32 may be positioned distal to the hub 50 . likewise , a proximal end of the distal portion 33 may be positioned proximal to the hub 50 , and a distal end of the distal portion 33 may be positioned distal to the hub 50 , such that the distal portion 33 extends through and distally beyond a lumen formed by the hub 50 . alternatively , the proximal end of the distal insulating layer 32 may be coterminous with a proximal end of the hub 50 , and / or a distal end of the distal insulating layer 32 may be coterminous with a distal end of the hub 50 . likewise , the proximal end of the distal portion 33 may be coterminous with a proximal end of the hub 50 , and / or a distal end of the distal portion 33 may be coterminous with a distal end of the hub 50 . according to some embodiments , a distal marker coil 36 is wound helically about an outer surface of the proximal insulating layer 34 . the distal marker coil 36 can be of a radiopaque material , such as platinum , gold , palladium , iridium , and alloys thereof . the distal marker coil 36 terminates at a proximal end thereof adjacent to a core wire end cap 60 . the distal marker coil 36 can be between about 10 and about 40 mm in length , for example , about 30 mm . the distal marker coil 36 can be attached to the core wire end cap 60 by one or more welds 62 . the core wire end cap 60 can be in physical contact and electrical conduction with the core wire 29 . an insulative layer 38 can be provided about an outer surface of the distal marker coil 36 . for example , as shown in fig5 , the insulative layer 38 can extend over an entire length of the distal marker coil 36 and distally beyond the distal marker coil 36 , such that every portion of the distal marker coil 36 is covered by the insulative layer 38 . a distal end of the insulative layer 38 may contact and / or be adhered to the proximal insulating layer 34 . the insulative layer 38 can be of an insulative biocompatible polymer material , such as polytetrafluoroethylene ( ptfe ). the insulative layer 38 may be shrink - wrapped over the corresponding portion of the delivery wire 10 . the distal marker coil 36 terminates at a proximal end thereof adjacent to a core wire end cap 60 . the distal marker coil 36 can be attached to the core wire end cap 60 by one or more welds 62 . the core wire end cap 60 can be attached to a pusher wire end cap 70 , located at a distal end of a pusher wire 74 . according to some embodiments , a proximal marker coil 66 is wound helically about an outer surface of the pusher wire 74 . the proximal marker coil 66 can be of a radiopaque material , such as platinum , gold , palladium , iridium , and alloys thereof . the proximal marker coil 66 terminates at a distal end thereof adjacent to the pusher wire end cap 70 . the proximal marker coil 66 can be about 1 mm in length . the proximal marker coil 66 can be attached to the pusher wire end cap 70 by one or more welds 64 . the pusher wire end cap 70 can be in physical contact and electrical conduction with the pusher wire 74 . the pusher wire end cap 70 and the core wire end cap 60 can be connected by an interface 68 ( e . g ., a weld ), configured to provide an electrically conductive connection between the pusher wire end cap 70 and the core wire end cap 60 . furthermore , an interface 68 can provide sufficient column strength to transfer an axial force applied to the pusher wire 74 to the proximal portion 31 of the core wire 29 . according to some embodiments , an insulative cover 72 can be provided about an outer surface of the proximal marker coil 66 . for example , as shown in fig5 , the insulative cover 72 can extend over an entire length of the proximal marker coil 66 and proximally beyond the proximal marker coil 66 , such that every portion of the proximal marker coil 66 is covered by the insulative cover 72 . a distal end of the insulative cover 72 may contact and / or be adhered to the pusher wire 74 . the insulative cover 72 can be of an insulative biocompatible polymer material , such as polytetrafluoroethylene ( ptfe ). the insulative cover 72 may be shrink - wrapped over the corresponding portion of the delivery wire 10 . the insulative cover 72 can be adjacent to or integral with the insulative layer 38 . a cover 76 may be provided over at least a portion of the delivery wire 10 , including portions of the insulative layer 38 and the insulative cover 72 . according to some embodiments , as shown in fig6 , a pusher wire 74 can be integrally connected to the proximal portion 31 of the core wire 29 . accordingly , an electric charge applied to the pusher wire 74 can be conducted through the pusher wire 74 , the proximal portion 31 of the core wire 29 , and the detachment zone 30 . furthermore , an axial force applied to the pusher wire 74 can result in an axial movement of the core wire 29 and the implant 20 . according to some embodiments , as shown in fig7 , the core wire 29 can include an anchor end 27 at a terminal distal end of the core wire 29 . the anchor end 27 can be located distal to the hub 50 . for example , the anchor end 27 can be located within an interior portion of the implant 20 . the anchor end 27 can have a maximum cross - sectional dimension that is greater than an inner cross - sectional dimension of the inner band 52 . accordingly , the core wire 29 is prevented from moving proximally entirely through the inner band 52 . for example , an interface between the distal insulating layer 32 and the inner band 52 or an interface between the distal insulating layer 32 and the core wire 29 may allow a degree of movement of the core wire 29 relative to the inner band 52 . to prevent the core wire 29 from being removed distally from within the inner band 52 , the anchor end 27 can be of a size that cannot pass entirely proximally through the inner band 52 . according to some embodiments , a detachment zone 30 can be configured such that the corrodible portion thereof defines a unique structure configured to enhance electrolytic corrosion while preserving the structural characteristics thereof , a reduction in corrosion resistance will reduce a time required to deploy an intravascular and / or intrasaccular implant , thus reducing the overall procedure time . according to some embodiments , corrosion resistance of detachment zone 30 is decreased by exposure to laser or other energy , causing the detachment zone 30 to be structurally modified by heat . as a result , the detachment zone 30 will have a different microstructure than the material outside of the zone ( e . g ., the proximal portion 31 and / or the distal portion 33 of the core wire 29 ). the result will decrease the time to electrolytically plate off the material , resulting in faster detachment times . the laser energy will create surface defects for a reduction in corrosion resistance . the laser energy will also alter the microstructure at a specific area , leading to a non - uniform corrosion rate . accordingly , the preferred corrosion site can have a faster detach time . according to some embodiments , the proximal portion 31 and / or the distal portion 33 have a microstructure with a crystallinity that is greater than a crystallinity of a microstructure of the detachment zone 30 . according to some embodiments , the detachment zone 30 comprises a microstructure that is more amorphous than each of ( i ) a microstructure of the proximal portion 31 and ( ii ) a microstructure of the distal portion 33 . according to some embodiments , a method of treating a delivery system includes providing an electrolytically corrodible core wire 29 comprising a proximal portion 31 , a distal portion 33 , and a detachment zone 30 between the proximal portion 31 and the distal portion 33 . the detachment zone 30 is treated to produce a microstructure in the detachment zone 30 that is more amorphous than each of ( i ) a microstructure of the proximal portion 31 and ( ii ) a microstructure of the distal portion 33 . according to some embodiments , a detachment zone 30 can be configured such that the corrodible portion thereof defines a unique surface structure or texture configured to enhance electrolytic corrosion while preserving the structural characteristics thereof . for example , the cross - sectional profile of the detachment zone can define at least one concavity , valley , recess , and / or indentation formed therein . in accordance with some embodiments , the cross - sectional profile of the detachment zone can define areas of positive curvature , such as one or more peaks , protrusions , and / or convexities , with areas of negative curvature , such as one or more valleys , recesses , concavities , and / or indentations . the one or more peaks , protrusions , and / or convexities and the one or more valleys , recesses , concavities , or indentations can be formed from surface structures such as grooves , channels , pits , threads , elongate troughs , circumferential or annular grooves , slots , apertures , coils , crimped ribbon , slotted ribbon , perforated ribbon , and / or other such structures that are precisely or randomly arranged . the shape of the cross - sectional profile of the connector body can be defined by one or more linear edges , parallel linear edges , intersecting linear edges , continuous curves , and / or combinations thereof . by providing a surface structure or texture , some embodiments can thereby provide an increased surface area of the detachment zone in order to enhance the contact area of the component 206 , reduce the overall volume of the detachment zone , and thereby improve the rate of corrosion . further , various embodiments can be provided that are configured to provide excellent structural characteristics in order to ensure that the detachment zone is sufficiently robust and durable . for example , in some embodiments , the component can have a component body comprising at least one structure , such as a trough , valley , recess , concavity , or indentation defining a recess surface area . in accordance with some embodiments , the component can be configured such that the valley , recess , concavity , or indentation can be used in the component without reducing structural characteristics of the component . further , the structure of the detachment zone can add recess surface area to the overall surface area of the detachment zone , thereby enhancing electrolytic corrosion of the detachment zone . thus , the ratio of surface area to volume of the detachment zone can increase with an increase in overall surface area and a decrease in volume of the component . as discussed herein , the increase in the overall surface area of the detachment zone can be achieved by the incremental addition of surface area of the structure ( e . g ., the valley , recess , concavity , or indentation ) versus the surface area of a surface without such a structure ( e . g ., a planar surface ). the decrease in volume can be achieved by the addition of the void created by the valley , recess , concavity , or indentation . additionally , the detachment zone can be fabricated to provide features that will lead to an increased current density in one or more areas of the detachment zone . such features can include , for example , ridges , edges , small radius corners , valleys , troughs , concavities , recesses , indentations , and / or other structures . in some embodiments , the presence of some of these structures on the detachment zone can reduce the local cross sectional area and / or otherwise contribute to the galvanic reaction . features that increase current density can accelerate the galvanic reaction . additionally , according to some embodiments , the electrolytically corrodible detachment zone can be fabricated using a mechanical cold working operation . the cold working of the detachment zone can be performed through operations such as stamping , drawing , squeezing , bending , and / or other processes . the cold working of the detachment zone can enhance the galvanic reaction or corrosion . for example , as discussed herein , the detachment zone can comprise one or more structures or have a cross section that increases the surface area to volume ratio , which can enhance the galvanic reaction . further , the process of cold working can alter the material properties of the detachment zone , which can improve the anodic quality or corrodibility of the detachment zone . cold working can induce stresses in the material of the detachment zone , which can be released during the galvanic reaction , thus facilitating the galvanic reaction . thus , fabrication of the detachment zone through a cold working operation can further enhance the galvanic reaction . furthermore , in accordance with some embodiments , the body of detachment zone can comprise a hollow portion that extends at least partially along the length of the body of detachment zone . the hollow portion can be formed as a discrete bubble or as an internal tubular vacuity extending within the body of detachment zone . in accordance with some embodiments , the tubular vacuity can extend longitudinally within the body of detachment zone . the hollow portion can define one or more sections that are exposed or open to an exterior of the connector body . accordingly , in such embodiments , the rate of corrosion can be enhanced . further , it is possible to thereby provide one or more areas where corrosion can be accelerated significantly as the corrosion process reaches the hollow portion ( s ) of the body of detachment zone . as such , one or more hollow portions can be present at one or more sections or points along the body of detachment zone . accordingly , in some embodiments , the presence of the surface structure ( s ) on the detachment zone can provide an increased ratio of surface area to volume , compared to a detachment zone that does not have such a structure . thus , with a higher ratio of surface area to volume , the galvanic reaction can be faster , more predictable , and more effective for some embodiments . further , in some embodiments , the presence of a surface feature ( s ) on the detachment zone can provide increased current density at such feature ( s ), compared to a detachment zone that does not have such a feature ( s ). with a higher current density , the galvanic reaction can be faster , more predictable , and more effective for some embodiments . other features and discussion of electrolytically corrodible connections is provided in other applications of the present assignee , including the discussion and disclosure of u . s . patent application publication no . 2012 / 0010648 and u . s . pat . nos . 7 , 323 , 000 , and 8 , 048 , 104 , the entirety of each of which is incorporated herein by reference . electrolytically non - corrodible sections of the delivery wire 44 can contain one or more of the following materials : noble metals or noble metal alloys , corrosion - resistant ceramic materials , corrosion - resistant plastics , and preferably platinum metal alloys . the use of the above mentioned materials for the formation of electrolytically non - corrodible sections and of the electrolytically corrodible flanges ensures specific electrolytic corrosion of the flanges at the predetermined points . in accordance with some embodiments , the electrolytically corrodible detachment zone can also be pre - corroded by etching or other methods . thus , the structure ( s ) of a given cross - sectional profile can be modified to reduce the presence of corners , increase the recess depth , and / or otherwise enhance the corrosion rate . further , various excellent structural designs can be provided to achieve desired corrosion performance through the teachings disclosed herein without pre - corrosion of the corrodible points . some embodiments can include a corrodible detachment zone that has a partial coating of a material to provide a greater or lesser electrochemical resistance . thus , in embodiments that have one or more corrodible points , the electrochemical resistance of the points can be varied to achieve staged or preferential electrochemical resistance . coatings of zn , sn , or alloys of such metals on fittings of stainless steel have been found to be particularly satisfactory . further , some embodiments , the end of the delivery wire can be insulated , for example , by a material coating with reduced corrosion properties or a shrunk - on sleeve to improve its electrochemical resistance . embodiments disclosed herein can be used in veterinary or human medicine and more particularly , for the endovascular treatment of intracranial aneurysms and acquired or innate arteriovenous blood vessel deformities and / or fistulas and / or for the embolization of tumors by thrombozation . the apparatus and methods discussed herein are not limited to the deployment and use of an occluding device within any particular vessels , but can include any number of different types of vessels . for example , in some aspects , vessels can include arteries or veins . in some aspects , the vessels can be suprathoracic vessels ( e . g ., vessels in the neck or above ), intrathoracic vessels ( e . g ., vessels in the thorax ), subthoracic vessels ( e . g ., vessels in the abdominal area or below ), lateral thoracic vessels ( e . g ., vessels to the sides of the thorax such as vessels in the shoulder area and beyond ), or other types of vessels and / or branches thereof . in some aspects , the stent delivery systems disclosed herein can be deployed within superthoracic vessels . the suprathoracic vessels can comprise at least one of intracranial vessels , cerebral arteries , and / or any branches thereof . in some aspects , the stent delivery systems disclosed herein can be deployed within intrathoracic vessels . the intrathoracic vessels can comprise the aorta or branches thereof . in some aspects , the stent delivery systems disclosed herein can be deployed within subthoracic vessels . in some aspects , the stent delivery systems disclosed herein can be deployed within lateral thoracic vessels . the foregoing description is provided to enable a person skilled in the art to practice the various configurations described herein . while the subject technology has been particularly described with reference to the various figures and configurations , it should be understood that these are for illustration purposes only and should not be taken as limiting the scope of the subject technology . there may be many other ways to implement the subject technology . various functions and elements described herein may be partitioned differently from those shown without departing from the scope of the subject technology . various modifications to these configurations will be readily apparent to those skilled in the art , and generic principles defined herein may be applied to other configurations . thus , many changes and modifications may be made to the subject technology , by one having ordinary skill in the art , without departing from the scope of the subject technology . a phrase such as “ an aspect ” does not imply that such aspect is essential to the subject technology or that such aspect applies to all configurations of the subject technology . a disclosure relating to an aspect may apply to all configurations , or one or more configurations . an aspect may provide one or more examples of the disclosure . a phrase such as “ an aspect ” may refer to one or more aspects and vice versa . a phrase such as “ an embodiment ” does not imply that such embodiment is essential to the subject technology or that such embodiment applies to all configurations of the subject technology . a disclosure relating to an embodiment may apply to all embodiments , or one or more embodiments . an embodiment may provide one or more examples of the disclosure . a phrase such “ an embodiment ” may refer to one or more embodiments and vice versa . a phrase such as “ a configuration ” does not imply that such configuration is essential to the subject technology or that such configuration applies to all configurations of the subject technology . a disclosure relating to a configuration may apply to all configurations , or one or more configurations . a configuration may provide one or more examples of the disclosure . a phrase such as “ a configuration ” may refer to one or more configurations and vice versa . it is understood that the specific order or hierarchy of steps in the processes disclosed is an illustration of exemplary approaches . based upon design preferences , it is understood that the specific order or hierarchy of steps in the processes may be rearranged . some of the steps may be performed simultaneously . the accompanying method claims present elements of the various steps in a sample order , and are not meant to be limited to the specific order or hierarchy presented . as used herein , the phrase “ at least one of ” preceding a series of items , with the term “ and ” or “ or ” to separate any of the items , modifies the list as a whole , rather than each member of the list ( i . e ., each item ). the phrase “ at least one of ” does not require selection of at least one of each item listed ; rather , the phrase allows a meaning that includes at least one of any one of the items , and / or at least one of any combination of the items , and / or at least one of each of the items . by way of example , the phrases “ at least one of a , b , and c ” or “ at least one of a , b , or c ” each refer to only a , only b , or only c ; any combination of a , b , and c ; and / or at least one of each of a , b , and c . terms such as “ top ,” “ bottom ,” “ front ,” “ rear ” and the like as used in this disclosure should be understood as referring to an arbitrary frame of reference , rather than to the ordinary gravitational frame of reference . thus , a top surface , a bottom surface , a front surface , and a rear surface may extend upwardly , downwardly , diagonally , or horizontally in a gravitational frame of reference . furthermore , to the extent that the term “ include ,” “ have ,” or the like is used in the description or the claims , such term is intended to be inclusive in a manner similar to the term “ comprise ” as “ comprise ” is interpreted when employed as a transitional word in a claim . the word “ exemplary ” is used herein to mean “ serving as an example , instance , or illustration .” any embodiment described herein as “ exemplary ” is not necessarily to be construed as preferred or advantageous over other embodiments . a reference to an element in the singular is not intended to mean “ one and only one ” unless specifically stated , but rather “ one or more .” pronouns in the masculine ( e . g ., his ) include the feminine and neuter gender ( e . g ., her and its ) and vice versa . the term “ some ” refers to one or more . underlined and / or italicized headings and subheadings are used for convenience only , do not limit the subject technology , and are not referred to in connection with the interpretation of the description of the subject technology . all structural and functional equivalents to the elements of the various configurations described throughout this disclosure that are known or later come to be known to those of ordinary skill in the art are expressly incorporated herein by reference and intended to be encompassed by the subject technology . moreover , nothing disclosed herein is intended to be dedicated to the public regardless of whether such disclosure is explicitly recited in the above description . while certain aspects and embodiments of the subject technology have been described , these have been presented by way of example only , and are not intended to limit the scope of the subject technology . indeed , the novel methods and systems described herein may be embodied in a variety of other forms without departing from the spirit thereof . the accompanying claims and their equivalents are intended to cover such forms or modifications as would fall within the scope and spirit of the subject technology . | 0 |
in the case of the present invention , the offset of a current detecting portion ( current detecting circuit ) is automatically corrected . therefore , an extra circuit for adjustment is unnecessary while keeping a resolution necessary for control and it is possible to realize a controller for a high - performance and inexpensive electric power steering system because the adjustment of the circuit is unnecessary . when further improving the resolution of a current detecting circuit in order to realize a high - performance electric power steering system , an automatic correction is performed by software in the case of the present invention . therefore , this is a correction method also suitable for performance improvement because improvement of the resolution of a detecting circuit automatically improves a resolution of a correcting means . means for correcting an offset corrects the offset in accordance with the added value of a standard value ( reference value assumed for design ) according to a designed value and the difference between a measured offset value and the standard value . therefore , even if measurement of an offset fails or a step of correcting an offset is skipped , it is possible to prevent considerable deterioration of a performance . embodiments of the present invention are described below by referring to the drawings . [ 0031 ] fig4 is a block diagram showing a configuration of a first embodiment of the present invention , in which a steering torque signal t from a torque sensor 41 and a vehicle speed signal v from a vehicle speed sensor 42 are inputted to a current command computing portion 50 and a computed current command value is inputted to an adder - subtracter 51 . an output of the adder - subtracter 51 is inputted to a driving control means 52 and the driving control means 52 drives a motor 40 for generating an assist steering force of a steering system through a motor driving portion 60 . a motor current is detected by a current detecting portion 61 and a current detection signal is inputted to the adder - subtracter 51 . moreover , a measured offset value 53 according to a measurement result is inputted to an offset correcting portion 54 and the adder - subtracter 51 and a current detection signal from the current detecting portion 61 is offset - corrected . operations of the above configuration are described below by referring to the flowchart in fig5 . first , initialization is performed by software ( step s 1 ) and the motor driving portion 60 before being activated is stopped before supplying a current to the motor 40 after initialization is completed ( step s 2 ). under the stopped state , no current is run through the motor 40 . however , because the current detecting portion 61 is electrically kept turned - on , a current detection signal inputted to a cpu ( controller ) from the current detecting portion 61 becomes only an offset value of a circuit system . therefore , by reading the offset value converted to a / d , it is possible to obtain a measurement of an offset value , that is , a measured offset value ( step s 3 ). a correction value is generated in accordance with the measured offset value ( step s 4 ). the correction value directly serves as an offset value when the scale of a motor current value for normal control is equal to that of an inputted motor current value . then , normal control is started , the steering torque signal t from the torque sensor 41 is a / d - converted and inputted ( step s 10 ), failure diagnosis to check whether the signal t is an abnormal value is performed ( step s 11 ), and a current detection signal from the current detecting portion 61 is a / d - converted and inputted ( step s 12 ). then , a value obtained by subtracting a correction value of the offset correcting portion 54 from the current detection signal is used as a current detection signal ( control current value ) for control ( step s 13 ), and failure diagnosis to check whether the signal is an abnormal value is performed ( step s 14 ). moreover , a motor control signal is computed by using the inputted current detection signal ( control current value )( step s 15 ). the motor 40 is controlled in accordance with the computed motor control signal ( step s 16 ) and the step is returned to the above step s 10 . by repeating the above normal control , it is possible to perform the assist control of the electric power steering not influenced by the offset of the current detecting portion 61 . [ 0035 ] fig6 shows a second embodiment of the present invention in relation to fig4 which has a configuration of storing a measured offset value in a offset - value - storing portion ( such as a nonvolatile memory ) serving as an external storage device . in this case , because the offset value of hardware is decided when fabricated , measurement of an offset is stably performed under fabrication by using a configuration of storing a measured offset value only once under fabrication and it is possible to suppress the influence of disturbance ( noise or power source fluctuation , etc .) and realize stable correction at a high accuracy . operations of the second embodiment are described below by referring to the flowchart in fig7 . initialization is first performed by software ( step s 60 ) and a correction - value - stored flag is read from an offset - value - storing portion 58 ( step s 61 ) to determine whether a correction value is stored ( step s 62 ). when it is determined that the correction value is stored , an offset correction value is read and the step is skipped to step s 70 ( step s 68 ). however , when it is determined in step s 62 that the correction value is not stored , the motor driving portion 60 is stopped ( step s 63 ), an offset value is measured ( step s 64 ), a correction value is generated in accordance with the measured offset value ( step s 65 ), and the correction - value - stored flag is turned on ( step s 66 ). then , the correction value and correction - value - stored flag are stored in the offset - value - storing portion 58 ( step s 67 ). then normal control is started , the steering torque signal t is inputted ( step s 70 ), failure diagnosis is performed ( step s 71 ), and a current detection signal is inputted from the current - detecting portion 61 ( step s 72 ). a value obtained by subtracting the correction value from the current detection signal is used as a current control signal ( control current value ) for control ( step s 73 ) to perform the failure diagnosis to check whether the current control signal is an abnormal value ( step s 74 ). then , a motor control signal is computed by using the inputted current control signal ( step s 75 ) to control a motor in accordance with the computed motor control signal ( step s 76 ). by repeating the above normal control , it is possible to perform the assist control of the electric power steering not influenced by the offset of the current detecting portion 61 . [ 0039 ] fig8 shows a third embodiment of the present invention in relation to fig4 which is an example of performing offset correction by adding a standard offset value 56 according to a designed value and the difference 57 between a measured offset value and the standard offset value according to the designed value . the offset value used for correction in this embodiment includes a standard offset value according to a designed value which can be considered for design generated because the current detecting portion 61 is constituted by an analog circuit and an measured offset value generated due to the solid difference between devices . to constitute a high - performance electric power steering system , it is indispensable to obtain a high and stable performance by using high - accuracy components because the current detecting portion 61 becomes a very important portion . therefore , because a standard offset value which can be considered for design is large in the whole offset value , it is possible to prevent the whole system from being greatly damaged even if a trouble occurs in measurement of an offset due to power - source fluctuation or noises , etc . by separately correcting the standard offset value 56 in accordance with the designed value and the measured offset value 57 due to the solid difference by measurement . to realize the above configuration , it is naturally necessary to previously set an estimated maximum range for the offset measurement according to the solid difference and measure an offset value not coinciding with the range again or output a warning as a trouble . operations of the third embodiment are described by referring to the flowchart in fig9 . initialization is first performed by software ( step s 40 ), the motor driving portion 60 is stopped ( step s 41 ) and an offset value is measured ( step s 42 ) to generate a correction value in accordance with the difference 57 between the measured offset value and a standard offset value according to a designed value ( step s 43 ). then , normal control is started , the steering torque signal t is inputted ( step s 50 ), failure diagnosis to check whether the signal is an abnormal value is performed ( step s 51 ), and a current detection signal from the current - detecting portion 61 is inputted ( step s 52 ). a value obtained by subtracting “ correction value + standard offset value according to designed value ” from the current detection signal as a current detection signal ( control current value ) for control ( step s 53 ) to perform failure diagnosis to check whether the signal is an abnormal value ( step s 54 ). then , a motor control signal is computed by using the inputted current detection signal ( step s 55 ) to control the motor 40 in accordance with the computed motor control signal ( step s 56 ). by repeating the above normal control , it is possible to perform the assist control not influenced by the offset of the current - detecting portion 61 . [ 0043 ] fig1 shows a fourth embodiment of the present invention in relation to fig8 which is provided with an offset storing portion ( e . g . nonvolatile memory ) 58 for adding and correcting a standard offset value according to a designed value and the difference 57 between a measured offset value and the standard offset value according to the designed value as well as storing the difference 57 . operations of the fourth embodiment are described below by referring to the flowchart in fig1 . an initialization is first performed by software ( step s 20 ) and a correction - value - stored flag is read from an offset storing portion ( step s 21 ) to determine whether a correction value is stored ( step s 22 ). when it is determined that the correction value is stored , an offset correction value is read to skip to step s 30 ( step s 28 ). moreover , when it is determined in the above step s 22 that no corrected value is stored , the motor driving portion 60 is stopped ( step s 23 ) and an offset value is measured the same as the above described to generate a correction value in accordance with the measured offset value ( step s 25 ). the correction value is generated by computing the difference between a standard value according to a designed value and a measured offset value . moreover , the correction - value - stored flag is turned on ( step s 26 ) to store the correction value and correction - value - stored flag in a offset - value - storing portion 55 ( step s 27 ). then , normal control is started , the steering torque signal t is inputted ( step s 30 ), failure diagnosis to check whether the signal is an abnormal value is performed ( step s 31 ), and a current detection signal from the current detecting portion 61 is inputted ( step s 32 ). a value obtained by subtracting a correction value from the current detection signal is used as a current detection signal ( control current value ) for control ( step s 33 ). that is , the difference between the current detection signal and the added value of the correction value and a standard value according to a designed value is used as the control current value . then , failure diagnosis to check whether the control current value is an abnormal value is performed ( step s 34 ) and a motor control signal is computed by using the inputted control current value ( step s 35 ) to control the motor 40 in accordance with the computed motor control signal ( step s 36 ). by repeating the above normal control , it is possible to perform the assist control of electric power steering not influenced by the offset of the current - detecting portion 61 . as described above , by separately correcting a designed standard offset value and a measured offset value , it is possible to prevent a system from being damaged due to power - source fluctuation or noises , etc . moreover , there is an advantage that a measured offset value can be stored only once under a stable state in fabrication . because a measured offset value is generally smaller than a designed standard offset value , it is possible to prevent a system from being damaged even if write of an offset value fails in a production process or a step of writing an offset value is erroneously slipped by storing only a measured offset value and separately correcting the designed standard offset value and the measured offset value ( previously restricting the correction value of the measured offset value ). the present invention can be applied to every electric power - steering system independently of the type of an electric power steering system ( column type , pinion type , or rack type , etc .) and the type of a motor ( brush - provided motor or brushless motor , etc .). in the case of the present invention , the offset of a hardware - constituted current detecting portion is automatically corrected in accordance with a software technique . therefore , an extra circuit for adjustment while keeping the resolution necessary for control is unnecessary and it is unnecessary to adjust the circuit . thereby , it is possible to realize a controller for a high - performance and inexpensive electric power steering system . moreover , an offset is corrected in accordance with a value obtained by adding a standard value ( reference value assumed for design ) according to a designed value and the difference between a measured offset value and the standard value . therefore , even if measurement of an offset fails , it is possible to prevent a performance from being considerably deteriorated . furthermore , when separately correcting a designed standard offset value and a measured offset value , it is possible to prevent a system from being damaged due to power - source fluctuation or noises , etc . and it is enough to store the measured offset value only once under a stable state in fabrication . because a measured offset value is generally smaller than a designed standard offset value , only the measured offset value is stored and the designed standard offset value and measured offset value are separately stored in the case of the present invention . therefore , even if write of an offset value fails in a production process , it is possible to prevent a system from being damaged . moreover , it is possible to prevent a system from being damaged even if a step of writing an offset value is erroneously skipped . | 1 |
the present invention may be described herein in terms of functional block components , screen shots , optional selections , and various processing steps . it should be appreciated that such functional blocks may be realized by any number of hardware and / or software components configured to perform the specified functions . for example , the present invention may employ various integrated circuit components , e . g ., memory elements , processing elements , logic elements , look - up tables , and the like , which may carry out a variety of functions under the control of one or more microprocessors or other control devices . similarly , the software elements of the present invention may be implemented with any programming or scripting language such as c , c ++, java , cobol , assembler , perl , or the like , with the various algorithms being implemented with any combination of data structures , objects , processes , routines or other programming elements . further , it should be noted that the present invention may employ any number of conventional techniques for data transmission , signaling , data processing , network control , and the like . for a basic introduction to cryptography , please review a text written by bruce schneider which is entitled “ applied cryptography : protocols , algorithms , and source code in c ,” published by john wiley & amp ; sons ( second edition , 1996 ), which is hereby incorporated by reference . it should be appreciated that the particular implementations shown and described herein are illustrative of the invention and its best mode and are not intended to otherwise limit the scope of the present invention in any way . indeed , for the sake of brevity , conventional data networking , application development , and other functional aspects of the systems ( and components of the individual operating components of the systems ) may not be described in detail herein . furthermore , the connecting lines shown in the various figures contained herein are intended to represent exemplary functional relationships and / or physical couplings between the various elements . it should be noted that many alternative or additional functional relationships or physical connections may be present in a practical electronic transaction system . it will be appreciated that many applications of the present invention could be formulated . one skilled in the art will appreciate that the network may include any system for exchanging data or transacting business , such as the internet , an intranet , an extranet , wan , lan , satellite communications , and / or the like . the users may interact with the system via any input device such as a keyboard , mouse , kiosk , personal digital assistant , handheld computer ( e . g ., palm pilot ®), cellular phone , and / or the like . similarly , the invention could be used in conjunction with any type of personal computer , network computer , workstation , minicomputer , mainframe , or the like running any operating system such as any version of windows , windows nt , windows 2000 , windows 98 , windows 95 , macos , os / 2 , beos , linux , unix , or the like . moreover , although the invention is frequently described herein as being implemented with tcp / ip communications protocols , it will be readily understood that the invention could also be implemented using ipx , appletalk , ip - 6 , netbios , osi , or any number of existing or future protocols . moreover , the system contemplates the use , sale , or distribution of any goods , services , or information over any network having similar functionality described herein . the customer and merchant may represent individual people , entities , or businesses . although labeled as a “ bank ,” the bank may represent other types of card issuing institutions , such as credit card companies , card sponsoring companies , or third party issuers under contract with financial institutions . it is further noted that other participants may be involved in some phases of the transaction , such as an intermediary settlement institution , but these participants are not shown . each participant is equipped with a computing system to facilitate online commerce transactions . the customer has a computing unit in the form of a personal computer , although other types of computing units may be used , including laptops , notebooks , hand held computers , set - top boxes , and the like . the merchant has a computing unit implemented in the form of a computer - server , although other implementations are possible . the bank has a computing center shown as a main frame computer . however , the bank computing center may be implemented in other forms , such as a mini - computer , a pc server , a network set of computers , and / or the like . the computing units are connected with each other via a data communication network . the network is a public network and assumed to be insecure and open to eavesdroppers . in the illustrated implementation , the network is embodied as the internet . in this context , the computers may or may not be connected to the internet at all times . for instance , the customer computer may employ a modem to occasionally connect to the internet , whereas the bank computing center might maintain a permanent connection to the internet . it is noted that the network may be implemented as other types of networks , such as an interactive television ( itv ) network . the merchant computer and the bank computer are interconnected via a second network , referred to as a payment network . the payment network represents existing proprietary networks that presently accommodate transactions for credit cards , debit cards , and other types of financial / banking cards . the payment network is a closed network that is assumed to be secure from eavesdroppers . examples of the payment network include the american express ®, visanet ®, and the veriphone ® networks . the electronic commerce system is implemented at the customer and issuing bank . in an exemplary implementation , the electronic commerce system is implemented as computer software modules loaded onto the customer computer and the banking computing center . the merchant computer does not necessarily require any additional software to participate in the online commerce transactions supported by the online commerce system . a customer account number generally is between fifteen and nineteen digits long and is frequently a sixteen - digit credit card number . credit card numbers comply with a standardized format , usually having four spaced sets of numbers , as represented by the number “ 0000 0000 0000 0000 ”. the first five to seven digits are reserved for processing purposes and identify the issuing bank , card type and etc . the last , sixteenth digit is used as a sum check for the sixteen - digit number . the intermediary eight - to - ten digits are used to uniquely identify the customer . as will be appreciated by one of ordinary skill in the art , the present invention may be embodied as a method , a data processing system , a device for data processing , and / or a computer program product . accordingly , the present invention may take the form of an entirely software embodiment , an entirely hardware embodiment , or an embodiment combining aspects of both software and hardware . furthermore , the present invention may take the form of a computer program product on a computer - readable storage medium having computer - readable program code means embodied in the storage medium . any suitable computer - readable storage medium may be utilized , including hard disks , cd - rom , optical storage devices , magnetic storage devices , and / or the like . the present invention is described below with reference to block diagrams and flowchart illustrations of methods , apparatus ( e . g ., systems ), and computer program products according to various aspects of the invention . it will be understood that each functional block of the block diagrams and the flowchart illustrations , and combinations of functional blocks in the block diagrams and flowchart illustrations , respectively , can be implemented by computer program instructions . these computer program instructions may be loaded onto a general purpose computer , special purpose computer , or other programmable data processing apparatus to produce a machine , such that the instructions which execute on the computer or other programmable data processing apparatus create means for implementing the functions specified in the flowchart block or blocks . these computer program instructions may also be stored in a computer - readable memory that can direct a computer or other programmable data processing apparatus to function in a particular manner , such that the instructions stored in the computer - readable memory produce an article of manufacture including instruction means which implement the function specified in the flowchart block or blocks . the computer program instructions may also be loaded onto a computer or other programmable data processing apparatus to cause a series of operational steps to be performed on the computer or other programmable apparatus to produce a computer - implemented process such that the instructions which execute on the computer or other programmable apparatus provide steps for implementing the functions specified in the flowchart block or blocks . accordingly , functional blocks of the block diagrams and flowchart illustrations support combinations of means for performing the specified functions , combinations of steps for performing the specified functions , and program instruction means for performing the specified functions . it will also be understood that each functional block of the block diagrams and flowchart illustrations , and combinations of functional blocks in the block diagrams and flowchart illustrations , can be implemented by either special purpose hardware - based computer systems which perform the specified functions or steps , or suitable combinations of special purpose hardware and computer instructions . as background , fig1 illustrates an exemplary prior art method for conducting an online commercial transaction between individual users of a distributed computer network , such as the internet . initially , individual users contact each other over the network and agree to the terms of a transaction ( step 1 ). if the particular transaction is a sales transaction involving goods , for example , the purchaser mails a check , money order , or other suitable negotiable instrument to the seller ( step 2 ). once the seller receives the negotiable instrument , the seller deposits it with an appropriate financial institution , such as a bank ( step 3 ). when the bank clears the check through the seller &# 39 ; s account , the seller is given access to the funds ( step 4 ). the seller then ships the goods to the purchaser ( step 5 ), and the purchaser receives the goods ( step 6 ). generally , this process involves an elapsed time of approximately two to three weeks before the seller receives “ good funds ” for the transaction , and three to four weeks until the purchaser receives the goods . moreover , this process may include the purchaser disclosing his / her name and address to the seller to effect the transaction , and the purchaser has little or no recourse if either the seller fails to deliver the goods as promised or the goods are damaged or otherwise misrepresented . the present invention comprises systems , methods , and computer program products for facilitating commercial transactions between remote individuals , wherein the transactions often include person - to - person transfers of funds . in a preferred aspect , the present invention facilitates commercial transactions comprising sales transactions conducted between remote individuals , such as transactions between users of a distributed computer network . one skilled in the art will appreciate that the phrase “ person - to - person transfers of funds ”, as used herein , includes , for example , transfers from a financial account of a first party , which may be an individual or an entity , to the financial account of a second party , which may be an individual or an entity . one skilled in the art further will appreciate that a “ financial account ” or “ account ” can include a card account , a demand deposit account , a credit line , a money market account , a digital cash account , and / or any other financial account . thus , a person - to - person transfer of funds can include card to card transfers of monetary value , card to demand deposit account ( dda ) funds transfers , dda to card transfers , card to credit line transfers , credit line to card transfers , and / or the like . moreover , funds transfers in accordance with the present invention can be between financial accounts held with either the same financial institution or different financial institutions . a “ financial institution ”, as will be appreciated by one of ordinary skill in the art , can include any suitable third party , such as a bank , a card issuer , a lender , a credit union , and / or the like . further , as one skilled in the art will appreciate , a “ transaction card ” or “ card ”, as used herein , includes any device , code , or suitable financial instrument representing an account with a financial institution , such as a bank , a card issuer , and / or the like , wherein the device , code , or other suitable financial instrument has a credit line or balance associated with it , and wherein the credit line or balance is in a form of a financial tender having discrete units , such as currency . moreover , a “ transaction card ” or “ card ”, as used herein , includes any device , code , or financial instrument suitably configured to allow the cardholder to interact or communicate with the system , such as , for example , a charge card , credit card , debit card , prepaid card , telephone card , smart card , magnetic stripe card , bar code card , authorization / access code , personal identification number ( pin ), internet code , other identification code , and / or the like . additionally , a “ cardholder ” or “ cardmember ” includes any person or entity which uses a transaction card and participates in the present system and may include a person who is simply in possession of a financial account identifier , such as an authorization or account code . similarly , a “ demand deposit account ” may include any suitable financial account , such as a bank account ( e . g ., checking , savings , money market , credit line , etc .) or other financial account maintained by a third party ( such as a suitably insured financial institution ), such account preferably having a balance of substantially the same financial tender as the card . communication between the parties to the transaction and the system of the present invention is accomplished through any suitable communication means , such as , for example , a telephone network , intranet , internet , point of interaction device ( point of sale device , personal digital assistant , cellular phone , kiosk , etc . ), online communications , off - line communications , wireless communications , and / or the like . one skilled in the art will also appreciate that , for security reasons , any databases , systems , or components of the present invention may consist of any combination of databases or components at a single location or at multiple locations , wherein each database or system includes any of various suitable security features , such as firewalls , access codes , encryption , de - encryption , compression , decompression , and / or the like . while a person - to - person transfer may generically be described as a transfer from the financial account of a first party to a financial account of a second party , for convenience and purposes of brevity and consistency , the present disclosure generally refers to the first party as the purchaser and the second party as the seller . however , it will be recognized by those of ordinary skill in the art that the seller need not provide goods or services to the purchaser in exchange for the transfer of funds . while this often may be the case , the present disclosure is not so limited and includes transactions which may be gratuitous in nature , whereby the purchaser transfers funds from their financial account to the financial account of the seller without the seller providing any goods , services , or other value in exchange . in accordance with an aspect of the present invention , a person - to - person funds transfer may be facilitated by any suitable financial institution , such as a card issuer like american express ® company for example , which suitably provides credit risk analysis and fraud risk analysis in essentially real - time , unlike other card - based fund transfer schemes which rely on third parties to facilitate such services . utilization of third - party credit risk and fraud risk analyses , such as used in conventional funds transfer schemes , not only may increase the amount of time to process the funds transfer , but also may jeopardize the security of confidential information associated with the transaction due to the typical need for multiple transmissions of the relevant information . furthermore , by reducing the participants in the transaction and by enabling the card issuer to facilitate the funds transfer , certain transaction fees and / or costs may be reduced or avoided entirely because the card issuer is positioned to profit from the increased card use , rather than simply profiting from the fees associated with the manner in which the card is used by individual purchasers . in accordance with an aspect of the present invention , fig2 is a diagram illustrating an exemplary transaction system 200 . the transaction system 200 comprises a transaction mechanism or server 202 which facilitates and controls commercial transactions between a purchaser 204 and a seller 206 . in order to complete the funds transfer from the financial account of the purchaser 204 to the financial account of the seller 206 , the transaction mechanism 202 communicates with at least one of a seller &# 39 ; s financial institution 208 , which comprises a suitable financial account associated with the seller 206 , and a purchaser &# 39 ; s financial institution 210 , which comprises a suitable financial account associated with the purchaser 204 . in the case where the seller &# 39 ; s financial account comprises a demand deposit account , for example , the seller &# 39 ; s account can include , for example , a bank account , such as a savings , checking , or money market account associated with the seller 206 . in an exemplary embodiment , the communication link between the transaction mechanism 202 and the seller &# 39 ; s financial institution 208 can comprise a suitable connection to an automated clearinghouse ( ach ) for facilitating bank checking account transfers , as is well - known to those in the industry . in an exemplary embodiment , the purchaser &# 39 ; s financial institution 210 may comprise the transaction mechanism 202 . in another exemplary embodiment , transaction mechanism 202 is maintained by an independent third party , such as an intermediary 314 , as described more fully below with reference to fig3 . the communication links between and among the transaction mechanism 202 , purchaser 204 , seller 206 , seller &# 39 ; s financial institution 208 , and purchaser &# 39 ; s financial institution 210 can be implemented through one or more communications networks , such as a private extranet , a public internet , and / or a third party extranet , though it will be recognized by those skilled in the art that other networks such as a public switch telephone network ( pstn ) likewise may be utilized . moreover , although the present invention may be suitably implemented with tcp / ip protocols , it will be readily appreciated that the invention also can be implemented using ipx , appletalk , ip - 6 , netbios , osi , or any number of other protocols either currently known or hereafter devised . further , in another exemplary embodiment , purchaser 204 and seller 206 are implemented by any suitable type of personal computer , point of interaction device , network computer , workstation , minicomputer , mainframe , and / or the like , which implementation preferably includes a suitable browser application , such as a world wide web ( web ) browser , preferably having suitable encryption capability . in accordance with the present invention , it is preferred that either one or both of the purchaser 204 and seller 206 pre - register with the transaction mechanism 202 . however , as those skilled in the art will appreciate , a specific registration of the purchaser 204 and / or the seller 206 is not required and registration may take place at any suitable time , including at the time of the transaction . during purchaser registration , the purchaser 204 preferably provides suitable financial account information , such as card information for example , and suitable purchaser identification information . in an exemplary embodiment , the purchaser identification and / or account information includes any suitable information related to the purchaser and / or the account , such as any one or more of the following : name , address , demographic information , social security number , telephone number , account number , account expiration date , personal identification number associated with the account , date of birth , mother &# 39 ; s maiden name , spending habit information , billing history information , credit history information , and / or any additional information which might identify the purchaser and the purchaser &# 39 ; s financial account . the purchaser identification information can be used for subsequent purchaser authentication . during seller registration , the seller 206 preferably provides suitable financial account information and suitable identification information relating to an account , such as an appropriate card or demand deposit account for example , at the seller &# 39 ; s financial institution 18 . the seller &# 39 ; s identification information can be used for subsequent authentication . in an exemplary embodiment , one or both of the purchaser 204 and seller 206 are cardmembers or cardholders of the card issuer which is providing the transaction mechanism 202 , thereby expediting and streamlining the registration process and , in another exemplary embodiment , subsequent authentication and credit / fraud analysis processes performed by the transaction mechanism 202 . as illustrated in fig2 , a transaction 212 may be initiated by one of either the purchaser 204 or the seller 206 . the transaction 212 , which is illustrated in phantom lines in order to represent that it is optional , may comprise the exchange of goods , services , or other value from the seller 206 to the purchaser 204 in exchange for a transfer of funds from the purchaser &# 39 ; s financial account at the purchaser &# 39 ; s financial institution 210 to the seller &# 39 ; s financial account at seller &# 39 ; s financial institution 208 . however , it should be appreciated that transaction 212 need not comprise an exchange of goods and / or services , but rather , may comprise a gratuitous transfer of funds from a purchaser 204 to a seller 206 . by way of example , the purchaser 204 may be purchasing goods from the seller 206 which goods were identified through a classified ad , an internet posting , an internet auction , and / or the like , or , alternatively , the purchaser 204 may be transferring funds to the seller 206 for philanthropic , charitable , or other gift - giving purposes . thus , depending upon the nature of the transaction 212 , one of either the purchaser 204 or the seller 206 will initiate the transfer of funds by suitably providing to the transaction mechanism 202 transaction information . the transaction information may include identification information regarding one or both of the purchaser 204 and the seller 206 as well as the terms of the transaction , which can include suitable account information , the date and time of the transaction , the amount of the funds transfer , a description of the goods , services , or other value , any escrow terms ( such as a suitable escrow release event ), and / or the like . in addition , requests for value - added services , such as insurance , dispute resolution , postal tracking , and / or the like may be made by one or both of the purchaser 204 and / or the seller 206 . the transaction mechanism 202 then suitably authenticates the seller 206 and / or the purchaser 204 to ensure that they are the appropriate owners of their respective accounts . in an exemplary embodiment , the transaction mechanism 202 is provided by the purchaser &# 39 ; s financial institution 210 , such as the card issuer of a purchaser &# 39 ; s card for example , which financial institution is able to perform suitable risk management functions , such as suitable credit risk and / or fraud risk analyses for example . the ability of the transaction mechanism 202 , through a suitable financial institution which preferably maintains and operates the transaction mechanism 202 , to perform credit risk and fraud risk analyses is particularly advantageous , since performance of these services by a third party not only delays the transaction process but presents an additional security risk when transmitting and processing confidential or transaction - sensitive information to and from the third party . moreover , when the transaction mechanism 202 is provided by the purchaser &# 39 ; s financial institution 210 , such as a card issuer , information such as historical transactional records , account records , and / or the like easily can be reviewed to determine whether a credit or fraud risk exists . in another exemplary embodiment , the transaction mechanism 202 suitably determines whether the purchaser &# 39 ; s financial account has a sufficient balance to enable the funds transfer identified in the transaction information . if the purchaser 204 has sufficient funds available in the financial account , and suitable risk management and authentication processes do not result in a negative determination , the transaction is deemed acceptable . the transaction mechanism 202 then executes the transaction by debiting the purchaser &# 39 ; s financial account and crediting a suitable escrow account maintained by the transaction mechanism 202 . the funds debited from the purchaser &# 39 ; s financial account preferably remain in the escrow account for some predefined period of time . the predefined period of time may be based upon the occurrence of a suitably defined escrow release event , such as any of the following events : receipt by the purchaser of the goods , services , or other value ; the lapse of a predetermined period of time within which the purchaser may evaluate the goods , services , or other value and either accept or refuse delivery ; and / or any other suitable , predefined event . preferably , the transaction mechanism 202 withholds the funds from the seller &# 39 ; s financial account and suitably maintains the funds in the escrow account pending the occurrence of the escrow release event . debiting of the escrow account and crediting of the seller &# 39 ; s financial account for the amount of the funds transfer occurs once the escrow release event has transpired and the purchaser has not rejected the shipment . in another exemplary embodiment , the transaction mechanism 202 may be suitably configured to include a transaction fee in the amount debited from the purchaser &# 39 ; s financial account , and / or the transaction mechanism 202 may be suitably configured to subtract a transaction fee from the amount credited to the seller &# 39 ; s financial account . in an exemplary embodiment , the transfer of funds to the seller &# 39 ; s financial account from the escrow account includes suitable communications with an ach , as will be appreciated by one of ordinary skill in the art . in an exemplary embodiment , the transaction mechanism 202 provides value - added services which may be requested by the purchaser 204 and / or the seller 206 as a part of the transaction between the parties . preferably , the value - added services may include insurance , dispute resolution , postal tracking , and / or similar services that potentially enhance the value of the transaction to the purchaser 204 and / or the seller 206 . in the event that value - added services are requested by the purchaser 204 as a part of the funds transfer , then the cost of such services is included in the amount of funds debited or deducted from the purchaser &# 39 ; s financial account . likewise , the cost of value - added services requested by the seller 204 are suitably withheld or deducted from the funds credited or added to the seller &# 39 ; s financial account . in accordance with another aspect of the present invention , fig3 is a diagram illustrating an exemplary transaction system 300 . the transaction system 300 comprises an intermediary 314 which suitably provides an interface between the purchaser 304 and the seller 306 . the intermediary 314 can be any suitable third party . in an exemplary embodiment , intermediary 314 can include an online auction such as ebay ® or ewanted ®, an online merchant such as amazon . com ®, an online classified ad site , and / or the like . by way of example , if the intermediary 314 is ebay , the seller 306 may list goods for sale through the intermediary 314 , for which a purchaser 304 may then submit bids . the intermediary 314 then suitably determines whether the purchaser 304 submitted the highest bid and , if so , then makes a final sale determination , which can include sending appropriate notice , such as by e - mail for example , to both the purchaser 304 and the seller 306 . once notified , the purchaser 304 is provided with the opportunity to select means for submitting payment to the seller 306 , such as through a suitable card or dda . for example , by selecting the card payment method , transaction information regarding the sale is transferred by intermediary 314 to a suitable transaction mechanism 302 provided by a suitable financial institution , such as a card issuer as described above with reference to fig2 , the seller 306 preferably is pre - registered with the transaction mechanism 302 , and the seller &# 39 ; s financial account at the seller &# 39 ; s financial institution 308 may suitably receive appropriate funds transferred from the purchaser &# 39 ; s financial account at the purchaser &# 39 ; s financial institution 310 . if the purchaser 304 is not pre - registered , purchaser registration may take place at the time of the transaction with the seller 306 . as discussed above , the transaction mechanism 302 receives transaction information regarding the sale , authenticates the purchaser 304 and the seller 306 , and performs suitable credit and fraud risk management analyses . if the purchaser 304 has sufficient funds available in their financial account and the risk management and authentication processes do not result in a negative determination , then the transaction mechanism 302 deems the transaction acceptable and debits suitable funds from the purchaser &# 39 ; s financial account . preferably , as described above with reference to fig2 , a suitable escrow account maintained by the transaction mechanism 302 is credited with the funds transferred from the purchaser &# 39 ; s financial account . upon the occurrence of a suitably predefined or pre - identified escrow release event , the escrow account is suitably debited and the seller &# 39 ; s financial account is suitably credited with the funds . again , as described above , any suitable transaction or service fees are preferably included in the amount of funds debited and transferred from the purchaser &# 39 ; s financial account and / or deducted from the amount of funds disbursed and credited to the seller &# 39 ; s financial account . as is often the case with an intermediary 314 , such as ebay , the transaction between the seller 306 and the purchaser 304 may involve the shipment of goods from the seller 306 to the purchaser 304 . consequently , as typically determined by the particular business rules of the intermediary 314 , the goods are shipped by a suitable shipping agent 316 from the seller 306 to the purchaser 304 . preferably , as a part of the escrow service performed by the transaction mechanism 302 , a tracking number will be provided by the shipping agent to the transaction mechanism 302 . upon confirmation that the purchaser 304 has received the goods , the transaction mechanism suitably transfers the appropriate funds to the seller &# 39 ; s financial account . preferably , the shipping agent 316 confirms that the purchaser 304 has received the goods . more preferably , the transaction mechanism 302 only releases the funds to the seller 306 upon the suitable occurrence of any predefined escrow release event , such as the lapse of a specified period of time in which the purchaser 304 may evaluate and either accept or reject the goods . in the case that the escrow release event is not satisfied or that the purchaser 304 rejects the goods , the transaction may be suitably reversed or otherwise abandoned . in the event that there is a dispute between a purchaser 304 and a seller 306 regarding a particular transaction , the financial institution that maintains the transaction mechanism 302 may provide the parties with a suitable dispute resolution mechanism , such as access to any suitable system for providing customer service for example . in an exemplary embodiment , anonymity or portions of anonymity between the purchaser 304 and seller 306 is suitably maintained throughout the transaction between the parties . one skilled in the art will appreciate that any subset of information may remain anonymous . preferably , the only purchaser information that is transmitted and known to the seller 306 is the purchaser &# 39 ; s user identifier . likewise , it is preferred that the purchaser &# 39 ; s knowledge of the seller 306 is limited to the seller &# 39 ; s user identifier . in other words , both the purchaser 304 and the seller 306 need not disclose their name , address , financial account information , or any other confidential information to one another in order to effect the transaction . in this embodiment , the purchaser 304 and seller 306 suitably provide their name , address , financial account information , and any other necessary information to the transaction mechanism 302 upon registering with the transaction mechanism 302 . in this manner , the shipping agent 316 suitably obtains the relevant purchaser shipping information from the transaction mechanism 302 to obviate any need for a seller 306 to have access to confidential identification information of a purchaser 304 . it should be understood that while fig3 illustrates respective communication links between the transaction mechanism 302 and both the purchaser 304 and the seller 306 , the scope of the present invention extends to the transmission of information , such as registration information , transaction information , and / or the like , from either or both of the purchaser 304 and / or the seller 306 directly to the intermediary 314 and then from the intermediary 314 to the transaction mechanism 302 . in other words , the intermediary 314 may mediate the flow of information from either / both the purchaser 304 and / or the seller 306 to the transaction mechanism 302 without any direct communication between the either the purchaser 304 or the seller 306 and the transaction mechanism 302 . moreover , the intermediary 314 may communicate directly with the transaction mechanism 302 through a suitable communications link or , alternatively , the transaction mechanism 302 may be integrated with the intermediary 314 , as illustrated in the exemplary transaction system 400 of fig4 . in accordance with this aspect of the present invention , the transaction mechanism 402 , which is integrated with the intermediary 414 , provides substantially the same functionality as the exemplary transaction mechanisms described above with reference to fig2 and 3 , respectively . with reference to fig5 , an exemplary transactional mechanism 502 includes a central processor 504 in communication with other elements of the transaction mechanism 502 through a system interface or bus 506 . a suitable display device / input device 508 , such as a keyboard or pointing device in combination with a monitor , may be provided for receiving data from and outputting data to a user . a memory 510 associated with the transaction mechanism 502 preferably includes a transactional control module 512 , a risk management module 514 , and an authentication module 516 . the memory 510 preferably further includes an operating system 518 which enables execution by processor 504 of the various software applications residing at transaction control module 512 , risk management control module 514 , and authentication module 516 . operating system 518 may be any suitable operating system , such as any version of windows , macos , beos , linux , unix , and / or the like . preferably , a network interface 520 is provided for suitably interfacing with other elements of the transaction system , such as the elements described above with reference to fig2 - 4 . lastly , a storage device 522 , such as a hard disk drive for example , preferably contains suitable files which are suitably accessed by the transaction control module 512 , the risk management module 514 , and the authentication module 516 . in particular , customers &# 39 ; transaction records file 524 preferably comprises transaction information of customers who are registered with the transaction mechanism 502 , which transaction information is used to perform suitable credit risk and fraud risk analyses . likewise , customers &# 39 ; information records 526 comprises information received either from a purchaser or a seller upon registration with the transaction mechanism 502 or during the maintenance of the appropriate financial account . as used herein , a “ customer ” may be either a purchaser or a seller who has a financial account with the financial institution which suitably maintains the transaction mechanism 502 and who is registered with the transaction mechanism 502 . accordingly , providing the transaction mechanism 502 with access to the appropriate transaction records and information records of the parties involved in the funds transfer facilitates essentially real time risk management by the risk management module 514 . similarly , authentication of the parties to the transaction may likewise be performed efficiently by the authentication module 516 , which preferably has access to the records residing in storage device 522 . one skilled in the art will appreciate that the storage device 522 and , therefore , customer transaction records 524 and customer information records 526 may be co - located with the transaction mechanism 502 , as illustrated in fig5 , or may be remotely located with respect to the transaction mechanism 502 . if the storage device 522 is remotely located with respect to the transaction mechanism 502 , communication between storage device 522 and transaction mechanism 502 may be accomplished by any suitable communication link but is preferably accomplished through a private intranet or extranet . referring next to fig6 and 7 , as discussed , the process flows depicted in these figures are exemplary embodiments of the invention only and are not intended to limit the scope of the invention as described above . fig6 is a flow diagram representing an exemplary process for facilitating a commercial transaction between a purchaser and a seller . in accordance with the present invention , an exemplary process executed by a suitable transaction mechanism may include any of the following : registering a purchaser with the transaction mechanism ( step 602 ); registering a seller with the transaction mechanism ( step 604 ); receiving agreed upon transaction terms from at least one of a purchaser and a seller ( step 606 ); receiving a purchaser &# 39 ; s selection of a method for transferring monetary value to a seller ( step 608 ); receiving transaction information from at least one of a purchaser and a seller ( step 610 ); performing authentication , credit risk , and / or fraud risk analyses ( step 612 ); determining whether the transaction is acceptable ( step 614 ); terminating the transaction if the transaction is not acceptable ; debiting funds from a purchaser &# 39 ; s financial account if the transaction is acceptable ( step 616 ); holding the funds in an escrow account ( step 618 ); releasing the funds from the escrow account and disbursing the funds to the seller &# 39 ; s financial account ( step 620 ); and crediting the funds to a seller &# 39 ; s financial account ( step 622 ). in accordance with the present invention , any purchaser having a financial account can transfer funds from the purchaser &# 39 ; s financial account to the financial account of a second party . for example , a purchaser having a card can transfer funds from the purchaser &# 39 ; s card to the card or demand deposit account of any second party having such an account . as represented in fig6 by step 602 , the purchaser preferably pre - registers with a transaction mechanism , which transaction mechanism can be established and maintained by any suitable third party , such as a card issuer , as described above with reference to fig2 and 3 . to register with the transaction mechanism , the purchaser may submit suitable purchaser registration information , such as information establishing the identity of the purchaser and information regarding the purchaser &# 39 ; s financial account . the purchaser registration information can be suitably stored by the transaction mechanism , such as by storage device 522 of fig5 . the purchaser may communicate with the transaction mechanism by any means of communication known to those skilled in the art , including communications by telephone or through the use of any form of computer or point of interaction device having a means for communication , such as a modem , suitable wireless means for communication , and / or the like . if the transaction mechanism is maintained by the purchaser &# 39 ; s financial institution , the purchaser can suitably register with the transaction mechanism at the same time that the purchaser initially completes the application for the financial account . alternatively , the purchaser can register with the transaction mechanism at any suitable time , including at the time of a transaction with a seller . the purchaser registration information which may be used by the transaction mechanism can include any suitable information , such as any of the types of information described above with reference to fig2 . upon submission of such information to the transaction mechanism , the transaction mechanism may then issue to the purchaser a unique user identifier , such as an identification number , code , password , pass phrase , and / or other suitable identifier which may be used by the transaction mechanism to identify the purchaser . in this manner , the purchaser &# 39 ; s user identifier can be used by the transaction mechanism to identify and suitably access the purchaser &# 39 ; s registration information at the time of a transaction between a purchaser and a seller . the user identifier can comprise any number or combination of letters , digits , or other characters . if the transaction mechanism is accessible through the internet , and especially if the purchaser registers with the transaction mechanism through an interface at an internet web page , the transaction mechanism or entity maintaining the transaction mechanism can e - mail the appropriate user identifier to the purchaser , optionally using any well - known means for secure communications , such as suitable encryption . as indicated at step 604 , the seller preferably also registers with the transaction mechanism . although fig6 illustrates the registration of a seller with the transaction mechanism subsequent to the purchaser &# 39 ; s registration , the seller can register with the transaction mechanism at any suitable time , including prior to the purchaser &# 39 ; s registration and at the time of the transaction with the purchaser . as with the purchaser , the seller preferably provides the transaction mechanism with registration information to identify the seller and to identify the seller &# 39 ; s appropriate financial account , such as a card or a demand deposit account , to which the transaction mechanism may transfer funds . the seller &# 39 ; s registration information may include any suitable information , such as the seller &# 39 ; s name , location or address , social security number ( if appropriate ), federal employer identification number , financial account number , financial institution , and / or any other suitable information that may be pertinent to a funds transfer transaction . if the seller is associated with the financial institution that is providing the transaction mechanism , the seller &# 39 ; s registration information can be suitably stored by the storage device shown in fig5 . furthermore , as with the purchaser , the seller suitably receives from the transaction mechanism a user identifier which identifies the seller to the transaction mechanism . after the purchaser and seller are registered with the transaction mechanism , as illustrated in steps 602 and 604 , the purchaser and seller can suitably agree upon the terms of a transaction , as shown in step 606 . the transaction illustrated in step 606 may be an exchange of goods or services for value , although this is not required . the transaction , for example , could include a transaction where the purchaser is gratuitously transferring funds from the purchaser &# 39 ; s financial account to the financial account of the seller , thereby eliminating the need for a reciprocal exchange . the purchaser and seller may enter into the transaction through the internet , such as where a purchaser seeks to purchase goods , services , or other value from an internet web site operated by the seller for example . alternatively , the purchaser and seller can agree to enter into the transaction in a more conventional manner , such as through person - to - person communication over the telephone or in person for example . the particular terms of the transaction between the purchaser and the seller may include any suitable terms that are agreeable to the parties and may address issues such as the nature of any goods , services , or other value ; the amount of the funds that are to be transferred from the purchaser &# 39 ; s financial account to the seller &# 39 ; s financial account ; the nature and definition of any escrow release event ; the anticipated date or window for delivery or shipment of any goods , services , or other value ; and / or other suitable terms and conditions pertaining to the transaction . after the purchaser and seller have agreed upon the terms of the transaction , the purchaser may be requested to select a method for transferring suitable funds to the seller , as indicated in step 608 . the selection of a method for transferring the necessary funds may be completed through the transaction mechanism or , alternatively , through any other suitable means and then suitably communicated to the transaction mechanism . for instance , where the purchaser is purchasing goods , services , or other value from an online seller via an internet web site , the web site , rather then the transaction mechanism , can request that the purchaser select a method of transferring monetary value to the seller . after the purchaser suitably responds to the query , such as through a pop - up display generated by the internet site , the purchaser &# 39 ; s response may be suitably communicated to the transaction mechanism . alternatively , the purchaser can select a funds transfer method directly through the transaction mechanism , which may occur in the case where the particular internet site does not request such information but , rather , allows the transaction mechanism to issue the relevant query . additionally , the latter circumstance may occur in the case where a purchaser is transacting with a seller through a site which maintains the transaction mechanism , such as an online sales site maintained by a card issuer . in addition to selecting a method for transferring funds to a seller , such as through a card or dda transaction , the purchaser may also select one or more value - added services , as indicated in step 608 . for example , where the transaction mechanism is maintained by a card issuer , the purchaser may be able to select value - added services provided by the card issuer , such as purchaser &# 39 ; s insurance , shipping alternatives ( where the purchaser has purchased goods or , alternatively , services which may be embodied in documents of any suitable type ), postal tracking alternatives , dispute resolution to mediate any dispute that may arise between the purchaser and seller regarding the transaction , and / or the like . it will be appreciated by those of skill in the art that additional value - added services may be offered by the seller in addition to those offered by the third party entity maintaining the transaction mechanism . after selecting a funds transfer method and any value - added services , the purchaser and / or seller may provide suitable transaction information to the transaction mechanism for authentication , credit risk analysis , and / or fraud risk analysis , as represented in step 610 . the transaction information can include , but is not limited to , the amount of funds to be transferred between the purchaser and seller , the date and time of the transaction , a description of the transaction , the purchaser &# 39 ; s and seller &# 39 ; s respective unique user identifiers , and any other pertinent information which may suitably identify the transaction as well as both the purchaser and the seller . for example , the transaction information can include a date and time at which the transfer of funds should take place . in this manner , the purchaser and seller can indicate that the transfer of funds can take place at a specific time in the future . upon receiving the transaction information , the transaction mechanism can look - up and access the customer information records , which preferably include at least one of the purchaser &# 39 ; s and the seller &# 39 ; s registration and financial account information . as discussed above , this information preferably includes data such as the purchaser &# 39 ; s financial account identifier and / or the seller &# 39 ; s financial account identifier , as well as any additional information that has been suitably input in steps 602 and 604 , above . thereafter , as represented by step 612 , the transaction mechanism may suitably determine whether the transaction is acceptable . in an exemplary embodiment , one component of this determination utilizes the transaction information and the purchaser and / or seller registration information to execute a fraud analysis , as represented by step 614 . for example , where the transaction mechanism is established and maintained by a card issuer and the purchaser is a cardholder of a card issued by the card issuer , the card issuer can maintain a history of the purchaser &# 39 ; s card transactions . such card transaction history can be suitably stored along with the purchaser registration information in the customer information records or the customer transaction records , as described above . using this historical information , the risk management module of the transaction mechanism can perform a fraud analysis by executing a fraud detection program or mechanism to determine whether the current transaction , or current transaction in view of recent transactions , is indicative of fraud . for example , where a card has been utilized to purchase multiple high - priced items , the fraud analysis may flag the transaction such that the transaction mechanism will terminate or otherwise not permit the purchaser to complete the transaction . the fraud detection mechanism may suitably end the transaction , as represented by the negative outcome of step 612 , or , alternatively , may query the purchaser to determine whether the purchaser is actually the proper cardholder . in the case of terminating the transaction without presenting further queries to the purchaser , the purchaser and / or the seller may be contacted through any suitable means , such as a real time display , e - mail , telephone , and / or the like , to notify the purchaser and / or the seller that the transaction was not completed . the transaction mechanism &# 39 ; s determination regarding the acceptability of the transaction may suitably include a second component , namely a credit analysis , as represented by step 615 , which effects a comparison of the user identifiers of either / both the purchaser and the seller with the user identifiers stored in the storage device to determine whether the transaction is acceptable . after suitably identifying the accounts of the parties entering into the transaction , the transaction mechanism may suitably analyze whether the transaction is acceptable based upon additional criteria . the analysis for determining transaction acceptability can be suitably implemented through a computer - readable storage medium encoded with processing instructions , as described above . such analysis can include a determination of whether the purchaser has sufficient credit or funds in the financial account to complete the transaction . additionally , in the event that the purchaser uses a card to accomplish the funds transfer to the seller , the transaction mechanism may suitably terminate the transaction if it determines that the purchaser &# 39 ; s card has expired , has been reported as lost or stolen , or is otherwise invalid . where the transaction mechanism determines , through a program or any other suitable means , that the transaction cannot be completed properly , the transaction mechanism will not complete the transaction , as seen in the negative outcome of step 612 . when a negative outcome occurs , the purchaser and / or the seller may be contacted through any suitable means , such as a real time display , e - mail , telephone , and / or the like , to notify the purchaser and / or the seller that the transaction was not completed and to provide particular reasons for the termination of the transaction . once a transaction is deemed to be acceptable , the transaction mechanism suitably completes the transaction by debiting the purchaser &# 39 ; s financial account , as represented by step 616 . preferably , the transaction mechanism then transfers the funds to a suitable escrow account and holds the funds in the escrow account until a suitable escrow release event has transpired , as represented by step 618 . once the escrow release event has transpired , the funds are then released from the escrow account and disbursed to the seller &# 39 ; s financial account , as represented by step 620 . in accordance with the terms of the transaction as agreed to by the purchaser and the seller , the funds then are disbursed to the seller &# 39 ; s financial account and the seller &# 39 ; s account is suitably credited with the funds , as represented by step 622 . the transaction mechanism may automatically include any suitable transaction fees , as a service charge for the transaction , in the funds debited from the purchaser &# 39 ; s financial account and / or may automatically deduct such fees from the funds disbursed to the seller &# 39 ; s financial account . fig7 is a flow diagram of the operation of an exemplary transaction mechanism in accordance with the present invention . as described above with reference to fig6 , the transaction mechanism preferably first receives registration information from the purchaser and the seller , as indicated by steps 702 and 704 . registration information may be entered by a purchaser and / or a seller using any well - known input device , such as a keyboard or mouse suitably connected to any type of computer which can suitably communicate with the transaction mechanism . the registration information may then be transmitted to the transaction mechanism either in real time or downloaded to the transaction mechanism after the registration information is input by the purchaser and / or the seller . optionally , as is shown in step 706 , the transaction mechanism may receive an indication that a transaction between a purchaser and a seller has been initiated . this indication may originate from either the purchaser or the seller or , alternatively , from an intermediary , which may be unrelated to the entity which maintains the transaction mechanism . for example , a purchaser may choose to transfer funds using an interface located at an intermediary &# 39 ; s web site . this type of funds transfer might occur after the intermediary has suitably queried the purchaser as to the purchaser &# 39 ; s preferred funds transfer method , such as by issuing a query by using any of several conventional graphical interfaces or pop - up graphics that are well - known in the art . alternatively , the seller may suitably initiate the transaction . thereafter , as represented by step 708 , the transaction mechanism receives suitable information regarding the purchaser &# 39 ; s selected method for transferring funds to the seller , such as by a card or dda for example , and any selected value - added services , as described above . this step may be facilitated by any suitable mechanism , such as a suitable network connection , such as an internet connection , or through any suitable input device associated with the transaction mechanism . preferably , at least one of the purchaser and the seller provides suitable transaction information to the transaction mechanism for authentication , credit risk , and fraud risk analyses . once the transaction mechanism receives suitable transaction information , as represented by step 710 and as described in greater detail above , the transaction mechanism suitably determines whether the transaction is acceptable , as represented by step 712 . the fraud detection mechanism executed by the risk management module of the transaction mechanism then suitably communicates with the customer transaction records and customer information records to determine whether the transaction represents a potential fraud risk , as represented by step 714 and as described in greater detail above with reference to fig6 . after the fraud detection mechanism has been executed , the transaction mechanism may then suitably perform a credit analysis , as represented by step 715 , to compare the user identifiers of either / both the purchaser and the seller to the user identifiers stored in the storage device in an additional effort to determine whether the transaction is acceptable . as described above with reference to fig6 , after suitably identifying the accounts of the parties entering into the transaction , the transaction mechanism also may suitably determine whether the purchaser has sufficient credit or funds in the financial account to complete the transaction . additionally , in the case that the purchaser uses a card to effect the funds transfer to the seller , the analysis can further include a determination of whether the card has expired , has been reported as lost or stolen , or is otherwise invalid . where the transaction mechanism determines , through a program or any other suitable means , that the transaction cannot be completed properly , the transaction mechanism will not complete the transaction , as seen in the negative outcome of step 712 . when a negative outcome occurs , the purchaser and / or seller may be contacted through any suitable means , such as a real time display , e - mail , telephone , and / or the like , to notify the purchaser and / or the seller that the transaction was not completed and to provide particular reasons for the termination of the transaction . once the transaction is deemed acceptable , the transaction mechanism completes the transaction by debiting the purchaser &# 39 ; s account , as represented by step 716 . preferably , the transaction mechanism then transfers the funds to a suitable escrow account and holds the funds in the escrow account until a suitable escrow release event has transpired , as represented by step 718 . once the transaction mechanism receives information indicating that the escrow release event has transpired , as represented in step 720 , the funds are then released from the escrow account and disbursed to the seller &# 39 ; s financial account , as represented by step 722 . the transaction mechanism also may automatically account for any suitable transaction fees , as a service charge for the transaction , by suitably including any such fees in the funds debited from the purchaser &# 39 ; s financial account and / or by suitably deducting any such frees from the funds disbursed to the seller &# 39 ; s financial account . referring now to fig8 , another exemplary embodiment of the present invention includes an auction intermediary 814 , such as ebay , and a shipping service 816 , such as federal express ®, united parcel service ®, and / or any other suitable shipping service . in this embodiment , the seller 806 and / or the purchaser 804 initially register with the transaction mechanism 802 . preferably , the seller 806 lists goods for sale at the web portal provided by the auction intermediary 814 , which listing results in a bid on the goods submitted by a purchaser . the auction intermediary 814 then determines who has submitted the highest bid and notifies both the high - bidding purchaser and the seller . the purchaser 804 then selects a method for transferring suitable funds to the seller , such as by a suitable transaction card or dda . at the time of the transaction , the purchaser may also be presented with the option of selecting one or more value - added services . the purchaser transaction information is then suitably transmitted to the transaction mechanism 802 . likewise , the seller suitably provides the transaction mechanism 802 with suitable seller information for authentication purposes . the transaction mechanism 802 then performs suitable risk management analysis to determine whether the proposed transaction is associated with any credit and / or fraud risks . if the purchaser 804 has sufficient funds available to complete the transfer and if both the purchaser 804 and the seller 806 are authenticated ( and assuming that the credit and fraud risk analyses do not result in a negative determination ), then the transaction mechanism 802 suitably debits the purchaser &# 39 ; s card or dda by the amount of the purchase price as well as the cost of any selected value added services . the transaction mechanism 802 then sends a confirmation to the seller 806 that the purchaser &# 39 ; s account has been debited . preferably , the transaction amount then is suitably held in an escrow account maintained by the transaction mechanism , and once the shipping service 816 acquires the goods from the seller for shipment to the purchaser , the transaction mechanism 802 receives a tracking number from the shipping service 816 . depending upon the nature of the escrow , the transfer of funds to the seller &# 39 ; s card or dda will be delayed accordingly . for example , the escrow may be based upon a 3 - day waiting period following notification to the transaction mechanism 802 of the receipt of the goods by the purchaser 804 , which notification may be received directly from the purchaser 804 or from the shipping service 816 . accordingly , the transaction mechanism 802 disburses the appropriate funds to the seller &# 39 ; s dda ( minus any transactional fee ) at the seller &# 39 ; s bank , which suitably credits the funds to the seller &# 39 ; s financial account . if selected by either the purchaser or the seller , value - added services , such as purchaser &# 39 ; s insurance and dispute resolution , may be provided as needed . as will be appreciated by one skilled in the art , the present invention admits of various aspects which may be implemented in any of several ways . fig9 - 20 illustrate the flow of an exemplary transaction implemented in accordance with particular aspects of the present invention . however , it should be understood that this transaction flow is exemplary only and is not intended to limit the scope of the present invention as described above . with reference to fig9 , an exemplary user registration process 902 begins when an individual 904 , such as an internet user , accesses the transaction mechanism and requests registration with the transaction mechanism . internet user 904 may be either a potential purchaser or a potential seller . as illustrated in the exemplary interface of fig1 , an internet user may suitably register with the transaction mechanism by activating hyperlink 1002 , which activation preferably results in the display of the terms and conditions for registration and a request that an internet user input suitable registration information , as described in greater detail above . once an internet user 904 has registered with the transaction mechanism , the internet user 904 may then suitably request to be logged into the transaction system , as represented by step 906 of fig9 . as illustrated in the exemplary transaction mechanism main page of fig1 , an internet user may suitably request the login page by activating hyperlink 1102 , which activation preferably results in the display of a login page having suitable datafields . the datafields may request any suitable login information from an internet user . such login information may include , for example , a request for the internet user &# 39 ; s unique user identifier and a password or pass phrase . once the internet user submits the requested information , the internet user is suitably logged into the transaction system . if the internet user submits an invalid user identifier and / or password , an error message is suitably displayed , and the internet user is requested to re - enter and re - submit the information . once the internet user is logged into the transaction system , the transaction system retrieves the list of registered card and dda accounts held by the internet user and displays a suitable interface , such as the exemplary interface of fig1 , which may provide any suitable means for either conveying information to or receiving information from the internet user . as illustrated in the exemplary embodiment represented in fig1 , the transaction system preferably provides means for initiating a transaction , such as tab 1202 for example , and may suitably display the internet user &# 39 ; s transaction history , as represented by data table 1204 . suitable data access options , such as hyperlinks 1206 and 1208 , may be provided to enable the internet user to access any suitable information that may be provided by the transaction system , such as information pertaining to other registered financial accounts and / or means for registering additional financial accounts with the transaction mechanism . with momentary reference to fig9 , in an exemplary embodiment , internet user 904 may be either a seller 908 or a purchaser 910 . if internet user 904 is a seller 908 who is suitably registered and logged into the transaction system , the seller 908 may suitably initiate a transaction through the transaction mechanism . in an exemplary embodiment , there are preferably two aspects involved in a seller - initiated transaction . first , the seller 908 suitably creates a transaction invoice , as represented by step 912 . then , the purchaser 910 preferably confirms or accepts the transaction , as represented by step 914 . preferably , at any given point during the transaction , either the seller 908 or the purchaser 910 may either cancel ( step 916 ) or reverse ( step 918 ) the transaction . in the event that a purchaser 910 or a seller 908 experiences any difficulty with the transaction mechanism or if there is a dispute between the seller 908 and the purchaser 910 , a customer service representative 920 associated with the third party entity which is providing the transaction mechanism may suitably provide any desired customer service and / or dispute resolution ( step 922 ). fig1 next illustrates an exemplary process for initiating a commercial transaction between a seller and a purchaser . in this exemplary embodiment , a seller - initiated transaction preferably begins when the seller submits a request to start a transaction , such as by activating tab 1202 of fig1 . once the transaction mechanism receives the request , the transaction mechanism determines whether the seller is a registered user ( step 1304 ). if the seller is not a registered user , the transaction mechanism provides a suitable registration interface ( step 1306 ), such as described above with reference to fig1 . if the seller is a registered user , the transaction mechanism provides a suitable means for initiating the transaction ( step 1308 ), such as by providing the exemplary interface of fig1 . the seller then suitably provides the information requested by the transaction mechanism ( step 1310 ). for example , the seller enters the appropriate information which may be requested by various transaction datafields provided by the transaction mechanism through a suitable user interface , such as the exemplary transaction invoice entry page 1400 of fig1 . the transaction datafields provided by a suitable transaction entry interface may include suitable datafields of any number or form , such as , for example , a datafield 1402 for a prospective purchaser &# 39 ; s email address ; a datafield 1404 indicating a final date for the acceptable transfer of funds to the seller ; a datafield 1406 for indicating the seller &# 39 ; s reference number ; a datafield 1408 for a transaction description , such as the identification of any intermediary , like ebay , which may be involved in the transaction ; datafields 1410 for a description of the particular items that will be the subject of the transaction ; datafields 1412 for indicating the appropriate quantity of each item described in datafield 1410 ; datafields 1414 for indicating the appropriate price for each item described in datafield 1410 ; datafields 1416 for indicating the subtotal amount or extended price associated with the quantity and price for each item described in datafield 1410 ; a datafield 1418 for indicating a suitable cost for any desired value - added services , such as insurance , dispute resolution , postal tracking , or any other suitable value - added service ; a datafield 1420 for indicating the cost associated with any shipping and handling charges ; datafield 1422 for indicating any miscellaneous charges that may be associated with the transaction , such as any applicable taxes for example ; and a datafield 1424 for indicating a total charge or total amount of funds to be transferred from the purchaser to the seller upon completion of the transaction . additional information that may be requested from the internet user may include the email address of the internet user , any optional email message intended for the purchaser , and / or any other suitable information . additionally , a suitable transaction entry interface may include any number or form of tabs , such as tab 1426 which activates the creation of additional datafields 1410 . the additional tab or tabs may be used by the seller to activate or implement any suitable function which may further facilitate the transaction between the seller and the purchaser . for example , transaction invoice entry page 1400 may also include an additional datafield , or tab for accessing an additional datafield , which may request that the seller provide suitable information regarding an escrow release event . such escrow release event information may include a particular time period within which a purchaser may either accept or reject any items prior to the transfer of funds from the escrow account to the seller &# 39 ; s account , such as a particular number of days after the purchaser receives goods , services , or other value from a suitable shipping agent . in addition to entering the appropriate information which may be requested by the various transaction datafields provided by the transaction mechanism , the seller preferably is further requested to select a suitable financial account which will ultimately receive the funds transferred from the purchaser at the completion of the transaction . preferably , the various options presented to the seller on the transaction entry interface reflect the financial account or accounts provided by the seller during the seller &# 39 ; s registration with the transaction mechanism , as described above . the financial account selection options may include any suitable selection options which provide the transaction mechanism with the appropriate information . as illustrated in exemplary transaction invoice entry page 1400 , financial account selection options may include selection options 1428 and 1430 which preferably indicate the type of financial account 1428 , such as a credit card or a demand deposit account ( dda ), and the financial account identifier 1430 , such as a credit card number or a dda number . as one skilled in the art will appreciate , the above described transaction entry interface , as well as any or all other aspects of the present invention , may include any suitable form of encryption and / or other security measures either currently known or hereafter devised . once the seller completes a suitable transaction entry interface , the seller may either submit or cancel the transaction invoice entry ( step 1312 ). if the seller cancels the transaction invoice entry , such as by activating tab 1432 of fig1 , the seller is returned to the transaction mechanism main page ( step 1314 ), such as the exemplary transaction mechanism main page illustrated in fig1 . if the seller submits the transaction invoice entry page to the transaction mechanism by activating , for example , a suitable tab , such as tab 1432 , or by pressing the enter key on a suitable input device , a transaction invoice is then displayed by the transaction mechanism ( step 1316 ). the transaction invoice may include any suitable information entered by the seller on the transaction entry interface and any other relevant information , such as any transaction or service fees charged by the transaction mechanism . as illustrated in the exemplary transaction invoice 1500 of fig1 , such information may include any or all of the entries corresponding to the datafields described above with reference to fig1 . in addition , the transaction invoice may include an invoice number 1536 which may be automatically assigned by the transaction mechanism ; an additional service fee amount 1538 which may be suitably deducted from the amount of funds transferred from the purchaser ; a total amount 1540 , net of fees , owed to the seller at the completion of the transaction ; the date 1542 that the transaction invoice was created ; and a status indicator 1544 , which may include any suitable indicator of any suitable status that may be relevant to the transaction as of the display date of the transaction invoice , such as any of the exemplary status indicators illustrated beneath status key 1546 ( i . e ., paid , waiting on purchaser , declined by purchaser , and expired ). after the seller completes a review of the transaction invoice , the seller may either decline or accept the transaction invoice ( step 1318 ). if the seller declines the transaction invoice , such as by suitably activating tab 1548 of fig1 for example , a suitable transaction interface is displayed ( step 1319 ), such as exemplary cancel transaction page 1600 of fig1 , which may provide suitable means , such as tabs 1602 and 1604 , for either initiating a new transaction or returning to the transaction mechanism main page . if the seller accepts the transaction invoice , such as by suitably activating tab 1550 of fig1 or pressing the enter key on a suitable input device for example , the transaction invoice is suitably stored by the transaction mechanism in a suitable storage device ( step 1320 ). then , the transaction invoice is preferably transmitted to both the purchaser and the seller by any suitable method , such as by email , facsimile , mail , and / or the like ( step 1322 ). preferably , the transaction invoice is transmitted via email to the respective email addresses of the purchaser and the seller . once the seller &# 39 ; s transaction invoice is transmitted to the purchaser , the transaction may be suitably completed when the purchaser accepts the transaction . in the exemplary embodiment illustrated by the flowchart of fig1 , when the purchaser receives a transmission from the transaction mechanism regarding the transaction invoice ( step 1702 ), such as an email transmission having a hyperlink to a suitable purchaser transaction interface , the purchaser may follow the link to the transaction interface ( step 1704 ), such as the exemplary purchaser transaction review page 1800 of fig1 , to review the terms and conditions of the transaction as set forth by the seller . as illustrated in fig1 , a purchaser may accept a transaction by one of at least three methods , wherein the methods are indicated by phantom lines to represent the purchaser &# 39 ; s optional courses of action . first , the purchaser may accept the transaction using a suitable card without logging into the transaction system ( step 1706 ). second , the purchaser may accept the transaction by suitably logging into the transaction system and selecting a suitable card to transfer funds to the seller ( step 1708 ). finally , the purchaser may accept the transaction by suitably logging into the transaction system and selecting a suitable dda to transfer funds to the seller ( step 1710 ). in the first case , the purchaser accepts the transaction with a suitable card without logging into the transaction system . if the transaction terms and conditions are acceptable to the purchaser , the purchaser suitably completes the purchaser transaction review page ( step 1706 ) by providing information regarding the purchaser &# 39 ; s card to effect a suitable transfer of funds from the purchaser &# 39 ; s card account to the financial account of the seller . as illustrated in exemplary purchaser transaction review page 1800 of fig1 , the purchaser enters the appropriate information which may be requested by various transaction datafields provided by the transaction mechanism on the purchaser transaction review page 1800 . the transaction datafields provided by the purchaser transaction review page may include suitable datafields of any number or form , such as , for example , a datafield 1802 for the purchaser &# 39 ; s name as it appears on the card ; a datafield 1804 for indicating a card account number ; a datafield 1806 for providing a card identification number , such as the four digits that are frequently printed on the card above the card number ; and datafields 1808 for indicating the card &# 39 ; s expiration date . additionally , purchaser transaction review page 1800 may include any number or form of additional tabs or datafields . the additional tabs or datafields may be used by the purchaser to implement any suitable function which may further facilitate the transaction between the seller and the purchaser . for example , purchaser transaction review page 1800 may also include an additional datafield , or tab for accessing an additional datafield , which may permit the purchaser to provide or modify information regarding an escrow release event . such escrow release event information may include a particular time period within which a purchaser may either accept or reject any items prior to the transfer of funds from the escrow account to the seller &# 39 ; s account , such as a particular number of days after the purchaser receives goods , services , or other value from a suitable shipping agent . if a purchaser modifies or adds information to the purchaser transaction review page , such as modifying or adding information regarding an escrow release event , the transaction flow as described herein preferably includes an additional communication or transmission of the transaction terms to the seller so that the seller is given a suitable opportunity to either accept or decline the modified terms and conditions of the transaction . after the purchaser has suitably entered the requested information , the purchaser suitably submits the purchaser transaction review page to the transaction mechanism , such as by activating tab 1810 or pressing the enter key on a suitable input device for example . once the purchaser &# 39 ; s card information profile has been completed and the purchaser transaction review page is submitted , the transaction mechanism displays a suitable transaction invoice , such as exemplary purchaser transaction invoice 1900 of fig1 a and 19b . at this point , the purchaser may either accept or decline the transaction ( step 1712 ). if the purchaser declines the transaction , such as by suitably activating tab 1902 of exemplary purchaser transaction invoice 1900 , a suitable interface is displayed ( step 1714 ), such as exemplary purchaser decline transaction page 2000 of fig2 , which may provide any suitable information or means for acquiring information , such as tabs 2002 and 2004 . if the purchaser accepts the transaction , the transaction mechanism performs a suitable card authorization / authentication routine , which may include suitable credit risk and fraud risk analyses ( step 1716 ). if the transaction is unacceptable , either due to a potential fraud risk or a credit risk , the transaction mechanism cancels the transaction and suitably notifies , such as by email , both the purchaser and the seller ( step 1718 ). if the transaction is acceptable , the transaction mechanism suitably debits the purchaser &# 39 ; s account . preferably , the transaction mechanism then credits an appropriate escrow account ( step 1720 ), pending notification by either the purchaser and / or a shipping agent that any defined escrow release event has transpired ( step 1722 ). if the defined escrow release event transpires , the transaction mechanism suitably disburses the appropriate funds to the seller &# 39 ; s financial account ( step 1726 ) and notifies both the purchaser and the seller that the transaction has been completed ( step 1728 ). however , if an escrow release event has been defined during the transaction by either the transacting parties or a suitable third party and the escrow release event is not satisfied , the transaction mechanism either reverses the transaction , such as by performing a suitable chargeback or some other suitable transaction reversal procedure , or follows a suitable dispute resolution protocol , as described above ( step 1724 ). as illustrated in phantom lines in order to represent alternative process flows , if any dispute between the parties is favorably resolved , suitable funds may be disbursed to the seller ( step 1726 ) and the parties may be notified of the completion of the transaction ( step 1728 ). however , if any dispute is not favorably resolved , or if the most appropriate resolution is cancellation of the transaction , the transaction is suitably terminated or otherwise reversed , and the purchaser and seller are suitably notified of the termination and / or reversal of the transaction ( step 1728 ). in the second case , the purchaser accepts the transaction by logging into the transaction system and selecting the option of transferring funds to the seller from the purchaser &# 39 ; s card ( step 1708 ). alternatively , the purchaser accepts the transaction by logging into the transaction system and selecting the option of transferring funds to the seller from the purchaser &# 39 ; s dda ( step 1710 ). in either of these situations , the transaction mechanism suitably processes the purchaser &# 39 ; s login request and determines whether the purchaser is a registered user ( step 1730 ). if the purchaser is not a registered user , the transaction mechanism provides a suitable registration interface ( step 1732 ), such as described above with reference to fig1 . if the purchaser is a registered user , the transaction mechanism then performs steps 1712 through 1728 , as described above . although the foregoing describes an exemplary seller - initiated transaction , one skilled in the art will appreciate that the present invention is not so limited and may be readily implemented by means of any suitable purchaser - initiated transaction or , alternatively , any suitable third - party - initiated transaction , such as an intermediary - initiated transaction . as one skilled in the art will appreciate , the transaction mechanism of the present invention may be suitably configured in any of several ways . it should be understood that the transaction mechanism described herein with reference to fig2 is but one exemplary embodiment of the invention and is not intended to limit the scope of the invention as described above . fig2 illustrates an exemplary transaction mechanism 2100 comprising a c2c service 2104 ; a transaction manager 2106 ; a business rules engine 2108 ; an express net interface manager 2110 ; an emailers engine 2112 ; an ssl gateway interface manager 2114 ; a c2c logging engine 2116 ; and a financial transaction submission daemon 2118 . the c2c service 2104 suitably processes initial transaction requests from internet users 2102 . exemplary processes performed by the c2c service 2104 include requesting transaction information , such as card and / or dda information , from an internet user 2102 who has logged into the transaction system ; validating the data entered by an internet user 2102 ; and submitting a completed transaction invoice to the transaction manager 2106 . the c2c service 2104 communicates with the other components of the system through any suitable communications link , including a network connection such as an intranet , extranet , and / or the like . the transaction manager 2106 performs a variety of processes which facilitate a transaction between a seller and a purchaser . these processes may include creating transaction invoices and managing them , including updating a particular transaction invoice at the various stages of the transaction process ; sending emails to sellers and purchasers using the e - mailers engine 2112 ; and processing requests from the virtual point of sale ( vpos ) capture daemon for transactions which are eligible for submission to the financial capture systems , as described in greater detail below . the business rules engine 2108 preferably provides access to a variety of operating standards that may be applied to any given transaction between a seller and a purchaser . the applicable operating standards may include , but are not limited to , any of the following : ( 1 ) given a transaction type and a transaction , business rules engine 2108 may return a suitable pricing model to be applied to the transaction ; ( 2 ) business rules engine 2108 may compute a transaction fee based upon a certain number of basis points , which preferably is a configurable parameter generated from a suitable fee table ( for example , one basis point = 0 . 01 %, so 375 bp = 3 . 75 % of the total price of the transaction ); ( 3 ) business rules engine 2108 may apply a flat transaction fee ; and / or ( 4 ) given a transaction and a transaction type , business rules engine 2108 may apply a fraud model to the transaction , wherein the exemplary fraud model may include any of the following : ( a ) authorization for the purchaser &# 39 ; s part in the transaction , including billing address verification and 4 dbc verification of the purchaser ; ( b ) verification of a lack of any relationship between the purchaser and the seller , wherein all transactions showing a relationship ( such as “ self ” or other personal relationship ) between the purchaser and the seller may be “ failed ” or otherwise terminated ; ( c ) application of a 3 - strike rule , wherein the transaction is failed or terminated if a 3 rd attempt to authorize the transaction fails and an email is sent to the seller providing an explanation for the cancellation of the transaction ; and ( d ) verification that the transaction amount has not exceeded any prescribed limits , such as a limit on the transaction amount and / or a limit regarding the maximum number of transactions that may be conducted between a first party and any other party during some defined period of time ( such as per day , per week , per month , etc .). preferably , any applicable transaction limits are provided as configurable parameters by the business rules engine 2108 . in the case of both verification of the purchaser &# 39 ; s billing address and verification of purchaser / seller non - relationship , a ‘ system not available ’ response is possible , in which case the business rules engine 2108 may recommend either a time - out or that the transaction be terminated . preferably , the non - relationship verification is the first process sent to the credit authorizations system ( cas ) from the transaction mechanism 2100 , since the data for this process preferably is contained within the cas rather than a separate cardmember system ( ims , triumph ). the cas is an online system which analyzes charge requests and either approves the charge requests or refers them to an authorizer for a decision . cas preferably contains a negative file , a delinquency file , and an accumulative file . if the purchaser and seller pass the non - relationship verification , then an authorization request ( with aav and 4 dbc ) is sent . the authorization request preferably involves cas accessing a suitable cardmember system to verify the billing address . the express net interface manager 2110 communicates with the express net , the utility which processes user registration and manages the accounts of registered users . the express net interface manager 2110 accesses the express net and acquires any suitable user data which may be desired to process a particular pending transaction . preferably , the express net interface manager 2110 acquires a list of the internet user &# 39 ; s registered cards and / or ddas as well as other unique data pertaining to the internet user 2102 , wherein the exemplary information may be used to process the transaction . the emailers engine 2112 preferably sends suitable email notifications and / or confirmations to both the seller and the purchaser in the case of either a merchandise transaction or a transfer of funds . for example , the emailers engine 2112 may send an email comprising a notification which may : ( 1 ) notify a purchaser , preferably with an encrypted url , of a transaction or funds transfer initiated by a seller and provide suitable means for the purchaser either to accept or decline the transaction or funds transfer ; ( 2 ) copy the seller on the notification sent to the purchaser ; and / or ( 3 ) indicate to both a seller and a purchaser that the purchaser has either accepted or declined a transaction or transfer of funds . the ssl gateway interface manager 2114 preferably communicates with the ssl gateway , which preferably includes a payment gateway client class and a cas authentication component . the ssl gateway is a message and file distribution system which accepts authorization requests online and distributes those authorization requests to the proper authorization system . the payment gateway client class preferably processes all of the protocol and transport level responsibilities that are may be used for communicating with the payment gateway server , which operates as a part of the ssl gateway . preferably , the defined protocols include the addition of a mime header to all xml messages sent to the payment gateway and the use of tcp / ip sockets for communication with the payment gateway . the cas authentication component preferably is responsible for performing the cas financial authorization processes ( iso8583 ) as well as performing the cas non - relationship verification processes based upon the new iso message . the c2c logging engine 2116 preferably audits and error logs all events in the transaction system 2100 . preferably , the c2c logging engine 2116 logs errors in the transaction system 2100 into a flat file . preferably , the ca unicenter agent for production support uses this flat file . the financial transaction submission daemon 2118 preferably submits each transaction &# 39 ; s financial transaction record , such as a credit and / or debit virtual point of sale ( vpos ) record that results from a particular card to card or card to dda transaction , to a vpos acceptance system 2202 via the ssl gateway 2204 , as better seen in fig2 . preferably , each individual financial transaction record is submitted to the vpos acceptance system as it is received , without being processed as part of a batch file . the vpos acceptance system receives the financial transaction record , formats the financial capture file , and forwards the financial capture file to the ssl gateway . the ssl gateway then forwards the financial capture file to the appropriate financial capture system . the submission of the financial transaction record preferably is based upon a message - based protocol that is implemented by the vpos acceptance system . although the invention has been described herein as facilitating commercial transactions between parties residing at remote locations , one of ordinary skill in the art will appreciate that the invention is not so limited and includes the facilitation of commercial transactions between co - located parties . it should be understood , however , that the detailed description and specific examples , while indicating exemplary embodiments of the present invention , are given for purposes of illustration only and not of limitation . many changes and modifications within the scope of the instant invention may be made without departing from the spirit thereof , and the invention includes all such modifications . the corresponding structures , materials , acts , and equivalents of all elements in the claims below are intended to include any structure , material , or acts for performing the functions in combination with other claimed elements as specifically claimed . the scope of the invention should be determined by the appended claims and their legal equivalents , rather than by the examples given above . for example , the steps recited in any method claims may be executed in any order and are not limited to the order presented in the claims . moreover , no element is essential to the practice of the invention unless specifically described herein as “ critical ” or “ essential ”. | 6 |
the particulars described herein are by way of example for purposes of discussion of the illustrated embodiments of the present invention in order to provide what is believed to be a useful and readily understood description of the principles and conceptual aspects of the invention . no attempt is made to show structural aspects of the invention in more detail than is necessary for a fundamental understanding of the invention . the invention may be implemented in various different embodiments of a device for converting external stimuli in the form of kinetic energy from the surrounding environment into electrical energy . the embodiments are described below in the context of the source of kinetic energy being vibrations caused by normal operations associated with creation and production of a petrochemical recovery well , fluid flow through a borehole , or both . however , the invention is not limited to petrochemical wells . referring to fig1 , a first exemplary embodiment of an energy harvesting device includes an energy conversion module ( 100 ) which is connected to an anchor member ( 102 ) via a flexure ( 104 ). the energy conversion module ( 100 ) operates by using vibrations to cause motion of magnets with respect to coils , thereby inducing electrical current . the harvested vibrations may be caused by one or more types of potential sources . a first type of source is acoustic vibrations transmitted through the wall ( 106 ) to the energy conversion module ( 100 ) via the anchor ( 102 ) and flexure ( 104 ). these vibrations may be caused by operation of equipment such as pumps and bhas . a second type of source is the flow of fluid ( 110 ) around the energy harvesting device . the fluid flow may be caused by pumping or natural pressure differential . the anchor member ( 102 ) functions to secure the energy harvesting device to a surface of the surrounding environment , such as the inner wall ( 106 ) of a borehole , casing or production tubing . the anchor ( 102 ) may include an array of protruding tabs ( 108 ) disposed in a circle , the tips of which define a slightly greater diameter than the borehole or casing in which the energy harvesting device is being mounted . this configuration provides a friction fit against the borehole or pipe wall in order to temporarily or permanently anchor the energy harvesting device in place . fluid flow is permitted between adjacent tabs ( 108 ). although the anchor maintains a fixed in position in the borehole , vibrations may be transmitted to the flexure ( 104 ) from the wall ( 106 ) through the anchor . features of the anchor member could be as described in anchor system and method , us published application 20070256827 , ser . no . 11 / 273 , 758 , filed nov . 15 , 2005 , which is incorporated by reference . referring now to fig1 and 2 , the coils ( 200 ) and magnets ( 202 ) may be disposed in parallel planes within a housing ( 203 ) of the energy conversion module ( 100 ). in the illustrated example , the magnets ( 202 ) are held in a fixed position relative to each other by a plate ( 204 ). the plate is connected to the protective housing ( 203 ) by linear slide tracks which permit the magnets ( 202 ) to move in one dimension relative to the coils ( 200 ) as the energy conversion module moves , i . e ., vibrates , relative to the anchor . note that the relative motion of the magnets and coils is not necessarily similar to the relative motion of the energy conversion module relative to the anchor . in fig1 , the motion of the magnets ( 202 ) relative to the coils ( 200 ) is linear even if the motion of the energy conversion module relative to the anchor is non - linear . thus , in response to kinetic energy in the form of either vibrations transmitted through the wall , or movement of fluid around the energy conversion module , or both , the coils move relative to the magnets , resulting in generation of electrical current . it should be noted that either the coils , the magnets , or both the coils and magnets could be caused to move while the other is maintained in a fixed position . the flexure ( 104 ) and energy conversion module ( 100 ) may be selected to tune the energy harvesting device to the source of vibrations in order to enhance energy conversion efficiency . although the anchor position is fixed , within the parameters of the deflection characteristics of the flexure ( 104 ), the energy conversion module ( 100 ) is free to move , i . e ., the flexure functions as a cantilever . due to uneven distribution of force of the flowing fluid on the energy harvesting module , or the transmission of vibrations to the energy harvesting module through the wall , anchor and flexure , or both , the energy conversion module can exhibit an oscillatory motion relative to the anchor . depending on the implementation , the oscillatory motion may be one , two or three dimensional . the characteristics of the oscillatory motion of the energy conversion module are a function of the shape of the energy conversion module housing ( 203 ), the length of the flexure ( 104 ), the rigidity and resilience of the flexure , and other factors . these factors may be considered when designing an energy harvesting module for a particular purpose in order to efficiently produce a desired amount of electrical energy composed of a given range of current and voltage . for example , the force versus range characteristic of the flexure may be selected to be a harmonic of the anticipated energy source . similarly , the range of motion permitted by the slide tracks in the energy harvesting module may be selected to accommodate the anticipate range of motion of the flexure , e . g ., so the coils or magnets do not move all the way to the end of the slide track . the relative position of the device with respect to the direction of fluid flow and acoustic waves of vibrations also influences the manner in which the energy harvesting module moves , and may be taken into account when designing a device for a particular purpose . as shown in fig3 through 6 , the energy harvesting device may be mounted in various different orientations with respect to the direction of fluid flow . in fig3 the flexure ( 104 ) is lengthwise - parallel to the direction of fluid flow , and the energy conversion module ( 100 ) is upstream relative to the anchor ( 102 ). in fig4 the flexure is again lengthwise - parallel to the direction of fluid flow , but the anchor ( 102 ) is upstream relative to the energy conversion module ( 100 ). in fig5 the flexure ( 104 ) is lengthwise perpendicular to the direction of fluid flow , and the anchor ( 102 ) is relatively nearer to the main casing or production tubing than the energy conversion module ( 100 ). in fig6 the flexure ( 104 ) is lengthwise perpendicular to the direction of fluid flow , and the energy conversion module ( 100 ) is relatively nearer to the main casing or production tubing than the anchor ( 102 ). in each of the orientations illustrated in fig3 through 6 the energy harvesting device is disposed in an alternative fluid path (“ side package ”) that is distinct from the main fluid path within casing or production tubing . an advantage of this deployment technique is that the energy harvesting device is less likely to impede future well operations in which operators might need to lower instruments into the well . however , the energy harvesting device could function in the main casing or production tubing . another advantage of the side package deployment technique is that the device can be retrieved relatively easily , thereby enabling design and implementation of less costly energy harvesting devices . referring to fig7 , in various alternative embodiments the energy harvesting device can be enhanced with optional equipment . for example , and without limitation , the energy storage device may be enhanced with an energy storage module ( 704 ), a device ( 706 ) that utilizes the energy to perform a useful task such as data collection , and a transmitter ( 708 ) to send signals to other devices . an advantage of such enhanced embodiments is that the device more fully satisfies a given requirement , e . g ., the device can be configured to power equipment to obtain information about fluid speed , or pressure , and transmit corresponding data to the surface . comparative data may be obtained by utilizing multiple devices in series along the flow . further , energy harvesting devices may operate simultaneously in both the casing ( 700 ) and the production tubing ( 702 ), e . g ., to obtain comparative measurements from them or from sensors powered by them . fig8 illustrates an alternative embodiment in which vibration of the magnets ( 800 ) ( or alternatively coils ( 802 )) is enhanced by interference with fluid flow . the embodiment includes and an anchor ( 102 ) as described above , a flexure ( 804 ) which connects the anchor ( 102 ) to a housing ( 806 ), and a compliant membrane ( 808 ), one end of which is connected to the anchor ( 102 ) or flexure ( 804 ), the other end of which is connected to the magnets . the flexure ( 804 ) is relatively rigid in comparison with the embodiment described above , so the housing ( 806 ) does not exhibit significant oscillatory motion . however , the compliant membrane ( 808 ) is flexible and resilient . consequently , the magnets ( 800 ) which are disposed on a free end of the compliant membrane ( 808 ) are free to move in an oscillatory manner . further , the compliant membrane facilitates the oscillatory motion of the magnets because the membrane interferes with fluid flow . in other words , fluids pass through the center of the housing ( 806 ), and cause the free end of the compliant membrane to move relative to the anchored end in an oscillatory manner . the oscillatory motion of the magnets ( 800 ) with respect to the coils ( 802 ) results in production of electrical energy . this alternative embodiment may be useful during completion , production and fracturing operations , oil / gas pipelines , and other instances in which the fluid flow regime is adequate . in more general terms , this embodiment has a flexure moving magnets with respect to coils . the magnets are moved by flow passing around the flexures containing them , and the coils are anchored with respect to the flow . in one embodiment the flow crosses through the middle of the device containing the magnets . the flow could pass outside it too . the device may be tuned for a particular range of anticipated conditions . for example , the housing ( 806 ) shape may be configured to change the flow rate , and focus , concentrate , or dissipate the fluid flow . further , the device may be configured to harvest energy only when the fluid flow is characterized by certain pre - defined conditions . because the device can be tuned to particular flow characteristics , the state of the device ( harvesting or not harvesting ) is indicative of flow condition . because this information can be of value , it may be useful to configure the device to signal information about the state of the energy harvesting device to other devices . further , the energy harvesting device can be enhanced to obtain and provide more detailed information about fluid speed , or pressure , e . g ., a measurement as opposed to a simple on or off indication . multiple devices may also be placed in series along the flow . as shown in fig9 through 12 , the alternative embodiment of the energy harvesting device can function to harvest energy , and optionally to sense flow speed , pressure , and other characteristics in various orientations with respect to the flow . in fig9 the anchor ( 102 ) is downstream relative to the compliant membrane ( 808 ). in fig1 the anchor ( 102 ) is upstream relative to the compliant membrane ( 808 ). in fig1 and 12 the energy harvesting device is transverse mounted relative to the direction of fluid flow such that the anchor ( 102 ) and compliant membrane ( 808 ) are disposed on an axis that is approximately perpendicular to the direction of fluid flow . the relative position of the anchored and free ends of the compliant membrane ( 808 ) with respect to the direction of fluid flow affect the manner in which vibrations are induced . referring to fig1 , individual units of the energy harvesting device can be disposed in the completion string as part of a casing ( 1300 ) and as part of the tubing ( 1302 ). as already described with regard to other embodiments , optional enhancements include energy storage , utilizing the energy to perform a useful task such as data collection , and a transmitter to send signals to other devices . it should be noted that the application of any of the various embodiments of the invention described above is not limited to the production phase of natural resource recovery operations . for example , a significant amount of fluid energy is available during fracturing operations , and a similar device may be used for distributed sensor networks or other applications requiring energy downhole , based on the energy harvesting principles described above . another possible application is to use this energy harvester inside an oil / gas pipeline . another application outside the oil industry could be placing these devices along currents in rivers , water pipelines , sewers , wind passages , and any other flow that can induce vibrations and therefore shaking the module that transforms kinetic energy into electric one . while the invention is described through the above exemplary embodiments , it will be understood by those of ordinary skill in the art that modification to and variation of the illustrated embodiments may be made without departing from the inventive concepts herein disclosed . moreover , while the preferred embodiments are described in connection with various illustrative structures , one skilled in the art will recognize that the system may be embodied using a variety of specific structures . accordingly , the invention should not be viewed as limited except by the scope and spirit of the appended claims . | 5 |
in the present application , the term “ foamed polyurethane ” refers to polyurethane materials having an entrained cell structure and thus has a variety of entrained voids within the polyurethane material . the foam can have an open or closed cell structure , and preferably has a density of less than 10 pounds per cubic foot , more preferably a density of between 0 . 1 and 5 lbs per cubic foot , and still more preferably , a density of between 0 . 35 and 3 lbs per cubic foot . largely as a result of the differences in foam density , the insulating ability ( for example the “ r ” value ) of the foam can be adjusted and / or controlled . typical “ r ” values would be between the ranges of 10 and 30 for a 4 inch thickness batt , and more preferably , between 13 and 25 . the general production methods to produce polyurethane foams are well known to the skilled artisan , as is the general chemistry for production thereof . for example , the following diagram describes in general the reaction of a process to prepare a typical polyurethane material produced from an isocyanate and a polyol resins : where r and r ′ are used to designate any of a variety of suitable alkyl or aromatic groups . depending upon the type of foam structure that is required by a specific application , the isocyante and / or polyol resin systems may selected according to their molecular weight . for example , low molecular weight materials tend to promote the formation of a more rigid material . to achieve a semi - rigid material , typically , a medium molecular weight resin system is typically used . to achieve a flexible foam , a high molecular weight resin system would preferably be used . however , this selection approach is merely a guideline as to the proper selection of resin components . as such , the flexibility of the polyurethane foam can , to a large extent , be controlled by selection of a resin having an appropriate molecular weight . for the preferred embodiment of the present application , a flexible polyurethane foam batt is one having a flexibility such that it can be bent 180 degrees or more from the horizontal , without any significant cracking or breaking of the batt . further , a flexible polyurethane batt is one which is compressible such that it can be compressed to a batt thickness which is 60 % of the original thickness of the batt without any significant cracking or breaking of the batt . of course , once the compressive force is removed , the compressed batt will re - expand to its original thickness , or at least to a thickness which is greater than 90 % of the original thickness of the batt of the present invention . additionally , for the purposes of the present invention , a rigid polyurethane foam is one that will crack and / or break once bent to an angle of 30 ° to the horizontal . a semi - rigid polyurethane form is one that will crack and / or break once bent to an angle of 90 ° to the horizontal . a semi - flexible polyurethane form is one that will crack and / or break only when it has been bent to an angle of between 90 and 180 ° to the horizontal . a semi - flexible batt is also one which can be compressed to a batt thickness which is 80 % of the original batt thickness without any significant cracking or breaking of the batt . for the purposes of the present invention , all of the above types of polyurethane foams can be used . however , flexible or semi - flexible materials are particularly preferred . with respect to the isocyanate component , low molecular weight materials would contain from 20 to 30 % isocyanate content . medium molecular weight resins preferably contain from 12 to 20 % isocyanate content , and high molecular weight resins preferably contain from 2 to 12 % isocyanate content . all percentage values are by weight unless otherwise stated . the isocyanate component of the polyisocyanate preferably has a functionality of 2 . 0 or more , and more preferably , a functionality of between 2 . 0 and 3 . 0 , and can include diisocyanates and polyisocyanates of the aliphatic , alicyclic , or aromatic types . the amount and type of isocyanate monomer used , or used in the production of the isocyanate resin component can directly affect the level of isocyanate groups present in the resin component . for example , hexamethylene diisocyante ( hdi ), has a monomeric level of isocyanate of 50 % nco . other materials will have different monomeric nco levels , such as , for example , bis -( 4 - isocyanatocyclohexyl ) methanes ( h12mdi ) at 31 . 8 % nco ; isophorone diisocyanate ( ipdi ) at 37 . 5 % nco ; toluene diisocyanate ( tdi ) at 48 % nco ; or methyl diphenyl diisocyanate ( mdi ) at 28 - 34 % nco . when reacted to form the isocyanate resin component , the monomeric nco level will affect the isocyanate level of the resulting resin material . the isocyanate is preferably a isocyanate selected from mdi , tdi , hexamethylene diisocyanate ( hmdi ), hdi , ipdi , tmxdi ( 1 , 3 - bis - isocyanato - 1 - methylene ethylene benzene ), or any of their oligomers , pre - polymers , dimmers , trimers , allophanates and uretidiones . further , suitable polyisocyanates useful in preparing the isocyanate resin component include , but are not limited to , toluene - 2 , 4 - diisocyanate , toluene - 2 , 6 - diisocyanate commercial mixtures of toluene - 2 , 4 - and 2 , 6 - diisocyanates , ethylene diisocyanate , ethylidene diisocyanate , propylene - 1 , 2 - diisocyanate , cyclohexylene - 1 , 2 - diisocyanate , cyclohexylene - 1 , 4 - diisocyanate , m - phenylene diisocyanate , 3 , 3 ′- diphenyl - 4 , 4 ′- biphenylene diisocyanate , 4 , 4 ′- biphenylene diisocyanate , 3 , 3 ′- dichloro - 4 , 4 ′- biphenylene diisocyanate , 1 , 6 - hexamethylene diisocyanate , 1 , 4 - tetramethylene diisocyanate , 1 , 10 - decamethylene diisocyanate , 1 , 5 - naphthalenediisocyanate , cumene - 2 , 4 - diisocyanate , 4 - methoxy - 1 , 3 - phenylenediisocyanate , 4 - chloro - 1 , 3 - phenylenediisocyanate , 4 - bromo - 1 , 3 - phenylenediisocyanate , 4 - ethoxy - 1 , 3 - phenylenediisocyanate , 2 , 4 ′- diisocyanatodiphenylether , 5 , 6 - dimethyl - 1 , 3 - phenylenediisocyanate , 2 , 4 - dimethyl - 1 , 3 - phenylenediisocyanate , 4 , 4 ′- diisocyanatodiphenylether , benzidinediisocyanate , 4 , 6 - dimethyl - 1 , 3 - phenylenediisocyanate , 9 , 10 - anthracenediisocyanate , 4 , 4 ′- diisocyanatodibenzyl , 3 , 3 ′- dimethyl - 4 , 4 ′- diisocyanatodiphenylmethane , 2 , 6 - dimethyl - 4 , 4 - diisocyanatodiphenyl , 2 , 4 - diisocyanatostilbene , 3 , 3 ′- dimethyl - 4 , 4 ′- diisocyanatodiphenyl , 3 , 3 ′- dimethoxy - 4 , 4 ′- diisocyanatodiphenyl , 4 , 4 ′- methylene bis ( diphenyl ) socyanate ), 4 , 4 ′- methylene bis ( dicyclohexylisocyanate ), isophorone diisocyanate , papi ( a polymeric diphenylmethane diisocyanate , or polyaryl polyisocyanate ), 1 , 4 - anthracenediisocyanate , 2 , 5 - fluorenediisocyanate , 1 , 8 - naphthalenediisocyanate and 2 , 6 - diisocyanatobenzfuran . also suitable are aliphatic polyisocyanates such as the triisocyanate desmodur n - 100 sold by bayer which is a biuret adduct of hexamethylenediisocyanate ; the diisocyanate hylene w sold by du pont , which is 4 , 4 ′- dicyclohexylmethane diisocyanate ; the diisocyanate ipdi ( isophorone diisocyanate sold by thorson chemical corp . ), which is 3 - isocyanatomethyl - 3 , 5 , 5 - trimethylcyclohexyl isocyanate ; or the diisocyanate thmdi sold by verba - chemie , which is a mixture of 2 , 2 , 4 - and 2 , 4 , 4 - isomers of trimethyl hexamethylene diisocyanate . further examples of suitable isocyanate components include 2 , 4 tolylenediisocyanate , 2 , 6 - tolylenediisocyanate , 4 , 4 ′- diphenylmethanediisocyanate , 4 , 4 ′- diphenylthere - diisocyanate , m - phenylenediisocyanate , 1 , 5 - naphthalene - diisocyanate , biphenylenediisocyanate , 3 , 3 ′- dimethyl - 4 , 4 ′- biphenylenediisocyanate , dicyclohexylmethane - 4 , 4 ′ diisocyanate , p - xylylenediisocyanate , bis ( 4 - isocyanatophenyl ) sulfone , isopropylidene bis ( 4 - phenylisocyanate ), tetramethylene diisocyanate , isophorone diisocyanate , ethylene diisocyanate , trimethylene , propylene - 1 , 2 - diisocyanate , ethylidene diisocyanate , cyclopentylene - 1 , 3 - diisocyanates , 1 , 2 - 1 , 3 - or 1 , 4 cyclohexylene diisocyanates , 1 , 3 - or 1 , 4 - phenylene diisocyanates , polymethylene ployphenylleisocyanates , bis ( 4 - isocyanatophenyl ) methane , 4 , 4 ′- diphenylpropane diisocyanates , bis ( 2 - isocyanatoethyl ) carbonate , 1 - methyl - 2 , 4 - diisocyanatocycloheane , chlorophenylene diisocyanates , triphenylmethane - 4 , 4 ′ 4 ″- triisocyanate , isopropyl benzene - a - 4 - diisocyanate , 5 , 6 - diisocnanatobutylbicyclo [ 2 . 2 . 1 ] hept - 2ene , hexahydrotolylene diisocyanate , 1 - methoxyphenyl - 2 , 4 - diisocyanate , 4 , 4 ′ 4 ″- triphenylmethane triisocyanate , polymethylene polyohenylisocyanate , tolylene - 2 , 4 , 6 - triisocyanate , 4 , 4 ′- dimethyldiphenylmethane - 2 , 2 ′ 5 , 5 ′- tetraisocyanate , and mixtures thereof . preferably , however , the isocyanate component of the polyurethane foam is selected from the group consisting of methyl diphenyl diisocyanate ( mdi ), toluene diisocyanate ( tdi ), hexamethylene diisocyanate ( hmdi ), hexamethylene diisocyante ( hdi ), isophorone diisocyanate ( ipdi ), tmxdi ( 1 , 3 - bis - isocyanato - 1 - methylene ethylene benzene ), or any of their oligomers , pre - polymers , dimmers , trimers , allophanates and uretidiones . the polyol portion of the polyurethane foam can be any suitable polyol commonly used within the art , and can include aliphatic or aromatic polyols , including polyester , polyether , and caprolactone - based polyols . the polyols include materials such as glycerol , 3 -( 2 - hydroxyethoxy )- 1 , 2 - propanediol , 3 -( 2 - hydroxypropoxy )- 1 , 2 - propanediol , 2 , 4 - dimethyl - 2 -( 2 - hydroxyethoxy )- methylpentanediol - 1 , 5 , 1 , 2 , 6 - hexanetriol , 1 , 1 , 1 ,- trimethylolpropane , or the like , or can be made by any suitable production method which would typically and preferably involve reacting ethylene oxide ( eo ), propylene oxide ( po ) or butylene oxide ( bo ) with materials such as : 1 , 1 , 1 - tris [( 2 - hydroxyethoxy ) methyl ] ethane , 1 , 1 , 1 ,- tris -[( 2 - hydroxypropoxy ) methyl ] propane , triethanolamine , triisopropanolamine , pyrogallol or phloroglucinol , in order to form a chain - extended polyol . one example of a suitable chain - extended polyol is the polyether triol sold under the trade name xd 1421 , which is made by the dow chemical company . it has a molecular weight of around 4900 , and is composed of a ratio of three oxyethylene ( ethylene oxide ) units randomly copolymerized per one unit of oxypropylene ( propylene oxide ). it has a hydroxy content of 0 . 61 meq . oh / g . another example of a material which is commercially available is pluracol v - 7 made by basf wyandotte which is a high molecular weight liquid polyoxyalkylene polyol . other polyols which might be used at polyether polyols such as pluracol 492 from basf , having a molecular weight of 2000 . alternatively , saturated polyester polyols such as desmophen 2500 from bayer , having a molecular weight of 1000 might be used . further , castor oils such as db caster oil or regular commercial grades of castor oil available from for example , cas chem , might also be used . additionally , polybutadiene resins , such as poly bd r45t , available from sartomer , can also be used . still further , the polyol can be selected from renewable sources , such as soy , castor and vegetable oil , or the like , or combinations thereof . as such , a wide variety of polyols might be used . moreover , combinations of various polyols , or even different types of polyols , might also be used . the ratio of isocyanate resin to polyol is typically identical to the ratios normally used in the prior art to cure these types of polymer systems . preferably , however , the amount of resin in this mixture is in the amount of from 1 to 40 %, and more preferably in the ratio of from 2 to 30 %. the skilled artisan will be aware that these ranges will vary , however , depending on the resins selected , and on the desired properties of the polymer system . further , as is known in the art , the foam structure of the polyurethane material is provided by a blowing agent which acts to form the voids within the polyurethane as it reacts and solidifies . the nature , types and amounts of blowing agents which are used in ) polyurethane foam manufacture are well known to those skilled in the art , but can include , for example , water , carbon dioxide , hydrofluorocarbons , chlorinated fluorocarbons and the like . again , though the skilled artisan will easily be able to determine suitable blowing agents . additionally , other additives such as catalysts or surfactants can be added to the reaction mixture in order to control various properties . catalysts , when used , can be amine based , including , for example , primary , secondary or tertiary amines or combinations thereof . the catalysts can also be metallic based , including , for example , tin , lead , bismuth based catalysts , or the like . catalysts can be used which promote the formation of urethane linkages in the polyurethane based systems , by reaction of isocyanate groups and hydroxyl groups . these types of amine catalysts include , for example , triethylenediamine , n - methylmorpholine , tetramethyl - 2 , 4 - butanediamine , n - methylpiperazine , dimethylthanolamine , triethylamine , and the like ; and organometallic compounds , such as stannous octanoate , dibutyltin dilaurate , dibutyltin di - 2 - ethylhexanoate , and the like . the catalysts may be used alone or in combination with one another . the amount of catalyst typically used is a broad range of amounts , which usually ranges from 0 . 03 to 2 . 0 parts by weight , and preferably between 0 . 02 to 1 . 2 parts by weight based on the total weight of the composition , exclusive of the reinforcing materials . surfactants might also be added . by introducing surfactants , the foam materials can be made as closed cell or open cell depending upon the desired application . where uniformity of cell structure is required , fine organic or inorganic particles may be used in a size range between 50 and 500 microns . where random cell structure is acceptable , larger reinforcing particles may be used . surfactants , when used , are preferably silicone based , although any suitable surfactant might be used . other materials can be included in the formulations of the present invention . for example , coupling agents , such as silane or titanates , may also be included in the preparation of the composition to improve the physical properties of the material . where ) other properties are desired additives may be added to the composition including colorants , dry or liquid inks or pigments , fire and flame retardants , internal mold release additives , antistatic agents , and such other additives as required , and which are known within the industry . as indicated above , once the foam is fully formed and cured , the final density is preferably less than 10 lbs per cubic foot . more preferably , the density is between 0 . 01 and 5 lbs per cubic foot , and an even more preferred density will be in the range of between 0 . 35 to 3 lbs per cubic foot . the production method used to produce the polyurethane material for the polyurethane batts of the present invention will be similar to the techniques used in the prior art for other products . this production method , or foam forming stage , is preferably conducted under heat and / or pressure , and is preferably accomplished using : an injection molding process ; an extrusion process ; a calendaring process ; a compression molding process ; a spray foam application process ; a slab stock foam process ; a rotational molding process ; or any other suitable foam forming process . as such , any suitable conventional or non - conventional manufacturing processes might be used for the forming stage . the polyurethane foam can be produced so that it foams to the desired size and shape by injecting the reactant materials into a suitable mold , or the like . alternatively , larger blocks of material can be produced , which can be cut into the proper size and shape necessary to provide a flexible polyurethane batt . cutting of the polyurethane foam can be accomplished in a number of different ways which are known to those skilled in the art . this might include knives , guillotines , or hot wire technologies in order to cut the foam to the desired shape and size . once the foam has been formed or cut to size , it is preferably compressible such that it can be compressed for placement into a shipping container , in a manner similar to fibreglass baits . this is particularly true for the flexible polyurethane materials . the container might simply be a plastic bag or wrap which can be used to ship the compressed foam to the job site . once on site , the container can be opened so that the compressed foam will essentially automatically expand back to its normal shape . as such , the preferably flexible , compressible polyurethane foam expands back to its original shape and size once the compressive force is removed . thus , preferred flexible polyurethane foam materials are preferred and this includes those materials which , as hereinabove described , can be compressed in size , by an applied force , in at least one dimension , to a value which is less than about 60 %, and more preferably less than about 50 %, and still more preferably less than about 30 %, of its original size . as such , for example , a 4 foot high collection of polyurethane bats might be compressed to 2 feet in height , while still being approximately 4 feet long , and 16 inches wide . this collection of polyurethane batts would be suitable for insertion into a plastic bag having dimensions of 4 feet , by 2 feet by 15 inches . production of the polyurethane batts of the present invention utilizes traditional polyurethane foam production techniques . typically the polyol and isocyanate resins are mixed together with mixing . mixing of the materials preferably involves the use of an efficient shear mixer to homogeneously blend either or both of the resin components together , and / or mix or pre - mix either component directly with any necessary additives . then , after mixing the isocyanate and polyol components together , the resultant composition is introduced into a mold cavity , or extruded through a die , calendered , sprayed on a surface , or applied in some other processing method , and is caused to react to form the polyurethane foam . the composition may be pumped , blown , sprayed , or poured into a forming tool or mold cavity , depending on the physical nature of the pre - polymer mixture . to improve the processing speed the forming tool , or mold , may be heated thereby promoting a faster reaction . those skilled in the art will be aware that tooling should be provided which preferably will allow excess gasses to exit the formulation so as to allow the composition to expand to the tool surface and thus providing for a uniform surface that is preferably smooth and free of pitting . prior to introducing the composition material into the forming tool , a release agent or coating in the form of a gel - coat system can be applied to the surface of the tool . the release agent or in - mold coating may comprise acrylic , urethane , melamine vinyl , silicone , epoxy , polyester coatings and combinations thereof to achieve the desired appearance and surface features . surface features such as a variety of textures may be applied to the tool surface to be molded into the final product . the foaming process can occur when , for example , the isocyanate from the blended pre - polymer resin reacts with moisture ( water ) which causes carbon dioxide gas ) to be liberated . a chemical blowing agent such as nitrogen , pentane , carbon dioxide , etc ., may also be used directly or released in a reaction to form a foam . the foam can also be co - blown by combinations of materials such as a combination of water and a hydrocarbon material such as pentane , and with hcfc &# 39 ; s or hfc &# 39 ; s like hfc - 245fa ( as those terms are used in the industry ). the foam may also be co - blown with gases like carbon dioxide or nitrogen , that are injected into the raw material , or into the mixing streams of the reactants . alternatively , water can be added to the reaction system , or some other blowing agent can be added to generate a gaseous material during the curing reaction . preferably , the flexible material is such that it provides a foam material that once formed , is essentially fully cured and crosslinked . as such , the polyurethane foam will not “ off gas ” to any appreciable extent . those skilled in the art would be aware of techniques to achieve this state . the material of the present invention can be foamed under atmospheric conditions , but might also be produced in a system which is under a compressive pressure . under these conditions , compression pressures of 0 to 1 , 000 psi ( 0 to 70 . 30 kg / cm 2 ) can be applied . the polyurethane foam material of use in the present invention can also be custom formulated and engineered for specific applications . the range of formulations includes using rigid , semi - rigid , or more preferably semi - flexible or flexible , polyurethane foams that may include a range of organic and inorganic reinforcing materials which may be in the form of a particle or fiber with the said reinforcing materials being in a variety of densities , sizes and regular and irregular shapes . the polyurethane foam can be produced having either a closed cell or open cell structure , in accordance with prior art techniques and practices . the cell size in the foam can be any suitable size , and this can be easily adjusted and modified by the skilled artisan . it can be noted that the density of the batt can be modified to some extent by adjustment of the cell size . preferred cell sizes are between 0 . 001 cm to 1 cm , and more preferably , between 0 . 001 cm and 0 . 5 cm . the batt can be made to different sizes and shapes , but preferably , the polyurethane batts of the present invention are similar in size and shape to the common fibreglass batts , or insulation sheets , already used in the industry . in particular , the flexible or semi - flexible batts can be preferably produced having a width of about 12 inches , 16 inches , 24 inches or even 48 inches , and a thickness of between 1 and 10 inches , and more preferably between 2 and 6 inches . the insulating ability , or “ r - value ”, provided by the batt will largely be dependent on the thickness of the batt for a given formulation or composition . the length of the batt can vary , but typically will be between 2 and 10 feet , and more preferably , between 3 and 6 feet . however , the batt might also be provided in longer rolls of up to , for example 50 feet or more , so that it can be cut to length on site . most commonly , however , the batt will be about 16 inches wide , about 48 inches long , and about 4 to about 6 inches thick . when compressed , for shipping or the like , the compressed batt will typically have dimensions of 16 inches wide , 48 inches in length , and a thickness of less than 2 inches . more preferably , the compressed batt will have a thickness of between about 1 to about 2 inches . the polyurethane batt can also be provided in larger formats , such as , for example , a batt which is 8 feet long , and 50 feet wide . the thickness can vary depending on the desired r - value . this batt would be suitable for coverage of , for example , the inner surface of an unfinished basement wall , or the like , or for applying to a flat surface . the rigid or semi - rigid polyurethane batts can be produced in similar sizes , but most commonly , would be expected to be in a 4 foot by 8 foot sheet , having a thickness of between 1 inch and 6 inches , and more preferably , having a thickness between 1 . 9 inches and 3 . 1 inches . the batt can be produced so as to have a exposed cell structure on any or all of the 6 surfaces , or a standard cube shaped batt . the batt might also include 1 to 6 surfaces which have a enclosed cell structure wherein there is a continuous “ skin ” on the surface ) of the batt . for example , the inner and outer larger surfaces of a batt might have a continuous skin , while the side and end surfaces might have exposed cells as a result of the cutting or trimming of a larger batt . however , numerous variations from this arrangement are possible depending on the production technique , and desired application . the batt could also be provided so as to be exposed cells on all sides , or have a enclosing skin on all sides . the enclosed cell structure , having a skin , can also act as a vapour barrier . however , a vapour barrier component can also be added to the batt by attaching ( by gluing or the like ), a continuous layer of plastic such as polyethylene film , on at least one surface of the batt . the film would typically have a thickness of between 1 and 20 mil , and more preferably between 3 and 10 mil . the final batt product may also be laminated with foils or plastic to suit different needs of the user , or to comply with building codes or other regulations . a benefit of the use of the polyurethane foam as insulation , is that it is typically unaffected by water which may be present , on occasion . if exposed to water , the polyurethane batt will simply dry when the water is removed , and again provide the same insulation value .) the polyurethane batt of the present invention can be used in any application where traditional fibreglass batts are used . this could include , for example , residential , commercial , or industrial applications where insulation for heating or cooling is required . the polyurethane batt could also be used for sound absorption , as well as other suitable applications where batt materials might be used . still further , the batt foam material can also be shredded in order that it can be used in a blown insulation application . for this application , the foam batt can be shredded to a size suitable for blown insulation applications , as known to those skilled in the art , but typically in the range of from 0 . 5 to 10 cm pieces . a variety of other applications will be apparent to those skilled in the art . the following non - limiting example provides an indication of suitable compositions for a polyurethane foam according to the present invention . of course , the skilled artisan will be well aware that modifications of the present formulation can be easily accomplished by simple experimentation . suitable open and closed cell polyurethane batts were prepared according to the following formulations . the above constituent elements were mixed together at room temperature in a suitable mould , and were allowed to foam to form a rigid closed cell batt . approximately , 10 . 66 lbs . of material were used to prepare a batt having dimensions of 4 feet by 10 feet by 2 inches ( or 5 . 333 cubic feet ). this would be a suitable replacement for a typical insulation sheet made of styrofoam ™, or the like , as provided in the prior art . again , the above constituent elements were mixed together at room temperature in a suitable mould , and were allowed to foam to form a flexible open cell batt . approximately , 1 . 96 lbs . of material was used to prepare a batt having dimensions of 4 feet by 4 inches by 16 inches ( or 1 . 7777 cubic feet ). this material is particularly suited for replacement for a typical fibreglass batt of the prior art , while having similar density and flexibility . thus , it is apparent that there has been provided , in accordance with the present invention , a foam material , and a method of production of the foam material , which fully satisfies the goals , objectives , and advantages set forth hereinbefore . therefore , having described specific embodiments of the present invention , it will be understood that alternatives , modifications and variations thereof may be suggested to those skilled in the art , and that it is intended that the present specification embrace all such alternatives , modifications and variations as fall within the scope of the appended claims . additionally , for clarity and unless otherwise stated , the word “ comprise ” and variations of the word such as “ comprising ” and “ comprises ”, when used in the description and claims of the present specification , is not intended to exclude other additives , components , integers or steps . moreover , the words “ substantially ” or “ essentially ”, when used with an adjective or adverb is intended to enhance the scope of the particular characteristic ; e . g ., substantially planar is intended to mean planar , nearly planar and / or exhibiting characteristics associated with a planar element . also , while this discussion has addressed prior art known to the inventor , it is not an admission that all art discussed is citable against the present application . | 2 |
in fig1 and 2 , the problem with current industry fitness equipment is seen clearly . insertion pin at the top of the weight stack may be difficult due to the accumulated thickness errors of the weight stacks . the central stem is oftentimes made offset , as to cause trouble when the cable tension is released , the bottom tip of the central stem cannot successfully come down through the center holes of all the remaining weight plates . present invention uses link - connectors , each fitting to one weight plate having center portion machined out to contain one link - connector . fig3 - 7 show the construction of link - connectors and how they are used on weight plate machined to fit said link - connectors . as shown in fig1 , there is only a small length of tip from a link - connector , when the cable is lifted . the selected portion of weight plates can come easily back to stack on top of unselected weight plates . fig8 and 9 show the link - connector can be made into a rectangle shape , with the hole of weight plate being correspondingly machined to fit such shape . fig1 shows when link pin corresponding to weight plate # 2 is deselected , all the weight plates under that link pin are also deselected . when cable is released , the selected weight plates (# 1 and # 2 , in this instance ) will come easily to align with the small length of tip of the # 3 link - connector . the problem of long - dangling central stem being offset , as depicted in fig2 , is no longer here . furthermore , the problem of accumulated thickness error causing difficulty for insertion pin to be smoothly inserted into the weight plates ( usually toward the bottom ) is no longer there , since present invention has one select pin corresponding to each link - connector and each weight plate . there is no issue of accumulated thickness , causing the vertical misalignment of side holes for the insertion pin . fig1 and 11 show users can make weight selection by directly push / push the desired link pin , to get the desired weight selection . to make selection of desired total weight easier , present invention envisions two intuitive user operation features , by the addition of a select pin , usually parallel to the link pin . the implementations are either a lever design , as in fig1 and 13 , or a on - off toggle switch , as in fig1 - 17 . in the drawings and embodiments containing an additional “ select pin ”, this is the pin that users will actually touch to pull or push , in order to accomplish the weight selection purpose . whereas the link - pin is the physical object that is inserted into the corresponding link - connector . in some embodiments , the link pin may be made invisible , as shown in fig1 - 33 . a selection box is added in fig1 - 33 ( see later disclosure ). with the added select pin , a fitness user can simply push in a select pin , causing the corresponding link pin to pop out ( deselected ). only the plates starting from the point of pushed in select pin are selected , as shown fig1 . note that a user can actually push in multiple select pins . however , only the first ( counting from top to bottom ) pushed - in select pin is operative , because any weight plates below the point of pushed - in selected pin are deselected . the push - in design can also be done by a on - off toggle switch , which mechanism is commonly found on pens and other electronic devices such as the on - off power switch of a stereo system . fig1 - 17 show that a gear wheel in placed in a spaced out area in a weight plate , the link pin and the select pin each contains gear teeth so that the in - out travel of the select pin and link pin are properly reversed by the gear wheel . as shown in fig1 , the link pin can be made non - visible and not - touchable to users . so that users push in the select pin (# 6 in fig1 ), the link pin ( in weight plate # 6 ) causes all the weight plates below that point be deselected . as in the case of lever design , a user can actually push in multiple select pins . however , only the first ( counting from top to bottom ) pushed - in select pin is operative , because any weight plates below the point of pushed - in selected pin are deselected . to create an auto - off feature , so that when one select pin is selected ( i . e ., pushed in ), all other select pins are automatically deselected , a select box is added to the front of the weight stack , as shown in fig1 - 33 . a push spring is used in every select pin , corresponding to each weight plate , as shown in fig1 , 24 , 25 and 26 . a select box , having same numbers of short slots on the front and long slots in the back ( near the stack of weight plates ) are shown in fig1 . a long plate , containing the same number of long slots are also shown in fig1 . a plurality of wedges are shown in fig2 , corresponding to the number of weight plates . these wedges serve as the “ selection pin ” that user will push in to select the desired weight , as shown in the number “ 60 ” pushed in pin , on fig3 . a pull spring is affixed inside said select box , to provide the restoration force to pull up the long plate when the long plate is wedged downward by any of the wedges , as shown in fig2 , 22 and 23 . fig2 , 25 and 26 show the operation of the auto - off feature when one wedge ( select pin ) is pushed in . in fig2 , # 2 select pin ( wedge ) is pushed in , because of the shape of the wedge , all the long slots are in “ open ” state when the # 2 wedge is being pushed in . all the push springs will cause other wedges to pop back ( being pushed out ). # 2 wedge , however , will be “ wedged ” down the # 2 long slot over the long plate , due to the arrow shape of the wedge , after all other wedges are popped back . fig2 and 26 show that when user selects # 4 pin , all other select pins ( wedges ), including the previously selected # 2 , will become deselected . fig2 , 28 and 29 show the cut out view of select box being set against one weight plate . when the select pin ( wedge ) is pushed in , the gear wheel reverse the travel and cause the link pin to move towards the select box , forming an “ unlock ” status . all the weight plates below the pushed in pin become deselected . fig3 , 31 and 32 show that , as the select pin labeled for “ 20 ” is pushed in ( selected ), all other select pins are pushed out ( deselected ), by the design of present select box . fig3 shows the completed view , as can be perceived by users of fitness equipment , of present invention , wherein select pin ( wedge ) labeled for “ 60 ” is pushed in . presuming each weight plate is 10 pounds , then a total of 6 plates are selected , causing a selection of 60 pounds . when other select pin is pushed in ( for example , “ 80 ”), then other select pins , including “ 60 ” select pin , will pop out , clearing showing to users that the selected desired weight is 60 pounds . | 0 |
referring to fig1 an example of a trash receptacle 1 embodying this invention is shown having a wall , which wall in this instance comprises a conventional rectangular shape with upwardly and outwardly sloping walls 4 , 5 , 6 and 7 . walls 4 - 7 terminate at upper edges 8 to form a rectangular upper trash receiving opening 9 . a curved lip 10 is preferably formed at the upper edge 8 to add structural rigidity to the receptacle 1 and reduce the risk of injury or back cutting through exposed sharp edges . the receptacle may be fabricated for many suitable material , however , in this example , it is formed of molded synthetic resin allowing inexpensive construction . the walls 4 - 7 terminate at lower edges 15 which contact the surface upon which the receptacle rests and offers stable support . in the embodiment of fig1 a false bottom 16 is integral with , and projects diagonally upwardly and inwardly from lower edges 15 , producing a frame like configuration with an interior edge 18 . at the inner edge 18 , cavity walls 19 , 20 , 21 and 22 depend therefrom and terminate at lower edges 24 , 25 , 26 and 27 , respectively , generally at the same level as lower edges 15 of the walls 4 - 7 . a bottom 29 is integral with cavity walls 19 - 20 forming a box receiving cavity 31 for receiving a bag containing box 40 . inwardly directed box engagement tabs 42 are spaced about the upper edge 18 of the cavity walls 19 - 22 and form obstructions that latchably receive and retain the box 40 in the cavity 31 to resist disengagement of the box 40 from cavity 31 . the tabs 42 , however , are not sufficiently obstructive to prevent removing of box 40 upwardly by hand for replacement with a full box . the box 40 comprises an upper wall 47 generally rectangular in shape with an outer edge 48 and of a size which can be snugly interposed within edge 18 of cavity 31 . intermediate box walls 50 , 51 , 52 , and 53 , are integral to and depend from upper wall 47 at its outer edge 48 and terminate at a lower edge 56 . the lower wall 58 is integral with box walls 50 , 51 , 52 and 53 . lower wall 58 is generally rectangular in shape and is of a sufficiently small surface area such that the lower edge 56 is not obstructed by tabs 42 when box 40 is inserted into cavity 31 . because the lower wall 58 is smaller in surface area than upper wall 47 , the box 40 appears to be tapered and trapezoidal in shape when viewed from any side and is thus wedgably and releaseably received by the cavity 31 . in addition , the upper wall 47 , in cross section normal to edge 48 , forms an angle 59 with walls 50 - 53 less than 90 °, as shown in fig3 and 4 . it is foreseen that the individual angles between the upper wall 47 and each wall 50 - 53 may be different from one another . further , however , it is foreseen that the lower wall 58 and walls 50 through 53 may assume other geometric shapes , such as hemispherical , which shapes can likewise be wedgably received by cavity 31 . the bottom facing surfaces of box 40 may assume any shapes which will not initially be obstructed by tabs 42 upon insertion of box 40 into cavity 31 . located within the interior volume 62 of the box 40 is a first bag roll 64 and a second bag roll 65 , each comprising rolls of commercially available trash bags , the individual bags for which are separated by a perforated division allowing for easy bag detachment ( not shown ). the individual bags are dispensed from rolls 64 and 65 through a first parallel slot 70 and a second parallel slot 71 located in the upper surface 47 , as shown in fig2 . as box 40 is inserted in cavity 31 , the lower wall 58 passes tabs 42 , which tabs 42 eventually urge against box walls 50 - 53 . however , the elasticity of box walls 50 - 53 allow the box 40 to be fully inserted with the tabs 42 ultimately overlapping the upper wall 47 , as shown in fig3 . after the box 40 is inserted , a top bag 77 from the first roll 64 may be grasped and withdrawn upwardly through first parallel slot 70 and expanded within the receptacle in the usual manner , normally by pulling the bag upper edge 78 downwardly over upper edge 8 of the receptacle , covering the upper edge and interior surfaces of the container . perforations or other weakening systems ( not shown ) allow the old and new bag to be easily separated . when the bag is full of refuse ( not shown ), the upper edge 78 of the bag may be gathered in the usual manner , tied , bag lifted out of the receptacle for disposal . the act of withdrawing the full bag automatically pulls the next bag upwardly for replacement and use within the container . when the first roll 64 is completed , the process may be repeated with the second roll 65 . when the box 40 is empty of bags , it may be grasped by the fingers through slots 70 and 71 and pulled upwardly out of the cavity 31 for discard and replacement . in an alternative embodiment shown in fig6 a four walled receptacle 80 with a wall portion 81 and a flat bottom 82 includes inwardly directed tabs 83 fixedly attached to wall portion 81 in the proximity of bottom 82 to define a cavity 88 . in yet another alternative embodiment shown in fig7 the box 40 is wedgably received by inwardly directed tabs 95 fixedly attached to continuous wall 95 of a round receptacle 100 , defining a cavity 102 near the bottom of a continuous wall 90 . box 40 may be inserted into cavity 88 and cavity 102 in the alternative embodiments in a manner similar to that described for cavity 31 . although certain embodiments of this invention have been illustrated and described , it should be understood that the scope of this invention is not to be limited thereto , except insofar as such limitations are included in the form of claims . | 8 |
with reference to fig1 , and 3 , wherein like numerals denote like parts , the system of the invention is particularly adapted for modifying the flow of coolant through the core 1 of a nuclear reactor . in such reactors , core 1 generally includes a reactor vessel 3 having a coolant inflow path ( not shown ) for introducing a flow 5 of liquid coolant through the interior 6 of a core barrel 7 that contains a plurality of nuclear fuel assemblies ( also not shown ). in most instances , this coolant is water pressurized to about 2 , 250 psi . the exterior of the core barrel 7 is circumscribed by a cylindrical thermal shield 9 as shown . as is indicated by the flow arrows 5 , pressurized water is directed downwardly in the annular space between the core barrel 7 , and the thermal shield 9 . much of this flow goes completely through the annular space defined between the core barrel 7 and the thermal shield 9 , where it impinges against the bowlshaped bottom of the reactor vessel 3 , and is ultimately directed upwardly through the interior 6 of the core barrel 7 . however , a set of lateral flowports 11 that circumscribe the core barrel 7 direct a portion 12 of the downflow 5 toward an array of baffle plates 13 that circumscribe the barrel interior 6 . these baffle plates 13 are circumscribed by a series of uniformly spaced former plates 15 into which a set of mutually aligned flowports 17 are bored . these flowports 17 in the former plates 15 direct the branch downflow 12 of the coolant downwardly toward the lower core plate 21 . after impinging on the top surface of the lower core plate 21 , the branch downflow 12 loops upwardly and flows through the apertures 23 of a lower baffle plate 25 spaced above the lower core plate 21 . at the same time , the main flow 5 impinges off of the bowl - shaped interior surface of the reactor vessel 3 , and ultimately flows through the flowports 19 of the lower core plate 21 . the two streams of coolant 5 and 12 unite in the space between the lower core plate 21 and the lower baffle plate 25 , and flow upwardly through the fuel assemblies disposed in the interior 6 of the core barrel 7 . the configuration of baffle plates 13 is comprised of a plurality of abutting plates which are held adjacent to the inner wall of the core barrel 7 . these plates 13 are only bolted together along their corners 27 . because there is no fluid seal between the abutting baffle plates 13 , high - pressure jets of coolant can squirt out between them as a result of the pressure differential which exists between the branch downflow 12 of coolant on the outside surface of the baffle plates 13 from the lateral flowports 11 , and the upflowing coolant on the inside surface of the baffle plates 13 . these high - pressure jets can impinge on the relatively fragile fuel rods in the fuel rod assemblies and damage them by rattling them against their retaining grids . the purpose of the system of the invention is to eliminate these high - pressure jets of coolant by modifying the conventional &# 34 ; downflow &# 34 ; coolant path illustrated in fig1 to the &# 34 ; upflow &# 34 ; coolant path illustrated in fig2 . to this end , two structural modifications to the reactor core 1 are made . first , all of the lateral flowports 11 of the core barrel 7 are plugged . such plugging causes all of the coolant flow 5 to flow downwardly between the inside of the reactor vessel 3 and the outside of the thermal shield 9 and back up through and around the lower core plate 21 . while most of the coolant flow 5 travels through the flowports 19 of the lower core plate 21 and up through the lower baffle plate 25 as previously described , a branch 32 of this flow travels upwardly through the ports 17 of the former plates 15 . second , in order to establish a coolant flowpath between the inside walls of core barrel 7 and the outside walls of the baffle plate 13 ( which will minimize any pressure differential in the coolant flowing on both sides of the baffle plates 13 ), a plurality of fluid flowpaths in the form of bores 34 are made in the top former plate which overlies the gap between the core barrel 7 and the baffle plate 13 . as is illustrated in fig3 some of the lateral flowports 11 that extend through the walls of the core barrel 7 include a chamfered portion 37 that leads into a round non - chamfered portion 39 . the edge of the chamfered portion 37 is closely spaced a distance l1 from the inner surface of the thermal shield 9 , which typically may be only 1 . 34 inches . additionally , the length of the chamfer along the longitudinal axis of the lateral flowport 11 may be on the order of 0 . 06 inches . in order for a conventional plug to effectively seal such a chamfered flowport 11 , the overall length l2 of the plug 30 would have to be approximately 1 . 5 inches . if the plug 30 were made any shorter , it would not extend sufficiently deep into the non - chamfered portion 39 of the port 11 to create a reliable fluid seal . however , as the overall length l2 of such a plug ( i . e ., 1 . 50 inches ) is greater than the distance l1 ( i . e ., 1 . 34 inches ) between the core barrel 7 and the thermal shield 9 , the use of a prior art plug 30 in such a chamfered flowport 11 is clearly unfeasible . as is described in detail hereinafter , the invention solves this problem by means of an improved system that employs both a plug 40 that is telescopically contractible during installation , and an installation tool 110 that includes a compact hydraulic ram , and a movable carriage assembly for holding the plug 40 during installation . specific description of the plug and installation tool used in the system and method of the invention with reference now to fig4 a , 4b and 4c , the improved plug 40 of the invention is generally formed from a cylindrical plug body 42 , and a retaining ring 44 that is telescopically engaged around this body . the plug body 42 includes a cylindrical shell 46 having a tapered mandrel 47 disposed therein that serves to expand the cylindrical shell 46 into sealing engagement with a flowport 11 . the distal end 48 of the shell 46 is insertable within the non - chamfered portion 39 of a flowport 11 , while the proximal end 50 is circumscribed by the retaining ring 44 which limits the extent to which the distal end 48 may be so inserted . when the plug 40 is installed , the distal end 48 of the shell 46 is sealingly engaged around the non - chamfered portion 39 of the flowport 11 , while the proximal end 50 is surrounded by ( but not engaged to ) the chamfered portion 37 of this flowport . on its outside surface , the distal end 48 of the cylindrical shell 46 includes a pair of gripping rings 52 formed from age - hardened stainless steel that are seated within annular grooves 53 . these gripping rings 52 are tapered along their outer edges , and indent into the inner diameter of the non - chamfered portion 39 of the flowport 11 when the plug body 42 is expanded , thus providing added retention capability against high coolant pressures which could act to dislodge the plug 40 during a postulated loss of coolant ( loca ) event . disposed directly above the gripping rings 52 are a pair of annular sealing ribs 54 integrally formed into the wall of the shell 46 . these sealing ribs deform into sealing engagement against the inner diameter of the non - chamfered portion 39 of the port 11 when the plug body 42 is expanded . disposed below the gripping rings 52 are a plurality of axially oriented slots 56 . these slots 56 facilitate the expansion of the distal end 48 of the cylindrical shell 6 when the tapered mandrel 47 is pushed therethrough . on its inside surface , the distal end 48 of the shell 46 includes a tapered wall section 58 that is generally complementary in shape to the distal end of the tapered mandrel 47 . at its top end , the tapered wall 58 terminates in an annular stopping shoulder 60 which co - acts with the mandrel 47 in a manner which will be described in detail presently . on its outside surface , top edge of the proximal end 50 of the cylindrical shell 46 is circumscribed by a stop flange 62 . this flange 62 becomes telescopically engaged with the retaining ring 44 when the plug body 42 is slid completely through the ring in the position illustrated in fig4 c and 5 . the outside of the proximal end 50 of the cylindrical shell 46 further includes an enlarged wall portion 64 disposed directly beneath the stop flange 62 . on its inside surface , the proximal end is circumscribed by an annular recess 67 for a purpose which will be described hereinafter . the expansion mandrel 47 includes a distal tapered section 70 that wedgingly engages against and is complementary in shape to the tapered wall section 58 of the shell 46 . the mandrel 47 also includes a cylindrical proximal section 72 that slidably engages against the inner cylindrical wall of the proximal end 50 of the shell 46 . the distal end of the cylindrical proximal section 72 terminates in an annular retention shoulder 74 that is complementary in shape and engageable with the annular stopping shoulder 60 disposed about midway in the inside of the shell 46 . stopping shoulder 60 of the shell 46 and retention shoulder 74 of the mandrel 47 help to prevent the mandrel 47 from being pushed too far toward the distal end of the shell 46 . the mandrel 47 also includes a proximal cylindrical section 72 that is circumscribed by a locking mechanism 76 . this locking mechanism 76 is formed in part by a c - shaped snap ring 78 that is seated within a c - shaped groove 80 around the proximal section 72 of the mandrel 47 as shown . when the mandrel 47 is pushed downwardly into the shell 46 in the position illustrated in fig4 c , the snap ring 78 ( whose resiliency biases it radially outwardly ) snaps into the previously discussed annular recess 67 . the locking mechanism 76 also has a linking pin 82 that is slidably disposed within a radially oriented bore 84 . the linking pin has a tapered distal end that engages a vertically disposed indicator pin 86 , and a flat proximal end that abuts the snap ring 78 . the purpose of the linking pin 82 is to trigger a vertical movement of the indicator pin 86 ( which is slidably disposed within a bore 88 ) when the mandrel 47 is pushed into shell 46 in the position shown in fig4 . a spring 90 biases the indicator pin 86 upwardly . the snap ring 78 causes the linking pin 82 to apply a radially directed force against a tapered section 92 of the indicator pin 86 when the mandrel 47 is in the upward position illustrated in fig4 a . this radially directed force is sufficient to overcome the biasing force of the spring 90 , so that the indicator pin 86 remains in the lower position illustrated in fig4 a so long as the mandrel 47 is not moved . however , when the mandrel 47 is pushed toward the proximal end 50 of the shell 46 so that its annular retention shoulder 74 becomes seated against the stopping shoulder 60 , the snap ring 78 expands into the annular recess 67 , thereby removing the radially directed force pushing the tapered end of the linking pin 82 into the tapered section 92 of the indicator pin 82 . consequently , the indicator pin 86 will pop axially upwardly in its bore 88 until its shoulder 95 ( located immediately below its tapered section 92 ) engages the tapered end of the linking pin 82 . this will result in the indicator head 97 of the indicator pin 86 rising above the outside surface of the tapered mandrel 47 , thereby providing a visual signal to the system operator that the mandrel 47 has been moved to its maximum extent toward the proximal end 50 of the shell 46 . as will be explained hereinafter , the indicator head 97 co - acts with an air valve stem 122 in the hydraulic ram 112 of the installation tool 110 to make an even more manifest visual signal . the last principal component of the improved plug 40 of the invention is the retaining ring 44 . in its interior , the retaining ring 44 includes a concentrically disposed , circular opening 100 for slidably receiving the proximal end 50 of the cylindrical shell 46 and plug body 42 . the inner diameter of the opening 100 is defined by a retaining ledge 101 that engages the stop flange 62 of the plug body 42 when the plug is extended into a flow port 11 . in its exterior , the ring 44 has an annular , wall - engaging face 102 that engages the portion of the outside surface of the core barrel 7 that circumscribes the chamfered portion 37 of the flowport 11 . immediately beneath the wall - engaging face 102 is a tapered shoulder 104 whose angle of taper is preferably about the same as the angle of taper of the chamfered portion 37 . a pair of parallel , opposing handling grooves 105a , 105b are provided along the exterior of the retaining ring 44 in order to facilitate the gripping of the entire plug 40 by the installation tool 110 . finally , a pair of detents 107a , 107b are formed on the inner diameter of the opening 100 of the ring 44 by a pair of shallow bores 109a , 109b ( as is best seen in fig4 b ). these bores create a thin flange of metal adjacent to the edge of the opening 100 that can easily be bent inwardly . the resulting detents 107a , 107b prevent the ring 44 from sliding completely off of the shell 46 after the plug 40 is assembled . fig5 illustrates a second embodiment of the plug 40 that is particularly well adapted for use in flowports 11 having relatively deep chamfered portions 37 . in this embodiment , the retaining ledge 101 is moved downwardly along the longitudinal axis of the plug 40 , and the tapered shoulder 104 is likewise extended in order to provide sufficient tensile strength to the telescopic fit between the stop flange 62 , and the retaining ledge 101 . since the embodiment illustrated in fig5 is in all other respects identical in structure to the embodiment illustrated in fig4 a , 4b and 4c , no further discussion thereof is deemed necessary . with reference now to fig6 a and 6b , the installation tool 110 of the system of the invention generally comprises a compact hydraulic ram 112 for pushing the mandrel 47 into the shell 46 of the plug 40 , and a cradle assembly 114 for retaining the plug 40 during the plug insertion and expansion operation . as will be described in more detail presently , both the compact hydraulic ram 112 and cradle assembly 114 are movably mounted within a rectangular frame 116 having a pair of parallel side members 117a , 117b . specifically , the hydraulic ram 112 is reciprocably movable along the vertical axis of the frame 116 between the side members 117a , 117b , while the cradle assembly 114 is pivotally movable out of the front of the frame 116 ( see fig7 a and 7b ). the compact hydraulic ram 112 includes a front piston 118 and a rear piston 119 which are telescopically interfitted within the square ram body 120 . concentrically disposed in the face of the front telescoping piston 118 is a spring - loaded air valve stem 122 . in operation , the face of the telescoping piston 118 is concentrically aligned with the upper face of the tapered mandrel 47 so that when the mandrel 47 is pushed downwardly into the shell 46 by the combined action of the front and rear pistons 118 , 119 reacting off of the thermal shield 9 , the indicator head 97 of the indicator pin 86 pops up against the air valve stem 122 . the resulting depression of the valve stem 122 generates a stream of bubbles of compressed air flowing out of the front of the ram 112 , which in turn informs the operator of the system that the plug 40 has been expanded into place within its respective flowport 11 . near its top portion , the hydraulic ram 112 includes a retaining bar 123 having an arcuate inner edge 124 that is complementary in shape to the outer edge of the retaining ring 44 of the plug 40 . just above the retaining bar 123 are a pair of fluid lines 125a , 125b for conducting compressed air to the valve stem 122 , and pressurized hydraulic fluid to the pistons 118 and 119 . disposed to one side of the top end of the ram 112 is a slide bar 126 which extends through a slot 127 in the frame 116 . this slide bar 126 is mounted onto a long - handled tool 128 , while the frame 116 of the tool 110 is connected to a second long - handled tool 129 . the foregoing configuration allows the operator of the tool 110 to move the ram 112 up and down within the frame 116 by holding the first long - handled tool 129 steady while reciprocating the ram - connected , long - handled tool 128 . at the bottom of the hydraulic ram 112 are a pair of symmetrically arranged ramps 130a , 130b disposed at approximately a 45 ° angle with respect to the axis of the frame 116 . each of these ramps 130a , 130b has approximately an lshaped cross - section . as will be explained in more detail presently , the 45 ° disposition of the ramps 130a , 130b allows them to wedgingly engage the top of the cradle assembly 114 when the hydraulic ram 112 is slid downwardly within the frame 116 in order to displaceably push the cradle assembly 114 forward and out of the front of the frame 116 . generally , the cradle assembly 114 is formed from an inner cradle 135 that is slidably connected on its sides to an outer cradle 136 . the inner edge of the inner cradle 135 is approximately u - shaped , and is formed from a pair of parallel inner flanges 137a , 137b on its sides , and an arcuate inner edge 138 at its bottom . the inner flanges 137a , 137b are receivable within the previously described grooves 105a , 105b present on opposite sides of the retaining ring 44 of the plug 40 . the shape of the arcuate inner edge 138 is approximately complementary to the outer edge of the retaining ring 44 . the outer edge of the inner cradle 135 is also approximately u - shaped , and includes a pair of outer flanges 139a , 139b which are slidably received within a pair of inner slots 141a , 141b disposed on opposite sides of the outer cradle 136 . the bottom edge of the inner cradle 135 includes a pair of rollers 143a , 143b which allows the inner cradle 135 to roll forward and backward across the bottommost member of the frame 116 . the outer sides of the outer cradle 136 are pivotally connected to the sides of the frame 116 by a pair of opposing parallelogram linkages indicated generally at 146a , 146b . each of these linkages is formed from an inner pivot arm 148a , 148b and an outer pivot arm 150a , 150b . as may best be seen in fig7 a and 7b , pivot arms 148a , 148b and 150a , 150b are of equal length , and overlie one another . each of the inner pivot arms 148a , 148b includes an upper pivot joint 152a , 152b that connects the top end of the arm to an outer side of the outer cradle 136 , as well as a lower pivot joint 153a , 153b that connects the lower end of the inner arm to a side of the frame 116 . similarly , each of the outer pivot arms 150a , 150b includes an upper pivot joint 155a , 155b and a lower pivot joint 156a , 156b that connects the upper and lower ends of these arms to the outer cradle 136 and sides of the frame 116 , albeit at points which are vertically displaced from the upper and lower pivot joints 152a , 152b and 153a , 153b . finally , each of the upper pivot joints 155a , 155b is connected to a side of the frame 116 by means of a spring - biased hook 158a , 158b . the purpose of the spring - biased hooks 158a , 158b is to withdraw the cradle assembly 154 from the position shown in fig7 b to the position shown in fig7 a when the compact hydraulic ram 112 is slid upwardly back into the position shown in fig6 a . while the cradle assembly 114 has been described with specific reference to a parallelogram - type linkage , an equivalent movement could be obtained any number of ways . for example , the vertically arranged arms of the linkages 146a , 146b could be replaced with horizontally arranged pivoting arms that operate between the cradle 136 and the frame 116 in a &# 34 ; carpenter &# 39 ; s ruler &# 34 ; configuration . additionally , guide rails could be placed on the sides of the cradle 135 to ensure a smooth to and fro movement between the cradle assembly 114 and frame 116 . such a configuration would advantageously eliminate the need for inner and outer cradles 135 and 136 , and allow these parts to be consolidated into a single u - shaped cradle . the method of the invention is particularly well suited for plugging the flowports 11 of core barrels 7 having an outside portion which is chamfered 37 , and an inside , cylindrically shaped portion 39 having a relatively small diameter ( i . e ., on the order of 1 . 25 inches ). in the first step of this method , a particular chamfered plug 11 is selected for plugging . both the maximum diameter and the axial extent of the chamfered portion 37 of the flowport 11 are next remotely ascertained by means of a television monitor . an appropriately dimensioned plug 40 is next assembled by choosing a retaining ring 44 whose annular , wall - engaging face 102 is large enough to engage the outside surface of the core barrel 7 as is illustrated in fig4 c and 5 when the plug 40 is inserted into the flowport 11 . additionally , the depth d1 of the retaining ledge 104 is chosen to accommodate the depth l3 , l4 of the chamfered portion 37 of the flowport 11 so that a sufficient amount of the distal end 48 of the cylindrical shell 46 of the plug body 42 engages the non - chamfered portion 39 of the flowport 11 after installation . once the appropriately dimensioned ring 44 has been chosen , the plug 40 is assembled by inserting the distal end 48 of the shell 46 completely through the circular opening 100 of the ring 44 , and creating the detents 107a , 107b by drilling the shallow bores 109a , 109b and bending inwardly the resulting thin flanges of metal adjacent to the opening 100 . in the next step of the method , the assembled plug 40 is detachably mounted onto the installation tool 110 by manually pulling the cradle assembly 114 toward the front of the frame 116 , and sliding the parallel grooves 105a , 105b of the retaining ring 44 over the parallel pair of flanges 137a , 137b of the inner cradle 135 . once this has been accomplished , the operator releases the cradle assembly 114 , which in turn allows the spring - biased hooks 158a , 158b to pull the retaining ring 44 of the plug 40 into the frame 116 and under the compact hydraulic ram 112 in the position shown in fig6 a . long - handled tools 128 and 129 are next mounted on the frame 116 and the slide bar 126 of the installation tool 110 . the plug 40 and installation tool 110 are then manually lowered in the annular space between the core barrel 7 , and the thermal shield 9 . the telescopic engagement between the retaining ring 44 and the cylindrical shell 46 of the plug body 42 allows the plug 40 to assume the contracted configuration shown in fig4 a . the operator then aligns the distal end 48 of the plug 40 with the chamfered portion 37 of a selected flowport 11 , and partially inserts it therein . he then completely inserts the distal end 40 of the plug into the flowport 11 by holding the frame 116 steady while sliding the compact hydraulic ram 112 downwardly within the frame 116 with the long - handled tool 128 . the ramps 130a , 130b extending from the bottom of the compact hydraulic ram 112 wedgingly engage the top ends of the inner and outer pivot arms 148a , 150a , and 148b , 150b , thereby rocking the entire carriage assembly 114 forward . when the bottom edge of the body 120 of the ram 112 finally engages the bottom of the frame 116 , the retaining ring 44 becomes captured between the arcuate inner edge 124 of the retaining bar 123 mounted on the front face of the ram 112 , and the arcuate inner edge 138 of the inner cradle 135 . at the same time , the front telescoping piston 118 becomes concentrically aligned with the proximal face of the tapered mandrel 47 ( see fig7 b ). in the next step of the method , pressurized hydraulic fluid is admitted through fluid line 125b in order to extend the front and rear telescoping pistons 118 and 119 into the positions illustrated in phantom in fig6 b . the rear piston 119 reacts against the thermal shield 9 , while the front piston 118 reacts against the distal face of the tapered mandrel 47 , thereby pushing it downwardly into the position illustrated in fig4 c and fig5 . when the tapered mandrel 47 is seated into its lowermost positions with respect to the cylindrical shell 46 of the plug 40 , the head 97 of the indicator pin 86 pops up in the manner previously described , and strikes the valve stem 122 concentrically disposed within the front telescoping piston 118 . the resulting air bubbles provide a positive visual signal to the operator that the plug 40 has been expanded in place within the core barrel 7 . in the last steps of the method , the flow of pressurized hydraulic fluid through line 125b is ceased , and the front and rear telescoping pistons 118 , 119 withdrawn back into the body 120 of the ram 112 . the operator then pulls the ram 112 upwardly back into the position illustrated in fig7 a . the retaining ring 44 is finally released from the installation tool 110 by pulling the frame away from the mounted plug 40 by means of the long - handled tool 129 connected to the frame 116 , thereby overcoming the force of the spring - biased hooks 158a , 158b and rocking the cradle assembly 114 out of the frame 116 . the retaining ring 44 may then be easily slid out of the installation tool 110 by merely pushing the frame 116 downwardly so that the inner flanges 137a , 137b slide out of the grooves 105a , 105b . the method is repeated until all of the flowports 11 of the core barrel 7 are plugged . | 8 |
typical of the compounds of the formulae ( i ), ( ii ) and ( iii ) useful in this invention are : ______________________________________ mesomorphic range (° c . ) ______________________________________ 4 - n - pentyl - 4 &# 39 ;- cyano - biphenyl ## str4 ## 4 - n - hexyl - 4 &# 39 ;- cyano - biphenyl ## str5 ## 4 - n - heptyl - 4 &# 39 ;- cyano - biphenyl ## str6 ## 4 - n - octyl - 4 &# 39 ;- cyano - biphenyl ## str7 ## 4 - n - pentoxy - 4 &# 39 ;- cyano - biphenyl ## str8 ## 4 - n - hexoxy - 4 &# 39 ;- cyano - biphenyl ## str9 ## 4 - n - heptoxy - 4 &# 39 ;- cyano - biphenyl ## str10 ## 4 - n - octoxy - 4 &# 39 ;- cyano - biphenyl ## str11 ## 4 - n - pentyl - 4 &# 39 ;- cyano - p - terphenyl ## str12 ## ______________________________________ ______________________________________ mesomorphic range (° c . ) ______________________________________ 4 &# 39 ;- cynanophenyl 4 -( p - n - pentylphenyl )- ## str13 ## benzoate 4 &# 39 ;- cynanophenyl 4 -( n - butyl ) benzoate ## str14 ## 4 &# 39 ;- cynanophenyl 4 -( n - pentyl ) benzoate ## str15 ## 4 &# 39 ;- cynanophenyl 4 -( n - hexyl ) benzoate ## str16 ## 4 &# 39 ;- cynanophenyl 4 -( n - heptyl ) benzoate ## str17 ## 4 &# 39 ;- cynanophenyl 4 -( n - pentyl ) thiobenzoate ## str18 ## 4 &# 39 ;- cynanophenyl 4 -( n - propylcarbonyloxy )- ## str19 ## benzoate______________________________________ ( 3 ) cyclohexyl benzene - type liquid crystal substances ( compounds of the formula ( iii )) ______________________________________ mesomorphic range (° c . ) ______________________________________ 4 - n - propylcyclohexyl 4 &# 39 ;- cyanobenzene ## str20 ## 4 - n - pentylcyclohexyl 4 &# 39 ;- cyanobenzene ## str21 ## 4 - n - heptylcyclohexyl 4 &# 39 ;- cyanobenzene ## str22 ## ______________________________________ note : s stands for smectic phase , n nematic phase and mon monotripic liquid crystal . liquid crystal substances for use in field effect mode display devices , when used singly , do not exhibit satisfactory performance because each has its own merit and demerit . for example , compounds of the schiff base type are not useful when evaluated mainly for reliability . azoxy compounds require a yellow filter and have the serious drawback of giving displays of reduced quality . compositions composed of biphenyl - type compounds alone , although having a relatively low viscosity , have a threshold voltage of 1 . 1 volts ( effective value ) at lowest . compounds of the ester type ( including those of the thioester type ) are viscous and have a relatively high mesomorphic range despite their low threshold voltage ( 0 . 8 volt ). cyclohexyl benzene - type compounds are of low viscosity and as low as about 0 . 9 volts in threshold voltage but have poor orientation . we have conducted intensive research and developed useful liquid crystal compositions from the foregoing liquid crystal substances by mixing such substances to compensate for the drawback of each substance while utilizing the advantage thereof . examples of preferred liquid crystal compositions are those prepared from at least one compound of the formula ( i ) and at least one compound of the formula ( ii ). more specific examples are : other examples of preferred liquid crystal compositions are those composed of at least one compound of the formula ( i ), at least one compound of the formula ( ii ) and at least one compound of the formula ( iii ) and including : various characteristics required of these liquid crystals for use in field effect mode liquid crystal display devices will be described below along with the drive systems employed therefor . since the liquid crystal compositions as incorporated in display devices are used at temperatures of about 0 ° c . to 40 ° c ., they must have a mesomorphic range wider than the range of - 10 ° c . to 50 ° c . with a drive system of the direct power cell - coupled type in which the actuating voltage is equal to the cell voltage , the threshold voltage v th of the liquid crystal composition must be approximate to the voltage v o of the cell serving as the power supply and to the bias voltage v bias which is dependent on the drive system . if the threshold voltage is too high relative to the bias voltage , the display will involve poor contrast , whereas if it is too low , non - selected segments will loom up , giving a display of poor quality . table 1 below shows bias voltages v bias and actuating voltages v on for various drive systems . table 1______________________________________ ( in volt ) drive mercury oxide silver oxide lithium cellsystem cell ( 1 . 35 v )* cell ( 1 . 57 v )* ( 2 . 8 v )* bias duty v . sub . bias v . sub . on v . sub . bias v . sub . on v . sub . bias v . sub . on______________________________________1 / 2 1 / 2 0 . 47 1 . 07 0 . 55 1 . 24 0 . 98 2 . 211 / 2 1 / 3 0 . 55 0 . 95 0 . 64 1 . 11 1 . 14 1 . 981 / 3 1 / 2 0 . 45 1 . 01 0 . 52 1 . 17 0 . 93 2 . 081 / 3 1 / 3 0 . 45 0 . 86 0 . 52 0 . 99 0 . 93 1 . 78______________________________________ * cell voltage the voltage v on is the effective value of the voltage on the liquid crystal composition of the selected segments , and the voltage v bias is that of the voltage on the liquid crystal composition of the non - selected segments . the voltages v on and v bias involved in the drive systems are expressed by the following equations . ## equ1 ## the construction of the twisted nematic field effect mode liquid crystal cell ( hereinafter referred to as &# 34 ; tnfem liquid crystal cell &# 34 ;) for which this drive system is employed will be described with reference to fig1 and 2 . fig1 is a plan view , and fig2 is a view in section taken along the line a -- a &# 39 ; in fig1 . these drawings show glass base plates s 1 , s 2 ; transparent segmental electrodes ts 11 to ts 18 , ts 21 to ts 28 , . . . , ts 81 to ts 88 formed on the glass base plate s 1 ; transparent common electrodes tc 1 , tc 2 , tc 3 formed on the glass base plate s 2 ; and terminals a 1 , b 1 , c 1 , a 2 , . . . , b 8 , c 8 led out from the transparent segmental electrodes . the transparent segmental electrodes ts i1 and ts i2 are connected to the terminal a i ; ts i3 , ts i4 , ts i5 to the terminal b i ; and ts i6 , ts i7 , ts i8 to the terminal c i wherein i = 1 , . . . , 8 . indicated at sm is a sealing member . the glass base plates s 1 and s 2 bearing the transprent electrodes are surface - treated and thereafter subjected to rubbing treatment . the rubbing directions are at right angles . the drawings further show polarizing plates p 1 , p 2 with the directions of polarization at right angles , a reflecting plate r and a liquid crystal composition m . the cell is 7 . 5 μm in thickness . fig3 is a time chart showing the wave forms involved in this drive system , namely of the transparent common electrode selection signals h 1 , h 2 , h 3 to be applied to the common electrodes tc 1 , tc 2 , tc 3 respectively , and transparent segmental electrode selection signals a 1 , b 1 , c 1 , a 2 , . . . , c 8 to be applied to the terminals a 1 , b 1 , c 1 , a 2 , . . . , b 8 , c 8 respectively when . is to be displayed at the lowermost place . the cycle of the signals is 5 m . sec . fig4 shows variations in the voltage to be impressed on the liquid crystal composition of the segments . with this 1 / 3 bias 1 / 3 duty drive system , the effective value v on of the voltage to be applied to the liquid crystal composition of the selected segments ts 11 , ts 12 , ts 13 , ts 15 , ts 16 , ts 17 , ts 18 is given by : ## equ2 ## the effective value v bias of the voltage on the liquid crystal composition of the non - selected segments ts 14 , ts 21 , . . . , ts 88 is given by : fig5 is a time chart showing the wave forms involved in this drive system , namely of the transparent common electrode selection signals h 1 , h 2 , h 3 to be applied to the common electrodes tc 1 , tc 2 , tc 3 respectively , and transparent segmental electrode selection signals a 1 , b 1 , c 1 , a 2 , . . . , c 8 to be applied to the terminals a 1 , b 1 , c 1 , a 2 , . . . , b 8 , c 8 respectively when . is to be displayed at the lowermost place . with this 1 / 2 bias 1 / 3 duty drive system , the effective value v on of the voltage to be applied to the liquid crystal composition of the selected segments is given by : ## equ3 ## the effective value v bias of the voltage on the composition of the non - selected segments other than the above is expressed by : ## equ4 ## the construction of the tnfem liquid crystal cell for which this drive system is used will be described with reference to fig6 and 7 . fig6 is a plan view , and fig7 is a view in section taken along the line b - b &# 39 ; in fig6 . the difference of this cell from the cell of fig1 and 2 only will be described . the liquid crystal cell differs from the foregoing cell in that it includes two transparent common electrodes tc 1 , tc 2 and that transparent segmental electrodes are connected to the terminals led out therefrom in a different manner . transparent segmental electrodes ts i1 , ts i2 are connected together and coupled to a terminal a i , ts i3 and ts i5 are connected together and coupled to a terminal b i , ts i4 and ts i8 are connected together and coupled to a terminal c i , ts i6 and ts i7 are connected together and coupled to a terminal d i wherein i = 1 , . . . , 8 . fig8 is a time chart showing the wave forms involved in this drive system , namely of the transparent common electrode selection signals h 1 , h 2 to be applied to the common electrodes tc 1 , tc 2 respectively , and transparent segmental electrode selection signals a 1 , b 1 , c 1 , d 1 , a 2 , . . . , d 8 to be applied to the terminals a 1 , b 1 , c 1 , d 1 , a 2 , . . . , c 8 , d 8 respectively when . is to be displayed at the lowermost place . with this 1 / 2 bias 1 / 2 duty drive system , the effective value v on of the voltage to be applied to the liquid crystal composition of the selected segments is given by : ## equ5 ## the effective value v bias of the voltage on the liquid crystal composition of the non - selected segments is given by : ## equ6 ## fig9 is a time chart showing the wave forms involved in this drive system , namely of the transparent common electrode selection signals h 1 , h 2 to be applied to the common electrode tc 1 , tc 2 respectively , and transparent segmental electrode section signals a 1 , b 1 , c 1 , d 1 , a 2 , . . . , d 8 to be applied to the terminals a 1 , b 1 , c 1 , d 1 , a 2 , . . . , c 8 , d 8 respectively when . is to be displayed at the lowermost place . with this 1 / 3 bias 1 / 2 duty drive system , the effective value v on of the voltage to be applied to the liquid crystal composition of the selected segments is given by : ## equ7 ## the effective value v bias of the voltage on the composition of the non - selected segments other than the above is expressed by : a liquid crystal composition is filled in the liquid crystal cell shown in fig1 and 2 or in fig6 and 7 , and 1 - khz a . c . voltage is applied across the transparent common electrode and transparent segmental electrode of a desired segment , with the voltage value progressively increased . the threshold voltage v th is defined as the effective value of the applied voltage at which the segment starts to produce a display as confirmed by observation . the observation is made in the direction in which θ =+ 60 ° and φ = 0 ° in fig1 ( see fig1 ). the response time is dependent on the cell thickness and drive system of the liquid crystal display device concerned . when these two factors are given , it is proportional to the viscosity of the liquid crystal composition . it is believed that the useful range is limited to not longer than 800 m . sec . since if the time is more than 800 m . sec ., the response appears somewhat slow to the eye . the response time is measured by filling a liquid crystal composition in the cell shown in fig1 and 2 or in fig6 and 7 and applying across the electrodes the voltage determined by the drive system concerned . the measuring system is shown in fig1 . the rise time τ r is defined as the time required for the quantity of light received to reduce to 10 % of the saturation value after the voltage applied to the liquid crystal composition of a desired segment has changed from v bias to v on . the decay time τ d is defined as the time required for the quantity of light received to restore to 90 % of the saturation value after the voltage applied to the composition of the desired segment has changed from v on to v bias . it is desired that the base plates be highly wettable ( i . e . of low surface tension ). if not easily wettable , a display of reduced quality as well as reduced production yield will result . the wettability is evaluated empirically since there is no definite index presently available therefor . the characteristics ( 1 ) to ( 4 ) and power consumption must be maintained at stable levels during storage or operation over a prolonged period of time . thus the liquid crystal composition needs to be chemically stable against heat , water , alkalis and acids . the liquid crystal compositions of this invention will be described below in greater detail with reference to specific examples , to which the invention is in no way limited . ______________________________________4 - n - pentyl - 4 &# 39 ;- cyano - biphenyl 34 . 6 % w / w4 - n - pentoxy - 4 &# 39 ;- cyano - biphenyl 9 . 94 - n - heptyl - 4 &# 39 ;- cyano - biphenyl 20 . 94 - n - pentyl - 4 &# 39 ; cyano - p - terphenyl 6 . 64 &# 39 ;- cyanophenyl 4 -( n - butyl ) benzoate 94 &# 39 ;- cyanophenyl 4 -( n - pentyl ) benzoate 94 &# 39 ;- cyanophenyl 4 -( n - pentyl ) thiobenzoate 10______________________________________ the liquid crystal composition had a mesomorphic range of 60 ° c . to - 25 ° c . ( free from freezing for 5 days ). the expression &# 34 ;- 25 ° c . ( free from freezing for 5 days )&# 34 ; means that the composition did not freeze when allowed to stand at - 25 ° c . for 5 days . to be more accurate , therefore , the lower limit of the mesomorphic range is lower than - 25 ° c . the liquid crystal composition of example 1 was filled in the liquid crystal cell shown in fig1 and 2 or fig6 and 7 , and the resulting device was evaluated . the device was found to have good orientation and satisfactory characteristics with respect to threshold voltage and response time so as to be driven by a single lithium cell . the composition was further tested for orientation as placed in a cell prepared by rubbing and oblique deposition . ( the cell included two base plates for sandwiching the composition , one of the base plates being surface - treated by rubbing and the other base plate having an oblique deposition film formed on the surface thereof .) consequently it was found that if the cell thickness is not larger than 8 μm , the device can be statically driven by a single silver oxide cell . the results of the experiment are as follows : ______________________________________drive system : staticpower supply cell : silver oxide cell ( v . sub . o = 1 . 57 volts ) v . sub . on : 1 . 5 voltscell thickness : 8 μmtemperature : 0 ° c . ______________________________________ it was further visually confirmed that if the response time is not more than 1000 m . sec ., the display turns on and off every second . ______________________________________4 - n - pentyl - 4 &# 39 ;- cyano - biphenyl 33 . 6 % w / w4 - n - pentoxy - 4 &# 39 ;- cyano - biphenyl 9 . 84 - n - heptyl - 4 &# 39 ;- cyano - biphenyl 20 . 34 &# 39 ;- cyanophenyl 4 -( p - n - pentylphenyl ) benzoate 6 . 34 &# 39 ;- cyanophenyl 4 -( n - butyl ) benzoate 104 &# 39 ;- cyanophenyl 4 -( n - pentyl ) benzoate 104 &# 39 ;- cyanophenyl 4 -( n - pentyl ) thiobenzoate 10______________________________________ the liquid crystal composition had a mesomorphic range of 58 . 2 ° c . to - 25 ° c . ( free from freezing for 5 days ) and good orientation and was suitable in threshold voltage and response time so as to be driven by a single power cell . ______________________________________4 - n - pentyl - 4 &# 39 ;- cyano - biphenyl 30 % w / w4 - n - pentoxy - 4 &# 39 ;- cyano - biphenyl 84 - n - pentyl - 4 &# 39 ;- cyano - p - terphenyl 84 - heptyl - 4 &# 39 ; cyano - biphenyl 104 &# 39 ;- cyanophenyl 4 -( n - butyl ) benzoate 124 &# 39 ;- cyanophenyl 4 -( n - pentyl ) benzoate 174 &# 39 ;- cyanophenyl 4 -( n - heptyl ) benzoate 104 &# 39 ;- cyanophenyl 4 -( n - propylcarbonyloxy ) benzoate 5______________________________________ the liquid crystal composition had a mesomorphic range of 60 . 5 ° c . to - 25 ° c . ( free from freezing for 5 days ) and good orientation and was suitable in threshold voltage and response time so as to be driven by a single power cell . ______________________________________4 - n - pentyl - 4 &# 39 ;- cyano - biphenyl 33 . 6 % w / w4 - n - pentoxy - 4 &# 39 ;- cyano - biphenyl 9 . 84 &# 39 ;- cyanophenyl 4 -( n - pentylphenyl ) benzoate 6 . 34 - n - pentylcyclohexyl 4 &# 39 ;- cyanobenzene 20 . 34 &# 39 ;- cyanophenyl 4 -( n - butyl ) benzoate 104 &# 39 ;- cyanophenyl 4 -( n - pentyl ) benzoate 104 &# 39 ;- cyanophenyl 4 -( n - pentyl ) thiobenzoate 10______________________________________ the liquid crystal composition had a mesomorphic range of 60 . 8 ° c . to - 25 ° c . ( free from freezing for 5 days ) and was found to be fully satisfactory in orientation despite the use of the cyclohexyl benzene - type liquid crystal substance . the composition was suitable in threshold voltage and response time so as to be dynamically driven by a single lithium cell . ______________________________________4 - n - pentyl - 4 &# 39 ;- cyano - biphenyl 28 . 8 % w / w4 - n - pentoxy - 4 &# 39 ;- cyano - biphenyl 8 . 44 &# 39 ;- cyanophenyl 4 -( p - n - pentylphenyl ) benzoate 5 . 44 - n - propylcyclohexyl 4 &# 39 ;- cyanobenzene 17 . 44 &# 39 ;- cyanophenyl 4 -( n - butyl ) benzoate 104 &# 39 ;- cyanophenyl 4 -( n - pentyl ) benzoate 104 &# 39 ;- cyanophenyl 4 -( n - hexyl ) benzoate 104 &# 39 ;- cyanophenyl 4 -( n - pentyl ) thiobenzoate 10______________________________________ the liquid crystal composition had a mesomorphic range of 60 . 5 ° c . to - 25 ° c . ( free from freezing for 5 days ) and good orientation . the composition was also found suitable in both threshold voltage and response time for dynamic drive with use of a single lithium cell . ______________________________________4 - n - pentyl - 4 &# 39 ;- cyano - biphenyl 30 % w / w4 - n - pentoxy - 4 &# 39 ;- cyano - biphenyl 84 - n - pentyl - 4 &# 39 ;- cyano - p - terphenyl 84 &# 39 ;- cyanophenyl 4 -( n - butyl ) benzoate 124 &# 39 ;- cyanophenyl 4 -( n - pentyl ) benzoate 174 &# 39 ;- cyanophenyl 4 -( n - heptyl ) benzoate 104 &# 39 ;- cyanophenyl 4 -( n - propylcarbonyloxy ) benzoate 5 % w / w4 - n - pentylcyclohexyl 4 &# 39 ;- cyanobenzene 10______________________________________ ______________________________________4 - n - pentyl - 4 &# 39 ;- cyano - biphenyl 30 % w / w4 - n - pentoxy - 4 &# 39 ;- cyano - biphenyl 84 - n - pentyl - 4 &# 39 ;- cyano - p - terphenyl 84 - n - heptyl - 4 &# 39 ;- cyano - biphenyl 104 &# 39 ;- cyanophenyl 4 -( n - butyl ) benzoate 124 &# 39 ;- cyanophenyl 4 -( n - pentyl ) benzoate 174 &# 39 ;- cyanophenyl 4 -( n - propylcarbonyloxy ) benzoate 54 - n - pentylcyclohexyl 4 &# 39 ;- cyanobenzene 10______________________________________ ______________________________________4 - n - pentyl - 4 &# 39 ;- cyano - biphenyl 29 . 9 % w / w4 - n - pentoxy - 4 &# 39 ;- cyano - biphenyl 84 - n - pentyl - 4 &# 39 ;- cyano - p - terphenyl 84 &# 39 ;- cyanophenyl 4 - n -( butyl ) benzoate 124 &# 39 ;- cyanophenyl 4 -( n - pentyl ) benzoate 174 &# 39 ;- cyanophenyl 4 -( n - propylcarbonyloxy ) benzoate 54 - n - butylcyclohexyl 4 &# 39 ;- cyanobenzene 6 . 74 - n - pentylcyclohexyl 4 &# 39 ;- cyanobenzene 6 . 74 - n - heptylcyclohexyl 4 &# 39 ;- cyanobenzene 6 . 7______________________________________ the liquid crystal compositions of examples 6 to 8 had mesomorphic ranges of 61 . 1 ° c . to - 25 ° c ., 59 . 3 ° c . to - 25 ° c . and 59 . 7 ° c . to - 25 ° c . respectively in the order mentioned and were free of freezing at - 25 ° c . for 5 days . they had good orientation and were found suitable in both threshold voltage and response time for dynamic drive with use of a single lithium cell . table 2 below shows characteristics ( threshold voltage and response time ) of the liquid crystal compositions of this invention in comparison with those of various like compositions heretofore known . table 2______________________________________ τ ( 1 / 2 bias 1 / 2 τ ( 1 / 3 bias 1 / 3comp . v . sub . th ( volts ) duty ) ( m . sec .) no . 25 ° c . 0 ° c . τ . sub . r ( 0 ° c .) τ . sub . d ( 0 ° c .) τ . sub . r ( 0 ° c .) τ . sub . d ( 0 ° c .) ______________________________________1 0 . 94 1 . 12 600 210 1250 2102 0 . 86 1 . 02 350 250 800 2503 0 . 93 1 . 06 -- -- 800 2104 0 . 86 1 . 00 340 220 750 2205 0 . 88 1 . 06 330 260 690 2606 0 . 92 1 . 07 -- -- 920 2007 0 . 94 1 . 07 -- -- 760 1908 0 . 92 1 . 09 -- -- 800 1709 1 . 16 1 . 33 580 330 980 33010 1 . 11 1 . 33 420 310 990 31011 1 . 12 1 . 24 600 600 1600 60012 1 . 0 1 . 19 580 470 920 47013 0 . 91 1 . 05 450 380 800 38014 0 . 93 1 . 04 450 240 1000 240______________________________________ in table 2 above 1 : example 1 of this invention 2 : example 2 of this invention 3 : example 3 of this invention 4 : example 4 of this invention 5 : example 5 of this invention 6 : example 6 of this invention 7 : example 7 of this invention 8 : example 8 of this invention 9 : e7 ( product of merck & amp ; co ., inc .) 10 : e8 ( product of merck & amp ; co ., inc .) 11 : e9 ( product of merck & amp ; co ., inc .) 12 : roce 200 ( product of hoffmannlaroche inc .) 13 : tn 132 ( product of hoffmannlaroche inc .) 14 : tn 430 ( product of hoffmannlaroche inc .) v . sub . th : threshold voltage τ : response time τ . sub . r : rise time τ . sub . d : decay time measuring conditions liquid crystal cell used : one shown in fig1 and 2 or in fig6 and 7 ( 7 . 5 μm in cell thickness ) drive system : 1 / 3 bias 1 / 3 duty drive or 1 / 2 bias 1 / 2 duty drive v . sub . on : 2 . 21 volts ( 1 / 2 bias 1 / 2 duty drive system ) 1 . 78 volts ( 1 / 3 bias 1 / 3 duty drive system ) v . sub . bias : 0 . 98 volt ( 1 / 2 bias 1 / 2 duty drive system ) 0 . 93 volt ( 1 / 3 bias 1 / 3 duty drive system ) power supply cell : lithium cell | 2 |
in one embodiment the invention encompasses an assay for determining the cyclooxygenase - 2 activity of a sample comprising the steps of : ( b ) determining the amount of prostaglandin e 2 produced in step ( a ). for purposes of this specification human osteosarcoma cells are intended to include , but are not limited to human osteosarcoma cell lines available from atcc rockville , md . such as osteosarcoma 143b is ( attc crl 8303 ) and osteosarcoma 143b pml bk tk ( atcc crl 8304 . we have found useful , osteosarcoma 143 . 98 . 2 which was originally obtained from dr . william sugden , mcardle laboratory for cancer research , university of wisconsin - madison . we have now made a budapest treaty deposit of osteosarcoma 143 . 98 . 2 with atcc on dec . 22 , 1992 under the identification human osteosarcoma 143 . 98 . 2 ( now atcc crl 11226 ). for purposes of this specification the osteosarcoma cell preparation shall be defined as an aqueous mono layer or suspension of human osteosarcoma cells , a portion of which will catalyze the synthesis of pge2 . furthermore the preparation contains a buffer such as hank &# 39 ; s balanced salt solution . within this embodiment is the genus where the human osteosarcoma cells are from the osteosarcoma 143 family of cell types including osteosarcoma 143b and 143b pml bk tk ; we have used osteosarcoma 143 . 98 . 2 . for purposes of this specification the osteosarcoma cell preparation also includes human osteosarcoma microsomes , said a portion of which will catalyze the synthesis of pge 2 . the microsomes may be obtained as described below from any of the osteosarcoma cell lines herein disclosed . ( a ) an osteosarcoma cell preparation , having 10 3 to 10 9 osteosarcoma cells per cc of cell preparation , and ( b ) 0 . 1 to 50 μl of peroxide - free arachidonic acid per cc of cell preparation . typically the cell preparation will be grown as a monolayer ann used in an aliquot of 8 . 2 × 10 4 to 2 × 10 6 cells per well ( of approximately 1 cc working volume ) as described in the protocol below . arachidonic acid is typically used in amounts of 1 to 20 ul per well of approximately 1 cc working volume . when osteosarcoma microsomes are used instead of whole cells , the cell preparation will typically comprise 50 to 500 ug of microsomal protein per cc of cell preparation . arachidonic acid is typically used in amounts of 1 to 20 μl acid per cc of cell preparation . in a third embodiment the invention encompasses an assay for determining the cyclooxygenase - 1 activity of a sample comprising the steps of : ( 1 ) a cell preparation , said cells capable of expressing cyclooxygenase - 1 , but not expressing cyclooxygenase - 2 , ( b ) determining the amount of prostaglandin e 2 produced in step ( a ). for purposes of this specification cells capable of expressing cyclooxygenase - 1 but incapable of expressing cyclooxygenase - 2 , includes the human histiocytic lymphoma cells such as u - 937 ( atcc crl 1593 ). such cells are hereinafter described as cox - 1 cells . for purposes of this specification the cell preparation shall be defined as an aqueous suspension of cell , typically at a concentration of 8 × 10 5 to 1 × 10 7 cells / ml . the suspension will contain a buffer as defined above . in a fourth embodiment the invention encompasses a human cyclooxygenase - 2 which is shown in fig1 . this cyclooxygenase - 2 is also identified as seq . id . no : 10 :. in a fifth embodiment the invention encompasses a human cyclooxygenase - 2 cdna which is shown in fig2 or a degenerate variation thereof . this cyclooxygenase - 2 cdna is also identified as seq . id . no : 11 :. within this embodiment is the reading frame portion of the sequence shown in fig2 encoding the cyclooxygenase - 2 shown in fig1 ; said portion being bases 97 through 1909 . as will be appreciated by those of skill in the art , there is a substantial amount of redundency in the set of codons which translate specific amino acids . accordingly , the invention also includes alternative base sequences wherein a codon ( or codons ) are replaced with another codon , such that the amino acid sequence translated by the dna sequence remains unchanged . for purposes of this specification , a sequence bearing one or more such replaced codons will be defined as a degenerate variation . also included are mutations ( exchange of individual amino acids ) which produce no significant effect in the expressed protein . in a sixth embodiment the invention encompasses a system for stable expression of cyclooxygenase - 2 as shown in fig2 or a degenerate variation thereof comprising : ( a ) an expression vector such as vacinia expression vector ptm1 , baculovirus expression vector pjvetlz , pul941 and pacmp1 invitrogen vectors pcep4 and pcdnai ; and ( b ) a base sequence encoding human cyclooxygenase - 2 as shown in fig2 or a degenerate variation thereof . in one genus of this embodiment cyclooxygenase - 2 is expressed in sf9 or sf21 cells ( invitrogen ). a variety of mammalian expression vectors may be used to express recombinant cyclooxygenase - 2 in mammalian cells . commercially available mammalian expression vectors which may be suitable for recombinant cyclooxygenase - 2 expression , include but are not limited to , pmc1neo ( stratagene ), pxt1 ( stratagene ), psg5 ( stratagene ), ebo - psv2 - neo ( atcc 37593 ) pbpv - 1 ( 8 - 2 ) ( atcc 37110 ), pdbpv - mmtneo ( 342 - 12 ) ( atcc 37224 ), prsvgpt ( atcc 37199 ), prsvneo ( atcc 37198 ), psv2 - dhfr ( atcc 37146 ), puctag ( atcc 37460 ), and gzd35 ( atcc 37565 ). dna encoding cyclooxygenase - 2 may also be cloned into an expression vector for expression in a recombinant host cell . recombinant host cells may be prokaryotic or eukaryotic , including but not limited to bacteria , yeast , mammalian cells including but not limited to cell lines of human , bovine , porcine , monkey and rodent origin , and insect cells including but not limited to drosophila derived cell lines . cell lines derived from mammalian species which may be suitable and which are commercially available , include but are not limited to , cv - 1 ( atcc ccl 70 ), cos - 1 ( atcc crl 1650 ), cos - 7 ( atcc crl 1651 ), cho - k1 ( atcc ccl 61 ), 3t3 ( atcc ccl 92 ), nih / 3t3 ( atcc crl 1658 ), hela ( atcc ccl 2 ), c127i ( atcc crl 1616 ), bs - c - 1 ( atcc ccl 26 ) and mrc - 5 ( atcc ccl 171 ). the expression vector may be introduced into host cells via any one of a number of techinques including but not limited to transformation , transfection , protoplast fusion , and electroporation . the expression vector - containing cells are clonally propagated and individually analyzed to determine whether they produce cyclooxygenase - 2 protein . identification of cyclooxygenase - 2 expressing host cell clones may be done by several means , including but not limited to immunological reactivity with anti - cyclooxygenase - 2 antibodies , and the presence of host cell - associated cyclooxygenase - 2 activity . expression of cyclooxygenase - 2 dna may also be performed using in vitro produced synthetic mrna . synthetic mrna can be efficiently translated in various cell - free systems , including but not limited to wheat germ extracts and reticulocyte extracts , as well as efficiently translated in cell based systems , including but not limited to microinjection into frog oocytes , with microinjection into frog oocytes being preferred . to determine the cyclooxygenase - 2 cdna sequence ( s ) that yields optimal levels of enzymatic activity and / or cyclooxygenase - 2 protein , cyclooxygenase - 2 cdna molecules including but not limited to the following can be constructed : the full - length open reading frame of the cyclooxygenase - 2 cdna ( base 97 to base 1909 ). all constructs can be designed to contain none , all or portions of the 3 &# 39 ; untranslated region of cyclooxygenase - 2 cdna ( base 1910 - 3387 ). cyclooxygenase - 2 activity and levels of protein expression can be determined following the introduction , both singly and in combination , of these constructs into appropriate host cells . following determination of the cyclooxygenase - 2 cdna cassette yielding optimal expression in transient assays , this cyclooxygenase - 2 cdna construct is transferred to a variety of expression vectors , including but not limited to mammalian cells , baculovirus - infected insect cells , e . coli , and the yeast s . cerevisiae . mammalian cell transfectants , insect cells and microinjected oocytes are assayed for both the levels of cyclooxygenase - 2 enzymatic activity and levels of cyclooxygenase - 2 protein by the following methods . the first method for assessing cyclooxygenase - 2 enzymatic activity involves the incubation of the cells in the presence of 20 μm arachidonic acid for 10 minutes and measuring the pge 2 production by eia . the second method for detecting cyclooxygenase - 2 activity involves the direct measurement of cyclooxygenase - 2 activity in cellular lysates or microsomes prepared from mammalian cells transfected with cyclooxygenase - 2 cdna or oocytes injected with cyclooxygenase - 2 mrna . this assay can be performed by adding arachidonic acid to lysates and measuring the pge2 production by eia . levels of cyclooxygenase - 2 protein in host cells is quantitated by immunoaffinity and / or ligand affinity techniques . cyclooxygenase - 2 specific affinity beads or cyclooxygenase - 2 specific antibodies are used to isolate 35 s - methionine labelled or unlabelled cyclooxygenase - 2 protein . labelled cyclooxygenase - 2 protein is analyzed by sds - page . unlabelled cyclooxygenase - 2 protein is detected by western blotting , elisa or ria assays employing cyclooxygenase - 2 specific antibodies . following expression of cyclooxygenase - 2 in a recombinant host cell , cyclooxygenase - 2 protein may be recovered to provide cyclooxygenase - 2 in active form , capable of participating in the production of pge 2 . several cyclooxygenase - 2 purification procedures are available and suitable for use . as described above for purification of cyclooxygenase - 2 from natural sources , recombinant cyclooxygenase - 2 may be purified from cell lysates and extracts , by various combinations of , or individual application of salt fractionation , ion exchange chromatography , size exclusion chromatography , hydroxylapatite adsorption chromatography and hydrophobic interaction chromatography . in addition , recombinant cyclooxygenase - 2 can be separated from other cellular proteins by use of an immuno - affinity column made with monoclonal or polyclonal antibodies specific for full length nascent cyclooxygenase - 2 . for the cyclooxygenase - 2 and cyclooxygenase - 1 assays , human osteosarcoma cells were cultured and used in aliquots of typical 8 × 10 4 to 2 × 10 6 cells / well . we have found it convenient to culture the cells in 1 ml of media in 24 - well multidishes ( nunclon ) until essentially confluent . the number of cells per assay may be determined from replicate plates prior to assays , using standard procedures . prior to the assay , the cells are washed with a suitable buffer such as hanks balanced salts solution ( hbss ; sigma ), preferably prewarmed to 37 ° c . approximately 0 . 5 to 2 ml is then added per well . prior to the assays , the appropriate number of cox - 1 cells ( 10 5 to 10 7 cells / ml ) are removed from cultures and concentrated such as by centrifugation at 300 × g for 10 minutes . the supernatant is decanted and cells washed , in a suitable buffer . preferably , cells are again concentrated , such as by centrifugation at 300 × g for 10 minutes and resuspended to a final cell density of approximately 1 . 5 × 10 6 cells / ml , preferably in prewarmed hbss . following incubation of human osteosarcoma cells or cox - 1 cells in a suitable buffer , test compound and / or vehicle samples ( such as dmso ) are added , and the resulting composition gently mixed . preferably the assay is performed in triplicate . the arachidonic acid is then added in proportions as described above . we prefer to incubate the cells for approximately 5 minutes at 30 ° to 40 ° c ., prior to the addition of the of peroxide - free arachidonic acid ( cayman ) diluted in a suitable buffer such as hbss . control samples should contain ethanol or other vehicle instead of arachidonic acid . a total reaction incubation time of 5 to 10 minutes at to 37 ° c . has proven satisfactory . for osteosarcoma cells , reactions may be stopped by the addition hcl or other acid , preferably combined with mixing , or rapid removal of media directly from cell monolayers . for u - 937 cells , reactions may be advantageously be performed in multiwell dishes or microcentrifuge tubes and stopped by the addition of hcl or other mineral acid . typically , samples assayed in 24 - multidishes are then transferred to microcentrifuge tubes , and all samples frozen on dry ice . similarly , samples are typically stored at - 20 ° c . or below prior to analysis of pge 2 levels . stored osteosarcoma 143 and u - 937 samples are thawed , if frozen , and neutralized , if stored in acid . samples are then preferably mixed , such as by vortexing , and pge 2 levels measured using a pge 2 enzyme immunoassay , such as is commercially available from cayman . we have advantageously conducted the plating , washing and colour development steps as an automated sequence using a biomek 1000 ( beckman ). in our preferred procedure , following the addition of ellmans reagent , color development is monitored at 415 nm using the biorad model 3550 microplate reader with microplate manager / pc data analysis software . levels of pge 2 are calculated from the standard curve , and may optionally determined using beckman immunofit eia / ria analysis software . in the absence of the addition of exogenous arachidonic acid , levels of pge 2 in samples from both human osteosarcoma cells and cox - 1 cells are approximately typically 0 . 1 to 2 . 0 ng / 10 6 cells . in the presence of arachidonic acid , levels of pge 2 in samples from these cell lines increased to approximately 5 to 10 fold in osteocsarcoma cells and 50 to 100 fold in cox - 1 cells . for purposes of this specification , cellular cyclooxygenase activity in each cell line is defined as the difference between pge 2 levels in samples incubated in the absence or presence of arachidonic acid , with the level of detection being approximately 10 pg / sample . inhibition of pge 2 synthesis by test compounds is calculated between pge 2 levels in samples incubated in the absence or presence of arachidonic acid . human osteosarcoma cells may be grown and maintained in culture as described above . 10 5 to 10 7 cells are plated in tissue culture plates such as available from nunclon and maintained in culture for 2 to 7 days . cells may be washed with a suitable buffer such phosphate buffered saline , ph 7 . 2 , ( pbs ). cells are then removed from the plate , preferably by scraping into pbs . samples may then be concentrated , such as by centrifuging at 400 × g for 10 minutes at 4 ° c . cell pellets or other concentrate are either stored at a suitable reduced temperature such as - 80 ° c ., or processed immediately . all further manipulations of the cells are preferably performed at 0 °- 4 ° c . cell pellets or concentrates obtained from two tissue culture plates are resuspended in a standard protective buffer , such as tris - cl , ph 7 . 4 , containing 10 mm edta , 1 mm phenyhnethylsulfonylfiuoride , 2 μg / ml leupeptin , 2 μg / ml aprotinin , and 2 μg / ml soybean trypsin inhibitor and blended or homogenized , such as by sonication for three × 5 seconds using a 4710 series ultrasonic homogenizer ( cole - parmer ) set at 75 % duty cycle , power level 3 . enriched microsomal preparations are then prepared , such as by diferential centrifugation to yield an enriched microsomal preparation . in our prefered procedure , the first step consists of four sequential centrifugations of the cell homogenate at 10 , 000 × g for 10 min at 4 ° c . after each centrifugation at 10 , 000 × g the supernatant is retained and recentrifuged . following the fourth centrifugation , the supernatant is centrifuged at 100 , 000 × g for 60 - 90 min at 4 ° c . to pellet the microsomal fraction . the 100 , 000 × g supernatant is discarded and the 100 , 000 × g microsomal pellet is resuspended in a suitable buffer such as 0 . 1m tris - cl , ph 7 . 4 , containing 10 mm edta and 0 . 25 mg / ml delipidized bovine serum albumin ( collaborative research incorporated ). the resulting microsomal suspension is recentrifuged such as at 100 , 000 × g for 90 min at 4 ° c . to recover the microsomes . following this centrifugation the microsomal pellet is resuspended in a stabilizing buffer , such as 0 . 1 m tris - cl , ph 7 . 4 , containing 10 mm edta at a protein concentration of approximately 2 - 5 mg / ml . aliquots of osteosarcoma microsomal preparations may be stored at low temperature , such as at - 80 ° c . and thawed prior to use . as may be apreciated by those of skill in the art , human or serum albumin or other albumin , may be used as an alternative to bsa . applicants have found that while the procedure may be carried out using standard bsa or other albumin , delipidized bsa is preferred . in particular , by use of delipidized bsa , endogenous microsomal arachidonic acid can be reduced by a factor of 2 or greater , such that the arachidonic acid produced in the assay constituted at least 90 % of the total . as may be appreciated by those of skill in the art , other lipid adsorbing or sequestering agents may also be used . for purposes of this specification microsomes from which the exogenous arachidonic acid has been reduced by a factor of approximately 2 or more shall be considered to be microsomes that are substantially free of exogenous arachidonic acid . cox - 1 cells are grown and maintained in culture as described above , washed in a suitable buffer , such as pbs , and cell pellets or concentrates stored , preferably at - 80 ° c . cell pellets or concentrates corresponding to approximately 10 9 to 10 10 cells were resuspended in a suitable buffer , such as 10 ml of 0 . 1m tris - hcl , ph 7 . 4 and blended or homogenized , such as by sonication for 2 × 5 seconds and 1 × 10 seconds using a 4710 series ultrasonic homogenizer ( cole - parmer ) set at 75 % duty cycle , power level 3 . the cell homogenate is then concentrated and resuspended . in our preferred procedure the cell homogenate is centrifuged at 10 , 000 × g for 10 minutes at 4 ° c . the supernatant fraction is then recentrifuged at 100 , 000 × g for 2 hours at 4 ° c ., and the resulting microsomal pellet resuspended in a suitable buffer , such as 0 . 1m tris - hcl , 1 mm edta , ph 7 . 4 to a protein concentration of approximately 1 to 10 mg / ml . aliquots of osteosarcoma microsomal preparations may be stored at reduced temperature and thawed prior to use . microsomal preparations from human osteosarcoma and cox - 1 cells are diluted in buffer , such as 0 . 1m tris - hcl , 10 mm edta , ph 7 . 4 , ( buffer a ) to a protein concentration of 50 to 500 μg / ml . 10 to 50 μl of test compound or dmso or other vehicle is added to 2 to 50 μl of buffer a . 50 to 500 μl of microsome suspension is then added , preferably followed by mixing and incubation for 5 minutes at room temperature . typically , assays are perforated in either duplicate or triplicate . peroxide - free arachidonic acid ( cayman ) in buffer a is then added to a final concentration of 20 μm arachidonic acid , followed by incubation , preferably at room temperature for 10 to 60 minutes . control samples contained ethanol or other vehicle instead of arachidonic acid . following incubation , the reaction was terminated by addition of hcl or other mineral acid . prior to analysis of pge 2 levels , samples were neutralized . levels of pge 2 in samples may be quantitated as described for the whole cell cyclooxygenase assay . cyclooxygenase activity in the absence of test compounds was determined as the difference between pge 2 levels in samples incubated in the presence of arachidonic acid or ethanol vehicle , and reported as ng of pge 2 / mg protein . inhibition of pge 2 synthesis by test compounds is calculated between pge 2 levels in samples incubated in the absence or presence of arachidonic acid . human osteosarcoma 143 . 98 . 2 cells were cultured in dulbeccos modified eagles medium ( sigma ) containing 3 . 7 g / l nahco 3 ( sigma ), 100 μg / l gentamicin ( gibco ), 25 mm hepes , ph 7 . 4 ( sigma ), 100 iu / ml penicillin ( flow labs ), 100 μg / ml streptomycin ( flow labs ), 2 mm glutamine ( flow labs ) and 10 % fetal bovine serum ( gibco ). cells were maintained at 37 ° c ., 6 % co 2 in 150 cm 2 tissue culture flasks ( corning ). for routine subculturing , media was removed from confluent cultures of cells , which were then incubated with 0 . 25 % trypsin / 0 . 1 % edta ( jrh biosciences ) and incubated at room temperature for approximately 5 minutes . the trypsin solution was then aspirated , and cells resuspended in fresh medium and dispensed at a ratio of 1 : 10 or 1 : 20 into new flasks . u - 937 cells ( atcc crl 1593 ) were cultured in 89 % rpmi - 1640 ( sigma ), 10 % fetal bovine serum ( gibco ), containing 50 iu / ml penicillin ( flow labs ), 50 μg / ml streptomycin ( flow labs ) and 2 g / l nahco 3 ( sigma ). cells were maintained at a density of 0 . 1 - 2 . 0 × 10 6 / ml in 1 liter spinner flasks ( corning ) at 37 ° c ., 6 % co 2 . for routine subculturing , cells were diluted in fresh medium and transferred to fresh flasks . for cyclooxygenase assays , osteosarcoma 143 . 98 . 2 cells were cultured in 1 ml of media in 24 - well multidishes ( nunclon ) until confluent . the number of cells per assay was determined from replicate plates prior to assays , using standard procedures . immediately prior to cyclooxygenase assays , media was aspirated from cells , and the cells washed once with 2 ml of hanks balanced salts solution ( hbss ; sigma ) prewarmed to 37 ° c . 1 ml of prewarmed hbss was then added per well . immediately prior to cyclooxygenase assays , the appropriate number of u - 937 cells were removed from spinner cultures and centrifuged at 300 × g for 10 minutes . the supernatant was decanted and cells washed in 50 ml of hbss prewarmed to 37 ° c . cells were again pelleted at 300 × g for 10 minutes and resuspended in prewarmed hbss to a final cell density of approximately 1 . 5 × 10 6 cells / ml . 1 ml aliquots of cell suspension were transferred to 1 . 5 ml microcentrifuge tubes or 24 - well multidishes ( nunclon ). following washing and resuspension of osteosarcoma 143 and l - 937 cells in 1 ml of hbss , 1 μl of test compounds or dmso vehicle were added , and samples gently mixed . all assays were performed in triplicate . samples were then incubated for 5 minutes at 37 ° c ., prior to the addition of 10 μl of peroxide - free arachidonic acid ( cayman ) diluted to 1 μm in hbss . control samples contained ethanol vehicle instead of arachidonic acid . samples were again gently mixed and incubated for a further 10 minutes at 37 ° c . for osteosarcoma cells , reactions were then stopped by the addition of 100 μl of 1n hcl , with mixing , or by the rapid removal of media directly from cell monolayers . for u - 937 cells , reactions in multiwell dishes or microcentrifuge tubes were stopped by the addition of 100 μl of 1n hcl , with mixing . samples assayed in 24 - multidishes were then transferred to microcentrifuge tubes , and all samples were frozen on dry ice . samples were stored at - 20 ° c . prior to analysis of pge 2 levels . osteosarcoma 143 . 98 . 2 and u - 937 samples were thawed , and 100 μl of 1n naoh added to samples to which 1n hcl had been added prior to freezing . samples were then mixed by vortexing , and pge 2 levels measured using a pge 2 enzyme immunoassay ( cayman ) according to the manufacturers instructions . the plating , washing and colour development steps of this procedure were automated using a biomek 1000 ( beckman ). following the addition of ellmans reagent , color development was monitored at 415 nm using the biorad model 3550 microplate reader with microplate manager / pc data analysis software . levels of pge 2 were calculated from the standard curve determined using beckman immunofit eia / ria analysis software . in the absence of the addition of exogenous arachidonic acid , levels of pge 2 in samples from both osteosarcoma 143 cells and u - 937 cells were generally 2 ng / 10 6 cells . in the presence of arachidonic acid , levels of pge 2 in samples from these cell lines increased to approximately 5 to 10 fold in osteosarcoma cells and 50 to 100 fold in u - 937 cells . table 1 show the effects of a series of non - steroidal antiinflammatory compounds on pge 2 synthesis by human osteosarcoma 143 cells and u - 937 cells in response to exogenous arachidonic acid . table 1______________________________________ concentra - osteosarcoma 143 u - 937 tion pge2 pge2sample nm ng / 10 . sup . 6 cells______________________________________aa -- 1 . 8 0 . 15aa , no inhibitor -- 8 . 6 17 . 7ns - 389 100 . 0 0 . 8 18 . 9 30 . 0 1 . 1 17 . 7 10 . 0 3 . 0 20 . 4 3 . 0 2 . 7 18 . 3 1 . 0 3 . 2 17 . 7 0 . 3 8 . 3 18 . 3ibuprofen 100 , 000 2 . 5 1 . 1 10 , 000 5 . 7 5 . 5 1 , 000 5 . 4 14 . 3 300 10 . 8 15 . 8 100 12 . 8 17 . 1 10 12 . 5 16 . 4______________________________________ osteosarcoma 143 . 98 . 2 cells were grown and maintained in culture as described above . 3 × 10 6 cells were plated in 245 × 245 × 20 mm tissue culture plates ( nunclon ) and maintained in culture for 5 days . cells were washed twice with 100 ml of phosphate buffered saline , ph 7 . 2 , ( pbs ) and then scraped from the plate with a sterile rubber scraper into pbs . samples were then centrifuged at 400 × g for 10 minutes at 4 ° c . cell pellets were either stored at - 80 ° c . until use or processed immediately . all further manipulations of the cells were performed at 0 °- 4 ° c . cell pellets obtained from two tissue culture plates were resuspended in 5 ml of 0 . 1m tris - cl , ph 7 . 4 , containing 10 mm edta , 1 mm phenyhnethylsulfonylfluoride , 2 μg / ml leupeptin , 2 μg / ml aprotinin , and 2 μg / ml soybean trypsin inhibitor and sonicated for three × 5 seconds using a 4710 series ultrasonic homogenizer ( cole - parmer ) set at 75 % duty cycle , power level 3 . the cell homogenates were then subjected to a differential centrifugation protocol to yield an enriched microsomal preparation . the first step consisted of four sequential centrifugations of the cell homogenate at 10 , 000 × g for 10 min at 4 ° c . after each centrifugation at 10 , 000 × g the supernatant was retained and recentrifuged . following the fourth centrifugation , the supernatant was centrifuged at 100 , 000 × g for 60 - 90 min at 4 ° c . to pellet the microsomal fraction . the 100 , 000 × g supernatant was discarded and the 100 , 000 × g microsomal pellet was resuspended in 8 mls of 0 . 1m tris - cl , ph 7 . 4 , containing 10 mm edta and 0 . 25 mg / ml delipidized bovine serum albumin ( collaborative research incorporated ). the resulting microsomal suspension was recentrifuged at 100 , 000 × g for 90 min at 4 ° c . to recover the microsomes . following this centrifugation the microsomal pellet was resuspended in 0 . 1m tris - cl , ph 7 . 4 , containing 10 mm edta at a protein concentration of approximately 2 - 5 mg / ml . 500 μl aliquots of osteosarcoma microsomal preparations were stored at - 80 ° c . and thawed on ice immediately prior to use . u - 937 cells were grown and maintained in culture as described above , washed in pbs , and cell pellets frozen at - 80 ° c . cell pellets corresponding to approximately 4 × 10 9 cells were resuspended in 10 ml of 0 . 1m tris - hcl , ph 7 . 4 and sonicated for 2 × 5 seconds and 1 × 10 seconds using a 4710 series ultrasonic homogenizer ( cole - parmer ) set at 75 % duty cycle , power level 3 . the cell homogenate was then centrifuged at 10 , 000 × g for 10 minutes at 4 ° c . the supernatant fraction was then recentrifuged at 100 , 000 × g for 2 hours at 4 ° c ., and the resulting microsomal pellet resuspended in 0 . 1m tris - hcl , 1 mm edta , ph 7 . 4 to a protein concentration of approximately 4 mg / ml . 500 μl aliquots of osteosarcoma microsomal preparations were stored at - 80 ° c . and thawed on ice immediately prior to use . microsomal preparations from osteosarcoma 143 and u - 937 cells were diluted in 0 . 1m tris - hcl , 10 mm edta , ph 7 . 4 , ( buffer a ) to a protein concentration of 100 μg / ml . all subsequent assay steps , including the dilution of stock solutions of test compounds , were automated using the biomek 100 ( biorad ). 5 μl of test compound or dmso vehicle was added with mixing , to 20 μl of buffer a in a 9 - well minitube plate ( beckman ). 200 μl of microsome suspension was then added , followed by mixing and incubation for 5 minutes at room temperature . assays were performed in either duplicate or triplicate . 25 μl of peroxide - free arachidonic acid ( cayman ) in buffer a is then added to a final concentration of 20 μm aracidonic acid , with mixing , followed by incubation at room temperature for 40 minutes . control samples contained ethanol vehicle instead of arachidonic acid . following the incubation period , the reaction was terminated by the addition of 25 μl of 1n hcl , with mixing . prior to analysis of pge 2 levels , samples were neutralized by the addition of 25 μl of 1n naoh . levels of pge 2 in samples were quantitated by enzyme immunoassay ( cayman ) as described for the whole cell cyclooxygenase assay . table ii______________________________________microsomal assay results - set 1 143 . 98 . 2 u - 937drug % inhibition % inhibition______________________________________100 nm dup - 697 92 63 um dup - 697 93 48100 nm flufenamic 16 53 um flufenamic 36 0100 nm flosulide 13 03 um flosulide 57 0100 nm zomipirac 45 303 um zomipirac 66 67100 nm ns - 398 45 03 um ns - 398 64 0100 nm diclofenac 70 493 um diclofenac 86 58100 nm sulindac sulfide 19 03 um sulindac sulfide 33 4100 nm fk - 3311 20 03 um fk - 3311 26 0100 um fluribprofen 55 573 um fluribprofen 58 89______________________________________ in order to confirm the type of cyclooxygenase mrna present in osteosarcoma 143 . 98 . 2 cells , a reverse transcriptase polymerase chain reaction ( rt - pcr ) analytical technique was employed . total rna was prepared from osteosarcoma cells harvested 1 - 2 days after the cultures had reached confluence . the cell pellet was resuspended in 6 ml of 5m guanidine monothiocyanate containing 10 mm edta , 50 mm tris - cl , ph 7 . 4 , and 8 % ( w / v ) β - mercaptoethanol . the rna was selectively precipitated by addition of 42 ml of 4m licl , incubation of the solution for 16 h at 4 ° c ., followed by recovery of the rna by centrifugation at 10 , 000 × g for 90 min at 4 ° c . the rna pellet which was obtained was resuspended in 10 mm tris - hcl , ph 7 . 5 , 1 mm edta , and 0 . 1 % sds at a concentration of 4 μg / ml and used directly for quantitation of cox - 1 and cox - 2 mrnas by rt - pcr . the quantitative rt - pcr technique employs pairs of synthetic oligonucleotides which will specifically amplify cdna fragments from either cox - 1 , cox - 2 , or the control mrna glyceraldehyde - 3 - phosphate - dehydrogenase ( g3pdh ). the synthetic oligonucleotides are described in maier , hla , and maciag ( j . biol . chem . 265 : 10805 - 10808 ( 1990 )); hla and maciag ( j . biol . chem . 266 : 24059 - 24063 ( 1991 )); and hla and neilson ( proc . natl . acad . sci ., ( usa ) 89 : 7384 - 7388 ( 1992 )), and were synthesized according to the following sequences : the rt - pcr reactions were carried out using a rt - pcr kit from cetus - perkin elmer according to the manufacturers instructions . brieflly , 4 μg of osteosarcoma total rna was reverse transcribed to cdna using reverse transcriptase and random hexamers as primers for 10 min at 23 ° c ., 10 min at 42 ° c ., followed by an incubation at 99 ° c . for 5 min . the osteosarcoma cdna sample was split into three equal aliquots which were amplified by pcr using 10 pmol of specific oligonucleotide pairs for either cox - 1 , cox - 2 , or g3pdh . the pcr cycling program was 94 ° c . for 1 min , 55 ° c . for 1 min , and 72 ° c . for 1 min . after the twentieth , twenty - fifth , and thirtieth cycle an aliquot was removed from the reaction mixture and stopped by the addition of 5 mm edta . control reactions included rt - pcr reactions which contained no rna and also reactions containing rna but no reverse transcriptase . following rt - pcr the reactions were electrophoresed through a 1 . 2 % agarose gel using a tris - sodium acetate - edta buffer system at 110 volts . the positions of pcr - generated dna fragments were determined by first staining the gel with ethidium bromide . the identity of the amplified dna fragments as cox - 1 , cox - 2 , or g3pdh was confirmed by southern blotting , using standard procedures . nitrocellulose membranes were hybridized with radiolabelled cox - 1 , cox - 2 , or g3pdh - specific probes . hybridization of the probes was detected by autoradiography and also by determining the bound radioactivity by cutting strips of the nitrocellulose which were then counted by liquid scintillation counting . the rt - pcr / southern hybridization experiment demonstrated that cox - 2 mrna is easily detected in osteosarcoma cell total rna . no cox - 1 cdna fragment could be generated by pcr from osteosarcoma cell total rna , although other mrna species such as that for g3pdh are detected . these results demonstrate that at the sensitivity level of rt - pcr , osteosarcoma cells express cox - 2 mrna but not cox - 1 mrna . we have developed a rabbit polyclonal antipeptide antiserum ( designated mf - 169 ) to a thyroglobulin - conjugate of a peptide corresponding to amino acids 589 - 600 , inclusive , of human cyclooxygenase - 2 . this amino acid sequence : asp - asp - ile - asn - pro - thr - val - leu - leu - lys - glu - arg . ( also identified herein as seq . id . no : 7 :) has no similarity to any peptide sequence of human cyclooxygenase - 1 . at a dilution of 1 : 150 , this antiserum detects by immunoblot a protein corresponding to the molecular weight of cyclooxygenase - 2 in microsomal preparations from osteosarcoma 143 cells . the immunoblot procedure used for these studies has previously been described ( reid et at ., j . biol . chem . 265 : 19818 - 19823 ( 1990 )). no band corresponding to the molecular weight of cyclooxygenase - 2 is observed using a 1 : 150 dilution of pre - immune serum from the rabbit used to raise antiserum . furthermore , a band corresponding to the molecular weight of cyclooxygenase - 2 is observed by immunoblot in microsomal preparations of osteosarcoma 143 cells using a 1 : 150 dilution of a commercially available polyclonal antiserum against cyclooxygenase - 2 ( cayman ). this antiserum is reported to not cross - react with cyclooxygenase - 1 . these results clearly demonstrate that osteosarcoma 143 cells express cyclooxygenase - 2 . furthermore , immunoblot analysis with these antisera and northern blot analysis using a cox - 2 - specific probe demonstrated that levels of cyclooxygenase - 2 protein and the corresponding mrna increase in osteosarcoma 143 cells as they grow past confluence . within a 3 - hour period , and in the presence of 1 % serum , human recombinant il1 - α ( 10 pg / ml ; r and d systems inc .) human recombinant il1 - β ( 10 pg / ml ; r and d systems inc . ), human egf ( 15 ng / ml ; calbiochem ) and conditioned medium from cells grown beyond confluence also increased levels of pge 2 synthesis by osteosarcoma 143 cells in response to arachidonic acid , relative to cells grown in the absence of these factors . identification by northern blot analysis of cell lines expressing either cox - 1 or cox - 2 exclusively northern blot analysis was used to determine that u - 937 cells express only cox - 1 mrna whereas osteosarcoma 143 . 98 . 2 expresses only cox - 2 mdna this was accomplished by first cloning human cox - 2 cdna from total rna of the human 143 osteosarcoma cell line . total rna was prepared from approximately 1 × 10 8 143 osteosarcoma cells using 4m guanidinium isothiocyanate ( maniatis , et al . ( 1982 ) molecular cloning , cold spring harbor ). oligonucleotide primers corresponding to the 5 &# 39 ; and 3 ∝ ends of the published cox - 2 cdna sequence ( hla and neilson , ( 1992 ) proc . natl . acad . sci ., usa 89 , 7384 - 7388 ) were prepared and are shown below . these primers ( also identified hereinunder as seq . id . no : 8 : and seq . id . no : 9 : respectively ) were used in a reverse transcriptase pcr reaction of 143 osteosarcoma total rna . the reaction contained 1 ug of 143 osteosarcoma total rna , which was first reverse transcribed using random hexamers and reverse transcriptase ( maniatis , et al . ( 1982 ) molecular cloning , cold spring harbor ). the products from this reaction were then amplified using the hcox - 1 and hcox - 2 primers described above and taq polymerase ( saiki , et al . ( 1988 ) science , 239 , 487 - 488 ). the conditions used for the amplification were 94 ° c . for 30 sec , 55 ° c . for 30 sec and 72 ° c . for 2 min 15 sec for 30 cycles . the amplified products were run on a 1 % low melt agarose gel and the 1 . 9 kb dna fragment corresponding to the predicted size of human cox - 2 cdna was excised and recovered . an aliquot of the recovered cox - 2 cdna was reamplified as described above ( no reverse transcriptase reaction ), the amplified products were again run on a 1 % low melt agarose gel and recovered . by standard procedures as taught in maniatis , et al . ( 1982 ) molecular cloning , cold spring harbor , this 1 . 9 kb dna fragment was cloned into the eco rv site of pbluescript ks ( obtained from stratagene ) and transformed into competent dh5α bacteria ( obtained from brl ) and colonies selected on lb agar / ampicillan overnight . three clones giving the correct pst i and hinc ii restriction digestions for human cox - 2 cdna were sequenced completely and verified to be correct . this was the first indication that the human 143 osteosacoma cell line expressed cox - 2 mrna . total rna from various cell lines and tissues were prepared using the guanidinium isothiocyanate method as described above ( maniatis , et al . ( 1982 ) molecular cloning , cold spring harbor ). poly a + rna was prepared using oligo dt cellulose spin columns ( maniatis , et al . ( 1982 ) molecular cloning , cold spring harbor ). the rna , 10 μg of total or 5 μg of u937 poly a + were electrophoresed on 0 . 9 % agarose 2 . 2m formaldehyde gels ( maniatis , et al . ( 1982 ) molecular cloning , cold spring harbor ). after electrophoreses the gel was washed 3 times for 10 minutes each with distilled water and then two times for 30 minutes each in 10xssc ( 1xssc = 0 . 15m nacl and 0 . 015 m sodium citrate ). the rna was transferred to nitrocellulose using capillary transfer ( maniatis , et al . ( 1982 ) molecular cloning , cold spring harbor ) overnight in 10xssc . the next day the filter was baked in a vacuum oven at 80 ° c . for 1 . 5 hrs to fix the rna onto the nitrocellulose . the filter was then equilibriated in pre - hybridization buffer ( 50 % formamide , 6 × ssc , 50 mm sodium phosphate buffer ph 6 . 5 , 10 × denhardts solution , 0 . 2 % sds and 250 μg / ml of sheared and denatured salmon sperm dna ) for approximately 4 hours at 40 ° c . the cox - 2 cdna probe was prepared using 32 p dctp and random hexamer priming with t7 dna polymerase using a commercial kit ( pharmacia ). hybridization was carried out using the same buffer as for pre - hybridization plus 1 - 3 × 10 6 cpm / ml of denatured cox - 2 cdna probe at 40 ° c . overnight . the blots were washed two times in 1 × ssc and 0 . 5 % sds at 50 ° c . for 30 minutes each , wrapped in saran wrap and exposed to kodak xar film with screen at - 70 ° c . for 1 - 3 days . the same blots were stripped of cox - 2 probe by putting them in boiling water and letting it cool to room temperature . the blot was re - exposed to film to ensure all hybridization signal was removed and then pre - hybridized and hybridized as described above using human cox - 1 cdna as probe . the human cox - 1 cdna was obtained from dr . colin funk , vanderbilt university , however the sequence is known in the art . see funk , c . d ., funk , l . b ., kennedy , m . e ., pong , a . s ., and fitzgerald , g . a . ( 1991 ), faseb j , 5 pp 2304 - 2312 . using this northern blot procedure applicants have established that the human 143 osteosarcoma cell line rna hybridized only to the cox - 2 probe and not to the cox - 1 probe . the size of the hybridizing band obtained with the cox - 2 probe corresponded to the correct size of cox - 2 mrna ( approximately 4 kb ) suggesting that 143 osteosarcoma cells only express cox - 2 mrna and no cox - 1 mrna . this has been confirmed by rt - pcr as described above . similarly , the human cell line u937 poly a + rna hybridized only to the cox - 1 probe and not to the cox - 2 probe . the hybridizing signal corresponded to the correct size for cox - 1 mrna ( approximately 2 . 8 kb ) suggesting that u937 only express cox - 1 mrna and not cox - 2 . this was also confirmed by rt - pcr , since no product was obtained from u937 poly a + rna when cox - 2 primers were used ( see above ). human cyclooxygenase - 2 cdna and assays for evaluating cyclooxygenase - 2 activity examples demonstrating expression of the cox - 2 cdna comparison of the cox - 2 cdna sequence obtained by rt - pcr of human osteosarcoma total rna to the published sequence ( hla , neilson 1992 proc . natl . acad . sci . usa , 89 , 7384 - 7388 ), revealed a base change in the second position of codon 165 . in the published sequence codon 165 is gga , coding for the amino acid glycine , whereas in the osteosarcoma cox - 2 cdna it is gaa coding for the amino acid glutamic acid . to prove that osteosarcoma cox - 2 cdna codes for glutamic acid at position 165 we repeated rt - pcr amplification of osteosarcoma cox - 2 mrna ; amplified , cloned and sequenced the region surrounding this base change from human genomic dna ; and used site directed mutagenesis to change cox - 2 glu165 to cox - 2 gly165 and compared there activities after transfection into cos - 7 cells . a 300 bp cox - 2 cdna fragment that includes codon 165 was amplified by rt - pcr using human osteosarcoma 143 total rna . two primers : were prepared that spanned this region and were used in the pcr reaction . briefly , cdna was prepared from 1 μg of osteosarcoma 143 total rna , using random priming and reverse transcriptase ( maniatis et al ., 1982 , molecular cloning , cold spring harbor ). this cdna was then used as a template for amplification using the hcox - 13 and hcox - 14 primers and taq polymerase ( saki , et al . 1988 , science , 238 , 487 - 488 ). the reaction conditions used were , 94 ° c . for 30s , 52 ° c . for 30s and 72 ° c . for 30s , for 30 cycles . after electrophoresis of the reaction on a 2 % low melt agarose gel , the expected 300 bp amplified product was obtained , excised from the gel and recovered from the agarose by melting , phenol extraction and ethanol precipitation . the 300 bp fragment was ligated into the taii cloning vector ( invitrogen ) and transformed into e . coli ( invαf &# 39 ;) ( invitrogen ). colonies were obtained and 5 clones were picked at random which contained the 300 bp insert and sequenced . the sequence of codon 165 for all 5 clones was gaa ( glutamic acid ). since the dna sequence amplified was only 300 bp and the taq polymerase has quite high fidelity for amplification of smaller fragments and its the second amplification reaction in which gaa was obtained for codon 165 confirms that cox - 2 mrna from osteosarcoma has gaa for codon 165 . to confirm that the osteosarcoma cox - 2 sequence was not an artefact of the osteosarcoma cell line and that this sequence was present in normal cells , the dna sequences containing codon 165 was amplified from human genomic dna prepared from normal blood . the primers used for the amplification reaction were hcox - 13 and hcox - 14 . the genomic organization of the human cox - 2 gene has not yet been determined . using mouse cox - 2 gene organization as a model for the exon - intron positioning of the human cox - 2 gene would place primer hcox - 13 in exon 3 and hcox - 14 in exon 5 . the size of the amplified product would be around 2000 bp based on the mouse cox - 2 gene organization . the pcr reaction contained 1 μg of human genomic dna , hcox - 13 and hcox - 14 primers and taq polymerase . the reaction conditions used were 94 ° c . for 30s , 52 ° c . for 30s and 72 ° c . for 45s , for 35 cycles . an aliquot of the reaction products was separated on a 1 % low melt agarose gel . there were however a number of reaction products and to identify the correct fragment , the dna was transferred to a nylon membrane by southern blotting and probed with a p - 32 labelled human cox - 2 internal oligo . hybridization was to a 1 . 4 kb dna fragment which was recovered from the remainder of the pcr reaction by electrophoresis on a 0 . 8 % low melt agarose gel as described above . this fragment was ligated into the taii cloning vector ( invitrogen ) and used to transform bacteria ( as described above ). a clone containing this insert was recovered and sequenced . the sequence at codon 165 was gaa ( glutamic acid ) and this sequence was from the human cox - 2 gene since the coding region was interrupted by introns . ( the 3 &# 39 ; splice site of intron 4 in human is the same as the mouse ). this is very convincing evidence of the existance of a human cox - 2 having glutamic acid at position 165 . 3 . cox - 2 glu165 vs cox - 2 gly165 activity in transfected cos - 7 cells to determine if cox - 2 glu165 has cyclooxygenase activity and to compare its activity to cox - 2 gly165 , both cdna sequences were cloned into the eukaryotic expression vector pcdna - 1 ( invitrogen ) and transfected into cos - 7 cells ( see below ). activity was determined 48 h after transfection by incubating the cells with 20 μm arachadonic acid and measuring pge 2 production by eia ( cayman ). the cox - 2 gly165 sequence was obtained by site directed mutagenesis of cox - 2 glu165 . briefly , single stranted ks + plasmid ( stratagene ) dna containing the cox - 2 glu65 sequence cloned into the eco rv site of the multiple cloning region was prepared by adding 1 ml of an overnight bacterial culture ( xl - 1 blue ( stratagene ) containing the cox - 2 plasmid ) to 100 ml of lb ampicillian ( 100 μg / ml ) and grown at 37 ° c . for 1 hr . one ml of helper phage , m13k07 , ( pharmacia ) was then added and the culture incubated for an additional 7 hrs . the bacteria was pelleted by centrifugation at 10 , 000 × g for 10 min , 1 / 4 volume of 20 % peg , 3 . 5m ammonium acetate was added to the supernatant and the phage precipitated overnight at 4 ° c . the single stranded phage were recovered the next day by centrifugation at 17 , 000 × g for 15 min , after an additional peg precipitation the single stranded dna was prepared from the phage by phenol and phenol : chorofonn extractions and ethanol precipitation . the single stranded dna containing the cox - 2 glu165 sequence was used as template for site directed mutagenesis using the t7 - gen in vitro mutagenesis kit from u . s . biochemical . the single stranded dna ( 1 . 6 pmoles ) was annealed to the phosphorylated oligo hcox - 17 ( 16 pmoles ), which changes codon 165 from gaa to gga and the second strand synthesis carried out in the presence of 5 - methyl - dc plus the other standard deoxynucleoside triphosphates , t7 dna polymerase and t4 dna ligase . after synthesis the parental strand was nicked using the restriction endonuclease msp 1 and then removed by exonuclease iii digestion . the methylated mutated strand was rescued by transformation of e . coli mcab -. colonies were picked , sequenced and a number of clones were obtained that now had gga for codon 165 instead of gaa . this cox - 2 gly165 sequence was released from the bluescript ks vector by an eco ri - hind iii digestion , recovered and cloned into the eukaryotic expression vector pcdna - 1 ( invitrogen ) which had also been digested with eco ri - hind hi . the cox - 2 glu165 sequence , was also cloned into the pcdna - 1 vector in the exact same manner . the only difference between the two plasmids was the single base change in codon 165 . the cox - 2 pcdna - 1 plasmids were used to transfect cos - 7 cells using a modified calcium phospate procedure as described by chen and okyama ( chen , c . a . and okyama , h . 1988 . biotechniques , 6 , 632 - 638 ). briefly , 5 × 10 5 cos - 7 cells were plated in a 10 cm culture dish containing 10 ml media . the following day one hour before transfection the media was changed . the plasmid dna ( 1 - 30 μl ) was mixed with 0 . 5 ml of 00 . 25m cacl 2 and 0 . 5 ml of 2 × bbs ( 50 mm n -, n - bis ( 2 - hydroxethyl )- 2 - amino - ethanesulfonic acid , 280 mm nacl , 1 . 5 mm na 2 hpo 4 ) and incubated at room temperature for 20 min . the mixture was then added dropwise to the cells with swirling of the plate and incubated overnight ( 15 - 18 hrs ) at 35 ° c . in a 3 % co 2 incubator . the next day the media was removed , the cells washed with pbs , 10 ml of fresh media added and the cells incubated for a further 48 hrs at 5 % co 2 - 37 ° c . the cells were transfected with 2 . 5 , 5 or 10 μg of cox - 2 glu165 / pcdna - 1 or cox - 2 gly165 / pcdna - 1 . two plates were used for each dna concentration and as a control the cells were transfected with pcdna - 1 plasmid . after 48 h the media was removed from the cells , the plates washed 3 × with hank &# 39 ; s media and then 2 ml of hank &# 39 ; s media containing 20 μm arachadonic acid was added to the cells . after a 20 min incubation at 37 ° c . the media was removed from the plate and the amount of pge 2 released into the media was measured by eia . the pge 2 eia was performed using a commercially available kit ( caymen ) following the manufacturers instructions . shown in table iii is the amount of pge 2 released into the media from cos - 7 cells transfected with pcdna - 1 , cos - 7 transfected with cox - 2 glu165 / pcdna - 1 and cos - 7 transfected with cox - 2 gly165 / pcdna - 1 . depending on the amount of dna transfected into the cos - 7 cells , cox - 2 glu165 is 1 . 3 to 2 . 3 times more active than cox - 2 gly165 . table iii______________________________________level of pge . sub . 2 pg / ml released from transfected cos - 7 cells 2 . 5 5 . 0 10 . 0amount of transfected dna ( μg ) pge . sub . 2 pg / ml______________________________________cos - 7 + cox - 2 . sub . glu165 / pcdna1 1120 2090 4020cos - 7 + cox - 2 . sub . gly165 / pcdna1 850 1280 1770______________________________________ cos - 7 or cos7 + pcdna1 ( 5 μg ) & lt ; 3 . 9 pg / ml pge . sub . 2 __________________________________________________________________________sequence listing ( 1 ) general information :( iii ) number of sequences : 14 ( 2 ) information for seq id no : 1 :( i ) sequence characteristics :( a ) length : 24 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : dna ( genomic )( xi ) sequence description : seq id no : 1 : tgcccagctcctggcccgccgctt24 ( 2 ) information for seq id no : 2 :( i ) sequence characteristics :( a ) length : 24 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : dna ( genomic )( xi ) sequence description : seq id no : 2 : gtgcatcaacacaggcgcctcttc24 ( 2 ) information for seq id no : 3 :( i ) sequence characteristics :( a ) length : 27 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : dna ( genomic )( xi ) sequence description : seq id no : 3 : ttcaaatgagattgtgggaaaattgct27 ( 2 ) information for seq id no : 4 :( i ) sequence characteristics :( a ) length : 24 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : dna ( genomic )( xi ) sequence description : seq id no : 4 : agatcatctctgcctgagtatctt24 ( 2 ) information for seq id no : 5 :( i ) sequence characteristics :( a ) length : 24 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : dna ( genomic )( xi ) sequence description : seq id no : 5 : ccacccatggcaaattccatggca24 ( 2 ) information for seq id no : 6 :( i ) sequence characteristics :( a ) length : 24 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : dna ( genomic )( xi ) sequence description : seq id no : 6 : tctagacggcaggtcaggtccacc24 ( 2 ) information for seq id no : 7 :( i ) sequence characteristics :( a ) length : 12 amino acids ( b ) type : amino acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : protein ( xi ) sequence description : seq id no : 7 : aspaspileasnprothrvalleuleulysgluarg1510 ( 2 ) information for seq id no : 8 :( i ) sequence characteristics :( a ) length : 23 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : dna ( genomic )( xi ) sequence description : seq id no : 8 : ctgcgatgctcgcccgcgccctg23 ( 2 ) information for seq id no : 9 :( i ) sequence characteristics :( a ) length : 24 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : dna ( genomic )( xi ) sequence description : seq id no : 9 : cttctacagttcagtcgaacgttc24 ( 2 ) information for seq id no : 10 :( i ) sequence characteristics :( a ) length : 604 amino acids ( b ) type : amino acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : protein ( xi ) sequence description : seq id no : 10 : metleualaargalaleuleuleucysalavalleualaleuserhis151015thralaasnprocyscysserhisprocysglnasnargglyvalcys202530metservalglypheaspglntyrlyscysaspcysthrargthrgly354045phetyrglygluasncysserthrproglupheleuthrargilelys505560leupheleulysprothrproasnthrvalhistyrileleuthrhis65707580phelysglyphetrpasnvalvalasnasnilepropheleuargasn859095alailemetsertyrvalleuthrserargserhisleuileaspser100105110proprothrtyrasnalaasptyrglytyrlyssertrpglualaphe115120125serasnleusertyrtyrthrargalaleuproprovalproaspasp130135140cysprothrproleuglyvallysglylyslysglnleuproaspser145150155160asngluilevalglulysleuleuleuargarglyspheileproasp165170175proglnglyserasnmetmetphealaphephealaglnhisphethr180185190hisglnphephelysthrasphislysargglyproalaphethrasn195200205glyleuglyhisglyvalaspleuasnhisiletyrglygluthrleu210215220alaargglnarglysleuargleuphelysaspglylysmetlystyr225230235240glnileileaspglyglumettyrproprothrvallysaspthrgln245250255alaglumetiletyrproproglnvalprogluhisleuargpheala260265270valglyglngluvalpheglyleuvalproglyleumetmettyrala275280285thriletrpleuarggluhisasnargvalcysaspvalleulysgln290295300gluhisproglutrpglyaspgluglnleupheglnthrserargleu305310315320ileleuileglygluthrilelysilevalilegluasptyrvalgln325330335hisleuserglytyrhisphelysleulyspheaspprogluleuleu340345350pheasnlysglnpheglntyrglnasnargilealaalaglupheasn355360365thrleutyrhistrphisproleuleuproaspthrpheglnilehis370375380aspglnlystyrasntyrglnglnpheiletyrasnasnserileleu385390395400leugluhisglyilethrglnphevalgluserphethrargglnile405410415alaglyargvalalaglyglyargasnvalproproalavalglnlys420425430valserglnalaserileaspglnserargglnmetlystyrglnser435440445pheasnglutyrarglysargphemetleulysprotyrgluserphe450455460glugluleuthrglyglulysglumetseralagluleuglualaleu465470475480tyrglyaspileaspalavalgluleutyrproalaleuleuvalglu485490495lysproargproaspalailepheglygluthrmetvalgluvalgly500505510alapropheserleulysglyleumetglyasnvalilecysserpro515520525alatyrtrplysproserthrpheglyglygluvalglypheglnile530535540ileasnthralaserileglnserleuilecysasnasnvallysgly545550555560cysprophethrserpheservalproaspprogluleuilelysthr565570575valthrileasnalaserserserargserglyleuaspaspileasn580585590prothrvalleuleulysgluargserthrgluleu595600 ( 2 ) information for seq id no : 11 :( i ) sequence characteristics :( a ) length : 3387 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : dna ( genomic )( xi ) sequence description : seq id no : 11 : gtccaggaactcctcagcagcgcctccttcagctccacagccagacgccctcagacagca60aagcctacccccgcgccgcgccctgcccgccgctgcgatgctcgcccgcgccctgctgct120gtgcgcggtcctggcgctcagccatacagcaaatccttgctgttcccacccatgtcaaaa180ccgaggtgtatgtatgagtgtgggatttgaccagtataagtgcgattgtacccggacagg240attctatggagaaaactgctcaacaccggaatttttgacaagaataaaattatttctgaa300acccactccaaacacagtgcactacatacttacccacttcaagggattttggaacgttgt360gaataacattcccttccttcgaaatgcaattatgagttatgtgttgacatccagatcaca420tttgattgacagtccaccaacttacaatgctgactatggctacaaaagctgggaagcctt480ctctaacctctcctattatactagagcccttcctcctgtgcctgatgattgcccgactcc540cttgggtgtcaaaggtaaaaagcagcttcctgattcaaatgagattgtggaaaaattgct600tctaagaagaaagttcatccctgatccccagggctcaaacatgatgtttgcattctttgc660ccagcacttcacgcaccagtttttcaagacagatcataagcgagggccagctttcaccaa720cgggctgggccatggggtggacttaaatcatatttacggtgaaactctggctagacagcg780taaactgcgccttttcaaggatggaaaaatgaaatatcagataattgatggagagatgta840tcctcccacagtcaaagatactcaggcagagatgatctaccctcctcaagtccctgagca900tctacggtttgctgtggggcaggaggtctttggtctggtgcctggtctgatgatgtatgc960cacaatctggctgcgggaacacaacagagtatgtgatgtgcttaaacaggagcatcctga1020atggggtgatgagcagttgttccagacaagcaggctaatactgataggagagactattaa1080gattgtgattgaagattatgtgcaacacttgagtggctatcacttcaaactgaaatttga1140cccagaactacttttcaacaaacaattccagtaccaaaatcgtattgctgctgaatttaa1200caccctctatcactggcatccccttctgcctgacacctttcaaattcatgaccagaaata1260caactatcaacagtttatctacaacaactctatattgctggaacatggaattacccagtt1320tgttgaatcattcaccaggcaaattgctggcagggttgctggtggtaggaatgttccacc1380cgcagtacagaaagtatcacaggcttccattgaccagagcaggcagatgaaataccagtc1440ttttaatgagtaccgcaaacgctttatgctgaagccctatgaatcatttgaagaacttac1500aggagaaaaggaaatgtctgcagagttggaagcactctatggtgacatcgatgctgtgga1560gctgtatcctgcccttctggtagaaaagcctcggccagatgccatctttggtgaaaccat1620ggtagaagttggagcaccattctccttgaaaggacttatgggtaatgttatatgttctcc1680tgcctactggaagccaagcacttttggtggagaagtgggttttcaaatcatcaacactgc1740ctcaattcagtctctcatctgcaataacgtgaagggctgtccctttacttcattcagtgt1800tccagatccagagctcattaaaacagtcaccatcaatgcaagttcttcccgctccggact1860agatgatatcaatcccacagtactactaaaagaacggtcgactgaactgtagaagtctaa1920tgatcatatttatttatttatatgaaccatgtctattaatttaattatttaataatattt1980atattaaactccttatgttacttaacatcttctgtaacagaagtcagtactcctgttgcg2040gagaaaggagtcatacttgtgaagacttttatgtcactactctaaagattttgctgttgc2100tgttaagtttggaaaacagtttttattctgttttataaaccagagagaaatgagttttga2160cgtctttttacttgaatttcaacttatattataaggacgaaagtaaagatgtttgaatac2220ttaaacactatcacaagatgccaaaatgctgaaagtttttacactgtcgatgtttccaat2280gcatcttccatgatgcattagaagtaactaatgtttgaaattttaaagtacttttgggta2340tttttctgtcatcaaacaaaacaggtatcagtgcattattaaatgaatatttaaattaga2400cattaccagtaatttcatgtctactttttaaaatcagcaatgaaacaataatttgaaatt2460tctaaattcatagggtagaatcacctgtaaaagcttgtttgatttcttaaagttattaaa2520cttgtacatataccaaaaagaagctgtcttggatttaaatctgtaaaatcagatgaaatt2580ttactacaattgcttgttaaaatattttataagtgatgttcctttttcaccaagagtata2640aacctttttagtgtgactgttaaaacttccttttaaatcaaaatgccaaatttattaagg2700tggtggagccactgcagtgttatctcaaaataagaatatcctgttgagatattccagaat2760ctgtttatatggctggtaacatgtaaaaaccccataaccccgccaaaaggggtcctaccc2820ttgaacataaagcaataaccaaaggagaaaagcccaaattattggttccaaatttagggt2880ttaaactttttgaagcaaacttttttttagccttgtgcactgcagacctggtactcagat2940tttgctatgaggttaatgaagtaccaagctgtgcttgaataacgatatgttttctcagat3000tttctgttgtacagtttaatttagcagtccatatcacattgcaaaagtagcaatgacctc3060ataaaatacctcttcaaaatgcttaaattcatttcacacattaattttatctcagtcttg3120aagccaattcagtaggtgcattggaatcaagcctggctacctgcatgctgttccttttct3180tttcttcttttagccattttgctaagagacacagtcttctcaaacacttcgtttctccta3240ttttgttttactagttttaagatcagagttcactttctttggactctgcctatattttct3300tacctgaacttttgcaagttttcaggtaaacctcagctcaggactgctatttagctcctc3360ttaagaagattaaaaaaaaaaaaaaag3387 ( 2 ) information for seq id no : 12 :( i ) sequence characteristics :( a ) length : 21 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : dna ( genomic )( xi ) sequence description : seq id no : 12 : ccttccttcgaaatgcaatta21 ( 2 ) information for seq id no : 13 :( i ) sequence characteristics :( a ) length : 21 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : dna ( genomic )( xi ) sequence description : seq id no : 13 : aaactgatgcgtgaagtgctg21 ( 2 ) information for seq id no : 14 :( i ) sequence characteristics :( a ) length : 21 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : dna ( genomic )( xi ) sequence description : seq id no : 14 : gagattgtgggaaaattgctt21__________________________________________________________________________ | 6 |
reference now will be made in detail to embodiments of the present disclosure , one or more examples of which are illustrated in the drawings . each example is provided by way of explanation of the present disclosure , not limitation of the present disclosure . in fact , it will be apparent to those skilled in the art that various modifications and variations can be made in the present disclosure without departing from the scope or spirit of the present disclosure . for instance , features illustrated or described as part of one embodiment can be used with another embodiment to yield a still further embodiment . thus , it is intended that the present invention covers such modifications and variations as come within the scope of the appended claims and their equivalents . fig1 and 2 provide a side view and a side cross - sectional view of an exemplary embodiment of a bottom fill , fluid dispensing system 10 of the present disclosure . in this embodiment , bottom fill , fluid dispensing system 10 includes a container 12 , a valve body 22 , and a valve housing 50 , wherein valve housing 50 may be mounted to a countertop 62 . countertop 62 , as used herein , refers to any fixed surface and is not limited to , e . g ., a kitchen or bathroom countertop . for instance , the present disclosure contemplates exemplary embodiments wherein valve housing 50 may be mounted to tabletops , bar tops , a sink , a fixed surface , and other embodiments as well . valve housing 50 includes a fluid inlet 64 and a chamber 68 , wherein chamber 68 defines an axial direction a . in one exemplary embodiment , valve housing 50 may have an exterior surface 52 that includes a threaded portion 58 allowing it to be mounted to countertop 62 using two retaining nuts 60 . retaining nuts 60 may be positioned on opposing sides of countertop 62 and may be in engagement with threaded portion 58 of valve housing 50 , allowing valve housing 50 to remain in a fixed position relative to countertop 62 . by mounting valve housing 50 as shown in fig1 and 2 , bottom fill , fluid dispensing system 10 may achieve a low profile and consume little space on countertop 62 . valve body 22 may include a first end 32 and a distal end , or a second end 34 , as well as a channel 36 for the flow of fluid that extends between an inlet port 38 and an outlet port 24 . valve body 22 may also define a circumferential direction , c . outlet port 24 is positioned at first end 32 of valve body 22 . second end 34 of valve body 22 is received within chamber 68 of valve housing 50 such that valve body 22 may slide along axial direction a . valve body 22 is slidable between a first position shown in fig3 and a second position shown in fig2 . in the first position , as shown in fig3 , valve body 22 is positioned within valve housing 50 such that fluid inlet 64 of valve housing 50 aligns with inlet port 38 of valve body 22 . this position allows fluid to flow from fluid inlet 64 , through inlet port 38 , into and through channel 36 , and through outlet port 24 , as is indicated by the arrows in fig3 . in the second position , as shown in fig2 , valve body 22 is positioned within valve housing 50 such that fluid is blocked from flowing from the inlet 64 of valve housing 50 through inlet port 38 of valve body 22 . referring to fig2 , fluid inlet 64 of valve housing 50 may be in fluid connection with any pressurized fluid source . in this exemplary embodiment , fluid inlet 64 is in fluid connection with a water filtering system 66 , including a filter for removing particles from the water . water filtering system 66 may be a point of use water filter installed beneath countertop 62 , and it may be in fluid communication with , e . g ., a commercial or residential water supply . this would enable bottom fill , fluid dispensing system 10 to deliver filtered water to the user for , e . g ., direct consumption . other configurations may be used as well . for the exemplary embodiment shown , valve body 22 includes an exterior surface 40 defining a plurality of grooves 42 , spaced apart along axial direction a and extending in a circumferential direction c around valve body 22 . additionally , bottom fill , fluid dispensing system 10 includes a plurality of seals , such as o - rings 44 , positioned in plurality of grooves 42 and configured for providing a fluid seal between valve body 22 and valve housing 50 . in this exemplary embodiment , o - rings 44 are positioned along valve body 22 such that when valve body 22 is in the first position , as shown in fig3 , or in the second position , as shown in fig2 , a pair of o - rings 44 are positioned on opposing sides in axial direction a of where fluid inlet 64 meets chamber 68 . bottom fill , fluid dispensing system 10 includes a biasing member , such as a spring 48 , configured so as to urge valve body 22 towards the second position , as is shown in fig2 . spring 48 is positioned in chamber 68 and is in contact with second end 34 of valve body 22 . in this exemplary embodiment , valve body 22 further includes a stem 46 extending from second end 34 of valve body 22 along axial direction a , while other embodiments may not . stem 46 is slidably received through an opening 54 in valve housing 50 . stem 46 may have a non - circular cross - sectional geometry , such as a square . this may prevent valve body 22 from rotating in circumferential direction c , and thus help keep fluid inlet 64 of valve housing 50 in alignment with inlet port 38 of valve body 22 when valve body 22 is in the first position , as in fig3 . additionally , a pin 56 may be positioned at the end of stem 46 . pin 56 may function to ensure valve body 22 is in a proper axial position when in the second position , as in fig2 . in this exemplary embodiment , container 12 includes a container wall 14 and a main opening 70 . container 12 is removably positioned onto the first end 32 of valve body 22 , such that container wall 14 is in contact with valve body 22 when positioned onto valve body 22 . additionally , as shown in fig2 and in the close - up view of fig4 , container 12 includes a one - way valve received within container wall 14 , or more particularly , received within an aperture 18 in container wall 14 . the one - way valve may be a flexible member made from any suitable material , such as silicone , and configured for opening to allow fluid to flow from outlet port 24 of valve body 22 through aperture 18 of container 12 when container 12 is positioned on valve body 22 . when fluid is not flowing through one - way valve into container 12 , the one - way valve is configured for closing to block a flow of fluid from container 12 and out of aperture 18 in container wall 14 into , e . g ., outlet port 24 or otherwise . in one exemplary embodiment , the one - way valve may be a duckbill valve 16 as shown that defines a slot 72 created by the edges 74 of a flexible member 76 . a flow of fluid through outlet port 24 opens flexible member 76 and slot 72 to allow a flow of fluid into container 12 . when fluid is not exiting outlet port 24 , slot 72 closes as the edges 74 of flexible member 76 collapse onto each other to form a seal . other flexible members for providing one - way flow may be used as well . as shown more clearly in fig4 , in one exemplary embodiment of the present disclosure , valve body 22 includes a boss 30 extending along axial direction a . in complementary fashion , container 12 defines a recess 20 into which boss 30 is received when container 12 is positioned onto valve body 22 . boss 30 and recess 20 are configured to align outlet port 24 of valve body 22 with the one - way valve in aperture 18 in wall 14 of container 12 . other embodiments of the present disclosure , however , are contemplated without boss 30 and recess 20 . in another exemplary embodiment , outlet port 24 further includes a conduit 26 extending along axial direction a and out of first end 32 of valve body 22 . conduit 26 is positioned for mating alignment with the one - way valve in aperture 18 of container 12 , when container 12 is positioned onto valve body 22 . in still another exemplary embodiment , first end 32 of valve body 22 further includes a top plate 28 positioned so as to make contact with and support container 12 when container 12 is positioned onto valve body 22 . in yet another exemplary embodiment , outlet port 24 extends through top plate 28 , and boss 30 extends along axial direction a from top plate 28 . for this exemplary embodiment , boss 30 also encircles valve 16 along the circumferential direction . other configurations may be used . fig5 shows an exploded view of bottom fill , fluid dispensing system 10 , illustrating how the various parts are disposed along axial direction a of chamber 68 of valve housing 50 . for this exemplary embodiment , spring 48 is received into valve housing 50 , followed by retaining nuts 60 , each engaged , one after the other , around threaded portion 58 of valve housing 50 . valve body 22 is also received within valve housing 50 , such that stem 46 is slidably received through opening 54 in valve housing 50 . additionally , duckbill valve 16 is received into container 12 , and container 12 may be removably mounted to first end 32 of valve body 22 . while duckbill valve 16 may be a component added to container 12 , it should be understood that valve 16 could also be insert molded with container 12 as an integrated feature . this written description uses examples to disclose the invention , including the best mode , and also to enable any person skilled in the art to practice the invention , including making and using any devices or systems and performing any incorporated methods . the patentable scope of the invention is defined by the claims , and may include other examples that occur to those skilled in the art . such other examples are intended to be within the scope of the claims if they include structural elements that do not differ from the literal language of the claims , or if they include equivalent structural elements with insubstantial differences from the literal languages of the claims . | 1 |
the embodiment of the invention provides a fuel system including un - gauged auxiliary fuel tanks and gauged main fuel tanks and a method of operating an aircraft with such a fuel system . fig1 shows an auxiliary tank 1 of the embodiment of the present invention . the fuel tank is shaped to fit in floor cavities of an aircraft and is provided with interconnect fittings 2 to enable a number of such fuel tanks to be connected together . vent fittings 3 are provided in the top of the fuel tank such that air is vented from the tank to ensure complete filling , the vent connections also act as overflow outlets for each tank . an auxiliary fuel tank system according to the embodiment of the invention consists of a number of individual tanks connected together via their interconnect and vent fittings . one of the vent fittings is an overflow for the auxiliary fuel tank system and is configured such that fuel only flows out of that overflow when the auxiliary tank system is full . fig2 shows auxiliary fuel tanks according to the present embodiment . the present embodiment utilises three fuel tanks 21 , 22 , 23 connected in a series arrangement . a first tank 21 has one of its interconnect fittings 29 connected to the fuel system of the aircraft to allow fuel to be pumped into , or out of , the auxiliary fuel tank system . other interconnect fittings of the first tank 21 are connected 27 to the interconnect fittings of a second tank 22 , which tank is also connected to a third tank 23 . any interconnect fittings of the third tank not utilised for connection to the second tank are closed 24 . the vent fittings of the first tank 21 are connected 26 to the vent fittings of the second tank 22 , with any unused fittings of the first tank being closed 25 . the vent fittings of the second tank are connected to the vent fittings of the third tank 23 . vent fittings of the third tank form an overflow and are connected 28 to a vent system of the aircraft , as described below . this connection system ensures that fuel can only flow out of the overflow when all auxiliary fuel tanks in the system are full . in the system of fig2 , all of the tanks will fill to the bottom of their vent connection before any fuel flows out of the overflow 28 . other systems of auxiliary fuel tanks are also possible , and it is also possible to use a single large auxiliary tank as opposed to the plurality of smaller tanks described above . fig3 shows a schematic diagram of a fuel system according to the embodiment of the present invention . auxiliary fuel tanks 30 are connected as described above with reference to fig2 . the interconnect port 31 of the first auxiliary fuel tank 32 is connected to the refuel gallery 33 and the main tank 34 , via a refuelling valve 35 and , in parallel , via an outlet valve 36 and a fuel pump 37 . the inlet 38 to the main tank 34 is equipped with a valve 39 . the overflow 40 of the auxiliary fuel tanks ( a vent connection of the last auxiliary fuel tank ) is connected to the main fuel tank whereby fuel can flow through the overflow into the main tank . the outlet into the main tank is equipped with a flow detector 41 . the main tank has a fuel gauge 42 which is connected to the avionics systems 43 of the aircraft to allow accurate monitoring and display of the quantity of fuel in the main tank . the auxiliary fuel tanks have a total capacity of approximately 4 , 000 litres , while the main fuel tanks have a capacity of approximately 60 , 000 litres . the method , according to the present embodiment , of operating an aircraft with a fuel system as described above will now be described with reference to fig4 . the method of the embodiment utilises the use of a fuel quantity gauging system implemented in software in the aircrafts computer systems ( not shown ). if a flight does not require more fuel than can be stored in the main fuel tanks , then fuel is only placed into those main fuel tanks 50 . during a flight not using auxiliary fuel tanks fuel is consumed from the main tanks and the fuel quantity is indicated based on the main tank fuel gauges 51 . if auxiliary tanks are required then refuelling begins by opening 53 the auxiliary tank refuel valve 35 and closing 54 the main fuel tank valve 39 such that fuel pumped into the refuelling gallery 33 passes into the auxiliary tanks . fuel is pumped 55 into the aircraft and the auxiliary fuel tanks will fill with fuel , until a level is reached where fuel flows out of the overflow 40 and into the main tanks 34 . this indicates that there is a known quantity of fuel in the auxiliary tanks and is indicated by fuel flow being detected by indicator 41 . when such flow is detected 56 the auxiliary tank refuel valve 35 is closed 57 and the main tank refuel valve 39 is opened 58 such that fuel passes into the main tanks . the total fuel load of the aircraft during filling of the main tanks is the quantity in the auxiliary tanks ( which is known since they are full ) plus the quantity of fuel in the main tanks which is known accurately by the indication of the gauge 42 . refuelling continues until the quantity of fuel in the aircraft is equal to the required fuel load 59 . operation of an aircraft using the auxiliary fuel tanks is split into two phases . at the start of the first phase valves 36 and 39 are opened 60 and fuel pump 37 is operated 61 . operation of pump 37 is controlled by the main fuel tank gauge such that the main tanks are kept full 62 . maintenance of the level of fuel in the main fuel tanks by pumping fuel from the auxiliary tanks to the main tanks continues while fuel is consumed by the auxiliary power unit ( apu ) and / or engines , throughout the first phase . the quantity of fuel remaining in the main tanks during aircraft operation is known from the fuel gauge in those tanks , and is therefore known to a high degree of accuracy . the rate of fuel consumption is monitored by aircraft avionics systems in a conventional manner , which utilises a plurality of fuel flow meters located in the fuel system of the aircraft . by integrating the fuel consumption rate over time that rate is used to provide an indication of the amount of fuel consumed . the quantity of fuel in the auxiliary tanks at the start of the flight is known and the quantity of fuel remaining in the auxiliary tanks is calculated by subtracting the consumed fuel quantity from that initial quantity . while fuel remains in the auxiliary fuel tanks , the total remaining fuel quantity is calculated as q aux — start + q main — ind − integral ( c engine + c apu ). where , q aux — start = fuel quantity in auxiliary tanks before the start of consumption , q main — ind = fuel quantity in main tanks , as indicated by the main tank gauges , c engine = consumption rate of engines and c apu = consumption rate of apu . the fuel remaining in the auxiliary tanks is equal to the total fuel quantity , minus the indicated level in the main tanks . during refuelling the auxiliary fuel tanks are filled until an overflow is detected and so the quantity of fuel in the auxiliary tanks at the start of the first phase is defined by the configuration of the auxiliary tanks . that quantity is stored in the aircraft avionic systems . alternatively the quantity can be entered into the system by the aircraft operator once refuelling has been completed . during this first phase of fuel consumption the total remaining quantity of fuel is only known by an indirect measure since the fuel quantity in the auxiliary tanks is calculated from the rate of fuel consumption and the initial quantity of fuel in the auxiliary tanks . the quantity of fuel in the auxiliary fuel tanks is therefore considered a low - integrity measurement , with a mean time to failure of 1 × 10 4 hours . however , the level of fuel in the main tanks is known to a high integrity ( as it is indicated directly by the fuel gauges ) and so there is a reliable measure of the minimum amount of fuel on board even if there is an error in the calculations and the auxiliary fuel tanks are empty . by emptying the auxiliary fuel tanks while maintaining a known quantity in the main fuel tanks a high - integrity indication of the quantity of fuel in the auxiliary fuel tanks is not required as the minimum quantity of fuel on board is known to a high integrity , thereby allowing safe flight completion . the consumption of all of the fuel in the auxiliary fuel tanks is detected by sensing that the rate of change of fuel in the main tanks has become equal to the consumption rate . when it is detected 63 that the auxiliary fuel tanks are empty valves 36 and 39 are closed 64 and pump 37 is turned off 65 . this terminates the first phase , and flight then continues in a second phase , using the fuel in the main tanks . during this second phase of fuel consumption the quantity of remaining fuel is known accurately from the fuel gauges in the main tanks , therefore allowing safe flight completion 66 . when the auxiliary fuel tanks are empty , the indicated fuel quantity switches from being based on the fuel consumption rate , to being a direct measure taken from the main fuel tank gauges . since the quantity calculated from the consumption rate is an approximation it is likely that there will be a step change in the quantity of fuel indicated when the basis of the indication changes . the fuel quantity display includes an indication of the source of the data . when the quantity displayed is derived only from the main tank fuel gauges the fuel quantity is displayed in green to indicate that it is a high - integrity reading . if the displayed quantity is derived from the main tank gauges plus the estimated quantity of fuel in the auxiliary tanks then the display is in amber , to indicate that it is a low integrity reading . the pilot also has access to a fuel page on the cds ( cockpit display system ) where the statuses of fuel tanks are shown . hence at the start of the flight when a low integrity total fuel quantity is displayed , the pilot can see that each of the main tanks still have high integrity measured quantities , whereas the auxiliary tanks have a low integrity calculated quantity . again , these status indications are coloured green for high integrity and amber for low integrity . other systems to display the source of the quantity of fuel are also possible . whilst the present invention has been described and illustrated with reference to particular embodiments , it will be appreciated by those of ordinary skill in the art that the invention lends itself to many different variations not specifically illustrated herein . by way of example , certain variations to the above - described embodiments will now be described . the embodiment described above estimates the quantity of fuel consumed by the consumption rate of the engines and apu , but it is also possible to estimate the fuel remaining in the auxiliary fuel tanks by measuring the volume of fuel pumped out of the fuel tanks . furthermore a combination of methods can be used to improve the reliability of the detection . in the embodiment described the consumption of all of the fuel in the auxiliary fuel tanks is indicated by the consumption rate matching the rate of change of the main tank volume . the auxiliary fuel tanks being empty , and hence the end of the first phase , can also be detected by the indication of a low pressure at pump 37 , or a combination of both techniques . the embodiment of the invention keeps the main fuel tanks full while there is fuel in the auxiliary fuel tanks , but the main tanks could be maintained at any level as opposed to being kept full . the fuel tanks should be maintained at a sufficiently high level that they will always hold enough fuel for the aircraft to land safely in the event that the indicated quantity in the auxiliary fuel tanks is incorrect . depending on the configuration of the aircraft the calculation and display of fuel quantities may be performed by the aircraft avionics systems , by a fuel quantity display apparatus forming part of the aircraft avionics systems or by a dedicated fuel quantity display apparatus . the main tank fuel gauges and fuel consumption rate indicators are connected to the appropriate apparatus , dependent upon the apparatus performing the calculation and display . where in the foregoing description , integers or elements are mentioned which have known , obvious or foreseeable equivalents , then such equivalents are herein incorporated as if individually set forth . reference should be made to the claims for determining the true scope of the present invention , which should be construed so as to encompass any such equivalents . it will also be appreciated by the reader that integers or features of the invention that are described as preferable , advantageous , convenient or the like are optional and do not limit the scope of the independent claims . | 6 |
in the embodiments of the present invention , an improved driving method for tft - lcd is provided . the method utilizes a timing controller to transmit polarity control signals to a plurality of source drivers , for changing the polarity distribution of the liquid crystal molecules within the panel . an ac power is coupled to the timing controller for generating ac control signals . fig3 a - 3f illustrate the timing diagram of the improved driving method according to the embodiments of the present invention . in fig3 a , it illustrates the information of stv 311 , clkv 312 , rgb data 313 , and “ 1 + k ” polarity distribution signal 314 . in frame f ( n + 0 ), if the polarity of the first horizontal line is positive , then the polarities of the second to the “ k + 1 ” horizontal lines are negative , the polarities of the “ k + 2 ” to the “ 2k + 1 ” horizontal lines are positive , and the other horizontal lines are distributed according to the same pattern , as shown in fig3 a . in frame f ( n + 1 ), if the polarity of the first horizontal line is negative , then the polarities of the second to the “ k + 1 ” horizontal lines are positive , the polarities of the “ k + 2 ” to the “ 2k + 1 ” horizontal lines are negative , and the other horizontal lines are distributed according to the same pattern , as shown in fig3 b . based on the illustration shown in fig3 a and 3b , frames of f ( n + 0 ) and f ( n + 1 ) form a polarity distribution “ 1 + k ” ( 314 and 324 ). in other words , the first horizontal line is given a first polarity , and every k lines thereafter changes to the second or to the first polarity , alternatively . besides , the frames of f ( n + 0 ) and f ( n + 1 ) comprise opposite polarity distributions . fig3 c illustrates the frame f ( n + 2 ), which comprising information of stv 331 , clkv 332 , rgb data 333 , and “ 2 + k ” polarity distribution signal 334 . if the polarities of the first to the second horizontal lines are positive , then the polarities of the third to the “ k + 2 ” horizontal lines are negative , the polarities of the “ k + 3 ” to the “ 2k + 2 ” horizontal lines are positive , and the other horizontal lines are distributed according to the same pattern , as shown in fig3 c . fig3 d illustrates the frame f ( n + 3 ), which comprising information of stv 341 , clkv 342 , rgb data 343 , and “ 2 + k ” polarity distribution signal 334 . if the polarities of the first to the second horizontal line are negative , then the polarities of the third to the “ k + 2 ” horizontal lines are positive , the polarities of the “ k + 3 ” to the “ 2k + 2 ” horizontal lines are negative , and the other horizontal lines are distributed according to the same pattern , as shown in fig3 d . based on the illustration shown in fig3 c and 3d , frames of f ( n + 2 ) and f ( n + 3 ) form a polarity distribution “ 2 + k ” ( 334 and 344 ). in other words , the first and second horizontal lines are given the first polarity , and every k lines thereafter changes to the second or to the first polarity , alternatively . besides , the frames of f ( n + 2 ) and f ( n + 3 ) comprise opposite polarity distributions . fig3 e illustrates the frame f ( n +( 2k − 2 )), which comprising information of stv 351 , clkv 352 , rgb data 353 , and “ k ” polarity distribution signal 354 . if the polarities of the first to the “ k ” horizontal lines are positive , then the polarities of the “ k + 1 ” to the “ 2k ” horizontal lines are negative , the polarities of the “ 2k + 1 ” to the “ 3k ” horizontal lines are positive , and the other horizontal lines are distributed according to the same pattern , as shown in fig3 e . fig3 f illustrates the frame f ( n +( 2k − 1 )), which comprising information of stv 361 , clkv 362 , rgb data 363 , and “ k ” polarity distribution signal 364 . if the polarities of the first to the “ k ” horizontal lines are negative , then the polarities of the “ k + 1 ” to the “ 2k ” horizontal lines are positive , the polarities of the “ 2k + 1 ” to the “ 3k ” horizontal lines are negative , and the other horizontal lines are distributed according to the same pattern , as shown in fig3 f . based on the illustration shown in fig3 e and 3f , frames of f ( 2k − 2 ) and f ( 2k − 1 ) form a polarity distribution “ k ” ( 354 and 364 ). in other words , the first to “ k ” horizontal lines are given the first polarity , and every k lines thereafter changes to the second or to the first polarity , alternatively . besides , the frames of f ( n +( 2k − 1 )) and f ( n +( 2k − 1 )) comprise opposite polarity distributions . in above description , “ n ” means that the initial position to be selected , “ n + 1 ”, “ n + 2 ”, etc . refer to the sequential relationship , and “ k ” should be natural numbers . if the resolution of the panel is “ 1024 × 768 ”, the value of k should be smaller than or equal to “ 768 − 1 ”. for example , k can be assigned as “ 50 ”. further , as shown in fig3 a and 3b , the polarity inversing positions in “ 1 + k ” mode ( frame f ( n + 0 ) and f ( n + 1 )) are at positions 315 / 325 , 316 / 326 , 317 / 327 , 318 / 328 , and other positions beyond the illustration . similarly , as shown in fig3 c and 3d , the polarity inversing positions in “ 2 + k ” mode ( frame f ( n + 2 ) and f ( n + 3 )) are at positions 335 / 345 , 336 / 346 , 337 / 347 , 338 / 348 , and other positions beyond the illustration . similarly , as shown in fig3 e and 3f , the polarity inversing positions in “ k ” mode ( frame f ( n +( 2k − 2 )) and f ( n +( 2k − 1 ))) are at positions 355 / 365 , 356 / 366 , 357 / 367 , and other positions beyond the illustration . in prior arts , the brightness at each of the polarity inversing positions are unbalanced due to undercharging . the problem is more critical in a panel with better specification such as resolution of “ 1920 × 1080 ” and renew frequency of “ 120 ” hz . in prior arts , line inversion or multi - line inversion approach inverses the polarity at fixed line positions , thereby the capacitors at same positions are always being undercharged and the unbalance of brightness should be obvious . in contrast , in the embodiments of the present invention , utilizing the above - mentioned driving method that the polarity inversing positions are dynamically changed , the above - mentioned problem can be obviously alleviated . for example , in fig3 a and 3b , the polarities are inversed at positions 316 / 326 , 317 / 327 , 318 / 328 , 319 / 329 , etc . in fig3 c and 3d , the polarities are inversed at positions 336 / 346 , 337 / 347 , 338 / 348 , etc . in fig3 e and 3f , the polarities are inversed at 356 / 366 , 357 / 367 , etc . accordingly , in dynamical polarity inversion comprising modes of “ 1 + k ”, “ 2 + k ”, “ k ”, etc ., the polarity inversing positions are always switched with different positions , and thus the positions currently being undercharged can be immediately fully charged in the next mode . further , the problem of brightness unbalance caused by undercharging of capacitors is eased by averaging effect upon the dynamically switching processes . fig4 shows the sequential diagram of the frames according to the embodiments of the present invention . in step 411 , frame f ( n + 0 ) is implemented . then , in step 412 , 421 , 422 , 431 , 441 , 442 , etc ., f ( n + 1 ), f ( n + 2 ), f ( n + 3 ), f ( n + 4 ), f ( n + 5 ), f ( n + 6 ), etc . are implemented , respectively . wherein step 431 may comprise implementing of f ( n + 4 ), f ( n + 5 ), f ( n + 6 ), and / or other possible candidates , and it is dependent on the predetermined value k . further , frames f ( n + 0 ) and f ( n + 1 ) are classified as “ 1 + k ” ( polarity distribution ) mode 410 , frames f ( n + 2 ) and f ( n + 3 ) are classified as “ 2 + k ” mode , f ( n +( 2k − 2 )) and f ( n +( 2k − 1 )) are classified as “ k ” mode , and the possible candidates f ( n + 4 ) and f ( n + 5 ) are classified as 430 ( other modes ). fig5 a - 5d illustrate part of the displaying frame ( comprising a plurality of pixels ) in mode “ 1 + k ” and “ 2 + k ”. in fig5 a , for example , the polarity distribution of the first vertical line which is marked with “ f ( n + 0 )” is arranged according to the “ 1 + k ” polarity distribution 314 shown in fig3 a , and each of the pixels on the second vertical line are arranged with polarities opposite to each of the pixels on the first vertical line , respectively . the vertical lines thereafter are arranged according to the same pattern . the description above may be alternatively represented as frames of f ( 2r − 2 ) and f ( 2r − 1 ), wherein r is natural number from 1 to k , and k is natural number which is smaller or equal to the horizontal line number of the panel minus one . this can be implemented by a method comprising : step ( a ), setting value of k ; step ( b ), setting each of first pixels on 1 to r horizontal lines of frame f ( 2r − 2 ) as positive polarity , setting each of first pixels on r + 1 to r + k horizontal lines of frame f ( 2r − 2 ) as negative polarity , and setting each of first pixels on every k lines thereafter as alternate positive and negative polarities ; setting each of first pixels on 1 to r horizontal lines of frame f ( 2r − 1 ) as negative polarity , setting each of first pixels on r + 1 to r + k horizontal lines of f ( 2r − 1 ) as positive polarity , and setting each of first pixels on every k lines thereafter as alternate negative and positive polarities ; in step ( c ), repeating the step ( b ) while substituting r from 1 to k with interval of 1 ; and in step ( d ), displaying the frames f ( 2r − 2 ) and f ( 2r − 1 ) by sequence of comparing values of 2r − 2 and 2r − 1 substituted with different r . further , via a frame initial position setting step ( may be implemented as a frame initial position setting module ), the frame initial position mark “ n ” is brought into frames f ( 2r − 2 ) and f ( 2r − 1 ) and represented as f ( n +( 2r − 2 )) and f ( n +( 2r − 1 )), for identifying initial positions of the frames . furthermore , if the renew frequency of a tft - lcd is setting as m ( m & gt ; k ) frames per second , then the method further comprises a frame recurring step , to display the frames reiteratively for satisfying the renew frequency . the method may further comprise a horizontal line pixel distribution step ( may be implemented by a horizontal line pixel distribution module ), for setting the polarities of other pixels according to the first pixels of each of horizontal lines . for example , the polarity of the second pixel is opposite to the first pixel , the polarity of the third pixel is opposite to the second pixel , and so on . a distribution with alternate positive and negative polarities is generated . however , in other embodiments of the present invention , all the pixels on one horizontal line can be alternatively with the same polarity as omitting the above step . in the embodiments of the present invention , a relative smaller k brings relative more times of polarity inversions , and the electric power consumption becomes higher . therefore , in preferred embodiments of the present invention , a relative larger k , such as k ≧ 50 , is chosen for reducing the inversion times , for lowering the electric power consumption and the heat generated . however , it should be noted that in conditions of choosing relative larger k , the positions except for the polarity inversion positions ( referring to continuous portions of the polarity inversion signal curve ) may exhibit the behavior similar to those in line inversion approach . for preventing the green color shift problem under the checker board testing signals , in other embodiments of the present invention , the source drivers in an improved tft - lcd are implemented as combinations of power of line ( pol ) and power of line reverse ( polr ) polarity control signals . for example , the plurality of source drivers can be classified as odd source drivers and even source drivers , and the odd source drivers and the even source drivers may be provided with polar driving signals and reverse polar driving signals ( may be implemented by coupling a not gate to part of the ends of the timing controller , for providing polar source drivers and reverse polar source drivers ), respectively . fig6 a and 6b show the displaying frames with “ 1 × 1 ” checker board testing signals according to the embodiments of the present invention , wherein the “ r ”, “ g ”, “ b ”, and “ k ” represent red , green , blue , and black , respectively . fig6 a illustrates the pixels driven by polar source driver . in the first and second rows illustrated in fig6 a , the increased 4v from the pixel 6111 to the pixel 6121 is balanced with the decreased 4v from the pixel 6112 to the pixel 6122 . the increased 4v from the pixel 6114 to the pixel 6124 is balanced with the decreased 4v from the pixel 6115 to the pixel 6125 as well . one of the improvements of the embodiment is that the voltage increases from the pixel 6113 to the pixel 6123 and from the pixel 6116 to the pixel 6126 will not cause the green color shift problem . it is credited to the existence of voltage decreases from the pixel 6213 to the pixel 6223 and from the pixel 6216 to the pixel 6226 shown in fig6 b ( driven by reverse polar driving signals ), while the voltage changes among other pixels 6211 , 6221 , 6212 , 6222 , 6214 , 6224 , 6215 , and 6225 are balanced . further , when the second row and the third row are considered , for example , the voltage changes of pixels 6121 , 6131 , 6122 , and 6132 are balanced , and the voltage changes of pixels 6124 , 6134 , 6125 , and 6135 are balanced as well . the left voltage decreases from pixels 6123 to 6133 and from pixels 6126 to 6136 can be balanced with the voltage increases from pixels 6223 to 6233 and from pixels 6226 to 6236 , as shown in fig6 b . therefore , the problem of green color shift is not happened . the above - mentioned solution can be implemented by a polarity distribution setting step , for setting the plurality of odd source drivers and even source drivers as opposite polarity distribution . in other embodiments of the present invention , the undercharging problem at the first lines , marked as “ 1 ” in the rgb data 313 , 323 , 333 , 343 , 353 , and 363 , are solved by coupling two horizontal storage units , such as memories , to the timing controller , while the undercharging problem at other lines can be solved by the dynamically polarity inversion method mentioned above . taking “ 1 + k ” polarity mode and the frame f ( n + 0 ) as example , the exemplary timing diagrams for improving the undercharging problem are shown in fig7 a and 7b . in fig7 a , in addition to information of stv 701 , clkv 702 , rgb data 703 , and “ 1 + k ” polarity distribution signal 704 , the diagram further comprises data enable ( de ) signal ( or data initiating signal ) 750 which may be implemented by a signal generating module coupled to the timing controller . when the de signal 750 is high ( from position 705 a ), the polarity data of the first horizontal line ( first horizontal data , for brevity ) of the frame is stored within the first horizontal memory . the polarity data of the next horizontal line is then set to be the same with the original first horizontal data , and the first horizontal data to be transmitted to source driver is substituted with “ v - blanking ” signal to delay a unit time “ 1h ” for the stv 701 . at the second horizontal line position after the de signal 750 is high , the original second horizontal data is stored within the second horizontal memory . then , the stv 701 is enabled , for transmitting the data stored within the first horizontal memory to the source drivers , and then the data stored within the second horizontal memory is transmitted to the source drivers consequently . the processes of the third horizontal line and the horizontal lines thereafter follow the same way , for solving the undercharging problem at the first line of the panel by delaying the enable time . in other words , the horizontal lines 706 a and 707 a , illustrated around the polarity inversing position 705 a , are originally distributed with opposite polarities , but the polarities of horizontal lines 706 b and 707 b are identical after the above - mentioned processes . therefore , it is achieved for preventing inversing polarity at the position 705 b , and the undercharging problem is thus solved . from the above description , it should be appreciated that the embodiments of the present invention implement a driving method by a driving device , for solving problems existed in driving circuit of the conventional lcd panel . for example , the brightness unbalance of lines , the green color shift problem with checker board testing signals , and the undercharging problem at the first horizontal lines can be solved . in addition , according to the embodiments of the present invention , the driving device does not cause apparently additional electric power consumption . taking a 37 ″ tft - lcd with resolution of “ 1920 × 1080 ” for example , if the total impedance of wiring of the source drivers is about 8 . 5 kohm , the total capacitance is about 200 nf , the number of source driver channels is about 720 , and the driving voltage is room temperature ( about 25 ° c . ), the electric power consumption comparisons of the embodiment of the present invention to the conventional approaches are listed in tab . 1 . in some embodiments , a storage medium readable by a timing controller is provided . the storage medium stores a program of instructions executable by the timing controller to perform a method for driving a panel of a liquid crystal display , for sending polarity control signals to a plurality of source drivers in the panel . the method comprises the steps mentioned above . the description above provides the preferred embodiments of the present invention . the present should be thoroughly understood by ordinary skill in the art via the teachings . however , it should be noted that the description above and the accompanying figures may not illustrate all the details , such as the detailed conventional components . however , it should be appreciated that the driving device for implementing the driving method should comprise but not limit to a control chip , an assembly of touch panel , a housing , and / or other related components . relative software , hardware , and / or firmware should also be included . some of them are not described in detail for purpose of being easier to be understood of the embodiments of the present invention . furthermore , the scope of the present invention is intended to be defined by the following claims and the equivalents . | 6 |
now , referring to the drawings , the present invention will be explained below with respect to an embodiment thereof which is applied to an isolated word recognition system for unspecified speakers . in fig1 illustrating the embodiment as a whole , speech data is supplied to an analog / digital ( a / d ) converter 3 through a microphone 1 and an amplifier 2 . the speech data can be training data or unknown word data . the a / d converter 3 converts the speech data into digital data by sampling it at 8 khz . the digital data is supplied to a feature value extraction unit 4 to be converted into feature values by using linear prediction coding ( lpc ) analysis . each feature value is generated every 14 nsec to be supplied to a labelling unit 5 . the labelling unit 5 performs labelling with reference to a prototype dictionary 6 . namely , a label alphabet { f i } and prototypes of feature values corresponding thereto are stored in the prototype dictionary 6 , and a label f i having a prototype which is nearest to an input feature value is discriminated and output therefrom . the number of elements of the label alphabet is 32 , for example , and a prototype of a label may be obtained by sampling at random feature values in a speech spoken for 20 sec . the label f i from the labelling unit 5 is supplied to a training unit 8 or a recognition unit 9 through a switching means 7 . an input terminal 7c of the switching means 7 is connected to a switching terminal 7a for the training unit 8 during training or to a switching terminal 7b for the recognition unit 9 during recognition . the training unit 8 processes a label string obtained from the training data and establishes a preselection table 10 and a probability table 11 . the preselection table 10 stores a maximum speech length l ( i ) and a minimum speech length l ( j ) for each word in the vocabulary for recognition . the probability table stores a probability p ( i , j , k ) of each of the labels f i being output in each of blocks b jk obtained by equally dividing a word w j in a vocabulary for recognition . in fact , for convenience of calculations , log p is stored in the probability table 11 , instead of the probability . the recognition unit 9 processes a label string obtained from a speech of an unknown word by referring ring to the preselection table 10 and the probability table 11 , and performs a recognition operation in two stages , to be stated later , to obtain a recognition result . the recognition result is displayed on a crt 12 , for example . in fact , the elements of block 13 may be realized as software in a personal computer , e . g ., pc xt manufactured by ibm corporation . the elements of block 13 may also be realized as hardware by adopting a configuration consisting of blocks shown with solid lines within block 13 . these blocks correspond respectively to the functions of the software , which will be explained later in detail in the explanation of steps corresponding thereto with reference to fig2 a , 2b , or 3 . for ease of understanding , the blocks shown with solid lines in fig1 are illustrated with the same numbers as those of the steps corresponding thereto shown in fig2 a , 2b , or 3 . the elements of block 14 may be realized by a signal processing board added to a personal computer . next , training of the system will be explained with reference to fig2 a and 2b . the system , which is for unspecified speakers , performs training based on speeches spoken by a plurality , for example ten to tens , of training speakers . the speakers sequentially input training data . in a particular embodiment , a speaker inputs a plurality of speeches , for example three speeches , at a time for each of the words w j in the vocabulary for recognition . in training , a histogram h ( i , j , k ) for the label f i in the training data is obtained first in each of the blocks b jk in the work w j . fig2 a illustrates a procedure for generating the histograms h ( i , j , k ). in fig2 a , at the beginning , the maximum speech length l ( j ), the minimum speech length l ( j ), and j for each of the words w j are initialized ( step 15 ). namely , they are set to l ( j )=∞, l ( j ) =+∞, and j = 0 , respectively . then , the crt 12 ( fig1 ) displays an indication that the word w j be spoken three times ( step 16 ), and a speaker responds thereto . the a / d conversion , feature value extraction , and labelling are sequentially performed on the speeches ( steps 17 - 19 ). thereafter , the maximum speech length l ( j ) and the minimum speech length l ( j ) are updated , if necessary ( step 20 ). namely , in case the longest one of these three speeches is longer than the maximum speech length l ( j ), the value is set to a new maximum speech length l ( j ). similarly , in case the shortest one of these three speeches is shorter than the minimum speech length l ( j ), the value is set to a new minimum speech length l ( j ). next , a normalization of the speech length and a block segmentation will be performed for each of the speeches ( of a word ) ( steps 21 and 22 ). in the normalization of the speech length , the number of labels included in one speech is set to a predetermined number n f ( = n 0 × n b , where n 0 is a positive integer and n b is the number of blocks b jk ), so that the block segmentation could be performed easily . of course , the block segmentation may be performed by using a unit smaller than a label . in that case , however , the calculation of histograms would be more complicated . in a particular example , the normalization is performed by setting the number of blocks , n b , to 8 and the positive integer n 0 to 10 , so that one speech includes 80 labels . this is illustrated in fig4 . the example illustrated in fig4 shows a case where a word speech before the normalization of the speech length includes 90 labels . as seen from fig4 some labels may be skipped as a result of the normalization . in a particular example , a label f ( t ) at a time t after the normalization to time ( e . g ., label ) intervals 0 through 79 is equal to a label f ( t ) at a time t before the normalization , assuming t = ( t × 90 )/ 80 + 0 . 5 , where α indicates that the figures of α below the decimal point should be omitted . the above formula may typically be illustrated as in fig5 . generally , the formula may be expressed as t = ( t × n f ) / n f + 0 . 5 , where n f is the number of labels after the normalization and n f is the number of labels before the normalization . in fig4 n f = 90 , and n f & gt ; n f , although it may be that n f ≦ n f . in the block segmentation , each of the speeches after the normalization is equally divided into the blocks b jk , as illustrated in fig6 . these steps 16 through 23 are performed for all of the words w j in the vocabulary for recognition ( steps 24 and 25 ). the procedure of generating the histograms illustrated in fig2 a is shown for one speaker . by performing the procedure for a plurality of speakers , it is possible to generate the histograms h ( i , j , k ) which are not biased to any particular speaker . after having generated the histograms h ( i , j , k ) which are not biased to any particular speaker as stated above , the histograms are normalized and the probability p ( i , j , k ) of the label f i being output in the block b jk in the word w j is calculated as illustrated in fig2 b ( step 26 ). the probability p ( i , j , k ) is obtained according to the following formula . ## equ1 ## the block segmentation and the calculation of histograms in steps 22 and 23 , respectively , illustrated in fig2 a may be performed as illustrated in fig7 for example . fig7 shows a case where the number of blocks b jk is 8 and the number of labels f i in the block b jk is 10 . in fig7 c 1 and c 2 indicate the values of counters , each of which is set to 0 at the beginning ( step 27 ). the c 1 is incremented by one each time a label is reached ( step 29 ), and is reset to 0 when the counter has reached 10 ( step 31 ). the c 2 is incremented by one , each time the c 1 is reset ( step 31 ). with the end of each of the blocks b jk and the end of each of the speeches being discriminated in steps 30 and 32 , respectively , the histograms h ( i ( 10c 2 + c 1 ), j , c 2 ) are incremented by one , every time t = 10c 2 + c 1 . the i ( t ) indicates the number of a label at the time t ( t = 0 through 79 ; the time units are intervals at which labels are produced ). next , referring to fig3 an explanation will be made as to the recognition of an unknown input unit . in fig3 when the data of an unknown word x is input ( step 33 ), the a / d conversion , feature value extraction , and labelling are sequentially performed on the data ( steps 34 , 35 , and 36 ). thereafter , the length of the speech of the unknown word x is discriminated ( step 37 ) and used in the subsequent preselection step 40 . the length of the speech of the unknown word x is normalized in the same manner as in step 21 illustrated in fig2 a ( step 38 ). particularly , in the preselection step 40 , it is discriminated whether or not the word w j satisfies the following formula , by referring to the preselection table 10 ( fig1 ). where the length ( x ) denotes the length of the speech of the unknown word . the delta is a small value , for example 0 . 2 . if this condition is not satisfied , the likelihood is set as - ∞ so that the word wj would be omitted from the candidates for the recognition result ( step 43 ). if the condition is satisfied , after the speech of the unknown word x is divided into the blocks b jk ( step 41 ) in the same manner as in step 22 illustrated in fig2 a , the likelihood is calculated ( step 42 ). the likelihood lh ( j ) of the word w j being the unknown word x may be obtained according to the following formula . ## equ2 ## all the steps 40 through 43 are performed for all of the words w j ( steps 39 , 44 , and 45 ) and the likelihoods lh ( j ) of all of the words w j are obtained . then , a word having the highest likelihood lh ( j ) is output as the recognition result ( step 46 ). it should be understood that the present invention is not limited to the above embodiment , but various changes in form and details may be made therein without departing from the spirit and scope of the invention . for example , while in the above embodiment , the present invention has been realized as software in a personal computer , it can , of course , be realized as hardware . further , while in the above embodiment , the present invention has been applied to speech recognition for unspecified speakers , such as used in banking systems , subway information systems and the like , it may also be applied to systems for specified speakers . further , smoothing may be performed in the present invention in order to improve the recognition accuracy . for example , in case a label output probability is 0 , it may be replaced with a value in the order of ε = 10 - 7 , or the histograms may be recalculated in consideration of confusions between labels . as explained above , according to the present invention , label output probabilities can be expressed quite simply . therefore , the present invention enables to perform training conveniently and reduce calculations at the time of recognition . further , since errors due to fluctuations in time can be absorbed by adopting the probabilistic expressions , recognition errors can be suppressed . | 6 |
fig2 is an exemplary illustration of a flowmeter utilizing the present invention . the flowmeter of fig2 is shown generally at 10 and shows a housing 11 ( partially broken away ) having inlet and outlet ends 12 and 13 . a turbine 14 and an impeller 15 in housing 11 are mounted on shaft 16 which is journaled at both ends on suitable ball bearings 18 with only the ball bearings 18 on the downstream end shown in fig2 . the turbine 14 and swirl generating impeller element 15 are coupled by a torque resistant element , spring 23 . an angular displacement occurs between the turbine 14 and impeller 15 in response to angular momentum imparted by the fluid to the impeller which is proportional to the mass flow rate of the fluid stream . turbine 14 is journaled on shaft 16 by means of ball bearings 18 . swirl generating impeller 15 , on the other hand , is secured directly to shaft 16 . impeller 15 consists of a main body portion having a plurality of skewed vanes 19 . the impact of the fluid on the vanes imparts an angular velocity to the fluid and to the impeller . since impeller 15 is secured directly to shaft 16 , rotation of the impeller causes the shaft to rotate at some angular velocity governed by the mass flow rate of the fluid . a cylindrical shroud 20 extends from the periphery of impeller and is concentric with , and surrounds , turbine 14 . thrust bearings , not shown , space the turbine and impeller / swirler along the shaft and are located between the turbine and the impeller and on the outside of the turbine and impeller . a plurality of fluid passages in the form of tubes 21 extend through and are distributed around the periphery of turbine 14 . a portion 22 on the downstreams side of the turbine 14 has on one end a helical spring 23 ( calibrated torque resistant element ) secured to the inner wall of the portion 22 with the other end of the spring being secured to shaft 16 . in effect , impeller 15 and turbine 14 constitute two independently rotating elements joined by a ( calibrated ) restraining spring 23 . thus , while the two elements rotate at the same rate , the fluid torque acting on the turbine , will cause the turbine to be displaced with respect to the impeller by an angle a which is a linear function of the mass rate of flow . readout of the relative phase angle a between the turbine and impeller is representative of the mass rate of flow and is achieved by measuring the time difference in the passage of rotating magnets 24 and 25 with respect to their respective low torque pick off assemblies 32 , and 30 , respectively . the flow of the liquid as it passes through the turbine has a change of angular momentum which is equal to the fluid torque acting on the turbine and is given by : the torque applied by fluid on turbine 14 acts to deflect the restraining spring 23 relative to shaft 16 . the spring 23 deflects through some angle a such that the spring torque equals the fluid torque . this spring torque is given by : the balance of torques on the turbine leads to equating the spring torque ( eq . 2 ) to the fluid torque acting on the turbine ( eq . 1 ) now , substituting equation 1 and 2 into 3 , and solving for a yields : ## equ1 ## thus , for a given geometry , the angle of deflection ( phase difference ) of the turbine 14 relative to the impeller 15 , ( a ), is a function of both turbine speed and mass flow rate . rather then measuring the angular displacement phase difference constrained by the spring 23 directly , the two magnetic pick - offs 30 , 32 measure the time difference between reference points on the turbine 14 and impeller 15 , as represented by magnets 24 and 25 , to move through the displacement angle a between the turbine 14 and the impeller 15 . angle a can be determined by measuring the elapsed time between the signal represented by a passage of magnet on impeller 15 and the signal produced by the passage of the magnet on turbine 14 . thus : m , the mass flow rate through the flowmeter is then directly proportional to the time difference between the ( delayed ) impeller pulse and the turbine pulse . the flowmeter scale factor k &# 39 ; is a function of the fixed geometry of flowmeter and the physical characteristic of the restraining spring . since the scale factor is constant through all operating conditions of the flowmeter , and from one flowmeter to another , the time differential dt thus becomes an accurate measure of the mass flow through the turbine . the angular velocity w can also be determined by counting the number of coil induced pulses per unit time . thus w , the shaft angular velocity , its obtained from one or both of the pick off coils during the calibration cycle of the flowmeter . fig3 illustrates the details of the two identical low torque pick - off assemblies 30 and 32 shown in fig1 each assembly includes a sensor 100 and a rotating member 115 . sensor 100 includes stationary magnet 101 having two magnetic poles , a north pole n and a south pole s . the two magnetic poles are aligned with the longitudinal axis of the housing , the north pole being to the left of the south pole . stationary magnet 101 creates a magnetic flux through field guide 103 through gaps 105 and 107 . field guide 103 is made of magnetically permeable material such as brand name &# 34 ; mu - metal &# 34 ; manufactured by carpenter steel . field guide 103 couples the magnetic field of stationary magnet 101 to coil 109 which is made up of one or more turns of a conductor , such as copper . each conductor turn 113 , the aggregate of which form coil 109 , forms an internal opening through which field guide 103 passes . rotating magnet 111 on the rotating member 115 , modulates the magnetic flux induced by stationary magnet 101 in the air gaps 105 and 107 and field guide 103 . this modulation is created by magnet 111 as it passes by magnet 101 during every revolution of rotating member 115 . rotating member 115 in fig3 and 4 can be any moving part internal to the flowmeter such as impeller 15 and turbine 14 as shown in fig2 . the changes in magnetic flux induced by the modulation of the magnetic field in field guide 103 are converted by coil 109 into electrical voltage fluctuations by the well known process of magnetic induction . the output voltage induced by the modulated magnetic field in coil 109 appears on leads 119 and 117 , corresponding to the beginning and end of the continuous conductor wound to create coil 109 and each individual turn 113 . by comparing the time difference at which the output voltage appears at the leads 119 and 117 , in each of two separate pickoffs 30 , 32 , the value of time interval dt as specified in equation ( 5 ) can be measured . this interval can be directly related to the mass flow rate through the meter as outlined by equations 1 through 6 . fig4 shows a perspective view of the pick off coil and rotating magnets shown in fig3 and shows the added detail of the relative thickness of the field guide 103 and its position with respect to the coil 109 . in practice , the assembly of coil 109 , stationary magnet 101 , and field guide 103 are encapsulated in a convenient plastic resin and threaded into housing 11 . the plastic encapsulating material has to be compatible with the fluids and temperatures where the flowmeter will be used . in an actual embodiment of the invention , an exemplary dimension for the thickness d of the field guide 103 is 0 . 050 inches , while the w dimension is 0 . 20 inches . the coil is made up of 4000 turns of 36 gauge ( 0 . 0005 inch diameter ) enameled copper wire . the coil is 0 . 25 inches high , 1 . 30 inches in diameter with a central opening sufficient to allow passage of the field guide 103 . the stationary magnet 101 has the same cross section as the field guide 103 and is 0 . 30 inches long . the clearance between stationary magnet 101 and rotating magnet 111 ranges from 0 . 070 to 0 . 120 inches . the rotating magnet 111 is also 0 . 30 inches long and has a 0 . 10 inch square cross section . both the rotating and stationary magnets are made of samarium cobalt type magnetic material having an energy product of 16 , 000 , 000 gauss oersted ( minimum ) manufactured by permag east . in yet another physical embodiment as shown in fig5 of the present invention , a coil 501 of 4000 turns of # 30 wire yields 30 mv to 400 mv from about 3 inches / sec to 20 inches / sec speed of the exterior magnet along an axis perpendicular to the page . the electric coil is not encapsulated per se . it is wrapped around a plastic bobbin made of g - 10 material which is a blend of thermoset plastic and fiberglass . both adhesives used in the bobbin construction and the material used as wire insulator are polymide or kapton . in fig5 the electric coil 501 axis is around the center leg 503 in the &# 34 ; e &# 34 ; shaped field guide 505 . the magnetic field levels in this leg 503 change from about 8600 gauss without the exterior , moving magnet present , to about 1300 gauss when the moving magnet is present . note that the magnetic field in the outside legs 507 and 509 changes from 8600 to 11400 gauss . the magnetic field change in the center leg 503 generates the coil &# 39 ; s electrical signal . while the instant invention has been described in connection with a preferred embodiment thereof , the invention itself is by no means limited thereto since many modifications in the instrumentalities employed and structures utilized may be made without departing from the true scope and spirit of the invention which is set forth in the appended claims . | 6 |
referring to the figures , in which like parts are indicated with the same reference numerals , various views of exemplary multi - chamber beverage containers and components thereof are provided . with reference to fig1 , a beverage container according to principles of the invention is comprised primarily of an aluminum alloy . a thin sheet of aluminum is cut into a circle , called a blank , which forms the bottom and sides of the can . after the circular blank is cut , it is drawn , pulled and pressed into a cup 100 having an open compartment 115 , bottom 105 and cylindrical sidewall 110 . after the cup is formed , a punch presses up against the base ( i . e ., the bottom ), causing the bottom 105 to bulge inward . this concavity counteracts the pressure of carbonation contained in the can 100 . afterwards the top edges of the cylindrical sidewall 110 are trimmed , leaving the upper walls straight and level . the can 100 may then be cleaned and imprinted with a label . after the can 100 is decorated , it is squeezed in slightly at the top to a make a neck 175 , and the neck 175 is given an outward flange at the very top edge , which will be folded over once a lid 150 is added . a lid 150 is cut to a diameter for attachment to the walls of the container . the center of the lid 150 is stretched upward slightly and drawn to form a rivet . a pull tab 145 is inserted under the rivet and secured by it . then the lid 150 is scored in a generally elliptical or oval path that defines a separable panel , referred to herein as a tongue 160 . when the tab 145 is pulled by a consumer , scored edges of the tongue 160 will detach easily , allowing the tongue to bend downwardly into the can 100 and leave a proper opening 165 . a rim defining the periphery of the lid is configured to engage the top edges 110 of the can 100 . an inner tubular cylinder 120 includes a flanged head 125 with a central opening 130 , a rim 135 for engaging the top edges 110 of the can 100 , and a scored horizontal and vertical tongues 140 , 170 . the inner tubular cylinder 120 may comprise an aluminum alloy comparable to , or the same as , the aluminum alloy comprising the can 100 and / or lid 150 . the inner tubular cylinder 120 may be formed from a circular blank that is drawn , pulled and pressed into the appropriate shape . the assembly is completed by filling the compartments and bending or rolling and then seaming the edges of the can 100 , flange 125 and lid 150 , to form a hermetic seal . first , the can 100 may be filled with a volume of liquid equal to the total volume of the can 100 minus the volume occupied by the tube 120 and any ullage . then the tube 120 may be filled and installed on the can 100 , with the tube 120 extending downwardly into the filled cavity 115 of the can 100 and the flange 125 resting atop the top edges of the sidewall 110 of the can 100 . then the lid 150 is placed atop the flange 125 . then the lid 150 , flange 125 and neck 175 are adjoined by bending . by way of example and not limitation , the neck 175 may be bent around the peripheral edges of the flange 125 and lid 150 and seamed shut , to provide a strong hermetic seal . this step , which entails bending the neck 175 around peripheral edges of the lid 150 , is performed in conventional aluminum can manufacturing processes , without the presence of a flange 125 and corresponding inner tube 120 . skilled artisans will appreciate that this embodiment of the present invention preserves conventional aluminum can manufacturing processes and merely adds steps of forming , inserting and filling the inner tube 120 with the flanged head 125 . in use , when the tab 145 is pulled upwardly in a familiar manner , as depicted in fig1 , the tip of the tab 145 presses against the top of the tongue 160 , thus rupturing the scored periphery of the tongue 160 . the pressure caused by the tip of the tab 145 depresses the tongue 160 of the lid 150 against the scored horizontal tongue 140 of the inner tube flange 125 , rupturing the scored periphery of the horizontal tongue 140 . the scored horizontal tongue is then urged into the scored vertical tongue 170 , which also ruptures , thus providing a path for fluid communication from the interior cavity 130 of the inner tube 120 to the interior cavity 115 of the can 100 and to the opening 165 formed in the lid 150 . this allows contained fluid to be dispensed from the interior cavity 130 of the inner tube 120 as well as from the interior cavity 115 of the can 100 , through the opening 165 . thus , advantageously , a single stay on tab 145 provides a means for opening all compartments of the container . with reference to fig2 , an alternative exemplary embodiment of a beverage container according to principles of the invention includes a robust pull tab opener comprising a finger tab 215 , a pointed tip 210 and a pivoting hinge 205 coupled to the lid 150 . the hinge 205 may be connected to the lid via a weld , bond , or rivet . in use , when the finger tab 215 is urged upwardly , the tip 210 presses against the top of the scored tongue 220 , thus rupturing the scored periphery of the tongue 220 . the pressure caused by the tip 210 depresses the tongue 220 of the lid 150 and pierces both the inner tube flange 125 and sidewall of the inner tube 120 , thus providing a path for fluid communication from the interior cavity 130 of the inner tube 120 to the interior cavity 115 of the can 100 and to the opening formed in the lid . this allows contained fluid to be dispensed from the interior cavity 130 of the inner tube 120 as well as from the interior cavity 115 of the can 100 , through the opening . thus , advantageously , a single stay on tab provides a means for opening all compartments of the container . after the can is opened , the robust pull tab opener may be torn from the lid 150 , by pulling it away from the lid 150 . upon pulling , the scored path surrounding the robust pull tab ruptures , allowing the robust pull tab and the panel 220 of the lid to which it is attached to separate from the lid 150 . with reference to fig3 , another alternative beverage container according to principles of the invention is conceptually illustrated . in this embodiment , the inner tubular cylinder 120 includes has a central opening 130 and a flanged head 305 with a rim 135 for engaging the top edges 110 of the can 100 and a recessed scored horizontal plateau 3 10 . the recessed plateau 310 is scored around its outer periphery . thus , the plateau 310 does not have to be rotated in alignment with the tongue 160 of the lid 150 . in use , when the tab 145 is pulled upwardly in a familiar manner the tip of the tab 145 presses against the top of the tongue 160 , thus rupturing the scored periphery of the tongue 160 . the pressure caused by the tip of the tab 145 depresses the tongue 160 of the lid 150 against the scored recessed plateau 310 of the inner tube flange 125 , rupturing a portion of the scored periphery of the recessed plateau 310 . the ruptured portion of the recessed plateau 310 is then urged into the interior cavity 115 of the can 100 . as the plateau 310 is recessed , fluid in the inner tube 120 may freely flow from the inner tube 120 through the space between the lid 150 and the recessed plateau 310 . thus a path is formed for fluid communication from the interior cavity 130 of the inner tube 120 to the interior cavity 115 of the can 100 and to the opening 165 formed in the lid . this allows contained fluid to be dispensed from the interior cavity 130 of the inner tube 120 , as well as from the interior cavity 115 of the can 100 , through the opening 165 . thus , advantageously , a single stay on tab 145 provides a means for opening all compartments of the container . with reference to fig4 , another alternative beverage container according to principles of the invention is conceptually illustrated . in this embodiment , an inner container 415 includes two separate compartments 425 , 430 formed by drawing , pulling and pressing . each compartment 425 , 430 has an opening 410 , 420 level with a flanged head and rim 405 for engaging the top edges 110 of the can 100 . a plastic gasket 475 with scored recessed panels 465 , 470 for sealing the chambers 425 , 430 is sandwiched between the lid 150 and flanged head and rim 405 . each recessed panel 465 , 470 is configured to be partially received in an opening 410 , 420 of a compartment 425 , 430 to provide a tight seal . the lid 150 includes a pair of pull tabs 665 , 670 pivotally attached by a rivet . the lid 150 is scored in two opposed generally elliptical or oval paths that each defines a separable tongue 440 , 455 . when the tab 450 is pulled by a consumer , scored edges of the tongue 440 , 455 being urged will detach easily , allowing the urged tongue 440 , 455 to bend downwardly into a recessed panel 465 , 470 thereby urging the recessed panel 465 , 470 open . the downwardly bent metal tongue 435 , 455 holds the opened recessed panel 465 , 470 in an open position . after one opening 435 or 460 has been created , the tab may be rotated 180 degrees to urge open the un - detached tongue 440 , 455 , thereby creating the second opening 435 or 460 . a rim defining the periphery of the lid 445 is configured to engage the top edges of the can 100 . this allows contained fluid to be selectively dispensed from either or both of the two separate compartments 425 , 430 . thus , advantageously , a single stay on tab 450 provides a means for selectively opening either one and / or all of the compartments of the container . with reference to fig5 , an embodiment similar to the embodiment depicted in fig4 further includes a plastic drinking cap 510 configured to releasably engage the top edge of the assembled container . the drinking cap 505 includes either an opening or a perforated panel 505 which may readily be removed to create an opening and through which fluids contained in the compartments 425 , 430 may flow . the installed drinking cap 505 and lid 445 define a mixing chamber in which fluids from both compartments 425 may mix before flowing through the opening 505 for consumption . optionally , various baffles , protuberances , barriers and / or textures ( not shown ) may extend from the interior walls of the drinking cap 510 to facilitate mixing . another advantage of the drinking cap 510 is that it insulates the consumer &# 39 ; s lips from the top of the lid , which may provide a sanitary cover for drinking . such a drinking cap 510 may be utilized on any and all embodiments described herein to facilitate mixing prior to consumption and to provide a sanitary drinking surface . with reference to fig6 , another alternative beverage container according to principles of the invention is conceptually illustrated . in this embodiment , an inner container 630 includes four separate compartments 635 , 640 formed by drawing , pulling and pressing . each compartment 635 , 640 has an opening 605 , 610 , 615 , 620 level with a flanged head and rim 625 for engaging the top edges 110 of the can 100 . a plastic gasket 695 with scored recessed panels 685 , 687 , 690 , 692 for sealing the chambers 635 , 640 is sandwiched between the lid 660 and flanged head and rim 625 . each recessed panel 685 , 687 , 690 , 692 is configured to be partially received in an opening 605 , 610 , 615 , 620 of a compartment 635 , 640 to provide a tight seal . without such a form fitting gasket to provide a good seal , liquid contained in a compartment may seep into another compartment before the lid is opened and the beverage is ready to be consumed . the lid 660 includes a pair of pull tabs 665 , 670 , each of which is pivotally attached by a rivet . a rim defining the periphery of the lid 660 is configured to engage the top edges of the can 100 . for each pull tab 665 , 670 , the lid 660 is scored in two opposed generally elliptical or oval paths that each defines a separable tongue 655 for each scored path . when a tab 665 , 670 is pulled by a consumer , scored edges of the tongue 655 being urged will detach easily , allowing the urged tongue 655 to bend downwardly into a recessed panel 685 , 687 , 690 , 692 thereby urging the recessed panel 685 , 687 , 690 , 692 open . the downwardly bent metal tongue 655 holds the opened recessed panel 685 , 687 , 690 , 692 in an open position . after one opening 645 , 650 or 675 , 680 has been created , each tab 655 , 670 may be rotated 180 degrees to urge open the un - detached tongue 655 , thereby creating the second opening 645 , 650 or 675 , 680 . this allows contained fluid to be selectively dispensed from either or both of the two separate compartments 635 , 640 . thus , advantageously , the pair of stay on tab 665 , 670 provides a means for selectively opening either one and / or all of the compartments of the container . with reference to fig7 , another alternative beverage container according to principles of the invention is conceptually illustrated . in this embodiment , an inner container 630 includes four separate compartments 635 , 640 formed by drawing , pulling and pressing . each compartment 635 , 640 has an opening 605 , 610 , 615 , 620 level with a flanged head and rim 625 for engaging the top edges 110 of the can 100 . a plastic gasket 790 with scored perforated recessed panels 770 , 775 , 780 , 785 for sealing the chambers 635 , 640 is sandwiched between the lid 700 and flanged head 630 and rim 625 . each recessed panel 770 , 775 , 780 , 785 is configured to be partially received in an opening 605 , 610 , 615 , 620 of a compartment 635 , 640 to provide a tight seal . without such a form fitting gasket to provide a good seal , liquid contained in a compartment may seep into another compartment before the lid is opened and the beverage is ready to be consumed . the lid 700 includes a threaded neck 710 , 715 , 720 , 725 , and a panel 735 , 740 , 745 , 750 for each compartment 635 , 640 . a removable threaded cap 750 , 755 , 760 , 765 is provided to close the threaded necks 710 , 715 , 720 , 725 . with reference to fig8 , a beverage container according to principles of the invention a cup - shaped vessel 805 having an open top 815 providing access to an interior compartment , a bottom 800 and a cylindrical sidewall 805 . a collar 820 with a threaded neck 825 is permanently or releasably attached to the top 815 of the vessel 805 . an inner tubular cylinder 810 includes a flanged head 830 with a central opening , and a rim with a plurality of perforations 835 , 840 , 845 , 850 configured to engage the top edges of the neck 825 . a removable form - fit gasket 855 seals the open top of the inner cylinder 810 . a threaded cap 860 threadedly engages the neck 825 and encloses the gasket 855 on the top of the inner cylinder 810 . while an exemplary embodiment of the invention has been described , it should be apparent that modifications and variations thereto are possible , all of which fall within the true spirit and scope of the invention . with respect to the above description then , it is to be realized that the optimum relationships for the components and steps of the invention , including variations in order , form , content , function and manner of operation , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the present invention . the above description and drawings are illustrative of modifications that can be made without departing from the present invention , the scope of which is to be limited only by the following claims . therefore , the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents are intended to fall within the scope of the invention as claimed . | 1 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.